J Toxicol Pathol 2007; 20: 29–37 Original Molecular Analysis on the Possible Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis in Rats Yusuke Yokouchi1, Masako Muguruma1, Mitsuyoshi Moto1, Miwa Takahashi1, Meilan Jin1, Yusuke Kenmochi1, Taichi Kohno1, Yasuaki Dewa1, and Kunitoshi Mitsumori1 1Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3–5–8 Saiwai-cho, Fuchu, Tokyo 183–8509, Japan Abstract: It has been speculated that oxidative stress is involved in the liver tumor-promoting effect of β- naphthoflavone (BNF; 5,6-benzoflavone) in rats, because of its strong induction of cytochrome P450 (CYP) 1A enzymes. In order to clarify the mechanism of liver tumor promoting effects of BNF, male F344 rats were initiated with a single intraperitoneal injection of 200 mg/kg diethylnitrosamine (DEN), and fed diet containing 2% of BNF for 6 weeks staring 2 weeks after injection. Two/third partial hepatectomy was perfomed at Week 3 after the treatment of BNF. Low-density Rat Toxicology & Drug Resistance Microarray and quantitative analyses of mRNA expressions of the selected genes using real-time reverse transcription (RT) -PCR were carried out on total RNAs extracted from the livers of F344 rats. Collected liver tissues were subjected to light microscopic examinations (hematoxylin and eosin staining), immunohistochemistries of proliferating cell nuclear antigen (PCNA), glutathione S-transferase placental form (GST-P) and CYP1A1, and Schmorl staining to identify lipofuscin. Gene expression analysis showed that 7 genes (CYP1A1, CYP1A2, CYP1B1, Gstm2 (GST mu2), Gstm3, glutathione peroxidase (Gpx)2 and NAD(P)H dehydrogenase, quinone 1(Nqo1)) were up-regulated (> 1.5 fold), and 4 genes (8-oxoguanine DNA glycosylase (Ogg1), Gpx1, peroxiredoxin (Prdx) 1 and P450 oxidoreductase (Por)) were down-regulated (< 0.67 fold) in the DEN + BNF group rats as compared with the DEN alone group. In immunohistochemical analyses, the numbers of foci positive for GST- P, the rate of PCNA-positive cells, and the rate of CYP1A1-positive cells were significantly increased in the DEN + BNF group, as compared to the corresponding control. Furthermore, deposition of lipofuscin, positive for Schmorl staining, was moderately increased in the DEN + BNF group. These results confirm the possibility that oxidative stress is involved in the liver tumor-promoting effect of BNF in rats. (J Toxicol Pathol 2007; 20: 29–37) Key words: β-naphthoflavone, non-genotoxic carcinogen, hepatocarcinogenesis, oxidative stress, rats Introduction these chemicals, BNF itself showed no mutagenic activity when screened over a wide range of concentrations in BNF is a synthetic derivative of a naturally occurring several strains of the Salmonella/mammalian microsome flavonoid which strongly induces CYP 1A1/2, and it has been assay5. In addition, a liver tumor promotion effect of BNF used as a specific CYP1A1/2 inducer in pharmacological has been demonstrated using a two-stage rat liver and/or pharmacokinetic experiments. With regard to CYP carcinogenesis model in rats given BNF for 6 weeks6. induction, BNF shows a similar potency and specificity to It has been reported that there is a good correlation polycyclic aromatic hydrocarbons (e.g, 3- between the ability of chemicals inducing CYP2B1/2 methylcholanthrene, benzo [a] pyrene) as well as isozymes such as phenobarbital (PB) and their potential to polyhalogenated aromatic compounds (2,3,7,8- promote hepatocarcinogenesis7,8. Additionally, the fact that tetrachlorodibenzo-p-dioxion (TCDD), and 3,3’,4,4’,5,5’- various types of liver tumor-promoting agents including PB hexachlorobiphenyl), which are mutagenic and/or have the ability to inhibit gap junctional intercellular carcinogenic in laboratory animals1–4. Although, unlike communication (GJIC) in the rat liver in vivo has been demonstrated9–11. Decreases in the abundance of the GJIC protein connexin 32 (Cx32) were induced in both altered Received: 27 October 2006, Accepted: 2 December 2006 hepatocellular foci12 and centrilobular hepatocytes where Mailing address: Yusuke Yokouchi, Laboratory of Veterinary 13 Pathology, Tokyo University of Agriculture and Technology, 3–5–8 CYP2B1/2 isozymes are induced , suggesting a relationship Saiwai-cho, Fuchu, Tokyo 183–8509, Japan between the agents inducing CYP2B1/2 isozymes and TEL & FAX: 81-42-367-5771 reducing Cx32 in the same area of the liver tumor promoting E-mail: [email protected] mechanism. However, it is unclear whether there is good 30 Mechanism of β-Naphthoflavone-Induced Hepatocarcinogenesis Fig. 1. Experimental design. correlationship between the induction of CYP1A subfamilies were fed powdered diet containing BNF at a concentration of other than CYP2B1/2 and liver tumor promoting activity. 