UNIVERSITAT AUTONÒMA DE BARCELONA
Development of gut microbiota in the pig: modulation of bacterial communities by different feeding strategies.
MEMÒRIA PRESENTADA PER MARIA SOLEDAD CASTILLO GÓMEZ
PER ACCEDIR AL GRAU DE DOCTOR DINS EL PROGRAMA DE DOCTORAT DE PRODUCCIÓ ANIMAL DEL DEPARTAMENT DE CIÈNCIA ANIMAL I DELS ALIMENTS
BELLATERRA, MARÇ DE 2006
Susana M. Martín-Orúe, investigadora del departament de Ciència Animal i dels Aliments de la Facultat de Veterinària de la Universitat Autònoma de Barcelona, certifica:
Que la memòria titulada “Development of gut microbiota in the pig: modulation of bacterial communities by different feeding strategies”, presentada per Maria Soledad Castillo Gómez per optar al grau de Doctor en Veterinària, ha estat realitzada sota la seva direcció i, considerant-la acabada, autoritza la seva presentació per que sigui jutjada per la comissió corresponent.
I per que consti als efectes oportuns, signa la present a Bellaterra, 20 de Març de 2006.
Dra. Susana M. Martín-Orúe.
The author was in receipt of a grant from the Departament d’Universitats, Recerca i Societat de la informació (DURSI) of the Generalitat de Catalunya for this study.
Sin duda, en la elaboración de una tesis y en el periodo de formación predoctoral participan muchas personas además del doctorando, por ello, quiero en primer lugar, agradecer el apoyo recibido durante estos años. En primer lugar, al equipo docente e investigador del grup de Nutrició, en especial a Susana, gracias por tu apoyo y ayuda durante estos años. Josep, Francisco, Mariola, AnaCris y Roser, gracias por brindarme la oportunidad de formar parte del equipo de Nutrición, por vuestra colaboración, consejos y cafés que hemos compartido. Y, sobre todo a Olga, muchísimas gracias por tu apoyo. A todos los becarios, aquellos que me brindaron su ayuda y consejos cuando empezaba (Joaquin, Jaume, Dani, Lucía), y a todos los demás con los que he compartido estos años: Montse, Eva, Alba, Núria, Edgar, Ceci, Arantza, Marta, Gabri, Walkiria, Juan Carlos, José, Sandra, Carol, Muzzafer, Francesc, gràcies!!!, A todos con los que he compartido despacho, Aina, Luciano, Glaubert, Feliu, Vincent…També als altres becaris amb els que he compartit l’aventura del doctorat: Mercè, Miquel, Maribel, Montse, Anna, Laura, gràcies! Also, I would like to thank to the Gut microbiology and Immunology division of the Rowett Research Institute, in particular to Harry Flint, Sylvia Duncan and Gail Skene, for their collaboration and support; as well to the rest of the staff and students who shared with me the adventure of the FISH, thanks a lot!! With special regards to Justin and Vanessa (and the little Maria Isabella), because they were my american family in Aberdeen, Scotland. Guillem, Pablo, David, Àlex, Joan, Beti, Anna i Laura, per ser els de sempre; Javier, por estar siempre, gracias. Muy especialmente a mi familia por su ayuda y apoyo incondicional, sin vosotros esta tesis no hubiera sido posible. Y, por supuesto a todos aquellos que en algún momento han sido cómplices en la elaboración de este trabajo, gracias.
PARA MIS PADRES, Resumen
RESUMEN
El objetivo de esta tesis fue el estudio de la microbiota gastrointestinal porcina, para mejorar el conocimiento existente de este complejo ecosistema y así, ayudar de alguna forma en el desarrollo de nuevas estrategias alimentarias para sustituir los antibióticos promotores del crecimiento recientemente prohibidos en la Unión Europea.
Para alcanzar este objetivo, se diseñaron diferentes pruebas experimentales (capítulo 4-9). En la Prueba I, se desarrolló la técnica de PCR cuantitativa para cuantificar bacterias totales, lactobacilli y enterobacteria en muestras de contenido digestivo. Con el fin de validar su utilidad, los resultados obtenidos se compararon con los que se obtuvieron con métodos tradicionales (cultivo en medio selectivo para lactobacilli y enterobacteria, y microscopía directa para bacterias totales). La PCR mostró valores superiores, en términos de copias del gen 16S rRNA que la microscopía directa y los cultivos. Sin embargo, a pesar de la diferencia, la ratio lactobacilli:enterobacteria fue similar entre métodos. Diferentes motivos pueden estar detrás de la diferencia entre métodos, tanto una sobreestimación con la PCR como una subestimación con los métodos tradicionales. No obstante, los contajes para el total de bacterias y lactobacilli mostraron una correlación significativa. Por ello, este método se consideró como válido para cuantificar cambios bacterianos en el tracto gastrointestinal del cerdo.
Con el fin de estudiar el establecimiento de la microbiota en el cerdo tras el destete, se diseñó la Prueba II. En ésta, 12 lechones (20 ± 2 días) de 6 camadas diferentes fueron divididos en un grupo control, el cual permaneció con la madre, y un grupo experimental el cual fue destetado y alimentado con una dieta pre-starter commercial. Tras una semana, los animales fueron sacrificados y se recogieron muestras de contenido de ciego. Para estudiar el cambio en la microbiota, se cuantificó el total de bacterias, lactobacilli y enterobacterias mediante PCR a tiempo real. Además, para obtener una imagen global del cambio producido por el destete, se utilizó la técnica del t-RFLP (“Terminal restriction fragment length polymorphism”). La población total bacteriana, así como la biodiversidad, medida como número de bandas obtenidas por t- RFLP, fue similar entre grupos, pero hubo un descenso importante en el ratio lactobacilli:enterobacteria. Además, el análisis de similaridad de los perfiles obtenidos
i Resumen por t-RFLP, mostró una agrupación separada de los grupos experimentales. Inferiendo con los fragmentos teóricos se observaron diferencias entre grupos. Los cerdos lactantes mostraron una mayor diversidad de fragmentos compatibles con bacterias ácido lácticas y se observó la presencia de algunos picos compatibles con Clostridium coccoides, C. butyricum y Lactobacillus delbruekii que no se encontraron en los animales destetados. Estos resultados confirman el destete como un punto crítico en el establecimiento de la microbiota gastrointestinal.
En la Prueba III, se utilizaron cerdos en crecimiento para estudiar la microbiota gastrointestinal y a su vez, el potencial de la fibra para modificar este ecosistema. Para ello, 32 cerdos (15 ± 0.38 kg de peso vivo) se distribuyeron en 4 tratamientos: una dieta control, una dieta rica en almidón resistente por la inclusion de maíz con un mayor tamaño de particula, una dieta rica en polisacáridos no amiláceos solubles por la inclusion de pulpa de remolacha, y una cuarta dieta rica en polisacáridos no amiláceos insolubles por la inclusion de salvado de trigo. Tras seis semanas de alimentación ad líbitum, los animales fueron sacrificados y el contenido digestivo fue muestreado. La técnica del FISH (“Fluorescent in situ hybridization”) se utilizó con el fin de describir los grupos bacterianos mayoritarios a lo largo del tracto gastrointestinal. Se utilizaron diferentes sondas para cuantificar bacterias pertenecientes al Bacteroides/Prevotella grupo, Ruminococcus flavefaciens, Ruminococcus bromii, clostridia cluster IV, clostridia cluster IX, Streptococcus/Lactococcus y Lactobacillus/Enterococcus sp. en estómago, yeyuno distal, colon proximal y recto. Los resultados obtenidos revelaron marcadas diferencias en la composición de estos grupos a lo largo del tracto, que no fueron marcadamente afectados por la dieta. En estómago, streptococci y lactobacilli fueron los grupos predominanates, mientras que en intestino grueso, el grupo de Bacteroides/Prevotella, clostridial cluster XIVa, IV, y ruminococci fueron los más abundantes. Los resultados obtenidos por RFLP (“restriction fragment length polymorphism”) mostraron cambios en el perfil bacteriano dependiendo de la dieta administrada. Los animales que recibieron salvado de trigo mostraron una menor biodiversidad con unos perfiles más similares entre animales. Además, se hallaron cambios en la fermentación mediante la determinación de ácidos grasos volatiles; Las dietas ricas en polisacáridos no amiláceos mostraron una menor concentración de ácidos grasos ramificados y valerico.
ii Resumen
En las pruebas IV y V, se estudiaron diferentes aditivos comerciales como posibles alternativas a los antibióticos promotores del crecimiento, con especial interés en sus efectos en la microbiota gastrointestinal. En concreto, en la Prueba IV, se testaron 3 aditivos: avilamicina (como control positivo), butirato sódico y un extracto de plantas (carvacrol, cinamaldehido y capsicum). Un total de 40 (18-22 días) cerdos se distribuyeron en cuatro tratamientos: una dieta control, ésta con 0.04% de avilamicina, con 0.3% de butirato sódico o con 0.03% de extracto de plantas. Después de dos semanas los animales fueron sacrificados y el contenido digestivo fue muestreado. Como en las pruebas anteriores, la PCR a tiempo real se utilizó para estudiar los cambios en la microbiota. No se encontraron diferencias en el total de bacterias a lo largo del tracto gastrointestinal con ninguna de las dietas, aunque la ratio lactobacilli:enterobacteria en ciego fue superior para los animales que recibieron el extracto de plantas. La técnica del RFLP mostró diferencias en el perfil bacteriano, agrupando los animales en función de la dieta administrada. La actividad bacteriana total medida como bases púricas también mostró diferencias entre dietas. Estos resultados podrían indicar que el efecto de los diferentes aditivos testados no se debería a una reducción en el total de bacterias sinó a modificaciones en la composición y actividad de la microbiota.
Finalmente, en la Prueba V, una fuente comercial de mananoligosacáridos y de zinc orgánico, administrados por separado o conjuntamente fueron testados para mejorar los indices productivos, microbiota gastrointestinal y respuesta inmune. En este caso, 128 cerdos (18-22 días de vida) se distribuyeron en cuatro tratamientos: una dieta control, ésta dieta con 0.2% de mananoligosacáridos, con 0.08% de zinc orgánico o con ambos aditivos. Las dietas fueron administradas durante cinco semanas. Tras dos semanas, 32 animales fueron sacrificados y el contenido digestivo fue muestreado. Se observó una mejora en el índice de conversion para todo el periodo experimental cuando los dos aditivos se añadieron conjuntamente. Los mananoligosacáridos redujeron la enterobacterias en yeyuno. La adición de zinc orgánico, tendió a incrementar el peso en vacío del ileon, que fue considerado como el segmento de intestino delgado con placa de Peyer continua. Estos resultados sugieren diferentes mecanismos de acción de los aditivos, mientras que los mananoligosacáridos podrían estar actuando modulando el ecosistema bacteriano, mediante la inhibición de algunos grupos, el incremento en el peso vacío del ileon podría sugerir un efecto inmunológico. Además, el efecto positivo
iii Resumen en la ratio vellosidad:cripta cuando ambos aditivos se incluyeron conjuntamente podría indicar acciones complementarias. Los resultados obtenidos en la presente tesis demuestran la validez de diferentes métodos moleculares para el studio de la microbiota gastrointestinal del cerdo. Ecosistema muy instable durante las primeras edades, con un cambio drástico al destete pero que consigue una estabilización de los grupos mayoritarios en el animal adulto. Por otra parte, los efectos promotores de las diferentes alternativas testadas parecen estar relacionados con sutiles cambios en la microbiota gastrointestinal más que con drásticos efectos antimicrobianos. No obstante, en algunos casos (butirato sódico, zinc) otros efectos diferentes al microbiano podrían estar implicados.
iv Summary
SUMMARY
The main objective of this thesis was to study pig gut bacteria to improve our knowledge of this complex ecosystem as this could help in the development of new feed strategies to substitute antibiotics as growth promoters.
To achieve this main objective, a set of five trials were designed (chapter 4-8). In Trial I, real-time PCR was developed to quantify total bacteria, lactobacilli and enterobacteria in digesta samples. To validate its usefulness, results obtained were compared to those obtained by traditional methods (selective culture for lactobacilli and enterobacteria, and direct microscopy for total bacteria). Real time PCR showed higher values in terms of 16S rRNA gene copies than direct microscopy counts or CFU. Despite the differences, the lactobacilli:enterobacteria ratio was similar between methods. Differences between methods might caused by an overestimation with PCR by quantification of dead bacteria or free DNA, and also an underestimation with conventional methods. Values obtained by PCR and traditional methods showed a significant correlation for lactobacilli and total bacteria. Therefore, real-time PCR was considered a valid method to quantify microbial shifts in the gastrointestinal tract.
To study pig gut microbiota establishment in the young pig after weaning, trial II was designed. Twelve pigs (20 ± 2 days ) from 6 different litters were divided into a control group that remained with the sow and an experimental group that was weaned and fed a commercial post-weaning diet. After one week, the animals were sacrificed and samples from cecal digesta were taken. To assess microbial shift, total bacteria, lactobacilli and enterobacteria were quantified using real-time PCR. To achieve an overall picture of the change in the global microbial profile, terminal restriction fragment length polymorphism of the PCR amplified 16S rRNA gene was applied. Total bacteria and biodiversity of the microbial ecosystem were similar between both experimental groups, although there was a decrease in the lactobacilli:enterobacteria ratio. Also, cluster analysis grouped animals in two different clusters. Considering theoretical restriction fragment lengths, differences in compatible bacterial groups were observed between groups. Suckling pigs showed a higher lactic acid bacteria diversity. Also peaks compatible with Lactobacillus delbruekii, Clostridium coccoides and C.
v Summary butyricum were also mostly present in suckling pigs. Results therefore confirm weaning as a challenging point on the indigenous microbiota establishment. In Trial III, growing pigs were used to study pig gut microbiota and the potential of fiber to modify this ecosystem. A total of 32 pigs (15 ± 0.38 kg of body weight) were distributed into four experimental diets: a control diet, a diet enriched in resistant starch by inclusion of coarse-ground corn, a diet enriched in soluble fiber by addition of 8 % sugar beet pulp and a diet rich in insoluble fiber by inclusion of 10 % wheat bran. After six weeks of feeding ad libitum, animals were sacrificed and samples of digesta content were taken. Fluorescent in situ hybridization (FISH) was applied to describe main bacterial groups along the gastrointestinal tract and to detect changes related to the diets. Probes to detect changes in total bacteria, Bacteroides/Prevotella group, Ruminococcus flavefaciens, Ruminococcus bromii, clostridia cluster IV, clostridia cluster IX, Streptococcus/Lactococcus and Lactobacillus/Enterococcus sp. were used in samples from the stomach, distal jejunum, proximal colon and rectum. FISH revealed marked differences in the composition of the microbiota throughout the gastrointestinal tract, which were relatively unaffected by changes in the diet. Streptococci and lactobacilli were predominant in the stomach whereas Bacteroides/Prevotella, clostridial cluster XIVa, IV, and ruminococci were predominant in the lower tract. Restriction fragment length polymorphism (RFLP) profiles showed changes in the bacterial profile related to diet, with pigs fed a wheat bran showing the lowest biodiversity and also having the most similar patterns. Moreover, changes in fermentation activity were detected when short-chain fatty acids were measured. Diets rich in non-starch polysaccharides (wheat bran and sugar beet pulp) showed lower molar percentages of branched chain fatty acids and valeric acid.
In trials IV and V, different commercial additives were studied as potential alternatives to antibiotic growth promoters, paying special attention to their effects on gut microbiota. In particular, in Trial IV, three different additives were tested: avilamycin (as a positive control), sodium butyrate and a commercial plant extract (carvarol, cinnamaldehyde and capsicum). Forty early-weaned (18 to 22 d) pigs were distributed into four dietary treatments: a control diet, a diet with 0.04% avilamycin, a diet with 0.3% sodium butyrate or with 0.03% plant extract mixture. After two weeks, the animals were sacrificed and samples from digesta were taken. As in the previous trials, real-time PCR was used to assess microbial shifts. The total microbial load did not show differences between diets, although, there was an increase in the
vi Summary lactobacilli:enterobacteria ratio in the cecum of piglets fed with plant extracts. RFLP also showed differences in microbial profile in jejunum digesta samples, with an increase in biodiversity with the different additives compared to control diet. Total microbial activity measured as purine bases also showed differences between diets. In the light of these results, the effect of the different additives would not be related to a reduction in the toal bacterial load, but rather to changes in the ecological structure and metabolic activity of the microbial community.
Finally, in Trial V, a commercial source of mannan-oligosaccharides and organic zinc, offered alone or in combination, were evaluated to enhance performance, gastrointestinal health and immune response. A total of 128 early-weaned pigs (18 to 22 d) were distributed into four dietary groups. For five weeks, animals received either a control diet, a diet with 0.2 % mannan-oligosaccharides, a diet with 0.08 % zinc-chelate or a diet with both additives together. Two weeks after weaning, 32 animals were sacrificed and digesta samples were taken to study the effect of the additives on gut health and immunity. An improvement in feed:efficiency was observed with both additives for the whole period. Mannan-oligosaccharides reduced enterobacteria counts in jejunum. The addition of organic zinc tended to increase empty ileal weight, defined as the segment including the continuous Peyer’s patch, and crypt depths were lower in the animals offered both additives together. These results suggest different modes of action of the additives tested; whilst mannan-oligosaccharides might be acting by modulation of intestinal microbiota through inhibition of certain microbial groups, the observed increase in ileal weight with zinc suggests a possible immunological effect. In addition, the response observed in gut architecture may be behind complementary actions when both additives were added together.
Results obtained show the usefulness of different molecular methods for studying pig gut microbiota quantitatively and qualitatively. This ecosystem, as confirmed, is specially unstable during the first weeks of life with marked changes at weaning. However, colonization progresses, resulting in a relatively stable composition in the main bacterial groups in the adult pig. The effect of the different additives tested might be related to subtle changes in microbiota composition more than drastic antimicrobial effects. Moreover, other effects not directly related with microbiota might be involved.
vii Abbreviations used
ABBREVIATIONS USED
A: adenine DM: dry matter AB: diet containing 0.04% avilamycin DNA: deoxy nucleic acid (Trial IV) dNTP: deoxy-nucleotide-triphosphate AC: diet containing 0.3% sodium E:L: ratio enterobacteria:lactobacilli butyrate (Trial IV) ENT: enterobacteria ADFI: average daily feed intake F-ent: forward primer for enterobacteria ADG: average daily gain FISH: fluorescent in situ hybridization AGP: antibiotic growth promoter F-lac: forward primer for lactobacilli BCFA: branched chain fatty acids FM: fresh matter BD: below detection F-tot: forward primer for total bacteria BM: diet containing 0.2% mannan- G: guanine oligosaccharides (Trial V) G:F: gain feed ratio BMP: diet containing 0.2% mannan- GALT: gut associated lymphoid tissue oligosaccharides plus 0.08% organic GC: diet enriched in resistant starch zinc (Trial V) (Trial III) bp: base pair GIT: gastrointestinal tract BP: diet enriched in soluble fiber (Trial HPLC: high performance liquid III) cromatography BP’: diet containing 0.08% organic zinc IEL: intraepithelia limphocyte (Trial V) iNSP: insoluble non-starch BSA: bovine serum albumin polysaccharides BW: body weight L:E: ratio lactobacilli:enterobacteria C: cytosine LACT: lactobacilli CD: crypt depth MAC: microflora associated CECT: colección española de cultivos characteristic tipo NOD: nucleotide-binding CFB: cytophaga-flexibacter-bacteroides oligomerization domain phylum NSP: non-starch polysaccharides CFU: colony forming unit OM: organic matter CP: crude protein P: P-value CT: control diet PAMP: pathogen-associated molecular DAPI: 4’,6’-diamino-2-phenylindole pattern DGGE: denaturant gradient gel PAS: periodic acid Schiff reaction electrophoresis PB: purine bases concentration
ix Abbreviations used
PBS: posphate buffered saline PCR: polymerase chain reaction PRR: pattern recognition receptor qPCR: quantitative polymerase chain reaction R-ent: reverse primer for enterobacteria RFLP: restriction fragment length polymorphism R-lac: reverse primer for lactobacilli RNA: riboncleic acid RS: resistant starch R-tot: reverse primer for total bacteria S: suckling pigs SCFA: short chain fatty acids SD: standard desviation SEM: standard error of the mean sNSP: soluble non-starch polysaccharides T: tymine TGGE: temperature gradient gel electrophoresis TLR: toll-like receptor TRF: terminal restriction fragment t-RFLP: terminal restriction fragment length polymorphism W: weaned pigs WB: diet enriched in insoluble fiber (Trial III) XT: diet containing 0.03% plant extract mixture (Trial IV) 16S rRNA: ribosomal small sub-unit
x Index
INDEX
Chapter 1. General introduction p. 1
Chapter 2. Literature review p. 4 2.1. Development of the intestinal microbiota after birth p. 6 2.1.1.First colonizers p. 6 2.1.2.Weaning: the adaptation to dry food p. 9 2.1.3.Autochtonous microbiota in the adult pig p. 12 2.2. Main functions of the indigenous microbiota in the gut p. 16 2.2.1.Effects of indigenous bacteria on gut maturation and development p. 16 2.2.2.Establishment of the gut barrier and colonization resistance p. 18 2.2.2.1.Glycoconjugates of the mucosa as specific attachment site p. 20 2.2.2.2.Molecules involved in bacterial adhesion p. 22 2.2.3.Effects of indigenous microbiota on immune response p. 23 2.2.3.1.Commensal bacteria tolerance-ignorance p. 24 2.2.4.The role of microbiota on digestion and absorption of nutrients p. 26 2.2.4.1.Carbohydrate utilization by indigenous bacteria p. 28 2.2.4.2.Protein utilization by indigenous bacteria p. 29 2.2.4.3.Lipid utilization by indigenous bacteria p. 30 2.3. Modulation of intestinal equilibrium through the feed p. 32 2.3.1.Macro-indredients p. 32 2.3.1.1.The role of dietary fiber p. 33 2.3.1.2.Fermented liquid feed p. 37 2.3.2.Micro-ingredients and in-feed additives p. 39 2.3.2.1.Prebiotics p. 39 2.3.2.2.Probiotics p. 40 2.3.2.3.Symbiotics p. 42 2.3.2.4.Acidifiers p. 42 2.3.2.5.Minerals: zinc and copper p. 44 2.3.2.6.Plant extracts p. 45 2.3.2.7.Other additives p. 46 2.4. New tools for the analysis of the gastrointestinal microbiota p. 48 2.4.1.Quantitative techniques p. 49
xi Index
2.4.1.1.Quantitative Polymerase Chain Reaction p. 49 2.4.1.2.Fluorescent In Situ Hybridization p. 52 2.4.2.Fingerprinting techniques p. 56 2.4.2.1.Denaturant/Temperature Gradient Gel Electrophoresis p. 56 2.4.2.2.Terminal Restriction Fragment Length Polymorfism p. 59
Chapter 3. Objectives p. 62
Chapter 4. Trial I. Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR p. 66 4.1. Introduction p. 68 4.2. Material and methods p. 68 4.2.1.Sample preparation p. 68 4.2.2.Bacteria quantification by traditional methods p. 69 4.2.3.Bacteria quantification by real-time PCR p. 69 4.3. Results and discussion p. 71 4.4. Conclusion p. 75
Chapter 5. Trial II. Influence of weaning on caecal microbiota of pigs: use of real-time PCR and t-RFLP p. 76 5.1. Introduction p. 78 5.2. Material and methods p. 79 5.2.1.Animals and housing p. 79 5.2.2.Sacrifice and sampling p. 79 5.2.3.Statistical analysis p. 83 5.3. Results and discussion p. 83 5.3.1.Bacterial quantitative change measured by real-time PCR p. 83 5.3.2.Ecological bacterial changes, t-RFLP results p. 85 5.4. Conclusions p. 91
Chapter 6. Trial III. Molecular analysis of bacterial communities along the pig gastrointestinal tract p. 92 6.1. Introduction p. 94 6.2. Material and methods p. 95 6.2.1.Animals and diets p. 95 6.2.2.Sample collection and processing p. 95 6.2.3.Statistical analysis p. 99
xii Index
6.3. Results p. 99 6.3.1.Microflora structure along the gastrointestinal tract as analyzed by FISH p. 99 6.3.2.Effects of fibre on microbial composition as estimated by RFLP and fermentation profiles p. 100 6.4. Discussion p. 103 6.5. Conclusions p. 106
Chapter 7. Trial IV. The response of gastrointestinal microbiota to the use of avilamycin, butyrate and plant extracts in early-weaned pigs p. 108 7.1. Introduction p. 110 7.2. Material and methods p. 110 7.2.1.Animals and housing p. 111 7.2.2.Dietary treatments and feeding regime p. 111 7.2.3.Collection procedures and measurements p. 113 7.2.4.Statistical analysis p. 116 7.3. Results p. 118 7.3.1.Chages in the total microbial counts p. 118 7.3.2.Changes in the microbial ecosystem p. 120 7.3.3.Changes in metabolic bacterial activity p. 122 7.4. Discussion p. 124 7.5. Implications p. 128
Chapter 8. Trial V. Use of mannan-oligosaccharides and zinc chelate as growth promoters and weaning preventative in weaning pigs: effects on microbiota and gut function p. 129 8.1. Introduction p. 131 8.2. Material and methods p. 132 8.2.1.Animals and diets p. 132 8.2.2.Performance and collection procedures p. 132 8.2.3.Analytical methods p. 133 8.2.4.Statistical analysis p. 134 8.3. Results p. 136 8.3.1.Growth performance p. 136 8.3.2.Faecal consistency p. 137 8.3.3.Organ weights and small intestine length p. 138 8.3.4.Short chain fatty acids p. 138
xiii Index
8.3.5.Quantitative changes in microbial population p. 140 8.3.6.Immune proteins and intestinal morphology p. 141 8.4. Discussion p. 141 8.4.1.Changes on microbial ecosystem p. 142 8.4.2.Effect on gut function p. 145 8.5. Implications p. 147
Chapter 9. General discussion p. 150 9.1. Usefulness of quantitative PCR, FISH and t-RFLP to study the intestinal microbiota p. 152 9.2. Weaning: a critical stage in the indigenous pig microbiota establishment p. 158 9.2.1.Establishment of adult gut bacteria p. 161 9.3. Are antibiotics-growth promoters a model to copy? p. 162 9.3.1.Mode of action of antibiotics: quantitative or qualitative effects on gut microbiota? p. 162 9.3.2.Other in-feed additives with antimicrobial properties p. 163 9.3.3.Effects on microbiota by other mechanisms p. 165 9.3.4.Other strategies to improve health and promote growth p. 167 9.4. Summary p. 168
Chapter 10. Conclusions p. 171
Chapter 11. Literature cited p. 174
xiv Index
Figures index
Chapter 2 Fig. 2.1. (A) Evolution of aerobic and anaerobic bacteria in piglet feces p. 8 from birth to 120 days of life Fig. 2.1. (B) Total bacteria counts and percentage of coliforms, Bacteroides and Clostridium in piglet feces (Swords et al., 1993) p. 8 Fig. 2.2. Review diagram of piglets post-weaning challenge p. 10 Fig. 2.3. (A) Diversity of the intestinal microbiota in piglets from birth to 14 days afer weaning. p. 11 (B) Dendogram based on TGGE profiles of one piglet (Inoue et al., 2005) p. 11 Fig. 2.4. Intestinal immune geography of responses to commensal bacteria (Macpherson et al., 2005) p. 27 Fig. 2.5. Representation of real-time PCR with TaqMan (A) and SYBR Green (B) p. 51 Fig. 2.6. (A) Epifluorescent image of mixed culture of seven Bifidobacterium species by multi color FISH p. 55 (B) Identification of Bifidobacterium species in human fecal samples using multi color FISH (Takada et al., 2004) p. 55 Fig. 2.7. PCR-DGGE profile generated from fecal samples obtained from a piglet over a 20-day experimental period using primers specific for the V3-16S rDNA (Simpson et al., 2000) p. 58 Fig. 2.8. An example of fragments and visualization of the electropherogram obtained after an enzymatic restriction p. 60 Fig. 2.9. T- RFLP profiles obtained from cecum digesta in pigs receiving different doses of zinc oxide and copper sulphate (Höjberg et al., 2005) p. 61
Chapter 4 Fig. 4.1. Bacterial loads in jejunum dgesta of pigs as total bacteria, lactobacilli or enterobacteria measured by qPCR, DAPI staining or selective culture technique p. 73
xv Index
Fig. 4.2. Correlation between the number of total bacteria measured by qPCR or by DAPI in jejunum digesta samples p. 74
Chapter 5 Fig. 5.1. Bacterial loads in the caecum of suckling and weaned pigs measured by quantitative PCR p. 84 Fig. 5.2. Dendogram illustrating the effect of weaning in t-RFLP banding patterns p. 87 Fig. 5.3. Electropherogram produced from Hha I digestion of 16S rRNA PCR products from one suckling and one weaned piglet p. 87
Chapter 6 Fig. 6.1. Ecological changes in microbial population measured by RFLP. Dendogram illustrating the percentage of similarity of PCR -RFLP banding patterns in samples of proximal colon digesta p. 101 Fig. 6.2. Fermentation patterns (pH, SCFA and purine bases concentration) in the proximal colon digesta from experimetal pigs p. 101
Chapter 7 Fig. 7.1. Quantitative PCR for total bacteria. (A) The amplification plot of the standards used to quantify total bacteria p. 118 (B) DNA concentrations plotted vs. Thereshold cycle value to construct the standard calibration curve p. 119 (C) Bacterial loads in the stomach, jejunum, cecum, distal colon colon digesta and in the jejunum mucous layer measured by quantitative PCR in early-weaned pigs p. 119 Fig. 7.2. Ecological changes in microbial population of jejunum digesta measured by RFLP. (A) Example of gel electrophoresis of the PCR amplifiedV3, V4 and V5 regions of the 16S rDNA restricted with the enzyme Hha I p. 121 (B)Dendogram illustrating the correlation between experimental diets in PCR-RFLP banding patterns p. 122 Fig. 7.3. Purine bases concentration in samples from the ileum, cecum,
xvi Index
proximal colon, distal colon and rectum in weaned pigs receiving A control diet (CT) or the same diet with avilamycin (AB), butyric acid (AC) or a plant extract mixture (XT) p. 123
Chapter 8. Fig. 8.1. Voluntary feed intake of pigs receiving a control diet (CT), the same diet supplemented with Bio-Mos (BM), Bioplex-Zn (BP) or both additives (BMP) the first week post-weaning p. 136 Fig. 8.2. Faecal consistency in pigs receiving a control diet (CT), or the same diet supplemented with Bio-Mos (BM) Bioplex-Zn (BP) or both additives during three weeks after weaning p. 138
Chapter 9 Fig. 9.1. Melting curve oftained after the PCR reaction for total (A), enterobacteria (B) and lactobacilli (C) p. 154 Fig. 9.2. Pie chart with the major 5'-terminal fragments expressed as the mean of the percentage of the toal area in suckling (S) and weaned (W)group p. 160 Fig. 9.3. Total bacteria, Bacteroides/Prevotella group, clostridia cluster XIVa, F. prausnitzii, R. flavefaciens and R. bromii, clostridia cluster IX, Streptococcus/Lactococcus spp. and Lactobacillus/Enterococcus spp. measured by FISH p. 162
xvii Index
Tables index Chapter 2 Table 2.1. Main bacteria traditionally cultured from the pig gut (adapted from Stewart et al., 1999) p. 13 Table 2.2. Major phylogenetic lineages to which the phylotypes from the pig gastrointestinal tract were affiliated (Leser et al., 2002) p. 14 Table 2.3. Number of cellulolytic bacteria from fecal samples of sows fed diets containing various levels of fiber (Varel and Pond,, 1985) p. 35 Table 2.4. Selected bacterial counts (CFU/g wet weight) in the colon of weaned pigs fed diets containing different sources of starch (MacFarland, 1998, reviewed by Hillman, 2001) p. 36 Table 2.5. Some probes used actually to quantify different gastrointestinal Bacteria p. 54
Chapter 5 Table 5.1. Control diet composition (as fed basis) administered to pigs p. 79 Table 5.2. Theroretical restriction 5' fragment length predicted for the major pig gut bacteria.
Chapter 6 Table 6.1. Sequences of oligonucleotides used in the study p. 82 Table 6.2. (A) Fermentation parameters including pH, and purine bases Concentration in samples of proximal colon contents from p. 98 pigs receiving experimental diets (B) SCFA profile in digesta of proximal colon p. 101 Table 6.3. Proportions of specific bacterial groupings in different regions of the porcine digestive tract estimated by FISH p. 101
Chapter 7 Table 7.1. Control diet composition, as fed basis p. 112 Table 7.2. Material and conditions for the quantification of total bacteria, enterobacteria and lactobacilli in digesta simples p. 116 Bacterial populations, size of lactobacilli, and enterobacteria in Table 7.3. the distal jejunum and cecum measured by qPCR in early-weaned pigs p. 120 Table 7.4. Bacterial enzymatic activity in samples of the cecum and colon
xix Index
contents from early-weaned pigs p. 124
Chapter 8 Table 8.1. Composition as fed basis of pre-starter and starter control diets of phase 1 and phase 2 p. 135 Initial and final pig body weight (kg), voluntary feed intake Table 8.2. (kg/day) average daily gain (kg/day) and feed efficiency in weaned pigs p. 137 Table 8.3. Weight (g/kg BW) and length (m) of different parts of the gut from early-weaned pigs sacrificed two weeks post-weaning p. 139 Table 8.4. pH, SCFA and lactic acid contentration in the stomach, ileum, and caecum of pigs sacrificed two weeks post-weaning p. 140 Table 8.5. Purine bases concentration in the ileum, caecum and rectum, and bacterial populations (lactobacilli and enterobacteria) from the jejunum measured by real-time PCR in ileum digesta in pigs p. 143 Table 8.6. Plasma and ileal immunoglobulin (IgA, IgM, IgG) concentration and jejunum histological parameters in weaned pigs sacrificed two weeks post-weaning p. 144
Chapter 9 Table 9.1 Results of lactobacilli:enterobacteria ratio and its relation with performance from pigs included in trial II, IV and V p. 155 Table 9.2. Summary of the main effects found in the different additives tested in the trials included in the thesis p. 169
GENERAL INTRODUCTION Chapter 1 1
General introduction
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW ribosomal DNAgenehasrevolutioned might beactingbyotherdifferentmechanis throught aneffectongut bacteria,by shif pharmacological doses andplantextractmixtures. Most ofthemarethoughttoact may beremarcked theuseof prebiotics, not comparable withthoseobtained antibiotics growthpromoters havebeente production indexesoftheantibio RFLP havebeenextensivelyus methods, quantitativePCR andsome fi microbial communityismuchgreaterthan not necessarytotheirstudy.Thosestudieshaveshowedthatthecomplexity of populations suchasthepiggut development inthelastyearsofhighre failure ofmany ofthem togrowinagi recongnized thatthesemethods misregard an microbiology havebeenbasedontraditi ecosystem isstilllimited modulating genehostexpression.However,ourknowledgeofthiscomplex plays important rolesingutmorphology, immu provides essentialproductsto pig gutsincebirth,andhave animal toresistinvasion with themaintenance ofarobustindigenous maintain productiveindexeswithouttheus and controllingentericbacteria look foralternativesorreplacement strate begining of thenegativeconsequencesof Union onJanuary2006.Sincethefirstrestrictiv into thetotal banof antibiotics asgrowth Recently numerous productshaveappeared inthe market withtheaim tomaintain Gastrointestinal microbiota isacomplex and dynamic ecosystem thatinhabits the Recent concernregarding cross-resistanceofpathogensinhumans havebecame
bypotentiallydisease-causingpathogenicbacteria. . Untilrecently, the majorpart of thestudies of intestinal an important influence ontheanimal health: gutbacteria the host,forms akeybarrieragainstpathogensandalso l diseases.Oneof theways th ed tostudypiggutbacteria. microbiota, sinceviabilityan tics “age”.Inthissense, solution molecular te antibiotics. Among thesenewalternatives,it ngerprinting techniques like DGGE and t- ngerprinting techniqueslikeDGGEand ting themicrobial equilibrium, whilstothers 2 previoslythought.Among thediversityof sted withpromising promotants in livestock inthe European gies tomaintain piggrowthperformance
onal methods, although ven culturemedium. Inthisregard,the the ban,greateffortshavebeendoneto our knowledge of complex microbialour knowledgeofcomplex e ofantibioticswoul probiotics, organicacids,minerals at important percentage ms intheimprovement ofhealthand intestinalmicrobiot e measures weretaken,andduetothe nity development, digestionandeven at probablycouldhelpto d latergrowth ofcellsis different alternativesto chniques basedon16S results, althoughstill General introduction d bethoserelated a thathelpedthe of bacteriadueto at presentitis
INTRODUCTION to improve knowledge knowledge to improve rther studies regarding pig pig regarding studies rther
tions. The use of molecular methods in methods of molecular tions. The use 3 ese compounds that undoubtly will help to that undoubtly ese compounds search is necessary search is s will be a key role in fu s will be a key
regarding the mechanism of action of th mechanism the regarding in field condi their proper use improve gut microbiota. conjunction with traditional one conjunction with performance. In this sense, further re In this sense, performance. Chapter 1
INTRODUCTION
LITERATURE REVIEW Chapter 2 4
Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW with theenvironment starts thegastrointe short period oftime, contactwiththe vagina fetal membranes are ruptured,thepigletis 2.1.1. the adultage,payingspecialattentionto with characteristicpopulation in There is also ahorizontalstratification 1996; Simpson etal., 1999), with thehi differs quantitativelyandqualitativelyth oxidation/reduction potential(Stewart et availability andcomposition, theflow colonization processareimmune reactivit several factorsofbothbact to maintain apermanent colonization(Mackie washout orelimination atanintestinalnich and occurrence overtime, by multiplying atarate thatequals orexceeds theirrate of are usuallydescribedinthelowertractof al., 2001).Morethan500di bacterial community populationforeachindivi continues asthepig matures, resulting successional stepswherediversedominant gr the gutofnewbornsisrapidlyinvade microbiota isacomplex processthatinvo At birth, the piglet gastrointestinal tract issterile. However,from themoment the This chapter willfocus onthepiggastrointestinal tract colonization from birthto To colonizethegastrointestinal tract, bacter Similarly toothermicrobial ecosystems, theestablishment ofthepiggut
First colonizers 2.1. Developmentoftheintes fferent bacterialspeciesof erial and host origin. The main factors affecting the erial andhostorigin.Themainfactorsaffectingthe each section(Leeetal.,1984; Introduction themost recentmicrobiological works. in thelumen, mucuslining andcryptspaces, theadultpig(vanKessel etal.,2004). ofdigesta,pH, molecular oxygenand ghest countsinthe caecum and thecolon. 6 al.,1993).Accordingly,pigmicrobiota exposed toahugevarietyofmicrobes. Ina lves afirstcolonizi roughout thegastrointe y, thepresenceof gutreceptors, nutrient d bybacteria,followeddifferent finally inacharacteristic anddynamic e, orifnot,byattachment tothegutwall tinal microbiotaafterbirth , fecesandskin ofthemother, aswell stinal colonizationofthe piglet’sgut oups become predominant. Thisprocess ial populationneedtobestableinsize et al.,1999).Itisinfluencedalsoby dual (Rolfeetal., indigenousmicro-organisms ng phaseduringwhich Simpson etal.,1999). 1996;Zoetendalet stinal tract(Berg, Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW CFU/g colonic 9 e change in gut e change in gut bacteria metabolic fingerprintings fingerprintings metabolic bacteria r, in the following days, simplified r, in the following days, simplified nds with the first week of life, thends with the first week of life, ) demonstrated that there was a high that there was ) demonstrated associated with the mother and the associated with the mother and nization is extremely fast; only twelve fast; nization is extremely . However, in a few days, microbiota few days, microbiota . However, in a inal environment (by consumption of (by consumption of inal environment re different from sow and characteristic re different from three different marked phases in the three different marked ns from entering the gut (Brandtzaeg, ns from eir dams during the early stages of the during the early stages eir dams gradually supplanted by strict anaerobes, digestive tract are very diverse, reflecting diverse, tract are very digestive Although not only th ght be a key factor in this adquisition and and in this adquisition ght be a key factor d that the establishment of the adult fecal the adult fecal of the establishment d that the sow and the from anaerobes ltative
grows (Conway, 1994; Favier et al., 2002; grows (Conway, 1994; Favier et 7 remarked a comprehensive work by Swords a comprehensive remarked onfirmed that piglets can consume up to 85 g that piglets can consume up to onfirmed distal colon reaches counts of 10 counts reaches distal colon Jensen et al., 1998). nal adaptation to dry food. First colonizers modify the gastrointest First colonizers modify In this first phase, aerobes and facu The first bacteria detected in the piglet in the piglet The first bacteria detected environment (Ewing and Cole, 1994). Howeve environment with more complex will become which characterized, been have profiles microbiota increasing its diversity as the animal time, within evolution fecal microbiota studied pig Figure 2.1) who (1993; and co-workers life, and conclude of the first four months process with flora is a large and complex comprising 80% of the total bacterial groups, the predominant become environment flora by three hours after birth. The gut colo content (Swords et al., 1993; favorable for it more molecular oxygen and reduction of the redox potential), making the following colonization by anaerobes. of these first Calostrum is involved in the substitution bacteria. environment immunoglobulins also act excluding antige 2002). As a result, aerotolerant bacteria are the miscellany of the microbial populations microbial of the the miscellany be may Inoue et al., 2005). In this regard, first phase correspo bacterial succession. The the end first of the second one, from to conclusion of suckling, and the third week weaning to fi phase from hours after birth, total bacteria in for each individual (Katouli et al., 1997). et al., 1997). for each individual (Katouli future microbiota development, as it is c as development, microbiota future mo in the piglet and become patterns change Chapter 2 Chapter of comparisons 1997). Recently, (Conway, (1997 Katouli and co-workers by determined th among the flora of piglets and similarity for flora gut the of source the initial were sows that therefore confirming life, animals feces mi the mother’s piglets. In particular, and Gleed 1981) (Sansom of feces per day
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 100 10 12 10 20 30 40 50 60 70 80 90 0 2 4 6 8 0 spp. and 1993; Figure2.1(A)). and 48hafterbirth,pigletsal Swords etal.,1993). birth to120daysoflife(adapt 0 0 h h Figure 2.1(B). Figure 2.1(A).
6 6 h h
12h 12h 100 120 Bacteroides 20 40 60 80 Total bacteria,log Clostridium 0
2 2 d d 0h 4 4d d
spp. , %Total bacteria spp.,%Totalbacteria 3h
6 6d Evolutionofaerobicandanaerobic d Totalbacteriacountsandpercentageofcoliforms, 6h spp. inpiglet fecesfrom birthto120 daysofage(adapted from 10
8 8 MF UFC/g d d 9h
10d 10d 12h
20d 20d 24h AEROBIC ANAEROBIC ANAEROBIC AEROBIC ed fromSwordsetal.,1993). ready show90%ofanaerobic 2d 30d 30d 3d 90d 90d 4d 5d 8 6d
100 100 10 20 30 40 50 60 70 80 90 10 20 30 40 50 60 70 80 90
0 0 7d 0 0 h h 8d 6 6 h h 9d 12 12
h Clostridium h Coliform bacteria, % Total bacteria %Totalbacteria Coliform bacteria, 10d bacteria inpigletfecesfrom 2d 2d 15d bacteria (Swords etal., 4 4 20d d d spp. , %Total bacteria , %Total bacteria spp. 25d 6 6 d d 30d
8d 8d Literature review 60d 1 1
0d 0d Bacteroides 90d
20 20 d d 120d
30d 30d
90d 90d
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW , , Clostridium Fusobacterium increases in this increases in this , ssociated disrupted during the first week first the during Dividich and Herpin, 1994) Eubacterium Pluske et al., 1997) which lead to unstable, with a marked decrease in decrease in unstable, with a marked anaerobic bacteria anaerobic bacteria al structure with a CFU/g digesta (Swords et al., 1993; CFU/g digesta 9 completed in this phase. As has been completed ental and nutritional changes (Fraser et ental and nutritional changes rly and suddenly weaning, usually at rly and suddenly weaning, usually s (Jensen et al., 1998). In this regard, and streptococci become the dominant the dominant become and streptococci occi continue being dominant bacteria, occi continue being dominant . As a consequence, from their mother (Drasar and Barrow, (Drasar and Barrow, their mother from changes in the microbiota as substrate substrate as in the microbiota changes tion of aerobic and facultative anerobic tion of aerobic , the piglet is subjected to complex social to complex , the piglet is subjected -10
7 d 24 days after weaning (Inoue et al., 2005; terms of species composition during the the during composition species of terms 9 spp. are also usually found in this second phase spp. are also usually found in this s refrain from eating (Le s refrain from , and low densities of of , and low densities et al., 1995, 1999; Figure 2.2).
