3-Methylcholanthrene Induces Chylous Ascites and Lethality in Tiparp Knockout Mice

Home , Methylcholanthrene

Tiffany Elizabeth Cho

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Pharmacology and Toxicology University of Toronto

Tiffany Elizabeth Cho

Master of Science

Department of Pharmacology and Toxicology University of Toronto

2015

Abstract

The aryl hydrocarbon receptor (AHR) is a ligand-regulated transcription factor that is activated upon binding to various ligands. The activated AHR modulates the expression of many genes including cytochrome P450s (CYPs) such as Cyp1a1, Cyp1b1, and 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD)-inducible poly(ADP-ribose) polymerase (Tiparp). We recently reported that

TIPARP is a transcriptional repressor of AHR and Tiparp knockout mice show increased sensitivity to dioxin-induced toxicities. Because of these findings, we examined the sensitivity of

Tiparp knockout mice to 3-methylcholanthrene (3-MC), another potent AHR ligand. Tiparp knockout mice treated with 100mg/kg of 3-MC exhibited increased hepatotoxicity, increased lipolysis, and developed chylous ascites compared with treated wildtype mice. No treated Tiparp knockout mice survived beyond day 16; all wildtype mice survived the 30 day treatment.

Collectively, this thesis shows that Tiparp knockout mice exhibit increased sensitivity to 3-MC- induced toxicity and lethality supporting our previous findings that TIPARP is an important negative regulator of AHR activity.

Acknowledgements

My M.Sc. has been a great learning experience and a fulfilling journey. I am forever grateful for the support and help that my supervisor, Dr. Jason Matthews, has provided me. I thank him the most for the amazing opportunity he has given me to learn and excel in research. Overall, it has been a pleasure to work under his guidance and mentorship; no words can describe how thankful I am for his supervision and generosity throughout.

Dr. Peter McPherson has been invaluable as my advisor, as he always makes himself available to his students and is always willing to lend an ear.

I would also like to extend my sincere thanks to the members of our lab: Alvin Gomez, Debbie Bott, Laura Tamblyn, Susanna Tan, Sunny Yang, and David Hutin. I am grateful for their help and support; the laughter and fun moments that we indulged in; and for sharing their knowledge with me. I have learned so much from everyone and I am always appreciative of the assistance and support that I have received from our lab members throughout the years. A special thank you to Susanna, my partner-in-crime, whom I will dearly miss “holding hands” with.

I would also like to acknowledge all the applicable funding agencies for their financial support that made this research possible: the Canadian Institutes of Health Research, the DOW Chemical Company, the government of Ontario, and the University of Toronto.

As always, I would like to extend my most sincere thanks and appreciation to my family: my parents, my aunt and uncle, and my grandmother for supporting me with anything and everything.

iii

Table of Contents

Abstract ...... ii

Acknowledgements ...... iii

Table of Contents ...... iv

List of Tables ...... vii

List of Figures ...... viii

List of Abbreviations ...... x

Chapter 1: Introduction ...... 1 1.1 Aryl Hydrocarbon Receptor ...... 1 1.1.1 Structure ...... 1 1.1.2 AHR Signalling Pathway ...... 3 1.1.3 AHR Responsive Genes ...... 4 1.2 AHR Ligands ...... 5 1.2.1 Natural Ligands ...... 5 1.2.2 Synthetic Ligands...... 7 1.2.3 3-Methylcholanthrene (3-MC) ...... 9 1.3 Functional role of AHR in Toxicology and Physiology ...... 11 1.3.1 AHR-mediated Toxicity...... 11 1.3.2 Physiological Role of AHR ...... 13 1.4 ADP-Ribosylation ...... 14 1.4.1 Poly(ADP-ribose) Polymerase (PARP) ...... 16 1.4.2 Mono(ADP-ribosyl)transferase ...... 16 1.5 Macrodomains...... 18 1.6 TCDD-inducible poly(ADP-ribose) polymerase (TIPARP) ...... 19 1.6.1 Structure ...... 19 1.6.2 Function ...... 20 1.7 AHRR and TIPARP: Similarities and Differences ...... 23 1.8 Characterization of the TIPARP Knockout Mouse Model ...... 24

Rationale and Research Objectives ...... 26 Research Aims ...... 26 iv

Chapter 2: Materials and Methods ...... 27 2.1 Materials ...... 27 2.1.1 Chemicals and Biological Reagents...... 27 2.1.2 Plasticware and Other Equipment ...... 29 2.1.3 Instruments ...... 30 2.2 Methods...... 31 2.2.1 Animal Facility ...... 31 2.2.2 Maintenance of Animal Colony ...... 31 +/+ -/- 2.2.3 Genotyping of Tiparp and Tiparp Mice ...... 32 2.2.4 Animals and Treatments ...... 33 2.2.5 Blood and Tissue Collection ...... 34 2.2.6 RNA Extraction and Isolation ...... 35 2.2.7 cDNA Synthesis and Gene Expression ...... 36 2.2.8 Tissue Processing and Sectioning for Histology ...... 38 2.2.9 Haematoxylin and Eosin (H&E) Stain ...... 39 2.2.10 Oil Red O Stain ...... 39 2.2.11 Wright-Giemsa Stain ...... 40 2.2.12 Serum ALT Activity ...... 40 2.2.13 Triglyceride Level Determination...... 41 2.2.14 Statistical Analysis ...... 41

Chapter 3: Results...... 42 3.1 30-Day Survival Study ...... 42 3.1.1 3-MC induces lethality in Tiparp knockout males and females ...... 42 3.1.2 Characterization and analysis of chylous fluid ...... 45 3.1.3 Fluid characteristics of the 30-day survival study ...... 47 3.2 6-Day Study ...... 48 3.2.1 Body weight loss in 3-MC-treated mice compared to controls ...... 49 3.2.2 Decreased food intake in 3-MC-treated Tiparp knockout mice ...... 52 3.2.3 Serum ALT activity increased on day 3 in 3-MC-treated Tiparp knockout mice ...... 54 3.2.4 Fluid characteristics in 6-day study mice ...... 56 3.2.5 H&E of day 6 liver show moderate levels of inflammation in 3-MC-treated Tiparp knockout mice ...... 57 3.2.6 Effects of 3-MC on lipid levels in the liver of males and females ...... 60 3.2.7 Liver, white adipose tissue, and brown adipose tissue weight ...... 62 3.2.8 Hepatic gene expression of AHR target genes ...... 65 3.2.9 3-MC-dependent increases in hepatic cytokine expression levels in wildtype and Tiparp knockout mice ...... 67 v

3.2.10 Gene expression of AHR target genes in white adipose tissue ...... 71 3.2.11 Lipolysis-associated genes in white adipose tissue ...... 74 3.3 6-Day Study with the Antagonist, CH-223191 (CH)...... 77 3.3.1 Fluid characteristics in 6-day mice co-treated with 3-MC and CH or DMSO ...... 78 3.3.2 CH-treated Tiparp knockout mice show no significant changes in body weight and slight fluctuations in food intake...... 79 3.3.3 Inhibition of the expression of AHR target genes ...... 81 3.3.4 Co-treatment of CH + 3-MC reduced serum ALT activity on day 3 ...... 83

Chapter 4: Discussion ...... 85 4.1 3-MC-induced weight loss in Tiparp knockout animals with reduced food intake ...... 85 4.2 3-MC-treated Tiparp knockout mice exhibit hepatomegaly, but reduced WAT and BAT stores ...... 87 4.3 AHR-target genes...... 88 4.4 3-MC-induced inflammation of the liver ...... 90 4.5 Gene expression of AHR target genes and lipolytic enzymes in epididymal WAT ...... 90 4.6 Increased serum ALT activity in males and females with moderate levels of hepatic inflammation ...... 92 4.7 Development of chylous ascites...... 93 4.8 CH and 3-MC co-treatment: antagonism of the ligand-induced AHR ...... 94

Limitations ...... 94

Future Directions ...... 96

Summary ...... 97

References ...... 98

List of Tables

Table 1. List of PARP members, enzymatic activity, other designated names, and their respective catalytic motif...... 18

Table 2. List of PCR primers for genotyping Tiparp+/+ and Tiparp-/- Mice...... 32

Table 3. List of qPCR primers used in the gene expression assay ...... 37

Table 4. Characteristics of chylous ascites found in Tiparp knockout mice (day 8 – 16) of the 30-day survival study...... 48

Table 5. Characteristics of chylous ascites found in 6-day Tiparp knockout mice...... 56

Table 6. Characteristics of chylous ascites found in 6-day Tiparp knockout mice treated with either DMSO + 3-MC or CH + 3-MC...... 78

vii

List of Figures

Figure 1. Schematic diagram of the functional domains within AHR, ARNT, and AHRR .. 2

Figure 2. Canonical AHR signalling pathway ...... 4

Figure 3. Structural examples of AHR ligands...... 8

Figure 4. Schematic diagram of the functional domains within TIPARP ...... 20

Figure 5. Network of mono(ADP-ribosyl)ation pathways related to TIPARP ...... 23

Figure 6. Study outline of the 30-day survival study in wildtype and Tiparp knockout mice treated with 3-MC (100mg/kg) ...... 42

Figure 7. Kaplan-Meier survival curves indicating the survival rate of 3-MC-treated wildtype and Tiparp knockout mice ...... 44

Figure 8. Photographic images of the closed peritoneum and opened peritoneal cavity (A: males; B: females) ...... 46

Figure 9. Wright-Giemsa stain of ascitic fluid collected from the peritoneum of 3-MC- treated Tiparp knockout on Day 16 (male) and Day 9 (female) ...... 47

Figure 10. Study outline of the 6-day study in wildtype and Tiparp knockout mice treated with 3-MC (100mg/kg) ...... 49

Figure 11. Daily male and female body weights expressed as a percent of baseline values (day 0 weight) ...... 51

Figure 12. Daily male and female food intake measurements expressed as g/g of daily mouse body weight ...... 53

Figure 13. Serum ALT activity measured at baseline (prior to injection), Day 3, and Day 6 for males (A) and females (B) ...... 55

Figure 14. Wright-Giemsa stain of ascitic fluid collected from the peritoneal cavity of 3- MC-treated Tiparp knockout males and females on day 6 ...... 57

Figure 15. H&E-stained liver sections from wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6 ...... 58

Figure 16. H&E-stained liver sections from Tiparp knockout mice treated with 100mg/kg 3- MC and euthanized on Day 6 ...... 59

viii

Figure 17. Gross liver structure and Oil Red O-stained liver sections from male wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6...... 61

Figure 18. Gross liver structure and Oil Red O-stained liver sections from female wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6...... 61

Figure 19. Male liver, white adipose tissue, and brown adipose tissue weights expressed as a percentage of total body weight on day 6...... 63

Figure 20. Female liver, white adipose tissue, and brown adipose tissue weight expressed as a percentage of total body weight on Day 6 ...... 64

Figure 21. Male hepatic gene expression of classical AHR target genes, Tiparp, and Cd36. 66

Figure 22. Female hepatic gene expression of classical AHR target genes, Tiparp, and Cd36 ...... 67

Figure 23. Male hepatic gene expression of inflammatory cytokines ...... 69

Figure 24. Female hepatic gene expression of inflammatory cytokines ...... 70

Figure 25. Gene expression of classical AHR target genes and Tiparp in white adipose tissue of male mice ...... 72

Figure 26. Gene expression of classical AHR target genes and Tiparp in white adipose tissue of female mice ...... 73

Figure 27. Expression of lipolytic genes and the triacyglycerol-protective Plin1 in the white adipose tissue of male mice...... 75

Figure 28. Expression of lipolytic genes and the triacylglycerol-protective Plin1 in the white adipose tissue of female mice ...... 76

Figure 29. Study outline of the 6-day antagonistic study in wildtype and Tiparp knockout mice treated with CH-223191 (10mg/kg) or DMSO and 3-MC (100mg/kg)...... 77

Figure 30. Wright-Giemsa stain of ascitic fluid collected from the peritoneal cavity of DMSO or CH + 3-MC-treated female Tiparp knockout mice ...... 79

Figure 31. CH + 3-MC female body (A) and food weights (B) ...... 80

Figure 32. Female hepatic gene expression of AHR target genes ...... 82

Figure 33. Serum ALT activity measured at baseline (prior to injection), Day 3, and Day 6 for females treated with DMSO or CH + 3-MC ...... 84

List of Abbreviations

3-MC 3-methylcholanthrene ADPr ADP-ribose AHR Aryl hydrocarbon receptor AHRE AHR response element AHRR Aryl hydrocarbon receptor repressor AIP AHR-interacting protein ALDH Aldehyde dehydrogenase ALT Alanine aminotransferase ANOVA Analysis of variance ARH ADP-ribosylhydrolase ARNT Aryl hydrocarbon receptor nuclear translocator ARTD ADP-ribosyltransferase diphtheria toxin-like ATGL Adipose triglyceride lipase B[a]P Benzo[a]pyrene BAT Brown adipose tissue bHLH Basic helix-loop-helix ΒNF β-naphthoflavone BW Body weight CCCH Cysteine-cysteine-cysteine-histidine CO Corn oil CYP Cytochrome P450 CYP1A1 Cytochrome P450 1A1 CYP1A2 Cytochrome P450 1A2 CYP1B1 Cytochrome P450 1B1 DC Dendritic cell DIM 3,3’-diindolylmethane DRE Dioxin response element ER Estrogen receptor FICZ 6-formylindolo[3,2-b]carbazole GSH Glutathione GST Glutathione S-transferase HAH Halogenated aromatic hydrocarbon H&E Haematoxylin and eosin HSL Hormone-sensitive lipase HSP90 90kDa heat shock protein HYE Histidine-tyrosine-glutamate I3C Indole-3-carbinol IARC International Agency for Research on Cancer ICZ Indolo[3,2-b]carbazole IDO Indoleamine 2,3-dioxygenase IP Intraperitoneal KD Equilibrium dissociation constant Kyn Kynurenine LC50 Median lethal concentration LD50 Median lethal dose x

LDL Low-density lipoproteins LPL Lipoprotein lipase MDA Malondialdehyde NAD Nicotinamide adenine dinucleotide NES Nuclear export signal NF-κB Nuclear factor-kappa-light-chain enhancer of activated B –cell NLS Nuclear localization signal NQO1 NAD(P)H quinone oxidoreductase 1 p23 23kDa co-chaperone protein PAH Polycyclic aromatic hydrocarbon PARG Poly(ADP-ribose) glycohydrolase PARP Poly(ADP-ribose) polymerase PAS Per-ARNT-Sim PCB Polychlorinated biphenyl PDGF Platelet-derived growth factor PCK1 Phosphoenolpyruvate carboxykinase Per Period PGC1α Peroxisome proliferator-activated receptor gamma co-activator 1-alpha PLIN1 Perilipin 1 PNPLA2 Patatin-like phospholipase domain containing 2 P/S/T Proline/serine/threonine ROS Reactive oxygen species SEM Standard error of the mean Sim Single-minded SIRT Sirtuin TCDD 2,3,7,8-tetrachlorodibenzo-p-dioxin TIPARP TCDD-inducible poly(ADP-ribose) polymerase TLR Toll-like receptor UGT UDP-glucuronosyltransferase UV Ultraviolet WAT White adipose tissue XAP2 Hepatitis B virus X-associated protein 2 XME Xenobiotic metabolizing enzyme XRE Xenobiotic response element

Chapter 1: Introduction

1.1 Aryl Hydrocarbon Receptor

The aryl hydrocarbon receptor (AHR) is a ligand-regulated transcription factor that regulates many physiological and toxicological pathways after activation by numerous synthetic and naturally- occurring substances. The AHR belongs to the basic helix-loop-helix (bHLH) Period-Aryl hydrocarbon receptor nuclear translocator-Single-minded (Per-ARNT-Sim; PAS) family of transcription factors that induce or repress a larger battery of genes to produce the subsequent response in diverse cell-, tissue-, species-, and ligand-specific manners (Denison et al., 2011; Shimba and Watabe, 2009). Several genes that are included in the AHR battery of genes include xenobiotic metabolizing enzymes (XMEs) such as the cytochrome P450 (CYP) 1A1, 1A2, and 1B1. The AHR is a promiscuous receptor that can bind many structurally distinct ligands, ranging from naturally-occurring compounds to anthropogenic chemicals (Denison et al., 2011; Denison and Nagy, 2003). Some of the roles of AHR include detoxification of the bound ligand; physiological functions in embryonic and fetal development; immunomodulation; modulation of the cardiovasculature; neural differentiation; and reproduction (Nebert and Karp, 2008).

1.1.1 Structure

The AHR contains numerous functional domains that are also commonly found in other transcription factors. The N-terminal end contains the bHLH motif, a basic region containing the DNA-binding domain, which binds the AHR to the consensus sequences of the target gene. The HLH is a region that participates in protein-protein interactions; heterodimerization; and 90kDa heat shock protein (HSP90) binding (Fukunaga et al., 1995; Hankinson, 1995; Jones, 2004; Ridolfi et al., 2014). Regions containing the nuclear localization signal (NLS) and the nuclear export signal (NES) are also present on the N-terminal end (Mimura and Fujii-Kuriyama, 2003). Adjacent to the bHLH region are the conserved PAS-A and PAS-B domains which can be found in numerous other proteins, such as those involved in the hypoxic response, circadian rhythm, and transcriptional activation (Kikuchi et al., 2003). These regions support heterodimerization with other proteins that contain a high sequence similarity to the PAS domain. The PAS-A domain is required for heterodimerization with ARNT whereas PAS-B is comprised of the residues necessary for the

1 ligand-binding pocket and HSP90 binding. The C-terminal half of AHR contains the transactivation domain and the co-activator recruitment region, which can then be subdivided into an acidic, a glutamine-rich, and a proline/serine/threonine (P/S/T)-rich region (Flaveny et al., 2008; Fukunaga et al., 1995; Hankinson, 1995; Kumar et al., 2001; Mimura and Fujii-Kuriyama, 2003; Ridolfi et al., 2014). The aryl hydrocarbon receptor repressor (AHRR) is an AHR target and functions as a negative regulator of AHR activity. AHRR is also a member of the bHLH/PAS family of transcription factors, is an AHR target gene, and acts as a repressor of AHR function (Baba et al., 2001; Mimura et al., 1999). AHRR is a potent repressor of AHR activity in vitro (Karchner et al., 2009), but exhibits gene and tissue-specific inhibition of AHR action in vivo (Hosoya et al., 2008).

Figure 1. Schematic diagram of the functional domains within AHR, ARNT, and AHRR. At the N-terminal, the bHLH motif contains the DNA-binding and protein-protein interaction domain; the PAS-A is required for heterodimerization with ARNT; and PAS-B facilitates ligand binding. Closer to the C-terminal, the transactivation domain is required for the binding of various factors in the initialization of gene expression while the transrepression domain of the AHRR is required for the inhibition of AHR activity.

1.1.2 AHR Signalling Pathway

In its inactive state, the AHR is a cytosolic protein that exists as a multimeric protein complex bound to several co-chaperone and subunit proteins. The associated proteins include HSP90, hepatitis B virus X-associated protein 2 (XAP2) or AHR-interacting protein (AIP), and the 23kDa co-chaperone protein (p23) (Denison and Nagy, 2003; Ridolfi et al., 2014). HSP90 maintains receptor competency for ligand binding and interacts with the bHLH region to conceal the NLS region to prevent the premature activation of the AHR (Mimura and Fujii-Kuriyama, 2003). The AHR/HSP90 complex is stabilized by p23 before being ligand-bound. Relevant lipophilic AHR ligands enter the cell by simple diffusion due to their lipophilicity and bind onto the cytosolic AHR on the receptor pocket of the PAS-B domain. Once the ligand binds to the AHR/HSP90/p23 complex, AIP is then recruited and induces a conformational change which exposes the NLS and allows for the nuclear translocation of the liganded AHR complex through the nuclear pore group of importins on the nuclear membrane (Denison et al., 2011; Ridolfi et al., 2014). After translocation into the nucleus, the AHR heterodimerizes with its obligatory nuclear protein partner, ARNT, and the dimerization triggers the release of HSP90 from the multimeric complex to facilitate the ligand-bound AHR/ARNT interaction towards its high-affinity, DNA-binding form (Denison et al., 2011; MacPherson et al., 2013; Ridolfi et al., 2014). The complex binds to specific DNA recognition motifs upstream of the transcriptional start site, referred to as AHR-/dioxin- /xenobiotic-response elements (AHRE/DRE/XRE), in the regulatory regions of AHR-responsive target genes. The binding of AHR/ARNT to the AHRE allows for the recruitment of co-regulator proteins including co-activators and co-repressors to the AHR target genes. The AHR target genes are then transcribed and protein is subsequently synthesized. One notable AHR target gene that we are particularly interested in is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-inducible poly(ADP-ribose) polymerase (TIPARP). Similar to AHRR, TIPARP is a ligand-induced negative regulator of AHR activity (MacPherson et al., 2014); however, a number of differences exist in their respective mechanisms of action. Some of these differences will be discussed later in this chapter. Consequently, AHR-dependent gene transcription is terminated with the exodus of the liganded AHR/ARNT complex via nuclear export followed by ubiquitin-mediated proteasomal degradation (Denison et al., 2011).

Figure 2. Canonical AHR signalling pathway. A ligand enters the cytosol and binds onto the AHR complex which recruits AIP to initiate a conformational change to reveal the NLS. The ligand-bound complex enters the nucleus through β-importin transporters and the co-chaperone proteins dissociate. AHR then binds with its heterodimerization partner, ARNT. Together, they activate transcription by binding to the core sequence of AHR target genes. After activation, AHR is shuttled into the cytosol for degradation by the 26S proteasome.

1.1.3 AHR Responsive Genes

Ligand-activated AHR induces a repertoire of genes upon transactivation for the detoxification of chemicals or other metabolic processes. These include phase I and II XMEs such as the CYP family members CYP1A1, CYP1A2, CYP1B1, UDP-glucuronosyltransferase (UGT) 1A6, NAD(P)H quinone oxidoreductase 1 (NQO1), aldehyde dehydrogenase (ALDH) 3A1, glutathione S-transferase (GST) A1, and GST Ya subunit, amongst others (Bergander et al., 2004; Mitchell and Elferink, 2009; Nguyen and Bradfield, 2008; Schmidt et al., 1996). Although not an XME, it is important to note that TIPARP is an AHR target gene and will be discussed further in this chapter. From the extensive gene battery, enhanced CYP1A1 transcription has long been regarded as the trademark of AHR activation and has been used as the classical system to define the

4 mechanism of AHR-regulated gene expression (Denison and Nagy, 2003; Ma, 2002). Unlike other CYP enzymes, CYP1A1 is not constitutively expressed in the liver at the protein level but prolonged CYP1A1 activation can generate reactive oxygen species (ROS). Furthermore, CYP1B1 expression is noted to be extrahepatic, occurring principally in steroid-responsive tissues (Mitchell and Elferink, 2009). Overall, ligand-bound AHR induces xenobiotic metabolism and these enzymes are important contributors to increased biotransformation of exogenous and endogenous compounds, which serves as a protective and adaptive response to regulate AHR activity (Bergander et al., 2004; Mimura and Fujii-Kuriyama, 2003; Nguyen and Bradfield, 2008; Schmidt et al., 1996).

1.2 AHR Ligands

Animals and humans are exposed to a variety of AHR ligands – both synthetic and natural – mainly through dietary sources. Due to receptor promiscuity, a diverse array of AHR-mediated responses can be invoked by a range of structurally divergent substances (Denison and Nagy, 2003; Kawano et al., 2010). Ligand-activated AHR has been well-characterized and studied using the prototypical ligand, TCDD. TCDD is the most potent AHR ligand with a calculated equilibrium dissociation constant (KD) in the nanomolar range (Hankinson, 1995; Mimura and Fujii-Kuriyama, 2003). However, in ligand-receptor binding studies of another halogenated dioxin, Bradfield et al. (1988) reported extrapolated KD values in the picomolar range under infinite receptor dilution. In addition, 6-formylindolo[3,2-b]carbazole (FICZ) has also been shown to bind AHR with a similar affinity in the nanomolar range that is also reported for TCDD (Nguyen and Bradfield, 2008; Stockinger et al., 2011)

1.2.1 Natural Ligands

The known physiological importance of AHR has spearheaded the search and identification of naturally-occurring AHR ligands. A number of endogenous and dietary ligands are known to bind and mediate the AHR signalling pathway. However, many of these ligands do not conform to the expected structure of typical AHR ligands and most endogenous substances are considered as weak inducers with low potency that act as either agonists or antagonists (Nguyen and Bradfield, 2008; Stockinger et al., 2011). These ligands are found from a variety of sources such as vegetable and fruit extracts; teas; natural herbal products; and plant-derived materials. Such compounds include 5 indole-3-carbinol (I3C), curcumin, carotinoids, polyphenolics, indoles, and the flavonoid family of flavones, flavanols, flavanones, and isoflavones (Mimura and Fujii-Kuriyama, 2003; Ridolfi et al., 2014). Although most compounds have low affinity for the receptor, some are classified as high potency/affinity ligands. For example, indolo[3,2-b]carbazole (ICZ) is an acid condensation product of I3C – a constituent of cruciferous vegetables - and is noted to possess high affinity and potency in vitro in nanomolar concentrations. Another major acid condensation product of I3C is 3,3’-diindolylmethane (DIM), which is also established as an AHR agonist but with lower potency. Conversely, a well-known plant stilbenoid or natural phenol, resveratrol, is known as an AHR antagonist. The synthetic flavone, CH-223191, is a commonly used AHR antagonist in laboratory studies. Understanding the physiological impact of plant-derived AHR ligands is an important area of study as humans and animals may have the greatest exposure to these AHR ligands through the diet (Mimura and Fujii-Kuriyama, 2003; Nguyen and Bradfield, 2008; Ridolfi et al., 2014).