2% for 6 weeks. To enhance the hepatocellular proliferation Shoda et al. performed a two-stage rat liver carcinogenesis in the liver, all rats were subjected to two-thirds partial model using BNF, and demonstrated that there is a link hepatectomy (left and median lobes excised) at Week 3. For between CYP1A2 induction and liver tumor promotion sampling of the liver at Week 8, all surviving animals were activity of BNF6. In addition, there have been some reports sacrificed under anesthesia with ether by exsanguination suggesting that the mechanism of liver tumor promoting from the abdominal aorta after measurement of body activity associated with the induction of CYP1A subfamily is weights. The animals were necropsied, the livers excised related to oxidative stress14–16. and their weights recorded. Since the animals had been In the present study, a short term study using the two- subjected to a partial hepatectomy, the remaining liver stage hepatocarcinogenesis model was performed in rats to consisted of the anterior and posterior right and caudate clarify the molecular mechanism of the liver tumor lobes. One section obtained from each lobe was fixed with promoting effect of BNF. neutral-buffered formalin for the histochemical and histological examinations. One hundred milligrams of liver Materials and Methods samples from the remaining liver were frozen in RNA-Later (Qiagen, Hilden, Germany) and stored at –80°C until use for Animals and chemicals gene expression analysis. Male Fischer 344 rats, 5 weeks old, were purchased from Japan SLC Inc. (Shizuoka, Japan). The rats were Histological examination housed in stainless steel cages with two or three animals per The fixed liver tissue from each animal was embedded cage and allowed free access to tap water and commercial in paraffin, sectioned at 4 µm and stained with hematoxylin basal diet (MF, Oriental Yeast Industries Co, Ltd. Tokyo, and eosin (H-E) for histological examinations. The level of Japan). All the animals were handled under standard lipofuscin in the liver was determined by the method of conditions (room temperature, 22 ± 2°C; relative humidity, Schmorl. Immunohistochemical staining was conducted 55 ± 5%; 12-h light- dark cycle). They were acclimatized for using the labeled avidin-biotin-peroxidase complex (ABC) 1 week before dosing and were randomly allocated to four method for binding of anti-rat GST-P (1:1000; MBL, test groups (five rats per group) by the stratification method Nagoya, Japan), anti-rat CYP1A1 (1:200; Santa Cruz based on their body weights immediately prior to the dosing. Biotechnology Inc, Santa Cruz CA, USA), and anti-rat The animal care and experiments were carried out in PCNA (1:200; Dako Japan, Kyoto, Japan) as primary accordance with the Guide for Animal Experimentation of antibodies. All specimens were lightly counterstained using Tokyo University of Agriculture and Technology. hematoxylin. Numbers and areas of altered foci positive for BNF (purity > 98%) and DEN were obtained from GST-P (> 2 hepatocytes in cross section) were measured Wako Pure Chemical Industries Ltd. (Osaka, Japan). using a Scion Image analyzer. All positive foci were counted in the DEN alone and DEN + BNF groups. To Experimental design obtain the PCNA labeling index, the number of PCNA- A two-stage liver carcinogenesis model in rats was positive cells was counted in 200–300 cells × 5 areas / slide, employed (Fig. 1). A total of 20 rats were divided into 4 without any recognition of the presence of foci. groups of 5 animals each. Animals in Group 3 and 4 were initiated with a single intraperitoneal injection of DEN at a Low-density rat toxicology & drug resistance dose of 200 mg/kg and animals in Group 1 (control) and 2 microarray received a single intraperitoneal injection of saline vehicle Gene expressions of the liver sample from the DEN alone. Two weeks after the injection, rats in Group 2 and 4 alone and DEN + BNF groups were analyzed by Oligo Table 1. List of Primer Sequences Used in Real-Time RT-PCR Analysis Accession Gene number symbol Gene name Forward primer Reverse primer NM_017013 Gsta2 glutathione-S-transferase, alpha type2 CAACTACATCGCCACCAAATATG GCCTTCGGTGTACATGTCAATC NM_057105 Ugt1a6 UDP glycosyltransferase 1 family, polypeptide A6 TGGCTACCCCAAAACGATCT ATACCATGGGAACCGGAGTGT NM_012540 Cyp1a1 Cytochrome P450, family 1, subfamily a, polypeptide 1 purchased from SuperArray Bioscience Corporation (base sequence is not shown) NM_012541 Cyp1a2 Cytochrome P450, family 1, subfamily a, polypeptide 2 AAGCGCCGGTGCATTG TGCAGGAGGATGGCTAAGAAG NM_012940 Cyp1b1 Cytochrome P450, family 1, subfamily b, polypeptide 1 CTTGGCCATTGATCGGAAA CAAGGCGAGCGAAGTACAAGT NM_017000 Nqo1 NAD(P)H dehydrogenase, quinone 1 TCCGCCCCCAACTTCTG TCTGCGTGGGCCAATACA NM_177426 Gstm2