Streptococcus and bifidobacteria ,
Weaning: the adaptation to dry food Weaning: the adaptation to dry
As a result, weaned piglet In particular, anorexia leads to rapid Modern pig production involves very ea Modern pig production involves Microbiota remains fairly stable in stable in fairly remains Microbiota Of these bacterial groups, lactobacilli lactobacilli bacterial groups, Of these three or four weeks of life. At this moment weeks of life. three or four and litter-mates from separation its mother, from separation changes, including counterparts, environm exposure to unfamiliar al., 1998). and concurrently, profound changes in intestin functional capacity take place (Hampson, 1986; growth stasis (McCracken (Radecki and Yokohama, 1991; Swords et al., 1993). 2.1.2. depletes fermentation available for microbial Propionibacterium especially becomes the microbiota postweaning and Melin, 2001) which will be restored after a biodiversity (Wallgren reestablishment period of two or three week increases in biodiversity have been reporte Figure 2.3). mentioned before, lactobacilli and streptoc before, lactobacilli and mentioned second phase when the piglets receive milk second phase when et al., 1998). The diversity of 1985; Mathew al., 2005) and supplanta period (Inoue et almost becomes anerobic bacteria bacteria by diet. the milk from substrate to utilize which are well adapted Bacteroides Ewing and Cole, 1994). Ewing and Cole, Chapter 2 Chapter whole the for maintained will be and life of week the first of at the end bacteria with counts of around 10 suckling period
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW of culturablebacteriafrom thelargeintes agrees withJensen(1998) whofoundthat one ofthemain bacteriapopulationsin anaerobes by members ofthegram-negative genus pig gutcolonizationis characterized 2002), withmarked changesinsomecharac pig gutcolonizationprocess 1998; Konstantinovetal.,2004a). are describedimmediately afterpiglets the keyfactorinmicrobiota change; the main energysourceinsteadoflipids, There isadecreasein totalculturable Swords andco-workers(1993)definedwean INMATURE DIGESTIVE DIGESTIVE INMATURE BACTERIAL OVERGROWTH MICROBIOTA UNBALANCE BACTERIAL OVERGROWTH MICROBIOTA UNBALANCE SYSTEM OPPORTUNISTIC Figure 2.2. INFECTIONS Reviewdiagram ofpiglet POST-WEANING SYNDROME POST-WEANING with theintr • MULTIPLE CHALLENGES Nutritional Social Environmental Social Nutritional GROWTH STASIS FASTENING PERIOD FASTENING PERIOD MALABSORPTION MALDIGESTION MALDIGESTION WEANING by thesupplantation ofthegram-positive oduction ofsolidfoodw STRESS and more complex chemical composition as 10 are weaned(Mathewetal.,1996;Jensen, STRESS major quantitative andqualitativechanges the adultpig(Swords etal.,1993).This immediately afterweaning,themain part tine weregram-negative. Thereisalso teristics groups.Also,thethirdphasein bacteria after weaning (Franklin et al., al., et (Franklin weaning after bacteria ing asthestartofthirdphasein s post-weaning challenge. Bacteroides VILLI HEIGHT VILLI HEIGHT MORPHOLOGICAL CHANGES MORPHOLOGICAL CHANGES MORPHOLOGICAL POST WEANING DIARREA WEANING POST whichwillrepresent INMATURE INMUNE ith carbohydratesas Literature review Literature review SYSTEM CRYPT DEPTH CRYPT DEPTH
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
immediately following immediately following of bands obtained by Temperature of bands obtained by Temperature ation parallel with an increase in with an ation parallel obacilli in the intestine, and a 50-fold a 50-fold the intestine, and in obacilli
ood and Hampson, 2003; Pluske et al., fact, abrupt weaning has been associated fact, abrupt weaning sceptible to overgrowth with potentially with potentially sceptible to overgrowth (Huis in’t Veld and Havennar, 1993). (Huis in’t Veld
uption in the period uption in the period 11 mmercial weaning (Mathew et al., 1993, 1996; et al., 1993, weaning (Mathew mmercial Dendogram based on TGEE profiles of one piglet. based on TGEE profiles Dendogram (B) (TGGE), of the intestinal microbiota in piglets from (TGGE), of the intestinal microbiota y 25 (Inoue et al., 2005). Escherichia coli Escherichia Diversity, expressed as number Diversity, expressed as number B A Figure 2.3. (A) The main result of this microbiota disr The main result
Chapter 2 Chapter popul in lactobacilli a decrease described of co as a consequence enterobacteria Franklin et al., 2002). In Jensen et al., 1998; of lact drop in the numbers with a 100-fold su more become piglets weaning is that pathogenic bacteria (Hopw disease-causing 2003). increase in the numbers of increase in the numbers Gradient Gel Electrophoresis birth to 14 days after weaning. Weaning takes places on da
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 1989). Severalhundredanaerobic environment divers forthedevelopment ofa digesta flow,theneutralpHandlo characterized byahighdiversepopulation.Th bacteria described (Conway,1994; Enterobacteria (Jensen andJorgensen,1994). gastrointestinal tractis considered atran pH resultinanincreaseddensityanddi upper sections.Theslowerpassagerate,th Bifidobacterium lactic acidbacteria,other gastrointestinal tract(mai probably thereasonwhythesebacteriab Gaskins, 2003)withtotalcountsof more than10 surface ofthestomach (parsoesophagea) ability of bacterial washoutrestrictthe and Jorgensen, 1994).Theacidicconditions, the 2.1.3. and peptostreptococci.The gr colon aregram-positive anaerobes: streptococci, lactobacilli, eubacteria, clostridia Cole, 1994).Themajority oftheculturable bacteriadescribed inthepigcecumand compared withthelower gastrointestinal tract (10 stomach tothececum (EwingandCole,1994). well asbyhostgenotypewithanincreasing et al.,2000).Thisadultmicrobial “climax” is became stable and characteristic foreachin The cecumandcolonarethemajor sitesfo The stomach andsmall intestine contai After weaning,thenormal adultfloradevelo In thedistal small intestine,theenviro
Autochthonous microbiota intheadult pig
lactic acidbacteria to , BacillusandBacteroides arealsofound(Melin,2001;Conway,1994). nly lactobacilliandstreptoc groups likeenterobacteria, am-negative bacteriacove associate with thestratifiedsquamous epithelial Jensen, 2001;Hilletal.,2005). bacterialspeciescoex Lactobacillus, Strepto population inthesesections.However,the 12 ecome thepredominantgroupinupper spp. arethemost sition zoneprecedingthelargeintestine nmental conditions slightly differ form the w redoxpotentialconstitutetheperfect dividual (Zoetendal et al.,1998; Simpson e greateramount ofdigestaandahigher versity ofbacteria. gradient ofindigenousmicrobes from the e andstablemicrobiota (FontiandGouet, influenced byenvironmental factorsas n relativelylownumbers ofbacteria allows theircolonization, andthisis r bacterialfermentation inthe piggut, e highamount ofsubstrate,theslow ps and,inthehealthyadultanimal, it rapid flowofdigestaandtherate 7
11 -10 -10 9 Clostridium 12 CFU/g fresh matter, in Jensen CFU/g freshmatter, inJensen occi; Jensen,2001).Beside CFU/gdigesta(Ewingand r onlyabout10%oftotal ist (Prydeetal.,1999;
ccoci, Clostridium, important culturable This section of the , Eubacterium Literature review Literature review and
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW groups Prevotella
and and family . This confirms again the from the pig gastrointestinal tract tract gastrointestinal the pig from Bacteroides ve greatly increased our knowledge of ve greatly increased our knowledge of out an experiment where the pig where the pig out an experiment crispatus, L. fermentum, L. johnsonii, L. crispatus, L. fermentum, L. johnsonii, the sequences amplified were unknown were the sequences amplified
morbillorum, S. intermedius, S. durans, S. suis, B. therophilum, B. pseudolongum suis, B. therophilum, B. pseudolongum 13 B. furcosus, B. pyogenes, B. amylophilus B. amylophilus B. furcosus, B. pyogenes, Enterobacteriaceace ystems that we still have today. ystems Bacteria ively described by 16S rDNA sequencing. antarum, L. delbrueckii, L. salivarius antarum, L. delbrueckii, L. salivarius 9; Moore et al., 1987; Table 2.1). et al., 1987; Table 9; Moore bacterial genera or species bacterial genera or C. welchii, C. perfringens E. hirae. E. faecalis, faecium, rity to any sequences in the database and therefore may in the database and therefore may any sequences to rity ., 1999, in alphabetic order). ., 1999, in alphabetic isolates belonging to the belonging to the isolates itzii, F. necrophorum itzii, F. necrophorum and other members of the members and other Main bacteria traditionally cultured cultured traditionally Main bacteria Table 2.1. Surprisingly, they found that 83% of Recently, advances in molecular biology ha biology in molecular Recently, advances Butyribibrio sp., B. fibrisolvens sp., Butyribibrio Clostridium sp., C. putrificum, E. Enterococcus sp., E. avium, Escherichia coli Bacteroides (Prevotella) ruminicola B. uniformis, Bacteroides fragilis, B. suis, Bifidobacterium adolescentis, B. boum, B. Bifidobacterium adolescentis, B. boum, L. reuteri, L. pl amylovorus, agilis, L. Megasphaera elsdenii Pediococcus halophilus Peptostreptococcus anerobius acnes, P. granulosum Propionibacterium Ruminococcus sp., R. flavefaciens S. S. bovis, Streptococcus sp., S. salivarius, Eubacterium sp., E. tenue, E. lentum, E. cylindroids, E. rectale E. lentum, E. Eubacterium sp., E. tenue, Fibrobacter succionogenes Fusobacterium prausn L. sp., L. acidophilus, L. brevis, Lactobacillus equines, S. intestinalis
(adapted from Stewart et al (adapted from Stewart ecos microbial regarding high ignorance (Russell, 1979; Salanitro et al., 197 1979; Salanitro (Russell, an elegant be remarked work by Leser and ecosystem. In particular, may this complex co-workers (2002; Table 2.2), who carried was extens gastrointestinal microbiota of simila a <97% because had represent yet-uncharacterized
Chapter 2 Chapter bacteria, mostculturable
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW GI tractswereaffiliated(a which phylotypes wereaffiliatedareshown. Bacteroides the low-G+Cgram-positive division (81%), agreed toagreatextentwithculturere b a becomes more susceptibletoovergrowthw succession withbothquantitativeandqualitat weaning, stresses theanimal resulting in birth, whenenvironmental bacteriabegi successional processthatisinfluencedbyseve sequences intheRDPalignmentversion7.1. Mean similarity ofallthe Meansimilarity affiliate phylotypes Phylogenetic grouping accordingto the Ribosomal DatabaseProject. Flexibacter-Cytophaga-Bacteroides subdivision Bacillus-Lactobacillus-Streptococcus Clostridium Eubacterium ihGCbcei 4 93.5 86.4 4 2 Anaerobaculum thermoterrenum Flexistipes sinusarabici Planctomyces Clostridium purinolyticum Spirochetes andrelatives High-G+C bacteria Mycoplasma Sporomusa Proteobacteria 20 94.8 Table 2.2. Despite thishighpercentageofunknown The establishment ofthepiggastrointestinal microbiota isalargeand and Phylogenetic group adrltvs 5 94.7 15 and relatives adrltvs 0 92.2 109 andrelatives adrltvs 78.6 8 and relatives adrltvs 2 93.0 125 andrelatives Majorphylogeneticlineagestowh adrltvs 86.0 1 andrelatives Prevotella asmlg 1 85.9 1 assemblage gop 94.4 1 group dated fromLeseretal.,2002). groups.InTable2.2,themajor phylogeneticlineagesto a
gop 84.3 1 group gop 2 87.5 42 group
sults. Themajor phylotypesfoundbelongedto Summary 14 n gutcolonization.However,commercial d tothat groupto therelated mostclosely ith potentiallydisease-causing pathogenic
No. ofphylotypes a disruptioninthenaturalbacterial bacteria, functional ive changes. Inconsequence, thepig and11.2%wereaffiliated to the ral factors.Itstartsimmediately after detected detected ich thephylotypesfrom theporcine 46 96.7 groups ofbacteria Similarity (%) Literature review Literature review b
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
, Eubacterium and in the healthy healthy and in the group as the main bacteria. group as the main Bacillus-Lactobacillus-Streptococcus colonization continues colonization
15 Cytophaga-Flexibacter-Bacteroides and bacteria belonging to the and bacteria subdivision and the subdivision and Chapter 2 Chapter the normal After this alteration, bacteria. Clostridium adult pig becomes a stable and characteristic ecosystem with characteristic ecosystem and a stable becomes adult pig
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW bacteria andhavebeenlargelystudiedby intestinal massperunitlengt microflora-associated characterist and biochemical changes,attributedto mainly mice andrats.Comparisons havede in asterileenvironment, withthesame 1996; Falketal.,1998).These 2.2.1. to theestablishment ofthegutbarrier,nut and thehost,payingspecialattentionto (Darveau etal.,2003). “mutualism” more thana“commensalism” as ithas been traditionally described bacteria, making therelationshipbetween contributions arereciprocated even inmodulating genehostexpressi immunity development (Pabstetal., pathogens andplaysimportantrolesin metabolic unitthatprovidesessentialproducts total mammalian cells(VanKesseletal.,2004).Thisecosystem isanactive 2004) withapproximately 10 1000 differentbacterialspeciescolonizeth community ofnon-pathogenicmicro-organi Morphologic changesfound intheabsence Gut microbiota influencesgutstructure, gutharborsacomplex, dens The mammalian This chapter focuses ontheimportance of the interaction between the microbiota
Effects of indigenous bacteria ongutmaturation anddevelopment 2.2. Mainfunctionsofthein h, intestinalthicknessand 14 by the provision of stableniches intheintestine for the bacteria (Pickard etal.,2004) effects aredirectlydueto ics (MACs;Midvedt,1989;Box2.1). 1988), nutrientdigestion(Wostmann, 1996)and Introduction on (Hooperetal.,2001).Thesephysiologic speciekeptusingconventionalhusbandry; the roleofbacteriaongutmorphology, and rient digestionandimmunitydevelopment. 16 comparing germ-free animals bredandkept gutmorphology(Coatesetal.,1963), the microbiota, that havebeencalled monstrated severalanatomic, physiologic digenous microbiotainthegut e adultintestine(N
sms. Studiessuggestthatbetween500- the hostand itsmicrobiota atrue functionandmaturation (Bergetal., tothehost,forms of microbiota include: a reductionin e, dynamic andspatiallydiversified
length (Wostmann, 1996),and thepresenceofcommensal , tenfoldhigherthanthe overr andHuffnagle, a keybarrieragainst Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW l is modulated by l is modulated by rly to some other rly to some ted to thinner villi has been seen that after has been e barrier, other commensal-non e barrier, other commensal-non ts are the reflection of a reduced ts are the reflection of a reduced . contents of a conventionally raised contents of a conventionally raised clear cells (Van Kessel et al., 2004)clear cells (Van the effect of these same bacteria in a the effect of these same crobiota is also rela tion of each individua t-Duke (1986) demonstrated that the that the demonstrated t-Duke (1986) due to the accumulation of undegraded of due to the accumulation The reduction in intestinal mass can be be can mass in intestinal The reduction some commensal bacteria such as bacteria commensal some al., 2005), has also been related to the 2005), has al., toxins (García-Lafuente et al., 2001). In toxins (García-Lafuente et al., 2001). ., 1994). One possible cause of this effect of this cause One possible 1994). ., may impair colonic barrier function and colonic barrier function and impair may ity of the lamina propia which contains which contains propia lamina ity of the intestinal epithelium of germ-free animals animals germ-free of intestinal epithelium crobiota fermentation. Different research crobiota fermentation. as well as local reflexes and myogenic as well as local reflexes and myogenic
e monocolonization of germ-free rats with of germ-free e monocolonization al morphology. Recently, Lafuente and co- al morphology. 17 alk et al., 1998). Simila the presence of ., 1996, 1997). Similarly, e digesta is moved by peristalsis along the by peristalsis along e digesta is moved of cells (Alam et al., 1994). However, not all bacteria of cells (Alam bed in germ-free animals, it animals, germ-free in bed consequence villi:crypt ratio increased (Umesaki et al., al., et (Umesaki villi:crypt ratio increased consequence lack of microbiota stimuli on immune response. On the stimuli lack of microbiota ect of short-chain fatty acids on gut motility, including including gut motility, fatty acids on ect of short-chain Escherichia coli Escherichia as one of the main bacteria in the pig gastrointestinal tract pig gastrointestinal tract in the bacteria the main as one of Peptostreptococcus micros Peptostreptococcus may improve the tightness of th the tightness improve may The presence of bacteria in the gastrointestinal tract also affects its motility. In its motility. In affects tract also bacteria in the gastrointestinal of The presence At a histological level, the absence of mi the absence level, At a histological colonizing the animals with the normal caecal with the normal colonizing the animals al et (Huseby the motility is restored animal, be related with end-products of mi may groups have studied the eff pathways humoral and neural systemic upper gastrointestinal tract is slower (F et al 1985; Cherbut responses (Yajima, the presence of the others. the rate at which th animals, germ-free descri characteristics usually lactobacilli, described (Hill et sections particularly in the gut upper Lactobacillus pathogenic species such as luminal to increase the colonic permeability epithelium species on the intestinal isolated bacteria of effects individual this, spite of representative of are probably not completely where the func ecosystem microbial complex workers have demonstrated that whereas that workers have demonstrated Chapter 2 Chapter a thinner mucosa. with caecum an enlarged reduced cellular a manifestly by explained cells, and mononu plasma fewer lymphocytes, be related to the which may is of the caecum other hand, the enlargement et al., 1970). Carlsted mucus (Gustaffson be easily reversed by th can enlargement bacteria the mucolytic and shorter crypts, and as a 1996). The shorter cryp 1993, 1995; Wostmann, rate in the index and a cell turnover mitotic with a reduction in the number effects on intestin species exert the same
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW development, there isanotherdirecteffect 2.2.2. (Tannock etal.,1999). lactic acid (which isproduced bythese genera) isabletostimulate intestinal motility microbiota effect ongut motility. Moreover, Besides theindigenous microbiota MORPHOLOGICALCHARACTERISTICS Box 2.1.
Establishment ofthegutbarrier Delayed immuneresponseagainstantigenicchallenge Delayed response imflammatory Decreased of intraepithelialTcells number Decreased Decreased numbers ofinmunoglobulin-A-producing lymphocites inlamina propia Decreased serum immunoglobulins levels patchessize Peyer’s Decreased Decreased lymph nodeandspleensize acidsLack ofshort-chainfatty No bileacidtransformation inintestines Kandvitamin sintesisofvitamin Bcomplex Decreased Decreased regionalblood flow output cardiac Decreased metabolic rate basal Decreased Increased oxigen levels patterns enzyme mucosal Altered Decreased rateofvillu motilityDecreased intestinal Decreased blood volume ofliver,heart,adrenals… size Decreased Thinner lamina propia Thinner intestinal villi surfacearea Decreased ofintestinalwall weight Decreased cecum size Increased Characteristicsofgermfree rodents PHYSIOLOGICAL/BIOCHEMICAL CHARACTERISTICS CHARACTERISTICS PHYSIOLOGICAL/BIOCHEMICAL with anindigenousmicrobiota (Bergetal.,1996). IMMUNOLOGICAL CHARACTERISTICS CHARACTERISTICS IMMUNOLOGICAL s epithelial cellrenewal and colonization resistance 18 that isessential for theprotectionof the
contribution togutmaturation and in vitro compared withconventionalrodents studieshavedemonstratedthat Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW ns (Coconnier et nt and thus in the t and the bacteria, t and the bacteria, esses colonization esses colonization nisms or indigenous or indigenous nisms ce that is a first line of is a ce that Hooper et al., 1998). This Hooper et al., 1998). ainst enteropathoge (Freitas et al., 2002). Special interest resistance are diverse: the peristaltic resistance are diverse: r gastrointestinal tract (Alander et al., r gastrointestinal tract (Alander (Schiffrin et al., 1997) and also the (Schiffrin et al., 1997) and also of bacterial attachme receptors by the hos tial pathogenic orga . Bacterial-mucose attachment appears attachment appears . Bacterial-mucose ric mucosa (Elliot et al., 1998). ric mucosa e enzymes and electrolytes; the secretion the secretion and electrolytes; e enzymes the other hand, indigenous microbiota the other hand, indigenous microbiota ng for epithelium receptors (Blomberg et (Blomberg receptors ng for epithelium the gut associated lymphoid tissue; and the gut associated lymphoid lex interacting mechanisms of both the of mechanisms lex interacting
ycoconjugates on the gut enterocytes and genous microbiota suppr genous microbiota determines microbiota composition and and composition microbiota determines 19 eriocines (Brook, 1999) and metabolizing eriocines (Brook, 1999) and metabolizing et al., 2000; Lievin et al., 2000). et al., 2000; Lievin et al., 2000). ndigenous microbiota composition and different composition ndigenous microbiota and enteric nutrients (Stewart et al., 1999), producing and enteric nutrients (Stewart et al., 1989; Rolfe et al., 1996; al., 1989; Rolfe ognition and adhesion to receptors is not only a ognition and adhesion to receptors ocess named colonization resistan colonization ocess named tagonistic activity ag ctive environment which is generally unfavorable for the the for unfavorable which is generally environment ctive The host factors involved in colonization The host factors in the control Several factors are involved Moreover, bacterial rec Chapter 2 Chapter invaders. The indi pathogenic host against a pr by bacteria of incoming defense against invasion by exogenous, poten defense against invasion of mucus; epithelial cell desquamation; epithelial cell desquamation; of mucus; opportunists (Van der Waaij et opportunists (Van several different comp process involves host. bacteria and the digestiv the secretion of diverse movement; 1993). On secretory IgA (Stewart et al., nutrients to create a restri (Fons growth of many enteric pathogens especially in the uppe colonization, permanent an 1999). It also determines system al., 1993), modulation of the immune gast of healing in the damaged improvement profile modulation of the indigenous microbiota of is nowadays focused on genetic modulation chapters following as we will see in the consequently as a key point defining i recognition to the essential are components Two main functions. bacterial-mediated between the host and the bacteria: the gl bacterial adhesins. prevents bacterial colonization by competi colonization prevents bacterial et al., 1994) al., 1993; Bernet as bact such compounds antimicrobial for colonization, which prerequisite
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW attachment ofnewly incoming bacteriapot indigenous bacteriaarerecognizedbythes recognition sitesforadhesionofbothco macromolecules andthedifferentlinkingwa Julien, 1987). attached totheoxygenatomoflateralch of thelateralchainasparagine whereas glycoproteins. InN-glycoproteins the oligos glucose andxylose.Theseglycoproteins N-acetylgalactosamine, fucose,N-acetylneur typesofcarbohydrateareinvo 1989). Different consist ofapeptidecorewithmany longsi mucins arethekeymolecules inthebact et al.,1995;Matsuo1997).Thesehi with othercomponents suchaswater, covalent interactionsbetweenlargeandhi epithelial surface (Specian a continuouslayer(100-200µm inthickn colonization resistanceproce is also essential in the mechanisms of bacterial colonization andtherefore in the and physicalinjury(ForstnerForstner barrier between thelumen contentandthe microorganisms tomucosal surface 2.2.2.1. establishment inthegut(LuandWalker, 2001). carbohydrates enablessome bacterialgroupsto The structural diversity ofthese carbohydrate structures on mucin Mucus issecretedby The gastrointestinalepithelium iscove In additiontothecolonizationresistan
Glycoconjugates ofthemucosa
specialized epithelial and Oliver, 1991). Themucus isthe resultfrom non- ss (vanDijk,etal.,2002). (Forstner andForstner,1996). peptides andsurfact as specific attachment site 20 ghly hydratedglycoconjugatesthatco-exist , 1994).Thepresenceofthismucusbarrier inO-glycoproteins theoligosaccharide is mmensal andpathogenicbacteria.When mucosa againstchemical, microbiological erial recognitionbytheenterocytes,and red by a layer of mucus, which forms a red byalayerofmucus,whichforms a de-chains ofsugars(MantleandStewart, accharide isattachedtothenitrogenatom e receptorsandoccupythose,avoidthe ain ofserineorthreonine(Mouricoutand entially pathogenics ess, Pullanetal., gh molecularweight glycoconjugates or t effect, theabilitytobind tomucin ys, becomes inahugedifferenttarget aminic acidor sialicacid,mannose, cellscalledgobletce are classifiedaseither N-orO- colonizethemucus layer,favoringits lved: N-acetylglucosamine, galactose, ant phospholip 1994) overlayingthe , retardingaccessof lls andconsistsof Literature review Literature review ids (Kindon
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW 1,2 α
and the mice and the mice microbiota to microbiota quantitatively and tal development in tal development et al., 2002) and llular glycoconjugates 2,6 sialylation to α microflora influences themicroflora mucins, and similarly some and similarly mucins, on the ability of on the ability pecian and Oliver, 1991), the pecian and Oliver, Stewart et al.,1999). tion pattern, both erefore, the gut microflora appears to appears to erefore, the gut microflora administered (Kotarski and Savage, (Kotarski administered acher, 1995). These factors result in acher, 1995). These cell maturation. Immature goblet cells Immature cell maturation. and as they mature and migrate to the to the and as they mature and migrate glycans (Freitas rrow et al., 1980), the age of the host rrow et al., 1980), 1,2 fucosyltranseferase (Bry et al., 1996). lphate contents of glycoconjugates when lphate contents of glycoconjugates terations in fucosylated glycoconjugate s occurs during postna α esence of bacteria (DDai, unpublished esence of bacteria (DDai, unpublished
e (Specian and Oliver, 1991). Age related e (Specian and Oliver, 1991). 21 testinal niche (Umesaki et al., 1995; Freitas testinal niche (Umesaki 1993). Turck and colleagues (1993) found 1993). Turck and colleagues (1993) (Hooper and Gordon, 2001). Sharma and (Hooper and Gordon, 2001). Sharma Bacteroides thetaiotaomicron ting production of host ce the “cross-talk process” that take place between the take place between that the “cross-talk process” zation (King, 1995; zation (King, 1995; A progressive change from A progressive change from e presence of a determined e presence of a determined al sites for attachment. for attachment. al sites e the gut glycosyla ted and sialylated types of glycoconjugates by the host. al., 1998), cell maturity (S maturity al., 1998), cell ecial attention has been focused been focused has attention ecial The epithelial cell receptors are host specific and are strongly affected by several are strongly are host specific and receptors The epithelial cell This phenomena forms part of forms This phenomena Recent studies suggest that the host epithelial cell can express specific host epithelial suggest that the Recent studies Different composition has been related to Different composition In recent years, sp Chapter 2 Chapter affecting gut glycoconjugates Factors (Falk et factors: genetics portion of the digestive tract involved (Ba portion of the digestive et al., 1993), and the diet (Dean, 1990; Turck needed for particular genera to join an in et al., 2002), and b) to modulat qualitatively by changing distribution of potenti consequently modifying host and its indigenous microbiota (1995) found that th Shumacher relative proportions of sulpha signals, in the an exchange of biochemical have demonstrated investigations recently between of soluble molecules, form This factor could cause al enterocytes. production through the induction of a host 1979; Turck et al., 1993; Sharma and Shum al., 1993; Sharma 1979; Turck et to coloni changes in susceptibility responsible for: a) initia be the most glycoconjugates in response to the pr glycoconjugates in response fucosylation of microvillar glycoconjugate fucosylation of microvillar et al., pigs (Kelly and King, 1991; King and su differences in fucose, glucosamine piglets. artificially fed suckling with comparing modulate the expression of 2001). Th and Walker, observations, 2000; in Lu produce mucins containing little sialic acid, produce mucins villus tip, the sialic acid residues increas acid sialic villus tip, the changes have also been found.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW altered bybacterialendo-andexo-glycos that involvesmodification ofhostproperties. energetic investment required for theinitiation of thiscomplex metabolic response whether theintestinal environment hasbeen regulatory mechanism wouldallowdifferen host-induced modifications; Hooperandco In addition,itseems thatbacteriahavetheab competing withotherbacteria used as anenergysource bythis bacteria. different bacteria,andalsoprovidecellula These host-inducedmucin modifications ma 2005). chemotactic attraction, andnon-specificattach and inespecificinvolvingcomplex m interaction canbebothsp adherence ofindigenousbacteriatothein has beendone todilucidate themechanisms indigenous bacteriatoglycoc 2.2.2.2. glycoconjugates bythemselves(Hoskins sugars that become available forother adhesion sitesthatmay modify potential oligosaccharide chainofmucins. Thislead a highquantity of glycosidehydrolases, that as aresult, may degradethe strains of outer membrane proteinsandfimbriae (pili) the mucopolysaccharides. Theseelements incl gram negative bacteria(Costerton etal Besides modification ofgene Different bacterialsurfaceel As describedabove,forthepermanent colo
Molecules involvedin Ruminococcus , Bifidobacterium ecific byrecognitionofglyc onjugates isessential.Howe for anichewithlimited resour bacterialadhesion ements areinvolvedintheat tic expressionglycoconjugate et al.,1992;MacFar 22 , testinal mucosa is echanisms includingbacterialmotility, r fucosylatedglycoconjugatesthatmay be This couldbeasele ., 1981).Otherfimbrial structures and Clostridium bacteria thatareunabletodigestthe colonization, andalsoproducessmaller s tothecreationorabolition ofspecific idases. Ithasbeendescribedthatsome adequatelycolonized which aredescribedin of attachment totheintestinal wall,the t bacteriato achieveaconsensuson -workers (1998)demonstrated thata ility todecidethebestmoment tostart y potentiallymodify colonizationof ude molecules ofproteintype,such as ment mucus tothe gel(Kellyetal., nization ofthegut,attachment of and oproteins orglycoconjugates ver, althoughmuch effort ces (Salyersetal.,1982). Peptostreptococcus lane etal.,1999). not entirely known. The not entirelyknown.The tachment ofbacteria to s, mucins may alsobe ctive advantage when advantage ctive beforemaking the the major partof Literature review Literature review hold
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW family, including family, including are polysaccharides are polysaccharides early weaned at 3-5 3-5 at early weaned ternal antibodies by ce of microbiota, the ce of microbiota, ococci presents a linear lk in relation to the host immune lk in relation to the host immune spp. (Knutton et al., 1985, 1987;spp. (Knutton et stinal tract strongly influences the ctures have also been described in ctures have also Enterobacteriaceae reared piglets are underdeveloped, with defects of cell- ae, also called type-1 fimbriae, which called type-1 fimbriae, ae, also onal-reared animals have demonstrated pe adhesines. Most pe adhesines. Most ssive transfer of ma erial stimulus is especially important in important is especially stimulus erial hyperadhesive strains (Abraham et al., et al., strains (Abraham hyperadhesive ., 2003). In the absen active immunity until 4-7 weeks of age of active immunity until 4-7 weeks stem in the correct way and for the whole stem key role in the development of the gut key role in the development urce of antigenic material for the animal. It for the animal. of antigenic material urce
23 et al., 1988). The surface of gram-positive of gram-positive surface The et al., 1988). Salmonella immune system (Kelly and King, 2001). immune system hnott, 1990; Kelly et al., 1994). obiota on immune response t-bacteria cross-ta and and to the cytoplasmic membrane which is known as which is known membrane to the cytoplasmic in the gastrointe glets, that are born with the immune system immature. system immature. glets, that are born with the immune eria, streptococci and staphyl Shigella , K88 (Bijlsma and Bouw, 1987). K88 (Bijlsma E. coli Klebsiella , Effects of indigenous micr Effects of indigenous
Considering this fact and that commercially and fact this Considering Some other bacteria present non-protein ty other bacteria present Some It is well known that the resident microbiota also affects immunity in the host, immunity in the host, also affects microbiota that the resident It is well known Studies comparing germ-free and conventi Studies comparing germ-free Chapter 2 Chapter in some been described have fimbriosomes sensitive fimbri mannose 1985). Specifically, the bacteria from several are associated with Esherichia 1987). Other fibrilar stru Clegg and Gerlach, enterotoxigenic positive gram present in are mainly acids that as lipotechoic the capsule or slime of Contrepois bacteria (Sato et al., 1982; bacteria such as bifidobact polyglycer-phosphate anchored lipoteichoic acid (Poxton and Arbut and do not develop an and milk calostrum (Stokes et al., 1992; Gaskins and Kelley, 1995). weeks, the knowledge of the hos 2.2.3. so major since it is usually described as the completely the immune system is still not when in early life important is especially developed, particularly in pi on the pa Newborn piglets depend completely system acquires special importance. This bact system the immuneearly life, in order to prime sy a functional life life and to maintain that the presence of bacteria immunity of local (Cebra et al., 1999). and systemic and development maturation bacteria play a commensal Particularly, (Fioramonti et al associated immune system tissue is lymphoid mucosal-associated animal
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 1981); andtheimmunoglobulin classprofile macrophage chemotaxis andphagocyticacti and lymph nodesalsodecreaseinsize the lamina propiaaredecreased;andinte mediated immunity(MacDonaldandCarter expansion andtranslocation of the secretory IgA whichpromotes bacterial niches formation butalso limits the and theintraepithelialleukocyt spectrum oflymphoid cells,especiallyIgA interfollicular populations ofTcells; andth Peyer patches; organized lymphoid tissues thatcontainB lymphoid folliclesand community withinthegut lumen andgut on thisfield, itisstillnot cleartheexact mechanisms involved. resident bacteriaonimmune system develo capacity torespondpathogensseems the 2.2.3.1. 2001; Shanahan,2002). immune andepithelialgutcellsmay bebehi also to otherluminal antigens.Thepres natal period isessential fo known. Itseems clearthatth over-react againstindigenousba processing (KellyandKing,1994). complex eventsthatareprobablytriggere still largelyunknown(Cebraet exact mechanisms bywhichmicrobial coloni concentration ofIgGandlowornoproductionIgA(Wostmann etal.,1996). There areseveralhostfactorsinahealt Dilucidation ofhowthecommensalbacteria In asimilar way,theprecisemechanism e marked these Despite
Commensal bacteriatolerance-ignorance r the development of toleranc e immediate acquirement of ffects ofindigenousbacteria es (Cebraetal.,1999;Stoke al.,1999);even pathogens is especially im cteria, andbecomes “toler 24 d followingtherouteofantigenuptakeand (Umesaki etal.,1993;Wostmann, 1996); wall: themucus layerdescribedabove;the stinal lymphoid Peyerpatches aggregates, ence ofpattern recognitionreceptors in e gutlamina propiathatpresents abroad plasmablasts, Tcells, pment. Although much effortisfocused , 1979).Thenumbersoflymphocytesin hy immune systemthatcontrolbacterial nd thisadaptativeprocess(Hooperetal., zation modulates the vity areinhibited(StarlingandBalish, by whichtheimmunesystem doesnot key toclarifythedescribedeffectsof tolerance isestablished, retaining the though itisthoughtthattheyinvolve is alsoaltered, e toindigenousbacteriaand microbiotaduringthepost- onimmuneresponse,the s etal.,2001).Theroleof portant (Bollingeretal., ant” isnotcompletely immune system are and dendriticcells, with much lower Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW ence of difference eliminate it (Netea it (Netea eliminate ler et al., 2002) and ate pro-imflamatory ate pro-imflamatory ., 2001; Schiffrin and ecognized by TLR2; by TLR2; ecognized e it. Therefore, it seems e it. Therefore, it seems on to this first recognition ests that when an indigenous bacteria an indigenous bacteria ests that when sis have been proposed to clarify the sis have been proposed to clarify the ys that control expression of a variety ys that control expression of a variety ensal bacteria (Hal synthesis of antimicrobial peptides, peptides, synthesis of antimicrobial ns and commensal bacteria, a second ns and commensal bacteria, a second reacts against potential pathogens reacts against potential pathogens y be the key in the host ability to cells (Akira et al bacteria by immune and epithelial gut bacteria by immune are also activated to obial peptides produced by Paneth cells by Paneth cells produced obial peptides bacteria are r might be absent in pathogens (Schiffrin be absent in pathogens (Schiffrin might d, it has been recently demonstrated that d, it has been recently demonstrated to bacterial stimulus: lipotheichoic acid to bacterial stimulus: lipotheichoic tolerance by the pres ere is a tolerance against commensal ere is a tolerance against commensal and TLR9 respectively. When a pathogen a pathogen and TLR9 respectively. When ia are recognized by TLR4; and flagellins flagellins ia are recognized by TLR4; and ecular patterns; PAMPs) called pattern ecular patterns; establishment process. It relies on a wide establishment the appropriate response to pathogenic mmensal bacteria. Although the exact mmensal ecognize highly conserved structures of of conserved structures highly ecognize
25 on domain molecules (NODs) and Toll-like molecules on domain phocytes may downregul phocytes may ) postulated that in additi nes (Kopp and Medzhintov, 1999). nes (Kopp and Medzhintov, 1999). e immune system to eliminat e immune system Kopp and Medzhitov, 1999). Kopp and Medzhitov, elial cells to comm However, whereas the immune system However, whereas the The nucleotide-binding oligomerizati The nucleotide-binding Among these host factors, recognition of these host factors, recognition Among mechanism is not known yet, different hypothe is mechanism Blum, 2002), and immediately starts the starts the 2002), and immediately Blum, and dendritic cells cytokines and chemokines, In this regar et al., 2004, Kelly et al., 2005). pathwa transduction signal to TLRs are coupled of inducible immune-response ge evidence sugg recognized by the different TLRs, by TLRs ma recognition bacterial that this between pathogen and co discriminate tolerance process. One explains indigenous that bacteria (PAMPs) in commensal traits 2002). Matzinger (1998 and Blum, by TLRs, that to would be common pathoge also be included to initiate signal might responses by intestinal epith is recognized by a specific receptor, th bacteria. Other studies suggest that lym Chapter 2 Chapter as are the antimicr et al., 2004) 2003; Suzuki in the tolerance- be the key to cells seems (PRRs, recognition receptors of There are several examples receptors. recognition are pattern (TLRs) receptors to respond TLRs that have been described positive gram of and peptidoglycan of gram negative bacter lipopolysaccharides by TLR5 and bacterial DNA are recognized of immune is recognized it results in signaling without signaling th microbiota in the intestinal crypts (Ayabe et al., 2004). et al., 2004). crypts (Ayabe in the intestinal which r specific receptors, repertoire of mol (pathogen-associated microorganisms
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Whereas intheproximal gut,bacterialcomp contribute to thetole members oftheTLRsfamily ontheapicalsurfacesofepithelialcellsmight recently, Kellyandco-workers(2005) suggestedthattheabsenceofsome ofthe 1999). absorption seems tobeaffected(Fulle utilization ofdietarylipidismore efficient.Also, in germ-free animals, whileutilization substrates. Studies comparing conventional to thehostbecauseitextracts dietary residuethatreachth more detrimentalthanbeneficialtothe bacterial interactionwiththehostdiffersin large intestine,wherematerialsareretained compounds thatarenotdegrad 2.2.4. within thebody(Macphers travel onlyfrom Peyer’spatchestothe immune system has.Whendendriticcells epitopes whennecessary.Itcanbeachieve preserves theabilitytomount aneffec induced after intravenous injection of liv against bacteria leavesthegut.They foundthatpa resident bacteria.Itresultsinaneff (2005) demonstrated recentlythatthehostsy tolerance againstcommensalbacteriade The microbiota plays averyimportant ro However, itisimportant to remark that
The roleofmicrobiotaondigest Enterobacter cloacae rance oftheguttowardsitsmicrobiota. on etal.,2005;Figure2.4). e distalgut(mainly carbohydrat (adominantmember ofitscommensalflora)butitwas nutrientvalue from otherw able bythepigendogenousenzy ective immune response when an indigenous ective immuneresponsewhenan r andReeds,1998,reviewedbyTannock, mesenteric lymph nodeswithoutre-circulation ion andabsorptionofnutrients scribed above,Macphersonandco-workers tive systemic responseagainstcommensal 26 host, microbial digestionofnon-digestible e micro-organisms. Bythisway, thehost of polysaccharides islesscomplete, the thogen-free mice didnothavespecificIgG theupperandlowergast forprolongedperiodsoftime. Therefore, with gnotobioticanimals haveprovedthat picks upcommensalbacteria,they can etition forabsorbablenutrientscouldbe d by thecompartmentalization that the stemic immunesystem remains naïve to , in contrast with this local immune le inthedigestionofdietary
amino acidabsorptionandmineral ise poorlyutilizeddietary e polymers) isbeneficial mes, especiallyinthe rointestinal tract. Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
ng access due to the physical due to the physical ng access
27 ely restricted from gaini from ely restricted s barriers (Macpherson et al., 2005). s barriers (Macpherson Intestinal immune geography of responses to commensal bacteria. to commensal of responses immune geography Intestinal Figure 2.4. Figure
epithelial and mucu Chapter 2 Chapter bacteria are larg Commensal
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW through itsactioninthe lumen andonth production isrelatedtoa normal largebowel substrate forcolonocytesandpromotes liver (Montagneetal.,2003).Of tissue (Cummings andEnglyst,1987),prop Acetate reachesthesystemic Wang etal.,2004). gastrointestinal tracttr and chemical structure ofpolysaccharides lower piggastrointestinaltr cecum. Atypicalratioof 60acetate:25pr organic acidinthestomachandsmall intest proportions dependingofthegastrointestinal and xylanases(Salyerset bacteria thatproducesaccharolytic enzymes, 1989). Thedigestionofthosecompounds depe dioxide, methane) (BachKnudsenetal.,1991) high SCFAconcentrations(70to100mM) important in thehindgut (Hillet al.,2005). preferently fermented bylactobacilli(Gra Yen, 1997).Othercarbohydratesubstrates Ruminococcus flavefaciens species as endogenous secretionsofthe of polysaccharidesand ligninand resistant starch which arenotdigestedbythe inability ofmammals toproduceenzymes capab 2.2.4.1. SCFA arerapidlyabsorbedfrom thegut Short chainfattyacidsproductionisaffect The fermentation ofcarbohydratesinthe The fermentation Pig microbiota harbors differe Carbohydrates arethemain energysubstr
Carbohydrate utilizationby Fibrobacter succinogenes ansit time andmicrobiota (A al., 1977;VarelandYen, 1997). , act (BachKnudsenetal.,1991). Butyrivibrio circulation andactsasan gastrointestinal tract(Tro specialinterestisbutyrat nt highly cellulolytic andhemicellulolytic bacterial indigenous bacteria , Fibrobacter intestinalis spp.,and a normal phenotype inthesecells.SCFA 28 lumen andSouthworth,1974). (Argenzio opionate: 15butyrateisdescribed inthe ine, SCFApredominate inthecolonand , lacticacidandga ham etal.,1986) whicharespecially ; substrateredoxandavailability; functionandtoprev e colonicmusculature andvasculature section. Whereas lacticacidisthemain cellulases, hemicellulases, pectinases ed byseveralfactorssuchas:thetype pig colonresultsintheproductionof such as B-glucans and pectins are such asB-glucansandpectinsare nds totally on the activity of different nds totallyontheactivityofdifferent varyinginconcentr le ofdegradingdiet ate forbacteria,asaresultofthe ionate isconverted Prevotella ruminicola llison andMacFarlane,1989; energy substrateformuscle well etal.,1976;Englyst, e whichisthemain energy , ses (hydrogen,carbon Ruminococcus albus ention ofpathology, ary fiber(the sum ation andrelative to glucoseinthe Literature review Literature review (Vareland ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
Clostridium , arrhea is limited is limited arrhea es and aminoacids and aminoacids es ine and isoleucine isoleucine and ine ., 1989; Yen et al., ., 1989; of protein digestion l cells (Yen, 2001). Salmonella rements and colonocytes rements and colonocytes branched-chain VFAs are nance energy requirement requirement nance energy (Prohaszka, 1986; May et rm of protein but also from rm ee conditions compared with with compared ee conditions coming from plasma can be plasma from coming been described. Di been described. ion of protein by bacteria in the small small ion of protein by bacteria in the the colon of germ-free rats (Moreau et the colon of germ-free ia that would diminish their availability ia that would diminish g pigs (Dierick et al g pigs (Dierick tions, high contentrations of SCFA have SCFA of high contentrations tions, no acids valine, leuc species may use peptid species may have found some amino acid degradation have found some amino e intestine proteolytic fermentation is very is very e intestine proteolytic fermentation on changes and becomes more proteolytic more proteolytic on changes and becomes etary nitrogenous compounds as well as etary nitrogenous compounds as
synthesis of their own proteins; this is synthesis of their own proteins; found a similar degree found a similar 29 n, and sloughed epithelia As carbohydrate sources become depleted due become sources As carbohydrate eir contribution to mainte eir contribution and energy. As a result, of pigs reared in germ-fr reared of pigs SCFA to energy pig requi SCFA to energy in opportunistic pathogens as in opportunistic
indigenous bacteria animal health have animal to utilize N not only in the fo growth is inhibited by SCFA sources. In particular, urea Escherichia coli Escherichia Protein utilization by and
In the large intestine numerous bacterial bacterial numerous intestine large In the Microbiota can use nitrogen from di Microbiota can use nitrogen from Besides the contribution of Besides the contribution important in contrast to small intestine. intestine. to small contrast in important fermentati the by bacteria, to fermentation (Piva et al., 1995). other organic or inorganic for the bacteria efficiently utilized by by the high amount of urea found in confirmed Degradat al., 1976; Forsythe and Parker, 1985). to be scarce. Salter (1984) intestine seems to the pig (Gaskins et al., 2001). In the larg as a source of carbon, nitrogen ami by the use of branched chain formed produced by upper gastrointestinal tract bacter difficile al., 1994). 2.2.4.2. the host, muci secretions of enzymatic have the ability also Bacteria intestine the small of at the end conventional pigs, although other authors (MacFarlane et al., 1992). as SCFA stimulate the reabsorption of water and sodium (Roediger and Moore, water and sodium (Roediger the reabsorption of as SCFA stimulate especially in acidic condi 1981), and because, growth of certa been inhibit the 1991; McBurney and Sauer, 1993). 1991; McBurney in nutrition, other implications has been estimated as 15 to 24 % in finishin as 15 to estimated has been Chapter 2 Chapter Th and Clifton, 2001). (Topping
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW faecalis Hylemon, 1997).Ithasbeenfoundthat as certainsecondarybileaci absorption bythehostanimal (Eyssen,1973) microbiota. Microbialdeconj the commensal bacteria. digestion, littleattentionha 2.2.4.3. reducing animal (V performance intestine, with areduced villus height, andmayalsoaffect pigmetabolism thus production hasbeenrelatedtoanimpair bacteria tosynthesizenew not beenconductedonthepig.Anexcessinur Bifidobacterium compounds, mainly bybacteriafrom MacFarlane, 1995).Aromatic aminoacids the abilitytoproduceamines bydecarboxilation ofamino acids(MacFarlane and Bacteroides 1983; MacFarlane etal., 1992;Williams etal potentially toxicmetabolites suchasNH3 rely ontheenergyobtained fr capable of bileacid transformation. Advantages of metabolising thissubstrate may Peptostreptococcus (Tannock etal.,1989). lactobacilli contributeatleas dehydroxilate bileacids.Studieswith Especially importantisthemetabolism of Despite thehighbodyofevidencemi A widerangeofintestinal However, thisproteolyticfermentation canalsoleadtotheformationof Several bacteria such as
, Bacteroides spp Lipid utilizationbyindigenousbacteria , Clostridium genera(MacFarlane spp.and ., , Enterobacterium Eubacterium s beengiventothedigestionandmetabolism oflipidsby protein canleadtoanin ds arecitotoxicandpotential t 74%ofthetotalconjugated Ruminococcus ugation anddehydroxylationof om bileacidtransformation, butmore probablyonthe bacteriapossessureaseac isek, 1984;Nousiainen,1991). and MacFarlane,1995). Clostridium spp.,and Bacteroides 30 , amines, phenolsandindols(Russelletal., E.coli , germ-free mice have demonstrated that are metabolized intophenolsandindols spp.alsohavedifferentdehydrogenases ed development ofthemucosa Lactobacillus andproducetoxicde ., 2001).Bacteria belonging tothegenera ease activitycompared totheabilityof bileacidsproduced bythe intestinal crobial collaborationincarbohydrate Clostridium spp, , , Lactobacillus Bacillus cereus crease inammonia. Ammonia tivity althoughstudieshave ly carcinogenic(Baronand and bile acidhydrolaseactivity Eubacterium lentum spp.havetheabilityto bile acidsimpair lipid Streptococcus gradation products, , Clostridium , Literature review Literature review Streptococcus Streptococcus possess and ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
effects for Bifidobacterium , are also altered by are also altered by and maturation) and and maturation) gnotobiotics rats has gnotobiotics rats a et al., 1981). Differenta et al., 1981). ve demonstrated that a that a ve demonstrated veral beneficial ostanol and coprostanone in als (Fuller and Reeds, 1998, als (Fuller and Bacteroides at is less well absorbed (Yen, at is less well absorbed cholesterol to coprostanol (Baron cholesterol to coprostanol (Baron nation of unsaturated fatty acids, nation of unsaturated
ia during thousand of years. This co- ia during thousand of years. This onjugation of bile acids can affect of bile acids onjugation ota. Germ free rats excrete unmodified free rats excrete unmodified ota. Germ acteria achieve steady niches in the gut, ic (gut evolution with an established balance between the between the balance an established with to the toxicity of some of the compounds of the compounds of some to the toxicity digestion of lipids in digestion of lipids s, and other lipids liffe, 1991). Cholesterol is reduced to liffe, 1991). Cholesterol is reduced
fford which is reciprocated to mammalian to mammalian which is reciprocated fford 31 as protection (immune system development development as protection (immune system Summary genus such as l reared rats excrete copr ary fatty acids as they act as emulsifiers, facilitating facilitating emulsifiers, as act they as acids fatty ary total fecal sterols (McNamar cells. Different studies ha It results in se tween them. at in normally reared anim at in normally Eubacterium e high proportion of stearic acid th e high proportion possess the ability to metabolize the ability to metabolize possess Clostridium Moreover, microbiota increases biohydroge increases Moreover, microbiota Mammals have co-habited with gut bacter Mammals amounts of up to 55% of the amounts been found to be higher th been found to be 1999). reviewed by Tannock, resulting in a relativ sterol et al., 1991). Cholesterol, dietary intestine (Ratc in the large microbiota the microbi coprostanol and coprostanone by cholesterol whereas conventiona bacteria belonging to the and Chapter 2 Chapter due bacteria of competing growth inhibition 1997). Dec and Hylemon, (Baron released of diet negatively the digestion absorption. In this regard, their process of 1997). and Hylemon, a narrow relationship evolution has become eukaryotic and prokaryotic continuous cross-talk exists be both, becoming in a mutualist association. B both, becoming in a mutualist and nutrient a with a stable environment such benefits several host that obtains effect), troph the barrier and homeostasis, nutritional effects.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW commercial pigdietshavebeenregularly antibiotic specificityformi ecosystem andtosubsequent growth promotantantibioticsismainly efficiency (Cromwell, 2002;Mroz,2003).Curren doses toprevent gastrointestinal disorder specific bacterialpopulationsnor (Hillman, 2001)haveledtothe are completely defined(Gaskinsetal.,2002). the EuropeanUnion.Thefirstconsequences restrictive actionsbytheEuropeanUnion diarrhea (Casewell etal.,2003).Inthelight lower post-weaningdailyweightgain manage thepiggastrointestinalecosystem diseases bythemaintenance ofthepi made toseekalternative orreplacement strategies forcontrolling enteric bacterial ecosystem may bethemodification oftheam from thediet;thus, si 2.3.1. young pigs. changes inmicrobiota andin gastrointestinal tractthrough its use.This allowsadirect andsimple controlover theprocess of fermentation inthe Since the1940’s,whenantibioticswere Recent concerns regardingcross-resist This chapter willfocus onthe major feed The main sourceofgrowthsubstrate fo