Other natural or physiological ligands include low-density lipoproteins (LDLs), arachidonic acid metabolites, cAMP second messengers, indigoids (indigo, indirubin), eicosanoids (lipoxin A4), prostaglandins, sterols, heme metabolites (bilirubin, biliverdin), and tryptophan derivatives (Bergander et al., 2004; Denison and Nagy, 2003; Mimura and Fujii-Kuriyama, 2003; Platten et al., 2012; Stockinger et al., 2011). Tryptophan is an essential amino acid and many of its derivatives possess potent AHR agonistic activity (Stockinger et al., 2011). Ultraviolet (UV) and visible light exposure leads to the formation of tryptophan photoproducts, including the high- affinity ligand, FICZ. However, gene expression is transient and peaks at 3 hours in vitro due to the rapid degradation of the ligand by induced XMEs. Furthermore, tryptophan can be converted to other AHR ligands by enteric bacteria in the digestive tract via the tryptophan metabolism pathway (Bergander et al., 2004; Bock and Köhle, 2006; Rannug et al., 1987; Stockinger et al., 2011; Veldhoen et al., 2008). Kynurenine (Kyn) is one of the metabolites generated from indoleamine 2,3-dioxygenase (IDO) metabolism and is known to influence the immune system since both AHR and IDO are found in dendritic cells (DCs), macrophages, and T-cells (Bock and Köhle, 2006; Nguyen et al., 2013; Stockinger et al., 2011). Although a few of these compounds have relatively weak potencies for AHR, are found at physiologically low concentration in cells, and are metabolized rapidly with the induction of XMEs, they may reach biologically relevant concentrations in certain tissues in vivo and are important ligands that require further study (Denison and Nagy, 2003; Nguyen and Bradfield, 2008; Stockinger et al., 2011).

1.2.2 Synthetic Ligands

Exogenous ligands represent the most extensively characterized class of AHR ligands that bind the receptor with high affinity. Unlike endogenous compounds, these substances and chemicals are environmental contaminants and originate from anthropogenic sources, are typically hydrophobic in nature, and possess structurally aromatic and planar features. High-affinity ligands include the halogenated aromatic hydrocarbon (HAH) and polycyclic aromatic hydrocarbon (PAH) families. HAH congeners are mostly byproducts of high-temperature industrial processes, fuel combustion, and waste incineration. Members of this class include the dibenzo-p-dioxins, dibenzofurans, polychlorinated biphenyls (PCBs), and the prototypical ligand of the AHR system,

TCDD, which possesses a high binding affinity for the receptor with a KD in the nanomolar range (Bergander et al., 2004; Denison and Nagy, 2003; Hankinson, 1995; Ma et al., 2001; Ridolfi et al., 2014). Organochlorine compounds accumulate in the environment and in the fatty tissues of organisms due to high liposolubility. As a brief history, TCDD is the infamous contaminant in Agent Orange, an herbicidal defoliant that was used as a strategic maneuver in the Vietnam War (Stellman et al., 2003). From studies conducted on veterans exposed to Agent Orange in Vietnam, dioxins are estimated to have a half-life of approximately 7-11 years in humans (Pirkle et al., 1989; Wolfe et al., 1994). TCDD is also listed as a class I carcinogen from the International Agency for Research on Cancer (IARC) and was classified in 1997 as being carcinogenic to humans (IARC, 1997).

The other class of exogenous ligands are the PAHs, which include AHR agonists such as 3- methylcholanthrene (3-MC) and benzo[a]pyrene (B[a]P). They induce ligand-dependent AHR signalling with a lower potency than TCDD by several orders of magnitude (Nguyen and Bradfield, 2008). PAHs are compounds found in the incomplete combustion of coal and fat; cigarette smoke and smog; chimney soot; charbroiled foods; and exhaust emissions. Similar to the HAHs, PAHs are also environmentally widespread and persistent (Hankinson, 1995; Nguyen and Bradfield, 2008; Park et al., 2014). To compare binding affinities between HAHs and PAHs, direct radiolabeled-ligand and competitive binding assays in vitro have demonstrated that TCDD binds AHR with an affinity that is 3-4-fold greater than 3-MC, indicating the ligands have similar binding affinities (Riddick et al., 1994). However, when considering potency and efficacy, TCDD induces AHR-mediated XME activity in mice with a potency that is approximately 1000-fold greater than PAH-related compounds (Denison and Nagy, 2003; Hankinson, 1995; Nguyen and Bradfield,

2008). However, this is time-dependent in vitro as TCDD and 3-MC differed in potency by 4-25- fold at earlier time points but TCDD was 100-1000-fold more potent than 3-MC at later time points (Riddick et al., 1994). This was attributed to the rapid metabolism of 3-MC which contributes to the lower potency of the compound, relative to the poorly metabolized TCDD (Riddick et al., 1994). The following section will discuss 3-MC in further detail.

Figure 3. Structural examples of AHR ligands.

1.2.3 3-Methylcholanthrene (3-MC)

In this thesis, 3-MC is the AHR ligand of interest. It is a synthetic ligand used as a prototypical PAH for AHR laboratory studies, as it is a potent inducer of the CYP family of enzymes (Rihn et al., 2000; Xue et al., 2008). 3-MC is also used frequently in carcinogenicity studies as it is a potent carcinogen and exposure promotes the tumour formation in mice and rats (Kwon et al., 2001). It is one of the most potent PAH ligands and metabolism of 3-MC is known to produce metabolites which covalently bind to DNA and can initiate carcinogenesis (Kondraganti et al., 2005).

3-MC was synthesized by Fieser and Seligman (1935) from the bile acid, deoxycholic acid, for the development of a compound with carcinogenic properties. Thus, there is a strong structural similarity between 3-MC and natural products such as sterols and bile acids (Barry et al., 1935). It was suspected that carcinogenic agents such as 3-MC may be synthesized in the body due to the natural origin of the parent compound and the synthesis reactions in its pathway which are present in the biological system (Barry et al., 1935; Boyland and Warren, 1937; Buu-Hoï, 1964). 3-MC and a few of its metabolites are known to possess estrogenic activity by interacting with estrogen receptor (ER) α in the presence or absence of AHR (Abdelrahim et al., 2006). Additionally, 3-MC has also been shown to possess mutagenic and genotoxic potential. In the study by Reddy et al. (1984), a 32P-postlabeling assay found that both 3-MC and B[a]P exhibited the highest levels of covalent DNA adducts in the mouse skin. Furthermore, treating Big Blue® mice – an in vivo transgenic model for gene mutation assays - by intraperitoneal (IP) injection with 80mg/kg 3-MC induced ten-times more nucleotide base transversions compared to that of control mice. This mutation frequency increased over the 30-day study which demonstrated the mutagenic potential of 3-MC. Due to the formation of DNA adducts and increased number of transversion mutations, 3-MC is classified as a mutagenic and genotoxic compound (Rihn et al., 2000).

Other studies also reported the effects of 3-MC at a high dose in vivo. In the study by Jin et al. (2013), an IP administration of 100mg/kg 3-MC significantly increased ROS and malondialdehyde (MDA) levels while decreasing glutathione (GSH) and the total antioxidant capacity. Overall, this signified the increase in oxidative stress within the liver. In the study by Kawano et al. (2010), a single IP administration of 100mg/kg 3-MC in vivo significantly increased triglyceride and fatty acid levels; enhanced the expression of fatty acid translocase; and resulted in positively lipid- stained Oil Red O liver sections indicating the presence of microvesicular steatosis. However,

9 steatosis of the liver improved 24 hours after 3-MC injection due to its elimination. Although the animals were euthanized and assessed at different time-points after 3-MC treatment, these studies suggest that a high dose of 3-MC induced acute oxidative stress and microvesicular steatosis in the liver at early time points (Jin et al., 2013; Kawano et al., 2010).

Chronic 3-MC exposure studies have been linked to tumorigenesis in the lung and mammary gland (Malins et al., 2004; Moorthy, 2000). 3-MC is readily metabolized by AHR-induced CYP1A1 and CYP1B1 which leads to the production of highly reactive metabolites that can covalently bind to DNA and initiate tumour formation (Fazili et al., 2010; Moorthy, 2000). A study by Fish et al. (1981) pre-inoculated rats with an oncornavirus preparation which was followed 10 days later with a subcutaneous injection of 400μg 3-MC. The purpose of viral exposure was used as a protective measure against 3-MC-induced carcinogenicity. Tumour growth was examined in those without viral exposure and these lesions progressed in size and led to lethality between 60-80 days. Another study investigated a single subcutaneous injection of low dose (0.005 - 0.5mg) 3-MC in rats and examined tumour growth on day 50 (Tanooka et al., 1982). Overall, 3-MC expresses its carcinogenic potential given a longer duration of time.

In comparison to TCDD, 3-MC is short-lived due to the quick metabolism by the induction of XMEs. In a radioligand study where [3H]MC was administered in rats, it was noted that only 0.94% of the administered dose was recovered after a day post-treatment in liver, suggesting that 3-MC was rapidly metabolized and eliminated (Moorthy, 2000). This was also observed by Bresnick et al. (1967) as hepatic levels of 3-MC were reduced to less than 1% of the administered dose 14 hours after a single treatment. Within 1 hour, approximately 30% of the parent 3-MC compound can be found excreted into the bile (Poland and Glover, 1973). This rapid hepatic metabolism and clearance of 3-MC is mainly attributed to the biotransformation by induced CYP1A1 and CYP1B1 enzymes (Mullen Grey and Riddick, 2011; Shimada, 2006). In addition, an earlier study by Poland and Glover (1973) reported the effects of both TCDD and 3-MC on hepatic monooxygenase induction in the rat. The study found that TCDD was 30,000 times more potent than 3-MC; however, TCDD was noted to only differ in potency and the duration of action. As suggested, this may have been affected by the quick metabolism of 3-MC, whereas TCDD has a reported biological half-life of 17 days in the rat and is more resistant to degradation (Poland and Glover, 1973). Nonetheless, both compounds induced monooxygenase activity to the same maximum level and were both concentrated in the liver in this study. Overall, TCDD is a more potent ligand with

10 a sustained duration of action while 3-MC is rapidly metabolized, but both ligands are reported to exert the same activity with respect to induction of XMEs when given in maximally-inducing doses (Poland and Glover, 1973).

1.3 Functional role of AHR in Toxicology and Physiology

As an ancient protein, the AHR is extensively conserved throughout evolution and may have been expressed approximately 450-510 million years ago in vertebrate evolution (Hankinson, 1995; Ridolfi et al., 2014). Due to its high conservation, AHR is thought to have an important role in physiology. The receptor mediates a variety of adaptive and toxic responses in animals, which vary depending on spatial and temporal prerequisites of ligand-binding and the affected tissue- or cell-type. Furthermore, the use of Ahr knockout animals in recent years has helped elucidate some of these aspects. Decades of research have established the current understanding of the molecular mechanism of AHR signalling and AHR-dependent gene expression but further work is required to improve our knowledge of this system and its pathways (Denison et al., 2011).

1.3.1 AHR-mediated Toxicity

TCDD- and PAH-activated AHR can elicit multiple toxicological endpoints and this has been observed in both humans and animal models. It is not clearly understood how AHR activation mediates the toxicity of TCDD exposure since the target genes expressed are not related to any toxic manifestation (Bock and Köhle, 2006). Nevertheless, it is a source of increasing public health concern due to its high toxicity, environmental pervasiveness, and its association with cancer, diabetes, and reproductive toxicity. In addition, TCDD exposure elicits a plethora of toxic outcomes such as dysregulated nutrient metabolism, chloracne, skin disorders, cleft palate, thymus involution, decreased energy production, endocrine disorders, hepatotoxicity, immunotoxicity, tumour promotion, cardiac contractile dysfunction, and lethal wasting syndrome (Bock and Köhle, 2006). The latter is characterized by an altered metabolism with significant weight loss and increased lipolysis (Marshall and Kerkvliet, 2010; Uno et al., 2004). It has been suggested that the diverse array of species- and tissue-specific TCDD-mediated toxicities are due to the sustained and inappropriate AHR activation (Bock and Köhle, 2006). In addition to the aforementioned toxicities, 3-MC modulates a series of effects such as cell-cell adhesion interactions, cytokine activation, carcinogenesis, atherosclerosis, cardiotoxicity, and teratogenicity, as seen in previous 11 in vivo studies. TCDD and 3-MC similarly affect endothelial dysfunction, initiate aberrant vascular disease, and generate ROS due to the prolonged induction of the XME battery (Park et al., 2014). Thus, long-term exposure to TCDD and related compounds, such as 3-MC, may lead to chronic diseases in humans (Ma, 2002).

An accurate median lethal dose (LD50) of 3-MC is not readily available; however, the median 3 lethal concentration (LC50) is reported to be 500mg/m for 2 hours via inhalation in the rat (Mavroidis and Palmeter, 2012). To date, there has been no reported cases of lethality in vivo from a single injection of 3-MC within a 30-day observation period. Conversely, it is well-known that there are profound strain and species differences in TCDD-related sensitivities where the oral LD50 can vary over a 5000-fold range among different species (Mimura and Fujii-Kuriyama, 2003). TCDD-induced toxicity varies among species, for example, guinea pigs are the most sensitive mammal with an oral LD50 of 1μg/kg whereas hamsters are the most resistant, with an LD50 that is over 5000μg/kg although lower LD50 values have been reported (Henck et al., 1981; Mimura and Fujii-Kuriyama, 2003; Olson et al., 1980; Wang et al., 2013). Intraspecies differences have also been reported. The Long-Evans (Turku/AB) rat strain is sensitive to TCDD lethality with an oral LD50 of 10-20μg/kg whereas the Han Wistar (Kuopio) strain tolerates a concentration upwards of 9600μg/kg of TCDD (Pohjanvirta et al., 2012). In mice and rats, these variations in sensitivities may be attributed to polymorphisms in the Ahr ligand-binding domain and a mutated transactivation domain of the AHR, respectively (Bock and Köhle, 2006; Mimura and Fujii- Kuriyama, 2003; Poland and Knutson, 1982). An important consideration in the AHR signalling system is the presence of polymorphisms, namely the Ahrb and Ahrd alleles which dictate the responsiveness to AHR ligands. Ahrb in C57BL/6 mice is the responsive allele, whereas Ahrd in DBA/2 or 129;S4 strains is the non-responsive allele due to an amino acid substitution of A375V, which results in a ten-fold lower affinity for TCDD (Nguyen and Bradfield, 2008; Stockinger et al., 2011). As in the DBA/2 mouse strain, which carry the Ahrd, a 10-fold higher concentration of TCDD is required to induce the same response in this mouse strain compared with what is required for the C57BL/6 strain (Hankinson, 1995). However, mice with the low-affinity binding allele do not display the development defects reminiscent of the null allele, such as parent ductus venosus (Nguyen and Bradfield, 2008).

In experimental animals, acute TCDD exposure is demonstrated by wasting syndrome with accompanying weight loss and cessation of weight gain; hypophagia; thymic atrophy and

12 involution; disruption of lipid pathways; suppressed gluconeogenesis; hepatosteatosis; and hepatic hypertrophy (Pierre et al., 2014; Sato et al., 2008; Seefeld et al., 1984; Schmidt et al., 1996). Wasting syndrome precedes lethality in mammalian species exposed to TCDD, where decreased food consumption may only be evident in the terminal stages before death (Seefeld et al., 1984). It has been proposed that these adverse effects may be caused by untimely and prolonged activation of gene expression by the ligand-activated AHR (Fujii-Kuriyama, 2003). Additionally, it has been suggested that the enzymatic activities induced by HAHs and PAHs can biotransform the ligands into carcinogenic and toxic entities (Nguyen and Bradfield, 2008).

1.3.2 Physiological Role of AHR

AHR has dual roles in normal biology: to mediate an adaptive response to xenobiotic exposure and to regulate normal embryonic development and adult physiology. The AHR has been well- conserved among species and there is ample evidence to suggest that it has an important role in other biological processes due to the absence of anthropogenic ligands in the past to drive evolutionary pressure for its conservation (Nguyen and Bradfield, 2008). AHR has also been implicated in normal physiological processes because AHR orthologs are found in invertebrate species, but these do not appear to bind the same xenobiotics recognized by the vertebrate receptor. This supports the notion that mammalian AHR has a physiological role outside of mediating an adaptive response to environmental pollutants (Nguyen and Bradfield, 2008).

The requirement of the AHR in development and regulatory physiology is exemplified in Ahr knockout mice. The most widely observed phenotype of Ahr knockout mice is their unresponsiveness to xenobiotic-induced toxicity, revealing that AHR is responsible for the toxic effects elicited by TCDD (Fernandez-Salguero et al., 1996; Pierre et al., 2014). AHR is required in development as a number of organ-specific and/or anatomical abnormalities occur in Ahr knockout animals while studies in cultured cells suggest that AHR is implicated in cell growth and differentiation (Denison and Nagy, 2003; Fujii-Kuriyama, 2003; Ma et al., 2001; Stockinger et al., 2011). In aged Ahr knockout mouse, the age-related changes observed include heart hypertrophy with the presence of cardiac muscle fibrosis and diminished cardiac output; severe localized epidermal hyperplasia; dermal fibrosis; deficiencies in the immune system related to B- and T-cell populations in the spleen; hyperproliferation of blood vessels in the portal areas of the liver; and calcification in the uterus (Gonzalez and Fernandez-Salguero, 1998; Vasquez et al., 2003). In 13 newborn Ahr knockout mice, it was determined that AHR was required to stimulate the developmental closure of the patent ductus venosus during embryonic development for the closure of the murine embryonic palate (Nguyen and Bradfield, 2008). In all ages, Ahr knockout mice are known to have a distinct liver pathology where the null mice possess a decreased liver weight with fibrosis around the portal triad compared to wildtype mice. Overall, these observations clearly indicate that the AHR has a fundamental role in cell and tissue homeostasis in vivo (Gonzalez and Fernandez-Salguero, 1998; Vasquez et al., 2003).

The physiologic functions of the AHR are only beginning to be understood, including its functions in the development of the vasculature, regulation of cell growth, differentiation, migration, and cell cycling. It is also noted to regulate neurogenesis, circadian rhythm, metabolism, and response to hypoxic conditions (Bock and Köhle, 2006; Ridolfi et al., 2014). The high evolutionary conservation of the AHR, the aberrant phenotypes of Ahr knockout mice, and the expression of AHRE-responsive genes during development support a normal physiological function for the AHR (Nguyen and Bradfield, 2008).

1.4 ADP-Ribosylation

ADP-ribosylation is a post-translational modification that is catalyzed by members of the poly(ADP-ribose) polymerase (PARP) family, which consist of at least 17 distinct proteins. They catalyze the transfer of single or multiple ADP-ribose (ADPr) units onto themselves (autoribosylation) or onto acceptor proteins (heteroribosylation) from nicotinamide adenine dinucleotide (NAD) in the oxidized form (Belenky et al., 2007). The catalytic transfer of multiple ADPr units to target proteins is referred to as poly(ADP-ribosyl)ation, whereas the transfer of a single ADPr unit is referred to mono(ADP-ribosyl)ation. The members of the PARP family can be categorized into four subfamilies based on their domain architecture. The DNA-dependent PARPs (PARP1-3) are activated by discontinuous DNA structures. Tankyrases (PARP5a, PARP5b) contain large ankyrin domain repeats which mediate protein-protein interactions. CCCH-zinc finger PARPs (PARP7, PARP12, PARP13.1, PARP13.2) contain cysteine-cysteine-cysteine- histidine (CCCH)-type zinc fingers that bind to RNA, a tryptophan-tryptophan-glutamate (WWE) domain for protein-protein interactions and ADPr binding activity, and the signature PARP catalytic domain. MacroPARPs (PARP9, PARP14, PARP15) containing macrodomain folds that can bind ADPr. PARPs have been characterized by multiple functional domains with varied 14 activities, subcellular locations, and functions (Amé et al., 2004; MacPherson et al., 2014; Ryu et al., 2015). The assortment of functional domains comprises an abundant and versatile protein that is suited to carry out a wide variety of cellular functions (Ryu et al., 2015).

Overall, ADP-ribosylation is a ubiquitous post-translation modification which regulates many cellular processes including transcription activation, protein-protein interactions, DNA damage- induced repair, chromatin remodelling, telomere protection, proliferation, cell cycle regulation, and programmed cell death (Kleine et al., 2008; Ma et al., 2001; MacPherson et al., 2013; Schreiber et al., 2006). ADP-ribosyltransferases and PARPs catalyze mono(ADP-ribosyl)ation and poly(ADP-ribosyl)ation, respectively. It was hypothesized that the highly-conserved glutamate residue in the active center predetermined either transferase or polymerase activity, but recent studies have discredited this original theory (Kleine et al., 2008). Overall, these proteins function to regulate the many cellular and physiological processes related to PARP signalling (Li and Chen, 2014). As noted, PARP family members hydrolyze NAD+ as a substrate to transfer ADPr onto residues of a target protein acceptor (Ma, 2002). This process is reversed by ADPr-removing enzymes known as poly(ADP-ribose) glycohydrolase (PARG) and ADP-ribosylhydrolases (ARHs). The former is responsible for the hydrolysis of mono(ADPr) and the cleavage of poly(ADPr) units, whereas the latter may only cleave free ADPr from poly(ADPr) chains but cannot remove the ADPr-protein bond – leading to the formation of mono(ADP-ribosyl)ated proteins. In contrast, macrodomain-containing proteins such as MacroD1 and MacroD2 have ARH activity and can also remove mono(ADPr) from substrate proteins by cleaving the ADPr-protein bond (Feijs et al., 2013). Macrodomains will be elaborated upon further in the next section.

The study by Vyas et al. (2014) systematically investigated the catalytic activity of all 17 PARP family members. They found that the majority of PARPs exhibit mono(ADP-ribosyl)transferase activity as determined by the observed single bands resolved on a SDS-PAGE gel followed by autoradiography. They also confirmed that glutamate, aspartate, and lysine are targets of mono(ADP-ribosyl)ating PARP members, displaying that both mono(ADP-ribosyl)transferases and PARPs modify similar amino acid targets (Vyas et al., 2014).

1.4.1 Poly(ADP-ribose) Polymerase (PARP)

In general, PARPs regulate many cellular activities including DNA repair, apoptosis, chromatin remodeling and other regulatory functions through repeated rounds of added poly(ADP- ribosyl)ation to generate poly(ADPr) chains on target proteins (Aravind, 2001; Elmageed et al., 2012; Hakmé et al., 2008). PARP1 is the founding and most widely studied PARP member. Loss of PARP1 activity leads to greater susceptibility to DNA-damaging agents, as studied in Parp1 knockout mice (Vyas et al., 2014). These mutant mice are noted to possess repair defects, cell cycle perturbations, increased genomic instability, and dysregulation of the chromatin superstructure (Hakmé et al., 2008).

As with PARP1, the catalytic activities of the DNA-dependent PARPs are activated by DNA double-strand breaks to initiate repair functions (MacPherson et al., 2013; Ryu et al., 2015). This consists of chromatin relaxation and subsequent poly-ADP-ribosylation of histones to recruit repair factors with a high affinity to poly(ADPr) units, such as the repair scaffold protein, XRCC1. It coordinates with other proteins and macromolecule regulators through poly(ADP-ribosyl)ation to mediate apoptosis, cell cycle arrest, DNA repair in response to damage, and activates nuclear factor-kappa-light-chain enhancer of activated B-cell (NF-κB) to regulate cytokine expression in inflammatory responses (Hakmé et al., 2008). PARPs can also trigger cell death directly in response to DNA damage and may control the fate of the cell. For example, if a tolerable amount of DNA breaks are present – this would favour DNA repair and cell survival. On the contrary, if the damage is insurmountable, the response triggers apoptotic cell death. This is also the case in Parp1-deficient cells which makes PARP inhibitors promising and appealing therapeutics as anti- tumour drugs which are non-specific for a single PARP (Hakmé et al., 2008). As such, PARP inhibitors are currently being used in cancer therapy (Kleine et al., 2008).

1.4.2 Mono(ADP-ribosyl)transferase

Mono(ADP-ribosyl)transferases transfer a single ADPr unit to target acceptor proteins. Less is known about mono(ADP-ribosyl)ation in comparison to poly-ADP-ribosylation, but recent findings have noted that mono(ADP-ribosyl)transferases may be involved in cell signalling processes and gene transcription (Feijs et al., 2013). Mono(ADP-ribosyl)ation was originally identified as a pathogenic mechanism of certain bacterial toxins such as the diphtheria, cholera, 16 pertussis, and clostridial toxins which exhibit similar mono(ADP-ribosyl)transferase activities. However, in mammalian systems, a subclass of mono(ADP-ribosyl)transferase known as ectoenzymes exist extracellularly to modify targets such as integrins, defensins, and other cell surface molecules. There are other mammalian mono(ADP-ribosyl)transferases which are present as intracellular enzymes and that cooperate with proteins involved in cell signalling and metabolism. It is noted that ADP-ribosylation usually leads to the inactivation of protein targets; thus, PARPs provide a mechanism in both physiological and pathological conditions (Corda and Di Girolamo, 2003; Kleine et al., 2008).

PARP10 was the first mono(ADP-ribosyl)transferase to be identified with mono(ADP- ribosyl)ating activity, with its involvement in repressing the NF-κB signalling by interacting with multiple factors of the pathway (Feijs et al., 2013). PARP14, another mono(ADP- ribosyl)transferase, was suggested to target proteins to regulate gene transcription and promote T- cell differentiation of the TH2 phenotype. Thus, specific PARP14 inhibitors can be a potential therapy for inflammation (Feijs et al., 2013). Additionally, mono(ADPr) modifications may also serve as a foundation or primer unit for further elongation of poly(ADPr) synthesis, with PARPs functioning cooperatively with mono(ADP-ribosyl)transferases to tightly regulate each step of the ADP-ribosylation process (Vyas et al., 2014). Corda and Di Girolamo (2003) suggested that mono(ADP-ribosyl)transferase activity is expressed in the cells of the immune system and participates in the actions of the innate and adaptive immune response in humans. Additionally, it was demonstrated that mono(ADP-ribosyl)ation may play a role in targeting heterotrimeric G- proteins and in regulating cytoskeletal structure through the modification of actin fibers. It is becoming more prominent that mono(ADP-ribosyl)ation is a crucial mechanism in regulating protein function (Corda and Di Girolamo, 2003).

Table 1. List of PARP members, enzymatic activity, other designated names, and their respective catalytic motif. Adapted from Vyas et al. (2014). PAR: poly(ADP-ribose); MAR: mono(ADP-ribose).

1.5 Macrodomains

Macrodomain-containing proteins are able to bind mono(ADPr) or poly(ADPr) through their macrodomain regions, which are evolutionarily conserved structural modules found across species. Members include MacroD1, MacroD2, C6orf130, and among many others that have yet to be identified. Both MacroD1 and MacroD2 have been recognized as hydrolases that participate in the removal of mono(ADPr) from the glutamate residue on substrate proteins (Feijs et al., 2013; Li and Chen, 2014). Thus, ADP-ribosylation is a reversible post-translational modification and suggests that macrodomain-containing proteins control cell-specific processes and protein-protein interactions with the removal of ADPr (Feijs et al., 2013; Vyas et al., 2014). Furthermore, biochemical analyses have suggested that although macrodomain proteins have structurally similar key residues, they have different functionality. Overall, mono(ADP-ribosyl)ation is a reversible process from the characterization of macrodomain-containing proteins (Feijs et al., 2013).

1.6 TCDD-inducible poly(ADP-ribose) polymerase (TIPARP)

TIPARP was first identified by Ma et al. (2001) as an AHR target gene that can be induced by TCDD and with poly(ADP-ribose) polymerase (PARP) functional activity. Hence, this novel protein was designated with the name, TIPARP. As such, TIPARP is a member of the PARP family and is induced via AHR-dependent gene transcription. TIPARP is also known as PARP7 and also as ADP-ribosyltransferase diphtheria toxin-like (ARTD) 14 (MacPherson et al., 2013). TIPARP is induced in the heart, brain, liver, kidney, lung, and testis of the mouse. Due to high sequence homology with other known proteins, TIPARP was hypothesized to play an important role in memory formation, T-cell function, and tumour growth; however, due to its wide expression in other tissues, TIPARP may be implicated in other crucial functions (Ma et al., 2002).

1.6.1 Structure

TIPARP has an open reading frame of 657 amino acid residues and a protein of approximately 75kDa in size (Ma et al., 2001). It is classified as a member of the CCCH-type zinc-finger family of PARPs; thus, contains the N-terminal zinc-finger domain, a central WWE domain, and the characteristic C-terminal PARP catalytic domain. The carboxyl half shares its sequence homology with other PARP catalytic domains. The CCCH-type zinc-finger domain is the putative DNA/RNA-binding site, the WWE domain contains its most conserved residues for the mediation of specific protein-protein interactions in ADP-ribosylation conjugation systems, and the catalytic domain is required for NAD+ binding and ADPr synthesis (Aravind, 2001; Li and Chen, 2014; Schreiber et al., 2006).

It was suggested that within the PARP catalytic domain, the histidine and tyrosine residue are highly conserved and are crucial in positioning NAD+ in the correct orientation for ADP- ribosylation. A catalytic glutamate is found in most PARPs which was widely believed to be important in poly(ADP-ribosyl)ating activities; thus, the three conserved amino acid residues form the histidine-tyrosine-glutamate (HYE) triad that appears in bona fide PARPs (Gibson and Kraus, 2012). TIPARP lacks the equivalent catalytic E988 glutamate residue of PARP1 and this was suggested to bestow its mono(ADP-ribosyl)ating properties. In single-point mutation studies, it was established that substituting the isoleucine at position I631 in TIPARP – which is analogous 19 to E988 of PARP1 – does not convert TIPARP catalytic activity to PARP synthase activity. In addition, the ability of TIPARP to repress AHR transactivation was prevented with the H532A and Y564A point mutations, but not I631A, which retained catalytic activity. Furthermore, single-point mutations of the cysteine residues on the CCCH-type zinc-finger motif abolished its repression on AHR transactivation. These data demonstrated important structural requirements from both the zinc-finger and catalytic domains for specific activity (MacPherson et al., 2013; Matthews, 2013).

Figure 4. Schematic diagram of the functional domains within TIPARP. Zn: zinc finger; WWE: tryptophan- tryptophan-glutamate; HYI: histidine-tyrosine-isoleucine.

1.6.2 Function

Following the discovery of TIPARP, Ma (2002) characterized TIPARP expression by TCDD- induction in Hepa1c1c7 cells and C57BL/6 mouse liver. There was a lack of ligand-induced TIPARP expression in AHR- and ARNT-defective variants but its expression was restored upon reconstitution of the variant cells with functional AHR and ARNT, respectively (Ma, 2002). Furthermore, Ma (2002) treated female C57BL/6 mice with a single dose of TCDD at 10μg/kg body weight (BW) and extracted total RNA from isolated liver samples. TIPARP was expressed in the hepatoma cell line as well as the liver of the TCDD-treated mice. From the in vitro studies, induction of TIPARP was found to be concentration- and time-dependent (Ma, 2002). TIPARP is not inducible in Ahr-deficient cells, demonstrating that AHR is required for TIPARP expression for ligand induced expression by AHR. In our recent in vitro study, the use of AHR and ARNT zinc-finger nuclease-mediated knockouts in human breast cancer cells demonstrated that in the absence of AHR or ARNT, induction of AHR target genes had ceased with a large reduction in basal expression of both Cyp1a1 and Cyp1b1. This indicates that the AHR/ARNT heterodimer complex is required for the ligand-mediated induction and expression at basal levels (Ahmed et al., 2014). Overall, these findings establish that TIPARP expression is time-dependent, inducible

20 by TCDD, expressed in mammalian liver, and requires the presence of functional AHR and ARNT in the system (Ma, 2002).

TIPARP induction in response to TCDD exposure represents a novel transcriptional response in the AHR signalling pathway. Studies conducted by Diani-Moore et al. (2010) identified TIPARP as a participant in TCDD-induced metabolic dysregulation by suppressing gluconeogenesis. Overall, TIPARP is implicated in limiting glucose stores, overconsuming NAD+ which ultimately leads to decreased activity of sirtuin (SIRT)-1, and resulting in the reduced deacetylation of the peroxisome proliferator-activated receptor gamma co-activator 1-alpha (PGC1α). Results from the study elucidated that TCDD-induced decrease of hepatic glucose production is due to the suppression of phosphoenolpyruvate carboxykinase (PCK1), a key regulator of gluconeogenesis, by ADP-ribosylation via TIPARP (Diani-Moore et al., 2013). It was also noted that AHR suppression enhanced ADP-ribosylation through a PARP-independent mechanism (Diani-Moore et al., 2013). Overall, the study concluded that TIPARP excessively consumes NAD+ and poly- ADP-ribosylates PCK1 in the process. By doing so, this leads to the TCDD-induced, AHR- mediated dysregulation of gluconeogenesis, nutrient signalling, and energy balance (Diani-Moore et al., 2010; Diani-Moore et al., 2013). However, our laboratory and others reported that TIPARP (MacPherson et al., 2013; Vyas et al., 2014) is a mono(ADP-ribosyl)transferase and not a poly(ADP-ribose) polymerase, as suggested previously (Diani-Moore et al., 2013; Ma, 2002). We also showed that TIPARP is a transcriptional repressor of the ligand-activated AHR and participates in a novel negative feedback loop leading to the proteolytic degradation of AHR (MacPherson et al., 2013; Matthews, 2013). AHR degradation via TIPARP may be a result of direct ADP-ribosylation of the receptor or through the targeting of unidentified factors facilitating the degradation process. TIPARP was also shown to modify core histones, co-localize in the nucleus with AHR, and repress AHR-mediated activity with overexpression of TIPARP. Conversely, knockdown of TIPARP results in increased CYP1A1 expression in response to TCDD (MacPherson et al., 2013). Moreover, we have demonstrated that TIPARP is not accountable for the dioxin-induced decrease in cellular NAD+ levels as TCDD-treated wildtype and knockout mice exhibit a reduction in hepatic NAD+ levels on day 6 and day 2, respectively, when compared to DMSO controls. Pck1 mRNA levels were also similar between TCDD-treated wildtype and knockout mice suggesting there were no significant differences in Pck1 repression (Ahmed et al., 2015). In addition, the administration of 100μg/kg or 10μg/kg TCDD in Tiparp knockout males and females led to the development of steatohepatitis, and other TCDD-related toxicities such as

21 wasting syndrome, hepatic damage, and lethality (Ahmed et al., 2015). Tiparp knockout mice displayed increased hepatic gene expression of classical AHR target genes and protein levels compared to their wildtype counterparts. Tiparp knockout mice given a single injection of 100μg/kg did not survive the 6-day experiment. The mice died between days 3 and 5 and due to drastic reductions in body weight; all wildtype mice appeared normal over the 30-day study. Serum alanine aminotransferase (ALT) levels were increased in both TCDD-treated male and female Tiparp knockout mice compared with wildtype controls (Ahmed et al., 2015). In Tiparp knockout animals, focal inflammation, cytoplasmic clearing of periportal hepatocytes, and microvesicular steatosis was evident by day 3. Due to the largely observed intrahepatic accumulation of free fatty acids, cholesterol, and triglycerides in the TCDD-treated Tiparp knockout mice by day 3 in conjunction with focal inflammation, it was suggested that the loss of Tiparp leads to the development of steatohepatitis in TCDD-treated mice (Ahmed et al., 2015). This study also revealed a novel interaction between TIPARP and MacroD1 on AHR-mediated activity via the mono(ADP-ribosyl)ating activity of TIPARP. The target-specific ADP-ribosylation of AHR is catalyzed by TIPARP; MacroD1 recognizes and binds to ADPr units on target proteins and hydrolyzes the linkage to allow for the reversal of this post-translational modification. Thus, the TIPARP-MacroD1-AHR axis possesses a regulatory function in mediating AHR activity under mono(ADP-ribosyl)ation (Ahmed et al., 2015). Thus, the novel functions of TIPARP have generated additional questions regarding its interaction with other transcription factors as well as mediators related and non-related to the AHR pathway. Further studies are necessary to understand the role that TIPARP plays in mediating other proteins and its involvement in other pathways.

Figure 5. Network of mono(ADP-ribosyl)ation pathways related to TIPARP.

1.7 AHRR and TIPARP: Similarities and Differences

AHRR and TIPARP are both AHR target genes and repressors of the AHR-mediated signalling pathway. The AHRR is induced by AHR activation and also represses the transcriptional activity of AHR in a regulatory loop (Zudaire et al., 2008). It has been reported to be an important factor in tumour suppression in humans and was indicated to inhibit cell growth of MCF-7 cells (Kanno et al., 2006; Zudaire et al., 2008). Similar to the other members of the bHLH/PAS family, AHRR is structurally similar to both ARNT and AHR; however, AHRR contains a potent transcriptional repressor domain and does not have the ability to be ligand-bound due to the absence of a PAS-B domain (Stevens et al., 2009). It was originally suggested that AHRR competes with AHR for heterodimerization with ARNT to regulate AHR activity (Mimura et al., 1999). However, it has been reported that AHRR repression of AHR transactivation does not involve competition for ARNT and it does not require binding to AHREs. Rather, it was proposed that transrepression occurs via protein-protein interactions instead of the inhibition of the AHRE-binding of the AHR- ARNT heterodimer (Evans et al., 2008). In relation to TIPARP, our laboratory has reported that

23 overexpression of AHR, not ARNT, rescues TIPARP-dependent repression of AHR transactivation (MacPherson et al., 2013).

Between AHRR and TIPARP, the repressive function of both proteins possess similarities and notable differences so both proteins exhibit partially overlapping but also distinct mechanisms in repressing AHR activity. Both proteins are inducible by ligand-activated AHR, they directly interact with AHR, and increased ARNT expression does not affect their ability to repress AHR. The differences are that TIPARP overexpression increases the proteolytic degradation of AHR, knockdown of TIPARP in in vitro systems increases the TCDD-induced AHR target gene expression and AHR protein levels. The latter results were not observed following AHRR knockdown. As demonstrated, AHRR and TIPARP both repress AHR transactivation by similar actions but also by distinct mechanisms and both are key regulators and important components of the AHR signalling pathway (MacPherson et al., 2014).

1.8 Characterization of the TIPARP Knockout Mouse Model

Schmahl et al. (2007) generated a Tiparp knockout mouse model designated as the TiparpGt(ROSA)79Sor as a means of studying the development of adult mice, particularly those systems associated with the platelet-derived growth factor (PDGF) family and the induction or repression of immediate early genes. The mutation was derived from the insertion of the gene-trap array vector (ROSAFARY) targeting Tiparp in the first intron (Schmahl et al., 2007; Schmahl et al., 2008). The authors used a gene-trap-coupled microarray analysis to identify and mutate multiple PDGF intermediate early genes in mice, which revealed TIPARP to be a PDGF target gene. In the mutant mouse, the viability, vasculature, kidney function, skeletal infrastructure, and snout shape were affected with the loss of Tiparp. It was noted that the apparent vascular defects, hemorrhaging, and microaneurisms may have been causative factors for the decrease in viability. A multitude of other abnormalities exist such as renal deformity, anemic phenotypes, abnormal smooth muscle cell number, and a higher immature blood cell count (Schmahl et al., 2007). Carrying on the research on the Tiparp knockout mouse, Schmahl et al. (2008) tested 11 important PDGF genes identified from the previous study which were essential for male and female fertility, as these genes of interest control steroidogenesis. This study revealed that Tiparp knockout females were sterile and females possessed high ovarian expression of Tiparp as indicated by X- gal staining of the β-geo reporter from the gene-trap vector. 24

PDGF targets are required for theca cell development and steroid production in the ovary. Female Tiparp knockout mice exhibit abnormal ovarian morphology with a polyfollicular phenotype. In the study, the ovaries were enlarged with increased follicle development; numerous antral follicles and corpora lutea; and formation of hemorrhagic cysts (Schmahl et al., 2008). The length of the estrous phase was greatly prolonged, persisting up to 4 days instead of the regular 13 hours in length, which was consistent with the alteration in hormone levels. Animal husbandry with Tiparp knockout females over a 3-month period observed only 6 pregnancies between 21 to 23 days instead of the normal gestation period of 19 days at which the pups were born dead or the mother was sacrificed due to complications. Small litter sizes were also noted as an average of 2.8 pups were conceived in comparison to the average of 9.3 pups in the wildtype females (Schmahl et al., 2008). Upon analysis, estradiol levels were reduced and the levels of CYP19A1, a CYP enzyme that participates in the conversion of androgens to estrone, was roughly two-thirds lower than wildtype mice. This may explain the overall decrease in estradiol levels as estrone is the precursor to estradiol. However, the absence of Tiparp did not affect male fertility or testosterone production which may indicate that the steroidogenic pathway is in control. In summary, mutation of the Tiparp gene as part of the PDGF pathway leads to changes in the balance of steroidogenic enzymes and ovarian phenotypes in female mice (Schmahl et al., 2008).

As mentioned above, our laboratory identified new roles for TIPARP in AHR signalling and dioxin-mediated toxicity. When Tiparp knockout mice were treated with a single intraperitoneal (IP) injection of 100μg/kg TCDD, mice did not survive beyond day 5 demonstrating increased sensitivity and lethality in the mutant mice whereas wildtype mice survive the full 30-day experiment. Phenotypically, Tiparp knockout mice displayed steatohepatitis, as evidenced by the haematoxylin and eosin (H&E) and Oil Red O staining (Ahmed et al., 2015). Hepatotoxicity was also noted due to the high levels of serum ALT – a marker of liver injury. Our study demonstrates that the loss of Tiparp increases sensitivity to dioxin-induced steatohepatitis and causes lethality (Ahmed et al., 2015). These findings support the previous results by MacPherson et al. (2013) that TIPARP is a repressor of AHR signalling, and also specifically targets AHR for ADP-ribosylation (Ahmed et al., 2015).

Rationale and Research Objectives

The mono(ADP-ribosyl)transferase, TIPARP is an AHR target gene and a transcriptional repressor of AHR-mediated signalling. It is an important mediator in the AHR pathway as TIPARP facilitates AHR-dependent toxicities induced by environmental contaminants such as TCDD. Our previous study (Ahmed et al., 2015) reported that TCDD-treated Tiparp knockout mice experience increased sensitivity to dioxin-induced steatohepatitis and lethality. Mice were treated with a single high, but non-lethal, dose of 100μg/kg TCDD which induced a multitude of responses such as wasting syndrome, hepatotoxicity, microvesicular steatosis, death within 6 days post-treatment, and high inflammation of the liver.

Due to the increased sensitivity to dioxin at 100μg/kg, treatment with another AHR ligand at a high dose would further test the sensitivity of this mouse model and elucidate any potential ligand- dependent differences. Therefore in the current study, we treated wildtype and Tiparp knockout mice with a single non-lethal intraperitoneal injection of 100mg/kg 3-MC. There has been no previous reports of 3-MC-induced lethality from an acute toxicity study within a 30-day period. To investigate the toxicological and physiological implications in this study, body weight and food intake measurements; gene expression analyses; serum ALT measurements; tissue weights; and numerous cell and histology staining procedures were analyzed. This study included both a 30- day survival study and two separate 6-day acute toxicity studies, to answer the following research aims.

Research Aims

1) To investigate the ligand-induced toxicological effects of 3-MC on Tiparp knockout mice through gene expression analyses; conducting serum ALT measurements; H&E and Oil Red O staining of hepatic tissue; and initiating a 30-day survival study.

2) To explore the effects of CH-223191, an AHR antagonist, and 3-MC co-administration in Tiparp knockout mice to assess the AHR-mediated specificity of the phenotypic outcomes.

Chapter 2: Materials and Methods

2.1 Materials

2.1.1 Chemicals and Biological Reagents

For chemical treatments, a 100mg vial of 3-methylcholanthrene (3-MC) was purchased from Sigma-Aldrich (St. Louis, MO, USA) at an HPLC purity of >97.5%. A 5mg vial of CH-223191 (CH) and dimethyl sulfoxide (DMSO) was also purchased from Sigma-Aldrich. President’s Choice 100% pure corn oil (CO) was purchased from a local grocer. The solution of 3-MC was made by adding 10mL of corn oil to the 100mg powdered 3-MC (Sigma-Aldrich) to generate a 10mg/mL stock. This solution was made fresh before injection and disposed of after 30 days. The solution of CH was made by adding 500μL of DMSO to the 5mg powdered CH (Sigma-Aldrich) to generate a 10mg/mL stock. The CH solution was made fresh before a set of experiments and disposed of after 2 weeks. Liver sections for H&E staining were preserved in neutral buffered 10% formalin solution (Sigma-Aldrich) and liver sections for Oil Red O were suspended in VWR® Clear Frozen Section Compound (Radnor, PA, USA) to embed tissues for cryosectioning. The Infinity™ ALT (GPT) Liquid Stable Reagent was purchased from Fisher Diagnostics (Middletown, VA, USA) for use in the in vitro determination of ALT activity in mouse serum.

A 100mg vial of 3-MC powder was reconstituted in 10mL of corn oil, generating a 10mg/mL stock of 3-MC. The mice were administered 100mg/kg of 3-MC in a volume of ~200μL (based on body weight). Corn oil was administered as a vehicle control in comparable volumes. In the CH + 3- MC experiment, a 5mg vial of CH was reconstituted in 500μL of DMSO, generating a 10mg/mL stock of CH. The mice were given 10mg/kg of CH in volumes equal to the day’s body weight (~20μL). DMSO was administered as a vehicle control in comparable volumes.

For RNA isolation of mouse liver and white adipose tissue (WAT), TRIzol® reagent was purchased from Life Technologies (Carlsbad, CA, USA) and chloroform (ACS grade) was purchased from Caledon Laboratories (Georgetown, ON, Canada). The Aurum™ Total RNA Mini Kit was purchased from Bio-Rad Laboratories (Hercules, CA, USA) for RNA extraction. Subsequently for cDNA synthesis, Superscript® III reverse transcriptase was purchased from Life

Technologies. A 100mM dNTP set (PureExtreme quality) comprised of dATP, dCTP, dGTP, and dTTP was purchased from Thermo Scientific (Waltham, MA, USA). Each dNTP was diluted in an aqueous solution with DNase/RNase-free distilled water to create a final dNTP mix concentration of 10mM. Random hexamers to serve as primers were designed by Integrated DNA Technologies (IDT; Coralville, IA, USA) and used in the reaction for cDNA synthesis. All quantitative real-time polymerase chain reactions (qPCR) were conducted by using SsoFast EvaGreen® SYBR Supermix (Bio-Rad) in each reaction with mRNA primers generated by IDT.

Triglyceride content of chylous effusions and serum was measured using the Serum Triglyceride Determination Kit purchased from the Sigma-Aldrich. Isolated protein from white adipose tissue was facilitated with the use of the Minute™ Total Protein Extraction Kit for adipose tissue from Invent Biotechnologies (Eden Prairie, MN, USA). Lipase activity was measured in mouse liver and white adipose tissue using the Lipase Activity Assay Kit III purchased from Sigma-Aldrich. The Wright-Giemsa stain for the differentiation of white blood cells was performed with the purchase of the modified Accustain® Wright-Giemsa dye from Sigma-Aldrich. Gram-staining for the imaging of Gram-positive and Gram-negative bacteria in chylous fluid was performed with the Gram-staining kit for microscopy purchased from Sigma-Aldrich. Cover slips were adhered onto the slides using a high-viscosity Cytoseal™ 280 mounting medium purchased from Fisher Scientific (Hampton, NH, USA). Permount™ mounting media was also purchased from Fisher Scientific for adhering cover slips on H&E-stained samples. For tissue staining procedures, Mayer’s modified haematoxylin solution, eosin Y, Oil Red O solution, and xylene (histological grade) were purchased from Sigma-Aldrich. H&E and Oil Red O staining on liver sections were conducted via standard methods for visualizing liver morphology and lipid disposition, respectively.

100% anhydrous ethyl alcohol was purchased from Commercial Alcohols (Tiverton, ON, Canada) as a solvent for multiple uses. Filtered, DNase/RNase-free distilled water was used for all applications (Sigma-Aldrich). Dulbecco’s phosphate buffered saline (PBS) was purchased from Sigma-Aldrich and used during the animal dissections to rinse harvested tissues. 100% HPLC- grade methanol for the fixation of the Wright-Giemsa stain and isopropanol for Oil Red O staining were purchased from Caledon Laboratories.

2.1.2 Plasticware and Other Equipment

Axygen® 1.5mL and 0.6mL polypropylene microcentrifuge tubes, purchased from Corning (Corning, NY, USA), were used throughout all experiments in this project and serological stripettes for aliquoting and dispensing fluid were purchased from Sarstedt (Nümbrecht, Germany). The Gilson® Diamond pipette tip series were purchased from Mandel Scientific (Guelph, ON, Canada) and autoclaved before use. 15mL and 50mL conical tubes for the storage of liquids were purchased from FroggaBio (Toronto, ON, Canada). 1cc Luer-slip plastic syringes and 25G x 5/8” needles used for animal injections were purchased from BD Biosciences (Franklin Lakes, NJ, USA). In the CH-223191 experiment, a 50µL Hamilton® glass syringe (Reno, NV, USA) was used for the microliter administration of CH-223191 or DMSO. Microvette® 200 Z- Gel tubes (Sarstedt) were used to collect blood and separate serum for analysis. Collection of flash- frozen tissues were placed in 2mL screwcap microtubes (Sarstedt). Liver sections for processing were stored in VWR® histology cassettes (with hinged plastic covers) (VWR) and these cassettes were submerged in formalin-filled Histoplex™ histology containers from Starplex Scientific (Cleveland, TN, USA). Liver sections processed for Oil Red O were suspended in Peel-A-Way® disposable embedding molds from Polysciences (Warrington, PA, USA). Surgical instruments for animal dissections included straight iris scissors and curved splinter forceps purchased from Almedic (Saint-Laurent, QC, Canada). Straight razor blades from Fisher Scientific were used to segment the liver into multiple slices, and this was conducted on the white surface of antistatic polystyrene weigh boats (VWR) – which were also used to rinse tissue samples in saline before collection. Samples were flash-frozen in a high-density, polyethylene Dewar flask purchased from Nalgene (Rochester, NY, USA) containing liquid nitrogen. A Fujifilm FinePix F900EXR (Minato, Tokyo, Japan) was used to capture liver photos and the abdominal cavity of the mouse.

PCR 0.2mL microtube strips and their respective flat caps were purchased from Sarstedt to use in cDNA synthesis. Non-skirted, 96-well PCR plates were purchased from D-Mark Biosciences (Toronto, ON, Canada) for qPCR reactions. Accompanying MicroAmp® Optical adhesive film and film applicator were purchased from Life Technologies. Greiner UV-Star® 96-well plates from Greiner Bio-One (Monroe, NC, USA) were used for the ALT activity assay as the plates’ extensive optical range was ideal for the assay. In addition, 25mL disposable reagent reservoirs for the ALT and lipase activity assay were purchased from VWR. Black, clear-bottom 96-well plates and clear 96-well plates were purchased from Corning for use in the fluorometric lipase

29 activity assay and colorimetric measurements, respectively. GoldLine microscope slides and micro cover glasses, both purchased from VWR, were used for all stained tissue intended for microscopy.