Macro-ingredients 2.3. Modulationofintestinal equilibrium throughthefeed
ngle and most important control for the bacterial gut crobial populationsdiffer,a pig feedcomposition (Jensen etal.,2003)thatproduces direct andindirecteffects the dominant bacteria inhabiting thegastrointestinal total withdrawalofantibiotic theirexactmode ofacti glet gastrointestinal ecosystem. Introduction and ahigherprevalenceinpostweaning 32 due tomodification ofthemicrobial due s andtoimprove growthrateandfeed fortified withantib were carriedout,huge ance of pathogensinhuman therapy with specialattentiontothoseusedin r thegastrointestinal microbiota comes ofthebanareappearingalready,with ount andtypeofs oftheseresults,andsincethefirst firstusedasgrowthpromoters, strategies that currently areused to tly itisknownthattheefficacyof on thehostanimal. However, on promoting animal growth nd neithertheireffectson s asgrowth promoters in iotics inprophylactic ubstrate available for available ubstrate effortsarebeing Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW granules that are sum of lignin and sum about the specific l of inclusion in the diet in the diet inclusion l of ed by pig gastrointestinal uded in the dietary fiber gelatinised starch nous secretions of the digestive tract tract of the digestive secretions nous rs are the main growth substrates to growth substrates main rs are the complete hydrolysis. The part of this part of this hydrolysis. The complete et al. (1976) as “the es) are the main plant polysaccharides. plant polysaccharides. es) are the main tics chapter as usually are classified in are classified usually tics chapter as nt are the source of dietary fiber (its of dietary fiber (its source nt are the e of microbial fermentation to fiber fermentation e of microbial hydrolysis for three reasons that have trices, thus physically inaccessible to the trices, thus physically inaccessible monogastric animals. It consist of mainly of mainly It consist animals. monogastric
the major substrate for pig gut microbiota substrate for pig gut microbiota the major ill a lack of knowledge t starch, together with NSP reach the lower NSP reach the lower with together t starch, 33 lane and Cummings, 1991, Jensen, 1998). 1991, lane and Cummings, d lignin (Conway, 1994; Bach Knudsen, 2001). d lignin (Conway, 1994; Bach Knudsen, -amylase; and RS3 comprises retrograded starch and RS3 -amylase; y fiber to modulate the gastrointestinal microbiota the gastrointestinal microbiota y fiber to modulate α stinal tract, whilst in the large intestine, where the large intestine, whilst in the stinal tract, accharides can also be incl are susceptible to be hydrolys on and processing) and the leve
The role of dietary fiber The role of dietary
Different factors influence the respons Although the ability of dietar Starch and NSP (non-starch polysaccharid Dietary fiber was first defined by Trowell Dietary fiber was enzymatic host package; RS2 comprises poorly RS2 comprises host package; enzymatic highly resistant to digestion by (Englyst et al., 1992). importa The most the diet. in administered lignificati of degree solubility, (Bach Knudsen and Hanse, 1991; Macfar determined its classification into three main types: RS1 includes resistant starch starch resistant types: RS1 includes three main into its classification determined whole plant cells and food ma trapped within there is st has been clearly demonstrated, enzymes, usually these compounds do not reach usually these compounds enzymes, resistan starch that is not digested, named al., et (Montagne fermentation bacterial to susceptible where are tract gastrointestinal be resistant to enzymatic 2003). Starch may this group (Gibson and Roberfroid, 1995). this group (Gibson and Roberfroid, capable of degrading NSP and, although amylose Pig lacks of endogenous enzymes starch from and amylopectine non-starch polysaccharides (cellulose, hemicellulose, xylans, beta-glucans, fructans, fructans, beta-glucans, xylans, hemicellulose, (cellulose, non-starch polysaccharides pectins) resistant starch an mannans, Although non-digestible oligos exposed in the prebio they will be definition, in the man”. The concept is applied also in is applied also in The concept man”. in the Chapter 2 Chapter suga simple 1994). Specifically tract (Conway, et al., 2001). al., 1991; Hampson (Bach Knudsen et 2.3.1.1. by endoge not digested that are polysaccharides bacteria in the upper gastrointe bacteria is biomass is located, dietary fiber major
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW ATP quantity,and5to9times CO high-fiber dietincreasestotalbacteriaactiv confirmed byotherauthors. VarelandYen activity inallsegments ofthehindgut.M effect ofdifferenttypesandamounts of [ harbors highly active ruminal cellulolytic to adaptby changinginspeciescompos greater SCFAconcentrationinthe growing pigs,compared tocornstarch.Pigs purine basescontent,whenpotatostarch workers (2003)havealso ability ofmicrobiota to adapttosubstrat bacterial enzymatic activitiesinthe lower administration ofdietsrichinmaize or pigs. Inasimilar studyfrom our the amount of totalculturable on barleysupplemented withpeafiberandp agreement, JensenandJorgensen(1994),when changes intotalmicrobial sources andlevelsofwheatoatdiet this regard,BachKnudsenandco-workers ( total microbial loada activity of the large intestin and dosesoffiberinthepigdiet,denoti indigenous microbiota. Different about itsrationalusetopromote thees genus), dietary fiber,themicrobial ecosystem isab utilization fiber bymicrobiota ruminicola Bacteroides succinogenes,B.intestinalis In addition tochanges in total bacteria Several workshaveshownhowincreasesin Ruminococcus flavefaciens,R.al ], whichindicatesthehigh potentialthat nd totalbacterialactivit al microbiota inpigs. found increasesinto activity throughoutthepigga bacteriainthestomach, (Varel etal.,1982,1985). Inresponsetoanincreasein authorshavestudiedtheinfluence ofdifferenttypes hindgut thanpigsfedcorndiet. 2 and CH group (Moralesetal ng changes in thecom es offered.Recently, Martinez-Puig andco- sorghum andacornproducesdifferencesin ary fibrewereadministered,foundmarked 34 ition has also been shown. The swine gut ition hasalsobeenshown.Theswinegut (currently re-classified into the fibreonparticularmicrobial groupsand loads andactivity, the abilityof microbiota ity, asdemonstrated bythe5times greater odulation ofmicrobiotaactivityhasbeen gastrointestinal tract;oncemoreshowing le toadaptbyincreasing totalcellulolitic tablishment ofagut 1991) inatrialwheredietswith different and hemicellulolytic bacterial species 4 (1997) foundthattheadministration ofa y throughoutthegastroin ectin) toadultpigs,foundanincreasein producedinthe gastrointestinal tract of fed thepotato starch dietalsoshoweda (highly resistant)wa administering ahigh–fiberdiet(based bus, ButyrivibrioandPrevotella fibercontentinthedietcanmodify tal bacteriaactiv pigshavetoprofitfrom dietary and ahighertotalmicrobial ., 2002),wefoundthat strointestinal tract.In position andmetabolic healthpromoting s administered to ity, measured as Literature review Literature review testinal tract.In Fibrobacter
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
a E. coli compared to compared tial to accurately land (1998; Table the gastrointestinal the gastrointestinal 52.5 a combinations of these combinations Bacteroides CFU /g dry matter) CFU /g dry 8 and and om fecal samples of sows fed diets diets fed of sows fecal samples om ces of starch (more or less resistant) (more or less of starch ces Moreover, when adult sows were fed when adult sows Moreover, 45.1 in total anaerobic counts when diets when diets in total anaerobic counts b tine content starch, and increases in should have the poten comparison with individual starches, starches, individual with comparison young pigs, shifts in rointestinal ecosystem composition. Reid composition. ecosystem rointestinal monstrated by MacFar monstrated ose/amylopectine ratio and retrogradation ose/amylopectine falfa meal) changes in particular species in particular changes falfa meal)
35 on corn and soybeans; Varel et al., 1984). on corn and soybeans; Ruminococcus had significantly lower coliform and had significantly lower coliform 15.2 b Cellulolytic bacteria (x 10 other two starches. Moreover, fiber (Varel and Pond, 1985). fiber (Varel and Control 20% corn 40% alfalfa 96% alfalfa tion within the gut. Number of cellulolytic bacteria fr bacteria of cellulolytic Number 5 10.1 10.2 34.4 56.5 34.4 10.2 5 10.1 0 14.7 6.0 10.8 14.1 10.8 6.0 0 14.7 14 22.4 17.5 18.8 24.2 71.0 18.8 54.9 41.3 17.5 76.3 105.3 16.9 14 22.4 43.5 16.3 59.3 21 28.4 63.7 32.8 35 27.8 56.5 50.2 49 24.6 9.3 12.5 70 25.0 98 33.3 Overall 23.3 Means with different superscripts differ (p< 0.05) Means with different superscripts differ Days on diet The administration of different vegetal sour The administration a, b Direct modification of starches as amyl of starches Direct modification Table 2.3. and Hillman (1999) found marked decreases (1999) found marked and Hillman with a high amylopec were supplemented containing various levels of containing various starch, potato When species. in bacteria changes with specific related been has also to corn and waxy corn were administered population in relation to the effects in intermediate produced starches suggesting that this form of manipulation popula control microbial the gast has also shown potential to modify Chapter 2 Chapter 2.3). 1985; Table (Varel and Pond, populations al dehydrated diet (35% with a high-fiber of increased numbers were found, with diet (based receiving a low-fiber animals were found, as was recently de ecosystem fed with potato starch 2.4). Animals
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 1998, reviewedbyHillman, 2001). microbiota dependingonth growing pigswithpotatoormaize star demonstrated marked differentmicrobial pa specially withthehighamylopectinestarch. of weanedpigletsfedmeal population, whichwasreflectedin amylopectine-rich starch. Moreover, retrogradation decreases thecoliform Lactobacillus dietary fiberinthedietand consensus is due to controversial results re its inclusioninthediet,pa different typesandamount of diseases. Itiscausedby multifactorial, itisassociated withproliferation of enterotoxigenic haemolytic main intestinaldisorder in the imme weaning colibacillosis andswinedysentery. lower gastrointestinaltract in the small intestine. Ingrowingpigs, sw Enterococcus Lactobacillus oiombcei 19ª 6.93 1.90ª Coliform bacteria Escherichia coli Escherichia coli Bacteroides oa neoe 9.82 Total anaerobes Table 2.4. In asimilar way,arecentwork ofMartínez-Puig and co-workers(2006) a, b Although potentialbenefitsongastrointe Meanswithdifferentsuperscriptsdiffer(p<0.05). Potato sp 7.16 spp spp.,whenanimals werefedadi sp 5.20 9.62 spp. spp. Selectedbacterial counts (CFU/ 1.73ª 6.62 Brachyspira hyodysenteriae e dietadministered. a a a a (Pluske etal.,2002).A few rticularly ofyounganimals, doe 7.43 6.44 8.62 8.66 the occurrenceofgastrointes diets containingdifferentsour fiberaddedintothepigdi Waxy Corn ahighlactobacilli:coliform bc ab ab b b b 8.76 7.88 8.88 7.16 7.43 7.39 diate post-weaningpe 36 ine dysenteryisoneof
garding inclusionofdifferentsources ch. T-RFLP profiles showeddifferent ch. T-RFLPprofiles Post-weaning colibacillosis (PWC) isthe Corn tterns inhingutdigestaafterfeeding stinal microbiota canberelatedto
g wetweight)intheproximal colon ab b b b a c 8.27 5.99 6.11 6.12 10.05 9.67 , whichproducescolitis inthe et richinretrogradationof Potato/ Waxy Corn et, todayconsensusregarding tinal disorderssuchaspost- years ago,itwassuggested ce ofstarch(MacFarland, bc bc ab b a a s notexist.Thislackof 9.67 4.24 8.54 4.69 3.64 9.86 ratioindistalcolon, riod, andalthough Potato/ themost important Corn Literature review Literature review ab ab c a a a 7.17 6.19 9.17 9.56 6.52 7.12 Waxy Corn/ Corn E. coli bc ab ab ab b a
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW r to pigs is that co-workers (2003) co-workers (2003) nd level of inclusion , and thus from swine , and thus from piglets (Geary, 1996; in piglets infected in piglets infected fiber and resistant starch resistant starch fiber and e main characteristics that e main E. coli -workers (1997, 1999, 2001) -workers (1997, such as soluble NSP in weaner diets, such as soluble insoluble fiber limited the severity of the severity insoluble fiber limited content of dietary fibe However, recent studies suggest thatHowever, recent als, type of diet a health by dietary manipulation is the health by dietary manipulation inclusion of fiber in the diet did not inclusion of fiber in the diet did and the occurrence of PWC in piglets occurrence of PWC and the swine dysentery is also controversial. dysentery is also controversial. swine rmic et al., 1998). However, recently rmic et al., 1998). However, recently ) and Lindecrona and ng colibacilosis and swine disentery, the ng colibacilosis and swine disentery, riched diets (guar gum and pearl barley), and pearl riched diets (guar gum ained by mixing dry feed with water and ained by mixing especially weaner ration of fermented liquid feed improves ration of fermented act as fermentation starter (Jensen and and starter (Jensen act as fermentation Different hypotheses have been proposed Different hypotheses have been proposed
ts, wheat, and barley supports protection protection and barley supports ts, wheat, 37 performance negatively. However, negative performance E. coli Brachispira hyodisenteriae Brachispira ey were fed carboxymethylcellulose. ey were fed carboxymethylcellulose. that diets low in dietary stinal proliferation of stinal proliferation rence. McDonald and co rence. McDonald ll these hypotheses end from th ll these hypotheses end from Fermented liquid feed, an example of feed strategy liquid feed, an example Fermented
Similarly, the effect of dietary fiber on the effect Similarly, Regardless of fiber effect on post-weani An interesting strategy to improve pig gut An interesting strategy to improve that administ It has been demonstrated (Thomlinson and Lawrence, 1981) and also the and Lawrence, (Thomlinson Chapter 2 Chapter oa of fiber from administration that the of enteropathogen against proliferation 1978). (Bertschinger and Effenberger, PWC sources, carbohydrate diets high in fermentable post- correlation also have a positive and growth to post-weaning are detrimental occu weaning colibacillosis Different works have reported and in non-infected piglets when th and in non-infected piglets when reported an increased inte reported an increased were fed fiber en when they experimentally infection with prevented pigs from these results, postulating that did not confirm affect swine dysentery disease development. development. affect swine dysentery disease disadvantage of feeding diets with a high main dysentery disease (Pluske et al., 1996a; Du dysentery disease (Pluske et al., Kirkwood and co-workers (2000 works from these materials tend to affect growth tend to these materials the anim on the age of effects depend so much the performance and gut health of pigs, (Moore et al., 1988; Valencia and Chavez, 1997). (Moore et al., 1988; Valencia and Chavez, 2.3.1.2. liquid feed, obt of fermented administration that usually, adding bacteria inoculums Mikkelsen, 1999). Brooks et al., 1996; Scholten et al., 1999). to explain these results. A
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW the potential benefitsoffermented liquid therefore possiblyprobioticla acid bacteriaisusedasstarterinocul administered topigs(Lindecrona etal.,2003). hyodisentariae addition totheseresults,feedingferm colon ofpigsfedfermented liquid feedhave compared withpigsfeddryfeed(1998), bacteria inthegastrointest dry-fed animals. Jensenandco-workersal gastrointestinal tract of piglets, with a (2000) demonstratedachangeinthe bacteria (JensenandMikkelsen,1999). bacteria populationinthestomach andsma improvement ofcolonizationresistan Kornegay, 1993)andtohigher lower pHofluminal contentsoftheuppe of lactobacilliandyeasts(Adams, 2001). this feedhave:itslowpHandhighconcentr populations oflactobacilli(Url lower intestine(vanWinsen etal.,2001),pr reduction ofenterobacteriainupp modification inthegutenvironment ma inhibited by acidic conditions areaffected In additiontotheseeffects, itisnecessary totake intoaccount that whenalactic Administration of fermented liquid feed hasalso beenrelated toalowertotal The lowpHandhighamount oflacticacid In particular,some members ofthe , showingalowerincidenceand inal tractofslaughterpigs ctobacilli arecontinuallyfed ings, etal.,1993;VanWinsen levels oforganicacids(van er gastrointestinal tractthat ce mechanisms (Mulderetal.,1997). ented liquidfeedwouldalsoaffect significant reductionofcoliformcompared to y alsoinfluencegutmicrobiota. um toproducefeedacidification,liveand Enterobacteriaceae
feed. (Moran etal.,2000; Hillman, 2001). 38 A recentstudybyMoranandco-workers so foundalowerconcentrationofcoliform and changes in microbiota structure in the (JensenandMikkelse ratio oflactobacilli ation oflacticacid,anditshighnumbers alsobeenshown(Leseretal.,2000).In r gastrointestinaltr obably duetoinfluencesofincreased ll intestine, and tohigher lactic acid in thefermented feedisrelatedtoa severity ofthediseasewhen fedfermented liquidfeed Winsen etal.,2001).This to theanimals, increasing familythatarespecially isalsomaintained inthe et al.,2001)andtoan :coliform throgought act (Ravindranand n, 1999).Thereisa Literature review Literature review Brachyspira
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW and . spp bifidobacteria and bifidobacteria and of action seems to to of action seems rding to this definition, Lactobacillus these nutrients (Gibson and and (Gibson nutrients these ., 1998), whereas pathogenic and ., 1998), whereas al shifts. Farnworth and co-workers al shifts. Farnworth cial commensal bacteria in the colon, bacteria in the colon, cial commensal robes, total aerobes, different intestinal bacteria with the with the bacteria intestinal different ing. Studies in vitro have demonstrated iotics as their mode iotics testinal tract; 2) a selective substrate for testinal tract; 2) food ingredients that beneficially affectsfood ingredients usually included in this group (Spring et by stimulating bacteria fermentation in by stimulating bacteria fermentation inoxylans, raffinose, stachyose, glucosyl- raffinose, stachyose, inoxylans, ngredient must be: 1) neither hydrolyzed ngredient must lonic microflora toward a more healthier healthier toward a more lonic microflora actosucrose, lactulose, and lactose are the actosucrose,
gosacharides increased the growth of hogens to mucus receptors and not acting as acting not and receptors to mucus hogens 39 eir mode of action is clearer by thorough of action is clearer by thorough eir mode become metabolically activated, or both; and metabolically become spp. (Jaskari et al., 1998; Sghir et al., 1998). ooligomers also improved also improved ooligomers fic bacterial populations. Acco duced abilities to degrade to degrade abilities duced on” (Gibson and Roberfroid, 1995). on” (Gibson and Bifidobacterium (Patterson and Burkholder, 2003). (Patterson and Burkholder,
and . spp. strains (Jaskari et al spp Prebiotics Micro-ingredients and in feed additives feed additives and in Micro-ingredients
In vivo studies have also shown microbi Prebiotics are defined as “non-digestible Prebiotics are defined i as a prebiotic, a food To be classified Similarly to dietary fiber, prebiotics act prebiotics dietary fiber, to Similarly Agarooligosaccharides, fructooligosaccharides, galactooligosaccharides, mannan- galactooligosaccharides, fructooligosaccharides, Agarooligosaccharides, Results using prebiotics have been promis Bifidobacterium putrefactive bacteria have re Roberfroid, 1995). in total anae increases (1992) found numerical Chapter 2 Chapter 2.3.2. 2.3.2.1. limited or a one activity of and/or the growth stimulating selectively by the host col the of bacteria in number prebiotics used main but th the lower gastrointestinal tract, of speci selective enrichment and xyl Beta-glucooligomers nor absorbed in the upper part of the gastroin nor absorbed in l inulin, isomaltose, sucrose, isomalturose, one or a limited number of potentially benefi of potentially number one or a limited to alter the co 3) able as a consequence Gibson, 1999). (Collins and composition arab oligosacharides, xylooligosaccharides, preb strictly are not mannan-oligosaccharides of binding pat neutralization be due to the however, they have been specific substrate, al., 2000). enhancement of the growth of the selective supply of oligosaccharides. Fructooli Lactobacillus thus stimulating the bacteria to grow or to grow the bacteria thus stimulating
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW preparations areapplied subtilis belonging to thegenus Bacillus (Bacillus farciminis bacteria, mainlyEnterococci ( EU aslivestockfeed additives. Basically,th positive effectonthehost (Metchinkoff, 1908). certain levels,providestabilityofthein 2.3.2.2. 1992), anddiminish theavailabi rats (Bovee-Oudenhovenetal.,1997),redu oligosaccharides havebeenshowntoincr that couldexplainthegrowthpromoting Diez-Gonzalez, 1998). metabolism, inhibiting thegrowthofmany selective increaseof al., 1993;Moliset1996;Houdijk increased shortchainfattyacidsproducti oligosaccharides, oligofructoseandtransgalac changes in gutchemicalenvironment. Differentstudies withnon-digestible Davis etal.,1999,2004a;Shim etal.,2005). prebiotics(Mor administration ofdifferent studies havealsoshownimprovements inpiggrowthperformance after decreases in total aerobes intheileum inresponse tofeeding oligofructose, andother form ofpelletedmixed feed (Simon etal,2003). coliforms whenweanlingpigswerefed Currently, thereare13preparations ofmicr Probiotics aredefinedaslivingmicro-or These specifically targeted microbial change Modification of thegastrointestinal eco ); andSaccharomyces yeasts(
Probiotics (livemicrobial feedsupplements) and Lactobacillusrhamnosus some bacteriagroupsalsopromotes productionoftheir at concentrationsof10 lity ofsome toxinsinrats(Zhang andOhta,1993). Enterococcus faecium 40 on anddiminished luminal pH(Bolduanet ease resistancetoinva cereus, Bacilluslicheniformis ) and with inulin.Houdijk al.,1997;Mikkelsenet2003).The testinal flora,andconsequentlyhavea imoto etal.,1984;Orban1997; ree different groups are used: lactic acid otherspeciesofbacteria(Russelland Sacharomyces cerevisiae ganisms infeedwhich,whentakenat system hasalsobeenconfirmed by ce translocationofpathogens(Berg, tooligosaccharides inthe dietofpigs 8 effect ofprobiotics.Non-digestible o-organisms thatareauthorized inthe to10 s can have different beneficialeffects s canhavedifferent Pediococcus acidilactici 9 CFU/kgoffeed,mainly inthe ), lactobacilli ( sion bypathogensin et al.(1997)found Literature review Literature review Lactobacillus ). Probiotic and ; bacteria Bacillus
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW in in to young Sacharomyces Sacharomyces is fair to remark is fair to remark related to an to an related Escherichia coli B. cereus spp. and ia. Some probiotic effects ia. Some and different hypothesis have Bacillus Bacillus , s with probiotics, it s with probiotics, s casei, Lactobacillus acidophilus, s casei, Lactobacillus ied in some cases with reductions in in with reductions cases ied in some an increase was detected in ileum, ileum, an increase was detected in Kyriakis et al., 1999) others have not Kyriakis et al., 1999) others have . Similarly to these results, Gedek and . Similarly In’t Veld, 1992). However, today the probiotics have been enting post-weaning diarrhea is also enting post-weaning diarrhea lance of pigs and to the strength of the creases in lactobacilli numbers in the gut in numbers in lactobacilli creases al., 1997; Gardiner et al., 1999). al., 1997; Gardiner et al., 1999). ., 1993; Abe et al., 1995; Kumprecht and ., 1993; Abe et
et al., 1998; Alexopoulus et al., 2004a, et al., 1998; Alexopoulus (Doyle, 2001; Adams, 2001; Simon et al., 2001; Simon (Doyle, 2001; Adams, obial compounds such as bacteriocines and such as obial compounds 41 al., 1992; Kirchgessner et al., 1993). al., 1992; Kirchgessner et have not found positive effects on pig have not found positive effects immune response stimulation, and also to a response stimulation, immune at after the administration of at after the administration ics is not entirely clear, clear, not entirely ics is partly due to the complex etiologic factors involved in involved etiologic factors complex the due to partly effect for undesirable bacter lactobacilli, bifidobacteria, eubacteria and lactobacilli, ; Danek et al., 1991; Kirckgessner et al ; Danek et al., 1991; In general, beneficial properties of The usefulness of probiotics in prev The usefulness of probiotics Probiotics might modulate the intestinal ecosystem by competition with with by competition intestinal ecosystem the modulate might Probiotics Recent research has demonstrated positive effects of probiotics for pigs. Different for pigs. Different of probiotics effects positive has demonstrated Recent research . Bifidobacterium pseudolongum, Lactobacillu Bifidobacterium seen such an effect (Eidelsburger et seen such an effect (Eidelsburger be Controversial results may the post-weaning syndrome. ambiguous. Whilst some authors have demonstrated a diminution in the incidence of in the incidence of diminution a authors have demonstrated Whilst some ambiguous. et al., 1998; diarrhea (Zani et al., 1998; Durst ba of the intestinal microbial improvement (Havenaar and Huis indigenous microbiota of action of probiot exact mode performance (Kowarz et al., 1994; Brown et (Kowarz et al., 1994; Brown performance that there are also several works that that there are also several works been postulated. for by competition exclusion), (competitive epithelial receptors pathogens for nutrients, or by the production of antimicr organic acids with inhibitory have also been related to intestinal passive aggregation to pathogenic bacteria 2003). caecum and colon. Despite these promising result and colon. Despite these promising caecum the upper gastrointestinal diminish, whereas the upper gastrointestinal diminish, 2004b; Taras et al., 2005), that was accompan al., 2005), 2004b; Taras et Chapter 2 Chapter strains different using performance growth on effects shown positive have studies ( Streptococcus thermophillus Enterococcus faecium, et al., 1998; Zani Zobac, 1998; Mathew in with and and clostridia bacteria coliform 1999) et al., (Tortuero et al., 1995; Nemcova th co-workers (1993) demonstrated pigs, the populations of spp
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW benzoate (Mroz,2003). propionic, butyric,lactic,fumaric, Ca-for modulators ofthegutecologyinpigs.Some 2.3.2.4. carrier throughthegastrointes bifidobacteria attachment tothe surfaceofth increase ofsubstrateforbacteria,itseems bifidobacteria thanwhentheprobioticwa amylose cornstarchand bifidobacteriato pi Brown andco-workers(1997)whodemonstr resistant starchisnotcons substrate intheintestin administration ofaprebioticbeingspecifi by anexogenousprobioticcouldbe bacteria must beused with specific substr probiotics andprebio 2.3.2.3. 1999). increase uptakeofnutrients(Stewartet and Estrada andco-workers(2001)feeding early lactobacilli, withadecrease to oligofructoseresultedinhighernumbe Recently, the administration toweanling pigsof Several organicacidsand Although workswithsymbiotics inpigsar Another waytomodify pigmicroflora isth It hasalsobeensuggestedthatprobiotics Bifidobacterium longum
Acidifiers Symbiotics
tics incombination (Gibson a al tract(Rolfe,2000). idered asaprebiotic,anin in enterobacteriaandclostr foundanimprovement efficiency.Although infeed tinal tract(Crittenden,1999). their saltsarerecognized aspreservatives and 42 enhanced andextendedbysimultaneous mate, Ca-propionate,K-diformate,and Na- ates forgrowth.Theref al., 1993;Starvicet1995;Lee that theeffectfound,might beduetothe s administered alone.Inadditiontothe -weaned pigswithfructooligosaccharides rs oftotalanerobes,aerobesand cally usedbytheprobi gs resulted inahi e starchgranulesthatmight beactasa affectthepermeabi e useofsymbiotics, whichistheuseof ofthemost usedare:formic, acetic, ated thatconcurrentfeedingofhigh- e stillscarce,resu Lactobacillus paracasei nd Roberfroid,1995).Thelive teresting resultwasfoundby idia (Nemcova al.,1999). et gher fecalexcretionof ore, thecolonization lity ofthegutand lts arepromising. otic strain asa Literature review Literature review inaddition
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW are mainly used are mainly primarily against not the main effect not the main es of bacteria, yeasts and yeasts and es of bacteria, trum and inhibits growth and inhibits growth trum of digesta pH after the Partanen and Mroz, 1999) rnatives to prophylactic in- to prophylactic rnatives ration of organic acids has ration of organic action of organic acids, is their action action of organic acids, is their y antimicrobial action of organic acids action of organic acids y antimicrobial ds, such as formic, acetic, propionic, ds, such as formic, ganic acid effective antimicrobial agent ganic acid effective antimicrobial of propionic acid is ves however, acidifiers ce of weaned piglets, fattening pigs and pigs and piglets, fattening ce of weaned gut pH reduction is c acids remains unclear, although several unclear, c acids remains ssociated to dissociated form, depending cently proposed as the most plausible and none against yeasts (Foegeding and and none against yeasts (Foegeding an et al., 1998; Radcliffe et al., 1998; an et al., 1998; Radcliffe et al., lipophilic and can freely diffuse through y) is through pH depression of the diet, y) is through pH depression of in the stomach of young pigs which have in the stomach
ages of life (Maxwell and Carter, 2001). tion. The specificity depends on the type of the type of tion. The specificity depends on 43 ercoming problems of the post-weaning period of the post-weaning problems ercoming nd et al., 1999; Bosi et al., 1999). Bosi et al., et al., 1999; nd appear to be potential alte appear to this regard, the administ this regard, the s demonstrated a broad spec 1999; Tsiloyiannis et al., 2001). 1999; Tsiloyiannis al., 1992, Roth et al., 1992; biting the growth of many speci biting the growth of many in the diet (Risley et al., 1991; Gubert and Sauer, 1995; iled to demonstrate reductions iled to demonstrate Moreover, administration of organic aci Moreover, administration The exact mechanism of action of organi The exact mechanism Organic acids and their salts acids and their salts Organic The ability of acids to change from undi However, more important than preservative However, more important in the pig gut. Undissociated form become in the pig gut. Undissociated form inclusion of different acids inclusion of Franco et al., 2005). pH, has been re on the environmental or capacity makes action. This of mechanism also been reported to be helpful in ov also been reported and Mroz, in piglets (Partanen on their salts of some acid, and and malic sorbic, tartaric fumaric, lactic, citric, (H are well defined growth performance Øverla et al., 1998; Siljander-Rasi primar The hypotheses have been postulated. or dela (strain-selective growth inhibition inhi a preservative, as acting consump moulds on the feed previously its whilst acetic acid ha acid used; the action of bacteria, yeast and moulds, and several trials have fa Chapter 2 Chapter the performan for improving feed antibiotics As with other feed additi reproductive sows. associated with early weaning as a way to prevent the problems in young pigs 2001). In (Maxwell and Carter, bacteria moulds, with poor activity against Busta, 1991, Partanen, 2001). proposed was One of the first mechanisms by different direct effects on the animal. the acidification of the digesta, particularly of these compounds (Risley et a limited secretion of HCl in the first st HCl in the first of secretion a limited Nevertheless, the evidence suggests that this
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW acid bacteriaaremore resistant yeasts andbacteriabelongingtothe (Foegeding andBusta,1991).Overall,thean efficacy isgenerallyimprovedas chainle Organic acidswithhigher pKavaluesar enzymes 1992). responsibleofnutrientuptake(Cherringtonetal.,1991;Russell, acid dissociates andsuppresses different the bacteriamembrane into biodiversity of coliforms andincreasesin biodiversity ofcoliforms high doses(2500ppm) ofzincoxidetopigl Waern etal.,1998). 2002) andpreventingtheapparitionof al., 1996;Smith etal., 1997;Mahanetal.,2000; related toimprovements inpost-weaningpe gastrointestinal health.Ad usually beenusedinpigletstomodul 2.3.2.5. required forintestinal also asprecursorsforsynthesisonnon- mucosal development, epithelial cell growth (Bolduan etal.,1988;Ri authors havenotfoundchangeswhenadmi et al.,1992).However,resultsregardingmicr lactobacilli, bifidobacteria,a Øverland etal.,2000).Intheupperandlowe pig coliformbacteria(Mathewetal.,1996; used. Specifically, differentty In addition,organicacidsma Different invivostudieshavedemonstrated The effectsshownmay beduetomicr Dietary supplementation with
Minerals: zincandcopper growth (Mroz,2003). sley etal.,1992). ministration ofpharmacological dosesofZnOhavebeen their cytoplasm (Partanen,2001) nd eubacteriahavealsobeen pes oforganicacidsarerela to theireffects(Lueck, 1980). y beusedasenergeticsubs high levelsofminerals su Enterobacteriaceae post-weaningdiarrhea(Poulsen,1998; 44 essential amino acids,DNAand onlipids obiota modulation. Thesupplementation of the stabilityof pig e more effectiveandtheirantimicrobial bacterial enzymes suchasATPasesand ngth anddegreeofunsaturationincrease rformance (HahnandBaker,1993;Hill et ate intestinalmicrobiota andimprove and increasingabsorptivecapacity,and ets hasbeenrelatedtoincreases inthe obial shiftsarenotconsistentandsome Jensen,1998;Øverlandetal.,1999; timicrobial activityisprimarily against microbiota shifts whenacidifiers are r intestine,micro-organism countsof nistering different Hilletal.,2000;CaseandCarlson, family (Frank,1994).Lactic shown todecrease(Gedek ted tomarked reductions in ch ascopperandzinchas . Onceinsidethecell, trate orasmodulator for microbiota (Katouliet acidifiers topigs Literature review Literature review
Jensen
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW eir antimicrobial eir antimicrobial tract (Höjberg et tract (Höjberg et the gastrointestinal tract jected intravenously with promote growth. been proposed as a means to been proposed as a means . Again, the improvement in growth in growth the improvement Again, . the gastrointestinal rial activity of different plant extracts al., 1991; Holden et al., 1998; Holden Holden 1998; al., 1991; Holden et al., Friedman et al., 2002), and in recent Friedman ve proved to be potent antimicrobial ve proved to be potent antimicrobial ect reducing post-weaning mortality has ect reducing post-weaning mortality rmacological doses of copper sulphate of copper sulphate doses rmacological e not consistent and depend so much on e not consistent and depend so much containing essential oils have provided containing essential oils have provided ential antimicrobial effects, benefits of benefits of effects, antimicrobial ential products known for th action of copper (Fuller et al., 1960). A action of copper (Fuller et al., 1960). A to a systemic effect; Zhou and co-workers to a systemic and weight (Cromwell et al., 1989; Dove and weight (Cromwell et al., 2005) have been shown recently. et al., 2005) have been shown
the stomach and ileum, parallel with an with an parallel and ileum, the stomach dded garlic to weanling pig diets without 45 hown by Cromwell and co-workers (1985), and include garlic, onion and leek; others are and include garlic, onion and leek; at weaning, and to gain when pigs were in Allium, ia and lactobacilli throughout products in the pig diet has Plant extracts Plant extracts
Similarly to ZnO, administration of pha to ZnO, administration Similarly spices For thousands of years, herbs and In vitro studies have demonstrated antibacte However, effects on growth response ar (Sen et al., 1998; Dorman and Deans, 2000; years, the inclusion of these al., 2005). efficiency in feed has shown improvements was related to an antimicrobial performance reduction in lactic acid bacter (1994a) observed an increase in copper. 2.3.2.6. ha and many distinctive properties to foods, of the most common plant agents. Some properties belong to the genus spices, of which and bay. There are also basil, cumin oregano, marjoram, thyme, be remarked. may pepper nutmeg and cloves, cinnamon, especially disorders, prevent intestinal the plant used. Different studies have a (Horton et influence on performance positive eff and McKean, 2000), although a promising effect on growth a positive Similarly, 2000). et al., been found (Peet-Schwering of weanling pigs was also s performance and Hayden, 1991; Dove, 1995; Hill et al., 2000) and Hayden, 1991; are due copper sulphate and also zinc oxide and in colonic coliform bacteria (Höjberg and in colonic coliform bacteria the pot However, it is possible that beside increase in coliform and enterococci throughout increase in coliform Chapter 2 Chapter of number in the total reduction have shown a doses same Recently, the al., 1999). bacteria in in lactic acid and anerobes
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW regarding microbial shifts after enzymes a microbial equilibrium (McCartney, 2005).Althoughthereis noknown evidence of substratesthatcouldprovokeexcessi animal (Verstegen andWilliams, 2002),wh The main effectofusingenzymes isahigh as aresultoftheinclusionenzymes enzymes areamong themostimportant. Many 2.3.2.7. pharmacological dosesand plantextract different sourcesoffiber,prebiotics, strategies hasbeenproposedwithpositiv the maintenance of the gastrointestinal strategies toimprove growth consequence important effortshavebeenmade ban ofantibioticsasgrowthpromoter guanidine:cytosine content(A that aneffectmay beexpect Taeonia lactiflora feces) when differentherbal addi composition (lowertotalbacteria, an improvement inweaningpigsperforman ileal bacterianumbers by60%andalsoredu intestinal microbiota. Inthisregard,Te and wheatgrass;Gr after administration ofyucca plant extract,a There areseveral other addi Concerns regardingresistance Effects onperformance aregenerallyattri
Other additives , Olea europea ela etal.,1998). ed. Theadditionofxylanaseto performance andto controlentericbacterialdiseasesby pajalahti etal.,2001). and inhuman bacterialpathoge tives thatarebeingused tives wereadded to thefeed( E. coli Portulaca oleracea Summary desco andco-workers(2005)recentlyfound in animaldiet(BedfordandSchulze,1998). s inanimal feedonJanuary2006.Asa 46 ddition inpigs,eviden ecosystem inpigs.The useofdifferent , total anerobic and e results, among themmay beremarked mixtures. Abetterunderstandingofthe ce andalso marked changes inmicrobiota ich helpdigestion andthe breaking down probiotics, organic ve microbial fermentation anddisturb ced theproportionofbacteriawithlower nd herbalmixtures (great nettle,garlic availability of dietarynutrients for the buted toaneffectofplantextractson tolookforalternativesorreplacement beneficial effectshavebeenreported .
broilerdietsreducedtotal inpigfeed,ofwhich ns haveledtothetotal Enterococcus ce inpoultrysuggests acids, mineral at Lycium barbarum Literature review Literature review spp.in ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW the near future a more rational design future a more the near
47 of non-antibiotic growth promoters. promoters. growth of non-antibiotic Chapter 2 Chapter actionmodes of in products will allow of these
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW genes sequencedatabank bacterial cell(Woese, 1987;Amann etal., composition withhighlyconservedandvariab is thekeybacterial markerduetoitsgeneticstability,domain characteristic such asthepiggutmicrobiota (Vaughanet microbiology hasgreatlyenhancedourknow (Amann etal.,1995).The introductionof techniques basedon16Sribosomal DNAgene bacteria isolatesisoftenin 1999) andthattheclassical only 10-40%oftotalgutbacteriaarecultu (Fuhrman etal.,1992;Dutta2001).Re unknowns species,time-consuming aspects different studies: lowsensitivities, inabil classical methodstodetectallgutcomm methods basedonphenotyticcharacterisati description ofthedifferentsp the world.Theuseofthesenewmethods hasbeenespeciallyfocusedonthe detection of bacterial shifts related to para rdp.cme.msu.edu/index.jsp works involvingmolecular methods methods applied habitually In ordertoovercome theproblems men Traditionally, gutmicrobiota hasbeen This chapter willfocus ondifferent 2.4.
2.4. Newtoolsfortheanalysis adequate (Leseretal.,2002). ) allowseasycomparison betweensequencesfrom across taxonomy basedonphysiological/biochemical analysisof in gutmicrobiology, payingsp ecies inhabitingthegastrointe for studyingpiggutmicrobiota. Introduction 48 meters suchasage,dietor illness. ity todetectnon-cultivatable bacteriaand 1.4. al., 2000). Nowadays, the 16S rRNA gene al.,2000).Nowadays,the16SrRNAgene rable (Zoetendaletal.,1998;Suau tioned above,higherresolutionmolecular unity bacteriahasbeenestablishedby
on. However,thein quantitative andqualitative molecular ledge ofcomplex microbial populations 1990a). In addition, thegrowthof of the gastrointestinal microbiota le regions,anditshi
studied byclassicalselective-culture s havebeendevelopedinrecentyears cent studieshavedemonstrated that thesemethods ingastrointestinal and lowlevelsof reproducibility (www.ncbi.nlm.nih.gov/entrez/ stinal tractand alsoonthe ecial attentiontorecent adequacy ofthese gh copynumber in Literature review Literature review ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW amount of target amount a fluorescent dye eaction with on-line thod is based on the CR and fluorencent in CR and fluorencent at increases its signal in oduct. When this probe is oduct. When rrays. Of these, we will look Of these, we will look rrays. PCR, where the first significant PCR, where the first significant ides that contain ates to the initial used to quantify bacteria in the used to quantify to both primers that are essential in the in the that are essential to both primers at the end of the PCR as conventional e detection and quantification of ae detection and quantification polymerase chain r on the use of labelled probes, such as on the use of labelled sually TAMRA) on the 3’ end, and it is sually TAMRA) ime PCR (Figure 2.5). The one that first ime to their relatively more frequent use in frequent more to their relatively al., 1991). This me on. Data are automatically collected collected automatically Data are on. ndard curve constructed with a known a known ndard curve constructed with real time PCR, and other methods not PCR, and other methods real time er of target DNA, the sooner a significant be classified basically into two groups: be classified basically solute quantitation can be achieved by the target sequence is soi, 1994). When w years: real time P w years: real time oduct in the reaction. Quantification of the oduct in the reaction. Quantification sfers energy to the quenching dye molecule sfers energy to the quenching dye molecule 49 ., 1993; Livak et al., , 1995) th xponential phase of ternal region of the PCR pr hybridization, dot blot and microa and blot hybridization, dot in situ Quantitative Polymerase Chain Reaction (qPCR) (qPCR) Chain Reaction Polymerase Quantitative Quantitative techniques techniques Quantitative
There are two different methods of real-t There are two different methods Real-time PCR system is based on th Real-time Several different techniques may be techniques may Several different based on the PCR is a method Real-time usually on the 5’end, and a quenching dye (u designed to anneal to an in increase in the amount of PCR product correl of PCR product increase in the amount fluorescent reporter (Lee et al of PCR pr direct proportion to the amount product takes place in the e The higher the starting copy numb template. is detected. Ab fluorescence increase in a sta from interpolating unknown samples of the target gene. amount et appeared was the TaqMan assay (Holland use of a fluorogenic labelled probe in addition PCR reaction. TaqMan probes are oligonucleot tran dye the excited fluorescent irradiated, rather than fluorescing (Hiyoshi and Ho reaction was traditionally performed. performed. traditionally was reaction Chapter 2 Chapter 2.4.1. can methods tract. These gastrointestinal such as methods quantitative PCR-based but previous amplification dependent on this fluorescent in this chapter due closely at two methods the last fe in gastrointestinal microbiology situ hybridization. 2.4.1.1. reacti the amplification of measurement rather than throughout the entire PCR process,
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW present, theprobeannealsdownstreamfrom one compared totraditionalones.However,th need toworkinfresh, et al.,2000).Thepossibilityofstoringthe compared totraditional culture:higher sens This increasestheassay of differentprobesisrequiredforeach sequencethatwantsto bedetected. On theotherhand,main disadvantageof by analysisofmelting ordissociationcu although itcanbeminimised problem isespecially importantwith lo to obtainunspecific amplification thatma dimer, making ittherefore more important to all double-strandedDNA,includingnon-sp detected witheachnewamplification cycle. PCR progresses,more ampliconsarecreate Then, theSYBR Greendyebinds toeach PCR, thepolymerase amplifiesthetarg signal uponbindingtodouble-strandedDNA groove bindingdyethatshowslittlefluores when boundtodoublestrandedDNA. SYBR non-sequence specificfluorescen produced. an increaseinfluorescenceintensity additional reporterdyemolecules arecleaved target, allowing extension toend thete of probecleavage.Atthesame time, Ta reporter dyestartstoemitasignal that incr cleavage producesaseparation from the the 5’nucleaseactivit Real-time PCRmethodology ha The main differencebetweenbothmethods The secondreal-time PCRsystem istheSYBRGreendye.Thismethod usesa y oftheTaqpolymerase astheprimer isextended.Thisprobe set-up andrunningcosts. is undoubtedlyaremarkable since non-specificamplifica t intercalatingagent(SYB s differentadvantagesin proportional tothe 50 rve oftheproductamplified (Ririe,1997). et sequence,creatingnewPCRproducts. q polymerase removestheprobefrom the w quantity template (Heinetal.,2001), new copy of double-stranded DNA.Asthe new copyofdouble-stranded eases ineachcycleproportional totherate itivity, rapidity and is method tendstooverestimate bacterial cence wheninsolution,butemits astrong d, increasingtheintensityoffluorescence samples untiltheiranalysis,avoiding the mplate strand. With each PCRcycle, two dyesthatmark theprobeand have awell-optimized reactionsoas not y generatefalsepositivesignals.This from theirrespective probes resulting in TaqMan chemistry isthat the synthesis ecific reactionproducts,andprimer- (Morrisonetal.,1998).Duringthe is thatSYBRGreenchemistry detects Greendyeisafluorogenicminor oftheprimer sitesandis cleavedby tion canbeeasilydiscarded advantage ofthismethod R Green)thatonlyemits bacteriaquantification reproducibility (Bustin amount ofamplicon Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW . B) d DNA, providing a of a Taq polymerase. Upon of a Taq polymerase. ter hybridization, the probe ter hybridization, et al.,2002) and also has a relatively a relatively and also has et al.,2002) esent in the PCR mixture, becomes esent in the PCR mixture, to all double-strande in real time (Invitrogen PCR Handbook). (Invitrogen PCR Handbook). in real time
to the long-wavelength fluorophore (red fluorophore (red to the long-wavelength 51 d, modifying the fluorescence detected. ( the fluorescence d, modifying wavelength fluorescence. Af wavelength fluorescence. tion by the endonuclease activity tion by the endonuclease . In the intact TaqMan probe, energy is transferred from the short- probe, energy is transferred . In the intact TaqMan Representation of real-time PCR with TaqMan primers (A) and SYBR (A) and SYBR PCR with TaqMan primers real-time Representation of (A)
B
A A Figure 2.5. direct method for quantifying PCR products direct method SYBR Green I dye (black diamonds), pr SYBR Green I dye (black diamonds), upon binding fluorescent (green diamonds) is susceptible to degrada is susceptible to is interrupte degradation, quenching
wavelength fluorophore (green circle) wavelength fluorophore the short- circle), quenching Green (B). Chapter 2 Chapter et al., 2002; Huijsdens ((Nadkarni populations high cost.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW from thegastrointestinaltr 2001), andalsotodetectpat chickens (Selim etal.,2005;Wise andSira Ott etal.,2004;Penders2005),pigs (Table 2.5). have beenstandarizedand areactuallybei universal probesareused,totalbacteriacan sequence withintheintact fluorescently labelledprobethathybridizes replaced radioactiveones.FISHmet Although thebasisofmethod has not Giovannoni andco-workers(1988)withradi an increasinginterestingutmicrobiology. 2.4.1.2. alternative totheuseof16Sr changes inspecificpig gutbacteriaandth rDNA gene.Thisstudydemonstrated theus In thiscase,Chaperonin-60genewasused real time PCRandalsoSYBR Green chemis Clostridium workers (2005)quantifieddifferentpiggut and lactobacilli bacteria inpigsfedthe e diets. Realtime PCRallowsthedetection the ilealand coloniccontents with SYBRGreendyechemistry toquantify totalbacteriaand some specific bacterialgroups.Collierand 2003; Wu al.,2005). et feces andsoil(Smythe etal.,2002;IbvekweandGrieve, 2003;Fukushima etal., specificity oftheprobeused,differentsp In recentyears,real-time PCRhasbeenwi Fluorescent Particularly inpigs,real time PCRisbeing used toquantify total bacteria and
Fluorescent spp.,
In Situ Streptococcus alactolyticus In Situ Hybridization(FISH)isaqua act ofhumans(Huijsdenset bacterial cell(Moterand Hybridization(FISH) hogen bacteriaindifferenten DNA gene inmicrobial ecology. DNA gene ofgrowingbarrowsfedw hod detectsnucleicacidsequencesbya xperimental diet. More recently,Hilland co- 52 ecific bacterialgroups ng usedtoquantifythe main gutbacteria of significant differences intotalbacteria gusa, 2005)andruminants (Tajima etal., e potentialofChaperonin-60geneasan (Collieretal.,2003; oactively labelledoligonuclotideprobes. specifically toitscomplementary target efulness ofrealtime PCRfor detecting co-workers (2003)usedreal-time PCR bequantified.Todate,severalprobes changed, fluorescentprobeshavenow try inweanlingpigsfeddifferentdiets. bacteria belonging tothe Bacillales, as atargetedgeneinstead of the16S dely usedtoquantif , and It wasfirstusedinbacteriologyby Lactobacillus amylovorus Göbel, 2000).Dependingonthe ntitative molecular method with al., 2002;Matsuk vironments suchaswater, ith differentexperimental Lactobacillus canbecounted;if y selectivebacteria Hilletal.,2005), Literature review Literature review i etal.,2003; spp.in using
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW B. , ude fluorescein, ude fluorescein, B. angulatum reover, when the obe to the target obe to the target , ding the biases that ; Takada et al., 2004, rointestinal microbiology of of rointestinal microbiology veloped, which detects, in a ds. Then, hybridization under ds. Then, hybridization B. longum (Wallner et al., 1997). et (Wallner B. adolescentes are used, is that counts can be made made are used, is that counts can be s, avoiding biases that are typically s, avoiding biases that are typically , and laborious. Bacterial cell is chemically is chemically Bacterial cell laborious. s et al., 2001). Mo fferent methods are used to quantify are used fferent methods ed is via epifluorescence microscopy ed is via epifluorescence microscopy cyanine dyes such as Cy3 and Cy5 and Cy5 such as Cy3 dyes cyanine ich allows a relatively faster and more ich allows a relatively faster and more tides in length and covalently labelled at at labelled covalently and in length tides resting alternative to quantify different high-resolution to bacteria counts. high-resolution to bacteria counts. ng of the selected pr ng of the selected ilization. Once fixed, bacterial cells are cells are Once fixed, bacterial ilization. agner et al., 2003). Alternatively, flux agner et al., 2003). Alternatively, pe, obtaining an accurate image of the accurate image an obtaining pe, that being a molecular method it does not method that being a molecular or kept in suspension depending on theor kept in suspension unities as well as information about unities as well as information automatized, thus avoi
53 Common fluorophors incl Common fluorophors B. dentium , (Wintzingerode et al., 1997). e recent application in gast at will be used afterwar at will be used es of Bifidobacterium ( an traditional microscopy an traditional microscopy hybridization method has been de B. catenulatum , in situ B. breve , Especially interesting is th Another advantage, when microscope slides Another advantage, when microscope One of the main advantages of FISH is One of the main FISH procedure is relatively easy though easy though is relatively FISH procedure single reaction, seven speci bifidum be an inte Figure 2.6). This approach may digesta samples. in groups of bacteria at a time FISH signal detection, wh to flow citometry spatial distribution of microbial comm spatial distribution of microbial 2000; Daim morphology (Moter and Göbel, sensitive quantification th etramethylrhodamine, Texas red, and carbo etramethylrhodamine, two di (Southwick et al., 1990). Nowadays, us common method stained cells. The most (W though it is laborious and subjective with appears as a potential method cytometry described on PCR based methods microsco scanning laser using a confocal can be technique is standarized, counting recently a multi-color et al., 1999). In addition, (Jansen counts can produce manual fluorescence depend on purification or amplification step depend on purification or amplification stringent conditions allows proper anneali stringent conditions probes are 15-30 nucleo sequence. Generally, a fluorescent dye. the 5’ end with method of quantification th of quantification method Chapter 2 Chapter slide on a pre-treated glass immobilized treated to allow cell fixation and permeab and allow cell fixation treated to
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
Table 2.5. Some probes currently used to quantify different gastrointestinal bacteria.
Probe name Target group Probe sequence( 5’-3’) Reference S-D-Bact-0338-a-A-18 Bacteria GCTGCCTCCCGTAGGAGT Amann et al., 1990b S-*-Bacto-0303-a-a17 CFB phylum CCAATGTGGGGGACCTT Manz et al., 1996 S-S F.suc-0650-a-A-20 F. succinogenes TGCCCCTGAACTATCCCAAGA Amann et al., 1990a S-S-F.int-0136-a-A-20 F. intestinalis CGGTTGTTCCGGAATGCGGG Lin et al., 1994 S-*-F.prau 0645-a-A-23 F. prausnitzii CCTCTGCACTACTCAAGAAAAC Suau et al., 2001 S-*-Erec-0482-a-A-19 C. coccoides cluster GCTTCTTAGTCAGGTACCG Franks et al., 1998 S-*-Elgc-01-a-A-19 C. leptum cluster GGGACGTTGTTTCTGAGT Franks et al., 1998 S-*-Chis-0150-a-A-23 C. histolyticum TTATGCGGTATTAATCTYCCTTT Franks et al., 1998 S-*-Bdis-0656-a-A-18 Bacteroides distansonis CCGCCTGCCTCAAACATA Franks et al., 1998 S-*-Bfra-0602-a-A-19 Bacteroides fragilis GAGCCGCAAACTTTCACAA Franks et al., 1998 S-S-Bvulg1017-a-A-21 Bacteroides vulgatus AGATGCCTTGCGGCTTACGGC Rigottier-Gois et al., 2003 S-*-Bacto-1080-a-A-18 Bacteroides spp. GCACTTTAAGCCGACACCT Doré et al., 1998 S-G-Bif-0164-a-A-18 Bifidobacterium spp. CATCCGGCATTACCACCC Langedink et al., 1995 S-*-Rfla-729-a-A-18 Ruminococcus albus and R. flavefaciens AAAGCCCAGTAAGCCGCC Harmsen et al., 2002 S-*-Rbro-730-a-A-18 C. sporosphaeroides, R. bromii, C. leptum TAAAGCCCAGYAGGCCGC Harmsen et al., 2002 S-*-Ehal-1469-a-A-18 Eubacterium halii group CCAGTTACCGGCTCCACC Harmsen et al., 2002 S-G-Lab0158-a-A-21 Lactobacillus-Enterococcus spp. GGTATTAGCAYCTGTTTCCA Harmsen et al., 2002 L-S-E.coli-1531-a-A-21 Escherichia coli CACCGTAGTGCCTCGTCATCA Krogfelt et al., 1993 S-*-Enter-1432-a-A-15 Enterobacteriaceae CTTTTGCAACCCACT Sghir et al., 2000 aProbe names have been standarized as follows: S or L for Large or Small subunit rDNA as the target; D for Domain, O for Order, F for Family, G for Genus, S for Species and Ss for Subspecies. ; letters designating the target group of the oligonucleotide probe; nucleotide position in E. coli gene; letter designating the version of the probe; S or A for Sense or Antisense direction; number indicating the length in nucleotides of the probe (Alm et al., 1996). An asterisk shows that this probe has not been standarized. INTRODUCTION
LITERATURE REVIEW
B. , are B. longum ia (Langendijk et ia (Langendijk et the detection of ity in wastewater B. adolescentis and al., 1998; Harmsen et al., al., 1998; Harmsen culture of seven different culture of seven B. dentium , Bifidobacterium species in human species in human Bifidobacterium ation of these bacter been also applied in Alfreider et al., 1996; Lemke et al., Alfreider et al., 1996; Lemke ia, specially from marine environments environments ia, specially from marine udy microbial divers udy microbial with various cell wall types. The high types. The high cell wall with various
ent microbiological studies. FISH has been ent microbiological (Moter et al., 1998a, 1998b) and the al., 2000a, 2000b, 2002; Zoetendal et al., al., 2000a, 2000b, 2002; Zoetendal et al., 55 B (blue), Y (yellow), M (magenta) and W and M (magenta) Y (yellow), B (blue),
complex bacterial ecosystems in the human ecosystems bacterial complex al., 1997; Bond et al., 1999). Moreover FISH wall hinders its permeabilization and probe permeabilization wall hinders its B B. catenulatum Identification of Identification , (B)
dijk et al., 1995; Franks et A B. breve result in an underestim , Epifluorescent image of mixed image Epifluorescent B. bifidum , have been used in differ FISH methods However, the FISH methods have also some limitations. One of them is the One of them limitations. some have also the FISH methods However, Figure 2.6. (A) used extensively to identify and count bacter et al., 1996; Glöckner et al., 1996; (Ramsing 1997; Jürgens et al., 1999), and also to st et al., 1996; Snaidr et (Amann treatment et 1999; Jansen et al., 1999; Harmsen 2002a; Hold et al., 2003). Finally, FISH has has been used in the study of different the oral cavity body such as those of gastrointestinal tract (Lange Chapter 2 Chapter probes in bacteria penetration of different bacteria gram-postitive of complexity can hybridization which (cyan), shown in G (green), R (red), C respectively. white), (blue-ish FISH (Takada et al., 2004). color using multi fecal samples al., 1995; Jansen et al., 1999). al., 1995; Jansen images, In the FISH. color by multi species Bifidobacterium angulatum
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW (Lab158) anddevelopedevaluatedaspecif bacteria (Bac338), and aprobetoquantifyLactobacillus-enterococcus group Konstantinov andco-workers(2004b)used only afew publishedworkscanbefound 2000) andin feces(Waar etal.,2005). pathogens intissuesamples (Boyeetal.,1998; by Muyzerandco-workers (1993) and thusinitschemical st objective DNAmoleculesbasedonvariabilityof 2.4.2.1. its sequence(Muyzeretal.,1993). an amplified fragment ofthe16SrDNAin (Charteris etal.,1997;Hozapfel2001) restriction withanendonucl (DGGE) areoneofthemostused. fragment lengthpolymorfism (T-RFLP)a dynamics anddiversityofcomplex bact fingerprinting techniquesar each microbial communitydepending onth rDNA genewithindifferentbacteria,whic 2.4.2. in theileum andcolonofpigsfeddi determination ofahi receiving dietsrichinfe to thegenera T-RFLP isbasedoncomparison of Although FISHhasbeenextensivelyused Denaturant/Temperature GradientGel Fingerprinting techniquesarebasedonth
Fingerprinting techniques:DGGE,t-RFLP Denaturant/Temperature Gradient Lactobacillus amylovorus gher prevalence of ability of16SrDNA.First in rmentable carbohydrates.Util ease that recognize specific sequences within the gene ease thatrecognizespecificsequenceswithinthegene e actuallybeingused toelucidatethe complexity, it iswidelyusedcurrently. ets richinfermentable carbohydrates. and L. reuteri 56 adenaturingelectrophoresisdependingon nd denaturinggradientgelelectrophoresis GelElectrophoresis(DGGE/TGGE) h providespecificpatternsorprofilesfor L. reuteri , andDGGEisbasedontheseparationof banding patternsobtainedfrom DNA erial populations.Term e existenceofpolymorphisms inthe16S Electrophoresis allowsseparationof auniversalprobetoquantifytotal ic probetoquantify to studyhuman intestinalmicrobiota, Trebesiusetal.,1998; on thestudyofpiggutbacteria. e bacteriaharbouring it.Genetic itssequenceinthevariableregions and
-like inweanlingpigsthatwere L. amylovorus troduced inmicrobial ecology ization ofFISHallowed bacteria belonging -like populations Literature review Literature review inal restriction Jensenetal.,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
rated by applying rated by inexpensive and with trophoresis system. A system. trophoresis cloning and sequencing t microbial studies due to studies due t microbial t, based upon age, diet, or ., 2003; Gueimonde et al., study pig gut microbiota. The first study pig gut microbiota. er et al., 1993; Muyzer and de Waall, er et al., 1993; Muyzer and de Waall, indicative of the number of bacterial of the number indicative . Subsequent identification of specific . Subsequent identification of specific hmalenberger et al. 2001; McCartney, 2001; McCartney, hmalenberger et al. Konstantinov et al., 2004b; Inoue et al., Inoue et al., et al., 2004b; Konstantinov ould be effectively applied to measure ould be effectively applied to measure ng ethidium bromide, silver staining or ng ethidium bromide, to differ, and molecules with different obiota after substrates inoculums (Zhu et obiota after substrates inoculums e through the gradient from low to high low from e through the gradient ient. At the point in the gradient where where gradient in the At the point ient. (Zoetendal et al., 1998; samples human rDNA products are sepa rDNA products hed in a polyacrylamide gel in parallel to gel hed in a polyacrylamide visualization of the genetic diversity of of visualization of the genetic diversity DNA happens, the migration of the DNA of migration DNA happens, the positions in the gel (Muyzer and Smalla, and Smalla, gel (Muyzer the positions in adient in an elec adient in idization of the profile using phylogenetic idization of the profile using phylogenetic nce), are separated (Reisner et al., 1992). nce), are separated
rapid, comparatively comparatively rapid, mpson and co-workers (1999, 2000; Figure mpson impson et al., 1999; Simpson et al., 2000; et al., 1999; Simpson impson 57 can be achieved by by can be achieved melting of the DNA fragments. Sequence of the DNA fragments. melting successfully used in gu used successfully in the gastrointestinal trac et al., 2002; Malinen et al rded and sequences of the same size, but of different of the same rded and sequences In these techniques, PCR-amplified 16S techniques, PCR-amplified In these DNA bands are thereafter visualised usi DNA bands are thereafter visualised Both methodologies have been have Both methodologies Different groups have been using DGGE to Chapter 2 Chapter gr or denaturing gradient a temperature is establis gradient or chemical temperature and thus allows species that are present et al., 1999) populations (Simpson microbial 2001; Sc et al., (Ampe good reproducibility 2002). These techniques have been used in the electric field. The DNA samplesthe electric field. migrat of the double-stranded partial denaturation different at migrating will stop sequences 1998). pattern is SYBR Green I. The PCR banding in the sample or species groups bacterial Zoetendal et al., 2002b; Favier temperature, or low to high chemical grad or low to high chemical temperature, reta drastically is fragment seque stability (by its or chemical thermal on the Separation is therefore based variation causes the melting temperatures the gel, or by hybr the excised bands from probes (Muyzer and Smalla, 1998). are reliable, the fact that these techniques (S 2004), in pig gastrointestinal samples et al., 2003; 2003; Konstantinov Collier et al., of pig micr 2005), in “in vitro” modification 1994). work using this technique was done by Si if DGGE c of determine 2.7), with the aim changes in bacterial populations al.., 2003) and to study bacterial biofilms (Muyz al.., 2003) and to study bacterial biofilms
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW analysis revealed diverse andstable indivi anatomic compartment. Theauthorsconc 16S rDNA.Bacterialstandardmarker lane individual pigletovera20-day composition (Inoueetal.,2005). weeks oflifeusingDGGE,detectingremarkab an interestingstudyhavefoundchangesin patterns demonstrated theeffect ofthean microbiota afteranantibioticgrowthprom have alsobeenusingthistechniquetode piglets asinoculum beetpulp ofsugar (2003) founddifferencesinbandpatternsan increase inmicrobial stabilityandhighe carbohydrates toweanlingpigs(Konstant observed havealsobeenelucidatedafte individualgut different agesandamong Figure 2.7. PCR-DGGEprofilegeneratedfrom experimental periodusing fermentation. Collierandco-workers(2003) 58 r diversity.Similarly, Zhuandco-workers tibiotic compared tocontrolpigs. Recently, termine differences inpig colonic andileal s aredenotedasM(Simpson etal.,2000). luded suitabilityofthemethod asDGGE dual bacterialpopulati r administrationofdifferentfermentable inov etal.,2003,2004b),showingan oter administration. Differencesinband piglet microbial profilesduringthefirst compartments. Differenceinpatterns le changesinmicrobiota diversityand invitrostudy withfecesof weaning fecalsamples obtainedfrom an primers specific for theV3- ons betweenpigsof Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
ity of bacteria in ity of bacteria in h is an endonuclease dard feed or cooked rice capillary electrophoresis. LP to study gut microbiota. enzyme used, using the analysis used, using the analysis enzyme base Project II software (Cole et al., (Cole et II software Project base cence detector is used to separate cence detector is used to separate (2004) studied the effect of different inference of potential bacteria present inference of potential bacteria present at give high resolution and sensitive at give high resolution and sensitive analysis of the divers , rats microbiota (Kaplan et al., 2001), , rats microbiota ymorphism is a very useful tool for ymorphism the 16S rDNA. It is a high-throughput, the 16S rDNA. d and by the use of universal primers, of universal primers, d and by the use ial communities in the colon of pigs fed of pigs in the colon ial communities were detected as different patterns were site will be detected (Figure 2.8). The 2.8). The site will be detected (Figure ing animals with the experimental diets, with the experimental ing animals obiota (Gong et al., 2003; Nagashima et obiota (Gong et al., 2003; Nagashima band per species as only the fragmentband per species as only the tional PCR, similarly to DGGE with the to tional PCR, similarly labelled fluorescently at the 5’ end. The labelled fluorescently at the 5’
ison of fragments obtained in the samples obtained in the samples ison of fragments al., 2001; Hogberg et al., 2004), chicken nvironmental samples (Liu et al., 1997; samples nvironmental striction enzyme, whic striction enzyme, 59 c sequence into the amplicon. Once the amplicon. into the c sequence ., 2000; Blackwood et al., 2003). ., 2000; Blackwood nt studies have used t-RF based on either modified stan fragments are separated by fragments restriction with the primers and with the primers restriction Terminal Restriction Fragment Length Polymorfism Length Polymorfism Restriction Fragment Terminal
in silico T-RFLP has appeared recently as an attractive tool for studying pig gut for studying T-RFLP has recently as an attractive tool appeared Particularly in pigs, differe Terminal restriction fragment length pol restriction fragment Terminal is extracte the sample Firstly, DNA from 2003). (Leser et al., 2000; Khan et microbiota (Gong et al., 2002), human micr microbiota and co-workers Högberg obtained. Similarly, function TAP-tRFLP from the Ribosomal Data the Ribosomal function TAP-tRFLP from et al., 2004) al., 2003; Ott et al., 2004; Wang e and characterization of bacteria from et al., 1998; Dunbar et al Clement bacter Leser and co-workers (2000) compared diets different experimental with dietary fibers. After feed supplemented structure differences in bacterial community that recognizes one determined specifi one determined that recognizes restriction is obtained, with a fluores Generally, a DNA sequencer one thus, T-RFLP gives only fragments, the fluorescently labelled primer containing are run on long sequencing gels th samples is obtained, detection. Once electropherogram can be achieved by compar in the sample with Chapter 2 Chapter 2.4.2.2. a of the fingerprinting allows that (Kitts, 2001) communities microbial comparing of the polymorphism community by analyzing that allows a qualitative reproducible method an ecosystem. is amplified by conven total bacterial DNA used is difference that one of the primers is then digested with a re DNA amplified
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW et al.,1997;Marsh,1999;Kaplan2001). RFLP, theselectionofprimer an overalldescription of anecosystemwantstobeachieved.Specifically witht- bias theprofileobtained,beingespecially amplification. Primers chosenwilllimit arehighlydeterminedand DGGE) bythepairofprimers chosenforPCR peaks wouldlooklikethegraphonright. restriction enzyme sitesandtheirlocation indicate fluorescent label; and circles, s obtained afteranenzymaticrestriction.Bars observed aparticularpatterndependingon cereal non-starchpolysaccharid accurately describe allmicroorganisms, ha gut bacteria.Thisfactwith theinadequacy fragment, avoidingthereforethepreciserec inappropiate selection can ma receiving different dosesofzincoxi and co-workers(2005)alsofounddifferences As iswithotherPCRbasedmethods, bot In recentyears,theincreasingconcernon Figure 2.8. Anexample offragments andvisu ke thatmany bacteriaspecies share the same length of s and restriction enzyme is es onthegutmicrobiota ingrowingpigs.Theauthors de andcoppersulphate(Figure2.9). Summary the numberoftargetedDNAandthusmay 60 important toselectuniversalprimers when ofclassicalculture-dependent methods to quares andrectangles ognition ofallthemicr s overcome thedevelopment ofdifferent in eachsequence.Thefragment analysis the dietadministere represent differentse h thesefingerprintingtechniques(t-RLP gut healthhasrekindledtheinterestfor inmicrobial cecalprofilesinpigs alization of the particularly important.An d. Recently,Höjberg quences, redspirals obial diversity(Liu indicate different different indicate electropherogram Literature review Literature review
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
important efforts efforts important As a consequence, nowadays nowadays As a consequence, berg et al., 2005). amount of information regarding the of information amount re will provide important information information important re will provide g gut; this is significantly increasing our g gut; this is significantly
61 ting on human microbiota, ting on human echniques for quantification, identification and identification for quantification, echniques opper sulphate (Höj strointestinal microbiota. microbiota. strointestinal bacteria for animal health. health. bacteria for animal T-RFLP profiles obtained from cecum digesta in pigs receiving receiving digesta in pigs cecum from T-RFLP profiles obtained
Figure 2.9. different doses of zinc oxide and c different doses of zinc oxide and
microbiota knowledge and in the near futu knowledge microbiota role of gut regarding the key Chapter 2 Chapter ga methods to study molecular of genetic t a current plethora there is with a huge community characterisation Although modification. with age, illness and dietary and how it changes ecosystem still concentra works are of the majority on pi to apply these methods are being made
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
OBJECTIVES Chapter 3 62
Objectives
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW gastrointestinal tract in weaning, andthequantita considered: microbiota, bearinginmind thedevelopment time PCRwasusedtostudyspecificbacterial after weaning. Cecaldigesta from weaned culture forlactobacillianden compared withthoseobtained bacterial load, lactobacilli and enterobacteria in pigdigesta samples. Results were be includedinchapters4-8. pigs. commercial in-feedadditivesorfibrousingred determine globalchangesin microbial groups,andterminal-restriction fr real time PCRandfluorescence antibiotics asgrowthpromot bacteria groupsthroughoutthe method global changesincecalbacterial forstudying profile. method populations. Also,afingerprinting (resistant starchanddifferent non-starch a method ofstudy;andsecondly,
1. The main objectiveof thisthesis was Trial II In To assess these three objectives, five different trials were designed. Results will 3. 2. Trial III
Trial I, To developand/orevaluatemolecular To studypotentialmodificati To studymicrobiotaestablishment a wasdesignedwiththeaim ofst was designed withtwo different objectives. Firstly, todescribe themain real-time PCRwasassessedasan thegrowinganimal. thecommunityprofile. tive importance ofmajor terobacteria, anddirectmicroscopy fortotalbacteria). ers. Toachievethis,thre bytraditionalmethods as gastrointestinal tractofth to studytheeffectofdiffere in situ on ofthisecosystembyth hybridization(FISH) to 64 polysaccharides) onmi and suckling pigs wascollectedandreal- agment lengthpolymo to improve ourknowledgeofpiggut udying microbial establishmentprocess nd changesproducedinthepigletby shifts inlactobacil of newfeedingstrate (t-RFLP) was evaluatedasauseful (t-RFLP) was ients inthediet of methods tostudypiggutmicrobiota: alternative method toquantifytotal e secondaryobjectiveswere e growingpigusingFISHas bacterial groupsalongthe reference values(selective nt typesofdietaryfibre e inclusionofdifferent crobiota usingFISH li andenterobacteria weanedorgrowing quantifyparticular rfism (t-RFLP)to gies tosubstitute Objectives
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
ia ratio, and purine ternatives. Real-time Real-time ternatives.
effect of a commercial mannan- effect of a commercial commercial additives on pig gut commercial additives alone or in combination, on growth alone or in combination, ion in plasma and digesta, and the ion in plasma e were tested as al e were tested
obacilli/enterobacter rn were also studied by measuring short-also studied by measuring rn were eria, lactobacilli and enterobacteria along eria, lactobacilli ed to assess changes in bacterial profile. profile. in bacterial ed to assess changes 65 easure microbial activity. To evaluate the activity. easure microbial ogy and immune response of weaned pigs. ogy and immune response of weaned zinc, administered zinc, administered was designed to evaluate the was designed to study the effect of designed was Trial V Trial
Finally, Trial IV PCR was used to study changes in total bact PCR was used to and RFLP was us tract, the gastrointestinal specific and some by purine bases content, was also measured Microbial activity activities. enzymatic bacterial oligosaccharide and organic gut histol gut microbiota, performance, lact PCR was applied to quantify Real-time acids, to m bases and short-chain fatty concentrat immune response, immunoglobulin were determined. of continuous Peyer’s Patch development Chapter 3 Chapter patte fermentation Changes in the and RFLP. in the colon. acid concentration chain fatty and sodium control was used as a positive pigs. Avilamycin weaned of microbiota extract mixtur a commercial plant butyrate and
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW POPULATIONS INPIGDIGEST QUANTIFICATION OFTOTALBACTERIA, ENTEROBACTERIA ANDLACTOBACILLI Chapter 4 66
A BYREAL-TIME PCR Trial I
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW European UnionGuidelines. management, housing,husbandryandslaugh samples onmicrobial counts,18animals animals herdweresampled. fromthesame Tostudytheeffectofpre-treatment of body weight).ForcomparisonofqPCR,se were sacrificedwithanintravenousinje days) pigsofapproximately40days old. 4.2.1. Samplepreparation total bacteria, lactobacilli andentero months oflife(Tortueroet colibacillosis, whichisoneof themost in theweaningpig,lactobaci intestinal disorders(Muralidhara,etal simple indexandanincrease inthisratio microbiota. Conventionally,theratiolactob find particularmicrobial groupsthatcould could beanimportant adva DNA-based methods offertheoptionofstor taking intoaccountthattheydonotrelyon molecular methods couldbemore sensitiv culture medium (Langendijk,etal.,1995; knowledge ismostly attributedtothefailu bacteria arestillunknown(P communities ismuch greaterthanprevious
Samples ofjejunum digestawereobta The objective ofthisworkwastoevaluate Considering thehighcomplexity ofgutmi Recently, molecularmethods shown have ntage infieldconditions. al., 1995;Nemcova etal.,1999). 4.2. ryde etal.,1999;Leser lli couldhaveapredomin
4.1. Materialandmethods bacteria inpigdigestasamples. ., 1977;ReidandHillman, 1999). Specifically
common intestinal disorders during the first Introduction ction ofsodium (200mg/kg pentobarbitone 68 ined from healthyearlyweaned(20 Animals received commercial diets and the abilityofbacteriatogrow.Moreover, e andselectivethan re ofmany bacteriatogrowinagiven serve asanindexofahealth-promoting ly thoughtandthatthemajority ofgut is related witha acilli:enterobacteria hasbeenusedasa lective cultureandDAPIstaining,32 from asecondherdwereused.The ing samples untiltheiranalysis,which Huijsdens et al.,2002). Quantitative Huijsdensetal.,2002).Quantitative theuseofrealtime PCRtoquantify tering conditionsconformed tothe crobiota, some authorshavetriedto that thecomplexity ofmicrobial
al.,2002).Thislackof ant role incontrolling higher resistanceto traditional methods ra Trial I ± 2
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
vol) in sterile PBS PBS vol) in sterile
Aamp Kit DNA Stool Mini of digesta samples preserved in of digesta samples Bacteria were enumerated using an using enumerated Bacteria were ature was increased to 90 ºC and an ature was increased serially diluted (wt/ serially Spain) and lactobacilli in Rogosa agar Spain) and lactobacilli in Rogosa digesta were sampled and frozen until digesta were sampled d for DAPI staining a fragment of 10 staining a fragment d for DAPI tubes that contained 3 ml of ethanol as 3 ml tubes that contained attached to particulate material during during material to particulate attached n times with sterile PBS, and 0.5 ml of with sterile PBS, and of ml 0.5 n times ith the ethanol and stored at 4 ºC until ith the ethanol and mg/mL, 37 ºC, 30 min) to improve the to improve 37 ºC, 30 min) mg/mL, was carried out by epifluorescent direct was carried out by epifluorescent ff and kept in ice for further dilution. For dilution. For in ice for further ff and kept of each One gram of the samples. tion tment of the sample on the total bacteria total bacteria the sample on the of tment ng 4',6-diamidino-2-phenylindole (DAPI) ng 4',6-diamidino-2-phenylindole 69 r sample were counted. (Olympus NCWHK were counted. (Olympus NCWHK r sample acteria were enumerated using MacConkey acteria were enumerated tion (13000g, 5 min). The DNA from the The DNA from tion (13000g, 5 min). ing and DAPI staining, DNA extraction was ained was stored at -80º C. and purified using the QI phere (48h) (CM-627, Oxoid). g/ml) and filtered through polycarbonate membrane filters filters membrane polycarbonate filtered through and g/ml) μ The equivalent volume to 400mg The equivalent volume
m, Whatman International, Kent, UK). m, μ
For microbiological culture procedures an procedures culture For microbiological were digesta samples culture, For selective total bacteria of Direct quantification To evaluate possible disregard of bacteria ocular graticule and ten random fields pe ocular graticule and ten random Spain). Barcelona, 10x, Olympus, 4.2.3. Bacteria quantification by real-time PCR (qPCR) DNA extraction. ethanol was precipitated by centrifuga precipitate was extracted (Qiagen, West Sussex, UK). The lysis temper preservative. Samples were gently mixed w were gently mixed preservative. Samples (0.22 was added (10 incubation with lysozyme Chapter 4 Chapter was tied, cut-o thedistal jejunum cm from qPCR counts, digesta was kept in one gram of assess the effect of pre-trea To analysis. jejunum 5 g from qPCR counts, approximately analysis. methods traditional 4.2.2. Bacteria quantification by Enterob and plated in selective media. Madrid, agar at 37 ºC (24h) (CM-115, Oxoid, at 37ºC in a 5% CO2 atmos (Hobbie et al. 1977) usi count method was diluted te staining. One gram of sample were stained Samples of 2 % formaldehyde. 4.5 ml this suspension was fixed with 1 with DAPI (10 min, bacterial cell rupture. The DNA obt of the samples for cultur pre-treatment dilu 1/10 after a previous also performed
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW purification system (Promega BiotechIbéri et al.(2002).ThePCR productwaspur also sequenced(ABI3100 at 260nm EppendorfIbéri (Biophotometer, coli the DNAextractedfrom pigblood. the absenceofamplification ofporcine similarity searchprogram nucleotide-nuc USA). Thedifferentprimers werealsochecked Primer ExpressSoftwaretoqPCRreco oligonucleotides wereadaptedfrompublis 5’CCTACTTCTTTTGCAACCCACTC3’ (adapted (adaptedfro 5’ATGGCTGTCGTCAGCTCGT3’ (adapted from Walterelal.(2001) R- 5’GCAGCAGTAGGGAATCTTCCA3’, (1995) fortotalbacteria.For lactobacilli:F-lac R-tot (reverse)5’CTGCTGCCTCCCGTAGGAGT 5’GCAGGCCTAACACATGCAAGTC3’ (adapted different primers wereused:F-tot(forward) Quantitative PCR. Cambridge, UK). DNAextractionkit(CAMGEN,Ca Genomic obtained frombloodsamplesthatwereco centrifugation of6ml ofcu and 4ml oftheliquidphasewerecent vortex mixer. Dilutedsamples wereletto sample wasdilutedten times withsterilePBSandhomogenized 1minute witha Escherichia coli(CECT515NT)washarvested Stool MiniKitandpro extracted and purified from thepelletusing the same commercialQIAamp DNA Standard curveswereconstructedusi The DNAfrom pureculturesofLactobaci and L. acidophilus To quantify totalbacteria, lactobacilli andenterobacteria cedures describedabove. . Primers andPCRconditions lture usingthesame Qiagen Genetic Analyzer,PEBios
rifugated (20,000 x g, 20 min). The DNA was rifugated (20,000xg,20min). TheDNAwas ng PCRproductofthe16SrRNAgene DNA was tested empirically by PCR using DNA wastestedempiricallybyPCRusing 70 leotide BLAST(Altsch standonthebenchduringanotherminute mmendations (AppliedByosistems, CA, ca, Spain) andtheconcentrationmeasured hed specificprimers lac 5’GCATTYCACCGCTACACATG3’ lac 5’GCATTYCACCGCTACACATG3’ llected asepticallyusingtheMammalian ca S.L.,Spain).Products obtainedwere ified withthecommercial kitDNA mbridge Molecular ) andforenterobacteriaF-ent for their specificity using thedatabase llus acidophilus (CECT 903NT) and and llus acidophilus(CECT903NT) from thebacterial m Leseretal.(2002))andR-ent 3’(adaptedfromAmann etal. from Marchesietal.(1998)and from Sghiretal.(2000)).The were thosepublishedbyLeser ystems, Warrington,UK)to Kit.Piggenomic DNAwas or probesusingthe ul etal.,1990)and Technologies Ltd., pellet obtainedby Trial I E. E.
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW M)
μ Green Green ® l 10x SYBR l AmpErase l AmpErase μ of lactobacilli. of lactobacilli. μ = - 2.32 x + 43.88; = - 2.32 x + 43.88; ts. Dilution 1/10 was ± 1.66 log gene copies / g l of each primer (12.5 (12.5 l of each primer tion. Similar contamination contamination tion. Similar l using the SYBR ilutions were performed and were performed ilutions μ μ l), 1 for quantification for quantification μ cycles of 95 ºC for 15 s, and 60 ºC tion conditions for amplification of tion conditions for amplification gree of contamination of the reagents gree of contamination lactobacilli; and Ct lactobacilli; and enterobacteria in jejunum samples using using samples in jejunum enterobacteria using optical grade 96-well plates. The using optical grade 96-well plates. (5 U/ in Figure 4.1. The values obtained, by in Figure 4.1. The were 11.1 ± 0.88 log gene copies / g FM the ABI 7900 HT Sequence Detection the ABI 7900 HT Sequence between Ct (threshold cycle) and x (log Ct (threshold cycle) and between l dNTPs (2.5 mM), 0.25 l dNTPs (2.5 mM), PCR reaction, and by the presence of amplification, analysis of product melting melting of product analysis amplification, cially supplied reagen ® fferent PCR reactions ranged from 105-106 fferent PCR reactions ranged from μ 71 re conditioned by the minimum dilution of re conditioned by the minimum lification, giving equivalent values to 1/100 et al., 2000; Nadkarni et al., 2002). L. acidophilus Results and discussion
cycle of each amplification. of each amplification. cycle opies calculated. Serial d opies calculated. 4.3. FM for total bacteria; 10.8 tween 10 and 200 copies / reac were used for quantification of the total bacteria and and the total bacteria of quantification for were used l AmpliTaq Gold l AmpliTaq μ l MgCl2 (25 mM), 2 E .coli μ l), 0.125 μ
l of DNA samples (diluted 1/10). The reac 1/10). (diluted l of DNA samples (1 U/ μ ® Real-time PCR was performed with PCR was performed Real-time Minimum levels of detection for the di Minimum and lactobacilli total bacteria, Results for 102, 103, 104 and 105 copies of the gene per reaction were used for calibration. for calibration. used were per reaction copies of the gene 104 and 105 102, 103, from Amplicons R2 = 0.99 for enterobacteria. UK) Warrington, (PE Biosystems, System of 25 total volume on a PCR reaction was performed enterobacteria and amplicons from from amplicons enterobacteria and sample DNA that did not inhibit the DNA that did not sample in the commer E. coli DNA contaminating and 1/1000 dilutions. On the other hand the de was variable but ranged be Chapter 4 Chapter c and number of them, confirm the relationship The functions describing total -3.19 x + 53.66; R2 = 0.99 for assays were: Ct = for the different copy number) 2.60 x + 46.82; R2 = 0.99 for bacteria; Ct = - reaction included 2.5 Each PCR Core Reagents kit (PE Biosystems). Green buffer, 3 UNG and 2 after the last curve was performed (FM) and we gene copies/g fresh matter found not to affect the efficiency of amp has been previously described (Suzuki qPCR and traditional methods are shown respectively, qPCR and traditional methods and 7.8 ± 0.37 log bacteria /g for lactobacilli and 8.4 ± 0.56 log gene copies / FM and 7.9 ± 0.79 log bacteria /g FM DNA were 50 ºC for 2 min, 95 ºC for 10 min, 40 95 ºCDNA were 50 ºC for 10 min, for 2 min, the specificity of To determine for 1 min.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW or CFU(3.4 quantification byqPCRgavehighervalues tract ofpigs(Khaddouretal.,1998;ReidandHillman,1999).Inallcases, confirming Lactobacillusspp.asoneofth regardless ofthemethod used,lactobacillicoun g FMand4.8±1.68logbacteria/gfor coarse particulatematerial. Previous wo 0.60 fordirectlyextractedand10.3 samples weredeadandthus,permanently beyond anyculturemethod. recently, Apajalahti etal.(2003) foundthat viable, orviablebutnotcu multiplicity of16SrRNAge (Nadkarni etal.,2002;Huijsdensal.,2002) discrepancies betweenPCRandculturi (2.5 ratio (expressedasthediffe lactobacilli andenterobacteria respectivel would suggestthatahigh percentageofmi numbers whensubjectingsamples toapr from digestasamples orfrom pre-diluted hypothesis wecompared qPCRresultsfortota coarse digestive material that persists in peak, indicatingtheabsence always hadasimilar meltingpointtothe However, thedissociation curveobtained overestimation duetoformation ofnon- was performedwithasubse isolation of thebacterial pellet,whereas fo samples directlyextractedfrom were the somehow withculturingandDAPImethods community attachedtotheco treatment of thedigesta. Thepresence The useofreal-time PCRwithSYBR Another reasontotheoverestimation re ± 0.58 for PCR and 3.1 0.58forPCRand ± 0.71,2.9 ± rence oflogarithms) wassi 1.73and3.6 lturable bacterialcells,and quent sub-sampling thatgene of non-desiredPCRproducts. ne copies (Fogeletal., 1999), tothe presence ofnon arse particulatematerial co ± 0.71forselectiveculture, ± 0.51logunitsfordiluted 72 thebottom of thetubes.Tovalidate this r cultureorDAPI,aprevious1/10dilution evious dilution.Meanvalueswere11.1 samples. Resultsconfirmed reductionin a ng havebeenfoundbyotherauthors rks havedescribeda ± at the endofeachPCRwascheckedand crobial populationremains attachedtothe standard samples, withoutanyadditional specific amplicons (Heinetal.,2001). in terms of 16S rDNA than DAPI counts in terms of16SrDNAthanDAPIcounts e major groupsinuppergastrointestinal y). However, lactobacilli:enterobacteria 1.72logunitshigher original material withoutanyprevious of aquantitativeimportant bacterial but notwithqPCR.InthisstudyDNA between 17-34%ofbacteriain fecal l bacteriausingDNA enterobacteria. Itshouldbenotedthat enterobacteria. gistered, aredifferences inthepre- ® ts wereclosetototalbacteriacounts, andtheyhavebeenrelatedtothe Greendyecouldalso lead to milar betweenmethodologies to freeDNA.Inthatsense, rally overlooksmostofthe uld havebeendischarged samples (n=18).This P =0.39).Similar high percentageof for total bacteria, extracted directly extracted directly Trial I ±
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
< 0.001) P total bacteria, bacteria, total n, Yang et al., 2001). n, Yang robacteria). Graph shows sults obtained indicate the sults obtained indicate pigs (n = 32) as FM, for total bacteria) or selective total bacteria) or selective FM, for the representativity of the species of the species the representativity differences between free bacteria and free bacteria and differences between DNA directly from the samples, while directly from DNA al counts, values obtained by qPCR and by qPCR obtained values al counts, t. This previous isolation could affectt. This previous
r 70 % in the rume r 70 % mples whatever the method of microbial microbial of whatever the method mples 73 by qPCR (log 16S rRNA gene copy number/g gene copy number/g by qPCR (log 16S rRNA gnificant correlation despite (r = 0.7; FM, for lactobacilli and ente let-Doreau et al., 2001). Re let-Doreau et al., Bacterial loads in jejunum digesta of digesta jejunum in loads Bacterial
Figure 4.1. of microbi In spite of PCR overestimation results quantitatively and also compromise results quantitatively taking into account ecological composition (Micha attached populations of sa of previous treatment importance use. quantification we measured or enterobacteria lactobacilli (log cells/g (FM)), DAPI staining fresh matter culture technique (log CFU/g and standard error of the means. means showed a si total bacteria DAPI for others isolate previously the bacterial pelle others isolate previously Moreover, for fecal and digesta samples, DNA extraction protocols are diverse are diverse protocols DNA extraction samples, digesta and for fecal Moreover, extract authors 2003), some (Anderson et al., Chapter 4 Chapter solid phase (ove attached to the microbes
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW jejunum digestasamples collected as log16SrRNAgenecopynumber/g FM (qPCR) criterion. considered bythetwomethodologiesfollowi significant correlation. Itco (r =0.51; somehow method discardedwiththeDAPI as increase inthepercentage ofbacteriaatt amount ofcellulardebrisand highest countsthanwiththelowestcounts. (Fig 2).It isinteresting topointout thatqPCRoverestimation washigher withthe significant correlation(r=0.48; Similarly tototalbacteria,PCRandcu changes inbacterialspeciesandmetabolic possible reasontoconsiderisachangein Figure 4.2. P <0.01).Howeverresultsobtainedforenterobacteriadidnotshow Correlation betweenthe number of free bacterialDNAwiththehi uld bedueto differences inthebacteria species P from jejunum samples ofpigs. <0.01)asdidthelactobaci 74 ached toparticulatematerial that hadbeen the number of16SrR lture countsforlactobacillishoweda or byDAPIstainingaslogcell/gFMin ng aphenotypic(cultu Itcouldbedueto activityofbacteria wehavementioned before.Another total bacteriameasured byqPCR ghest counts or also to an ghest countsoralsotoan lli:enterobacteria ratio NA copiesrelatedto (Fogeletal.1999). an increaseinthe re) oragenotypic Trial I
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
the gut health health gut the ll be a practical method method a practical ll be an index of though numerical values are though numerical gut bacterial shifts in the near future. gut bacterial shifts in the near future. in absolute values could be related to in absolute values
oring samples until analysis, could turn could turn until analysis, samples oring qPCR (once implemented) compared with compared with qPCR (once implemented) 75 Conclusion Conclusion
4.4. that real-time PCR may we PCR may that real-time cteria ratio could be used as cteria ratio could ts in pig gut bacteria al ts in pig gut bacteria
The results obtained suggest The results obtained for studying quantitative shif for studying quantitative Differences methods. higher than for traditional particle- some loss of and to the dead cells with qPCR DNA from of the amplification groups between values Relative culture. and selective with DAPI bacteria attached the lactobacilli:enteroba such as Chapter 4 Chapter of status of pigs. The ease and rapidity st of and the possibility culture, traditional for quantifying qPCR into the preferred method
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW INFLUENCE OF WEANINGON INFLUENCE OF OF PIGS: USE OF REAL-TIME PCR AND T-RFLP REAL-TIMEPCRANDT-RFLP USEOF PIGS: OF Chapter 5 76
CAECALMICROBIOTA Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW at weaningusingt-RFLPandreal-timePCR. antibiotics growthpromotersinweanedpigs. place atweaningwouldbeofgreathelp phase. Inthatsense,amoreexhaustiveknow little isknownaboutthespecificchangesof opportunistic disease-causingpathogenic the pigletmoresusceptible tomicrobia bacterial community(Katoul complex carbohydrates,causessubstantialquant 2002). Allthis,togetherwiththefactthat lactoferrin, thatpreventthe the removal ofimmunoglobulinAandlyso especially atstressfulperiods suchasw etal colonization bypathogens(VanKessel plays akey roleinthe maintenance of microbiota, characteristicanddynamic maintain piglet guthealtharerequired. European Union(January2006),newfeedst have beentraditionallyfedtopigs.Howe control theactivityof economical loses(McCrackenetal.,1995; nutritional andenvironmentalchangeswhichca that appearsatweaningandinvolvesdiar most important problems inpigproduc diseases andreducegrowth(Pluskeetal Bearing thisinmind, anexperiment was It isitgenerallyrecognisedthatth At weaning,thepigletissubjectedtocoun thegutmicrobiota atweaning,antibioticsgrowthpromoters i etal.,1995,1999;Melin growth ofopportunisticbact 5.1. Introduction tion nowadaysisthepost-weaningsyndrome eaning whensow’smilk withdrawalinvolves for eachindividual (Simpson etal., 2000), 78 piglets arefirstlyexposedtomanydifferent ., 1997; Jensen, 1998). In fact, one of the ., 1997;Jensen,1998).Infact,oneofthe l disbiosis with potentialovergrowth of bacteria (Mathewetal.,1996).However, 1999). Inordertoenhancegrowth,and e establishment ofadiversebacterial ., 2004).Itmay importance beofextreme to followtheproper strategy toreplace the gastrointestinalhealthavoiding ver, sincetheir recent total baninthe
microbialecosystem rhoea, growthstasis designed tostudymicrobial shift inpigs zyme, otherproducts,suchas among tless ofstressorsduetocomplex social, ledge ofthebacterialshiftsthattakes n alsoenhancepiglet itative andqualitativechangesinthe rategies and/orfeedadditivesto al., 1997,2000),becoming eria (EdwardsandParret, andconsequently during thiscritical susceptibility to Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
ona facilities. The rmates. Weaned pigs Weaned pigs rmates. oquinol, S.A., Spain; ponding farm with an ponding farm ition (as fed basis). piglet remained during this week in during this week piglet remained tering conditions conformed to the tering conditions conformed 2 days, mixed males and females) were males 2 days, mixed and the rest of litte of and the rest
anized in the corres t Autònoma de Barcel t Autònoma itone (Dolethal, Vet 79 fed a high quality commercial post-weaning commercial post-weaning quality high fed a taking initial body weight into account. One One account. body weight into initial taking 5.2. Material and methods and methods 5.2. Material Control diet compos whereas the other whereas the other Table 5.1. Corn 46.70 Corn Full fat extruded soybeans 15.00 Lactose Soybean meal, Potato protein Whey powder 17.00 L-Lysine HCl (78) DL-Methionine 0.10 L-Threonine 0.01 phosphate Bicalcium Salt 0.80 10.00 carbonate Calcium 3.77 Vit-Mineral premix 0.17 1.52 Sepiolite 1.20 3.04 0.44 0.25 Ingredient % % Ingredient
were euth On day 28 of life, the animals A total of 12 piglets (4.4 ± 0.36 kg; 20 ± A total of 12 piglets were allocated in a box in the Universita were allocated 5.2.2. Sacrifice and sampling pentobarb sodium intravenous injection of 5.2.1. Animals and housing 5.2.1. Animals and and was weaned litter each from piglet (Table 5.1) diet for one week with the dam commercial farm the original housing, husbandry and slaugh management, selected from six commercial litters, six commercial selected from European Union Guidelines. Chapter 5 Chapter
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 200 mg/kg BW). werebled,th Animals from absolute quantification of the total bacteria andenterobacteria and the amplified gene those publishedbyLeseretal.( were usedtoconstructthestandard of quantification, PCRproducts well platesandSYBRGreendye(PEBi performed withtheABI7900HTSequenceDe al. (2000)).Amplifi (2002)) andR-ent5’CCTACTTCTTTTGCAAC enterobacteria F-ent5’ATGGCTGTCGTCAG (adapted 5’GCATTYCACCGCTACACATG3’ (1995). Forlactobacilli:F-lac5’GC R-tot (reverse)5’CTGCTGCCTCCCGTAGGAGT 5’GCAGGCCTAACACATGCAAGTC3’ (adapted bacteria, primers used using thePrimer ExpressSoftware(A within 16SrDNAgeneandwereadapted Castillo etal.(2006).Theoligonucleotide quantified usingreal-time PCRfollowing stored at-80ºCuntilanalysis. 30min)mg/mL, 37ºC, inordertoimprove increased to90ºCandaposteriorincuba Mini Kit(Qiagen,West Sussex,UK).Th precipitate wasextracted in ethanolwasprecipitatedbycentrif ethanol (96%)asapreservative. samples (1g) ofthecaecum contentweretakenandkeptintubeswith3mL of Escherichia coli Real-time PCR(qPCR). DNA extraction. L. acidophilus for quantification of thelactobacilli. (CECT515NT)and cation anddetectionofDNAby The equivalentvolume to400mg and purifiedusingthecommercialQIAampDNAStool obtained from theamplifica
Total bacteria, lactobacilliand enterobacteriawere 2002). Theamplified genefrom ugation (13000gx5min) andDNAfrom the curves. ThePCRconditionscorrespondedto AGCAGTAGGGAATCTTCCA3’ andR-lac 80 pplied Byosistems, CA,USA). Fortotal Lactobacillus acidophilus e abdomen wasimmediatelyopenedand osystems, Warrington, UK).Forabsolute from publishedspecificprimers orprobes s usedwerebasedonregionsofidentity tion stepwithlysozyme wasadded(10 thebacterialcellrupture.TheDNAwas e recommended lysistemperature was procedures andprim tection System usingopticalgrade 96- CTCGT3’ (adaptedfrom Leseret al. were: F-tot(forward) from Walterelal.(2001))andfor CCACTC3’ (adaptedfromCCACTC3’ Sghiret 3’(adaptedfromAmann etal. from Marchesietal.(1998)and quantitative real-timePCRwas of digesta samples ofdigesta preserved
tion ofthewhole16SrDNA E. coli ers describedby (CECT 903NT) (CECT903NT) was used for wasusedfor Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
L of μ T-RFLP T-RFLP in silico . eraging algorithm
netic Analyzer, PE its (the area of the ce coeficient was ce coeficient was the pattern to the total area PCR were made for each sample. PCR were made forward primer: S-D-Bact-0008-a-S- forward primer:
mode with 25-U detection threshold. mode Fingerprinting II (Informatix, Bio-Rad, Bio-Rad, Fingerprinting II (Informatix, loaded on the capillary, the sum of all loaded on the capillary, the sum purified on QIAquick PCR purification purified on QIAquick alyzer (ABI 3100 Ge of the profiles, Dy group method with av group method P-tRFLP from the Ribosomal Database ith the primers and the enzyme used were the enzyme and primers the ith area were deleted from the data set. New New the data set. from were deleted area and eluted in a final volume of 30 final volume and eluted in a normalize peak detection threshold in each each in threshold detection peak normalize bp fragment of the 16S rDNA gene was 81 ormed following the procedure described by described the procedure following ormed PCR product was submitted to a restriction a restriction to submitted PCR product was eak area) by 323 area un cterial composition in the samples, in composition cterial t Length Polymorfism (t-RFLP) Polymorfism t Length ratio of total peak area in Sample data consisted of size (base pairs) and peak data Sample rd GS-1000-ROX (PE Biosystems). (PE Biosystems). rd GS-1000-ROX l) (Biolabs Inc. New England, USA). The fluorescentlyl) (Biolabs Inc. New England, μ I (20,000 U/
Hha Treatment of t-RFLP data. Terminal-Restriction Fragmen Terminal-Restriction of peaks in each sample once number Diversity was considered as the ba the potential infer to In order Biosystems, Warrington, UK) in Gene-Scan Warrington, Biosystems, in the range of 50 to 700 base pairs were of the sizes of TRFs Determinations with the size standa performed 20 (5’-6-FAM-AGAGTTTGATCMTGGCTCAG-3’) (5’- PH1552 and reverse primer AAGGAGGTGATCCAGCCGCA-3’). Duplicate labeled PCR products were The fluorescently Sussex, UK,) (Qiagen, West kit columns the resultant water. After that, milli-Q with the DNA area for each TRF. To standardize to pattern was used the TRF peak areas in a Kitts (2001), a new threshold value was obtained by multiplying Following sample. pattern’s relative DNA ratio (the labeled terminal restriction fragments (TRF) were analyzed by capillary capillary by (TRF) were analyzed fragments restriction labeled terminal sequence an electrophoresis on an automatic Chapter 5 Chapter was perf community of bacteria analysis (2005). Briefly, a 1,497 Höjberg et al., using a 6-carboxy-fluorescein-labeled amplified total p with the smallest in the sample total peak with the smallest sample in the threshold at the 25 detection peak smallest lower peaks with area). For each sample, pattern. in each peak areas of all the remained the sum by was obtained area total standardized. For pairwise comparisons constructed using calculated and dendograms Ca, USA) software and unweighted pair (UPGMA). pig gut bacteria w the major restriction for obtained using the analysis function TA Project II software (Cole et al., 2003; Table 5.2).
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
Table 5.2. Theoretical restriction 5’- fragment length predicted for the major pig gut bacteria. Results were obtained from the TAP- RFLP tool of the Ribosomal Database II Project software.
d a b c Frequency Bacteria groups Compatible bacteria In silico restriction Real restriction Suckling Weaned L. acidophillus, L. brevis, L. bifermentum, rhamnosum, casei 597, 598, 599 597, 599 1 (1.45) 2 (0.54) L. delbruekii sp. Delbruekii 254 254 4 (1.96) 1 (0.98) Lactic Acid Bacteria L. delbruekii sp. Lactis 223 221-223 5 (4.59) 0 L. fructivorans 68 68 3 (0.88) 3 (0.59) Lactococcus lactis, Lactobacillus vaginalis 61 62 6 (14.22) 5 (19.42) Enterococcus sp. 216, 218, 220 214 5 (2.18) 2(1.35) Cytophaga 92, 94, 96, 100 Bacteroides and relatives Flexibacter 82, 84, 90, 94, 96, 97 89-104 6 (4.06) 5 (5.17) Bacteroides 95, 96, 98, 101, 102, 104 Fibrobacter succinogenes 139, 141, 145 138, 140, 142-145 6 (1.80) 4 (2.70) Fibrobacter Fibrobacter intestinales 148, 152 148-152 6 (3.46) 5 (0.69) Clostridium coccoides 66 66 3 (1.67) 0 Clostridium butyricum 544 544 5 (0.86) 0 Eubacterium 188, 190, 192, 194, 203 Ruminococcus 189 Clostridium and relatives Clostridium clostridiforme, C. Symbiosum 190 188-193 2 (1.19) 4 (0.63) Roseburia 192 Butyrivibrio 193 Other Clostridium spp. 229, 231, 233, 237 229-232, 237 6 (1.30) 5 (1.36) Escherichia sp 371, 372, 373, 374 376-377 3 (0.51) 1 (0.55) Proteobacteria Other enteric bacteria (Salmonella, 367, 370, 371, 372, 373, Citrobacter, Klebsiella) a Major pig gut bacteria with a potential compatible fragment found in at least three animals. Other peaks with 58, 59, 69, 111-120, 123, 133, 162, 211, 278 and 279 did not correspond with any 16S rDNA sequences in the database from the Ribosomal Database Project 8.1 software. b In silico restriction was performed using the tap-tRFLP tool from the Ribosomal Database project II. c Terminal fragment length obtained after PCR product restriction with Hha I. d Number of animals that showed the peak in each experimental group. In braquets abundance of the peak expressed as % of total area. Mean value is calculated only considering the animals showing the peak.