2.1.3 Instruments

In all applications, when transferring or aliquoting samples and reagents, the PIPETMAN Classic™ set of calibrated pipettes were purchased and used from Mandel Scientific. The multichannel pipettes, PIPETMAN® L, and the motorized Gilson Pipetman Concept C10 were also purchased from Mandel Scientific. The INTEGRA PIPETBOY was purchased from INTEGRA Biosciences (Hudson, NH, USA). The Eppendorf Repeater® Plus for dispensing fluid was used in conjunction with various combitips purchased from Eppendorf (Hamburg, Germany).

Multiple samples placed in 1.5mL or 0.6mL Eppendorf tubes from different applications were centrifuged with the Centrifuge 5415D, at room temperature, which was purchased from Eppendorf. Samples centrifuged at 4°C were placed in the Thermo MicroCL 17 Centrifuge (Thermo Scientific). For the centrifugation of 50mL conical tubes at variable temperatures and 96- well plates used in qPCR reactions, the Centrifuge 5810R was used (Eppendorf). The Mini Centrifuge was purchased from Mandel Scientific for 1.5mL Eppendorf tubes and 0.2mL strip tubes.

In the RNA isolation of hepatic and adipose tissue, flash-frozen samples were homogenized using the PowerMax Advanced Homogenizing System 200 from VWR. For the quantification of freshly extracted RNA samples, the concentration, purity, and quality was measured with the Ultrospec™ 2100 Pro UV/Visible spectrophotometer from General Electric Healthcare (Little Chalfont, United Kingdom). cDNA synthesis and gene expression data were generated using the Bio-Rad Chromo4™ DyadDisciple™ (Peltier Thermal Cycler) for PCR and qPCR, respectively (Bio-Rad). Alternatively, the DNAEngine® (Peltier Thermo Cycler) was used for cDNA synthesis as well (Bio-Rad). The Infinity™ ALT (GPT) Liquid Stable Reagent and prepared chemicals for treatment were incubated in 37°C using the Isotemp™ Incubator (Fischer Scientific) prior to performing the ALT activity assay and before injections, respectively. The Multiskan™ EX plate reader (Thermo Scientific) was used to quantify the amount of protein present in samples. Mice and food were weighed daily using the OHAUS CS2000 (Parsippany, NJ, USA) portable digital scale and on the day of sacrifice, mouse tissue weights were measured on the Mettler-Toledo AB204-S analytical 30 balance purchased from Mettler-Toledo (Columbus, OH, USA). The BioTek Synergy™ MX multi-mode microplate reader (BioTek Instruments; Winooski, VT, USA) was used to measure the serum ALT enzymatic activity and triglyceride content along with the Gen5 data analysis software program (BioTek Instruments). Histology slides stained with H&E, Oil Red O, or Wright- Giemsa was visualized and imaged using a Nikon® Eclipse Ci-L upright light microscope (Melville, NY, USA). NIS Elements – Basic Research (Nikon) was the program used for image acquisition and capture.

2.2 Methods

2.2.1 Animal Facility

The Division of Comparative Medicine at the University of Toronto (Toronto, ON, Canada) ensures that properly trained and certified technicians, staff, and veterinarians are employed for the care of laboratory animals in research. Food and water supplies were inspected by technicians daily and caging – which includes, bedding and water – were changed every two weeks. The veterinary technicians also monitored animals and reported any unusual behaviour or signs. Animals received adequate stimulation with environmental enrichment such as igloos and nesting material. The temperature was constant at 21°C; a maintained light-dark cycle (12 hours and 12 hours); humidity within the facility was controlled; and standard rodent chow and sterile water were provided ad libitum. All procedures and experiments conducted were in accordance with the principles set by the Canadian Council on Animal Care guidelines and approved by the Animal Ethics Committee at the University of Toronto.

2.2.2 Maintenance of Animal Colony

TIPARPGt(ROSA)79Sor mutant mice (stock number: 007206) were purchased from Jackson Laboratories (Bar Harbor, ME, USA) and is a gene-trapped mutation made by Dr. Philippe Soriano at the Mount Sinai School of Medicine. The mutant mice were produced and maintained on a mixed C57BL/6;129S4 background and were believed to be backcrossed 2-3 generations into C57BL/6J by Dr. Philippe Soriano and one generation into C57BL/6J (stock number: 000664) at Jackson Laboratories before the strain was cryopreserved. The ROSAFARY gene-trap vector was designed with a promoter trap and poly-A-trap module correctly targeted to the endogenous Tiparp 31 gene in the first intron on chromosome 3 (Ahmed et al., 2015; Soriano et al., 2007). The total number of backcrosses into the B6 background before its arrival to the Jackson Laboratories is currently unknown but single nucleotide polymorphism analysis detected that the mice used were approximately 90% of the C57BL/6 background (Ahmed et al., 2015). Litters of the Tiparp+/- intercross were housed 3-4 per cage, and mice used for experiments were housed individually. Aseptic techniques were used and all procedures were conducted in biological safety cabinets to maintain a sterile environment.

+/+ -/- 2.2.3 Genotyping of Tiparp and Tiparp Mice

Live colonies were maintained at the facilities in the Division of Comparative Medicine at the University of Toronto by breeding heterozygous mice to generate the Tiparp knockout and wildtype genotypes used in our studies. Seven-nine week old mice were genotyped at weaning with isolated genomic DNA via tail clippings processed by separate PCR methodologies. A 20µL reaction contained 1x JumpStart™ Taq reaction buffer and 0.2 units of JumpStart™ Taq DNA

Polymerase (Sigma-Aldrich), 1.75mM MgCl2, 0.2mM dNTPs, 0.2µM of each primer, and 2µL of genomic DNA. PCR amplification cycles included an initial denaturation step of 3 minutes at 94°C that was followed by 35 cycles of the following: 30 seconds at 94°C to denature DNA, 30 seconds at 59°C for primer annealing, and 70°C for 45 seconds for elongation. This was followed by a final step of 7 minutes at 70°C for a final extension. The amplified DNA was evaluated using 1% agarose gel electrophoresis following by visualization with ethidium bromide staining (Ahmed et al., 2015).

Table 2. List of PCR primers for genotyping Tiparp+/+ and Tiparp-/- Mice. Primer Name Primer Sequence

Tiparp Common Primer TGTCAGATCCCTCCTTCGTGAGGC

Tiparp+/+ Primer GTATAGTACCTAGCACTGTTCACC

Tiparp-/- Primer GAAGCCTATAGAGTACGAGCCGTAGA

2.2.4 Animals and Treatments

Seven-to-nine week old male and female Tiparp+/+ and Tiparp-/- mice were given a single-injection of 100mg/kg BW of 3-MC dissolved in CO through the IP route of administration. Control mice received an equivalent volume of CO by BW. Reconstituted compounds were heated to 37°C and vortexed to ensure solubilization of the compound prior to treatment. Injections were administered on Day 0 using a standard 1cc plastic syringe and 25G x 5/8” needle. In the CH-223191 experiment, mice received an initial IP injection of 10mg/kg BW of CH dissolved in DMSO, or an equivalent volume of DMSO by BW for control mice, using a 50µL Hamilton® glass syringe and 25G x 5/8” needle for microliter administration volumes. Four hours following this initial dose of CH-223191 or DMSO, 100mg/kg of 3-MC dissolved in CO was administered in all mice via the IP route. 3 days after the initial CH or DMSO treatment, mice were once again re-administered with their respective treatment (CH) or control (DMSO). Mice were monitored daily and proper personal protective equipment was implemented for the handling of 3-MC-treated animals.

Experimental mice were supplied with standard chow (Teklad Global Diet® 2018; 18% protein, 6% fat) in the form of pelleted food from Harlan Laboratories (Indianapolis, IN, USA). Mice and food pellets were weighed daily in the morning using the OHAUS CS2000 portable digital scale and values were recorded until the end of the study. Body weight was taken after stabilization of weight fluctuation by the scale. For food intake measurements, ~100g of intact food pellets were placed on the top wire feeder and weighed on Day -1 for the calculation of the baseline value (Day 0). All pellets on top of the wire feeder as well as any residual pieces on the cage floor were accounted for in the daily food intake measurement. Measurements recorded on each subsequent day were subtracted from the previous day’s recorded value to provide the daily food intake value. Body weight and food intake values were normalized to baseline and graphed as an increase or decrease from Day 0.

For the survival/mortality study, mice were followed and monitored up to 30 days after administration (Day 0). The chemical conversion date for 3-MC is 7 days, at which it is believed that the chemical is largely eliminated from the system, and new caging is provided. If considered endpoints were met at any moment during the experiment, humane intervention was implemented to prevent or relieve unnecessary pain and distress. Preventative measures would comprise of providing mash, subcutaneous injections of saline, and/or applying warmth to the cage from a heat

33 source. Suggested endpoints include body weight loss exceeding 20% of normal body weight as measured on Day 0; severe lethargy and reluctance to move when provoked; hunched or abnormal posture; severe dehydration or malnutrition; and signs of severe discomfort. If these ailments cannot be alleviated through preventative measures, then the mice were humanely euthanized via cervical dislocation.

2.2.5 Blood and Tissue Collection

Conscious mice were controlled in a home-made restraint tube (i.e. 50mL conical tube with ventilation holes) and fur was removed from the distal areas of the hind leg to reveal the lateral saphenous vein. The hind leg was immobilized in an extended position, petroleum jelly was applied to clear the puncture site, and a 25G needle was used to perforate the vein to obtain blood. Approximately 100-150µL of blood was collected in a Microvette® 200 Z-Gel tube, and this was conducted on Day 0 (before treatment for baseline values), 3, and 6. Blood flow was stopped by inverting the animal downwards, applying pressure to the site with a section of gauze, and releasing the hold on the hind leg. The animal was returned to the cage and the scab formed can be removed on subsequent days for further blood collection. Blood samples were placed at room temperature for a minimum of 30 minutes for coagulation. The sample can then be centrifuged at 10,000rpm for 5 minutes to separate the serum, which was subsequently collected and stored at -80°C until analysis.

For the 6-day study, mice were humanely euthanized by cervical dislocation and photos were taken of the revealed subcutaneous white adipose tissue and lymph nodes; the exposed abdominal cavity; and gross liver. Dissections were initiated by saturating the abdomen with 70% ethanol, grasping the skin anterior to the urethra with forceps, and creating an incision along the sagittal plane to the base of the neck. Two additional cuts were made at the base of the first incision towards the knee. The skin was then stretched back to reveal the intact peritoneum, displaying the subcutaneous white adipose tissue, axillary lymph nodes, and inguinal lymph nodes. If chylous ascites was suspected from the observable distension of the abdomen, the peritoneum was carefully slit for the insertion of a 1cc Luer-slip syringe and withdrawal of the fluid for inspection and analysis. The second incision was made upwards on the peritoneum towards the sternum to reveal the abdominal cavity and intra-abdominal organs. The liver was removed from the cavity by removing the diaphragm and gall bladder; severing the vena cava; cutting the hepatic artery and portal vein; and

34 removing the connective tissue to liberate the liver and its four lobular sections. Once extracted from the body, the whole liver was washed in ice-cold PBS, dried quickly on absorbent paper, and recorded for tissue weights on a Mettler-Toledo AB204-S analytical balance. Liver weight was recorded, and was spread on a white surface for photo collection. With a straight razor blade (VWR), the left lobe was divided into two long slivers for H&E staining and the other for Oil Red O staining. The former is placed into a histology cassette and submerged in formalin, whereas the latter was suspended in an embedding mold filled with frozen section compound. The remainder of the left lobe was cleaved into ~50mg sections for RNA extraction. Epididymal white adipose tissue was removed from the perigonadal region (with care not to include any of the reproductive organs), washed in ice-cold PBS, and weighed. To extract interscapular brown adipose tissue, 70% ethanol was applied to the dorsal area and removal of the tissue yielded two lobular sections between the scapulae. The surrounding white adipose tissue attached to the brown adipose tissue was removed, washed in ice-cold PBS, and weighed. Both WAT and BAT were collected for RNA extraction and lipase activity assays. All tissues were stored in 2mL screw cap tubes and flash- frozen immediately in liquid nitrogen after recording tissue weights. Collected fluid samples were prepared on microscope slides before storing at -80°C. Tail clippings were saved for verification of genotypes, if required. Due to the toxicity of 3-MC and its potential as a carcinogen, precaution was taken as all treated carcasses and chemical-contaminated materials were collected separately for proper disposal according to the University of Toronto regulations and standards.

2.2.6 RNA Extraction and Isolation

For RNA isolation from liver, ~50mg of frozen liver was homogenized in 500μL of TRIzol® for 10 seconds. Samples were incubated at room temperature for 5 minutes to allow for the complete dissociation between complexes before the addition of 100μL of chloroform. For RNA isolation from WAT, 100mg of adipose tissue was homogenized in 1mL of TRIzol® for 10 seconds and homogenized samples were incubated at 30°C for 15 minutes. The top lipid layer of each sample was removed and discarded. TRIzol® was replenished to the 1mL volume and 200μL of chloroform was added. The homogenizer tip was rinsed between samples in ice-cold PBS. Following the addition of chloroform in both tissue types, the samples were vigorously vortexed for 15 seconds following a 3 minute incubation at room temperature, which was then centrifuged at 13,000rpm for 15 minutes at 4°C for phase separation. The RNA, located in the upper aqueous

35 phase, was collected and transferred to 1.5mL microcentrifuge tubes and 70% ethanol of equal volume was added.

The lysate was thoroughly mixed and transferred into RNA binding columns supplied by the Aurum™ Total RNA Mini Kit. The speed of centrifugation in all following steps was set at 10,000rpm.The lysate was centrifuged for 30 seconds, and the filtrate was discarded. Next, 700μL of the low stringency wash was added to the column, centrifuged for 30 seconds, and the filtrate was discarded. The lyophilized DNase I was reconstituted in 250μL of 10mM Tris (pH 7.5) and 5μL of the prepared DNase I was added to 75μL of DNase dilution solution. Approximately 80μL of the diluted DNase I mix was added to a single column and incubated for 25 minutes at room temperature. After the incubation, the column was rinsed with 700μL of high stringency wash solution and the filtrate was discarded. A final 700μL low stringency wash followed, the filtrate was discarded, and the columns were air-dried by centrifugation for 2 minutes. Columns were placed on designated tubes for RNA collection, and 80μL (liver) or 30μL (WAT) of elution solution was added to the membrane stack. The elution solution was allowed to saturate the membrane for 2 minutes before it was centrifuged for 2minutes to elute. Once the RNA was eluted, these tubes were placed directly on ice. RNA concentration, purity, and quality were measured using the spectrophotometer at a 40-fold dilution in water. Extracted liver RNA samples were adjusted to 50ng/μL and WAT RNA samples were adjusted to 100ng/μL concentrations with the addition of DNase/RNase-free distilled water.

2.2.7 cDNA Synthesis and Gene Expression

To synthesize cDNA, 10μL of 500ng or 1μg normalized liver or WAT RNA, respectively, was reverse transcribed using SuperScript® III and its components. The reaction mix consisted of 4μL 5X First Strand buffer, 2μL 0.1mM DTT, 1μL 50mM random hexamers, 1μL 10μM dNTP mixture, 1.75μL distilled water, and 0.25μL SuperScript® III in a total reaction volume of 20μL per sample. Using the MJ Cycler Software 2.0 (Bio-Rad) on the Bio-Rad Chromo4™ DyadDisciple™, the cDNA synthesis reaction involved an initial 1 hour incubation at 50°C followed by a 15 minute period at 70°C to inactivate the enzyme. The synthesized reaction was then diluted with 60µL of DNase/RNase-free distilled water. The qPCR reaction was prepared on non-skirted, 96-well plates with a reaction mixture of 1µL of synthesized cDNA, 2.8µL of DNase/RNase-free distilled water, 5µL of the SsoFast EvaGreen® SYBR Supermix, and 0.1µL 36 each of the 10mM forward and reverse primer (Table 3) verified with NCBI Primer-BLAST (Bethesda, MD, USA) and designed by IDT. The plate was sealed with MicroAmp® Optical adhesive film and technical duplicates were performed for each target gene transcript and normalized to the mTbp (housekeeping gene) mRNA content. Measurements were made on the Bio-Rad Chromo4™ DyadDisciple™ and the reaction steps included a preliminary denaturation and enzyme activation at 95°C for 3 minutes and 45 cycles of the following: 95°C for 5 seconds for denaturation and 60°C for 20 seconds to anneal primers to the template and assist in elongation. Measurements were recorded after the completion of each cycle. Data were analyzed using the Opticon Monitor™ 3 software (Bio-Rad) and fold changes were computed by applying the comparative cycle threshold (CT) difference between treatment and control (ΔΔCT). The expression level of each gene was calculated using the 2-ΔΔCt method of analysis, and compared to wildtype, CO-treated controls. In the case of the CH-223191 experiment, the expression of each gene was compared to wildtype, DMSO-treated controls.

Table 3. List of qPCR primers used in the gene expression assay. Primer Name (mRNA) Primer Sequence

mTbp 5’ GCACAGGAGCCAAGAGTGAA

mTbp 3’ TAGCTGGGAAGCCCAACTTC

mCyp1a1 5’ CGTTATGACCATGATGACCAAGA

mCyp1a1 3’ TCCCCAAACTCATTGCTCAGAT

mCyp1b1 5’ CCAGATCCCGCTGCTCTACA

mCyp1b1 3’ TGGACTGTCTGCACTAAGGCTG

mTiparp (exon 3,4) 5’ ACATCACACCGTATTGCCCT

mTiparp (exon 3,4) 3’ GCCCAAAAGTCTTGTCCTCCAT

mLpl 5’ GGATGGACGGTAACGGGAAT

mLpl 3’ GGCCCGATACAACCAGTCTA

mHsl 5’ GCTGGGCTGTCAAGCACTGT

mHsl 3’ GTAACTGGGTAGGCTGCCAT

mPlin1 5’ AAGGGCCCAACCCTGCTGGA

mPlin1 3’ CCAGGCCTCTGCAGGCCAAC

mPnpla2 5’ GGGGTGCGCTATGTGGATGGC

mPnpla2 3’ AGGGTTGGGTTGGTTCAGTAGGC

mIl-1β 5’ GATGAAGGGCTGCTTCCAAAC

mIl-1β 3’ GATGTGCTGCTGCGAGATTT

mIl-6 5’ CTCTGCAAGAGACTTCCATCCA

mIl-6 3’ AGTCTCCTCTCCGGACTTGT

mTgfβ 5’ TCGAGGGCGAGAGAAGTTTA

mTgfβ 3’ AAAAGAATGTCCCGGCTCTC

mCxcl2 5’ AAGTTTGCCTTGACCCTGAA

mCxcl2 3’ AGGCACATCAGGTACGATCC

mTnfα 5’ ATGAGCACAGAAAGCATGATCCGC

mTnfα 3’ CCAAAGTAGACCTGCCCGGACTC

mCd36 5’ GGAACTGTGGGCTCATTGC

mCd36 3’ CATGAGAATGCCTCCAAACAC

2.2.8 Tissue Processing and Sectioning for Histology

To prepare slides for H&E staining, liver sections obtained from the animal dissections were freshly fixed in neutral buffered 10% formalin solution before processing and paraffin embedding. The tissue was dehydrated through a number of graded ethanol solutions and then solidified in wax blocks. In this procedure, the liver was sectioned into 5µm thick segments and attached to a glass slide. To prepare slides for Oil Red O staining, liver samples were suspended in VWR® Clear Frozen Section Compound and flash-frozen in liquid nitrogen. This established the optimal cutting temperature (OCT) for cryosectioning. Sections of 5µm thick tissue-embedded ribbons

38 were sliced using a cryostat and adhered onto a glass slide. The aforementioned procedures were services provided by Mr. Andrew Elia and his team at Princess Margaret Hospital (Toronto, ON, Canada) of the University Health Network.

2.2.9 Haematoxylin and Eosin (H&E) Stain

For H&E staining of the liver sections, an eosin Y stock solution (1%) was made using 10g of eosin Y (Sigma-Aldrich), 200mL of distilled water, and 800mL of 95% ethanol. This was mixed thoroughly and stored at room temperature. An eosin Y working solution (0.25%) was made fresh which consisted of 250mL of eosin Y stock solution (1%), 750mL 80% ethanol, and 5mL of glacial acetic acid. The solutions were contained within slide staining dishes (Wheaton; Millville, NJ, USA) and sample slides were placed on a slide rack (Wheaton). The paraffin wax was removed through two exchanges in xylene for 10 minutes each. Subsequently, slides were rehydrated in 2 exchanges of 100% ethanol for 5 minutes each, then placed into 95% ethanol for 2 minutes, and another 2 minutes in 70% ethanol. Slides were gently rinsed under distilled water. The slides were immersed into Mayer’s haematoxylin solution (Sigma-Aldrich) for 15 minutes. Following this step, slides were placed under gentle, warm, running tap water for 10 minutes while ensuring the samples were not under highly pressurized water. Slides were rinsed briefly in distilled water before submersing in 95% ethanol for a count of ten dips. Slides were processed in the counterstain with eosin Y solution for 1 minute before following the standard dehydration procedure. Slides were placed in 95% ethanol and then two exchanges of 100% ethanol for 5 minutes each. The slides were then cleared in two exchanges of xylene for 5 minutes each and allowed to air-dry before adhering cover slips with the xylene-based Permount™ mounting medium (Fisher Scientific). For each slide, representative images of the cell population were obtained at 40X, 100X, and 200X magnification.

2.2.10 Oil Red O Stain

Slides were placed on dry ice prior to staining and taken out to room temperature before staining. A 5% formalin solution was made from the 10% formalin stock solution (Sigma-Aldrich) with the addition of distilled water. 60% isopropanol was also prepared from the stock isopropanol solution (Caledon Laboratories) and distilled water. A differentiation solution was made from 70% ethanol and 1% 12N hydrochloric acid. A bluing solution was made with 500mL of distilled water with

1.5mL of ammonium hydroxide. Slides were placed onto a glass rack (Wheaton) with solutions in staining dishes (Wheaton). The slides were fixed with 5% formalin for 7 minutes and the stain was washed off in two exchanges of PBS for 2 minutes each. The slides were then placed in 60% isopropanol for 5 minutes before the transfer to Oil Red O solution (Sigma-Aldrich) for 30-40 minutes. Subsequently, slides were quickly placed in 60% isopropanol for 20 seconds and placed in distilled water to rinse thoroughly. The slide rack was then placed into Mayer’s haematoxylin solution (Sigma-Aldrich) for 5 minutes before rinsing under distilled water. The slides were immersed in the differentiation solution for 20 seconds and rinsed with distilled water. Following this, slides were submerged into bluing solution for 1 minute before rinsing thoroughly with distilled water. Slides were then allowed to air-dry and cover slips were mounted with the use of 70% glycerol. For each slide, representative images of the cell population were obtained at 40X, 100X, and 200X magnification.

2.2.11 Wright-Giemsa Stain

Once chylous fluid was obtained from the abdominal cavity of the mouse, the sample was vortexed briefly to ensure a homogeneous mixture before transferring fluid. An aliquot of 20µL of the sample was smeared as a thin film across a microscope slide using aseptic techniques over an open flame. The sample was allowed to air-dry for 5 minutes before fixing in 100% methanol for 40 minutes. Slides were subsequently removed from the fixative and air-dried before staining. The fixed sample was flooded with 600µL of the modified Accustain® Wright-Giemsa stain for 1 minute to visualize a differential of leukocytes. Following this, an equal volume of distilled water was added to the stain, mixed by pipetting, and the blend was incubated on the slide for 3 minutes. The slides were thoroughly rinsed under a constant stream of distilled water. Slides were allowed to dry for 30 minutes before preservation with Cytoseal™ 280 mounting medium and sealed with rectangular (24 x 50mm) cover glasses. Visualization of Wright-Giemsa-stained slides were imaged using a brightfield microscope and Nikon imaging software. For each slide, representative images of the cell population were obtained at 40X, 100X, and 200X magnification.

2.2.12 Serum ALT Activity

The collection of serum samples was used in the assessment of the ALT activity levels. The Infinity™ ALT (GPT) Liquid Stable Reagent (Fisher Diagnostics) was warmed to 37ºC for optimal

40 assay conditions. Samples were processed in duplicates. An appropriate amount of serum was diluted in distilled water in a 1:1 ratio and 10μL of the mixture was used per reaction on a Greiner UV-Star® 96-well plate. Immediately before assay measurements, 160μL of the ALT reagent was aliquoted into each well and shaken for 20 seconds at medium speed. The constant temperature was set at 37ºC within the BioTek Synergy™ MX multi-mode microplate reader (BioTek Instruments) and kinetic measurements were taken at an absorbance of 340nm each minute for a total duration of 15 minutes. Activity levels were adjusted with the recommended factor. Values were then plotted against time and the average of the two slopes was obtained.