OBJE CTIO REVI TRIA INTR CTIV ODU LITE URE RAT EW ES L I TRIAL II N = 0.13). The P
rical decrease in 0.05. et al. (2002) in piglets ≤ P increase in enterobacteria (9.97 increase in enterobacteria (9.97 ra et al. (1977), has been routinely and enterobacteria were quantified in and enterobacteria were quantified log gene copy number/g FM for S and log gene copy number/g The individual pig was used as the The individual the end of the experimental period body the end of the experimental
food showed a nume ng the GLM procedures of a SAS statistic ng the GLM procedures gut health. The ratio between these two anaerobic counts were maintained after after counts were maintained anaerobic log 16S rDNA copies/g fresh matter (FM), log 16S rDNA copies/g fresh matter < 0.001). 83 ng desirable that lactobacilli outnumber ng desirable that lactobacilli outnumber P ssed as difference of logarithms, wasssed as difference of logarithms, remain with the sow (6.1 ± 0.25 kg and 5.05 with the sow (6.1 ± 0.25 kg remain < 0.001). Expressed as average daily gain < 0.001). Expressed as average there was one case of yellowish liquid faeces there was one case of yellowish ilar for both groups, with 4.4 ± 0.16 kg for Silar for both groups, with 4.4 ± P measured by real-time PCR s against opportunistic pathogens. 9.01 log gene copy number/g FM for S and F group 9.01 log gene copy number/g lts were found by Franklin 5.3. Results and discussion 5.3. Results and vs. significance was accepted at significance was = 0.24) that was accompanied by an = 0.24) that was accompanied P The animals remained in good health throughout the experiment. Diarrhea was in the experiment. good health throughout remained The animals 5.2.3. Statistical Analysis Analysis 5.2.3. Statistical and enterobacteria lactobacilli, on total bacteria, of weaning The effect The total microbial population, lactobacilli population, The total microbial as The total bacteria counts, expressed Lactobacilli and enterobacteria have been traditionally selected as microbial as microbial selected traditionally been have enterobacteria and Lactobacilli As expected, animals fed with dry fed with As expected, animals not detected in any of the pigs, although in any of the pigs, although not detected expected, at and 4.4 ± 0.15 kg for W, and, as Chapter 5 Chapter tested with an ANOVA usi biodiversity was Inst., Inc. 8.1, Cary, NC). package (SAS unit. Statistical experimental sim (W group). Initial live weight was that weight (BW) was higher for piglets 5.3.1. Bacterial quantitative change ± 0.27 kg for S and W respectively, ± 0.27 kg for S and W respectively, for suckling than for weaned(ADG), growth rate was higher and pigs (0.25 ± 0.02 respectively, 0.10 ± 0.02 kg for S and W (Figure 5.1). digesta using qPCR caecum were similar between groups (12.84 and 12.81 were similar resu W respectively). Similar weaned at 24 days where total faecal lactobacilli population (9.70 respectively, FM for S and F group respectively, vs. 10.78 log gene copy number/g weaning. groups with a particular significance for bacterial groups, firstly proposed by Muralidha used as a gut health indicator, bei robustnes enterobacteria to improve expre ratio enterobacteria:lactobacilli,
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW fold dropinthenumbers ofl 1996; lactobacilli inparallel withincreases in (Risley etal.,1992;Jensen,1998).Thisre connection betweenlactobacil numbers of respectively ( lactobacilli andenterobact significantly higherinweanedpigs reflect life. immune response(Perdigónetal.,2001),spec E. coli its relatedeffectspromoting guthealthbyi from themilk (Hopwood andHampson, 2003)ma rDNA genecopies/gFM)insucklingorweanedpigs. The maintenance oflactobacil Figure 5.1.
log 16S rDNA gene copies /g FM Franklin etal.,2002).In 10 12 14 (Hillman etal.,1995;Tann 0 2 4 6 8 Escherichia coli P =0.05)).Comparable resultshaveb Bacterial loads in caecum meas Bacterialloadsincaecum oa atbcliEnterobacteria Lactobacilli Total eria populations(0.27a (Huisin’tVeldandHavennar,1993). li andenterobacteria during the first week post-weaning actobacilli inthe intestine, fact, abruptweaninghasbe li population,thatiswellad ock etal,1999)andalso Weaned Suckling 84 enterobacteria population (Mathew etal.,
nhibition ofsome otherbacteria, suchas
ing thecontraryeffectofweaningon sponse isduetomarked decreasesin ially important duringthefirststageof ured byquantitativePCR(log16S y beofagreatinterestconsidering nd 1.76forSgroupandW een found before, with an inverse een foundbefore,withaninverse * Ratio E:L and 50-fold increase inthe en associatedwitha100- modulating anadequate apted toutilisesubstrate 0,0 0,5 1,0 1,5 2,0 2,5 3,0
enterobacteria:lactobacilli (log/log) Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW l effect shaping the form of a dendogram of a dendogram form digestive system digestive system may gs, due to the fact that gs, due to the fact ing has also been related tless of stressors. Dietary ing therefore a bacterial iles (25-76%). This higher the beginning of some kind the beginning of some e high effect of the sow being kers (1997), studying metabolic kers (1997), studying metabolic the animal that showed liquid faeces. that showed liquid faeces. the animal also have a crucia onents such as different glycoproteins have become into a fail of microbial have become into a fail of microbial that grouped in the suckling branch of that grouped in reover, is well known that bacterial reover, is well known that bacterial rity of the piglet ent, to which the animal is exposed, that ent, to which the animal ling piglets could have been determined ling piglets could have been determined such as litter or individual effects. This such as litter or s clearly dominating in comparison with in comparison with dominating s clearly e for the intestinal bacteria. Also, there is is Also, there bacteria. the intestinal e for stools are related with malabsorption stools are related with malabsorption ofiles illustrated in ofiles illustrated m at sampling. The effect of weaning on on The effect of weaning at sampling. m higher similarity between them (54-78%) between them higher similarity ter weaning (Kyriakis et al., 1989). A poor ter weaning (Kyriakis et al., 1989). have caused a higher speed in transit time. have caused a higher speed in transit of digesta, being impaired by a high speed of digesta, being impaired by a 85 ters, one for each experimental group. There experimental for each one ters, lthough no differences in productive parameters parameters lthough no differences in productive of diet, it involves a coun social stress suffered at wean food in this animal, remain hows microbial profiles of 11 pi profiles hows microbial heterogeneous microbial prof heterogeneous microbial the dendogram might reflect might the dendogram release and an increased transit time via the sympathetic sympathetic via the time transit and an increased release sense, Katouli and co-wor tochthonous microbiota. tochthonous microbiota. et’s microbiota, demonstrated th demonstrated et’s microbiota, Weaning is not only a change In that sense, suckling pigs showed a The similarity indexes of the t-RFLP pr the t-RFLP indexes of The similarity fingerprinting of pigl than weaned pigs with more pigs with than weaned of suck found in the microflora homogeneity effect. In this by a mother with increases in cortisol in cortisol with increases (Pluske et al., 2002). Mo nervous system factors might (Stewart et al., 1999). All these to adapt to dry ecosystem suckling period. to that of the community more similar by carbohydrates as the lipids are substituted are drastically changed; components immatu energy that with the source of main substrat fermentable important an result into environm change into the microbial a marked milk of the withdrawal with by the sow. All this, determined was mainly before supply, and therefore diverse functional comp profile of the piglet au the dendogram that interesting corresponded to the dendogram Besides dry feed introduction, on flow colonisation is highly dependent 1996b) can et al., and oligosaccharides (Pluske Chapter 5 Chapter results changes, t-RFLP bacterial 5.3.2. Ecological 5.2. It s are shown in Figure cecu digesta in the present one pig did not wa of microbiota the ecological composition affected, have been that could other factors piglet one weaned for was only an exception Separation of this piglet in a of enteric disbiosis in this piglet, were observed. In fact, watery measured that usually appears 3-10 days af syndrome might animal adaptation to dry feed in this was reflected in two clearly separate clus was reflected in
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW represented in3animals. relative abundance (as %of totalarea) of experimental groupwith inferenceofsome Figure 5.3showsanexample oftheel major piggutbacterialgroupsthathaveb of specietoonepeakisnotcompletely possible. compatible bacterial species andalways have more than one organism inthe sample.Re of identicalsize(Liu etal.,1997)andthat needed toremind thatdispersedphylogeneti potential ecologicalchangesinthesamples. biodiversity 25dayspost-weaning. More recently, Inoue andco-workers (2005) would also reflectthe stressofthe life. the determinant factor inmicrobiota establis (1993) foundthatuntil3-4mont capacity ofthemicrobiota inthehindgutha Jensen (1998)foundthatittakes2to3 probably, alatersacrificecoul probably in theprocess of reestablishment of anewmicrobial equilibrium and McBain, 1999;Melinetal., intestinal disordersandpr diversity implies lowercolonization resistan on aplethoraoffactors.Ahi that, there is aprocess of re-establishment that can take more or less timedepending weaning involvesacleardisruptionin (Katouli etal.,1997;Jensen-W works havedescribedamarked decreasein experimental groups(49.34forSand53.40Frespectively, individually. In ourcase,wedidanattempt toassigncompatible bacteria speciesamong those In silico On theotherhand,highervariabilityinmicrobial profilesinweanedgroup Biodiversity, measured asthetotalnumb restrictionusingRibosomal Databa oliferation ofopportunistic gher biodiversityisdesirabledu 2004). Inourcase,thepigs d haveshownahigherbiodiv aern etal.,1998; hs afterweaningthemicrobio weeks afterweaningbeforethefermentative the normal pigmicrobiota evolution.After pig atweaning,respondingeachanimal 86 een recentlydescribed(Leser etal.,2002). compatible bacteria. Table 5.2 shows the compatiblebacteria.Table 5.2showsthe asinglet-RFinprofilemayrepresent
sults aretherefore presented aspotential s fullydeveloped,moreover Swords etal c groupsofbacteriamay produceT-RFs ectropherogram for one pigofeach ce beingthe pigletmore susceptible to some ofspeculative asdirectattribution hment withinthepiglet’s first days of compatible bacteriathat wereat least biodiversityjustaf Before considering these resultsitis er ofbandswassimilar betweenboth foundarecovery inpiglet bacterial Melinetal.,2000)showingthat se Project IIwasused toinfer pathogens (MacFarlaneand fedwithdryfoodwere e tothefact that a lower ta isstillin ersity. Inthatsense, P = 0.22). Different =0.22).Different ter pigletweaning evolution. Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW Weaned Weaned Suckling Weaned Suckling Weaned W1 W1 W2 W3 W4 S1 S2 S3 S4 S5 S6 W5
100
. 90 intestinalis
Hha I digestion of 16S rDNA PCR Hha I digestion of 16S rDNA PCR 80 ii g pig and one weaned piglet. The size pig and one weaned piglet. The size g 4
from 11 piglets sacrificed on day 28 of on day 28 of piglets sacrificed from 11 Fibrobacter 3. Base pairs Base pairs
87 70 L. delbruek
4. 60 e in percentage of similarity e in percentage of 3 3 Percentage of similarity Percentage of similarity
C. coccoides C. coccoides L. vaginalis/L. lactis L. vaginalis/L. lactis
2
1 50 40 Dendogram illustrating the effect of weaning in t-RFLP banding in t-RFLP banding of weaning the effect illustrating Dendogram
Electropherogram produced from produced from Electropherogram 2
1
1 30
Figure 5.3. Figure 5.2. Figure Fluorescence detected detected Fluorescence caecum digesta from one sucklin products from by using Genescan software. Arrows were determined of each band and intensity peaks in the samples. abundant show the most Chapter 5 Chapter represents results The dendogram patterns. distances ar life. The dendogram
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW base pairscompatible with both acid bacteriaincluding 2005). are describedasoneofthemajor groupsin are alsocharacterizedbytheformation of animals withamean around contribution delbruekii, rhamnosum, Enterococcus, Mean areafortotallactobacilliwassi that usuallyrefrainfrom eating(LeDividich behaviour ofsucklingpiglets,much more described before(Krauseetal.,1995).Itha four sucklingpigs,andonlyappearedinoneweanedpig. fragment withcompatible size.Similarly, representing nearthe5%of Particularly biodiversity incompatible TRFswithdiffere for sucklingandweanedpigsrespectiv gastrointestinal tractinsu higher andcontinousamountofsubstrate lactobacilli species observed gastrointestinal insucklingpigstract that result inamorebeneficialenvironment carrier niche forlactobacillifrom stomach to results intotheformation of milk clotsin may becompatiblewiththisgroup(2.18 %) found adecreaseinenterococci newborn babies(Favier etal weaned group(1.35%).Inthe Analysis ofelectropherograms revealed co Lactic acidbacteria.
In thecaseof
The presenceofahigherdiversity and
L. delbruekii L. vaginalis,Lactococcuslactis,de belong totheFirmicutes withlow L. fructivorans. Enterococcus L.adidophilus,bifermentu ckling pigs.Moreover,thecase sp. totalarea,whereasnoanimal oftheW any groupshowed
in posteriorsections. ., 2002)andisalsoin ag lactis Lactobacillus sp.,fiveofthesixsucklingpigsshowedapeak that when pigletswereweaned. same way,thisbacteriagr L. lactis It isalsointeresting toremark thefragment of 62 waspresentinfiveanimals fromthisgroup, milar betweenbothgroups(23.1%and21.5 ely).although sucklingpigsshowedhigher and 88 lacticacid(AguirreandCollins,1993) for thegrowthoflactobacilliinupper thestomach thatcouldactsomehow asa L. delbruekii couldbebehindthegreaterdiversityof frequent thanweanedpigs(Moran,1982) 15 –20%oftotalarea(seeFigure5.3).
andHerpin,1994).This s beenrelatedwiththedifferentfeeding available forfermentation intheupper nt lactobacilli species the piggastrointestinal tract(Hilletal., , small intestine. Allthesefactors could lactobacilli insucklingpigshasbeen L. vaginalis that onlyappearin mpatible TRFs withdifferent lactic Lactococcus, Streptococcus mol% G+CcontentinDNA,that lbruekii sp. lactis,L.delbruekii sp. sp. ree withJens m, L.brevis,casei, in component ofsow’smilk that waspresent inall the oup isoftendescribedin delbruekii twopigsfrom the than weanedpigs. might result ina was present in en (1998)who , and Trial II
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW sensu as one clusters I, IV I, IV clusters FA. In fact, it has Clostridium ., 1984: Seki et al., only appear in three the suckling group. the suckling group. Clostridium respectively. However, it peak area for suckling and peak area for suckling spp is on of the predominant predominant spp is on of the fall within the genus, as well as as well as the genus, within fall the Clostridium genera too (Collins genera the Clostridium of the genera (Collins et al., 1994). of the genera (Collins et al., The presence of C. coccoides may be presence of C. coccoides may The heterogeneous group of organisms. heterogeneous group of organisms. peak area. In the same way, a peak peak area. In the same ed deeply branching lineages within the the within lineages deeply branching ed
Bacteroides nd humans (Han et al nd humans to its production of SC bacteria belonging to any of those groups ckling period, declining progressively in phylum (Gherma and Woese, 1992) can be 1992) can and Woese, (Gherma phylum Clostridium coccoides Clostridium species (Sharp and Ziemer, 1999; Lawson, species (Sharp and Ziemer, 89 ilar size ranging from 89 to 104 bp (see Table ilar size ranging Clostridia represents a phenotypically and and a phenotypically represents Clostridia Ruminococcus our results and have described
Different species from the group phylogenetic species from Different (0.86 %) was only found in is classified into the Cluster I, Clostridium I, Clostridium the Cluster into is classified aks represent 4.0 % of total aks represent 4.0 for suckling and weaned pigs for suckling and weaned C. butyricum C. butyricum species that are scattered throughout species that are scattered throughout , where are found the majority of species , where are found the majority Savage et al. (1977) demonstrated that Savage et al. (1977) and relatives. Clostridium with In our study, a peak compatible Bacteroides and relatives. Bacteroides Some other authors agree with Some Other compatible peaks with different species from the with different species from peaks Other compatible
phylogenetically extremely complex and complex phylogenetically extremely 5.2 % for weaned pigs being therefore the second group in importance behind behind group in importance pigs being therefore the second 5.2 % for weaned lactobacilli. also as one have been described in the adult pig caecum, and negative anaerobes gram Cavazzoni, 1999) with a marked and piglets (Adami young bacteria in important et al., 1993). increase after weaning (Swords have demonstrat Sequences of the 16S rRNA clostridia, which included nonclostridial of the genus 1999). All members Eubacterium 1995). et al., 1994; Rainey and Janssen, % of total suckling pigs representing 1.67 with compatible Phylogenetically Chapter 5 Chapter (CFB) Cytophaga-Flexibacter-Bacteroides of sim with a series of TRFs compatible of these pe 5.2). Summed area stricto of the main anaerobic bacteria during su of the main abundance with the age (Swords et al., 1993). considered as beneficial for the piglets due been used as a probiotic both in animals a been used as a probiotic both in animals 2003). of mean as a representing of animals both groups and XIVa and XVIII were found in 2.49 and 1.99 % of total area is difficult to conclude potential changes in process. related to weaning
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Mycoplasma arthritidis of T-RFLPwithqPCRresults.. found forenterobacteriaceafamily compared to represent typicalpiggut bact These threebacteriawere notconsidered are lessrepresented.Thisfactmight expl attention andhugeamount ofsequencesha interests. Inthatsensebacterialgroups different sequencesinthedatabasesar counted byreal-time PCRinallthepigs. like digestacontentmight explainabse also thecomplexityofamp of particularprimer pairstocertain A biasinthe amplification animals, eventhatwedetermined enteroba (Ewing andCole,1994).However,wefoundpot have beenroutinelydescribedasmember which belongdifferentbacteriasuchas utilize dietary fibreespecially experimental groupsmay pointoutthehighpot suckling and3.4%forweanedpigs). intestinalis activities (Gokarnetal.,1997) al., 1997).Thosebacteriashowhighcellu particular, highnumbers ofthesebacteriahave found inthepiggastrointestinaltract(V fibrolytic bacteriainrumi al., 1990a).Bacteriabelonging being recently reclassified intothe speci Three peaks(161,173and238basepa Proteobacteria. Until recently,thesebacteria weregr Fibrobacter. werefoundinbothgroupsofanimal
Compatible peakswith Compatible Proteobacteriaphylum includes , Mycobacterium nants (GriffithsandGupta,2001)althoughhavebeenalso lifying bacteriainlowerpr of particularsequences,cause eria (Leseretal.,2002). important inadult animals. . Therefore,thepresenceof to thisgeneraareone templates (SuzukiandGiovanonni,1996) E. coli,Shigella,Kl like lacticacidbacteriahavereceivedmuch fically named genusFibrobacter(Amann et e undoubtedlybiasedbytheinvestigation
sp.and 90 arel etal.,1984;Va in the studytakingintoaccount thatdidnot Fibrobacter succinogenes It is alsofair to remark thatthe presence of nce ofcompatible TRFsalthoughbeing ain, atleastpartia ouped into theBacteroidessub-phylum, cteria countsbyqPCRin
ve beendeposited,whereasothergroups indigenouspiggutmicrobiota s ofthe lolityc andhemicellulolityc enzymatic beendescribedinadultpigs(Varelet lacticacidbacteria andinconsistence ential thatthepighavetoeffectively ential compatible irs) werefoundcompatible with s (5.3%oftotalpeakareafor Staphylococcus Enterobacteriaceae oportions incomplex samples d bypreferentialannealing thisbothbacteriain of themajor indigenous ebsiella, Salmonella lly, thelow abundance rel andYen,1997);in peaks onlyinfour sp.respectively. and alltheanimals. Fibrobacter family to Trial II that
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW species that were species that were nse, alternatives to alternatives to nse, ng could be to avoid ling pigs showed a higher ling pigs showed C. butyricum , and ecum microbiota, with an increase in in with an increase microbiota, ecum g bacteria. In that se bacteria. In that g lactic acid bacteria than weaned group, group, weaned than lactic acid bacteria al health at weani al health ious works concluding that commercial ious works concluding ese tentative results, an interesting way to an interesting ese tentative results, r as possible the weaning microbial profile microbial the weaning r as possible 91 eaning and changes in T-RFLP bacterial eaning and changes required to increase our knowledge regarding required to increase our knowledge C. coccoides 5.4. Conclusions 5.4. Conclusions esumptions can be made, suck be made, can esumptions The results obtained agree with prev obtained agree with The results marked shifts in these characteristic sucklin characteristic in these shifts marked as fa maintaining in focus may antibiotics favorable to a more by leading transition, post-weaning the at least during However, more studies are equilibrium. changes at weaning. the microbiota maintain post-weaning piglet gastrointestin piglet post-weaning maintain absent in weaned pigs. In the light of th absent in weaned Chapter 5 Chapter changes in pig ca marked weaning produce after w ratio enterobacteria:lactobacilli only pr profiles. Even though TRFs with different compatible of diversity with compatible and showed peaks
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
MOLECULAR ANALYSIS OF BACTERIAL COMMUNITIES MOLECULAR ANALYSISOFBACTERIAL ALONG THE PIG GASTROINTESTINAL TRACT ALONG THEPIGGASTROINTESTINAL Chapter 6 92
Trial III
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 1999; Holdetal.,2003;Takada2004)but been usedtoquantifydifferentmicrobial also givinginformation aboutthespatialdi hybridization (FISH).FISH hastheadvantage as theirprimary availablesubstrates (Sal represent themain growth s young animals.Nutrientsthatescapedigest environmental changescouldhelp Gaining anunderstandingofpopulationdynamics advances, ourknowledgeofahealthypiggut immune development andgutmetabolism from theimpact ofcommensal bacteriaonhos lactobacilli (Konstantinovetal.,2004b). pig gutmicrobiology althoughthis phylogenetically targetedoligonucleotidepr The availabilityof16S rRNAsequences different compartments of thegastrointestinal differences havealsocontributedtoour profiling techniques,suchasDGGEand and indicatedthatmuch ofthepiggut pigs. Thisworkconfirmed thecomplexityof thepigintestinal microbial community sequenced morethan4200cloned16SrDNA diversity (Pryde etal.,1999;Vaughan development ofnewmolecular toolshasrevol bacteria more readilythanothers,and Robinson etal.,1981;Varel isolates obtainedbyanaerobi large intestine(MooreandHoldeman, 1974; more than400-500speciesa investigated thespeciesdive A major incentive tounderstanding the The gutmicrobial ecosystem inmammals ubstrate forgutbacteria with nd viablecountsupto10 rsity ofthepigin c culturing (Tannock et al., al., 1987).Culturinghoweveris todesignstrategiespr techniquehasbeenused 6.1. understanding of population dynamics along the understandingofpopulationdynamics alongthe
yers etal.,1979).Th Introduction is laborious (Zoetendal et al., 2004). The is laborious(Zoetendaletal.,2004).The 94 microflora remains uncultured. Meanwhile stribution ofgutmicr groups inthehuman gut(Harmsen etal., T-RFLP thatexploit16SrRNAsequence T-RFLP obes thatcanbeusedforfluorescent Eckburg etal.,2005).Se al., 2000). Leser and co-workers (2002) al., 2000).Leserandco-workers(2002) composition ofthegutmicroflora comes utionized ourknowledge t health, in particul tractofthepig(Simpson etal.,1999). microbiology isstillfarfrom complete. (Stewart etal.,1997).Despiterecent ion intheuppergast is highlycomplex, typicallycomprising sequencesfrom digestasamples of52 that itavoidspotentialPCR-bias,while testine throughphenotypicanalysisof has alsofacilitated thedesignof there isrelativelylittleinformation on andresponsestodifferentdietary 12
pergram contentinthe ofgut complex plantcarbohydrates 1970; Salanitro et al., 1977; 1970; Salanitroetal.,1977; omote healthparticularly in to studytheabundanceof ese includesolublenon- likelytorecoversome ar pathogenexclusion, oorganisms. FISHhas veral studieshave rointestinal tract ofgutmicrobial Trial III in situ
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW a diet enriched in 0.38 kg of body colon and rectum ± e the gut microbial e the gut microbial ential mechanism to ential mechanism e Animal Protocol Review e Animal of basal diet (2.5 mm) by of basal diet (2.5 mm) itative importance of major major of importance itative is way, manipulation of the manipulation is way, (54% corn, 15% barley, 28% rals and aminoacids), rals and aminoacids), distal jejunum, distal distal jejunum, xperimental Farms of the Universitat of the Universitat Farms xperimental BW). Animals were bled, the abdomen Animals BW). of the pig gastrointestinal tract and of the pig gastrointestinal ched in soluble fiber (BP) by partial % of wheat bran. Animals were fed ad % of wheat bran. Animals pulp or a diet enriched in insoluble fiber or a diet enriched pulp -1 lation and make it more resistant to the resistant it more lation and make rced ventilation. Pens were distributed into Pens were distributed rced ventilation. to a pig can be a pot to a pig can be
ment, and slaughtering housing, husbandry ely after the collection, the samples were ely after the collection, the samples etary fibre to modulat 95 the intestinal content were taken. content the intestinal firstly, to study the quant firstly, to study x (Large White x Landrace) of 15 x (Large White 6.2 Material and methods 6.2 Material and methods ceived prior approval from th ceived prior approval from titution of fine-grounded corn enous injection of sodium pentobarbitone (Dolethal, enous injection of sodium included a control diet (CT) a control included yst and Cummings, Cummings, yst and In th 1987). d, Spain; 200 mg kg d, Spain; 200 mg For FISH analysis, samples of the stomach, of the stomach, For FISH analysis, samples
At the end of the experimental period, twenty animals (5 per treatment) were (5 per treatment) period, twenty animals At the end of the experimental The aim of this project was, of this The aim The experiment was performed at the E at the was performed The experiment A total of 32 pigs (Pietrain pigs (Pietrain 32 A total of digesta were taken (500 mg). Immediat digesta were taken (500 mg). was immediately opened and samples of was immediately opened and samples change the structure of the microbial popu the microbial of change the structure of opportunistic pathogens. establishment along the different sections bacterial groups Chapter 6 Chapter (iNSP), and polysaccharides non-starch insoluble (sNSP), starch polysaccharides starch (RS) (Engl resistant secondly, to evaluate the potential of di secondly, to evaluate quantity or the type of fibre administered type of fibre administered quantity or the ecosystem. 6.2.1. Animals and diets de Barcelona and re Autònoma into 32 pens with fo weight, were distributed diets that four experimental mine vitamins, soya-44, 0.7 % vegetable oil, 3% corn (4 mm), a diet enri coarse-grounded substitution of the corn by 8% of sugar beet (WB) by partial substitution of corn by 10 libitum for 6 weeks. libitum 6.2.2 Sample collection and processing euthanised with an intrav Vetoquinol, S.A., Madri Committee of this Institution. The manage Committee Union Guidelines. to the European conditions were conformed resistant starch (GC) by subs
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Harmsen andco-workers(2002). jejunum, proximal colonandrectum dige preservative. samples ofapproximately 1gofdigestawere approximately 50gweretaken,frozenand ºC). Forpurinebasesanalys chain fattyacids(SCFA)analysis, samples we 4 ºCandfinallystored prepared 4%paraformaldehyde.To fixthecel and1mlwere centrifuged(700xg,3min) homogenised anddilutedtentimes withPBS. posterior incubation step with West Sussex,UK).Therecommended lysis te was extractedandpurifiedusingthecommerci were precipitatedbycentri with 10 Lactobacillus/Enterococcus (Fprau645), clostridia Ruminococcus flavefaciens following groups:Totalbacteria(Eub338), AE (Qiagen,West Sussex,UK)andwasstor to improve thebacterialcellr (in duplicate). DMRXA epifluorescencemicroscope. Twentyfi California) wasaddedtoeachsample.Fluorescentcellswerecounted withaLeica To preventfadingoffluorescence Vectashield (VectorLaboratories, Burlingame, hybridisation bufferovernight(exceptforB (Erec482), clostridia cluster IVspeciesrelatedto Diluted cellsuspensions(10 Fluorescent insituhybridization (FISH). Digesta from proximalcolonwashomogeni DNA extractionandpurification. μ l ofeacholigonucleotide probe(50ngµl
cluster IX(Prop853), at -80ºCuntiluse. fugation (13000gx5min) a (Rfla729), sp.(Lab158)(Table6.1)fo upture. TheDNAwaseluted in200 lysozyme wasadded(10mg ml is (guanine plus adenine) used as microbial marker, μ
l) wereappliedtogelatin Digesta samples(400mg)preservedinethanol R. bromii 96 lyophilised untilanalysis.ForDNAanalysis, ac303 probe,whichwashybridisedfor2h). Streptococcus/Lactococcus sta wereassessedw al QIAamp DNAStool ls, thesamples wereincubatedovernight mperature was increased to90ºCand a Bacteroides/Prevotella Toremove grossmaterial, thesamples kept intubes with 3 re collected (5g) and kept frozen (-20 ed at-20ºC. The purifiedDNAwas of supernatantwasfixedwithfreshly zed andthepH determined. Forshort ve fieldswerecountedfor eachsample (Rbro730), clostridia cluster XIVa (Rbro730),clostridiaclusterXIVa Samples from the stomach, distal llowing themethod describedby -1 stocksolution)in110 Faecalibacterium prausnitzii nd DNA from the precipitate nd DNAfrom theprecipitate coated slidesandhybridised -1 , 37ºC,30min) inorder μ ith probes for the ith probesforthe l ofQiagenBuffer ml ofethanol asa group(Bac303), Mini Kit(Qiagen, sp.(Str493)and Trial III μ l of
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW at 4
ing at 45 ºC (1min) ing at 45 ºC (1min) bed by Lane and co- bed by Lane and Basel, Switzerland). The ºC (1 min 15 s); and a final 15 s); and ºC (1 min isons of the banding patterns . For their analysis purine bases were 1990) that takes into account the size each lane of a gel was analyzed by the each lane of a gel was analyzed BSA (Bovine Serum Albumin, Sigma- Albumin, Serum BSA (Bovine enzymatic restrictions were carried out restrictions enzymatic , UK) and the degree of microbial , UK) and the degree of microbial -1 of different bands obtained from the four the of different bands obtained from al confirmation of PCR products with al confirmation ons were those descri
plified from DNA extracts by PCR using DNA extracts by PCR using plified from by the manufacturer, with the appropriate by the manufacturer, ity matrices were generated based on the were ity matrices rent fragments were separated using a 2% rent fragments 94 ºC (1 min), anneal ºC (1 min), 94 1989) modified by Jensen and co-workers 1989) modified . The DNA amplification DNA conditions were . The nking variable regions V3, V4 and V5: 5’- nking variable regions
d using a GeneAmp PCR System 9700 (PE,d using a GeneAmp PCR System ) and 5’- CCGTCWATTCMTTTGAGTTT- opurinol as an internal standard. 97 by their incubation with 2 ml 2 M-HClO by their incubation with 2 ml l of ribonuclease A (Sigma-Aldrich). A (Sigma-Aldrich). l of ribonuclease μ Analysis of SCFA was performed by GLC using was performed of SCFA Analysis l of 40 mg ml l of 40 mg μ per cycle, extension at 72 extension per cycle, stions. For pair-wise compar
To analyze the total bacteria in the proximal colon digesta, a digesta, colon proximal in the bacteria total the analyze To (F.Hoffmann-LaRoche Ltd Group, (F.Hoffmann-LaRoche PCR-RFLP analysis . PCR-RFLP analysis Fermentation product analysis. The size and the intensity of the bands within of the intensity The size and AluI, RsaI, HpaII, CfoI 100ºC for 1h, including 0.5 ml of 1 mM-all 100ºC for 1h, including 0.5 ml workers (1991). The reaction was performe workers (1991). The reaction was UK) thermocycler Warrington, Biosystems, at 35 cycles of denaturation 94 ºC (4 min); 3’ (reverse). Primers and PCR reaction conditi and PCR reaction 3’ (reverse). Primers were (40 mg) digesta samples in lyophilised and guanine) (1995). Purine bases (adenine by HPLC (Makkar and Becker, 1999) determined of 16S-rDNA was am gene 580 bp fragment sequences fla specific to conserved primers (forward CTACGGGAGGCAGCAGT-3’ 0.1 ºC of with an increment Following visu extension at 72 ºC (15 min). independent agarose gel electrophoresis, four ( similar and the construction of dendograms, and Rousseaw, Manhattan distance (Kaufmann and the height of the bands generated. ( of Richardson and co-workers the method the nucleic acid chain hydrolyzed from biodiversity was measured as the total number as the total number biodiversity was measured independent restriction dige Aldrich Química S. A., Madrid) plus 2 S. A., Madrid) Química Aldrich as recommended digestions were performed hours. Diffe restriction buffer at 37 ºC for 3 high resolution agarose gel. Cambridge Gene Tools software (Syngene, Chapter 6 Chapter 4 of addition with the stabilized
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
Table 6.1. Sequence of oligonucleotide probes used in this study. Probe Sequence (5’→ 3’) Targeted bacterial group Reference Eub338 GCTGCCTCCCGTAGGAGT Domain bacteria Amann et al. 1990b Bac303 CCAATGTGGGGGACCTT Bacteroides-Prevotella group Manz et al. 1996 Rfla729 AAAGCCCAGTAAGCCGCC Ruminococcus flavefaciens-like Harmsen et al. 2002 Rbro730 TAAAGCCCAGYAGGCCGC Ruminococcus bromii-like
Erec482 GCTTCTTAGTCAGGTACCG Clostridium cluster XIVa Franks et al. 1998 Lab158 GGTATTAGCA(C/T)CTGTTTCCA Lactobacillus-Enterococcus group Fprau645 CCTCTGCACTACTCAAGAAAAAC Faecalibacterium prausnitzii group Suau et al. 1999 Str493 GTTAGCCGTCCCTTTCTG Streptococcus and Lactococcus sp. Franks et al. 1998 Prop853 ATTGCGTTAACTCCGGCAC Clostridium cluster IX Walker et al. 2005
OBJE CTIO REVI INTR CTIV ODU LITE URE RAT EW ES TRIAL III TRIAL II TRIAL I N
the
centration, pH and centration, over the four diets. In -1 g 8 the main groups and both the main Lactobacilli (Lab) and colon and rectum (averaging colon and rectum 10
(Bac303). As expected, total × In contrast, the rest of groups contrast, the rest of groups In Ruminococcus flavefaciens/bromii abundant, while bacteria related to nd cluster IV bacteria related to nd cluster IV bacteria related junum, proximal colon and rectum of colon and rectum junum, proximal tal eubacterial count. Streptococci (15 - acteria belonging to clostridial clusters clusters acteria belonging to clostridial ntestinal tract as analyzed by FISH ntestinal least significant difference test (LSD) least significant
overed 32 % of the total bacteria. Lactic overed 32 % of the total bacteria. Lactic c package (SAS Institute, INC. 8.1, Cary,c package (SAS Results odiversity, SCFA con odiversity, s. Counts were obtained for each sample each sample were obtained for s. Counts
99 so abundant on diets BP and WB (27 and 11 ith Eub338 probe increased from proximal to ith Eub338 probe increased from average accounted for 56-93 % of the eub338 average accounted for respectively) than in stomach and jejunum (3.6 and jejunum respectively) than in stomach 6.3. < 0.05. Statistical accepted at was significance cluster IX group made up a highly significant cluster IX group made 10 P ub338, and with seven non-overlapping, group- ub338, and with seven non-overlapping, 10 × streptococci (Strc493) (Fprau645) or to tococci and lactobacilli) were and 5.8 east 100-fold higher in proximal east 100-fold higher in proximal group of Gram-negative bacteria group of Gram-negative 10 10 × respectively). 8 10 ×
and 2.4 8 By contrast, in the jejunal samples the probe set coverage was lower than in the lower than coverage was the probe set samples in the jejunal By contrast, Eub338 counts for the stomach averaged around 4 Eub338 counts for the stomach The effect of the diet on bacterial, bi of the diet on The effect stomach, je from were analyzed Samples < 0.05. 10 together exceeded 24 % of the eub338 counts. together exceeded acid bacteria measured (strep acid bacteria measured count in the stomach. count in the stomach. on CT diet only c and particularly stomach fraction (14-41 %) when compared with the to fraction (14-41 %) when compared % respectively). The probe set used on this site the little studied clostridial 37 %) and lactobacilli (8-26 %) were also were al clostridial cluster IV ruminococci (Rbro730/Rfla729), as well as Bacteroides/Prevotella × Faecalibacterium prausnitzii Chapter 6 6 Chapter Analysis 6.2.3. Statistical ANOVA an with was tested segment intestinal in a given concentration purine bases procedures of a SAS statisti using the GLM with were assessed means NC). Treatment were effects when overall treatment P gastroi the 6.3.1. Microflora structure along on four different diet maintained animals e with the broad eubacterial probe, b Firmicute specific probes. These targeted (Prop853) a XIVa (Erec482), cluster IX w measured of digesta bacteria per gram distal sections being at l 4.0 approximately
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW and valericacid( with additional fibrealthoughdifferences showed lowermolar percentagesofbranchedchainfattyacids(BCFA)( rest ofdiets, between diets(Table6.2). %); GC(86-91%)andBP (83-95%)diets. having themostsimilar RFLPpatterns( Dendograms (Figure6.1) evidencedthatanim cluster IV control diet(34±1.12),GC(38 compared totheeub338count. XIVa bacteriaamounting to10-19% counts werebelowthedet the 6%oftotalcounts.Asf measured wereless important in this gastrointestinal section and were alwaysbelow bran showedthelowestbi differences relatedtothedietarysourceof as number ofbandsobtainedwith thefour fermentation profiles 6.3.2. Effectsoffibreonmicrobial by theprobesused. that amajor fractionofthebacterialvariati intestine, bycomparison withstomach andje clostridial cluster IV dominance of anaerobic bacteria related toclostridial clusters XIVa andtothe 2%, andlessthan0.5%,oftheeub338count The pHandpurinebaseconcentrationsofproximal colonsamples weresimilar Bacterial profiles inthe proximal colona The levelofbiodiversitytheproximal F. prausnitzii P =0.06).Dietsenrichedinnon-star P =0.002).
F. prausnitzii
ection limits (counts<2 odiversity level( relatives1.4-3.6%andclus Total SCFA concentration wa ound inthestomach, clusterIV Streptococcus ± 2.48)orBP(372.15)diets( relatives ,
100 composition asestimated byRFLPand 95-97 %similarity) followedbyCT(91-94 Bacteroides/ did not reachstatistic fiber.Animals fedon dietincludingwheat independent enzymatic 28 ±0.66number ofbands)compared to on at these sites is still not accounted for on atthesesitesisstillnotaccountedfor junum. Ontheotherhand,itisalsoclear
colonic microbial ecosystems expressed and respectively.These in thedensecommunities of thelarge als receiving WBclusteredseparately nd rectum weresimilar, withcluster Lactobacillus × ch polysaccharides (BPandWB) 10 Prevotella 6 g -1 s higherfordietsenriched ter IXbacteria4.7-7.7% ). F. prausnitzii al significance (CT numbers averaged1-
relatives 4.5-10%, restrictions showed results confirm the P =0.008). P relatives =0.10) ra I Trial III vs.
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW -value -value P P
BP diet WB diet CT diet GC diet 0.463 0.002 0.002 0.463 b of similarity of PCR-RFLP of of similarity 1.68 b D1 D2 D3 D4 A1 D5 A2 A3 A4 B1 A5 B2 B3 B4 C1 C2 B5 C3 C4 C5 from pigs receiving experimental diets. from pigs receiving experimental groundedBP: control diet enriched in corn; colon digesta. The dendogram represents represents The dendogram colon digesta.
101 . Least-squares within a row lacking a means 1.56 DIETS DIETS ab < 0.05) P 2.10 a Fermentation parameters (pH, total SCFA concentration and and (pH, total SCFA concentration parameters Fermentation ) 128 141 155 147 ) 19.5 0.17 Dendogram illustrating the percentage illustrating Dendogram -1 ) 33.0 31.2 34.3 33.0 6.09 0.98 -1 . Major proportions of the different SCFA
(B) Table 6.2. (A) Figure 6.1. Figure SCFA (µmol g SCFA (µmol Parameter CT GC BP WB SEM WB BP GC Parameter CT pH g PB (µmol 5.85 6.05 5.78 5.92 0.174 0.72 SCFA (%) Acetate Propionate 63.8 59.5 63.1 60.2 20.2 25.1 24.9 26.3 CT Butyrate 4.78 5.73 0.40 0.35 Valerate 2.78 13.3 13.3 10.4 11.9 2.30 GC 0.16 BP WB SEM
Branched-SCFA 1.72 1.17 0.74 0.75 0.694 0.10 Branched-SCFA CT: control diet; GC: control diet with coarse- insoluble in diet enriched WB: control and beet bulp of sugar 8% of by addition soluble fiber wheat bran. of 10% of fiber by addition Each represents fivemean individual pigs common superscript letter differ ( purine bases), in the proximal colon contents purine bases), in the proximal Chapter 6 Chapter of proximal patterns in samples banding 20 pigs euthanised. results from
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW porcine digestivetractestimated byfluorescent Jejunum Jejunum Stomach Rectum Rectum Proximal colon
WB WB WB WB GC GC GC GC CT CT CT CT BP BP BP BP Table 6.3. ( Count × 10 9 Rb Fprau645 Erec482 Eub338 Bac303 )/ml 0.22 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 61.3 37.7 37.7 44.5 39.6 0.12 0.25 0.37 0.49 0.53 0.29 47.7 44.6 49.6 0.12 0.13 15.6 10.0 15.8 0.11 0.31 0.50 0.63 0.49 0.27 25.5 14.0 0.11 6.4 6.8 9.5
Proportionsofspecificbacterialgr
±
10.0a 8.1ab ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 6.8b 8.6a 8.9 5.1 5.5 3.5 1.9 2.2 1.8 4.5 8.9 9.3 2.4 4.7 1.8 0.7 1.5 0.7 2.0 2.5 1.9 1.2 0.5 1.6 0.5 2.3 2.2 1.6 0.9 0.4
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 10.4 12.1 11.0 13.6 12.2 18.7 16.9 16.7 2.0 2.9 1.5 2.1 2.1 2.8 2.6 1.6 4.2 2.6 3.9 2.9 1.4 0.7 1.4 0.4 1.0 1.0 1.1 1.7 8.4 7.9 9.2 0.6
1.6bc 2.0ab ± ± ± ± ± ± ± ± 2.5a 1.4c 102 2.4 3.6 3.6 2.1 bd 2.8 bd 2.9 bd 3.3 bd 10.5b bd 26.9a bd 3.3c bd bd 2.0 0.3 0.5 0.7 0.5 2.1 0.5 0.4 0.3
Counts as % Eub338 Counts as in situ oRl rp5 Sr9 Lab158 Str493 ro/Rfla Prop853 ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 3.4c oupings indifferentregionsofthe 9.4 8.9 5.3 3.7 4.7 4.6 9.6 8.5 1.3 1.1 1.5 1.5 1.1 1.7 1.6 1.1 1.6 2.4 1.3 1.3 1.0 1.6 1.3 1.8
hybridization. 25.3ab ± ± 14.4b 17.0b 41.1a ± ± ± ± ± ± ± ± ± ± ± ± ± ± 1.0 2.1 3.7 3.3 5.8 5.1 7.7 6.1 6.4 5.5 4.7 5.1 18.1 14.6 0.5 2.0 2.2 1.7 4.4 3.4 1.7 1.4 4.5 1.4 2.6 1.3 0.7 1.3
± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± 20.2 14.9 31.1 12.9 25.7 15.5 36.5 4.9 1.0 1.4 1.3 2.1 1.8 1.2 1.5 1.2 36.2 17.7 22.6 41.4 9.4 5.3 8.7 5.8 0.3 0.8 0.8 1.0 1.5 1.1 1.3 1.1
ra I Trial III ± ± ± ± ± ± ± ± ± ± ± ± ± ± 21.7 11.4 15.3 25.0 11.4 11.0 26.2 8.0 0.1 0.2 0.1 0.1 0.1 0.5 0.1 17.5 16.2 12.8 15.3 47.1 23.6 12.4 37.1 Bd ± 0.2 0.1 0.1 0.1 0.1 0.5
0
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW detected here by a valuable array of Clostridium cluster Clostridium on the characteristics on the characteristics significant proportions testinal microflora have testinal microflora also strict anaerobes, and strict anaerobes, and also pig rectum than has been pig rectum dietary regimes. groups, that comprise groups, that comprise ion of particular phylogenetic
logenetic groupings, e a significant superscripts show did not acteria that belong e helping to provide nt bacteria do not correspond closely to to nt bacteria do not correspond closely ng (FACS) analysis (Lay et al., 2005). es of this group from the human intestine the human es of this group from species, made up species, made
grounded enriched in BP: control diet corn; e lower gut. A similar distribution was similar e lower gut. A ze different regions of the gut. In some In some ze different regions of the gut. gut (Barcenilla et al., 2000). The expectations based Streptococcus nd gut (proximal colon and rectum) rather and rectum) colon nd gut (proximal mammalian gut communities (Harmsen e e (Harmsen gut communities mammalian
Discussion 103 ndings were unexpected. The group targeted ndings were unexpected. The group
1999; Vaughan et al., 2000). Together with et al., 2000). Together 1999; Vaughan sponses to different ). and 6.4. -1 g 6 diversity of the porcine in 10 × tate studies on the distribut -related bacteria, which are -related bacteria, which group was less abundant in the Lactobacillus > 0.05); where no superscripts are no superscripts > 0.05); where effect ofshown, there was no significant F. prausnitzii P The present study shows that particular phy The present study shows that particular Molecular analyses of the Molecular specific FISH probes, preferentially coloni probes, preferentially specific FISH with agrees distribution cases the observed other fi of cultured representatives, but b Firmicute by the Erec482 probe represents in the hi XIVa, and was significant mainly Most isolat and jejunum. than in the stomach to depend on anaerobic conditions and are presumed are highly oxygen sensitive, of th found only in the dense community observed for butyrate- the main These two groups include belong to the clostridial cluster IV. producing species from the human Bacteroides/Prevotella probes and primers that facili probes and primers re groups within the intestine, and their feces human of analysis microscopic automated using studies comparable reported in feces have been reported for human estimates et al., 2002) although lower (Harmsen based on Fluorescence Activated Cell Sorti Conversely, the revealed that a high proportion of the reside revealed that a high proportion et al., known cultured species (Pryde other work from 16S rRNA-based similar et al., 2005) these analyses ar al., 2002; Lay and facultatively anaerobic microaerophilic diet. <2 (counts Bd=below detection Chapter 6 Chapter diet; GC: controlCT: control coarse- diet with insoluble in diet enriched WB: control and bulp beet of sugar 8% of by addition soluble fiber wheat bran. of 10% of fiber by addition Values are average ± SD. Values sharing the sam effect of diet (
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW flavefaciens intestine includespecialistfibre-degrad Megasphaera includes adiversecollectio contribution tothemicroflora of of themicroflora ofthestomach andsm numbers are far lower in the stomach than in belong todistinctstrain/species.Itshoul were quiteunexpected.Again, populations of breakdown ofstructuralplantpolysacchar colon ofthepigcorrespondwithwhatispr highly oxygen sensitive andtheirsignifican stomach andlargeintestine, butfurther inves populations ofclusterIXbacteriafound in the stomach. Itseems unlikelythatth however,thisgroupaccountedfo Remarkably, proportion hereinpigrect around 5%oftotalbacteriafoundinhuman bacteria inthepiggut.Theprobeusedhere hypothesized thatahighfibercontentinfo and may reasonablybeexpectedinanimals al faeces. lysis inthestomach thansome ofthe populations inthestomach, andthatruminoco some thatre-ingestion possibility of can detected metabolically inactive or inviable, as wellasviable, cells. Thus thereis pellets eatenfrom thecagefloorin Increases indietarycellulose havebeende explaining thehigheramountsofruminococci Cluster IV bacteria classi bacteria IV Cluster Little isknownfrom culturalstudiesa Coprophagy hasbeendescribedinsuck , andstarch- degrading species such as and Ruminococcus Mitsuokella al contentsandproximal n ofanaerobes,including -related organisms inthe fied asruminococci from therumen orhuman large , most ofwhichproduceprop theproximal colonandrectum. it isapossibility that thestomach representatives captive wildwatervoles (Woodall, 1989). faecalmaterial might producetransient other groupsofanaerobicbacteriafoundin ing, oftencellulolytic 104 monstrated toincreasetheamount offaecal bout thetworemaining targetedgroupsof e same specieswouldaccountforthe d alsobenotedhoweverthattheoverall rm ofNSPcouldstimulate thisbehaviour, ides. On theotherhand,veryhigh faeces (Walkerfaeces etal.,2005)andasimilar ling piglets(SwansonandGleed,1981) tigations willbeneeded rectalcontents, and esumed tobethesiteofmost efficient t populations (8-10%)intheproximal all intestine,butmade averysmall the verydifferentenvironments ofthe cci might berelativelymore resistantto to detect cluster IX bacteria detected detected bacteria IX cluster todetect located in small pens r 14-41%oftotalbact in thestomach ofBPandWB diets. R. bromii. stomach ondietsBPandWB colon. Thetargetedgroup Selenomonas ionate asan , bacteriasuchas Thesespeciesare that FISH detection . Itcouldbealso toestablish this. eria detectedin , endproduct. Veillonella ra I Trial III R. ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW ces decreased as lowest biodiversity bacterial population. SCFA profiles observed in in this work may partly reflect the the reflect partly may in this work e animals. Similar results in terms of results in terms Similar e animals. orkers (2004) comparing the microflora the microflora orkers (2004) comparing bran provides plenty of substrate to the s in intestinal ecosystem was confirmed was confirmed ecosystem s in intestinal y changes in gastrointestinal microflora microflora in gastrointestinal y changes ity of microflora. Analysis of ecological ecological of Analysis ity of microflora. in those animals receiving diets with receiving diets with in those animals et have been described by other authors et have been described by other that were changes in composition some ). Similar decreases in BCFA with the decreases ). Similar y regimes. y regimes. Wheat bran diet could be , reflect somehow the higher availability the higher availability , reflect somehow tween diets and by modifications in the tween diets and by modifications e inclusion of wheat bran decreased the of wheat bran e inclusion amount and solubility of NSP. Animals and solubility of NSP. Animals amount
e, fermentation becomes more proteolytic more proteolytic becomes e, fermentation rticularly for sites such as the jejunum. such as the jejunum. rticularly for sites promoted a much more homogeneous homogeneous more promoted a much reason for the lower biodiversity and the luble NSP showed the as carbohydrate sour nges could come from both, a change in both, a change in from nges could come d require a specialized species composition of the different groups of the different groups species composition 105 e is difficult and time-consuming to ferment to ferment and time-consuming e is difficult uble NSP mostly cellulose and hemicellulose. cellulose and hemicellulose. uble NSP mostly All these fermentation products, which mostly products, which mostly All these fermentation
riction fragments detected by T-RFLP. riction fragments rtially to the failure of our set of probes to target all to target probes of set our of rtially to the failure d explain the differences in been designed initially against human faecal bacteria. faecal bacteria. human initially against designed been The relatively low probe coverage achieved coverage achieved low probe The relatively We were not able to detect marked dietar marked detect to We were not able change The ability of the diets to promote composition of colonic community revealed of colonic community composition in pigs (Bach Knudsen et al., 1993). activ metabolic in and/or composition species diet. Th evident with the WB particularly Chapter 6 Chapter probes had most fact that the less- of some target that to design probes work is required more Clearly much colonize the pig gut, pa studied groups that pattern be by changes in the fermentation NSP (BP and WB fed diets rich in animals of NSP in the di inclusion of higher amounts acids the of amino fermentation from came substrate of carbohydrates as fermentable cha additional amounts of fibre. These and also biodiversity of the ecosystem dietar other to the community compared in insol considered as a diet enriched wheat to beep pulp or coarse maize, Similarly substrat this case in this but bacteria (Bach Knudsen et al., 1991) and this coul using FISH. It could be due pa using FISH. It could in to changes also groups but microbial detected. that had not been RFLP profiles. It is well known that fermentable substrate in the large intestin the large substrate in fermentable (Piva et al., 1995). This coul This type of specialization could be the higher homogeneity in the microflora of thes in the microflora higher homogeneity biodiversity were found by Högberg and co-w of pigs receiving diets differing in the receiving diets with high amounts of inso receiving diets with high amounts defined as number of terminal rest of terminal defined as number
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW homogenous microflora. fermentation ofproteinandparticularlywheat related tofibre.Globally,increased fermentation pattern and communityprofile were notreflected in major bacteria contribution tothemicrobiota ofthestom along thelengthoftract,andthisgr and rectum. Theabundanceofthelittlestudied jejunum, strictanaerobessuchas Whereas lacticacid-produci of pigsusingFISH.Importantdifferen fibre issuitablein promoted bydifferentdiets. the typeofpathogenchallengeoron ecosystem butalsoonmanyotherfactorsas intestinal microfloraprobablywillde terms asdesirable,theresistanceagai pathogens. Howeveralthougha than wheatbrantopromotearobustmicr 1999). Inthisregard,beetpulporcoarse opportunistic pathogens(Kühnet a keyrole initsstability avoiding inte index (Atlasetal.,1984),andahighlydivers This studyisthefirsttoexamine the The stability ofabacterialecosystem seems eachsituation. ng bacteriaareabundantmainly inthestomach and Further studies areneeded to 6.5 al.,1993;Katouliet higher biodiversitycould F. prausnitzii . Conclusions ces areshownbetweenforegutandhindgut. pend not only on the complexity ofthe pend notonlyonthecomplexity amounts offibrepromoted decreases in 106 nst pathogencolonizationofferedbythe l groupsquantifiedbyFISH, however major bacterialcommunities alongtheGIT
ach. Dietarychangesinfibrecomposition maize would appearasbetteringredients oup wasshowntomake asignificant the particular microbial species presents, oflora andpreventtheproliferationof e microflora hasbeen different characteristics of the digesta different characteristicsofthedigesta stinal disorders a branpromoted alessdiverseandmore analyzedby RFLPshowedchanges clostridialclusterIX areonlypresentinproximal colon to bedirectly related toitsdiversity
determine whichkindof 1999; Macfarlane etal., be consideredinbroad nd proliferationof considered toplay groupisrevealed ra I Trial III
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
THE RESPONSE OF GASTROINTESTINAL MICROBIOTA OFGASTROINTESTINAL THE RESPONSE TO THEUSEOFAVILAMYCI EXTRACTS IN EARLY-WEANED PIGS INEARLY-WEANED EXTRACTS Chapter 7 108
N, BUTYRATE AND PLANT ANDPLANT N, BUTYRATE Trial IV
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION
7.1. Introduction Early weaning makes the piglets an easy target for microbial aggressions (Wallgren and Melin, 2001). To prevent gastrointestinal disorders and to improve the
post-weaning growth rate, feed-grade antibiotics are used regularly. Despite their REVIEW general use, their exact mode of action is not entirely clear. Different mechanisms LITERATURE have been proposed. Most of them are based on a reduction in bacterial numbers with a decrease in the production of growth depressing microbial metabolites and in the competition for nutrients with the host (Anderson et al., 1999; Hardy et al., 2000). However other mechanisms related to the selection of a healthier microbial
community could also be implicated. OBJECTIVES Concerns about bacterial resistance to antibiotics and general food safety issues have encouraged intensive research on new feed additives to maintain the growth promotant effects of AGPs without their potential drawbacks. The addition of different organic acids to the feed is one of the most widely used alternatives with effects that have been related to a reduction in the growth of some bacteria (Partanen, TRIAL I 2001). Herbs have been known since ancient times to have antimicrobial, antioxidative and antifungal properties. Some of these compounds have been reported to improve animal performance due to their stimulating effect on salivation and pancreatic enzyme secretions or by having a direct bactericidal effect on gut microflora (Hardy, 2002). Carvacrol from oregano has demonstrated strong TRIAL II antimicrobial properties (Dorman and Deans, 2000), cinamaldehyde from cinnamon has shown antioxidant and also antimicrobial effects (Mancini-filho et al., 1998), and capsaicin from chili stimulates gastric secretions (Platel and Srinivsan, 2000). The experiment reported here aims to evaluate the effect of an antibiotic, an acidifier, and a plant extract mixture, on the load, metabolic activity and community structure of the early-weaned pigs’ gastrointestinal microbiota. TRIAL III
7.2. Material and Methods The experiment was performed at the Experimental Farms of the Universitat Autònoma de Barcelona and received prior approval from the Animal Protocol TRIAL IV Review Committee of this Institution. The management, housing, husbandry and slaughtering conditions conformed to the European Union Guidelines.