2.2.13 Triglyceride Level Determination

The Serum Triglyceride Determination Kit (Sigma-Aldrich) was used to measure the amount of glycerol and true triglyceride levels in the fluid samples obtained from the peritoneal cavity of the 3-MC-treated Tiparp knockout mice. All reagents and the internal plate reader temperature were adjusted to 37ºC for optimal assay conditions. Samples were processed in duplicate. 10μL of each sample was aliquoted into a well of a clear 96-well plate. To determine the glycerol content, 160μL of Free Glycerol reagent was aliquoted into each well, shaken for 20 seconds at medium speed, and protected from light during a 5 minute pre-incubation at 37ºC. Initial absorbance was recorded at 540nm and 40μL of the reconstituted Triglyceride reagent was added in each well. Incubation resumed for 5 minutes at 37ºC before recording the final absorbance of each sample. The concentration of glycerol, true triglyceride, and total triglyceride levels were determined accordingly.

2.2.14 Statistical Analysis

Daily body weight and food intake measures are expressed as the mean ± standard error of the mean (SEM) across all animals and analyzed by a repeated measures two-way analysis of variance (ANOVA) with a Tukey’s post-hoc statistical test for multiple comparisons between day-matched mice. A log-rank (Mantel-Cox) test was used in the survival curve analyses to determine significance (P<0.05) between groups. In all other results, a two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparisons test was used to determine statistical significance (P<0.05). All data were graphed and analyzed using GraphPad Prism 6 statistical software (San Diego, CA, USA) using grouped measures.

Chapter 3: Results

3.1 30-Day Survival Study

Figure 6. Study outline of the 30-day survival study in wildtype and Tiparp knockout mice treated with 3-MC (100mg/kg). Mice were monitored daily for the duration of this experiment. Blood was collected before 3-MC treatment on day 0, and subsequently on day 3 and 6.

3.1.1 3-MC induces lethality in Tiparp knockout males and females

In the previous study by Ahmed et al. (2015), a single IP injection of 100μg/kg TCDD administered to male and female Tiparp knockout mice resulted in a lethal wasting syndrome and death between day 3 and 5; treated wildtype survived to the end of the 30 day observation period. Moreover, male Tiparp knockout mice treated with a single IP injection of 10μg/kg TCDD died between day 5 – 8, while all Tiparp wildtype mice survived to the end of the 30-day study (Ahmed et al 2015). It is important to note that the TiparpGt(ROSA)79Sor mutant mice used in that study and in this thesis b d were created on a mixed C57BL/6 and 129;S4 strain, which harbor the Ahr and Ahr alleles, respectively. However, the mixed lines were backcrossed 3 generations onto C57BL/6 and Ahr specific genotyping revealed that the mice used in these studies harbour the Ahrb allele (Ahmed et al., 2015). Going forward, to determine if Tiparp knockout mice exhibit increased sensitivity to another, but readily metabolizable, ligand we treated wildtype and Tiparp knockout male and female mice with a single IP injection of 100mg/kg 3-MC and monitored the mice for 30 days (Figure 6). The 100mg/kg dose of 3-MC was equivalent to male and female mice receiving ~2.2mg and ~1.8mg, respectively. Body weight, food intake, and health status of the mice were monitored daily. All wildtype mice, regardless of gender, survived the 30-day study without any

42 signs of distress or pain. In contrast, 3-MC-treated Tiparp knockout males died on day 8, 11, 13 (2 died on day 13), and 16 (Figure 7A). This was significant compared to wildtype mice using a log-rank (Mantel-Cox) test for differences between survival curves (P<0.05). In agreement with those data, 3-MC treated female Tiparp knockout mice died on day 9, 12, 13, and 14 (Figure 7B). The survival curve comparison between 3-MC treated wildtype and Tiparp knockout female mice was also significant with the log-rank (Mantel-Cox) test (P<0.05). The mice were either found dead the morning on the day of death or had to be euthanized because of a greater than 20% loss in body weight with displayed lethargy or pain, which was in accordance with the care and guidelines set by the Canadian Council on Animal Care and approved by the University of Toronto Animal Care Committee.

Figure 7. Kaplan-Meier survival curves indicating the survival rate of 3-MC-treated wildtype and Tiparp knockout mice. An event was noted when body weight loss had met or exceeded 20% of the baseline-measured body weight or if the animal had reached an endpoint which would require immediate euthanasia; n = 4 - 5.

3.1.2 Characterization and analysis of chylous fluid

In each of the male and female Tiparp knockout mice assessed, abdominal distention was evident around day 5-6. On the day of sacrifice, these mice always possessed a pool of viscous and milky, or white and translucent viscous fluid in male (Figure 8A) and female (Figure 8B) animals. This was an unexpected finding with the high-dose administration of 100mg/kg 3-MC as this fluid production was not evident in the Tiparp knockout mice treated with TCDD at 100μg/kg in the previous study (Ahmed et al., 2015). In other documented studies involving a high-dose of 3-MC (100mg/kg), the production or accumulation of this fluid was not reported. No fluid was observed in treated wildtype animals (Figure 8A and 8B). The fluid was subsequently stained with Wright- Giemsa and acquired with visualization under 40X magnification. Populations of cells resembling lymphocytes were apparent in both male and female Tiparp knockout fluid samples (Figure 9).

Figure 8. Photographic images of the closed peritoneum and opened peritoneal cavity (A: males; B: females). Images on the top show an intact peritoneum with fluid accumulation in the Tiparp knockout 3-MC-treated mice (right set) compared to wildtype controls (left set). Images on the bottom show the open abdominal cavity and all tissues in the peritoneal cavity. Reduced visceral fat was noted in the Tiparp knockout mice with remnants of the fluid adhered to the tissues.

Figure 9. Wright-Giemsa stain of ascitic fluid collected from the peritoneum of 3-MC-treated Tiparp knockout on Day 16 (male) and Day 9 (female). Predominance of lymphocytes present, as noted by the deep-blue violet nuclear stain. A: 40X magnification, the scale bar represents 500μm; B: 200X magnification, the scale bar represents 100μm.

3.1.3 Fluid characteristics of the 30-day survival study

Upon extraction of the fluid from the Tiparp knockout mice treated with 3-MC on the day of death, the appearance and texture of the fluid was recorded. All fluid samples obtained from the 30-day study mice were milky and white with a viscous texture (Table 4). A triglyceride determination assay was conducted on multiple chylous fluid samples collected from the survival study mice. The triglyceride concentrations in the fluid ranged from 487 – 2065 mg/dL. Wright-Giemsa staining, which is used to visualize white blood cells, was used to determine that large cell populations of lymphocytes were present in the fluid, with smaller populations of macrophages and neutrophils by observation. However, in addition to microscopy, the use of flow cytometric differentiation through fluorescence-activated cell sorting should be used to differentiate populations of white blood cells. A colorimetric assay was used to determine that the chylous fluid had a protein concentration between and 1.9 – 5.1 g/dL. For the diagnosis of chylous ascites in 47 humans, triglyceride levels must be above 200 mg/dL, the cell population must be predominantly lymphocytic, total protein levels should range from 1.1 – 7.0g/dL, and the appearance of the fluid should be white and milky (Cárdenas and Chopra, 2002). These traits are among other biochemical characteristics (e.g. cholesterol, amylase, glucose, serum-ascites albumin gradient, etc.); however, these factors were not analyzed in this study.

Table 4. Characteristics of chylous ascites found in Tiparp knockout mice (day 8 – 16) of the 30-day survival study. Values for the clinical diagnosis of chylous ascites were adapted from Cárdenas and Chopra (2002).

The unexpected result from the survival study, in which the Tiparp knockout mice died within a range of two weeks after receiving a single injection of 3-MC, was possibly due to the accumulation of large volumes of the white, milky substance (~500-1200μL) in their abdominal cavities. To date, there have been no reports in regards to the administration of an AHR ligand and the production of a milky fluid in the abdominal cavity; thus, we are the first to report such a phenomenon.

3.2 6-Day Study

The unanticipated results obtained from the survival study, in which we found that 3-MC-treated Tiparp knockout males and females succumbed to health-related complications between day 8 to 16, was an observation that has not been reported previously in the literature with a high dose of 3-MC. Therefore, we conducted a short-term 6-day study to characterize the effects of 3-MC on the Tiparp knockout mouse model. The 6-day study time point was chosen because this was before the onset of death. A schematic of the 6-day study outline is provided in Figure 10.

Figure 10. Study outline of the 6-day study in wildtype and Tiparp knockout mice treated with 3-MC (100mg/kg). Mice were monitored daily for the duration of this experiment along with daily body weight and food intake measurements. Blood was collected before 3-MC treatment on day 0, and subsequently on day 3 and 6. All groups were euthanized on day 6 and liver, WAT, and fluid samples (if applicable) were collected for subsequent analyses.

3.2.1 Body weight loss in 3-MC-treated mice compared to controls

Since dioxin-exposed mice display decreased body weight and experience a loss of weight gain over time, the body weight of wildtype and Tiparp knockout mice of both genders were measured on a per day basis up until day 6. On each day after day 0, male Tiparp knockout mice treated with 3-MC displayed decreased body weight in comparison to their genotype-matched, CO control. With the exception of day 6, male wildtype mice treated with 3-MC weighed significantly less than their genotype-matched, CO controls (Figure 11A). Aside from Day 1, male wildtype mice treated with 3-MC weighed significantly more than the treatment-matched, Tiparp knockout males. As such, it appeared that 3-MC-treated Tiparp wildtype males displayed a decrease in body weight from baseline measurements following treatment, but this decrease was not as pronounced as the body weight loss of the 3-MC-treated Tiparp knockout males.

Tiparp knockout females treated with 3-MC weighed significantly less compared with their genotype-matched, CO controls (Figure 11B). Between days 4-6, Tiparp knockout mice treated with 3-MC also displayed significantly lower body weight compared to treatment-matched, wildtype mice. Conversely, Tiparp wildtype mice treated with 3-MC weighed significantly less than the Tiparp wildtype CO-treated mice, but this difference in body weight loss was only evident between day 2-4. Similar to the males, the female 3-MC-treated knockout mice did not appear to recover body weight during the 6-day study. Overall, the data indicated that the single injection of

100mg/kg 3-MC resulted in body weight loss; however, knockout mice lost more body weight compared with their wildtype counterparts and the recovery of body weight to baseline levels (100%) was not observed in the treated Tiparp knockout group.

Figure 11. Daily male and female body weights expressed as a percent of baseline values (day 0 weight). Mice were weighed on a daily basis during the 6-day study. Data represent the mean ± SEM; n = 6 - 11. a: P < 0.05 repeated- measures two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 repeated measures two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.2 Decreased food intake in 3-MC-treated Tiparp knockout mice

Since food consumption was decreased in conjunction with lower body weights in the TCDD- exposed Tiparp knockout mice preceding the onset of death (Ahmed et al., 2015), we measured food intake in 3-MC-treated wildtype and Tiparp knockout mice. Food intake was measured as g/g of daily mouse body weight.

Male 3-MC-treated Tiparp knockout mice consumed significantly less food (P<0.05) after 3-MC treatment compared to genotype-matched, CO controls on most post-treatment days, with the exception of day 4 (Figure 12A). On days 3-6, Tiparp knockout mice treated with 3-MC also consumed significantly less food than their wildtype counterpart. This indicated that there were no differences between the groups in daily food intake, with the exception of the 3-MC-treated Tiparp knockout mice which exhibited reduced food intake after treatment. In female mice, data were variable and significance was only detected on day 2 (P<0.05) for the 3-MC-treated Tiparp knockout mice where food consumption was significantly less than that of the Tiparp knockout CO control (Figure 12B). Although the food intake data in female mice across the 6 days were variable, male 3-MC Tiparp knockout mice displayed a steady trend of decreased food consumption signifying hypophagia.

Figure 12. Daily male and female food intake measurements expressed as g/g of daily mouse body weight. Food intake was measured daily during the 6-day study. Data represent the mean ± SEM; n = 5 - 11. a: P < 0.05 repeated- measures two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 repeated measures two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.3 Serum ALT activity increased on day 3 in 3-MC-treated Tiparp knockout mice

Serum ALT activity, which is a measure of liver toxicity or liver injury, was increased on day 3 for both genders (Figure 13). In males treated with 3-MC (Figure 13A), Tiparp knockout mice expressed significantly higher levels of ALT in the serum on day 3 compared to baseline levels (P<0.0001), when compared to wildtype males treated with 3-MC on day 3 (P<0.0001), and when compared to Tiparp knockout CO control males on day 3 (P<0.0001). Day 6 ALT levels in the 3- MC-treated Tiparp knockout mice were significantly lowered when compared to day 3 (P<0.0001). The same significant differences were detected in the 3-MC-treated female mice (Figure 13B) as Tiparp knockout animals had higher ALT levels in the serum on Day 3 compared to baseline levels (P<0.0001), when compared to wildtype females treated with 3-MC on day 3 (P<0.0001), and when compared to Tiparp knockout CO control females on day 3 (P<0.0001). Additionally, 3-MC treated female Tiparp knockout mice had significantly lower levels when compared with day 3 animals (P<0.0001).

Figure 13. Serum ALT activity measured at baseline (prior to injection), Day 3, and Day 6 for males (A) and females (B). The data represent the mean ± SEM with an n = 4 – 12 (males) and n = 3 – 9 (females). a: P < 0.05 two- way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post- hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test, c: P < 0.05 two-way ANOVA comparison with the day before within groups (i.e. day where indicator is placed versus the day before) followed by a Tukey’s post-hoc-test. 55

3.2.4 Fluid characteristics in 6-day study mice

Similar to the fluid obtained in the survival study Tiparp knockout mice treated with 3-MC, the appearance of most samples collected were white, milky, and viscous (Table 5). However, some samples were also white and translucent (2 of 6 3-MC-treated Tiparp knockout mice). The triglyceride concentration and protein amounts were also assessed. As a result, the triglyceride content ranged from 322 – 1923mg/dL while protein levels ranged from 1.9 – 2.6g/dL. Fluid samples were smeared onto slides for the visualization of white blood cells using the Wright- Giemsa stain. A lymphocytic population was present, but the cellular composition would require further verification by, for example, flow cytometry. Collectively, the results obtained show that by day 6, 3-MC-treated Tiparp knockout mice were found with a build-up of fluid indicative of chylous ascites in humans. It was also evident from the Wright-Giemsa stain of the fluid that large clusters of suggested lymphocytes were present in the fluid (Figure 14).

Table 5. Characteristics of chylous ascites found in 6-day Tiparp knockout mice. Values for the clinical diagnosis of chylous ascites were adapted from Cárdenas and Chopra (2002).

Figure 14. Wright-Giemsa stain of ascitic fluid collected from the peritoneal cavity of 3-MC-treated Tiparp knockout males and females on day 6. Predominance of lymphocytes present, as noted by the deep-blue violet nuclear stain. A: 40X magnification, the scale bar represents 500μm; B: 200X magnification, the scale bar represents 100μm.

3.2.5 H&E of day 6 liver show moderate levels of inflammation in 3-MC-treated Tiparp knockout mice

Due to the high levels of serum ALT detected and the observed lethality of Tiparp knockout 3- MC-treated mice, we examined the histopathology of the liver to determine if there was any indication of liver toxicity or injury. Liver samples on day 6 were excised and harvested for tissue processing. Two sections of the liver were allocated for histology: the right posterior lobe and the left lateral lobe. Subsequent H&E staining of sections from the left lateral lobe of CO-treated animals displayed an intact architecture with no migratory immunological cells from the portal triad or the central vein (Figure 15). Wildtype males treated with 3-MC showed mild microvesicular steatosis as evidenced by vacuolated hepatocytes. In 3-MC-treated Tiparp knockout mice, there was an observed increase in the number of resident Kupffer cells in the 57 sinusoids signifying a mild inflammatory cell infiltration. All CO control groups displayed normal liver structure. However, upon examination of the sections collected from the right posterior lobe, areas of neutrophilic infiltration and encapsulating necrosis were found. The damage was most severe in areas covered by the unidentified white abscesses. The left lobe was considered to be a normal liver region unscathed by white globules, compared with the right lobe, where the origin of the leakage was noted to occur. Therefore, we compared the two regions in 3-MC-treated Tiparp knockout animals (Figure 16). In the right lateral lobe of the male, necrosis was apparent around the capsule of the liver. In the right lateral lobe of the female, dilation of the blood vessels was observed in the central vein of the lobules.

Figure 15. H&E-stained liver sections from wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6. 200X magnification. Scale bar represents 100 µm.

Figure 16. H&E-stained liver sections from Tiparp knockout mice treated with 100mg/kg 3-MC and euthanized on Day 6. Sections originate from two areas: the left medial and the right lateral lobe. The latter was observed to be coated in a white abscess. 40X magnification. Scale bar represents 100 µm.

3.2.6 Effects of 3-MC on lipid levels in the liver of males and females

Gross liver images from male wildtype CO- and 3-MC-treated mice as well as the Tiparp knockout CO control animals displayed a normal liver appearance with a rich red-brownish colouration. Interestingly, all male Tiparp knockout mice treated with 3-MC were found with white, lobular lesions encapsulating the organ. As indicated previously, the source of this white infiltrate appeared to originate from the right lobe due to a greater, white mass formed in the area. Occasionally, male wildtype mice treated with 3-MC displayed a very small, white droplet of lipid formation on the surface of the right liver lobe (data not shown). To investigate the involvement of the AHR in hepatic steatosis with 3-MC, liver sections from the left lateral lobe were isolated in OCT medium and processed under a cryosection. Subsequent Oil Red O staining was conducted to visualize neutral fats due to the solubility of the red dye. In liver histology assessed by Oil Red O staining, both wildtype and knockout CO-treated mice exhibited normal liver histology. Conversely, wildtype males treated with 3-MC show microvesicular fat accumulation around the central vein (Figure 17). This observation was also reported by Kawano et al. (2010) who observed lipid accumulation around the central vein when mice were injected with 100mg/kg 3-MC through the IP route. However, this was not observed in the 3-MC treated Tiparp knockout mice. Under bright-field microscopy, lipids appeared to coalesce on Glisson’s capsule of the liver lobe with slight infiltration of lipids around the perimeter. However, the liver interior and its hepatic lobules were not stained with the lipid-soluble dye indicating that the area beyond the liver capsule was lipid-free.

Similarly, analysis of gross liver images from male (Figure 17) and female (Figure 18) mice revealed the appearance of large, white lesions in 3-MC treated Tiparp knockout mice, while CO and 3-MC treated wildtype and CO-treated Tiparp knockout livers displayed normal liver structure and colouration. Histologically, liver sections extracted from wildtype and knockout mice treated with CO were negative for Oil Red O staining. However, wildtype mice treated with 3-MC exhibit microvesicular steatosis from the widespread staining, as indicated by the focal patches of red around the central vein or portal triad in the hepatic lobule. Similar to the males, Tiparp knockout females treated with 3-MC exhibited a coating of lipid on the liver capsule with an absent display of lipids within the liver lobule. These observations were consistent amongst all groups and between genders.

Figure 17. Gross liver structure and Oil Red O-stained liver sections from male wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6. 100X magnification. Scale bar represents 100 µm.

Figure 18. Gross liver structure and Oil Red O-stained liver sections from female wildtype and Tiparp knockout mice treated with corn oil or 100mg/kg 3-MC and euthanized on Day 6. 100X magnification. Scale bar represents 100 µm.

3.2.7 Liver, white adipose tissue, and brown adipose tissue weight

Since TCDD-treated mice display hepatomegaly with decreased fat stores as a result of fat mobilization towards the liver, whole liver, epididymal white adipose tissue from fat pads in the perigonadal region, and interscapular brown adipose tissue were removed for the analysis of tissue weights in this study (Tanos et al., 2012; Tuomisto et al., 1999). A two-way ANOVA with Tukey’s post-hoc multiple comparisons test was used to detect significant differences in tissue weights for males and females. Tissue weights were normalized to the body weight of the animal on the day of sacrifice.

Male, wildtype mice treated with 3-MC displayed a significantly greater increase in liver weight when compared with genotype-matched CO-controls (P<0.05) and also to 3-MC-treated Tiparp knockout mice (P<0.05), suggesting that the 3-MC wildtype mice exhibit hepatomegaly in the presence of TIPARP (Figure 19A). However, in females, both 3-MC-treated Tiparp wildtype and knockout mice possessed heavier liver weights when compared to their corresponding genotype- matched CO controls (p<0.0001 and p<0.005, respectively) (Figure 20A).

White adipose tissue extracted from the perigonadal region was weighed to represent the total WAT as epididymal fat is known as the largest depot of dissectible WAT (Cinti, 2005). 3-MC- treated Tiparp knockout males and females exhibit a significant decrease in WAT weight compared to Tiparp knockout CO controls (P<0.05 and P<0.05, respectively) (Figure 19B and Figure 20B).

Interscapular brown adipose tissue (BAT) was also extracted and weighed to determine if any changes occurred in this tissue-type. Tiparp 3-MC-treated knockout males display a significant decrease in BAT weights compared to their treatment-matched wildtype controls (P<0.01)(Figure 19C). Tiparp 3-MC-treated knockout females also display a significant decrease compared to their genotype-matched, CO controls (p<0.005) (Figure 20C).

Figure 19. Male liver, white adipose tissue, and brown adipose tissue weights expressed as a percentage of total body weight on day 6. White adipose tissue removed and collected exclusively from the perigonadal region. Data represent the mean ± SEM; with an n = 6 (liver) and n = 3 (WAT and BAT). a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

Figure 20. Female liver, white adipose tissue, and brown adipose tissue weight expressed as a percentage of total body weight on Day 6. White adipose tissue removed and collected exclusively from the perigonadal region. Data represent the mean ± SEM; with an n = 6 – 7 (liver) and n = 3 (WAT and BAT). a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.8 Hepatic gene expression of AHR target genes

Since TCDD-treated Tiparp knockout mice exhibit increased AHR-mediated target gene expression, we determined if 3-MC induces higher AHR activity in Tiparp knockout mice compared with wildtype by measuring hepatic Cyp1a1 and Cyp1b1 mRNA levels. When wildtype and Tiparp knockout male mice were treated with 3-MC, Cyp1a1 expression levels were significantly induced compared to their corresponding CO controls (P<0.005 and P<0.05, respectively)(Figure 21). However, in females, hepatic induction of Cyp1a1 mRNA levels was greatly increased in 3-MC-treated wildtype mice compared with genotype-matched CO controls and also when compared to Tiparp 3-MC-treated knockout mice (P<0.001 and P<0.05, respectively)(Figure 22).

In the analysis of Cyp1b1 induction, Tiparp knockout males treated with 3-MC significantly induced Cyp1b1 gene expression compared to the corresponding CO control (p<0.05). In females, significant increases were observed in both 3-MC-treated wildtype and Tiparp knockout mice when compared with the corresponding genotype-matched CO control mice (P<0.01 and P<0.05, respectively).

The gene expression of Tiparp mRNA was tested as a verification to the Tiparp knockout mouse model. This was verified as CO- and 3-MC-treated Tiparp knockout mice showed negligible expression of Tiparp when compared with wildtype mice administered CO and 3-MC (P<0.05 and P<0.0001, respectively). There was a ligand-induced expression of Tiparp in 3-MC-treated wildtype mice compared to CO-treated wildtype mice (P<0.001). Similarly in females, CO- and 3-MC-treated Tiparp knockout mice displayed lower expression levels of Tiparp mRNA when compared with their respective wildtype mice (P<0.05 and P<0.0001, respectively).

Cd36 mRNA expression levels were also investigated in the liver due to the involvement of CD36 in enhanced fatty acid uptake and hepatic steatosis as well as the report that Cd36 is an AHR target gene (Lee et al., 2010). In males, Tiparp 3-MC-treated knockout mice expressed significantly higher levels of Cd36 mRNA compared to its genotype-matched CO control (P<0.05). There were no significant differences detected in female mice in regards to Cd36 mRNA expression levels.

Figure 21. Male hepatic gene expression of classical AHR target genes, Tiparp, and Cd36. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

Figure 22. Female hepatic gene expression of classical AHR target genes, Tiparp, and Cd36. Data represent the mean ± SEM; n = 3 - 4 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.9 3-MC-dependent increases in hepatic cytokine expression levels in wildtype and Tiparp knockout mice

The AHR participates in immunity through its interactions with NF-κB and Stat proteins. Studies investigating dioxin-activated AHR signalling have observed broad effects such as thymocyte lineage differentiation, generation of inflammation, changes in immune cell populations, and aberrant cytokine secretion. In vivo sensitivities to dioxin include strong systemic immunosuppression of the multifaceted immune response. More recently, exposure to a high-dose of TCDD promoted a focal inflammatory infiltration and increased cytoplasmic clearing in hepatocytes that was seen in conjunction with steatosis, thereby eliciting dioxin-mediated steatohepatitis (Ahmed et al., 2015; Esser et al., 2009). Additionally, TCDD can induce greater amounts of ROS which can stimulate proinflammatory cytokine activation such as the induction of IL-6, IL-1β, TNFα, and TGFβ (Esser et al., 2009; Matsubara et al., 2012). As such, an increased 67 cytokine presence and inflammation along with lipid content in the liver would classify a case of steatohepatitis.

Thus, we investigated the effect of 3-MC on hepatic cytokine gene expression levels in wildtype and Tiparp knockout mice. Five notable cytokines were studied in this experiment. These include Il-1β, Il-6, Tnfα, Tgfβ, and Cxcl2. No significant differences were detected in the expression of Il- 1β, Tnfα, or Cxcl2 in male mice under a two-way ANOVA (Figure 23). Male 3-MC-treated Tiparp knockout mice expressed significantly higher levels of Il-6 compared to Tiparp knockout CO controls and 3-MC-treated Tiparp wildtype mice (P<0.05 and P<0.05, respectively). Similarly, male 3-MC-treated Tiparp knockout mice expressed increased levels of Tgfβ compared to genotype- and treatment-matched controls (P<0.01 and P<0.01, respectively). Although no significance was conferred for Cxcl2 due to variability between mice, there was a trend of increased expression in the Tiparp knockout 3-MC-treated mice.

No significant differences in the expression levels of Il-1β, Il-6, or Tnfα were observed in 3-MC treated female mice irrespective of genotype (Figure 24). Tiparp knockout females treated with 3-MC have a significantly increased level of Tgfβ compared to Tiparp knockout CO- and Tiparp wildtype 3-MC-treated mice (P<0.001 and P<0.01, respectively). Also, a significant increase in Cxcl2 expression was observed in the Tiparp knockout 3-MC-treated mice compared to genotype- and treatment-matched controls (P<0.01 and P<0.001, respectively).

Figure 23. Male hepatic gene expression of inflammatory cytokines. Data represent the mean ± SEM of inflammatory genes; n = 3. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3- MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

Figure 24. Female hepatic gene expression of inflammatory cytokines. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.10 Gene expression of AHR target genes in white adipose tissue

Although the liver is the main organ of drug metabolism in which the AHR is highly expressed, the expression and induction of XMEs also exists in extrahepatic locations such as white adipose tissue. To confirm if 3-MC-activated AHR activity was induced in WAT, AHR classical genes were investigated along with Tiparp expression. In males, 3-MC-treated Tiparp knockouts displayed a significantly increased level of Cyp1a1 expression compared to genotype- and treatment-matched controls (P<0.0001 and P<0.0001, respectively) (Figure 25). 3-MC-treated wildtype showed a significantly increased level of Cyp1a1 compared to Tiparp wildtype CO control (P<0.05). Only 3-MC-treated Tiparp knockout mice expressed higher Cyp1b1 mRNA expression levels when compared to genotype- and treatment-matched controls (P<0.001 and P<0.01, respectively). Tiparp mRNA levels were expressed in wildtype animals only, as wildtype CO- and 3-MC-treated animals have increased Tiparp expression levels when compared to their treatment-matched knockout counterparts (P<0.0001 and P<0.0001, respectively). As expected, 3- MC increased Tiparp mRNA levels in wildtype mice (P<0.001).

Similar trends were observed in females, as well. Tiparp knockout female mice treated with 3-MC have increased levels of Cyp1a1 mRNA compared to genotype- and treatment-matched controls (P<0.05 and P<0.0001, respectively) (Figure 26). As expected, in the absence of Tiparp repression on the AHR system, 3-MC-treated Tiparp knockout mice exhibited higher levels of Cyp1a1 mRNA in comparison to wildtype control (P<0.0001). Cyp1b1 mRNA expression levels were moderately increased in comparison to Tiparp knockout CO control mice (P<0.05). Tiparp knockout mice expressed negligible levels of Tiparp mRNA levels. 3-MC-treated wildtype mice displayed increased Tiparp mRNA expression levels compared to its treatment-matched knockout counterparts (P<0.05).

Figure 25. Gene expression of classical AHR target genes and Tiparp in white adipose tissue of male mice. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two- way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

Figure 26. Gene expression of classical AHR target genes and Tiparp in white adipose tissue of female mice. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype- matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.2.11 Lipolysis-associated genes in white adipose tissue

Due to the decrease in WAT weight in the Tiparp knockout mice treated with 3-MC, we suspected an increase of lipase enzyme activity present in WAT. Mobilization of fatty acids requires the presence of lipolytic enzymes such as hormone-sensitive lipase (HSL), lipoprotein lipase (LPL), and patatin-like phospholipase domain containing 2 (PNPLA2) (also known as adipose triglyceride lipase [ATGL]) in adipose tissue to shuttle degraded triacylglycerol throughout the body for energy homeostasis (Zimmermann et al., 2004). The expression of perilipin 1 (PLIN1) was also investigated as it encases lipid droplets as a protective measure against the lipolysis of stored triacylglycerol (Londos et al., 1995).

Male mice expressed significant changes in Pnpla2 and Hsl mRNA levels among groups but no significant difference was found for Lpl or Plin1 mRNA levels due to high variability in one of the Tiparp knockout CO controls (Figure 27). Male Tiparp knockout mice treated with 3-MC were observed to have greater expression levels of Pnpla2 compared with Tiparp knockout CO and wildtype 3-MC controls (P<0.01 and P<0.01, respectively). Pnpla2 encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. A similar trend was observed for Hsl as male 3-MC-treated Tiparp knockout mice exhibited higher Hsl mRNA levels compared with their genotype- and treatment-matched controls (P<0.05 and P<0.05, respectively).

For female mice, 3-MC-treated Tiparp knockout mice expressed higher mRNA levels of Pnpla2 when compared with genotype-matched CO and treatment-matched wildtype controls (Figure 28). No significant differences were observed for Lpl, Plin1, or Hsl in 3-MC-treated wildtype or Tiparp knockout mice. However, there was an increasing trend for Hsl expression in 3-MC treated Tiparp knockout mice compared with genotype-matched CO controls (P=0.0566).

Figure 27. Expression of lipolytic genes and the triacyglycerol-protective Plin1 in the white adipose tissue of male mice. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

Figure 28. Expression of lipolytic genes and the triacylglycerol-protective Plin1 in the white adipose tissue of female mice. Data represent the mean ± SEM; n = 3 for all genes. a: P < 0.05 two-way ANOVA comparison between genotype-matched corn oil- and 3-MC-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.3 6-Day Study with the Antagonist, CH-223191 (CH)

Due to the observed effects from the studies in both CO- and 3-MC-treated wildtype and knockout mice, we conducted a follow-up 6-day study with a co-treatment of CH and 3-MC in female mice only. This was also done to assess if the fluid production was mediated through a 3-MC-induced AHR-dependent pathway, since 3-MC may bind other receptors and activate other systems as well. All animals were given three IP injections, two on day 0 and one on day 3. Treated mice received an initial dose of 10mg/kg CH at an equivalent volume to body weight (i.e. a 20g mouse would receive 20μL); 4 hours later, these mice were injected with a single dose of 3-MC at 100mg/kg. Seventy-two hours later, mice were bled prior to the second administration of 10mg/kg CH. Control animals followed the same dosing regimen; however, these mice were injected with DMSO instead of CH. All animals were euthanized on day 6 for tissue and fluid collection. A timeline of the study procedures is provided in Figure 29. CH is a synthetic AHR antagonist that inhibits TCDD-induced AHR-dependent transcription. Previous in vivo studies have observed that CH-223191 co-treatment with AHR agonists resulted in reduced DNA binding of the AHR/ARNT heterodimers with reduced Cyp1a1 mRNA expression level and activity (Kim et al., 2006).

Figure 29. Study outline of the 6-day antagonistic study in wildtype and Tiparp knockout mice treated with CH- 223191 (10mg/kg) or DMSO and 3-MC (100mg/kg). Mice were monitored daily for the duration of this experiment along with daily body weight and food intake measurements. Blood was collected before 3-MC treatment on day 0, and subsequently on day 3 and 6. All groups were euthanized on day 6 and liver, WAT, and fluid samples (if applicable) were collected for subsequent analyses.

3.3.1 Fluid characteristics in 6-day mice co-treated with 3-MC and CH or DMSO

Biochemical analyses, such as the triglyceride or protein content, were conducted on the fluid of the female mice from this study (Table 6). The fluid samples found in 4 mice were variable in appearance – ranging from clear to white and milky. Other factors such as the triglyceride levels and protein amounts were also assessed in the fluid. CH-223191 appeared to have a ligand- mediated effect in the CH + 3-MC group as the number of cell populations were diminished or abolished when compared to the DMSO + 3-MC females (Figure 30). Furthermore, 2 of the 6 mice treated with CH + 3-MC did not produce fluid in the abdominal cavity, suggesting an observed inhibitory effect of CH on 3-MC-treated Tiparp knockout mice. Table 6 displays the results obtained from all the mice in the DMSO + 3-MC group and the 4 mice which produced fluid in the CH + 3-MC treatment group.

Table 6. Characteristics of chylous ascites found in 6-day Tiparp knockout mice treated with either DMSO + 3- MC or CH + 3-MC. Values for the clinical diagnosis of chylous ascites were adapted from Cárdenas and Chopra (2002).

Figure 30. Wright-Giemsa stain of ascitic fluid collected from the peritoneal cavity of DMSO or CH + 3-MC- treated female Tiparp knockout mice. Predominance of lymphocytes present in DMSO + 3-MC whereas no cells were found in the mucin-covered area of the CH + 3-MC mice. A: 40X magnification, the scale bar represents 500μm; B: 200X magnification, the scale bar represents 100μm.

3.3.2 CH-treated Tiparp knockout mice show no significant changes in body weight and slight fluctuations in food intake

To assess if 3-MC administration and its downstream physiological effects were truly AHR- dependent, female Tiparp wildtype and knockout mice were administered either CH + 3-MC as treatment, or DMSO + 3-MC as control. No differences were observed in body weight loss among the groups; however, all groups experienced a decline in body weight post-treatment (Figure 31A). The food intake measured in Tiparp knockout mice treated with DMSO + 3-MC was significantly less compared to wildtype DMSO + 3-MC-treated mice on day 4 (Figure 31B). This may be due to an increased sensitivity of Tiparp knockout mice to multiple injections such as the second DMSO injection on day 3 due to the possibility of their declining health. All groups experienced a decline in food intake post-treatment, as seen on day 1 and day 4.

Figure 31. CH + 3-MC female body (A) and food weights (B). Data represent the mean ± SEM; n = 5 – 6. a: P < 0.05 repeated-measures two-way ANOVA comparison between genotype-matched DMSO- and CH-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 repeated-measures two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.3.3 Inhibition of the expression of AHR target genes

The co-treatment of CH + 3-MC was hypothesized to reduce the AHR activation by 3-MC with the inhibitory effects of CH. As such, the expression levels of classical AHR genes were assessed. Cyp1a1 mRNA levels were significantly reduced in the Tiparp knockout CH + 3-MC females when compared to DMSO + 3-MC-treated Tiparp knockout mice and CH + 3-MC-treated wildtype mice (P<0.05 and P<0.05, respectively) (Figure 32). Correspondingly, Cyp1b1 expression levels were also greatly reduced in the Tiparp knockout females treated with CH + 3-MC in comparison to its genotype-matched DMSO + 3-MC control (P<0.05). Overall, this suggests that the CH co- treatment reduced the AHR-activation of Cyp1a1 and Cyp1b1 expression that was induced in the presence of 3-MC.

Figure 32. Female hepatic gene expression of AHR target genes. Data represent the mean ± SEM; n = 5 – 6. a: P < 0.05 two-way ANOVA comparison between genotype-matched DMSO- and CH-treated mice followed by a Tukey’s post-hoc test for multiple comparisons and b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test.

3.3.4 Co-treatment of CH + 3-MC reduced serum ALT activity on day 3

The ALT assay was conducted to assess if CH would reduce serum ALT levels measured on day 3 and 6 compared to DMSO-treated controls, and perhaps reduce the hepatotoxicity and damage inflicted by chemical exposure. As expected, Tiparp knockout females treated with the CH + 3- MC co-treatment had significantly lower ALT levels compared to Tiparp knockout mice treated with DMSO + 3-MC on day 3 (P<0.0001), but greater levels when compared to wildtype females treated with CH + 3-MC on day 3 (P<0.01) and compared to baseline levels within this group (P<0.001) (Figure 33). ALT levels measured from the CH + 3-MC-treated mice on day 6 was significantly lower than what was measured on day 3 (P<0.01). In the Tiparp knockout group treated with DMSO + 3-MC, higher levels of ALT were reported in this group compared to treatment-matched wildtype females on day 3 (P<0.0001) and when compared to baseline levels within the group (P<0.0001). Day 6 activity levels had substantially decreased when compared to day 3 in the Tiparp knockout group treated with DMSO + 3-MC (P<0.0001). Overall, co-treatment of CH + 3-MC reduced the amount of released ALT from the liver of the Tiparp knockout mice, indicating reduced hepatotoxicity compared with the DMSO + 3-MC-treated Tiparp knockout group.

Figure 33. Serum ALT activity measured at baseline (prior to injection), Day 3, and Day 6 for females treated with DMSO or CH + 3-MC. Data represent the mean ± SEM; n = 5 – 6. a: P < 0.05 two-way ANOVA comparison between genotype-matched DMSO- and CH-treated mice followed by a Tukey’s post-hoc test for multiple comparisons; b: P < 0.05 two-way ANOVA comparison between treatment-matched Tiparp wildtype and Tiparp knockout mice followed by a Tukey’s post-hoc test; and c: P < 0.05 two-way ANOVA comparison between days of treatment- and genotype-matched mice (i.e. day where indicator is placed versus the day before) followed by a Tukey’s post-hoc-test.

Chapter 4: Discussion

In our previous study by Ahmed et al. (2015), we investigated the effect of increased dioxin- induced sensitivities due to the loss of Tiparp, an AHR target gene that functions as a negative repressor of the AHR (MacPherson et al., 2013). The loss of Tiparp resulted in increased sensitivity to steatohepatitis and lethality when exposed to a high-dose of TCDD (100μg/kg). TCDD is a non- metabolizable and highly stable compound that is a member of the HAH group of compounds. In the current study, we exposed wildtype and Tiparp knockout mice to 100mg/kg of 3-MC, a synthetic model PAH that is a potent AHR ligand but is highly metabolized. We assessed the induction of AHR target genes, and a number of known AHR-ligand dependent toxic endpoints. Two unexpected and novel observations were noted in our study. The first, and perhaps the most stunning, was the observation that a single IP injection of 3-MC induced lethality between days 8 – 16 in Tiparp knockout mice. The second was the appearance and accumulation of a white, viscous fluid in the abdominal cavity which we have characterized to be chylous ascites with published clinical diagnostic factors derived from humans. We also co-treated mice with CH- 223191, a synthetic antagonist of the AHR, with 3-MC to determine if the presence of the fluid was a ligand-induced AHR-mediated effect and if AHR-activation by 3-MC could be inhibited with an antagonist. Although CH-223191 did not completely prevent the fluid accumulation in all mice, fluid was not observed in 1/3 of the treated Tiparp knockout animals. Additionally, a number of other 3-MC-dependent outcomes were reduced which supports a role for the AHR in mediating the 3-MC-induced fluid accumulation.

4.1 3-MC-induced weight loss in Tiparp knockout animals with reduced food intake

Body weight loss, cessation of weight gain, and hypophagia are hallmarks of TCDD-induced toxicity in laboratory animals. Dose-dependent decreases in body weight and feed intake are early markers of TCDD toxicity in vivo, which later manifested into more serious conditions such as wasting syndrome and metabolic disorders (Seefeld et al., 1984, Watson et al., 2014). Additionally, animal studies involving a high or lethal dose of TCDD generate progressive body weight loss and continuous decline in feed intake until death (Christian et al., 1986). Therefore, mice and feed were

85 weighed daily in the 6-day study to determine if exposure to 3-MC also elicits similar effects to TCDD-related treatments.

We show that both male and female Tiparp knockout mice treated with 3-MC show a moderate decrease in body weight compared with genotype-matched CO controls. Similarly, there was also a decrease in body weight loss compared to treatment-matched wildtype control, which indicates that 3-MC-treated Tiparp knockouts do not recover from the body weight loss experienced post- treatment and 3-MC-treated wildtype mice recovered body weight as the divergence between the two groups increased on day 2 to 6 for males, and day 4 to 6 for females. Perhaps body weight recovery in the Tiparp knockout mice treated with 3-MC can be achieved but this can also be confounded with the increase in fluid accumulation that was observed post-day 6. Overall, there is a ligand-induced effect which drives the loss of body weight and the cessation of further weight gain in a genotype-specific manner, since wildtype animals treated with 3-MC initially lose body weight but recover during the course of the study.

In the study by Maddox et al. (2008), BigBlue® Fisher 344 male rats were treated with 3-MC at 80mg/kg body weight as a positive control in a mutagenicity study. Although in this study, the animals were treated weekly for 4 weeks, the treated rats had an average of 172.9 ± 36.8g whereas CO-administered rats had an average weight of 245.1 ± 8.2g. Thus, treatment with 3-MC led to a reduction of weight gain, which may indicate some general health complications induced by the chemical (Maddox et al., 2008). Weight gain may also be inhibited due to a multitude of factors. For example, a set-point model for the regulation of body weight had been established previously to explain and provide a rationale for the TCDD-induced body weight loss and wasting syndrome (Seefeld et al., 1984; Tuomisto et al., 1999). Depending on the weight of the animal upon injection, TCDD or 3-MC treatment can decrease the body weight set-point and allow for chronic maintenance of this reduced weight without any adverse effects (Seefeld et al., 1984).

Food intake rates in the males correlate well with the loss in body weight, whereas females show more variability in food intake. Male Tiparp knockout mice treated with 3-MC show decreased food consumption in comparison with their genotype- and treatment-matched controls. Hypophagia is a well-known occurrence in animals treated with TCDD (Christian et al., 1986; Khan, 2012; Seefeld et al., 1984). It is a property of wasting syndrome and one of the several responses which contribute to mortality in TCDD-treated animals (Christian et al., 1986).

However, body weight loss in the 3-MC-treated Tiparp knockout mice is not substantial as losses are <10% of the baseline body weight (measured before injection) and is stable without any further drastic decrease. It cannot be concluded that 3-MC-treated Tiparp knockout mice experience wasting syndrome as TCDD-treated mice do, as body weight reductions are fairly moderate and are not characteristic of wasting syndrome. Although a high dose of 3-MC leads to body weight loss and reductions in food intake in Tiparp knockout mice, it does not confer the same extreme results as TCDD would in eliciting wasting syndrome and the correlated body loss and food reduction.

4.2 3-MC-treated Tiparp knockout mice exhibit hepatomegaly, but reduced WAT and BAT stores

TCDD-treated animals show a trademark condition of possessing an extremely enlarged liver due the accumulation of lipids with pronounced alterations in lipid metabolism (Fernandez-Salguero et al., 1996). Continuous increase in liver mass is due to lipid accumulation into what is known as fatty liver (Khan, 2012). Thus, we were interested in observing if the condition of hepatomegaly also manifests itself in 3-MC treated mice. Wildtype males treated with 3-MC had significantly greater liver weights compared with wildtype CO controls and 3-MC-treated Tiparp knockout mice. This may signify that the liver of the 3-MC-treated wildtype males is steatotic due to fat accumulation in hepatocytes. Other causes of hepatomegaly can be considered (e.g. hypertrophy and hyperplasia of parenchymal cells), but this increase in weight gain is most likely from the accumulation of lipids in the wildtype mice treated with 3-MC in comparison to the lipid-free liver of the 3-MC-treated Tiparp knockout males.

The epididymal white adipose tissue levels from the perigonadal fat pads were also assessed for their abundance and weight. This was done since TCDD-treated mice exhibit reduced stores due to excessive fat mobilization in the state of hypophagia (Khan, 2012). In addition, the steatotic effect of prolonged AHR-activation most likely occurs due to peripheral fat mobilization towards the liver (Lee et al., 2010). Both male and female 3-MC-treated Tiparp knockout mice had significantly less WAT in comparison to genotype-matched CO controls. Other studies have observed a similar effect. When guinea pigs are administered a single IP injection of 2μg/kg TCDD, no peripheral fat pads or epidydimal fat stores could be extracted or found. Similarly, subcutaneous WAT was also substantially depleted (Khan, 2012). It was noted that the lipolysis 87 of the stores resulted in increased free fatty acid concentrations in the blood, in which it is then used for lipoprotein synthesis (Khan, 2012; Swift et al., 1981). Overall, 3-MC-treated Tiparp knockout mice express reductions in visceral WAT similar to observations made with TCDD- treated animals.

The brown adipose tissue has not been an organ of focus in many TCDD-related studies; however, Rozman et al. (1986) suggested that BAT is actually a target of TCDD-toxicity and the destruction of this tissue leads to energy imbalance which leads to additional pressures on the animal to regulate body temperature through greater energy production. The inefficient use of energy has also been suggested to be a cause of wasting syndrome (Rozman et al., 1986). Results show that interscapular BAT was significantly reduced in Tiparp knockout males and females treated with 3-MC. A significant decrease in the male BAT was detected in Tiparp knockout 3-MC-treated mice when compared with the treatment-matched wildtype. In females, lower BAT weights were obtained from the Tiparp knockout 3-MC-treated mice compared to genotype-matched CO controls. To extrapolate on this, males experience a genotype-dependent difference whereas females were shown to have a ligand-dependent effect, although additional animals will be required to reinforce the data.

4.3 AHR-target genes

As 3-MC is a highly potent and prototypical PAH of the AHR, the classical AHR target genes were assessed in a gene expression assay to elucidate 3-MC-mediated induction levels compared to CO controls. Expression levels of Tiparp were assessed to provide confirmation of our Tiparp wildtype and knockout animals in the presence of 3-MC and CO. Additionally, Cd36 was a gene of interest as CD36 expression leads to enhanced fatty acid uptake. In a study by Lee et al. (2010) to investigate the role of AHR in mediating steatosis, a Cd36 knockout mouse was found to inhibit the steatotic effect of an AHR agonist. Furthermore, Ahr knockout animals fed on a high-fat diet were protected from obesity and hepatic steatosis due to lower levels of Cd36 – which reduced the entry of fat into the liver (Xu et al., 2015). This suggests that there is a link between fatty liver and the expression of CD36, and the latter could be a target of interest for future therapeutics (Lee et al., 2010).

Male 3-MC-treated Tiparp knockout mice significantly show an increased expression of hepatic Cyp1a1 and Cyp1b1 mRNA levels compared with CO controls. Additionally, 3-MC-treated Tiparp wildtype males expressed increased Cyp1a1 mRNA levels compared to the respective CO control. In females, Cyp1a1 mRNA levels are greatly induced in 3-MC-treated Tiparp wildtype mice when compared to genotype- and treatment-matched controls. The greater increase in Cyp1a1 observed in the 3-MC-treated wildtype mice was not observed in the previous study with TCDD (Ahmed et al., 2015) which indicates that 3-MC-induced AHR activity, in addition to the presence of TIPARP, creates a synergistic effect with another mediator in the system to produce a heightened expression of Cyp1a1. Another proposed reason would be the ability of 3-MC to elicit a greater inducibility of CYP1A1, as 3-MC and other PAHs are known inducers of XMEs through the AHR pathway (N’Guyen et al., 2002). A study by Iba et al. (2006) demonstrated the effects of cigarette smoke and wood smoke, and how both substances differed in their ability to induce pulmonary Cyp1a1 levels. Thus, it may also be a ligand-independent effect that is observed with 3-MC and not TCDD where both wildtype and Tiparp knockout mice express extremely high levels of Cyp1a1. Previously in our lab, it was determined that ERα can upregulate Tiparp expression, and in turn, TIPARP can repress ERα signalling (Rajendra, 2013). Han et al. (2005) also suggested that cigarette smoke extract-stimulated ERα can regulate both CYP1A1 and CYP1B1 at the translational and transcriptional level, respectively, in the lungs. Since 3-MC is a well-known estrogenic compound and this effect is only observed in females, perhaps there is a molecular interaction among TIPARP, AHR, and ERα may lead to the increased induction in Cyp1a1 of 3-MC-treated Tiparp wildtype compared to Tiparp knockout females. An increase in Cyp1b1 was observed in the male 3-MC-treated Tiparp knockout mice compared to CO controls. However, Cyp1b1 mRNA levels were increased in both 3-MC-treated groups in the females when compared to their respective CO control. However, when analyzing the expression levels of Cd36 in hepatic tissue, only male 3-MC-treated Tiparp knockout mice displayed a significant difference of increased Cd36 expression when compared to CO controls. Although transcripts levels of this gene are expressed, a different phenotype is observed in the liver sections stained with Oil red O. A greater increase in Cd36 mRNA levels would suggest increased uptake and intracellular transport of fatty acids into the hepatocytes and contribute to fat accumulation in the liver. However, it may also be that Cd36 protein was not translocated to the plasma membrane to exert its effects as a fatty acid transporter (Miquilena-Colina et al., 2011). Therefore, protein levels will need to be determined since transcript levels do not always correspond with protein expression (Koussounadis et al., 2015; Vogel and Marcotte, 2012).

4.4 3-MC-induced inflammation of the liver

TCDD exposure results in inflammation in the liver and such activation can also trigger liver injury to stimulate a proinflammatory cytokine profile (Matsubara et al., 2012). Although the presence of 3-MC in the biological system is transient, certain inflammatory markers have not been previously investigated with exposure to 3-MC. Among the numerous cytokines assessed, Il-6 and Tgfβ was increased in male 3-MC-treated Tiparp knockout mice in comparison to genotype- and treatment-matched controls. Although Il-6 was not significant in females, Cxcl2 and Tgfβ were both significantly increased in 3-MC-treated Tiparp knockout females in comparison to genotype- and treatment-matched controls. In summary, Tiparp knockout mice consistently expressed higher levels of selected hepatic cytokines.

In commonality between the two genders, Tgfβ, is the gene that is significantly expressed. Induction of Il-6 and Tgfβ expression is dependent on the presence of AHR and ARNT expression in the liver and is most likely from resident macrophages, known as Kupffer cells (Matsubara et al., 2012; Vaquero et al., 2011). Other studies note that the AHR is highly implicated in Treg through antigen-presenting DCs. Ligand-activated AHR regulates the expression of certain cytokines and this cytokine milieu determines Treg/TH17 cell balance and differentiation. TGFβ induces Treg differentiation while the presence of IL-6 leads to TGFβ-dependent TH17 cell production and as such, AHR-mediated transcriptional changes can affect T-cell activation but requires both cytokines (Nguyen et al., 2013; Stevens et al., 2009; Stockinger et al., 2011).