110 TRIAL V T; Table 7.1) ized as 5% (wt/wt) as ized 0.71 kg and were 0.71 kg and were ± ature was gradually amycin, (AB; MAXUS, amycin, formulated (C formulated as a digestibility marker in all diets diets in all marker a digestibility as itial BW of 5.9 itial BW ona facilities according to their initial their initial to according facilities ona height with bars into the top up to 80 height with bars inert fatty carrier that represented the represented the inert fatty carrier that n x (Large White x Landrace), mixed x Landrace), mixed White n x (Large mixture was standard mixture e given in Table 7.1. Pigs were fed the were fed the 7.1. Pigs Table e given in ctation period. The animals were weaned animals ctation period. The ldehyde (Cinnamonum spp.) and 2% spp.) and 2% ldehyde (Cinnamonum . The 40 pigs were allocated in the same allocated in the same . The 40 pigs were ation and the temper and the ation
e drinker. The weaning room was equipped was equipped e drinker. The weaning room 111 , 0.3 % sodium butyrateand 0.03 % (AC), , 0.3 % sodium added: 0.04 % avil an average in used. A control diet was m for 3 wk weeks after weaning and they had free access for 3 wk weeks after weaning and they had free access m
were Four dietary treatments
A total of 40 early-weaned pigs (Pietrai pigs 40 early-weaned of A total Chapter 7 Chapter
housed in the Universitat Autònoma de Barcel Universitat Autònoma housed in the per pen) pens (five animals weight in eight and separated by solid walls of 60 cm in room feeder and nippl Each pen had its own cm. ventil and forced heating with automatic the experiment. reduced from 29 to 25 ºC during regime 7.2.2. Dietary treatments and feeding were to which three different additives Elanco Animal Health, Madrid, Spain) Elanco Animal extract The plant (XT). mixture plant extract carvacrol (Origanum spp.), 3% cinnama in an annum) (Capsicum oleoresin capsicum oxide was included 90%. Chromic remaining ar diet composition Details of the (0.02%). diets ad libitu experimental to water throughout the experiment. between 18 to 22 d of age with between 18 to 22 males and females) from a commercial herd were selected from 10 different litters. litters. 10 different from were selected herd a commercial from and females) males was provided during the la No creep feeding and Housing 7.2.1. Animals
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION Table 7.1. Control diet composition, as fed basis
Ingredient g/kg Corn 276 Barley 300 REVIEW
Soybean meal, 44% CP 40 LITERATURE Full fat extruded soybeans 40 Soya protein concentrate 60 Fish meal LTa 50 Dried whey 40 Acid wheyb 150 Wheat gluten 6.8 OBJECTIVES Sepiolite 10 Dicalcium phosphate 11 L-Lys·HCl 4.4 DL-Met 2.7 L-Thr 1.9 TRIAL I L-Trp 0.4 Choline chloride, 50% choline 2.0 Chromic oxide 1.5 Vitamin and mineral premixc 3.0 Calculated nutrient compositiond TRIAL II GE, Mcal/kg 4.75 CP, g/kg 183.9 Ether extract, g/kg 51.1 Crude fiber, g/kg 27.8 Ca , g/kg 6.44
P total , g/kg 6.95 TRIAL III P available , g/kg 4.01 Lysine, g/kg 13.87 a Fish meal low temperature: product obtained by removing most of the water and some or all of the oil from fish by heating at low temperature (< 70 ºC) and pressing. b Acid whey: product obtained by drying fresh whey (derived during the manufacture of cheeses) that has been pasteurized. TRIAL IV c Provided the following per kilogram of diet: vitamin A, 13,500 IU; vitamin D3, 2000 IU; vitamin E, 80 mg; vitamin K3, 4 mg; thiamine, 3 mg; riboflavin, 8 mg; vitamin B6, 5 mg; vitamin B12, 40 µg; nicotinic acid, 40 mg; calcium pantothenate, 15 mg; folic acid, 1.3 mg;
112 TRIAL V 10 mg/mL, 37 ºC, 30 10 mg/mL, DNA from the precipitate the precipitate DNA from the jejunum mucous layer: a mucous the jejunum of digesta from the stomach, distal distal of digesta from the stomach, per treatment) were euthanized with were euthanized per treatment) d using the same Qiagen Kit. Pig Qiagen Kit. Pig d using the same and was stored at -80º C. The DNA C. and was stored at -80º a spatula (250 to 500 mg), placed in a spatula (250 kept in weighed tubes with 3 mL of mL kept in weighed tubes with 3 -frozen in liquid N. Samples were kept were kept N. Samples liquid in -frozen colon digesta were snap-frozen in liquid in liquid digesta were snap-frozen colon llus acidophilus (CECT 903NT) and samples using the Mammalian Genomic samples using the Mammalian Animals were bled, the abdomen was was were bled, the abdomen Animals ested using the same commercial kit. The The commercial kit. ested using the same
pproximately 50 g) from the ileum, cecum, cecum, the ileum, 50 g) from pproximately mmercial QIAamp DNA Stool Mini Kit QIAamp mmercial lysozyme was added ( lysozyme 113 ll rupture. The DNA was eluted in 200 mL of ll rupture. The DNA was eluted in 200 mL e intestinal content were taken. taken. were content e intestinal (13,000 x g for 5 min), and (13,000 x g for 5 min), sodium pentobarbitone (Dolethal, Vetoquinol, S.A., (Dolethal, Vetoquinol, sodium pentobarbitone mples were also taken from also taken from were mples Digesta samples (400 mg) preserved in ethanol were (400 mg) Digesta samples
Based on composition values from NRC (1998) values from Based on composition On d 19 and 21, a total of 32 animals (eight a total of 32 animals On d 19 and 21, DNA Extraction. d For DNA analysis, of about 1 g samples Chapter 7 Chapter
genomic DNA was obtained from blood from DNA was obtained genomic Escherichia coli (CECT 515NT) was harveste DNA from pure cultures of Lactobaci min) in order to improve the bacterial ce in order to improve min) Sussex, UK) Qiagen Buffer AE (Qiagen, West layer scrapings was harv the mucous from (Qiagen, West Sussex, UK). The recommended lysis temperature was increased to to was increased lysis temperature (Qiagen, West Sussex, UK). The recommended 90ºC and a posterior incubation step with was extracted and purified using the co N and kept at -80 ºC until analysis. precipitated by centrifugation 7.2.3. Collection Procedures and Measurements Procedures and Measurements 7.2.3. Collection as copper mg Zn, 110 sulfate 5H2O; carbonate; Cu, 175 as iron 120 mg Fe, µg; 150 biotin, as as mg oxide; Mn, 65 zinc sulfate;manganese as potassium selenium, iodate; mg 1 mg I, selenite. as sodium 0.10 mg of injection an intravenous of pigs per day an equal number Each slaughter BW). 200 mg/kg Madrid, Spain; with individual those from each pen were The pigs selected were included. treatment pen weight. to the mean closest BW of th opened, and samples immediately and the cecum, distal colon were jejunum, ethanol as a preservative. Sa saline with sterile gently washed and cut was longitudinally of 4 cm segment layer was scraped with mucous solution. The snap weighed capped tubes, and immediately (a samples at -80 ºC until analysis. Digesta were taken for purine base analysis. Samples and rectum colon, distal colon, proximal enzymatic of microbial study For the analysis. were frozen and lyophilized until and distal of 5 g of cecum samples activities,
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION DNA extraction kit (CAMGEN, Cambridge Molecular Technologies Ltd., Cambridge, UK).
Quantitative Polymerase Chain Reaction (qPCR). The primers used to quantify the different bacterial groups are listed in Table 7.2. The oligonucleotides REVIEW were based on regions of identity within 16S rDNA and were adapted from published LITERATURE specific primers or probes using the Primer Express Software (Applied Byosistems, CA, USA). This software was used to check for primer-dimer, internal hairpin configurations, the melting temperature, and percentage guanine and cytosine values within possible primer/probe sets. The different primers were also checked for their specificity using the database similarity search program nucleotide-nucleotide OBJECTIVES BLAST (Altschul et al., 1990) and the absence of amplification of porcine DNA was tested empirically by PCR using DNA extracted from pig blood.
Amplification and detection of DNA by quantitative real-time PCR were performed with the ABI 7900 HT Sequence Detection System using optical grade 96- well plates and SYBR Green dye (PE Biosystems, Warrington, UK). Duplicate TRIAL I samples were routinely used. The PCR reaction was performed in a total volume of 25 μl using the SYBR Green PCR Core Reagents kit (PE Biosystems, Warrington, UK). Each reaction included 2.5 μl 10x SYBR Green buffer, 3 μL MgCl2 (25 mM), 2 μL dNTPs (2.5 mM), 0.25 μL AmpErase UNG (1 U/μL), 0.125 μl AmpliTaq Gold (5
U/μL) (PE Biosystems, Warrington, UK), 1 μL of each primer (12.5 μM), and 2 μL TRIAL II of DNA samples (diluted 1/10). The reaction conditions for amplification of the DNA were 50ºC for 2 min, 95ºC for 10 min, and 40 cycles at 95ºC for 15 s and 60ºC for 1 min. To determine the specificity of amplification, the product melting curve was analyzed.
For absolute quantification, PCR products obtained from the amplification of the TRIAL III TRIAL III whole 16S rDNA of Escherichia coli (CECT 515NT) and Lactobacillus acidophilus (CECT 903NT) were used to construct the standard curves, the PCR conditions corresponded to those published by Leser et al. (2002). An amplified gene from E. coli was used for absolute quantification of the total bacteria and enterobacteria and an amplified gene from L. acidophilus for quantification of the lactobacilli. The functions describing the relationship between Ct (threshold cycle) and x (log copy TRIAL IV number) for the different assays were: Ct = -3.19 x + 53.66; R2 = 0.99 for total
114 TRIAL V turation at 94ºC incubation period, visual confirmation visual confirmation the intensity of the bands the intensity of the bands nine) in lyophilized digesta 1ºC per cycle, extension at extension 1ºC per cycle, tion was performed using a using tion was performed cycles of dena eria, a fragment of 16S-rDNA of 16S-rDNA eria, a fragment each lane of a gel were analyzed by by each lane of a gel were analyzed ng patterns and the construction of lactobacilli; and Ct = - 2.32 x + 43.88; and Ct = - lactobacilli; al. (1987). After the ms, Warrington, UK) thermocycler. The Warrington, ms, trophoresis, four independent enzymatic trophoresis, four independent enzymatic from the nucleic acid chain by their from ber of different bands obtained from the ber of different bands obtained from were carried out as recommended by the were carried out as recommended PCR using primers specific to conserved specific to conserved PCR using primers 72ºC (15 min). After (15 min). 72ºC ridge, UK), and the degree of microbial microbial ridge, UK), and the degree of cells with lysozyme (5 mg/mL, 37ºC, 3h) (5 mg/mL, cells with lysozyme LC (Makkar 1999). For their & Becker,
nerated based on the Manhattan distance d using a 2% high resolution agarose gel. d using a 2% high resolution agarose 115 aI, HpaII, CfoI (F.Hoffmann-LaRoche Ltd Ltd aI, HpaII, CfoI (F.Hoffmann-LaRoche 100ºC for 1h, including 0.5 mL of 1 mM- verse). Primer and PCR reaction conditions and verse). Primer on buffers at the recommended temperature temperature on buffers at the recommended regions V3, V4 and V5: 5’- regions V3, The microbial enzymes were extracted from the from were extracted enzymes The microbial re 94ºC (4 min); 35 re 94ºC (4 min); kes into account the size and min) with an increment of of increment with an min) ne et al. (1991). The reac The ne et al. (1991). Purine bases (adenine and gua To analyze the total bact total To analyze the
Microbial enzymatic activities. enzymatic Microbial Purine Bases Analysis. The size and the intensity of the bands within of the intensity The size and of the bandi For pairwise comparisons PCR-RFLP analysis. Chapter 7 Chapter
digesta contents by hydrolysis of bacterial described by Silva et following the method samples (40 mg) were determined by HP were determined (40 mg) samples analysis, purine bases were hydrolyzed 2 M-HClO4 at incubation with 2 mL allopurinol as an internal standard. generated. were those described by La were those described gel elec of the PCR products with agarose out (AluI, Rs were carried restrictions digestions Group, Basel, Switzerland). The with appropriate restricti manufacturer, were separate for 3 h. Different fragments as the total num biodiversity was measured four independent restriction digestions. were ge matrices similarity dendograms, et al., 1990) that ta (Kaufmann sequences flanking variable sequences flanking CTACGGGAGGCAGCAGT-3’ (forward) and 5’- (re CCGTCWATTCMTTTGAGTTT-3’ Camb the Gene Tools software (Syngene, for 46.82; R2 = 0.99 Ct = - 2.60 x + bacteria; for enterobacteria. R2 = 0.99 DNA extracts by from gene was amplified (PE, Biosyste 9700 PCR System GeneAmp conditions we DNA amplification (1 at 45ºC annealing (1 min), 15 s); and a final extension at 72ºC (1 min
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION samples were centrifuged (23,000 g for 15 min) and the enzymes, from the supernatant were kept frozen (-80ºC) until analysis. Polysaccharidase activities of the enzymatic extract were determined by assay of reducing sugars released from purified substrates according to the Nelson-Somogyi method (Ashwell, 1957). The substrates were suspended in 0.1N sodium phosphate buffer (pH 6.7). The samples REVIEW LITERATURE (0.05 mL) were incubated (30 min, 40ºC) with 0.45 mL of each substrate solution containing carboxymethylcellulose (Sigma-Aldrich Química S. A., Madrid), xylan from oat spelts (Sigma-Aldrich Química), soluble starch from potato (Panreac, Barcelona, Spain), and waxy starch from corn (Sigma-Aldrich Química). Activities against these four substrates were referred to as CMCase, xylanase, amylase, and amylopectinase respectively. After the incubation period, the reaction was stopped by OBJECTIVES denaturing enzyme proteins (100 ºC for 10 min) and the amount of reduced sugars was quantified spectrophotometrically at 600 nm. Dilutions of glucose (0, 25, 50, and 100 µg/mL) were used as a standard curve. The activity of the enzymatic extract was expressed as μmoles of neutral sugars released per mL of extract per minute and TRIAL I referred to the purine bases concentration (bacterial enzymatic activity).
7.2.4. Statistical Analysis
The effect of diet on microbial counts, biodiversity, purine base concentration,
and enzymatic activities in a given intestinal segment was tested with an ANOVA TRIAL II using the GLM procedures of a SAS statistic package (SAS Inst., Inc. 8.1, Cary, NC). The individual pig was used as the experimental unit. When treatment effects were established (P < 0.05), treatment least square means were separated using the probability of differences (PDIFF) function adjusted by Tukey-Kramer (SAS Inst. Inc.). Purine bases concentrations along different intestinal segments in each animal were analyzed as repeated measures using the PROC MIXED procedure of SAS. TRIAL III Statistical significance was accepted at P < 0.05.
TRIAL IV
116 TRIAL V TRIAL IV L II L III L III TRIA TRIA
Table 7.2. Material and conditions for the quantification of total bacteria, enterobacteria, and lactobacilli
Melting Tc Position in Amplicon Group Namea Sequence (5’→ 3’)b Reference (Cº) E. coli gene length (bp)d
Total F-Tot GCAGGCCTAACACATGCAAGTC 61 23 Marchesi et al. (1998) 315 R-Tot CTGCTGCCTCCCGTAGGAGT 60 337 Amann et al. (1995)
Enterobacteria F-Ent (G)ATGGCTGTCGTCAGCTCGT 58 1035 Leser et al. (2002) 385 R-Ent CCTACTTCTTTTGCAACCCACTC 58 1419 Sghir et al. (2000)
Lactobacilli F-Lac GCAGCAGTAGGGAATCTTCCA 58 373 349 Walter et al. (2001). R-Lac GCATTYCACCGCTACACATG 59 721
a Oligonucleotides used as primers (F, forward; R, reverse) for the quantification of 16S rDNA genes from the total bacteria (F-Tot, R-Tot), lactobacilli (F-Lac, R-Lac), and enterobacteria (F-Ent, R-Ent). b Italicized bases denote added nucleotides and in brackets deleted nucleotides from previous published primers. c Melting temperature estimated by Primer Express Software (Applied Byosistems, CA, USA). d Length of PCR product expressed in base pairs.
standards usedtoquantif in anypartoftheanalyzed significant differencesintotal increase ofmorethanonelogunitcompar 12.3 significance. Thececumandcolondige 0.94 log16SrDNAcopynumber/g FM)diffe quantified andalthoughmean valueswere microbial populationintimately attachedto the jejunum, considerableincreas showinga copies/g freshmatter (FM),increasedfrom8.0 tract usingqPCR(Figure7.1).Intheforegut,counts,expressedaslog16SrDNA 7.3.1. Changesintheto communication). and 165.9gforCT,AB,ACXTresp greater ADG( detected inanyofthepigs 10 Δ Rn (magnitude of thesignal generated bythePCR conditions). 8 16S rDNA gene copies/g freshmatter 16SrDNAgenecopies/g (F Figure 7.1. The totalmicrobial populationwasquan The animals remained healthythroughout ± 0.93log16SrDNAcopynumber/gFMre P Quantitative PCRfor totalbacteria. =0.069)attheendofe tal microbialcounts y totalbacteria:2.7x10 gastrointestinal tract. . Animals receiving thediffe bacterial loadsrela 7.3. Results sta showedmean valuesof12.4 118 ed tothetotalcountsinjejunum. No lowerthancountsinthelumen (10.2 the jejunum mucous membrane wasalso xperimental period(124.7,177.4,177.6, M). Thresholdcyclewasplottedversus tified alongthewhole e ofmorethanthreelogunits.The theexperiment anddiarrheawasnot ± ectively; E.G.Manzanilla,personal 1.16inthestomach to11.1 spectively. Thesevaluesrepresentan ted toexperimental dietswerefound 11 rences didnotreachstatistical (A) , 2.7x10 Theamplification plot of the rent additivestendtohad 10 , 2.7x10 gastrointestinal 9 ± , and2.7x 0.13and Chapter 7 ± 0.88in
±
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
digesta rDNA gene copies rDNA gene copies Cecum digestaCecum Colon Distal copies / g FM) were plotted vs. g FM) were copies / , cecum, distal colon digesta, and in , cecum, ntitative PCR (log 16S C) or 0.03 % plant extract mixture (XT). (XT). C) or 0.03 % plant extract mixture 119 membr ane the standard calibration curve. calibration curve. the standard XT AC AB CT Stomach digestaStomach digesta Jejunum mucous Jejunum Bacterial loads in the stomach, jejunum Bacterial loads in the stomach, DNA concentrations (16S rDNA gene rDNA gene concentrations (16S DNA 9 8 7 6 14 13 12 11 10
(B) (C) Total bacteria, log (16S rDNA copies / g FM g / copies rDNA (16S log bacteria, Total ) threshold cycle value to construct to construct value cycle threshold Chapter 7 Chapter by qua mucous layer, measured the jejunum diet with 0.04 same a control diet (CT) or the pigs receiving /g FM) in early-weaned (AB); 0.3 % butyric acid (A % avilamycin and standard error of the means. Bars represent means
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION 7.3.2. Changes in the microbial ecosystem
In order to find possible effects of the additives on particular microbial groups, we also quantified enterobacteria and lactobacilli in the jejunum and cecum using qPCR (Table 7.3). Both groups increase in number from the jejunum to the cecum; however, REVIEW
while the enterobacteria showed an increase of around four log units, lactobacilli LITERATURE increased only by around two logs. Expressing the difference between both bacteria groups as a ratio of logarithms (lactobacilli:enterobacteria ratio) the cecum showed lower ratio values than the jejunum. Between dietary treatments, XT promoted an increase in the lactobacilli:enterobacteria ratio in the cecum when compared to the CT (P = 0.02), which can be explained by an increase in lactobacilli numbers (P = OBJECTIVES 0.02). The AC diet also showed higher lactobacilli:enterobacteria ratio mean values; however, differences with control diet were not significant (P = 0.49).
Table 7.3. Bacterial populations, size of lactobacilli, and enterobacteria in the distal jejunum and cecum measured by qPCR (log (16S rDNA gene copies / g FM) TRIAL I in early-weaned pigsa
Dietsb
Segment Bacteria CT AB AC XT SEM
Jejunum Enterobacteria 8.2 8.6 8.6 8.0 0.20 TRIAL II Lactobacilli 11.5 10.6 10.9 10.2 0.59 lactobacilli:enterobacteriac 3.30 2.02 2.32 2.23 0.583
Cecum Enterobacteria 12.4 12.5 12.4 12.4 0.05 Lactobacilli 12.9z 12.9z 13.1yz 13.5y 0.11
lactobacilli:enterobacteria 0.48z 0.43z 0.75yz 1.10y 0.129 TRIAL III a Each mean represents eight individual pigs. b Experimental diets: CT, control diet; AB, control diet with 0.04 % avilamycin; AC, control diet with 0.3 % butyrate; and XT, control diet with 0.03 % plant extract mixture. c Relation between lactobacilli and enterobacteria populations expressed as ratio of logarithms. y,z Least-squares means within a row lacking a common superscript letter differ (P < TRIAL IV 0.05).
120 TRIAL V (AB); 0.3 % butyric different animals receiving of the PCR-amplified V3, diets were observed. The diets were observed. (63.5% similarity) followed by followed (63.5% similarity) = 0.03). The effects of the = 0.03). The population of jejunum digesta population of jejunum digesta P cted with the enzyme Hpa II (for more Hpa II (for more cted with the enzyme thod (Figure 7.2). The effectthod (Figure of different different banding patterns is shown in different banding 121 with 0.04 % avilamycin bands for the control diet (28.9, 38.5, 38.8, and bands for the control hods). Each line represents according to the different according to the biggest structural changes biggest structural Example of gel electrophoresis Example (A) Ecological changes in microbial Figure 7.2. In samples of the jejunum digesta, a PCR-amplified region from the microbial the microbial from region a PCR-amplified digesta, the jejunum of In samples the XT diet (66.9 %), and then the AB diet (73.3 %). AB the XT diet (66.9 %), and then the by RFLP. measured Chapter 7 Chapter me using the RFLP was analyzed 16S rDNA of bands, was evident when as number measured additives on biodiversity, of in number considering the decrease clusters Figure 7.2. Distinct the acidifier diet promoted V4, and V5 regions of the 16S rDNA restri and met details see materials diet the control diet (CT) or the same (XT). mixture acid (AC); or 0.03 % plant extract 32.0 for CT, AB, AC, and XT respectively; AC, and XT respectively; 32.0 for CT, AB, by the distinguished clearly more were composition microbial on diets experimental comparing A dendogram cluster analysis.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION (B) Dendogram illustrating the correlation between experimental diets in PCR- RFLP banding patterns. The dendogram represents results from 16 piglets killed during the second sampling day (d 21). The dendogram distances are in percentage of similarity REVIEW
Percentage of similarity LITERATURE
65 70 75 80 85 90 95
CT
73.3 OBJECTIVES AB 66.9
XT 63.5 TRIAL I AC
7.3.3. Changes in metabolic bacterial activity TRIAL II
Total microbial activity along the hindgut was also studied according to the concentration of all purine bases in the digesta. Evolution of the purine bases concentration along the ileum, cecum, proximal colon, distal colon, and rectum, according to the different diets is shown in Figure 7.3. All the treatments show an
increase in PB concentration from the ileum to the cecum that is quantitatively larger TRIAL III for the CT and AB diet than for the AC and XT diet. In the hindgut, the evolution of the PB concentration also shows differences between diets (diet x intestinal section, P = 0.01). While the CT diet reached maximum values at the end of the colon, with an abrupt decline from the colon to rectum, the rest of the treatments reached maximum values in previous intestinal sections. Finally, PB concentration in the rectum was TRIAL IV similar for all the treatments.
122 TRIAL V
mol/g DM) μ se or xylanase < 0.05). Differences P * distal colon digesta were digesta were distal colon Distal ColonDistal Rectum < 0.001) and in relation to diet x < 0.001) and in relation to 0.03 % plant extract mixture (XT). The (XT). 0.03 % plant extract mixture P Colon e activity, which is shown in Table 7.4. e activity, which et (CT) or the same diet with 0.04 % diet with or the same et (CT) proximal colon, distal colon and rectum in distal colon and rectum colon, proximal ore data are not shown. However, we did ore data are not 123 enough carboxymethylcellula * activities in the cecum and cecum the in activities = 0.01). s in the microbial metabolic activities between diets, diets, between activities metabolic microbial the s in P AB AC XT CT * Ileum Cecum Proximal Purine bases (PB; adenine and guanine) concentration ( Purine bases (PB; adenine and guanine)
60 50 40 30 20 10
M D mol/g μ PB, Figure 7.3.
In order to detect change In order The data showed high variability, precluding the ability to find any differences differences any to find ability the precluding variability, high showed The data between treatments. cecum, the ileum, in digesta samples from control di early-weaned pigs receiving a (AB); 0.3 % butyric acid (AC); or avilamycin find detectable amylase and amylopectinas amylase find detectable ( differ section that diets within an intestinal show asterisks Chapter 7 Chapter carbohydrase microbial different not detect could We also measured. and theref samples the in most of activity sections ( intestinal between also occurred ( interaction section intestinal
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION Table 7.4. Bacterial enzymatic activity in samples of the cecum and distal colon contents from early-weaned pigsa
Dietsb
Enzyme Segment CT AB AC XT SEM REVIEW LITERATURE Amylase Cecum 1.11 0.27 0.33 1.49 1.112
Distal Colon 0.67 0.88 0.99 0.85 0.344
Amylopectinase Cecum 1.80 1.50 2.08 4.34 1.810
Distal Colon 0.99 1.72 1.64 0.58 0.336 OBJECTIVES a Each mean represents eight individual pigs. b Experimental diets: CT, control diet, AB; control diet with 0.04 % avilamycin, AC; control diet with 0.3 % butyrate; and XT, control diet with 0.03 % plant extract mixture.
TRIAL I
7.4. Discussion
We found that the antibiotic did not reduce the total microbial counts along the GIT, which was also true for butyrate and the plant extracts. Although it is generally accepted that antibiotics reduce the number of bacteria in the gut at growth promoting doses, results obtained in the literature are not always consistent and probably depend TRIAL II on the type and doses of antibiotic administered. Collier et al. (2003) using a similar PCR methodology described a decrease in the total bacteria in the ileum of growing pigs after 2 wk of treatment with 40 ppm of tylosin. This decrease was observed until d 21, however, the effect disappeared after 28 d, which reflects the microbial
community’s adaptive response, replacing susceptible strains with resistant TRIAL III organisms. In our case, this new equilibrium could have been reached sooner (2 wk), which would explain the absence of an antibiotic effect on the total bacteria counts.
The values for the total bacteria in the stomach, jejunum, cecum, and colon estimated by qPCR were similar to those described by other authors for culturable bacteria in pigs of a similar age (Jensen and Jorgensen, 1994; Krause et al., 1995; TRIAL IV McFarland, 1998). It is fair to remark that values were always close to the highest levels, probably due to the trend of qPCR to overestimate microbial populations.
124 TRIAL V e clearest effect, crobial counts, it crobial counts, it Huisjdens et al., Huisjdens ct effect through an different spectra that dding an antibiotic to to dding an antibiotic = 0.17). There are few = 0.17). There are few et al. (2004) using qPCR P icrobial effect (Hammer et icrobial effect (Hammer for weaned piglets and its for weaned piglets and its increase in the number of increase in the number cilli and enterobacteria populations cilli and enterobacteria populations culture methods, have also described have also methods, culture tested, XT showed th In this respect, the In this respect, an index of desirable or undesirable undesirable or index of desirable an effects on the total mi effects on the total lla et al., 2004). It is difficult to find an ned mainly by the presence of a high by the presence of ned mainly r quantification of free DNA from dead of free DNA from r quantification (Nadkarni et al., 2002; (Nadkarni The relationship between these bacterial The relationship by a direct or indire al population after a o compared to the control. Increases were Increases control. to the o compared a higher resistance to intestinal disorders disorders to intestinal a higher resistance ternatives such as organic acids or plant acids or plant such as organic ternatives l size of the microbial population but by population l size of the microbial terobacteria ratio although in this case eptibility of bacteria to different organic organic bacteria to different of eptibility ta. Adding butyrate to diets also promoted to diets also promoted butyrate ta. Adding ng into account that most of the in vitro ng into account that most crobial ecosystem; however, using group crobial ecosystem; rDNA genes per genome in prokariotic genome rDNA genes per same plant extract mixture also showed plant extract mixture same 125 ecrease in the number of bifidobacteria. ecrease in the number nt results seem to point to some kind of prebiotic to point to some nt results seem ion of n-butyrate in diets ton et al., 1991). Possemiers ton et al., 1991). Possemiers control were not significant ( lturable bacterial cells in the digesta samples (Rigottier- samples digesta the in cells bacterial lturable = 0.006) mainly due to an = 0.006) mainly have shown an unspecific antim P Looking for ecological changes, the lactoba Looking for ecological changes, In the light of the absence of significant In the light of the Chapter 7 Chapter qPCR with when comparing authors, Some even two log units of one or discrepancies the human mi of simulator vitro an in they could detect a d specific primers using qPCR. in the jejunum were quantified considered as been groups has traditionally index with bacteria in pigs, relating a high the additives (Ewing and Cole, 1994). From rati increasing the lactobacilli:enterobacteria cecum ( the observed in 2002). These discrepancies could be explai 2002). These discrepancies of viable but not cu number the amplification and late Gois et al., 2003), microbi could not detect changes in the total the with results Previous lactobacilli. of weaned pigs due to in the jejunum ratio in the lactobacilli:enterobacteria increases (Manzani an increase in lactobacilli numbers explanation for this promoting effect taki plant extracts with studies al., 1999). However these consiste effect on the lactobacilli population, either microbio intestinal in the ecological change values in the lactobacilli:en higher mean to the differences compared bacteria, and the multiplicity of 16S of the multiplicity and bacteria, organisms (Fogel et al., 1999). organisms antibiotics and other al feasible that seems the tota extracts, could act not by reducing of particular bacteria. the selection promoting susc the specific and also have antibiotics acids is well known (Cherring publications studying the inclus
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION effects on microbial populations. Galfi and Bokori (1990) using 0.17 % sodium n- butyrate in the diets of weaned piglets observed changes in the ileal microbiota with a decrease in the proportion of coliform bacteria with a simultaneous increase in lactobacilli, however these authors also found an increase in the ileal concentration of butyrate that we did not observe (data not shown). Van Immersel et al. (2004) using REVIEW LITERATURE microencapsulated butyric acid in young chickens could also demonstrate a decrease in Salmonella in the cecum colonization after an experimental infection. It is interesting to note that the same authors using other organic acids like formic and acetic acid observed the opposite effect with an increase in Salmonella in the cecum colonization. Probably many other factors, such as the activation or inhibition of different metabolic routes with different organic acids, are involved in the changes OBJECTIVES observed with the acidifiers and not only a simple effect caused by a lower pH. This complexity could explain the diverse and sometimes contradictory effects of different acidifiers on microbial populations described in the literature (Hebeler et al., 2000; Canibe et al., 2001; Février et al., 2001). TRIAL I Avilamycin is an antibiotic mainly active against gram positive bacteria; therefore, we could expect a decrease in lactobacilli numbers. However, we did not find this effect. Other authors using avilamycin (50 ppm) also did not find differences in bacterial numbers (Decuypere et al., 2002). Similarly, Collier et al. (2003) using tylosin (another macrolide active against gram positives) could not detect any decrease in lactobacilli but rather an increase, which is particularly intriguing and TRIAL II could reflect complex interactions between different species in the bacterial ecosystem. When using RFLP to analyze variations in the bacterial community, we evidenced changes in band patterns related to dietary treatments. It is interesting to point out how profiles for each treatment were clustered separately, the cluster for the animals that received the AC diet showed the most difference. Differences in the TRIAL III TRIAL III RFLP patterns were due to an increase in the biodiversity in the microbial ecosystem with the use of additives (number of bands) and also to a change in the species composition of the community (type of bands). From our results, it could be suggested that a more complex microbial community would have a higher robustness in response to changes in the intestinal environment promoted by different dietary ingredients or stress and that the beneficial effects of antimicrobial additives could be TRIAL IV related, to an improvement of the adaptive capacity of commensal microbiota as a natural barrier defense against the overgrowth of pathogens, more than to a reduction
126 TRIAL V hemicellulose in in hemicellulose earlier in animals earlier in animals (Martinez-Puig et (Martinez-Puig et arrival of different s in growing pigs n et al., 2001) and n et al., e and amylopectinase e and amylopectinase occurrence. If additives hindgut showed that the tributed to differences in not detected. This lack of maximum values at the at the values maximum digestion and absorption of like cellulose or of resistant starch value at the distal colon, decreasing decreasing value colon, at the distal ing similar fingerprinting techniques techniques fingerprinting similar ing community were significantly altered by altered by significantly were community scribed similar patterns when comparing when comparing patterns similar scribed lly have promoted the lly have promoted oncentration decreased ribed by other author the biodiversity but they did detect how the biodiversity ndgut and therefore changes in microbial microbial ndgut and therefore changes in (DGGE); McCracke (DGGE); l diet but that the banding patterns were l diet but that the that while the amylas and AB. While in the CT diet, the purine in and AB. While e number of DGGE bands in ileal samples bands in ileal samples e number of DGGE edient composition except for the added edient composition 127 2003) working with pigs receiving 40 ppm of 40 ppm receiving with pigs 2003) working re unable to observe that changes in the extent of or xylanase activities were ses concentration along the fermentation should not be at fermentation ine concentration reached its concentration ine wer amount of fermentable starch. In the present work, of fermentable wer amount
The evolution of purine ba activities were comparable to those desc to those comparable were activities (Morales et al., 2002), cellulase of adaptation to an insufficient be related bacteria activity could enzymatic carbohydrates to digesting complex microbiota young animals. comparing fecal microbial populations from rats receiving diets supplemented or not or not supplemented diets rats receiving from populations fecal microbial comparing in detect changes did not with antibiotics, our group de Previous results from cecum. receiving diets differing in the amount animals bases c al., 2003). In that case, the purine receiving the diet with a lo ingr the same diets have experimental in changes additives therefore dietary carbohydrates. However, potentia nutrients at the foregut level could to the hi material of fermentable amounts carbohydrases activity, but we we differences, they were not big enough to be detected by this did promote interesting to point out It is methodology. bacterial species that form each microbial microbial each that form bacterial species AB diet pur the afterwards, Chapter 7 Chapter authors us Other numbers. in bacteria Electrophoresis Gradient Gel (Denaturant Collier et al. ( Similarly, the antibiotic. than 21 d, found that th tylosin for more contro the in to the number was similar dependent. treatment CT differences were between diets main maximum bases concentration reached its
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Trial IV
INTRODUCTION 7.5. Implications
Results suggest that the effects of some growth promoters could be related more with changes in the species and complexity of the microbiota than to a simple decrease in bacterial colonization of previous sections of the gastrointestinal tract. REVIEW
More specific studies are required to clarify how these products modify pig LITERATURE gastrointestinal bacteria, which would facilitate their most judicious use in field conditions.
OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL III TRIAL IV
128 TRIAL V
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
CHELATE ASGROWTHPR USE OFMANNAN-OLIGO PREVENTATIVE IN WEANI MICROBIOTA AND GUT FUNCTION MICROBIOTA ANDGUTFUNCTION Chapter 8 130 SACCHARIDES AND ZINCSACCHARIDES AND OMOTERS ANDDIARRHEA
NG PIGS:EFFECTS ON
Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
Saccharomyces cerevisiae ,andaZnchelat weaning pigsofBMderivedform they Zn compared topharmacological levelsofZnOundercertainconditions. Carlson (2002) demonstrated equivalent e release tothe environment whilstmaintaining thebenefits totheanimal. Caseand bioavailability, wouldallowa effect, then theuseof alternativesources elevated excretionlevels infaeces.Ifthe high dosesofinorganicZnhasraisedso high levelsofZnOareassociatedwith BM Recently, some trialshave st experimental an intestinal(Carlsonet Various studiessuggestthatitcouldbeme nursery dietsasagrowthpromotant, althoughits diarrhea duringweaning(Poulsen,1995)andac (ZnO) atpharmacological levels(2,000to enhance immunity (Newman andNewman, 2 with bacterialattachment totheepithe health (Pettigrew,2000;Migueletal.2004). outer cellwall of a selected strain of yeast the proposalswithprobedpositive results. agents, mannan-oligosaccharides traditionally recommended asawaytohelpthe pigletduringthisstage. Amongthese industry. Incommercial practice,theus
The main objective of this workwas Mannan-oligosaccharides, Bio-Mos (Alltech Reducing post-weaningdiarrheaisone al., 1999)orasystemic eff reduction initsfeedcon (MOS)andsupplements ofzinchavebeensome of 8.1.
lial cell (Spring et al., 2000) and can also lial cell(Springetal.,2000)andcanalso Introduction 132 mode ofactionZnisbasedonasystemic fficacy oflowdosesorganicsources have been extensively e andthecombined useofbothadditives. udied thepossible synergistic effectwhen e ofdifferentin-feedadditiveshasbeen diated byaluminal(Katoulietal.,1999), of organicforms ofZn,withahigher (Davisetal.,2002).However,theuseof to studythegrowthpromoting effecton me environmental concernsduetothe 3,000ppm) hasbeenusedtoprevent
east cellwallofaselectedstrain of 001; O’Quinnetal.,2001).Zincoxide Research suggeststhatBMinterferes of themain challenges for thepig tually, ithasbecome routinelyused in mode isnotentirelyclear. ofaction Inc, USA;BM)derived fromthe
ect (Case andCarlson,2002). centration, and also in its centration, andalsoinits used toenhancegut Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW Zn equivalent to Zn equivalent to ng litter and initial in Table 8.1. Diets 1.17 kg. dditives (BMP) were were (BMP) dditives ± ets were slightly modified ets were slightly modified
pigs per pen) taki basis and feed intake (by pen) was four dietary treatments. A control diet A control treatments. dietary four rol diets are showed Experimental Farms of the Universitat Farms Experimental of a commercial source of mannan- source of a commercial tions of NRC (1998). Animals were fed tions of NRC (1998). Animals
s but maintaining constant levels of BM constant levels of BM maintaining s but A; BM), 0.08% organic ain x (Large White x Landrace, 66 males x Landrace, 66 males ain x (Large White USA; BP’) or both a animals were challenged by a controlled a controlled by were challenged animals eceived prior approval from the Animal the Animal from prior approval eceived mmercial herd. The animals were weaned mmercial herd. The animals eekly thereafter. Average daily gain (ADG) were included in any of the diets. were included in any of the diets. 133 oom temperature from 27 to 17 ºC and feed 27 to 17 ºC temperature from oom dividually and by group respectively. Material and methods Material
an average initial BW of 6.7 of an average initial BW 8.2. s. During the starter period, di ee of this Institution. ee of this Institution.