Interestingly, AHR knockout native T-cells were noted to fail in differentiating to the TH17 subset with exposure to IL-6 and TGFβ (Nguyen et al., 2013). Overall, this may suggest that 3-MC- treated Tiparp knockout males possess an induced population of TH17 cells in the liver due to the combined expression of Il-6 and Tgfβ, whereas female 3-MC-treated Tiparp knockout mice possess a predominant population of Treg cells due to the sole increased expression of Tgfβ (Veldhoen et al., 2008).

4.5 Gene expression of AHR target genes and lipolytic enzymes in epididymal WAT

Due to the excessive mobilization of visceral white adipose tissue from TCDD-treated Tiparp knockout mice, we isolated WAT to examine if there was an increased expression in lipolytic 90 genes owing to the increased disposition of fat stores. 3-MC-treated Tiparp knockout mice from both genders exhibited a significantly higher expression in Cyp1a1 mRNA levels when compared to both genotype- and treatment-matched controls. Additionally, 3-MC-treated Tiparp wildtype mice also had an increased expression of Cyp1a1 when compared to CO controls. Cyp1b1 mRNA levels were also elevated in 3-MC-treated Tiparp knockout mice and was significant against genotype- and treatment-matched controls in males, and a significant difference between genotype-matched CO female controls.

In the analysis of the lipolytic genes which are proposed to participate in lipase activity, male Tiparp knockout mice treated with 3-MC are shown to have increased expression levels of both Pnpla2 and Hsl – two genes implicated in the triacylglycerol hydrolysis pathway. Female 3-MC- treated Tiparp knockout mice only show a significant differences in Pnpla2 expression. PNPLA2, also known as ATGL, and HSL are the major lipases that act in cooperation for the mobilization of free fatty acids from adipose triacylglycerol (TG) stores in WAT (Schweiger et al., 2006; Zimmermann et al., 2004). Both enzymes have specific catabolic activities and together, they are accountable for more than 95% of the lipase activity present in murine WAT (Schweiger et al., 2006). In periods of energy demand, TG is hydrolyzed to free fatty acids (FFAs) which is then released into the circulation. PNPLA2 catalyzes the first step in the hydrolysis of triacylglycerol which results in the release of FFA and diacylglycerol, and this is considered the rate-limiting step of the reaction (Schweiger et al., 2006). HSL was considered as the first enzyme in the cascade but it is now known as the second participant as it is more important as a diacylglycerol hydrolase than a triacylglycerol lipase (Haemmerle et al., 2006; Kraemer and Shen, 2002). Other lipases such as triacylglycerol hydrolase (TGH) and TGH2, which has high homology to TGH, are both major adipocyte lipases. They are both capable of hydrolyzing TG but are more efficient in hydrolyzing substrates with short-chain fatty acids (Schweiger et al., 2006). Ultimately, TG catabolism of adipose tissue is required for the use of glucose as metabolic fuel. Pnpla2 and Hsl deficient mice develop complications such as glucose tolerance, increased insulin sensitivity, and decreased availability of FFA (Haemmerle et al., 2006). Both enzymes are required for a homeostatic balance in lipase activity, and in the case of the males, increased expression of each enzyme was found in the 3-MC-treated Tiparp knockout mice supporting the observation of reduced epididymal WAT present in the perigonadal area.

4.6 Increased serum ALT enzyme activity in males and females with moderate levels of hepatic inflammation

Serum ALT was measured as a marker of hepatotoxicity and liver injury where baseline levels are noted to be between 15 – 30U/L and values greater than 100U/L are deemed biologically significant. This assay demonstrated that 3-MC-exposed Tiparp knockout mice experienced chemically-induced liver toxicity. Both male and female 3-MC-treated Tiparp knockout mice display significantly increased levels of ALT on day 3, with an observed significant decrease on day 6. Females appear to be protected against the toxic insult as ALT activity in the males are 2.7- fold greater in comparison on day 3. However, ALT activity measured in 3-MC-treated Tiparp knockout mice do not parallel the levels obtained from TCDD-treated Tiparp knockout males, as the ALT activity measured from TCDD-treated mice can be upwards of ~2000U/L signifying that 3-MC-treated Tiparp knockout mice experienced moderate liver toxicity (Ahmed et al., 2015).

In both males and females, 3-MC Tiparp knockout mice did not survive the 30-day survival study. On the contrary, all male and female 3-MC-treated wildtype mice survived the 30-day study. This is an unreported and unexpected phenomenon and suggests that Tiparp knockout mice are more sensitive to the toxicities of 3-MC which brings the importance of TIPARP as a mediator of ligand- induced AHR toxicity. However, due to the minor inflammatory response seen in the liver, the assessment of cytokine mRNA expression levels, and measured ALT levels, the cause of death is unlikely to be attributed to hepatotoxicity. From the gross morphology of the liver tissue, it is apparent that all Tiparp knockout mice treated with 100mg/kg 3-MC retained a white substance on its apical surface. The qualitative severity of its coverage increased in the survival curve mice (day 8 – 16) compared to the Tiparp knockout mice sacrificed during the 6-day study. This suggests this phenotype is exacerbated by a downstream process of the AHR or via another molecular pathway that is currently unknown.

As seen in the Oil Red O staining, the liver interior of both wildtype and knockout CO-treated controls contained no indication of lipid accumulation. In stark contrast, the liver lobules of the male and female 3-MC-treated wildtype mice were flushed by the permeation of miniscule lipid droplets. Remarkably, 3-MC-treated Tiparp knockout mice do not display the same phenotype as their wildtype counterparts. Here, the lipids appear to be bound to the outer capsule and restricted from fully diffusing into the interior of the liver lobules. This suggests that the lipids do not traverse

92 through the bloodstream in the form of released FFA from TG stores, as it is evident that this is clearly due to the external coverage from the fluid accumulation.

4.7 Development of chylous ascites

The unexpected appearance of chylous fluid was observed in all 3-MC-treated Tiparp knockout mice. The appearance and texture of the collected fluid was white, viscous, and sticky; the range of the volume collected was approximately 0.2 – 1.05mL. We determined this was chylous due to its characteristic properties: high triglyceride content, predominantly lymphocytic, and high protein concentration. Chylous ascites is noted as a lymphatic anomaly and refers to the accumulation of lipid-rich lymph in the peritoneal cavity due to a number of etiologies (Al-Busafi et al., 2014; Brouillard et al., 2014). Primary causes include malignancies, cirrhosis of the liver, tuberculosis in developing countries, trauma to the abdomen, and as a negative outcome of post- operative procedures. In children, congenital abnormalities of the lymphatic system is the most common cause of chylous ascites (Al-Busafi et al., 2014). Specifically, the cause of chylous ascites is the disruption of the lymphatics through obstruction of lymph flow from the digestive tract to the cysterna chyli, impaired capacity of lacteals in the mucosa for absorption in the gut, exudation of lymph fluid through the lymphatic vessels, increase in hepatic venous pressure, or cardiovascular disease (Cárdenas and Chopra, 2002). Management of chylous ascites in the clinical setting requires a change in diet to a low-fat, high-protein plan to reduce the production of chyle formation, which may coincide with paracenteses if symptoms do not resolve. This may also include a pharmacological intervention of somatostatins (Man and Spitz, 1985). If such non- invasive procedures are ineffective, surgical procedures to ligate the leaking lymphatics, initiate peritoneovenous shunting, or removal of the offending lesion are other options for improvement of the condition (Mishin et al., 2009; Talluri et al., 2011).

In the 3-MC-treated Tiparp knockout mice, all tissues in the peritoneal cavity were bathed in this fluid and careful measures were taken to collect the chylous fluid. It is unknown if the production of this chylous fluid is due to obstruction of the lymphatics or a defect in dietary and endogenous lipid absorption and metabolism. It is certainly a consequence of the deletion of Tiparp and the subsequent exposure to a high-dose of 3-MC, as this anomaly only appears in knockout mice treated with 3-MC. However, to determine the exact molecular pathways involved will require future studies to fully understand this complex mechanism of action. 93

4.8 CH and 3-MC co-treatment: antagonism of the ligand- induced AHR

A ligand-selective antagonist known as CH-223191, which is specified to inhibit the binding of TCDD to the AHR, was utilized in this study at a concentration of 10mg/kg BW and administered through the IP route twice in conjunction with a single IP dose of 3-MC at 100mg/kg (Kim et al., 2006). This was a short-term study to determine if the chylous effusion observed in the abdominal cavity was a direct effect of AHR-mediated signalling, then we would expect that CH would reduce the severity or number of animals experiencing chylous ascites. Two out of the six Tiparp knockout mice co-treated with CH + 3-MC did not show any evidence of chylous ascites and as a result no volume was collected from them. The chylous fluid present in the other CH + 3MC co-treated Tiparp knockout mice was found in variable amounts and the appearance also varied among the animals. A few females possessed the typical white, milky fluid whereas other females would produce exudate that was clear, yellowish, and less viscous. This would suggest the fluid produced in the subset of mice was ascitic in nature, but no longer chylous by observation. The common constituents of chyle includes protein, lymphocytes, immunoglobulins, and lipids in the form of chylomicrons – the latter which gives chylous fluid its white, milky appearance and high triglyceride content (Al-Busafi et al., 2014). Due to the complete resolution of chylous ascites, the absence of large populations of lymphocytes, and the change in the appearance of the fluid, this provides evidence that the production of chylous ascites is to some degree mediated by AHR activation. Limitations

One of the limitations of this study is whether or not all downstream events are mediated by the parent 3-MC compound or by several of its metabolites. Although 3-MC is a synthetic PAH that is used widely in many carcinogenicity and toxicology studies, many authors prefer to use other AHR ligands such as PCB due to its resistance against rapid metabolism and degradation. On the contrary, 3-MC may be converted to a number of hydroxylated metabolites. 3-MC is known to directly activate ERα but the generated metabolites may be more estrogenic than the parent compound; thus, the issue of using 3-MC could lead to the added activation of the ER pathway as well as the AHR (Abdelrahim et al., 2006). From this, it would be difficult to elucidate the ligand-

94 induced signalling cascade initiated, how much of an activated pathway was induced, and to propose causation by a specific receptor.

Completion of this study would require protein levels to be elucidated, as studies based purely on mRNA expression data cannot make assumptions that changes in gene expression are biologically relevant. Gene transcript levels do not always correlate with protein expression levels since a discrepancy can arise from other levels of regulation between transcription and translation. This creates a concern for inferences to be made from mRNA expression data only (Koussounadis et al., 2015). Another technical limitation of the study is the lack of a larger set of animals per group. Although statistical analyses can be conducted with an n of 3, more animals would be required to create a more robust set of data to increase power and detect significance to draw conclusions from these interactions. For example, there were several genes of interest that had an observable trend but significance was not achieved due to variability in the dataset.

Lastly, the AHR antagonist used in this study is a novel, synthetic compound which potently inhibits TCDD-induced AHR-dependent signalling (Kim et al., 2006). However, CH acts in a ligand-dependent manner where it preferentially inhibits the ability of agonists such as TCDD and related HAHs, but not others such as PAHs, flavonoids, or indirubin (Choi et al., 2012; Zhao et al., 2010). In the study by Zhao et al. (2010), 12 other AHR agonists were used to examine the ability of CH to inhibit AHR-dependent luciferase reporter gene induction. CH antagonized the HAH-induced activation of the AHR only, but not the non-HAH agonists. This may be attributed to the halogenated side chains of the agonists, as even a halogenated flavonoid was antagonized by CH (Zhao et al., 2010). This preferred antagonism of CH was hypothesized based on its binding to the AHR ligand-binding domain (orthosteric site) or to an allosteric site where it changes the confirmation of the receptor; thus, excluding the binding of only a subgroup of AHR agonists – namely, those with halogenated functional groups (Choi et al., 2012). In light of this, the inhibitory action of CH may not have been completely effective in antagonizing the ligand-induced effects of the PAH, 3-MC, due to its specificity towards inhibiting HAH activity. However, CH is the most potent AHR antagonist without any agonistic potency until the synthesis of new, and more pharmacologically-effective antagonists become available (Choi et al., 2012).

Future Directions

We are just beginning to understand the Tiparp knockout mouse model but there are many other ligands; dosage and dose regimens; tissue-specific systems; and receptor-mediated pathways to investigate. As such, tissue-specific Tiparp knockout mice will be interesting to study in the future as we can investigate the different phenotypes elicited from the disruption of Tiparp in specific areas or cells. To address some of the open-ended questions of the current study, we will need to employ additional experiments and techniques to facilitate our results. To understand the etiology of chylous ascites, we may provide a non-absorbable tracer dye in rodent chow pellets to visualize whether the chylous fluid arises from dietary fat or from the mobilization of fat stores within the body (Flury and Flühler, 1994). Brilliant Blue FCF can be used as a dye tracer to use in food because the general toxicity is low and it will stain the soluble transport in the diet. Although caution must be exercised in using such a compound because it may lead to agonistic effects on the AHR system (Flury and Flühler, 1994). Alternatively, the assessment of lymph flow through the vessels can be made using Evan’s blue dye (Iolyeva et al., 2013). In addition to using a pharmacological agent to determine if chylous ascites is AHR-mediated, the ultimate test would be a genetically-based model: an Ahr-Tiparp double-knockout mouse model. The Ahr-Tiparp double-knockout mouse model would be ideal and fulfilling to elucidate the origin and cause of chylous ascites, but to understand the role of TIPARP in this response would be paramount.

Additionally, future avenues of research could evaluate lower doses of 3-MC and perhaps more frequent doses as well to simulate a more toxicologically relevant exposure level. Perhaps changing the route of administration to an oral gavage in mice would also assist in making such a study more relevant to humans as most of our exposure to PAHs are dietary. Although each of these suggestions would have their caveats, they are reasonable alternatives to add to the current study. In our laboratory, we have assessed the effects of two different AHR ligands, a HAH and a PAH, on the Tiparp knockout mouse. Moving away from exogenous ligands would be the next phase, as possible endogenous ligands such as DIM or Kyn could be used to elucidate the effect of Tiparp loss on the physiological function of the AHR.

Summary

This thesis characterized the sensitivity of Tiparp knockout mice to 3-MC, a prototypical PAH and potent AHR agonist. Wildtype and Tiparp knockout mice of both genders were treated with a single IP injection of 3-MC or CO. Mice were assessed initially in a 30-day survival study, followed by an acute 6-day study. Subsequently in another experiment, an AHR-specific antagonist known as CH-223191 was used to inhibit the effects established by 3-MC. Our goal was to explore body weight and food intake measurements; mRNA expression levels of classical AHR genes, lipolytic genes, and inflammatory genes of the liver and white adipose tissue; serum ALT levels; and the histopathological examination of liver sections stained with H&E and Oil Red O. An observable weight loss was seen in 3-MC-treated Tiparp knockout males and females; however, only male data in food intake correlated with the decrease in body weight. mRNA expression of AHR target genes show increased induction of Cyp1a1 and Cyp1b1 mRNA levels in 3-MC Tiparp wildtype and knockout mice. 3-MC-treated knockout mice display increased levels of Il-6, Cxcl2 and Tgfβ, signifying a preferable cytokine milieu for the expression of TH17 cells in the liver. In the WAT, the two major triacylglycerol hydrolase enzymes, Pnpla2 and Hsl, show increased gene expression which correlates with the loss of epididymal WAT in the perigonadal region. The H&E staining and serum ALT measurements provide a qualitative and quantitative assessment of mild hepatotoxicity. In the Oil Red O staining, 3-MC-treated wildtype mice possessed intrahepatic lipid accumulation whereas 3-MC-treated Tiparp knockout mice presented a lipid-lined capsule with no signs of intrahepatic lipid accumulation. Two unexpected phenomena occurred during the course of the study: 3-MC-treatment proved to be lethal in Tiparp knockout mice between day 8 to 16 and the presence of chylous ascites was found exclusively in the abdominal cavity of 3-MC-treated Tiparp knockout mice. Following this, the co-administration of CH-223191 and 3-MC in Tiparp knockout mice diminished the ligand-induced gene expression of hallmark AHR target genes, reduced the circulating levels of serum ALT, and decreased the immune cell infiltration in the fluid. Furthermore, a third of the CH + 3-MC treated Tiparp knockout mice did not display an accumulation of fluid. The overall significance of this study suggests that 3-MC-treated Tiparp knockout mice display a differential response based on ligand- dependent processes via the AHR-signalling pathway. Thus, the increased sensitivity to 3-MC- induced toxicity and lethality supports the role of TIPARP as an important negative regulator of AHR-mediated responses.

References

Abdelrahim M, Ariazi E, Kim K, Khan S, Barhoumi R, Burghardt R, Liu S, Hill D, Finnell R, Wlodarczyk B, Jordan VC, and Safe S (2006) 3-methylcholanthrene and other aryl hydrocarbon receptor agonists directly activate estrogen receptor α. Cancer Res 66: 2459 – 2467.

Ahmed S, Bott D, Gomez A, Tamblyn L, Rasheed A, Cho T, MacPherson L, Sugamori KS, Yang Y, Grant DM, Cummins CL, and Matthews J (2015) Loss of the mono-ADP-ribosyltransferase, Tiparp, increases sensitivity to dioxin-induced steatohepatitis and lethality. J Biol Chem 290: 16824 – 16840.

Ahmed S, Wang A, Celius T, and Matthews J (2014) Zinc finger nuclease-mediated knockout of AHR or ARNT in human breast cancer cells abolishes basal and ligand-dependent regulation of CYP1B1 and differentially affects estrogen receptor α transactivation. Toxicol Sci 138: 89 – 103.

Al-Busafi SA, Ghali P, Deschênes M, and Wong P (2014) Chylous ascites: evaluation and management. ISRN Hepatology: 1 – 10.

Amé JC, Spenlehauer C, and de Murcia G (2004) The PARP superfamily. BioEssays 26: 882 – 893.

Anger DL, Crankshaw DJ, and Foster WG (2006) Spontaneous appearance of uterine tumors in vehicle and 3-methylcholanthrene-treated Wistar rats. Reprod Toxicol 22: 760 – 764.

Aravind L (2001) The WWE domain: a common interaction module protein ubiquitination and ADP ribosylation. Trends Biochem Sci 26: 273 – 275.

Baba T, Mimura J, Gradin K, Kuroiwa A, Watanabe T, Matsuda Y, Inazawa J, Sogawa K, and Fujii-Kuriyama Y (2001) Structure and expression of the Ah receptor repressor gene. J Biol Chem 276: 33101 – 33110.

Barry G, Cook JW, Haslewood GAD, Hewett CL, Hieger I, and Kennaway EL (1935) The production of cancer by pure hydrocarbons – Part III. Proceedings of the Royal Society of London. Phil Trans R Soc B 117: 318 – 351.

Belenky P, Bogan KL, and Brenner C (2007) NAD+ metabolism in health and disease. Trends Biochem Sci 32: 12 – 19.

Bergander L, Wincent E, Rannug A, Foroozesh M Alworth W, and Rannug U (2004) Metabolic fate of the Ah receptor ligand 6-formylindolo[3,2-b]carbzaole. Chem Biol Interact 149: 151 – 164.

Berry CL (1985) Solitary “necrotic nodule” of the liver: a probably pathogenesis. J Clin Pathol 38: 1278 – 1280.

Bock KW and Köhle C (2006) Ah receptor: dioxin-mediated toxic responses as hints to deregulated physiologic functions. Biochem Pharmacol 72: 393 – 404.

Boyland E and Warren FL (1937) The induction of tumours by methylcholanthrene in two strains of mice. J Pathol Bacteriol 45: 171 – 177.

Bradfield CA, Kende AS, and Poland A (1988) Kinetic and equilibrium studies of Ah receptor- ligand binding: use of [125I]2-iodo-7,8-dibromodibenzo-p-dioxin. Mol Pharmacol 34: 229 - 237.

Bresnick E, Liebelt RA, Stevenson JG, and Madix JC (1967) The distribution of radioactivity within the hepatic cell after administration of lableled 3-methylcholanthrene. Cancer Res 27: 462 – 468.

Brouillard P, Boon L, and Vikkula M (2014) Genetics of lymphatic anomalies. J Clin Invest 124: 898 – 904.

Buu-Hoï NP (1964) New developments in chemical carcinogenesis by polycyclic hydrocarbons and related heterocycles: a review. Cancer Res 24: 1511 – 1523.

Cárdenas A and Chopra S (2002) Chylous Ascites. Am J Gastroenterol 97: 1896 – 1900.

Cinti S (2005) The adipose organ. Prostaglandins Leukotr Ess 73: 9 – 15.

Chen WV, Delrow J, Corrin PD, Frazier JP, and Soriano P (2004) Identification and validation of PDGF transcriptional targets by microarray-coupled gene-trap mutagenesis. Nat Genet 36: 304 – 312.

Choi EY, Lee H, Dingle RWC, Kim KB, and Swanson HI (2012) Development of novel CH223191-based antagonists of the aryl hydrocarbon receptor. Mol Pharmacol 81: 3 – 11.

Christian BJ, Inhorn SL, and Peterson RE (1986) Relationship of the wasting syndrome to lethality in rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 82: 239 - 255.

Corda D and Di Girolamo M (2003) Function aspects of protein mono-ADP-ribosylation. EMBO J 22: 1953 – 1958.

Denison MS and Nagy SR (2003) Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol 43: 309 – 334.

Denison MS, Soshilov AA, He G, DeGroot DE, and Zhao B (2011) Exactly the same but different: promiscuity and diversity in the molecular mechanisms of action of the aryl hydrocarbon (dioxin) receptor. Toxicol Sci 124: 1 - 22.

Diani-Moore S, Ram P, Li X, Mondal P, Youn DY, Sauve AA, and Rifkind AB (2010) Identification of the aryl hydrocarbon receptor target gene TiPARP as a mediator of suppression of hepatic gluconeogenesis by 2,3,7,8-tetrachlorodibenzo-p-dioxin and of nicotinamide as a corrective agent for this effect. J Biol Chem 285: 38801 - 38810.

Diani-Moore S, Zhang S, Ram P, and Rifkind AB (2013) Aryl hydrocarbon receptor activation by dioxin targets phosphoenolpyruvate carboxykinase (PEPCK) for ADP-ribosylation via 2,3,7,8- tetrachlorodibenzo-p-dioxin (TCDD)-inducible poly(ADP-ribose) polymerase (TIPARP). J Biol Chem 288: 21514 – 21525.

Dipple A (1995) DNA adducts of chemical carcinogens. Carcinogenesis 16: 437 – 41.

Dixon D, Yoshitomi K, Boorman GA, and Maronpot RR (1994) “Lipomatous” lesions of unknown cellular origin in the liver of B6C3F1 mice. Vet Pathol 31: 173 – 182.

Elmageed ZYA, Naura AS, Errami Y, and Zerfaoui M (2012) The poly(ADP-ribose) polyermases (PARPs): new roles in intracellular transport. Cell Signal 24: 1 – 8.

Esser C, Rannug A, and Stockinger B (2009) The aryl hydrocarbon receptor in immunity. Trends Immunol 30: 447 – 454.

Evans BR, Karchner SI, Allan LL, Pollenz RS, Tanguay RL, Jenny MJ, Sherr DH, and Hahn ME (2008) Repression of aryl hydrocarbon receptor (AHR) signaling by AHR repressor: role of DNA binding and competition for AHR nuclear translocator. Mol Pharmacol 73: 387 – 398.

Fazili IS, Jiang W, Wang L, Felix EA, Khatlani T, Coumoul X, Barouki R, and Moorthy B (2010) Persistent induction of chytochrome P4501A1 in human hepatoma cells by 3-methylcholanthrene: evidence for sustained transcriptional activation of the CYP1A1 promoter. J Pharmacol Exp Ther 333: 99 – 109.

Feijs KLH, Forst AH, Verheugd P, and LKhatlani T, Coumoul X, Barouki R, and Moorthy B (2010) Persistent induction of chytochrome mono(ADP-ribosyl)ation. Nat Rev Mol Cell Biol 13: 445 - 453.

Fernandez-Salguero PM, Hilbert DM, Rudikoff S, Ward JM, and Gonzalez FJ (1996) Aryl- hydrocarbon receptor-deficient mice are resistant to 2,3,7,8-tetrachlorodibenzo-p-dioxin-induced toxicity. Toxicol Appl Pharmacol 140: 173 – 179.

Fieser LF and Seligman AM (1935) The synthesis of methylcholanthrene. J Am Chem Soc 57: 942 – 946.

Fish DC, Demarais JT, Djurickovic DB, and Huebner RJ (1981) Prevention of 3- methylcholanthrene-induced fiborsarcomas in rats pre-inoculated with endogenous rat retrovirus. Proc Natl Acad Sci USA 78: 2526 – 2527.

Flaveny C, Reen RK, Kusnadi A, and Perdew GH (2008) The mouse and human Ah receptor differ in recognition of LXXLL motifs. Arch Biochem Biophys 471: 215 – 223.

Flury M and Flühler H (1994) Brilliant Blue FCF as a dye tracer for solute transport studies – a toxicological overview. J Environ Qual 23: 1108 – 1112.

Fukunaga BN, Probst MR, Reisz-Porszasz S, and Hankinson O (1995) Identification of functional domains of the aryl hydrocarbon receptor. J Biol Chem 270: 29280 – 29278.

Gibson BA and Kraus WL (2012) New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat Rev Mol Cell Biol 13: 411 – 424.

100

Gonzalez FJ and Fernandez-Salguero P (1998) The aryl hydrocarbon receptor studies using the AHR-null mice. Drug Metab Dispos 26: 1194 – 1198.

Haemmerle G, Lass A, Zimmermann R, Gorkiewicz G, Meyer C, Rozman J, Heldmaier G, Maier R, Theussl C, Eder S, Kratky D, Wagner EF, Klingenspor M, Hoefler G, and Zechner R (2006) Defective lipolysis and altered energy metabolism in mice lacking adipose triglyceride lipase. Science 312: 734 – 737.

Hakmé A, Wong HK, Dantzer F, and Schreiber V (2008) The expanding field of poly(ADP- ribosyl)ation reactions [Protein modifications: beyond the usual suspects' review series]. Eur Mol Bio Org 9: 1094 - 1100.

Han W, Pentecost BT, Pietropaolo RL, Fasco MJ, and Spivack SD (2005) Estrogen receptor alpha increases basal and cigarette smoke extract-induced expression of CYP1A1 and CYP1B1, but not GSTP1, in normal human bronchial epithelial cells. Mol Carcinogen 44: 202 – 211.

Hankinson O (1995) The aryl hydrocarbon receptor complex. Annu Rev Pharmacol Toxicol 35: 307 – 340.

Hardardóttir I, Doerrler W, Feingold KR, and Grünfeld C (1992) Cytokines stimulate lipolysis and decrease lipoprotein lipase activity in cultured fat cells by a prostaglandin independent mechanism. Biochem Biophys Res Commun 186: 237 – 243.

Henck JW, New MA, Kociba RJ, and Rao KS (1981) 2,3,7,8-tetrachlorodibenzo-p-dioxin: acute oral toxicity in hamsters. Toxicol Appl Pharmacol 59: 405 – 407.

Hosoya T, Harada N, Mimura J, Motohashi H, Takahashi S, Nakajima O, Morita M, Kawauchi S, Yamamoto M, and Fujii-Kuriyama Y (2008) Inducibility of cytochrome P450 1A1 and chemical carcinogenesis by benzo[a]pyrene in AhR repressor-deficient mice. Biochem Biophys Res Commun 365: 562 – 567.

Iba MM, Fung J, Chung L, Zhao J, Winnik B, Buckley BT, Chen LC, Zelikoff JT, and Koi YR (2006) Differential inducibility of rat pulmonary CYP1A1 by cigarette smoke and wood smoke. Mutat Res 606: 1 – 11.

International Agency for Research on Cancer (IARC) (1997) Polychlorinated dibenzo-para- dioxins and polychlorinated dibenzofurans. IARC Monogr Eval Carcinog Risks Hum 69: 1 – 631.

Iolyeva M, Aebischer D, Proulx ST, Willrodt AH, Ecoiffier K, Häner S, Bouchaud G, Krieg C, Onder L, Ludewig B, Santambrogio L, Boyman O, Chen L, Finke D, and Halin C (2013) Interleukin-7 is produced by afferent lymphatic vessels and supports lymphatic drainage. Blood 122: 2271 – 2281.

Jigyasi J and Kundu R (2014) Toxicity of low dose TCDD to body weight and glucose-6- phosphatase in liver and kidney cells of mice. Eur J Exp Biol 4: 273 - 277.

Jin Y, Miao W, Lin X, Pan X, Ye Y, Xu M, and Fu Z (2013) Acute exposure to 3- methylcholanthrene induces hepatic oxidative stress via activation of the Nrf2/ARE signaling pathway in mice. Environ Toxicol 29: 1399 – 408

101

Jones S (2004) An overview of the basic helix-loop-helix proteins. Genome Biol 5: 226.0 – 226.6.

Kanno Y, Takane Y, Izawa T, Nakahama T, and Inouye Y (2006) The inhibitory effect of aryl hydrocarbon receptor repressor (AhRR) on the growth of human breast cancer MCF-7 cells. Biol Pharm Bull 29: 1254 – 1257.

Karchner SI, Jenny MJ, Tarrant AM, Evans BR, Kang HJ, Bae I, Sherr DH, and Hahn ME (2009) The active form of human aryl hydrocarbon receptor (AHR) repressor lacks exon 8, and its Pro185 and Ala185 variants repress both AHR and hypoxia-inducible factor. Mol Cell Biol 29: 3465 – 3477.

Kawano Y, Nishiumi S, Tanaka S, Nobutani K, Miki A, Yano Y, Seo Y, Kutsumi H, Ashida H, Azuma T, and Yoshida M (2010) Activation of the aryl hydrocarbon receptor induces hepatic steatosis via the upregulation of fatty acid transport. Arch Biochem Biophys 504: 221 - 227.

Khan MAQ (2012) Controlled Release, Biochemical Effects of Pesticides, Inhbition of Plant Pathogenic Fungi (Volume 6 of Chemistry of Plant Protection) in Biochemical Effects of Pesticides on Mammals (eds. Bahadir M, Böger P, Buchenauer H, Eto M, Khan MAQ, Pfister G, and Sandmann G), Springer Science & Business Media: Berlin, Germany.

Kikuchi Y, Ohsawa S, Mimura J, Ema M, Takasaki C, Sogawa K, and Fujii-Kuriyama Y (2003) Heterodimers of bHLH-PAS protein fragments derived from AhR, AhRR, and Arnt prepared by co-expression in Escherichia coli: characterization of their DNA binding activity and preparation of a DNA complex. J Biochem 134: 83 – 90.

Kim SH, Henry EC, Kim DK, Kim YH, Shin KJ, Han MS, Lee TG, Kang JK, Gasiewicz TA, Ryu SH, and Suh PG (2006) Novel compound, CH-223191, prevents 2,3,7,8-TCDD-induced toxicity by antagonizing the aryl hydrocarbon receptor. Mol Pharmacol 69: 1871 – 1878.

Kleine H, Poreba E, Lesniewicz K, Hassa PO, Hottiger MO, Litchfield DW, Shilton BH, and Lüscher B (2008) Substrate-assisted catalysis by PARP10 limits its activity to mono-ADP- ribosylation. Mol Cell 32: 57 – 69.

Kondraganti SR, Muthiah K, Jiang W, Barrios R, and Moorthy B (2005) Effects of 3- methylcholanthrene on gene expression profiling in the rat using cDNA microarray analyses. Chem Res Toxicol 18: 1634 – 1641.

Koussounadis A, Langdon SP, Um IH, Harrison DJ, and Smith VA (2015) Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Sci Rep 5: 1 – 9.

Kraemer FB and Shen WJ (2002) Hormone-sensitive lipase: control of intracellular tri- (di)acylglycerol and cholesteryl ester hydrolysis. J Lipid Res 43: 1585 – 1594.

Kumar MB, Ramadoss P, Reen RK, Vanden Heuvel JP, and Perdew GH (2001) The Q-rich subdomain of the human AhReceptor transactivation domain is required for dioxin-mediated transcriptional activity. J Biol Chem 276: 42302 – 42310.

102

Kwon YW, Ueda S, Ueno M, Yodoi J, and Masutani H (2002) Mechanism of p53-dependent apoptosis induced by 3-methylcholanthrene involvement of p53 phosphorylation and p38 MAPK. J Biol Chem 277: 1837 – 1844.

Lee RT (2003) Lessons from lymph flow-guided vessel formation. Circ Res 92: 701 – 703.

Lee JH, Wada T, Febbraio M, He J, Matsubara T, Lee MJ, Gonzalez FJ, and Xie W (2010) A novel role for the dioxin receptor in fatty acid metabolism and hepatic steatosis. Gastroenterology 139: 653 – 663.

Li N and Chen J (2014) ADP-ribosylation: activation, recognition, and removal. Mol Cells 37: 9 - 16.

Londos C, Brasaemle DL, Gruia-Gray J, Servetnick DA, Schultz CJ, Levin DM, and Kimmel AR (1995) Perilipin: unique proteins associated with intracellular neutral lipid droplets in adipocytes and steroidogenic cells. Biochem Soc Trans 23: 611 – 615.

Ma Q (2002) Induction and superinduction of 2,3,7,8-tetrachlorodibenzo-p-dioxin-inducible poly(ADP-ribose) polymerase: role of the aryl hydrocarbon receptor/aryl hydrocarbon receptor nuclear translocator transcription activation domains and a labile transcription repressor. Arch Biochem Biophys 404: 309 – 316.

Ma Q, Baldwin KT, Renzelli AJ, McDaniel A, and Dong L (2001) TCDD-inducible poly(ADP- ribose) polymerase: a novel response to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Biochem Biophys Res Commun 289: 499 – 506.

MacPherson L, Ahmed S, Tamblyn L, Krutmann J, Förster I, Weighardt H, and Matthews J (2014) Aryl hydrocarbon receptor repressor and TiPARP (ARTD14) use similar, but also distinct mechanisms to repress aryl hydrocarbon receptor signaling. Int J Mol Sci 15: 7939 - 7957.

MacPherson L, Tamblyn L, Rajendra S, Bralha F, McPherson JP, and Matthews J (2013) 2,3,7,8- tetrachlorodibenzo-p-dioxin polymerase (TiPARP, ARTD14) is a mono-ADP-ribosyltransferase and repressor of aryl hydrocarbon receptor transactivation. Nuc Acids Res 41: 1604 - 1621.

Maddox C, Wang B, Kirby PA, Wang K, and Ludewig G (2008) Mutagenicity of 3- methylcholanthrene, PCB3, and 4-OH-PCB3 in the lung of transgenic BigBlue® rats. Environ Toxicol Pharmacol 25: 260 – 266.

Malins DC, Anderson KM, Gilman NK, Green VM, Barker EA, and Hellström KE (2004) Development of a cancer DNA phenotype prior to tumour formation. Proc Natl Acad Sci USA 101: 10721 – 10725.

Man DWK and Spitz L (1985) The management of chylous ascites in children. J Pediatr Surg 20: 72 – 75.

Marshall NB and Kerkvliet NI (2010) Dioxin and immune regulation: emerging role of aryl hydrocarbon receptor in the generation of regulatory T cells. Ann N Y Acad Sci 1183: 25 – 37.

103

Matsubara T, Tanaka N, Krausz KW, Manna SK, Kang DW, Anderson ER, Luecke H, Patterson AD, Shah YM, and Gonzalez FJ (2012) Metabolomics identified an inflammatory cascade involved in dioxin- and diet-induced steatohepatitis. Cell Metab 16: 634 – 644.

Matthews J (2013) Alternative negative feedback control in the aryl hydrocarbon receptor signaling pathway. J Drug Metab Toxicol 4: e116.

Mavoridis PC and Palmeter ND (2012) Regulated Chemicals Directory 1995 in Part B. Regulatory Summaries, Springer Science & Business Media: New York, USA.

Miksztowicz V, Lucero L, Zago V, Cacciagiú L, Lopez G, Gonzalez-Ballerga E, Sordá J, Fassio E, Schreier L, and Berg G (2012) Hepatic lipase activity is increased in non-alcoholic fatty liver disease beyond insulin resistance. Diabetes Metab Res Rev 28: 535 -541.

Mimura J, Ema M, Sogawa K, and Fujii-Kuriyama Y (1999) Identification of a novel mechanism of regulation of Ah (dioxin) receptor function. Genes Dev 13: 20 – 25.

Mimura J and Fujii-Kuriyama Y (2003) Functional role of AHR in the expression of toxic effects by TCDD. Biochim Biophys Acta 1619: 263 – 268.

Miquilena-Colina ME, Lima-Cabello E, Sánchez-Campos S, García-Mediavilla MV, Fernández- Bermejo M, Lozano-Rodríguez T, Vargas-Castrillón J, Buqué X, Ochoa B, Aspichueta P, González-Gallego J, and García-Monzón C (2011) Hepatic fatty acid translocase CD36 upregulation is associated with insulin resistance, hyperinsulinaemia and increased steatosis in non-alcoholic steatohepatitis and chronic hepatitis C. Gut 60: 1394 – 1402.

Mishin I, Ghidirim G, and Vozian M (2009) Acute spontaneous chylous peritonitis: report of a case. J Gastrointestin Liver Dis 19: 333 – 335.

Mitchell KA and Elferink CJ (2009) Timing is everything: consequences of transient and sustained AhR activity. Biochem Pharmacol 77: 947 – 956.

Moorthy B (2000) Persistent expression of 3-methylcholanthrene-inducible cytochromes P4501A in rat hepatic and extrahepatic tissues. J Pharmacol Exp Ther 294: 313 – 322.

Mullen Grey AK and Riddick DS (2011) The aryl hydrocarbon receptor pathway and the response to 3-methylcholanthrene are altered in the liver of adrenalectomized rats. Drug Metab Dispos 39: 83 – 91.

Nebert DW and Karp CL (2008) Endogenous functions of the aryl hydrocarbon receptor (AHR): intersection of cytochrome P450 1 (CYP1)-metabolized eicosanoids and AHR biology. J Biol Chem 283: 36061 – 36065.

N’Guyen QB, Fallone F, Seree E, Fina F, Villard PH, Guigal N, De Meo M, Lacarelle B, Martin PM, and Barra Y (2002) Serum increases CYP1A1 induction by 3-methylcholanthrene. Biochem Biophys Res Commun 297: 249 – 254.

Nguyen LP and Bradfield CA (2008) The search for endogenous activators of the aryl hydrocarbon receptor. Chem Rest Toxicol 21: 102 – 116.

104

Nguyen NT, Hanieh H, Nakahama T, and Kishimoto T (2013) The roles of aryl hydrocarbon receptor in immune responses. Int Immunol 25: 335 – 343.

Olson JR, Holscher MA, and Neal RA (1980) Toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the Golden Syrian Hamster. Toxicol Appl Pharmacol 55: 67 – 78.

Park HR, Yang H, Kim GD, Son GW, and Park YS (2014) Microarray analysis of gene expression in 3-methylcholanthrene-treated human endothelial cells. Mol Cell Toxicol 10: 19 – 27.

Pierre S, Chevallier A, Teixeira-Clerc F, Ambolet-Camoit A, Bui LC, Bats AS, Fournet JC, Fernandez-Salguero P, Aggerbeck M, Lotersztajn S, Barouki R, and Coumoul X (2014) Aryl hydrocarbon receptor – dependent induction of liver fibrosis by dioxin. Toxicol Sci 137: 114 – 124.

Pirkle JL, Wolfe WH, Patterson DG, Needham LL, Michalek JE, Miner JC, Peterson MR, and Phillips DL (1989) Estimates of the half-life of 2,3,7,8-tetrachlorodibenzo-p-dioxin in Vietnam Veterans of Operation Ranch Hand. J Toxicol Environ Health 27: 165 – 171.

Platten M, Litzenburger U, and Wick W (2012) The aryl hydrocarbon receptor in tumor immunity. Oncoimmunology 1: 396 – 397.

Pohjanvirta R, Korkalainen M, Moffat ID, Boutros PC, and Okey AB (2012) Toxicity of TCDD in The AH Receptor in Biology and Toxicology (ed. Pohjanvirta R), John Wiley & Sons: Hoboken, NJ, USA.

Poland A and Knutson JC (1982) 2,3,7,8-tetrachlorodibenzo-p-dioxin and related halogenated aromatic hydrocarbons: examination of the mechanism of toxicity. Annu Rev Pharmacol 22: 517 – 554.

Poland A and Glover E (1973) Comparison of 2,3,7,8-tetrachlorodibenzo-p-dioxin, a potent inducer of aryl hydrocarbon hydroxylase, with 3-methylcholanthrene. Mol Pharmacol 10: 349 – 359.

Quintana FJ, Basso AS, Iglesias AH, Kom T, Farez MF, Bettelli E, Caccamo M, Oukka M, and Weiner HL (2008) Control of Treg and TH17 cell differentiation by the aryl hydrocarbon receptor. Nature 453: 65 – 71.

Rajendra S (2013) The regulation of TiPARP by the aryl hydrocarbon receptor, the platelet-derived growth factor receptor, and the estrogen receptor alpha (Master’s dissertation). Retrieved from University of Toronto Libraries. (Accession No. 2013-12-10T17:20:46Z).

Rannug A, Rannug U, Rosenkranz HS, Winqvist L, Westerholm R, Agurell E, and Grafström AK (1987) Certain photooxidized derivatives of tryptophan bind with very high affinity to the Ah receptor and are likely to be endogenous signal substances. J Biol Chem 262: 15422 – 15427.

Reddy MV, Gupta RC, Randerath E, and Randerath K (1984) 32P-postlabeling test for covalent DNA binding of chemicals in vivo: application to a variety of aromatic carcinogens and methylating agents. Carcinogenesis 5: 231 – 243.

105

Riddick DS, Huang Y, Harper PA, and Okey A (1994) 2,3,7,8-tetrachlorodibenzo-p-dioxin versus 3-methylcholanthrene: comparative studies of Ah receptor binding, transformation, and induction of CYP1A1. J Biol Chem 269: 12118 – 12128.

Ridolfi R, Cozzolino R, Boscaino F, Malorni L, Canzanella S, Malorni A, Palmieri G, and Malorni L (2014) AHR (aryl hydrocarbon receptor) polymorphisms: a possible role in TCDD (dioxins)- AHR binding and carcinogenesis. Int J Biol Sci 6: 1916 - 9671.

Rihn BH, Bottin MC, Coulais C, Rouget R, Monhoven N, Baranowski W, Edorh A, and Keith G (2000) Genotoxicity of 3-methylcholanthrene in liver of transgenic Big Blue® mice. Environ Mol Mutagen 36: 266 – 273.

Rozman K, Pereira D, and Iatropoulos MJ (1986) Histopathology of interscapular brown adipose tissue, thyroid, and pancreas in 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-treated rats. Toxicol Appl Pharmacol 82: 551 – 559.

Ryu KW, Kim DS, and Kraus WL (2015) New facets in the regulation of gene expression by ADP- ribosylation and poly(ADP-ribose) polymerases. Chem Rev 115: 2453 – 2481.

Sato S, Shirakawa H, Tomita S, Ohsaki Y, Haketa K, Tooi O, Santo N, Tohkin M, Furukawa Y, Gonzalez FJ, and Komai M (2008) Low-dose dioxins alter gene expression related to cholesterol biosynthesis, lipogenesis, and glucose metabolism through the aryl hydrocarbon receptor- mediated pathway in mouse liver. Toxicol Appl Pharmacol 229: 10 - 19.

Seefeld MD, Corbett SW, Keesey RE, and Peterson RE (1984) Characterization of the wasting syndrome in rats treated with 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 73: 311 - 322.

Schmahl J, Raymond CS, and Soriano P (2007) PDGF signaling specificity is mediated through multiple immediate early genes. Nat Genet 39: 52 – 60.

Schmahl J, Rizzolo K, and Soriano P (2008) The PDGF signaling pathway controls multiple steroid-producing lineages. Genes Dev 22: 3255 – 3267.

Schmidt JV, Su GHT, Reddy JK, Simon MC, and Bradfield CA (1996) Characterization of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth and development. Proc Natl Acad Sci USA 93: 6731 – 6736.

Schreiber V, Dantzer F, Amé JC, and de Murcia G (2006) Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol 7: 517 – 528.

Schrenk D and Chopra M (2012) Dioxins and polychlorinated biphenyls in foods in Chemical Contaminants and Residues in Food (Schrenk D ed), Woodhead Publishing Limited: Cambridge, UK.

Schweiger M, Schreiber R, Haemmerle G, Lass A, Fledelius C, Jacobsen P, Tornqvist H, Zechner R, and Zimmermann R (2006) Adipose triglyceride lipase and hormone-sensitive lipase are the major enzymes in adipose tissue triacylglycerol catabolism. J Biol Chem 281: 40236 – 40241.

106

Shepherd NA and Lee G (1983) Solitary necrotic nodules of the liver simulating hepatic metastases. J Clin Pathol 36: 1181 – 1183.

Shimada T (2006) Xenobiotic-metabolizing enzymes involved in activation and detoxification of carcinogenic polycyclic aromatic hydrocarbons. Drug Metab Pharmacokinet 21: 257 – 276.

Stevens EA, Mezrich JD, and Bradfield CA (2009) The aryl hydrocarbon receptor: a perspective or potential roles in the immune system. Immunology 127: 299 – 311.

Stockinger B, Hirota K, Duarte J, and Veldhoen M (2011) External influences on the immune system via activation of the aryl hydrocarbon receptor. Semin Immunol 23: 99 – 105.

Swift LL, Gasiewicz TA, Dunn GD, Soulé PD, and Neal RA (1981) Characterization of the hyperlipidemia in guinea pigs induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 59: 489 – 499.

Stellman JM, Stellman SD, Chrsitian R, Weber T, and Tomasallo C (2003) The extent and patterns of usage of Agent Orange and other herbicides in Vietnam. Nature 422: 681 – 687.

Talluri SK, Nuthakki H, Tadakamalla A, Talluri J, and Besur S (2011) Chylous ascites. N Am J Med Sci 3: 438

Tanooka H, Tanaka K, and Arimoto H (1982) Dose response and growth rates of subcutaneous tumors induced with 3-methylcholanthrene in mice and timing of tumor origin. Cancer Res 42: 4740 – 4743.

Tanos R, Murray IA, Smith PB, Patterson A, and Perdew GH (2012) Role of the Ah receptor in homeostatic control of fatty acid synthesis in the liver. Toxicol Sci 129: 372 - 379.

Tillmann T, Kamino K, Dasenbrock C, Germann PG, Kohler M, Morawietz G, Campo E, Cardesa A, Tomatis L, and Mohr U (1999) Ito cell tumor: immunohistochemical investigations of a rare lesion in the liver of mice. Toxicol Pathol 27: 364 – 369.

Trayhurn P and Wood IS (2004) Adipokines: inflammation and the pleiotropic role of white adipose tissue. Br J Nutr 92: 347 – 355.

Tuomisto JT, Pohjanvirta R, Unkila M, and Tuomisto J (1999) TCDD-induced anorexia and wasting syndrome in rats: effects of diet-induced obesity and nutrition. Pharmacol Biochem Behav 62: 735 – 742.

Uno S, Dalton TP, Sinclair PR, Gorman N, Wang B, Smith AG, Miller ML, Shertzer HG, and Nebert DW (2004) Cyp1a1(-/-) male mice: protection against high-dose TCDD-induced lethality and wasting syndrome, and resistance to intrahepatocyte lipid accumulation and uroporphyria. Toxicol Appl Pharmacol 196: 410 – 421.

Vasquez A, Atallah-Yunes N, Smith FC, You X, Chase SE, Silverstone AE, and Vikstrom KL (2003) A role for the aryl hydrocarbon receptor in cardiac physiology and function as demonstrated by AhR knockout mice. Cardiovasc Toxicol 3: 153 – 163.

107

Vaquero J, Riehle KJ, Fausto N, and Campbell JS (2011) Liver regeneration after partial hepatectomy is not impaired in mice with double deficiency of Myd88 and INFAR genes. Gastroenterol Res Pract 2011: 1 – 8.

Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier L, Renauld JC, and Stockinger B (2008) The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature 453: 106 – 110.

Vogel C and Marcotte EM (2012) Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet 13: 227 – 232.

Vyas S, Matic I, Uchima L, Rood J, Zaja R, Hay RT, Ahel I, and Chang P (2014) Family-wide analysis of poly(ADP-ribose) polymerase activity. Nat Commun 5: 1 - 13.

Wang Y, Wang Q, Wu B, Li Y, and Lu G (2013) Correlation between TCDD acute toxicity and aryl hydrocarbon receptor structure for different mammals. Ecotox Environ Safe 89: 84- 88.

Watson JD, Prokopec SD, Smith AB, Okey AB, Pohjanvirta R, and Boutros PC (2014) TCDD dysregulation of 13 AHR-target genes in rat liver. Toxicol Appl Pharmacol 274: 445 - 454.

Wolfe WH, Michalek JE, Miner JC, Pirkle JL, Caudill SP, Patterson DG, and Needham LL (1994) Determinants of TCDD half-life in veterans of Operation Ranch Hand. J Toxicol Environ Health 41: 481 – 488.

Xu CX, Wang C, Zhang ZM, Jaeger CD, Krager SL, Bottum KM, Liu J, Liao DF, and Tischkau SA (2015) Aryl hydrocarbon receptor deficiency protects mice from diet-induced adiposity and metabolic disorders through increased energy expenditure. Int J Obes 39: 1300 – 1309.

Xue X, Xiao Y, Zhu H, Wang H, Liu Y, Xie T, and Ren J (2008) Induction of P450 1A by 3- methylcholanthrene protects mice from aristolochic acid-I-induced acute renal injury. Nephrol Dial Transplant 23: 3074 – 3081.

Yasui Y, Toyoda K, and Imai K (2009) A primary hepatic malignant mesenchymal tumor with myofibrogenic differentiation in a B6C3F1 mouse. Toxicol Pathol 37: 244 – 248.

Yoshinari K, Okino N, Sato T, Sugatani J, and Miwa M (2006) Induction of detoxifying enzymes in rodent white adipose tissue by aryl hydrocarbon receptor agonists and antioxidants. Drug Metab Dispos 34: 1081 – 1089.

Zhao B, DeGroot DE, Hayashi A, He G, and Denison MS (2010) CH223191 is a ligand-selective antagonist of the Ah (dioxin) receptor. Toxicol Sci 117: 393 – 403.

Zimmermann R, Strauss JG, Haemmerle G, Schoiswohl G, Birner-Gruenberger R, Riederer M, Lass A, Neuberger G, Eisenhaber F, Hermetter A, and Zechner R (2004) Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science 306: 1383 – 1386.

Zudaire E, Cuesta N, Murty V, Woodson K, Adams L, Gonzalez N, Martinez A, Narayan G, Kirsch I, Franklin W, Hirsch F, Birrer M, and Cuttitta F (2008) The aryl hydrocarbon receptor repressor is a putative tumor suppressor gene in multiple human cancers. J Clin Invest 118: 640 – 650.

108