Body weight was recorded on a weekly The experiment lasted for 5 weeks including a pre-starter period of two weeks and The experiment lasted for 5 weeks The experiment was carried out in the The experiment (Pietr A total of 128 early-weaned pigs housed into 32 pens (four were The animals added. No medication or other additives added. No medication of the animal the requirements to according of the cont and organic Zn. The composition following the recommenda were formulated and of the second week, and had free access to feed and water. At the end ad libitum just before changing to the starter diet, stress. Stress consisted of lowering the r deprival over a period of 10 hours. 8.2.2. Performance and collection procedures recorded daily during the first week and w and gain:feed data were calculated in a starter period of three week 80 ppm of Zn: (Bioplex Zn™ Alltech Inc, of 80 ppm oligosaccharide (Bio-Mos® Alltech Inc, US oligosaccharide (Bio-Mos® Autònoma de Barcelona in Spain and r de Barcelona in Spain Autònoma Committ Protocol Review diets 8.2.1. Animals and and 62 females) from a co were selected between 18 to 22 days of age with received Animals body weight into account. was formulated (CT) to which 0.2 % Chapter 8 Chapter
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW method ofSwansonet al., (2002) wasus Montgomery, TX).Forthedetermination of using PigIgA, Ig GandIgMELISAQuantitationKits.(BethylLaboratories, Inc., the method ofRichardsonetal.(1989) 8.2.3. Analyticalmethods DNA extractionandposterior concentration. Samples ofje Lyophilised ilealsampleswerealsoan were also frozen (-20 ºC)and lyophilised until analysis of purine bases(PB). short-chain fattyacids(SCFA).Digesta determined. Samples (approximately 5g)werekeptfrozen(-20ºC)untilanalysisfor formaldehyde. histology weretakenfrom th Lengths ofthewholesmall intestineand empty stomach,andsmall in whole gastrointestinal tract (GIT)tied and (200mg/kg BW). .Animals werebled,the allopurinol asaninternalstandard. incubation with2mL 2M-HClO4at analysis, purinebaseswe samples (40mg) weredetermined byHPLC(Makkar &Becker,1999).Forthe injection ofsodium (Dol pentobarbitone faeces and3 =thin,liquidfaeces. ranking form 0to3with=normally shap daily during thefirstthree weeks.Faecal Purine Basesanalysis. Short-chain fattyacid analysis. Digesta from thestomach, ileum Immunoglobulins. On day14,32animals, onefrom eachpen, Two personswhowereblindtotreatmen IgA, IgG and IgM concentrationinserumwasquantified IgA,IgGandIgM Purine bases(adenineandgua e distaljejunum andtransfer re hydrolysedfrom the nucleicacidchainbytheir junum digestaweretakenan testine, empty ileum,and microbiological studies. AnalysisofSCFAwasperformed byGLCusing modified byJensen 100ºC for1h,including0.5mLof1mM- 134 samples from theileum, caecumandrectum and caecumwashomogenised andpH excised. Weight ofthewholeGIT,fulland morphology wasclassifiedusingascale abdomen was immediat ethal, Vetoquinol, S.A., Madrid, Spain) ethal, Vetoquinol,S.A.,Madrid, ileum werealso registered. Samples for alyzed forprotein contents andIgA ed. Samples (2g) werelyophilised and ed faeces,1=shapeless faeces,2 = soft t modality monitored faecalconsistency IgAin ileum digestasamples, the were sacrificed withan intravenous red to10%neutralbuffered full hindgutwererecorded. etal.(1995). nine) inlyophiliseddigesta d preservedinethanolfor ely openedandthe Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW 37ºC, 30 min) in 37ºC, 30 min) < 0.05), multiple multiple < 0.05), 2 test using the same 2 test using the same P χ < 0.05. P eserved in ethanol were eserved in ethanol robacteria and lactobacilli in in and lactobacilli robacteria rnatant was collected and ileal Ig rnatant was collected r 30 min at room temperature and then and temperature at room r 30 min temperature was increased to 90 ºC and to 90 ºC and increased temperature was ein, was determined in ileum digesta as as digesta in ileum was determined ein, in an Erlenmeyer flask along with 20 mL 20 mL along with flask in an Erlenmeyer al time PCR using SyBR Green following al time PCR using SyBR Green (PAS) reaction. For each sample, villus (PAS) reaction. For each sample, was added (10 mg/mL, e (SAS Institute, INC. 8.1, Cary, NC). For Institute, e (SAS unit for ADG, and pen for e experimental ght was used as a covariate for productive ters was tested with an ANOVA using the The DNA was eluted in 200 mL of Qiagen The DNA was eluted in 200 mL ements, the pig was the experimental unit. the pig was the experimental ements, phocytes (IEL) were measured. The Goblet were measured. phocytes (IEL) 135 ounted. All measurements were made in 10 were made ounted. All measurements et effects were established ( (13000g x 5 min) and DNA from the precipitate was DNA from and (13000g x 5 min) al significance was accepted at al significance Formalin-fixed samples were included in paraffin and in paraffin included were samples Formalin-fixed Microbial populations of ente Digesta samples (400 mg) pr Digesta samples centration per crude prot centration per crude
parame The effect of diet on different Quantitative PCR. Quantitative Histological analysis. DNA extraction. order to improve the bacterial cell rupture. order to improve slides processed for periodic acid-Schiff lym height, crypt depth and intraepithelial also c cells in the villi and crypts were well-oriented villi and crypts. 8.2.4. Statistical Analysis GLM procedures of SAS statistics packag analyses, pig was used as th performance ADFI and feed efficiency. Initial live wei In slaughter measur results. performance di significant that event In the using the PDIFF function of SAS adjusted performed were of the means comparisons a analyzed by data were Faecal consistency by Tukey Kramer. Buffer AE (Qiagen, West Sussex, UK) and was stored at -80º C. and was stored at -80º C. Sussex, UK) Buffer AE (Qiagen, West Castillo et al. (2006) specifications. precipitated by centrifugation precipitated by DNA Stool Mini Kit (Qiagen, QIAamp the commercial using purified and extracted lysis West Sussex, UK). ). The recommended lysozyme a posterior incubation step with were quantified by re digesta samples ileum Statistic statistical software. Chapter 8 Chapter being placed before a mortar with crushed fo were mixed pH 7.2. Samples PBS solution, The supe x g for 30 min. centrifuged at 20.000 samples. kits used for serum using the same were determined concentrations con Calculation of Ig (AOAC, 1990). the Kjeldahl method total N following
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Phase 1and2.
b a Table 8.1. mg; I,0.75mg;Se,0.10; etoxiquin, 0.15 mg. acid, 0.6mg;mg;vitaminmg; Co, 0.75K3, 2 mg;Zn,185 Fe, 80 mg;Cu, 6 mg;Mn,60 B6, 1.5mg; calcium pantothenate,10 mg; nicotinicacid,15mg; biotin, 0.1 mg; folic vitamin E,15mg; vitaminB1, 1.3mg; vitamin B2,3.5mg; vitamin B12,0.025; vitamin Soya HP-300. Soya Hamlet proteinA/S (Spain). Provided the following per kilogram ofdi hln C 0 20 0.7 - 2.0 0.7 2.0 0.9 0.2 3.0 - 0.7 5.0 0.3 7.0 5.0 80.0 5.0 150.0 - - 30.0 - Vitamin andmineralpre-mixbadditives. 9.0 Choline HCl50% 30.0 100.0 L-Tryptophan 10% 30.0 60.0 215.7 L-Threonine 98% 16.0 60.0 120.0 DL-Methionine 99% 93.0 93.0 HCl 99%L-Lysine - Salt 240.2 60.0 - 180.0 Calcium phosphate(dicalcium) (18%) 40.0 - Calcium carbonate 360.6 Sweet whey Fat-filled sweetwhey Potato protein Wheat gluten Soya protein concentratea Full fatextrudedsoybeans Starter meal,Soybean 44% CP Wheat flakes Pre-starter Wheat Barley Corn flakes Ingredient, g/kg Experimental period Composition asfed basis of pre-starter andstarter control diets of 136 et: vitamin A,10000 IU; vitamin D3,2000IU; Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW
< 0.05). < 0.05). P the second day there < 0.05). < 0.05), with BP’ and P e 8.2. Body weight or e 8.2. Body weight P BMP BP
pigs receiving a control diet (CT), pigs receiving a control diet (CT), ily gain (ADG), average daily feed ily gain (ADG), Days n increase in intake up to 170 g/d that g/d that n increase in intake up to 170 differences between treatments. Intakes differences between ciency was increased with the use of the ciency was increased with the use
rimental period, both additives and their rimental period, both additives progressive increase from 155 g/d during from progressive increase BM eek. For the first day post-weaning, intake the first day post-weaning, eek. For than 100 g/d. During ) are shown in Tabl ) are shown in 137 Bio-Mos (BM), Bioplex-Zn (BP’) or both Bio-Mos (BM), Bioplex-Zn (BP’) 8.3.Results 8.3.Results ontrol diet during the starter period ( period ontrol diet during the starter CT ratio compared to controls ( ratio compared d1 d2 d3 d4 d5 d6 d7 Voluntary feed intake (kg/day) of Voluntary feed intake (kg/day)
0,30 0,25 0,20 0,15 0,10 0,05 0,00 Voluntary feed intake, kg/day intake, feed Voluntary
Results for body weight (BW), average da weight (BW), Results for body Figure 8.1. 8.3.1. Growth performance 8.3.1. Growth performance and feed efficiency (G:F intake (ADFI), did not show significant ADG of the animals showing a between treatments were similar w 825 g/d during the fifth the first week to more did not eat was very low and animals Chapter 8 Chapter with a sudde were a compensatory response Feed effi thereafter (Figure 8.1). normalised c compared to the additives different the first week post-weaning. during additives (BMP) or the same diet supplemented with diet supplemented or the same Regarding mean values for the whole expe Regarding mean higher values than BM ( demonstrating animals BMP treatment combination improved efficiency improved combination
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW hl eid .5 .4 .5 .7 .1 0.72 0.019 0.37 0.35 0.34 0.35 Starter 0.63 Pre-starter 0.57 Feed efficiency Whole period 0.82 0.99 Starter 0.43 0.782 0.207 Pre-starter 0.15 0.58 18.73 6.68 18.09 6.63 17.77 17.81 6.64 Pre-starter 0.44 0.14 6.65 0.66 kg/day Voluntary feedintake, Finalbody weight Initial body weight Pig bodyweight,kg 0.15 0.66 0.44 Item CT 0.16 0.47 BM 0.033 BP’ 0.15 0.032 0.039 0.77 BMP 0.72 SEM hl eid 0.63 Whole period hl eid .0 .7 .9 .1 .2 0.54 0.023 0.51 0.49 0.47 0.50 Average DailyGain,kg/day Whole period Starterc 0.68 0.64 0.66 0.69 0.042 0.82 0.08 % Bioplex Zn)andBMP (control diet with 0.2 % Bio-Mosand0.08 % BioplexZn). inconsistency. During the followingdays,BM inconsistency. Duringthe effect, overall (diet diet for CT increase infaecalinconsistency Percentage ofpenswithscoretwoandth 8.3.2. Faecalconsistency average daily gain(kg/day) andfeed 0.05). Faecal consistency wasscored during x, y ,z d c b a Table 8.2. Periodbetween the3to5th weekpost weaning. Diets:CT(controldiet), BM (control diet with0.2 % Bio-Mos),BP’(control diet with Period between the 1to5thweekpost weaning. Period between the1to2nd weekpost weaning. Least-squares means within a row lacking a common superscript letter differ ( letterdiffer common superscript lacking a within arow means Least-squares b 0.24 0.22 0.24 0.24 0.011 0.58 Initialandfinalpigbodyweight(k P at dayfourforallofthedi
= 0.11) with more than 80 % of the pens withfaecal =0.11)withmorethan 80 %ofthepens z z 0.64 0.69 efficiencyinearly-weanedpigs 138 x y Diets ree isshowninFigure8.2.Therewasan 0.66 0.67 the firstthree weeks post-weaning. a showedthefastestrecovery withno
x x g), voluntaryfeedintake(kg/day), 0.67 0.68 ets thattended tobehigher x x .0 0.002 0.009 0.04 0.014
Diet p- value Trial V P <
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW < P was similar across across similar was BMP ek while the rest of diets the rest of diets ek while BP a score value 2 and 3) in pigs in pigs value 2 and 3) a score ed by the experimental diets in any of ed by the experimental Days the different sections studied or their e 14th day of the experimental period, experimental e 14th day of the BM CT respectively (diet overall effect (diet overall CT respectively ) during the initial three weeks post- initial three ) during the ed changes related to the diets with BP’ with BP’ diets to the related ed changes 8.3. In general, the experimental diets did 8.3. In general, the experimental
onsistency on day 15 that onsistency on day 139 CT ce at the end of the first we of the first end ce at the , or the same diet supplemented with Bio-Mos (BM), with diet supplemented , or the same = 0.08). P Faecal consistency (% of boxes with (% of boxes Faecal consistency d1 d2 d3 d4 d5 d6 d7 d8 d9 d10 d11 d12 d13 d14 d15 d16 d17 d18 d19 d20 d21
0% 80% 60% 40% 20%
100%
Figure 8.2. Weights and lengths from different compartments of the gastrointestinal tract at at tract the gastrointestinal of compartments different lengths from and Weights Total SCFA, pH and lactic acid concentrations in the stomach, ileum and caecum and caecum ileum in the stomach, concentrations Total SCFA, pH and lactic acid Faecal inconsistency, percentage of boxes of percentage inconsistency, Faecal all dietary treatments. all dietary treatments. was reflected by an increase in faecal inc an increase in was reflected by 0.001). The controlled stress performed on th stress performed 0.001). The controlled diet (CT) receiving a control (BMP Bioplex-Zn (BP’) or both additives 8.3.3. Organ weights and small intestine length the end of starter period are shown in Table weaning of changes in weights or lengths not promote contents. Only the empty ileal weight show empty the contents. Only having the highest values (8.9, 9.6, 11.9 and 10.3 for CT, BM, BP’ and treatment BMP respectively; 8.3.4. Short Chain Fatty Acids (SCFA) are shown in Table 8.4. The pH was not modifi Chapter 8 Chapter faecal inconsisten with animal and for BP’, BMP 25, 75, and 75 % showed
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW 0.08 % Bioplex Zn)andBMP (control diet with0.2 % Bio-Mosand0.08 % Bioplex Zn). the sections.Asexpected,fermentation produc gastrointestinal tractfrom early-weaned sections. Lactateconcentration wasalsosimilar between diets. butyrate, valerateand branchedchain fatty either intotalSCFAconcentrationor to theileum andabruptly 0.05) ai .5 0.15 0.190.17 0.15 Ratio 0.016 0.82 Whole 10.60 10.23 26.77 27.30 26.27 30.95 0.31 1.99 intestine Content Large 11.07 Empty 19.55 20.37 23.25 9.74 22.95 0.76 2.56 Content intestine ileum 7.317.437.95 Small 7.76 Empty 0.27 0.35 8.91 26.85 27.81 31.19 30.70 0.59 2.66 0.324 9.56 Full Stomach intestine 0.66 Whole 11.92 Weight, g 10.34 Item 0.82 0.08 intestine Small Length, m x, y ,z a Table 8.3. Diets:CT(controldiet), BM (control diet with0.2 % Bio-Mos),BP’(control diet with Least-squares means within a row lacking a common superscript letter differ ( letterdiffer common superscript lacking a within arow means Least-squares 1.552.001.63 1.55 Ileum 38.03 37.11 48.81 35.43 0.12 0.178 0.92 4.15 Full 55.27 58.47 58.05 SEM 53.38 0.51 2.71 84.04 85.76 84.97 Empty 84.32 0.90 BMP 3.88 Full BP’ BM 146.9 150.7 162.2 150.5 0.41 6.64 CT Full Weight (g/kgBW) andlength to thecaecum. Nodifferen pigs sacrificedtwoweekspost-weaning 140 in theircomponents (acetate,propionate, Diets acids, data not s ts increasedslightlyfrom thestomach a
(m) ofdifferentpartsthe ces werefoundbetweendiets hown) inanyofthe
Diet p- Trial V value P <
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW value Diet p- r, enterobacteria
< 0.05). Expressed as P jejunum are also shown. jejunum 8 137.8 0.89 7.478 tration (µmol/g dry matter (DM)) in in (DM)) matter dry (µmol/g tration tween diets, howeve
a purine bases in the ileum, caecum and caecum purine bases in the ileum, numbers with BM and BMP treatment. treatment. and BMP with BM numbers decreased from 9.13 to 8.05 gene copies /g decreased from cally from the ileum to the caecum, without the ileum to the caecum, cally from tal microbial population size and activity. population size and activity. tal microbial 141 Diets 3.68 3.75 4.80 0.594 0.51 3.68 3.75 4.80 0.594 nd enterobacteria in the distal CT BM BP’ BMP SEM BMP BP’ CT BM 4.35 = 0.05) and from 9.13 to 7.89 with BMP ( P pH, SCFA and pH, SCFA concen lactic acid Stomach 3.2 3.09 3.25 3.25 0.293 0.98 3.2 Stomach 3.25 3.09 3.25 0.293 Stomach 8.31 7.48 6.24 9.6 0.17 1.048 Stomach
Diets: CT (control diet), BM (control diet with 0.2 % Bio-Mos), BP (control diet with diet with BP (control Bio-Mos), % diet with 0.2 BM (control diet), Diets: CT (control Lactobacilli did not show differences be Table 8.5 shows the concentration of a Table 8.4. 0.08 % Bioplex Zn) and BMP (control diet with 0.2 % Bio-Mos and 0.08 % Bioplex Zn). % Bio-Mos and 0.08 % diet with 0.2 (control Zn) and BMP Bioplex 0.08 % showed a significant decrease in their decrease showed a significant enterobacteria to control (CT), Compared FM with BM ( rectum digesta as an estimate of the to digesta as an estimate rectum Population size of lactobacilli a Purine base concentration increased drasti and DM for ileum, caecum and 35.04 µmol/g differences between diets (6.46, 47.65 and that in both the caecum is interesting to remark However it respectively). rectum values. the lowest mean BM promoted rectum, 8.3.5. Quantitative changes in microbial population population in microbial 8.3.5. Quantitative changes Chapter 8 Chapter two weeks post-weaning in pigs sacrificed caecum and ileum the stomach, Ileum 15.84 9.85 14.34 14.20 3.845 0.72 3.845 14.20 14.34 9.85 15.84 Ileum 0.87 3.29 2.25 1.40 2.10 Caecum 1.648 Ileum 14.56 12.93 9.84 12.48 2.009 0.43 2.009 12.48 9.84 132. 12.93 136.3 14.56 130.1 Ileum Caecum Lactic Acid Ileum 6.82 6.7 6.74 6.69 0.107 0.81 0.107 6.69 6.74 6.7 pH 6.82 Ileum 0.91 5.73 5.66 5.68 5.59 Caecum 0.135 Total SCFA Item
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW immunoglobulins, ilealIgAorinthenumber significant differencesamong dietswere IgA andhistologicalmeasurements performe 8.3.6. Immune proteinsandintestinalmorphology ( lactobacilli:enterobacteria, theBMP dietpr organic zinc(Zn-polysaccharideorZn-che improvements ingrowth controversial. AuthorssuchasCarl (Miguel etal.2004).Inthecaseoforganics 2.11 %improvement infeed nursery pigsfedwithBio-Mosdemonstrat Davis etal., 2002,2004a). Recently, ameta-a weaning phaseimproves growthperforman increases when BMandorganic Zn resulted inaresponsevillus:crypt rati difference fortheBMPdiet( experimental dietscomparedtoCT, alt cells inthejejunum. However,cryptde conversion canbeconsidered asapromisi controlled (Spring,2004). Consideringthis than inanexperimental farm situations arerearedunder fieldconditi when animals significance. Growthpromoting effectsof differences promoted inADGorDFIwe or BPpromotedanincreaseinfeedefficiency compared tocontrols,although andCarlson,2002).In et al.,2002;2004,Case that Znchelate(BioplexZn)may improve P =0.03). Table 8.6 shows serum concentrations ofIg Table 8.6showsserumconcentrations Numerous studieshavereportedthat performance whennurserypigs P =0.04). Thevillusheight wasnotaffected andthis take andanincreasein were bothaddedintothediets. 8.4.
where hygiene and environment arecarefully son etal.,(2004)didnotdemonstrate 142 Discussion hough differences only growthperformance inyoungpigs(Mullan o similartocryptdepth,withsignificant ng resultofthepotential ofbothadditives ed a4.12%improvement inweightgain, BMsupplementation duringthepost- omoted thehighest ratiocompared toCT feedadditivesarenormally maximised late) however,other re notlargeenoughtoreachstatistical ons wherediseasechallengesaregreater ources of Zn, results are scarce and more ources ofZn,resultsarescarceandmore ce ofpigs(DvorakandJacques,1998; pth showedlowermean valueswith ofintraepitheliallymphocytes orgoblet , ourimprovements registeredinfeed d in thedistaljejunumd in wallsamples. No found intheserum of concentration nalysis of54differentexperiments in G, IgMandIgA,ilealconcentrationof our case,theinclusionofeitherBM
were feddifferentsourcesof feed efficiencyof2.29% researchers suggest reached statistical Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW ility seems to be ility seems r concentration of pring et al., 2000). pring et al., 2000). ls BM addition was ls BM addition fits of using BM and BP BM and BP fits of using is group of bacteria have have is group of bacteria of robustness of commensal commensal of robustness of performance to BM was more BM was more to performance excess of Zn. by modifying the gastrointestinal by modifying tio of lactobacilli:enterobacteria wastio of lactobacilli:enterobacteria . Le Mieux et al. (2003) in a series of in a series of (2003) Le Mieux et al. . after weaning (Gianella, 1983). This P diets), but no change was registered P diets), but no change was registered stinal epithelium (S colonisation. This ab in some of the tria in some e BM diet showed a more rapid recovery rapid recovery e BM diet showed a more described by Davis et al. (2004b) with a described by Davis ct any significant improvement in growth in growth improvement ct any significant could prevent or decrease the severity of the prevent or decrease could which was manifest as an improvement in as an improvement which was manifest with MOS. The decline in enterobacteria with MOS. The decline tion in the enterobacteria population in pigs tion in the enterobacteria population al. (2002) found a lowe 143 y observed at four days post-weaning. at four days post-weaning. y observed mucosa binding proteins on the cell surface of binding proteins on the cell surface of mucosa d not include an of the relationship that th et al. (1977) as an index relation to the possible bene to the possible relation the initial days ral, the response of growth ral, the response
BM has been proposed to promote growth BM has been proposed to promote could be the reason why animals receiving th could be the reason why animals of faecal inconsistenc after the outbreak diarrhea that appears during with Zn addition. Likewise, White et with Zn addition. Likewise, White in the faeces of pigs fed diets coliforms is noteworthy because numbers The ra diarrhea syndrome. with post-weaning first proposed by Muralidhara An inhibition of these bacteria microbiota. fed diets supplemented with BM (BM and BM fed diets supplemented 8.4.1. Changes on microbial ecosystem and reducing intestinal pathogen ecosystem, diminu In that sense, we found a selective Chapter 8 Chapter In conditions. under practical we could not dete from our study together, alone with the additives compared performance with in nursery pigs BM and ZnO supplementation evaluated four experiments In gene variable responses. of an excess of Zn effective in the presence results were variable gain:feed ratio. Similar when diets di response of BM major to due to the capacity of BM to attach colonisation of inte bacteria, preventing some consistent with low levels of Zn, although consistent with
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW
Table 8.5. Purine Bases concentration (µmol/g DM) in the ileum, caecum and rectum, and bacterial populations (Lactobacilli and enterobacteria) from the distal jejunum measured by Real-Time PCR (log 16S rDNA gene copies /g FM) in ileum digesta in early-weaned pigs
Item Dietsa
CT BM BP BMP SEM Diet p-value Purine Bases Ileum 6.17 5.62 6.58 7.46 1.38 0.81 Caecum 50.23 40.38 52.86 47.16 5.64 0.45 Rectum 41.28 25.28 34.79 40.00 6.25 0.19
Bacteria Jejunum Lactobacilli 10.04 9.62 9.76 9.79 0.27 0.75 Enterobacteria 9.13x 8.05y 8.87xy 7.89y 0.28 0.01 Lactobacilli : enterobacteria 0.91y 1.57xy 0.89y 1.89x 0.81 0.04 a Diets: CT (control diet), BM (control diet with 0.2 % Bio-Mos), BP (control diet with 0.08 % Bioplex Zn) and BMP (control diet with 0.2 % Bio- Mos and 0.08 % Bioplex Zn).
x, y ,z Least-squares means within a row lacking a common superscript letter differ (P < 0.05).
TRIAL V
L II L III L III L IV
TRIA
TRIA TRIA
TRIAL V
Table 8.6. Plasma and ileal immunoglobulin (IgA, Ig M and IgG) concentration and jejunum histological parameters in early-weaned pigs sacrificed two weeks post-weaning
Dietsa Item CT BM BP BMP SEM Diet P-value Inmunoglobulin Plasma Ig G, mg/ml 25.50 20.97 25.10 13.88 4.142 0.26 Ig M, mg/ml 4.40 5.44 6.81 5.05 0.853 0.32 Ig A, mg/ml 0.82 1.43 1.48 1.05 0.255 0.34 Ileum digesta IgA/gDM 1.47 2.01 1.72 1.94 0.470 0.85 IgA/Gcp 6.19 8.29 7.04 7.42 1.670 0.84 Morphology Jejunum wall Crypt depth, μm 281.3x 241.60xy 240.10xy 234.50y 11.980 0.04 Villus height, μm 338.5 340.80 328.50 335.10 19.420 0.97 Villus: crypt ratio 1.23y 1.41xy 1.40xy 1.46x 0.060 0.05 Lymphocytes/100 enterocytes 4.64 3.60 4.66 5.16 0.940 0.69 Crypt Goblet cells/100 enterocytes 17.56 15.33 15.70 15.51 1.071 0.44 Villus Goblet cells/100 enterocytes 3.36 3.35 3.83 2.91 0.604 0.76
a L II L III L III
Diets: CT (controlL IV diet), BM (control diet with 0.2 % Bio-Mos), BP (control diet with 0.08 % Bioplex Zn) and BMP (control diet with 0.2 % Bio- TRIA TRIA TRIA Mos and 0.08 % Bioplex Zn).
inability of feedaddedmannan oligosa bytheexperimentalwere unaffected diets. compared toothernon-digestedcarbohydrat bifidobacteria species(Kaplan and Hutkins, 2000 high susceptibility to befermented preferentially by some lactobacilli and oligosaccharides (FOS)are al., 2002).Althoughnon-digestiblefermentabl concentration inweaningpigs(White et the immune system to adapttothisne digestive andabsorptive func expand and colonise the gut.Themaintenance of theintestinal integrity andthe intestinal flora. Facultativepathogens, associated withthenewfoodand 8.4.2. Effectongutfunction account thattheyareaddedtoamuch lowerdoses. (Sordeberg etal.,1990).Kat ZnO asagrowthpromotanthasbeenth of theirbindingsitesashasprev impairment ofgutcolonisationbytheseb that thespecificeffectofBMonentero promote differentfermentation patterns. of Znplaytheirrolethroughadirecteff with pharmacological levelsofZnOmake itdi enterococci infaeces.This Waern etal.(1998)using2500ppmofZnO absence ofquantitativeeffectsoncoliform However, nosignificanteffectwasfoundin of coliform speciesthat increased the stabilityof theintestinal microflora throughareductionin thediversity Changes inbacterialpopulationswerenot The early-weaned piglet hastocope withamassivechallenge withantigens modes proposedfo One ofthe ofaction theauthorsregardedasaninde considered asVFA-promoting compounds duetotheir lack ofadirecteffecton ouli etal.(1999)showedth tion duringthisweakperiod dependsontheabilityof iously proposed(Springetal.,2000). ect onintestinalmicrobi 146 previously controlled bymaternal IgAcan al., 2002)andneitherindogs(Swansonet acteria, presumably byaspecificblockage w situationandtodiscriminate between ccharides tomodify faecalpHorVFA populationswasalsodescribedbyJensen- the establishment ofanovelcommensal From ourresultsitseems moreplausible Similarly otherauthorshaverelatedthe bacteria populationsisrelatedtoan es probablypreclude r the use of pharmacological levelsofr theuseofpharmacological eir potentialantimicrobial properties in weanerswithnoeffectsoncoliand fficult toconsiderthatorganicsources reflected infermentation patterns that the totalnumberofcoliforms. The ), theirlowinclusionrateinthediet e oligosaccharidessuchasfructo x ofamorerobustmicrobiota. specific bacterialpopulations at highdosesofZnoxide ota whentakinginto their potentialto Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW ever it is possible rypt ratio as villus villus as rypt ratio milar to the results to the results milar al villi compensated al villi compensated ons in piglets fed BM. ons in piglets fed BM. increase in such a ratio rather than crypt depth. rather than crypt depth. which results in a reduced results in a reduced which depth, although differences depth, although nt, the addition of BM or BP to BP to of BM or nt, the addition titers in sow’s milk or Davis et al. milk sow’s titers in cs in the presents of BM could be cs in the presents of BM could may also be due to other mechanisms. mechanisms. also be due to other may tic and intestinal Igs or intraepithelial ntal treatments. Other authors have ntal treatments. ormance. None of the inmunological ormance. gistered in the villi:c in the gistered inclusion of BM, how ding 0.1 % Bio-Mos to broilers did not ding 0.1 % Bio-Mos to broilers r the production of mucous on villi or on villi r the production of mucous xperiment did not detect any increase in did not detect xperiment cterial aggression thus protecting the host cterial aggression thus protecting an atrophy of intestin increase in the production of the mucous mucous increase in the production of the tion on gut structure. Si appropriate response (Bailey et al., 2001). et al., 2001). response (Bailey appropriate cance when both additives were combined were combined when both additives cance mune response by modulating the immune the immune response by modulating mune mmune response has been demonstrated by mmune response has been demonstrated 147 as those caused by microorganisms or new or caused by microorganisms as those tinal morphology may respond to the observed may tinal morphology nt increase in villi height tion in the leukocytes populati in the mean values for crypt in the mean ji et al. (2001) also observed an erated turnover of crypt cells erated turnover iller et al., 1986). In this experime In this iller et al., 1986).
The use of BM as a tool to modulate i The use of BM as a tool to modulate Chapter 8 Chapter with an antigens and “harmless” “harmful” enterocyte, the to aggressions External feed proteins are normally associated with associated with normally feed proteins are at least partially by an accel at least partially villi:crypt ratio (M a decrease the diets promoted into the BMP diet. A similar response was re response A similar diet. into the BMP with control only reached statistical signifi with control only by the experime unaffected height remains BM addi previously described the effect of reported here, Ferket (2002) found that ad reported here, Ferket (2002) found with a lower villi:crypt crypt depth in a decrease height, but promoted villus affect ratio. Other authors such as I reduction in the enterobacteria population, but reduction in the enterobacteria population, on mucin dynami effects crypts. Stimulating IgA increased et al. 2001) who found (O'Quinn (2004a) who reported an altera in poultry, but due to a significa intes This beneficial effect of BM on an Ferket et al. (2002) have also proposed of action of mannan-oligosaccharides. by BM as another mode gel layer promoted layer acts as barrier against ba The mucous The current e from enteric infection. animal of Goblet cells responsible fo the number the increase in actual rather than gene expression in mucin an increase attributed to et al 2005). goblet cells (Smirnov Preventing the onset of an acute phase im on growth perf response has a profound impact in this study, like plasma included parameters responded significantly to the lymphocytes, that these broad indexes are not sensitive enough to detect more subtle effects on on subtle effects more to detect enough sensitive are not indexes that these broad immune response.
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW the Entobacteriaceaefamily, whereasorga BM seems toberelated performance interms offeedefficiencyin of SaccharomycescerevisiaeandBioplex Patches. observed both inintestinal architecture of theimmuneresponse in theyoung pig. This could explain thepositive result Supplementing anadditionalorganic sourceof architecture ofthemucosalimmunesy birth rudimentary Peyer’sPa mucosal immunesystem isalmost complete higher development ofthePeyer’sPatches in showing acontinuousPeyer’s Patch.Therefor treatments. In this work,theileum wasconsid heavier empty ileum, whichwasnumerically longer compared withthe restof the lowest. Inaddition,itisinterestingtonot highest IgMandAplasmatic mean valu in theplasmatic relatedtodiets,howeverBPdietshowedthe immunoglobulins the immune responsecanalsobesuggested. ratio. Inadditiontoanincreasedprotecti antigens after weaningcouldexplainthein against deleteriouseffectsof radicals generatedduringimmuneactiva also functionsasanantioxidantprotecti (ShankarandPrasad,1998), know toplayacentralroleintheimmunesystem sources ofZnwithhigherbioavailability environment. IfZnpromotedgrowththr it hasraised some environmental concerns because of thehighrelease of Znintothe a commonpracticetocontrol post-weaning di systemic effect.Highfeedconcentrations remains unclear, andthere are The useofBio-Mos®derivedfromtheout The mode ofactionsupplemental Zn theinhibition ofcertainoppo inappropriateimmune respons tch folliclesexpandrapidly doubts ifitisbasedonalu 8.5 . ng cells from the damaging effects ofoxygen ng cellsfrom thedamaging effects oughout asystemic effect,theuseoforganic Implications 148 of Zn (2000-3000 ppm ofZn(2000-3000 ofZnO)hasbecome on, animprovement ofthedevelopment of tion (BrayandBettger could representagoodalternative.Zinc is stem takesplace(Baileyetal.,2001). nic Zncouldactthrough an improvement e thatanimals organiczincshoweda fed and inthedevelopment ofthePeyer’s theweaningpig.Themode ofaction ly absent,andduringthefirstweeksafter We couldnotfindsigni Zn™supplement improved growth es, whereasthe control dietshowedthe crease that weobservedin villus:crypt these animals. Inthenewbornpiglet ered asthesection of the small intestine arrhea withprobedpositiveresults,but e, ahigherilealweightmay indicatea as agrowthpromot Zn couldaidthesuitabledevelopment er yeastcell wall of aselected strain
rtunistic gut bacteria from es againstbacterialornew and aspatiallyorganised minal, anintestinalora , 1990).Protection ant inyoungpigs ficant differences Trial V
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE INTRODUCTION REVIEW sted by an increased ileal weight. ileal weight. an increased sted by 149
Chapter 8 Chapter sugge response, host immunological in the ratio when villus:crypt in values explain the highest could actions Complementary used together. both additives were
INTRODUCTION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW and gutfunction. promoters anddiarrheapreventativein TRIAL V.Useofmannan-oligosaccharid avilamycin, butyrateand plantextr TRIAL IV.Theresponseofgastrointe gastrointestinal tract. TRIAL III. Molecular analysis of bacterial communities along the pig time PCRandt-RFLP. TRIAL II.Influenceofweaningoncaeca populations inpigdigestabyrealtime PCR. TRIAL I.Quantification of totalbact experiments includedinthis The followingchapterdiscusses theovera GENERAL DISCUSSION thesis(Chapter4-8): Chapter 9 acts inearlyweaned pigs. 150
weaningpigs:effectsonmicrobiota eria, enterobacteriaandlactobacilli stinal microbiota totheuse of ll resultsobtainedinthedifferent l microbiota ofpigs:usereal- es andzincchelate asgrowth General discussion General discussion
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
DISCUSSION LITERATURE OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW Lebepe-Mazur, 2003),DNA extractionbeinga DNA isolationefficiencyof DNA from thedigesta can turnonalimitation 1996, Raskinetal.,1999;McCartney,2002). traditional methods, highlevels ofse with the traditional ones.Moreove cells togrowthinamedium semisynthetic th not required,thusavoidingthe have several advantages compared withtraditional ones:the viabilityof thecellsis for bytraditionalmethods (Zoetendaletal only arange ofaround10-40%thegastro all gutbacteria(Furham worksestimate etal.,1992;Dutta2001).Recent that limited bytheirlowsensitivity, reproducibilit gastrointestinal microbiology, itiswellknow composition, phylogenyandfunctionofthiscomplexecosystem. gastrointestinal microbiology, greatly of thewholeecosystem. Inthis regard, a that template inthesample (Cleme achieve adirectproportionbetweenthe (Suzuki and Giovanonni,1996)and PCRcond election ofprimers (Liuetal.,1997;Os PCR amplification ofthe16SrRNA gene the microbiota (known asfingerprintingmet many ofthesemolecular methods usedforcharacterization of species composition of comparable thanatpresent, avoiding this in themethod usedtoextractDNAmight be 9.1. Although traditionalmethodshavegreatly In thelastfifteenyears,molecular me
Usefulness ofquantitative PCR,FISH different bacteria(McOrist r, onceimplemented they need toworkinfresh andal nt etal.,2000;Dunbar2000). microbiota 152 consensus betweendifferentworkinggroups improving theknowledgeregarding bundance ofamplicons totheabundanceof born etal.,2000),number ofPCRcycles ., 1998).Inthisregard,molecular methods nsitivity andreproducibility (Wang etal., bias. Also,itisnecessary toremark that thodology hasbeenincreasinglyusedin
y, labourityand inadequacyindetecting hods) couldalsobebiasedonthefirst at appearasacriticalpointformost of extremely usefultoobtainresultsmore intestinal microbiota canbeaccounted using universalprimers. Theproper However, whenrequired,isolationof n thatthesemethods areinherently and t-RFLPtostudytheintestinal source ofbiasin contributedtosetupthebasisof step thatmay involvedifferencesin itions (Kitts,2001) is essentialto etal.,2002;Anderson and are lesscumbersome than so theability ofbacterial the representativity General discussion General discussion
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE used: qPCR( Polymorfism (t-RFLP)andFluorescent were used: real-time PCR(qPCR),terminal-Restriction Fragment Length methods, althoughsimilar discrepancieshave traditional methods (cultureanddirectmicroscopy) toassess itsusefulness. Chapter 9 considered asausefultechnique toasse confirmed validationoftheresultsobt lactobacilli: enterobacteria curve analysiswasperformed anddis Green dyehavealsobeendescribed(Hei material upto90%.Finally,quantifica previous dilutionisdone.Inthisregard,we important fraction of thebacteria firmly attachedtoparticulated material when treatment ofdigestaindirectmicroscopy Fogel etal.,1999).Andthirdly,differencesin multiplicity of 16SrRNAgenecopies (7for quantified bytraditionalmethods (Rigot and free DNA presentinthe samples and thus amplified byreal-time PCRbutnot differences observed.Firstly,presenceofnon- 2002; Bachetal.,Huijsdensal 2005). Firstresultsobtained( and lactobacilli inpiggut digesta by real-time PCR(Collieretal.,2003; Hillet al., Recently, otherresearch groupshavealsode lactobacilli andenterobacter described inthepig. ratio andthesecondoneto method toassessrobustnessofmicrobiota To quantifytotalandparticularbacter In ourcase, theresults obtained byqPCR werehigherthan thosewithtraditional In thedifferenttrialsincl Despite differences inabsolute numbers,correlation intotal bacteria and inthe Real-time PCRwithSybrGreen® dyewa trial I,II, IVandV ratiobetween traditional and molecularmethod used, ia, asobjectivebacterialgr obtain anoverallpictureof uded inthisthesis,three trial I ) andFISH( carded thispossibility(Figure9.1). in situ ss changesinmicrobial ecosystemrapidlyby ) werecompared withthoseobtainedby 153 n etal.,2001),although inourcase,melting tion ofnon-specificamplicons withSybr ained. Forthisreason,themethod was and culturethatmay involvealossofan .,2002). Differentfactsmay bebehind tier-Gois etal.,2003).Secondly, the ial groups,twodifferentmethods were
wereabletodetect lossesof microbial hybridization(FISH). measured aslactobaci trinsic tomethods, inparticularthepre- scribed quantification oftotalbacteria often beendescribed(Nadkarnietal., s employed toquantifytotalbacteria, E. coli E. viable, viablebutnotculturablecells trial III and4for different molecular methods themain bacterialgroups oups inpigmicrobiology. ), thefirstoneasarapid Lactobacillus lli:enterobacteria spp.;
TRIAL II related withdiarrheaout effects onanimal health, becomes from thefactthatwhereas lactobaci being consideredbeneficialforthe animal gut health (Muralidharaetal.,1977;Ewingand et al.,1993;Tannockal,1999), health throughinhibitionofsome the useof ratiolactobacilli:enterobacter modulating anadequateimmune response that appearsduringtheinitialdaysaf product plottedvs.thesigna values. Muralidhara etal.,1977; ReidandHillman, 1999;Manzanilla etal.,2004). Inthis enterobacteria (B),and lactobacilli (C). bacteria inpigsofdiffere from previousworksthatdescribed cha objective istomaintain aratiofavorable C B A This ratio,aspreviouslymentioned, hasbeen Figure 9.1. However, itisfair toremark thatliterature ontheratioisscarce. Results come Meltingcurveobtainedafter breaks (Melin,2001).Lactobaci nt agesandexperimental bacteria belongingtothe l fluorescencederivative. opportunisticpat by preventingorde to lactobacilli,espe ter weaning(Gianella 154 Dissociation temperature (ºC)forPCR nges bytraditionalmethods inintestinal ia, avoidingcomparis (Perdigón etal.,2001)
Cole, 1994)withanincreaseintheratio lli havebeenassociatedwithfavorable health.Interestinboth thesebacteria routinelyusedas hogens, suchas the PCRreactionfor total(A), conditions (Chopraetal., 1963, creasing theseverityofdiarrhea Enterobacteriaceae lli isthoughttopromote cially inyoungpigs. , 1983)andalsoby on betweenabsolute an indicator of gut an indicatorofgut E. coli . Duetothis,the General discussion General discussion family are (Blomberg
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE = notsignificant to changesandt,atendency improve). performance improvement. pig guthealthandalsotoseeifitc regard, furtherinvestigationsareneededto Chapter 9 ratio incecum withanimproveme animals thatreceivedthe plant extractshow show thehighratioparallelto in showed animprovement inperformance, compared tocontrol treatment. Inparticular, piglets werealwayshealthy. performance from pigsinclude together (mannan-oligosaccharides plusorga significantly increased inthejejunum digest
Trial Item IV trial II II V
a Table 9.1. In ourcase, theratio was determined in Overall results observedingrowthperforma Overall results performance Improvement ingrowth performance Improvement ingrowth performance Improvement ingrowth lactobacilli:enterobacteria Ratio lactobacilli:enterobacteria Ratio lactobacilli:enterobacteria Ratio
, comparing suckling withweanedpigs, Resultsof lactobacilli:enterobacteria a
In general,whentheindex d intrial II,IVand V. nt inaveragedailygain.In er lowerbodyweight.Similarly, in /Performance /Performance Average daily Average daily Average daily Average daily efficiency efficiency efficiency efficiency ould havesome kindofrelationshipwith measure measure 155 Jejunum 0.91 Jejunum 3.30 2.02 2.32 2.23 Caecum 0.48 Caecum -0.27 Caecum Section Feed Feed gain gain verify theusefulnessofthisratiotocheck trials II, IVandV
a ofanimals that received both additives ed thehighestlactoba nic zinc) with anincreasealsointhe nce (-, indicates significant impairment, +, +, indicates significantimpairment, nce (-,
those that remain withthemother ratioanditsrelationwithgrowth CT BM BP’ BMP CT AB AC XT increased theanimals always S W + + + + t t t + + = y z y 0.43 1.57 -1.76 (Table 9.1),wherethe (Table trial V cilli:enterobacteria cilli:enterobacteria xy Diet z x 0.75 0.89
, theratiowas
trial IV, yz y 1.89 1.10 x y
TRIAL II obtained withFISHandqPCR(10 behind differencesobtained. been describedasimportant habitantsof Of thesegroups,proteobacteriaandalsosome other of probesused,may explain the presence ofbacteriabelongi gastrointestinal tractdue tothe higher c of piglets. hystoliticum novel galactooligosaccharideon Tzortzis andco-workers(2005) and method toquantifytotalbacteria, study piggutmicrobiota: Konstantinov our knowledge,thereareonlytwopublishedwo is notrequired,thusavoiding thepossibili main DNA advantagecompared toqPCR: 2003; Takadaetal.,2004),itsapplicationin an increaseintheratio. feed:gain ratio.However,whentheperfor been extensivelyusedtostudyotherecosy potential of dietaryfiber tomanipulate and flavefaciens Bacterial groupsdetermined were tract withthedifferentprobesusedto objective was tocovermostofthemain mi results obtained. performance inadditiontothoserelateddire composition ofadultpiggutmicrobiota along Faecalibacterium prausnitzii Regarding methodological aspects,asim In ourcase, theresults obtai Besides qPCR, FISHwasalsousedtoquant Lactobacillus/Enterococcus L. reuteri , group,and R. bromii -like inileum andcolonicdigest , clostridia cluster XIVa, clostridia cluster IVspecies related to Lactobacillus/Enterococcus Undoubtly, severalfactorsar ng todifferentgroupsfrom , clostridiaclusterIX, appliedFISHtostudythe sp.( Bacteroides lack of coverageintheupper gastrointestinal tract. ned weremore clarifyingindistalsectionsofthe Lactobacillus-enterococcus 5 : Bacteroides/Prevotellagroup, -10 trial III 6 overage obtainedwiththeprobesused.The 156 cells/gofdigesta).However,FISHhasa its equilibrium. Althoughthis method has give aoverallpictureoftheecosystem. mance improved wecouldnotalwayssee and co-workers(2004b),whichusedthe extraction andfurtherDNA amplification the piggut(Leseretal.,2002)may be piggutmicrobiology hasbeenscarce;to ctly withmicrobiota, thatmay behindthe crobial groupsofthe
stems (Amann etal spp, ty ofthepreviouslymentioned bias. ilar minimum levelofdetection was ). Theaim of thistrial wastostudy the gastrointestinaltractandalso ify total bacteria, butin thiscasethe rks thathaveappliedthismethod to a ofweaningpigs;andrecently, Bifidobacterium groupofthegastrointestinaltract Streptococcus/Lactococcus Clostridium e impliedinimprovingpig those containedwiththeset effect oftheadditiona group, ., 1996;Holdetal., pig gastrointestinal spp., groupsthathave General discussion General discussion L. amylovorus Ruminococcus Ruminococcus Clostridium sp.
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE polysaccharides. Recently,Inoue andco case, alowerbiodiversity wasobtained feeding dietswithdifferenttypesand quan in pigmicrobial biodiversityobtained by higher biodiversity.Similarly,Högbergand weaning pigs.Theanimals fedwithferm obtained by DGGE)afteraddition of fermentable carbohydrates tothediet of (2003, 2004b)showeddifferencesinbiodive observed changesinbiodiversityofpiggut difficult tobealteredby opportunistic pa health. Theanimals hadachievedamore additives were used,supportingthusthe still scarce. Inourcase, resultsfrom pathogens (Hillman etal.,2001). However,lite ecosystem (Atlas,1984)andthusahigherre biodiversity, ahighernumber regard, therobustnessofa which seemstobeausefulindexassessgut permit ustoobtainthebiodiversityofth modifications. providing valuableinformation ofcha et al.,2004),ortheadministration ofdi dietary changesasfibercomposition content microbiota byotherresearchgroups,toasse that issubstantiallysimilar toT-RFLP. and the method describedbyHöjbergandco-workers(2005).Results shown in studied. TheT-RFLPmethodology valuable inmicrobiological studies. Göbel, 2000)tocounthybridizedbacteria with FISH.Theapplicationofflowcy Moreover, additional information regarding Chapter 9 In additiontobacterialpr The bacterialprofilebasedonpolymorphi IV includedinformation obtainedbyRFLP microbial ecosystemhasbeendirectlyrelatedtoits ofile obtainedbyt-RFLP, fingerprintingmethods also ofspecies beinganindicator ofamorestable was implemented andused in trial IV This method hasbeenusedtostudypiggut 157 nges inmicrobiota dueto thesedietary tometry (Wallner etal.,1997;Moterand thogens. Recently,otherauthorshavebeen e samples (measurede samples asnumberofbands) entable carbohydratesinthedietshoweda tities ofnon-starchpolysaccharides. Inthis microbiota. Konstantinovandco-workers fferent additives(Höjbergetal.,2005)fferent co-workers (2004)alsofounddifferences l cellswouldmake thismethod highly hypothesis thatadditivesimproved gut -workers (2005), usingTGGE method t-RFLP inileumofgrowingpigsafter
morphology ofbacteriacan beobtained ss differences in microbial profilesafterss differencesin diverse ecosystem andthereforemore of thediet(Leseretal.,2000;Högberg sistance againstpoten in animals fed insoluble non-starch microbiota stability andhealth.Inthis rature regarding piggut biodiversity is rsity (measured asnumber ofbands method (PérezdeRozasetal.,2003), sm wasalso ofthe16SrRNAgene showedanincreasewhendifferent trial II, tial opportunistic following trial III
TRIAL II described theevolutionofpi methods especiallyattractiveandcomp RFLP, andpracticaladvantageslikenot about thebacterialecosystem groups. Aswithothertechniques,therear tools forstudyingpiggutmicrobiota andfor least inthreeanimals, using al., 2000).Inourcase,weinfe to their potential compatibility using their also usedsimilar procedures,butinthiscas in the database, interesting results have been obtained ( Although itisneedtokeepinmind thatre bacterial DNAinthesamples withpotentialcompatible speciesmay beremarked. increase inbiodiversityafterweaning. commonly usedinintestinal also topeakswithoutth attributed todifferences doing so,wecoveredaround30%ofthetotalpeakarea,remaining 70%being with severalnegativeconsequences forthei still immature (Baileyetal involves veryearlyandabrupt independence from her (HeldandMendl, change fromtotalnutritionalandsoci sow (Wallgren andMelin,2001). et al.,1993)andundergoesamarked disruptio complex andsuccessional process that takes severalmonths tobecompleted (Swords On theotherhand,theoreticalinfere In conclusion,molecular methods usedinth In nature,weaning isatransitional As describedinthepreviouschapters 9.2.Weaning: acriticalstageinthe eoretical correspondanceinthedatabaseused. between animals, inherentbackgroundofthemethod, and ., 2001).Asaconsequence, microbiologial studies. public databasesoftware of g gutmicrobiota inthefirst structureisgivenbyfinge pigletweaningatatime whentheimmune system is rred bacterialgroupsofthos 158 nd long period of time in which mammals nd longperiodoftime inwhichmammals lementary totradi lementary 2001). However,thepigproductionsystem own databaseobtained sults aredependentonsequencesdeposited al dependence onthemother tototal e onlysome particular e limitations;however,newinformation digenous pigmicrobiotaestablishment , piggutcolonizationbybacteriaisa
needing toworkinfresh,make these nce ofbandsobtainedbyrestriction detecting changes in r health thatarereflectedinthe post- n whenpigletsareseparatedfrom the is thesiscanbec RDP II(Coleet trial II animals refrainfrom eating, weeksof lifewithamarked rprinting methods liket- tional methodology and e bandsthatappearedat ). Otherauthorshave onsidered usefulnew bandswereinferred by cloning(Leseret particular bacterial General discussion General discussion al., 2003).In
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE pigs. weaning syndrome (Pluskeetal.,1997;seeFi Chapter 9 with bacteriasuchas lower compatibility withlactic acid bacteria of whatishappeninginthisenormous eco Although theoretical,andtheref bacteria inferredfrom theresultsobtainedin between them whichagainreflects thedisbiosis suffered. Thedifferent compatible clustered animals separately.Asexpected, et al.,2002). microbial profilewithlactic that may explaindifferencesobserved;thos the other trials( environment (Swords etal.,1993;Ewing a groups thatcolonizepiglet high enterobacteria counts, duetothefact the rest of thetrials (see Table9.1). Th al., 2002) decreases inlactobaci regard, previousworkshavedescribedincrease lactobacilli:enterobacteria ratio,withasigni after separation from thesow.Thischangewasclearly reflected inthe marked changein the bacteria inhabiting the pigletcaecum wasobserved oneweek after weaningindifferentways. different trialscompleted withweanedpi
The shiftinmicrobiota profilewasalso In addition, theratiowas lower than that The shiftinmicrobiota observedin .
IV andV lli afterweaning(Jen C. coccoides ) weresacrificedatan older age than thosein gutafterbirth,coming from themother fecesandthe acid bacteriaasoneofthe ore restricted,resultscanbe and e shortageofthesepi C. butyricum 159 system (Figure9.2).Weaned pigsshoweda trial II sen, 1998;Mathewetal.,1996;Franklin gs supportedthestress nd Cole,1994).Theweanedpigsusedin and also anabsence ofcompatible bands e animals couldhaveamore established
demonstrated byt-RFLPprofiles,which weaned pigsshowedalowersimilarity that those bacteria are one of the main that thosebacteriaareoneofthemain ficant decreaseinweanedpigs.Inthis obtained inanimals slightly older from gure 2.2,chapter2).Inthisregard,the this trial seem particularly interesting. s incoliform bacteria inparallelwith seems particularlyremarkable constantly present insuckling main bacterialgroups(Leser consideredasanimage glets may explainthe described in pigs described inpigs trial II, afact . A
TRIAL II
bacteria portion representsthe meanofthepercentage of thepercentagetotalareain disorders (Mathewetal., 1996).Inthisre may beanexcellentopportuni biodiversity canbeespeciallyimportant at by pathogens(VanKesseletal.,2004).Theref the maintenance ofthegastrointestinal hea weaning. Ithasbeenrecognized resistance ofanimals topotentialpat in atransitionaldecreasebiodiversity.Th sudden changeintheamountof These changesundoubtedlyreflectthenews weaning (Katouli etal.,1995; Although alowerbiodiversity Figure 9.2.
.
Lactobacillus vaginalis Lactobacillus L. fructivorans L. sp. Lactis delbruekii L. sp. Delbruekii delbruekii L. acidophillus
Piechartwiththe major 5’-termina SUCKLING ty foropportunisticbacteria 1999), lactobacillibiodiversity typeofsubstrateavailabl thatdiversebacterialpopul bacteria Lactic acid C. butyricum spp. Clostridium spp. Clostridium Roseburia, Butyrivibrio, Ruminococcus, Eubacterium, coccoides Clostridium Enterococcus sp. in coliform bacteriahasus suckling(S)andw hogen colonizationinthedaysfollowing 160 lth because itavoids potentialcolonization weaning duetothefactthatfluctuations
of totalarea compatible withapotential gard, theadministration ofprobiotics, is factcouldhelptoexplainthelower ore, avoidingamarked ituation wherethepigletsare,witha l fragments expressed as themean e forbacteriawhichresults that contributetodigestive WEANED ation playsakeyrolein eaned (W)group.Each Others intestinalis Fibrobacter succinogenes Fibrobacter Escherichia phylum CFB havebeenlessstudied. ually beendescribedat General discussion General discussion decreaseofthis bacteria Lactic acid
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE and rectum; Figure9.3).Asexpected,differe main bacteria description of qualitatively throughoutth described similar values (Stewart etal.,1999).OtherauthorsusingFI and the lower rate passage improve colo impairs bacterialcolonization (Ewing and parts ofthegut.Whereas peri environmental conditionsmark theincrease of differencebetweenstomach anddi around 2logunits.Similarlyto bacterial loadmeasured showedaclearin adult pig gastrointestinal tr 9.2.1. diarrhea outbreaksafte arquitecture togetherwithamicrobiota could beinvolvedinthisfact.Amongthese,lowintakeandchangesgutwall In thiscase, apeakoffecalinconsisten more clarifyingindistal se the upperandlower gastro mainly aslactic acid bacteria, might be Chapter 9 was found in thefirst2-3days,whichwasnotrecovereduntil 7 was foundin of weanedpigswasassessedduringthefirs remainded withtheirdams. Similarly, in by weaning;weanedpiglets showedalower 1999). Inourcase, described afterweaning(LeDividich associated with commercial weaning. Moreover, gastrointestinalmicrobiota di In Another issueespeciallyimportant in
Establishment ofadultgut bacteria trial III
, anoveralldescriptionofdifferen trial II r weaning(Pluskeetal.,1997). (Konstantinov etal.,2004b). confirmed theresults,perfor e gut.Inthisregard, act was obtained. In agreement withliterature, the total intheadultpiggut(stomach, jejunum, proximal colon ctions of thegastrointestin staltic movement andacidicco trial IV, intestinal tract.However, and Herpin,1994;McCrackenetal.,1995; 161 trial V, ce was detectedon day4;different causes with youngeranimalsandqPCR3logunits a keystrategytoavoi Cole, 1994),thehigh quantity ofsubstrate stal colonwerefound.Thedissimilar crease from smallintestinetorectum of unstabilization havebeenrelatedwith
nization incaecum, colonandrectum pigproduction,isthegrowthstasis t 7daysafterweaning,amarkeddrop nt bacteriaweref inpopulationfrom todistal proximal ffers notonlyquantitatively,butalso weight gain than theirlittermates that SH tocounttotalba where daily evolution of feed intake where dailyevolutionoffeedintake t bacteriainhabitingthegrowing- trial III mance beingclearlyaffected al tract,duetothehigher the resultsobtainedwere nditions intheuppertract shows usaninteresting ound asmaingroupsin d problems regularly th daypost-weaning. cterial loadhave
TRIAL II Enterococcus IX (Prop853), Ruminococcus flavefaciens clostridia clusterXIVa(Erec482), Leser etal.,2002). eubacteria, clostridiaandCFBphylum in tract (ReidandHillman, 1999;Hilletal., lactic acidbacteriaaredesc acid bacteriaappearedasthepredominant relatives inthelarge anaerobic bacteria related toclostridialclusters XIVaandtotheclostridialcluster IV coverage obtainedwiththeprobesused. Although they wereused widelyinrecent de regularly used toimprove feedutilization, gr 9.3.1. 100 110 10 20 30 40 50 60 70 80 90 0 Figure 9.3. of growingpigs(TrialIII). Until theirtotalban in Ja TOTAL
Mode ofactionantibiotics: quantitativeorqualitative effects ongut microbiota? TMC EUU OO RECTUM COLON JEJUNUM STOMACH sp.(Lab158)measured byFISHingastrointestinal tract. BAC303 9.3. Totalbacteria,
Streptococcus/Lactococcus Are antibiotic-growthprom intestine, incompar EREC482 and ribed asthemain bacteria nuary 2006, antibiotics as growth promoters were R. bromii FPRAU645 Bacteroides/Prevotella Faecalibacterium prausnitzii 162 ison withstomach andjejunumwherelactic Results obtainedconfirmthedominance of
group. Resultsagreewithliteraturewhere (Rbro730 andRfla729), clostridiacluster the largeintestine
cades, theirexactmechanism ofactionis RBRO/RFLA 2005), andobligate anaerobes suchas owth, andtomaintainpigletguthealth. sp.(Str493)and oters amodeltocopy? in theuppergastrointestinal PROP853 group(probeBac303), (Conway etal.,1994; General discussion General discussion STR493 Lactobacillus/ (Fprau645), LAB158
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE normal microbiota, isone ofthemain tract, andtherefore inthe energypotentia not completely known.Thereductionofbacter Chapter 9 today inpigproduction different trials included inthisthesis aimed toevaluate some of theadditives used development effortisbeingfocusedonthesearchforeffective replacements. The 9.3.2. promotants insteadofreducingtotalbacteria an optimal equilibrium wouldbethestrate composition becoming microbiota inamore favorableequilibrium forthehost. health of the animals not might indicatethat,contra marked changeinspecies bacteria compos obtained byRFLPshowedaclearseparation et al.,2002). found beforewithabsenceof bacteria, however,thiswasnotdetected.In lactobacilli wasexpected, duetothe spec replacement ofbacteriaaff feeding pigs withtylosin that was recove Collier and co-workers (2003)found adecr gastrointestinal tract. Otherauthors haveseen similar results whentesting antibiotics. antibiotic didnotreduceto Hardy etal.,2002). promoters duetotheirantimicrobial properties. organic acidsandplant extractsareproposed with specialinterestinth In responsetotheneedforalternatives These resultswouldsuggest ofavilamy Despite thelackofeffect However, resultsobtainedin
Other infeed-additiveswith
(acidifiers, plantextracts,pr eir effectsongutmicrobiota (T by reducingtotalbacterialo ry tothought,antibioticsco ected byotherresistantstrain effectofavilamycin on tal bacteriaeith that themodulation trial IV antimicrobialproperties hypothesis postulated(Andersonetal.,1999; 163 didnotagreew cin ontotalbacterialload,thedendogram lly availableforthehostbutconsumed by tra of avilamycin against gram positive l loadashavebeenroutinelyproposed. red oneweekafter, ition withtheantibiotic used.This fact
gy tosubstitute antibiotics asagrowth thisregard,similar resultshavebeen ease in totalbact toin-feedantibio of diets, afact th asalternativesto ial loadintheuppe er intheupperorlower of bacterialmicr ebiotics andorganicminerals), lactobacilli counts (Decuypere lactobacilli counts(Decuypere uld improve growthandgut ad, butbychangingspecies able 9.2).Oftheseadditives, ith thishypothe s. Moreover,aneffecton eria onday21after at could be behind a at couldbebehinda probably duetoa tics, researchand antibioticgrowth obiota toachieve r gastrointestinal sis, sincethe
TRIAL II
study withincreasesonly detectedinthe administered alongtheupper gastrointestinal tract. coliform andlacticac also shownreductionsincoliformbacteria weaned pigs(GalfiandBokori,1990).Similarly, otherworksusingformates have parallel withincreases inla authors havefoundchangesinilealmicrobi have beenreflectedinotherbacterialgroups( activities. the upperintestinemeasured astotalbacter effect forlactobacilli.However,wecould shifts indirectly,couldprovi fermentative activity inthesmall intestine against co-workers (2006)showedspecificantibact (enterobacteria) bylactobacillimight bepostu Indeed, apotentialsupplantationofspecifi and Deans,2000)cinamaldehyde from for twoof theextracts included in the mixt extracts (Didryetal.,1994;Sen produced. Previous workshavedemonstrated before (Manzanillaetal.,2004),althoughitis digesta. Increasesinlactobacillipopulati reduce enterobacteriapopulationin jejunum changes inbacterialpopulati bacterial loadwasmeasured itdidnotchange. the colonicbacterialecosystem, althoughsu butyrate andplantextract;thedendogram not reflectedinlactobacilli Results obtainedfrom However, thesepreviousworksdetectedhigh amounts oftheorganicacid Contrary toplantextract, The changeinsimilarity showedbyth E. coli . Also,modificationsofgastrointe id bacteria(Canibe etal.,2005) trialIV ctobacilli afteradministration or enterobacteriapopulation, ons measured byqPCRwith de cecum andhindgutwith sodium butyrate showedamodulation ofgutbacteriawithsodium 1998; Dorman 2000);inparticular, andDeans, 164 on bythisplantextracthavebeenshown stomach (Manzanilla etal.,2006).Taking ure used: carvacrol fr not detectchangesin obtained byRFLPconfirmed changesin c bacteria inhibited bythe plantextract
erial activityofcarvacrolandcinnamon cinnamon (Mancini-filhoetal.,1998). ia, purinebasesormicrobial enzimatic by theextractsdirectlyorbacterial ota withdecreasesin (Øverlandetal.,2000)andintotal, e dendogram clearlyreflectedin was difficulttoexplainhowthisincreaseis abroadantibacterial activity for plant increasedlactobacilliincaecum and tract that we could not confirm in our tract thatwecouldnot confirm inour lated. Inthisregard,recently,Siand effectsobservedondendogramwere ch aswithantibio stinal environment byareductionof trial IV throughout thega ). Previousworksofother plant extract. and presumibly thiscould of thissodium butyrate to a substratewithprebiotic om oregano(Dorman microbial activityin coliform bacteria General discussion General discussion tics, whentotal strointestinal Ittendedto
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE promotant ofthiscompoundisrelatedto pigs feddietswithmannan-oligosaccharides. Inthiscase,theeffectasgrowth White andco-workers(2002)foundalowerconc counts, whichwasreflectedinahigherlact type/amount ofsubstratemay bethekeyto antibacterial activity.Indeed,modulation of seems tobeduesome kindofindirecteffectsonbacteriaratherthandirect 9.3.3. be excluded(seechapter9.4). butyrate. complete absorptionoftheacid at sacrifice time cantherefore be behind thelack of lack ofacid inthesmall intestine (ad 6.5 hafterlimiting theiraccesstofeed, bei stomach (BugatandBentajac,1993).Inourcas the time ofsampling, asNa-butyrateisr ecosystem, reducingintestinalcolonization with organiczinc,qPCR resultsshoweda enterobacteria wasobserved.When pigletsre included inthethesis. bacterial ecosystem indistal microbiota, some effectonstomach micr this intoaccount,andthatRFLPresu Chapter 9 effect of microbiota ofanteri effect ofmicrobiota different betweendiets.Theau enterobacteria weremaintained in feceswherelactobacillipopulation werenot lactobacilli thatcould havelimited thei enterobacteria populationinthestomach after administration offermented liquidf Mode of actionof some in-feed additives andfeed strategiesingut microbiota On theotherhand,some kindofsystemic In addition,thislackofbutyratedetection In thisregard, in
Effects onmicrobiotabyothermechanisms
trial V or sectionsoverposteriorones sections.Inthisregard,vanWinsen andco-workers, thors attributedthese results , acleareffectofmannan-oligosaccharides on libitum accesstofeedfrom 20hto8h).A 165 obiota might somehow eadily absorbedinth lts indicatechangesinproximal colon r growth.Surprisingly,lower levelsof eed togrowingpigsfounddecreasesin
by potentiallypathogenic bacteria.This ng thereforeapotential factor affecting gutenvironment, attachment sitesand theresultsfoundin amodulation of th ceived thediet alone or incombination in thesmall intestinecouldberelatedto attributed toahigherpopulationof obacilli:enterobacteria ratio.Similarly, effect ofthebutyrat selective reduction in enterobacteria e, animals weresacrificedbetween4- entration of coliforms inthefecesof (vanWinsen etal.,2001). to some kindofcarryover e gut starting in the e gutstartinginthe e absorbedcannot have modified the some ofthetrials e gastrointestinal
TRIAL II biodiversity thatmight bemore easily specialization of bacteriainhabiting thelowergut.Thisimpliestherefore alower 9.3.4. bacteria. also modify gutenvironment andthusim viscosity, transittime water binding and also bydifferencesreportedforthesame di by increasingorchangingtheamount of s colonization. might indicateahigherdifficultytodigest insoluble non-starchpolysaccharides with Högberg andco-workers(2004)recentlyre content andthemost homogenous ecosystem betweenanimals. Inagreement, that theanimals fedwithwheatbranhad (data notshown).However, in microbial activitymeasured aspurineba changes inbacterialgroups soluble andinsolublenon-starch polysaccharides; dubious (Hampsonetal.,2001). inclusion inthedietanda tract isan effective toolto It iswellknown thatthemodification ofs different typesoffiberwasalsotestedas acids. not supportedbychangesinthefermentation However, inagreement withpreviouswork oligosaccharide, cannotbediscarded,a intestinal epithelium (Springetal.,2000).Ho proteins onthesurfaceof some bacteriaand modulation couldbeduetothefact that These effectspromoted bythedifferentt In ourcase, theadministration Apart from the different additives evaluated, in
Other strategiestoimprove modify microbiota. However, pparition ofsome entericdiseases make this approach studied alongthegast differences wereshownwithRFLPanalysis,showing of dietsrichinfiber(info health andpromotegrowth 166 nd couldalsoexplaintheeffectsobserved. awaytomodulate thebacterialecosystem. capacity (Anguitaetal.,2006).Thismight ubstrate reachingthelowergastrointestinal ses orenzymatic acitiv pair orimprove col interruptedbyoppor the lowestbiodiversityinproximal colon s (White etal.,2002),thishypothesiswas s (White theoligosaccharide ubstrate thatarrivestobefermented but
ypes offibercouldbe thus preventstheirfurther attachment to a lowermicrobial biodiversity, which ets insome parameters suchasdigesta wever, apotentialpreb this typeoffiberre lated administration ofdietsrichin patterns measured asshortchainfatty rointestinal tract.Also,differences trial III trial III controversies regarding fiber fiber regarding controversies ) didnotresu rm ofresistantstarch and onization bydifferent , administration of ities werenotfound neutralizes binding sulting inahigher explainednotonly tunistic pathogen General discussion General discussion iotic effectofthe lt inmarked
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW
REVIEW REVIEW
TRIAL V V TRIAL TRIAL IV IV TRIAL
TRIAL III III TRIAL II TRIAL I TRIAL OBJECTIVES DISCUSSION DISCUSSION LITERATURE LITERATURE enterobacteria counts,and alsoamoresu consequent impairment ofgutfuncti at pigletweaningwhenvillusatrophy given alone(Ijietal.,2001; 1994). Similar results havebeenobtained inpoultry withmannan-oligosaccharides villus:crypt ratiowhichisconsidered anindi together showedthelowestcryptdepth zinc andmannan-oligosaccharides were adde zinc wasadministered, althoughdiffere IgA andIgMmeasured injejunum digesta weight observedmay reflectingahigherdevelopment be ofthePeyer’sPatches. Also showing acontinuousPeyer’s Patch,which piglets showedaheavier empty ileum, considered asthesection of thesmall intestine much higherconcentrations(Katouliet studied, contrarytoeffectsfoundwhenthe Chapter 9 our studydidnotshowdifferences. O’Quinn etal.,2001;Davis et molecular similarity todifferentbacter pig immune responsethroughactivationofdifferentmembrane receptors bytheir Prasad, 1998). Similarly, mannan-oligosacchar nonspecific immunity,andalsoforT that Zniscrucialfor thenormal deve zinc oxide,withanimmunoestimulatory effect ( performance. Among theadditivestested, also considered as mechanisms bywhich improvement ofthepigletimmune response, added topigdietscannotbecompletely of pigletlife whentheimm trial V) Therefore the organicmineralcould act The administration oforganiczinc( Improvements inpigguthealthandpe Moreover, asynergiceffect andsodium butyrate( une systemisstillimmature. Ferket, 2002).Thiseffectmight al.,2004b).However,immune measurements donein trial IV wasobservedinintestin ) may beactingintheseways. nces didnotreachsignificance. on (Pluskeetal.,1997). Thereductionof ial structures(Newman andNewman, 2001; trial V) 167 explained bytheireffectonmicrobiota. An al., 1999;Höjbergetal.2005).However, lopment andfunctionofcellsmediating B lymphocytesproliferation(Shankarand itable immuneresponse might bebehind some additivesimpr mannan-oligosacharides andorganiczinc and crypthyperplasiaappearwiththe
cator of overall gut health(Zijlstra et al., and thiswasreflectedinthehighest was alsonumerically by adifferent mechanism of actionthan d together. Animals fed inbothadditives were numerically higherwhenorganic mineral is added ininorganicform at gutbarrieranddigestivecapacityare rformance obtained whenadditives are ides havebeenreportedtoenhancethe , especiallyimportant didnotmodify thebacterialgroups al morphology whenorganic In fact,ithasbeenshown beespeciallybeneficial ove gutfunctionand longer. Thehigher atearly’sstages
TRIAL II successfully androutinelyused complex modification of bact to copy,didnotactsimplybyreducingtota ofadditivestested.Antibio modes ofaction gain (Manzanillaet and thusexplainingtheimprovement foundin possible therefore that butyrate wasalso and alsobystimulating proliferationinde Cummings1995), improving absorptionofs 1990) byprovidingenergytoepithelia has acomplex trophiceffectonthegastro that acidwasonlydetectedinthestomach. Ithasbeenshownthatsodium butyrate administered inthedietcannotbediscar However, asystemic effectonpighealth promoting effectsongrowthcouldbedue mimic. Moreover,results obtained with gut bacteria,resultsobtainedwithboththes these effects.Takingintoaccounttherela considered thekeyresponsestoimprove pighealthandperformance. microbiota, andtheimprovement ofgut to antibiotics proposed,althoughthe achievement ofanoptimal equilibrium ofgut our knowledgeregardingtheexactmechanism response, orothersystemic effects. Furthe by blockingadhesionofpotentialharm mechanisms ofaction:selectiveeffecton Results obtained inthedifferent trialsincluded inthisthesis pointtodifferent In thecaseofsodiumbutyrate( al., 2006,Inpress). during thelastfiftyyears, erial profile.Inthisre 9. 4.Summary trial IV 168 microbial groups,modul acting intheseways,improving pighealth ded, specially taking intoaccount the fact r studiesaretherefor tionship betweentheimmunesystem and e additivesseem particularlyinteresting. x incrypts(Salminen function andimmuneresponsecouldbe odium andwater(BondLevit.,1976), tic growthpromoter,regardedasamodel theadditivestested ful bacteria, improvement of immune ofimmune bacteria,improvement ful duetoabsorptionofsodium butyrate
intestinal epithelium totheobservedeffectonmicrobiota. l cells(BugatandBentajac,1993; l bacterialloadbut thegain:feedratio of actionthediffe ), wehaveseenbeforethattheir
gard, antibioticstrategy, is notaneasystrategyto e requiredtoimprove probably byamore indicatedifferent ation ofhosthealth (Galfi andBokori, andaveragedaily et al.,1998).Itis General discussion General discussion rent alternatives
TRIAL I OBJECTIVES LITERATURE DISCUSSION REVIEW DISCUSSION L II L III L III L IV TRIA TRIA TRIA
Table 9.2. Summary of the main effects found for the different additives tested in the trials included in the thesis
Gut Immune Microbial indexesa morphology status
Intestinal Total Villus: Crypt Trial Additive tested Lactobacilli Enterobacteria Profile Biodiversity Igs section bacteria Crypt depth AB (avylamicin) ═ ═ ═
AC (sodium butyrate) Jejunum ═ ═ ═ XT (plant extract) ═ ═ ↓ Trial IV AB (avylamicin) ═ ═ ═ ≠ ↑ Caecum AC (sodium butyrate) ═ ═ ═ ≠ ↑
XT (plant extract) ═ ↑ ═ ≠ ↑
BM (mannan-oligosacharides) ═ ↓ ═ ═ ═ BP’ (zinc-quelate) ═ ═ ═ ═ ↑ Trial V Jejunum BMP (mannan-oligosacharides ↓ ═ ═ ═ ═ plus zinc quelate) a A symbol has been assigned to classify effects observed on the different parameters evaluated (═, denotes abscence of changes; ↓, denotes a diminish and ↑ denotes an increase compared to control diet).
CONCLUSIONS Chapter 10 170
Conclusions
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES CONCLUSIONS INTRODUCTION
INTRODUCTION CONCLUSIONS OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V
conditions: 6. 5. 4. 3. 2. 1. The resultsobtainedinthisthesis allow us
the microbial profilewithoutmodifying Similarly toavilamicyn, sodium butyrate that couldbebehindtheobservedeffects on performance. In particular,anincrease inmicrobial to themodulation ofitsprofile Contrary towhatweexpected,effect in microbial diversity withmore si bran, asasourceofinsolublenon-starch produced inthediversity the intestinal tract. However, as (10%) inthedietofgrowingpigsdoes The inclusionofcoarsegroundcorn(4 the main groupsinthelowertract. Clostridium butyricum and theabsenceofsome particularspecieslike polymorfism (t-RFLP).Specifically,alowe in bacterialprofilesassessedbyte with asignificant decrease in the lact Bacteroides/Prevotella lactobacilli arethepredominan hybridization (FISH)differalongthegastro In thegrowingpig,major bact by weaning. Commercial weaningproduces amarked gene copies,isapracticalmethod tode Real-time PCRusedtoquantifygutb it generateshighercountsthandirect by thelactobacilli:enterobacteria index. and group,clostrialclusterXIV,IVandruminoccoci of specieswithineachgr C. perfringens
rather thanareduction intotal bacterial load. 172 erial groupsquantifiedbyfluorescent milar profiles between animals.
observed by RFLP results, changes are are changes byRFLPresults, observed microscopy and s ofavilamicyn onmicrobiota arerelated obacilli:enterobacteria t intheuppertract,whereas acterial groups,interms of16SrRNA diversitywasdemonstrated by RFLP tect changesinmicrobiota equilibrium not affectthemain toconcludethatinourexperimental polysaccharides, promotes a decrease polysaccharides,promotesadecrease total microbial counts.However,each rminal restrictionfragment length However, forabsolutequantification mm), beetpulp(8%)orwheatbran and plantextractareable tomodify arerelatedtomicrobiota disruption shiftinpiglet cecum microbiota, r diversity inlacticacidbacteria intestinal tract.Streptococciand Lactobacillus delbruekii oup. Inparticular,wheat selective culture. bacterial groupsof ratio and changes ratioandchanges Conclusions in situ
are ,
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I OBJECTIVES CONCLUSIONS INTRODUCTION bitory effect on enterobacteria on effect bitory with mannan oligosaccharides and oligosaccharides with mannan ove development of the continuous ove development particular, plant extract significantly significantly plant extract particular, by a significant increase in villi:crypt increase in villi:crypt by a significant to different modes of action. Whilst of action. to different modes
173 additive promotes different changes. In promotes different additive increases lactobacilli in the cecum, and butyrate promoted the highest the butyrate promoted and the cecum, lactobacilli in increases biodiversity. improvement The growth performance organic zinc in weaning pigs are due organic zinc in is manifested Peyer’s Patch. Synergy mannan-oligosaccharides show an inhi show an mannan-oligosaccharides zinc tends to impr population, organic together. ratio when both additives are included
7. Chapter 10 10 Chapter
INTRODUCTION CONCLUSIONS OBJECTIVES TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V LITERATURE CITED Chapter 11 174
Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Alfreider, A., J. Pernthaler, R.Amann,B.Sattle J.Pernthaler, Alfreider, A., Alstchul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J.Lipman.1990.Basiclocal Alstchul, S.F.,W.Gish, W.Miller,E.Myers, Allison, C.,and G.T.MacFarlane.1989.Influe Adami, A.,andV.Cavazzoni.1999. Occurrenc Abraham, S.N.,J.D.Goguen,andE. H. A Alander, M.,R.Satokari,andKorpela.1999. Alam, M.,T.Midtvedt,and A.Uribe.1994.Di Akira, S.,K.Takeda,andT.Kaisho.2001.Toll-li Aguirre, M.,andM.D.Collins.1993. aci Lactic Adams, C.A.2001. Total Nutrition. Feeding animals forhealth and growth. Notthingham Alexopoulus, C.,I.E.Georgoulakis, A. Tzivara, A.Tzivara,S. Georgoulakis, Alexopoulus, C.,I.E. Alm, E.W.,D.B.Oerther,N.Larsen,A.Stahl,andL.Raskin. 1996. The oligonucleotide be, F.,N.Ishibashi, and S. Shimamura. 1995. Effect ofadministration of bifidobacteria and alignment tool. J.Mol.Biol. 215:403-410. Appl. Bacteriol.75:95-107. piglets fedwith 2144. 1029. withformation E.coliassociated fimbriated Sci.78:2838-2846.lactic acidbacteriatonewborncalvesandpiglets. J.Dairy layers ofahighlayers mountain lakebyinsitu hy 1996. Community ofthebacterial analysis ass rh probiotic strain,Lactobacillus a mucosa by 29:445-451.of germ-freerats. Scand.J.Gastroenterol. and acquired immunity. Nat. Immunol. 2:671-680. Press,UK. University quality of quality grower andfinisherpigs.J.Ve andBacillussubtilissporesonth licheniformis 2004b.Field evaluation oftheef Kyriakis. Anim. Phisiol.Anim. 88:381-392. Nutr. thehealthstatus subtilus spores,on Bacillus 2004a. Field ofaprobioticevaluation of the efficacy containing Bacillus licheniformis and Environ. Microbiol. 65:351-354. probe database.Appl.Envir Environ. Microbiol. 55:2894-2898. rate onamine Bacteroides production by Bacillus coagulans on. Microbiol. 62:3557-3559. asprobiotic.J.Basic Microbiol.39:3-9. t. Med.A.Physiol. Clin. Med.51 :306-312. Beachey. 1985. Hyperadhesive mutant 1985.Hyperadhesive oftype-1Beachey. 176 bridization. App.Environ. Microbiol. 62:2138- of FIMH organelles. Infect. Immun. 56:1023- of FIMHorganelles.Infect.Immun. fragilis andClostridium perfringens.Appl. fferential cell kinetics in the ileum and colon andcolon fferential cellkineticsintheileum Persistence of colonisation ofhuman colonic Persistenceofcolonisation r, F. –O. Glöckner, A. Wille, and R. Psenner. r, F.–O.Glöckner,A.Wille,andR.Psenner. and performance of sows and their litters. J. J. and theirlitters. sows and performanceof nce ofpH, nutrient availability, andgrowth amnosusoral consumption. Appl. GGafter e ofselectedbacterialgroupsinfaeces ke receptors: critical proteinslinkinginnate ke receptors: critical emblages inthe winter coverandpelagic d bacteria and human clinical infection.J. d bacteriaandhumanclinical e health status, performance, and carcass e healthstatus,performance, fect ofaprobiotic-containingBacillus K. Kritas, A. Siochu, and S. C. Kyriakis. K. Kritas,A.Siochu,andS.C.Kyriakis. C. S. Kyriakis, A.Govaris,andS.C. C. S.Kyriakis, Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED rential recovery species of bifidobacterial zation. Int. J. Food Microbiol.65:45-54. J. Food zation. Int. by Paneth cells in response to intestinal rences in the gastrointestinal microbial on the physicochemical on the physicochemical characteristics of Parks, M. E. Selsted, and A. J. Ouellette. Parks, M. E. Selsted, and A. J. Ouellette. fermentation studied by denaturing gradient natural microbial community. naturalBacteriol.microbial J. nd environmental in studies nd environmental J. microbiology. gonucleotide probes with flow cytometrygonucleotide for edition. AOAC, Arlington, USA. J. Jatila, and W. E. Holben, 2003. Selective 2003. E. Holben, Jatila, and W. J. th r. 1995. Phylogenetic identification and in situ identification Phylogenetic r. 1995. microbiology and growth promoting antibiotics promoting and growth microbiology 2003. Comparison of rapid methods for the for the rapid of Comparison methods 2003. 177 l. 1990a. Fluorescent-oligonucleotide probing of probing Fluorescent-oligonucleotide l. 1990a. hout cultivation. Microbiol. Rev. 59:143-169. Rev. 59:143-169. Microbiol. hout cultivation. sugar. Methods in Enzymology 3:73-105. 3:73-105. sugar. Methods in Enzymology
2000. Secretion of microbicidal alfa-defensins Secretion of microbicidal 2000. 1:113-118. bacteria. Nature Immunol. analyzing mixed microbial populations. Appl. Environ. Microbiol. 56:1919-1925. 56:1919-1925. Microbiol. Environ. Appl. populations. microbial mixed analyzing 1990b. Combination of 16S RNA-targeted oli RNA-targeted of 16S Combination 1990b. whole cells for determinative, phylogenetic, a for determinative, whole cells Bacteriol. 172:762-770. sour cassava starch responsible for traditional rRNA hybridigel electrophoresis and quantitative visualization of high genetic diversityvisualization of high a in 12:231-236. Opin. Biotechnol. fluorescence in Curr. situ hybridization. detection of individual microbial cells wit microbial detection of individual 178:3496-3500. K. C. Marshall, ed. Plenum Press, New K. C. Marshall, ed. Plenum York. profiling accurately diet-related diffe reveals community of broiler chickens. Appl. Environ. Microbiol. 67:5656-5667. 67:5656-5667. Microbiol. community chickens. Appl. Environ. broiler of in swine. Nutr. Abstr. Rev. B70:101-108. in swine. Nutr. Abstr. Rev. B70:101-108. to the Livestock Science. digesta in growing pigs. Submitted Verstegen, and H. R. Gaskins. 1999. Gut pulp, sugar beet corn, and wheat gran ground extraction of bacterial DNA from colonic and caecal lumen contents of the pig. J. Appl. contents of the colonicbacterial DNA and caecal lumen from extraction of Microbiol. 94:988-993. plating underestimates abundance and shows diffe plating underestimates feces. human Microbiol. 69:5731-5735. Appl. Environ. from Amann, R. I., W. Ludwig, and K. H. Schleife R. I., W. Ludwig, Amann, Anderson, K. L., and S. Lebepe-Mazur, 15 AOAC. 1990. Official of analysis. methods Chapter 11 Chapter and D. A. Stah I., L. Krumholz, R. Amann, R. Devereux, and D. A. Stahl. R. J. Olson, R. I., B. J. Binder, S. W. Chisholm, Amann, W. R. I. Mackie, M. Anderson, D. B., V. J. McCracken, J. M. Simpson, R. I. Aminov, J. Gasa, S. Anguita, M.., Effect of coarse M. Martín-Orúe, M. Nofrarias and J. F. Pérez. 2006. Ampe, F., A. Sirvent, and N. Zakhia. 2001. Dynamics of the microbial community community of the microbial Dynamics 2001. and N. Zakhia. F., A. Sirvent, Ampe, Amann, R., J. Snaidr, M. Wagner, W. Ludwig, and K. H. Schleifer. 1996. In situ situ In 1996. Schleifer. and K. H. M. Wagner, W. Ludwig, J. Snaidr, R., Amann, by of microoganisms identification The 2001. and S. Behrens. R., B. M. Fuchs, Amann, Ayabe,C. T., D. P. Satchell, C. L. Wilson, W. Atlas, R. M. 1984. Diversity communities. In: Advances in of microbial microbial ecology. Ashwell, G. 1957. Colorimetric analysisAshwell, G. 1957. Colorimetric of Apajalahti J. H., A. Kettunen, M. R. Bedford, and W. E. Holben. 2001. Percent G+C Percent 2001. Bedford, and W. E. Holben. Apajalahti J. H., A. Kettunen, M. R. H. Päivi, P. Apajalahti, J. H. A., A. Kettunen,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Bach Knudsen, K. E., and I. Hansen. 1991. Gastro I. Hansen.1991. Knudsen, K.E.,and Bach fibreon levelofdietary B. Jensen. 1991.Effectofsourceand K.E.,and Bach-Kudsen, B T., T.Ayabe, Ashiba,Y. Kohgo, and T. Kono. Bailey, M., F. J. Plunkett, H. J. Rothkötter, M.,F.J.Plunkett,H. Bailey, Bach Knudsen,K.E.2001. Carbohydrate and Bach Knudsen,K.E.1997.InProceedingsof I. Bach-Knudsen, K.E.,B. B. Jensen,and Bach Knudsen,K.E.,B.Jensen,J.O.A Ballongue, J.,C.Schumann,a Baron, S.F.,andP.B.Hylemon. 1997. Bi Barcenilla, A.,S.E.Pryde, J.C.Martin,S.H. Bedford, M.R.andH.Schulze.1998. Exogeno A., B.E.Brooker,R.Fuller,andM.J.Newport. 1980. Theattachment of Barrow P. ach, H.J.,J.Tomanova, M.Schloter, and J.C. samples mediatedquantitative PCR by amplification. J.Microbiol. Methods 49:235-245. and bacteriawithgenes for proteolyticac microbial fermentationinthe largeintestineofpigs. EAAP publication54:389-394. antimicrobial peptidesininnate host animals feeding.Anim. FeedSci.Techol. 90:3-20. Anim. Sciences,Wageningen,Netherlands. food forthecolon? Healthy oligosaccharides: oat fractionsrichinbeta-D-glucan.Br.J. Nutr. 70:537-556. other majorcomponents inthesmalland large tract. Br.J.Nutr.65:233-248. implications inpigsofwheat constituents. Br. J.Nutr.65:217-232. andbulkingpr oat fractions.1.Digestibility Nutrition Society 60:427-435. Stokes. 2001.Regulationofmucosal immune res Appl. Environ. Microbiol. 66:1654-1661. Phylogenetic relationshipsofdominant butyr colonic microflora andenzymatic activity. Rev. 11:91-114. intestine. J.Appl.Bacteriol.48:147-154. bacteria tothegastricepithelium ofthepig York. eds.ChapmanandHall,New Isaacson, Microbiol steroid hormones.InGastrointestinal and oat fractions. 2. Microbial activity in the gastrointestinal inthe gastrointestinal and oatfractions.2.Microbialactivity nd P. Quignon. 1997.Effectsoflactuloseandlactitolon defense. TrendsMicrobiol.12:394-398. Hansen. 1993. Digestion of polysaccharides and and Hansen. 1993.Digestionofpolysaccharides Scand.J.Gastroenterol. 222:41-44. 178 otransformation of bile acids, cholesterol, and otransformation ofbileacids,cholesterol, ndersen andI.Hansen.1991. Gastrointestinal ndersen and itsimportance of the inthemicroecology tivity inpurecultures andinenvironmental M. A. Vega-López, K. Haverson, andC.R. M. A.Vega-López,K.Haverson, the InternationalSymposium “Non-digestible Duncan, C.SStewart, andH.J.Flint. 2000 operties of polysaccharides and other majorother and operties ofpolysaccharides ate producing gut.bacteria from thehuman Munch. 2002. Enumeration of totalbacteria us enzymes for pigs and poultry. Nutr.Res. for pigs andpoultry. us enzymes R. Hartemink,Wageningen Instituteof ed. 2004. The role ofPaneth cellsandtheir lignin contentsof planmaterialsusedin intestine ofpigsfedondietsconsisting intestinal implication in pigs of wheat and and inpigsofwheat intestinal implication ogy. R. I. Mackie, B. A. White and R. E. ponses in effector sites. Proceedings ofthe ponses ineffectorsites.Proceedings Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED : additive Escherichia feed containing Na-n- Lactobacillus acidophillus acidophillus Lactobacillus in the colon of rats and man. colon of rats in the Salmonella enteritidis bute to biofilm formation in the gut. to biofilm formation in the gut. bute th, digestibility and characteristics of gutth, digestibility cteria in healthcteria in Curr. Stud. and disease. K88-mediated adhesio of Escherichia coli K88-mediated the Med. gastrointestinal tract. Adv. Exp. Evaluation of low nutrient, high fibre diets fibre diets nutrient, high low of Evaluation P. J. Heidt, and R. Van der Meer. 1997. P. J. Heidt, and The effect of oligosaccharides on piglets. effect of oligosaccharides The spp. Appl. Environ. Microbiol 59:34-39. Microbiol 59:34-39. Environ. spp. Appl. es and inhabits cell attachment and invasion enterotoxaemia. Vet. Microbiol. 3:281-290. 3:281-290. Vet. Microbiol. enterotoxaemia. nd L. L. Blackall. 1999. Identification of some Identification L. Blackall. 1999. nd L. ine experiment with a ine experiment and B. Klenke. 1988. Influence of fumaric acidand B. Influence of fumaric Klenke. 1988. tinal microflora. Trends Microbiol 4:430-435. 4:430-435. Trends Microbiol tinal microflora. 179 t and nonefficient biological phosphorus removal removal phosphorus t and nonefficient biological analysis. Vet. Res. Commun. 509-518. 11: Lactobacillus Escherichia coli 1976. Fate of soluble carbohydrate Fate of soluble carbohydrate 1976.
K88 to piglet ileal mucus by ileal mucus piglet K88 to for the prevention of porcine of porcine for the prevention Increasing the resistance invasive pathogen of rats to the effects of dietary Gut 40:497-504. and calcium. lactulose to jejunal brush borders in pigs: a genetic borders in to jejunal brush coli Sci. 12:1104-1110. content. Asian-Australasian J. Anim. Gremokolini, and S. Mattuzzi. 1999. Effects of dietary characteristics and buffering and S. Mattuzzi. 1999. Gremokolini, grow acids on piglet protected or unprotected Immunology 109:580-587. 109:580-587. Immunology of the groups of bacteria in efficien major 65:4077-4084. Microbiol. activated sludge systems. Appl. Environ. Human secretory immunoglobulin A may A contri secretory immunoglobulin Human Arch. Tierernahr. 44:21-27. and propanediol formate on piglets. J. Anim. Physiol. Anim. Nutr. 59:143-149. Nutr. 59:143-149. Anim. Physiol. on Anim. piglets. J. formate and propanediol butyrate. Magy. Allatory. Lapja. 44:501 (abs.). (abs.). butyrate.Lapja. 44:501 Magy. Allatory. Fragment Length Polymorphism data Length Polymorphism analysisFragment for quantitative comparison of microbial 69:926-932. Microbiol. Appl. Environ. communities. Hematol. Blood Transfus. 59:44-65. 59:44-65. Blood Transfus. Hematol. Biol. 473:11-30. Biol. 473:11-30. bacteria. Gut 35:483-489. by enterovirulent LA binds to cultured human intestinal LA binds to cultured cell lin J. Clin. Invest. 57:1158-1164. 57:1158-1164. J. Clin. Invest. Bijlsma, I. G., and J. Bouw. 1987. Inheritance of Bijlsma, Bovee-Oudenhoven, I. M. J., D. S. Termont, D. S. Termont, J., M. Bovee-Oudenhoven, I. Bond, J. H., and M. D. Levit. M. D. Levit. Bond, J. H., and a Wagner, J. Keller, R. Erhart, M. L., Bond, P. L. Casini, D. Creston, C. J. A. Cacciavillani, Han, S. Perini, K. J. Jung, I. Bosi, P., H. Bollinger, R. R., M. L. Everett, D. Palestrant, S. D. Love, S. S. Lin, and W. Parker. 2003. Parker. 2003. Lin, and W. D. Palestrant, S. D. Love, S. S. R., M. L. Everett, Bollinger, R. Bolduan, G., M. Beck, and C. Schubert. 1993. Bolduan, G., M. Beck, and C. Schubert. Bolduan G., H. Jung, R. Schneider, J. Block, Bolduan G., H. Jung, R. Schneider, Chapter 11 Chapter Berg, R. of enteric ba D. 1992. Translocation Blomberg, L., A. Henriksson, and P. L. Conway, 1993. Inhibition of adhesion of of adhesion of Conway, Inhibition 1993. L., A. Henriksson, and P. L. Blomberg, Berg, R. D. 1996. The indigenous gastrointes indigenous The Berg, R. D. 1996. Restriction Terminal and E. A. Paul. 2003. Kim, S. H. C. B., T. Marsh, Blackwood, Berg, R. D. 1999. Bacterial translocation from translocation from Bacterial Berg, R. D. 1999. Bernet, M. F., D. Brassart, J. R. Neeser, and A. L. Servin. 1994. 1978. E. Eggenberger. and Bertschinger, H. U., Bokori, J., P. Galfi, and I. Boros. 1989. Sw
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Boye, M., T. Boye, K. Jensen,Moller,T.D.Leser Brandtzaeg, P.E.2002.Current understanding of Brown, I., M. Warhurst, J. Arcot, M. Playne, R.J.Illman,Brown, I.,M.Warhurst,J.Arcot,Playne, andD.L.Topping. 1997. Fecal Brooks, P.H., D.T.Morgan T.M.Geary, adA.Campbell. 1996. Newdevelopments in Brook, I. Crit. Rev.Microbiol. 25:155-172.1999. Bacterialinterference. T.M. and W.J.Bettger.1990.Bray, antioxidant. FreeThe physiological roleofzincasan Carlstedt-Duke, B.,T. Midvedt,Carlstedt-Duke, C. E. Nord,and B. E.Gustafsson. 1986. Isolation and S., C.A.Boren,Wu,E.Huntington,Carlson, M. D.W.Bollinger,and T. L.Veum. Bustin, S.A.2000.Absolute quantification Bugat, M.,and acidsin M.Bentejac.1993. nonruminant Biologicalofshortchain fatty effect Buddington, R. K.,C.H.Williams,1996. Dietary S. –C.Chen,andA.Witherly. L.,P.G.model Falk,T.Midvedt,andJ.I.Gordon.1996.Bry, A forhost-microbial cross- Carlson, M.S.,Hill,G.M.,andJ.E.Link. B. Højsgaard, and Canibe, N.,O.Højberg,S. C anibe, N.,S.H.Steien,M.Øverland,andB. mammals. Annu.Rev.Nutr. 13:217-241. growing pigs. J.Anim. Sci.83:1287-1302. affect the gastroin acid addtitiontothefeed piglets, andon gastricalterations.J.Anim. Sci.79:2123-2133. acidity,microbiota, andthestarter dietson amount oforganicacidsinthedigestivetract fluorescent rRNA in situ hybridization. Mol.Cell.Probes 12:323-330.fluorescent rRNAinsituhybridization. the genus numbers ofbificobacteriaarehigherinpigsfed liquid feeding. PigJournal 36:43-63. Radic. Biol.Med.8:281-291. relation tofood Ann. allergy. N.Y.Acad.Sci.964:13-45. Acta Pathol.Microbiol.Immunol. Scand.Sect. B.94:292-300. characterization ofamucin degrading strainof characterization Sci. 82:1359-1366. ongrowthperformance, plasma,chelate complex andexcretioninnursery pigs.J. Anim. or aspolysaccharide 2004. Evaluationofvariousinclusionratesorganic zinceither Nutr.63:709-716. enzymes inhumansubjects.Am. J.Clin. supplement ofneosugaraltersthefecalflor talk inanopen mammanlianScience 273:1380-1383. ecosystem. amylose cornstarchthatwithalowam benefit from phase-feeding pharmacologicalbenefit from c metallothionein andmineral concentr J.Mol.Endocrinol.25:169-193. polymerase chainreactionassays. Serpulina, S.hyodysenteriae ations. J.Anim.Sci. 77:1199-1207. ylose cornstarch.J.Nutr.127:1822-1827.ylose 1999. Earlyandtraditionally pigs weanednursery , and 180 of mRNA transcription using real-timereverse B. Jensen. 2005. FeedphysicalB. formandformic a and decreases activities of some reductive activities ofsome a anddecreases , and S. E.Jorsal. 1998. Specific detectionof testinal ecology andgrowthperformanceof testinal ecology B. in Jensen. 2001.EffectofK-diformate Peptostreptococcus gastrointestinal immunoregulation andits oncentrations ofzincoxide:effecton S. pilosicoli Bifidobacterium longum inporcineintestinesby from ratintestinal tract. Literature cited Literature cited withahigh
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED and Lactobacillus . Int. J. Food Microbiol. 35:1-27. 35:1-27. Microbiol. . Int. J. Food sequences for human and animal health. J.sequences for human nc balance in nursery pigs. J. Anim. Sci. Anim. J. in nursery pigs. nc balance ents of penicillin. Br. J. Nutr. 17:141-151. ents of penicillin. Br. J. Nutr. 17:141-151. n fatty acids in the rat terminal ileum. Gut ileum. rat terminal in the acids n fatty J. P. Galmiche. 1997. Effects of short chain J. P. Galmiche. illa, I. Badiola, M. Martín and J. Gasa. 2006. illa, I. Badiola, M. and C. L. Kitts. 1998. Terminal restriction and C. L. Kitts. 1998. Terminal , and I. Phillips. 2003. The European ban on 2003. The I. Phillips. , and germ-free apparatus germ-free and in a conventional of feeding organic and inorganic sources of sources of feeding and inorganic organic ia by and lactobacilli populations in pig digesta Kwok. Fluorescence energy transfer detection 181 nd J. K. Collins. 1997. Review article:selective tions. Adv. Microb. Physiol. 32:87-108. 32:87-108. Physiol. Microb. tions. Adv. acterial fimbriae. J. Bacteriol. 169:934-938. J. Bacteriol. 169:934-938. acterial fimbriae. Comp. Med. Vet. Sci. 27:290-294. Med. Vet. Sci. 27:290-294. Comp. method. 1997. Proceedings of the Natl. Acad. Sci. method. 1997. Proceedings of the tification of potential probiotic 2000. Isolation PCR quality DNA from human feces with a soil human 2000. Isolation PCR quality DNA from species in mixed bacterial populations bacterial species in mixed
environment, with and without dietary supplem environment, the growth of xhicks in the Fustafsson detection, enumeration and iden detection, enumeration fragment patterns (TRFPs), a rapid, PCR-based method of complex comparison for the 31:135-142. J. bacterial communities. Methods Microbiol. Bifidobacterium 38:53-58. 1996. In vitro contractile effects of short chai contractile 1996. In vitro antibacterial activity and practical applica USA. 94:10756-10761. USA. 94:10756-10761. fattyScand. J. Gastroenterol. 222:58-61. motility. acids on gastrointestinal as a homogeneous DNA as a homogeneous diagnostic additional zinc on growth performance and zi performance growth on zinc additional 80:1917-1924. 80:1917-1924. Clin. Nutr. 69:1046S-1051S. Clin. Nutr. 69:1046S-1051S. Antimicrob. Chemotherapy 52:159-161. 52:159-161. Chemotherapy Antimicrob. growth promoting antibiotics and emerginggrowth promoting con DNA kit. Biotechniques 28:640-646. Prod.11:47-56. enteritis of early-weaned Can. J. pigs. Quantification of total bacteria, enterobacter Quantification of real-time PCR. Vet. Microbiol. In Press. Close, W. H. 2000. Producing pigs without antibiotics growth promoters. Adv. Pork Adv. Pork without antibiotics growth promoters. Close, W. H. 2000. Producing pigs A comparison of 1963. Coates, M. E., R. Fuller, G. F. Harrison, M. Lev, and S. F. Suffolk. Clement, B., and Kitts, C. L. Clegg, S., and G. F. Gerlach. 1987. Enterob G. F. Gerlach. 1987. Clegg, S., and Clement, B. G., L. E. Kehl, K. L. DeBord, Chopra, S. L., Blackwood, A. C., and D. G. Dale. 1963. Intestinal microflora associated withmicroflora Blackwood, A. C., and D. G. Dale. 1963. Intestinal Chopra, S. L., Cherbut, C. A. C. Aube, H. M. Blottiere, and Cherbut, C. A. C. Aube, H. M. Blottiere, Chen X., B. Zehnbauer, A. Gnirke, and P. Y. Zehnbauer, Chen X., B. C. Aube, H. M. Blottiere, P. Pacaud,A. P. Galmiche.Cherbut, C., C. Scarpignato, and J. Organic acids: chemistry, Chopra. 1991. I. Mead, and G. C. C. A., M. Hinton, Cherrington, Chapter 11 Chapter L., Case, C. 2002. Effect and M. S. Carlson. Casewell, M., C. Friis, E. Marco, P. McMullin Marco, Friis, E. Casewell, M., C. Charteris, W. L. Morelli, a P., P. M. Kelly, Castillo, M., S. M. Martín-Orúe, E. G. Manzan Castillo, M., S. M. J. development. system Cebra, J. J. 1999. immune Am. of on intestinal microbiota Influences
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Contrepois, pathogens: M. 1988.Lescolibacilles approaches R. Gibson.1999.Probiotics,prebiotics,andsymbiotics: Collins, M.D.,andG. Cromwell, G. L., T. S. Stahly, and H. J. Monegue. 1985. Efficacy of sarsaponin for weanling ofsarsaponinforweanling andH.J.Monegue.1985.Efficacy L.,T.S.Stahly, G. Cromwell, Crittenden, R.G.1999. Prebiotics. G.W. In:Tannock, ed., Probiotics:acriticalreview. in 1981. natureand Thebacterialglycocalyx W., R.T.Irvin,K.J.Cheng. Costerton, J. Cromwell, G.L.,T.S. Stahly, andH. J. P. Conway, L. 1997. Development of intestin P. Conway, L. 1994. Function and regulation of the gastrointestinalmicrobiota ofthepig. Collins, M.D.,P.A.Lawson,Willems,J. Collier, C.T.,M.R.Smiricky-Tjardes, D.M.Albin,J.E.Wubben, V.M. Gabert,B. Cole, J. R., B. Chai, T. L. Marsh, R. J. Farris, Q. Wang, S. A. Kulam, S. Chandra,Coconnier, Chauvière, J.Fourniat,andM. H.,F. A.L.Servin. Bernet,S.Kernéis,G. D. M. Cromwell, G. L.2002. andhowCromwell,Why antibiotics areusedinswineproduction.Anim. 44:812-826. proposal of five newgeneraandeleven new sp J. Cai,H.Hippeand J.A.E.Farrow. 1994. The phylogeny of the genusClostridium: for modulating themicrobial of ecology the gut. Am. J.Clin.Nutr. 69:1052S-1057S. and growing-finishing swine housedattwo anim Horizon ScientificPress,Wymondham, UK. Rev.Microbiol.disease. Ann. 81:299-324. Microbiol., vol. 2.Chapman andHall,London. host interactions. In: Mackie, R. I., Whyte, B. host interactions.In:Mackie, R.I.,Whyte, EAPP publication 2:231-240. France. Excerpta Medica, colibaciles entérotoxigènes. In:L’intestine Gr Sci. 81:3035-3045. microbiota responsestoantimicrobialgrowth promoters. J.Anim. of porcineileal analysis D. Bane,B.Anderson,and Deplancke, prokariotic taxonomy. Nucleic AcidsRes.31:442-443. autoaligne Project (RDB-II):previewinganew a McGarrell, T.M.Schmidt, G.M.Garrity, Lett.110:229-306. by 1993. Inhibition ofadhesion ofenteroinvasive Biotechnol. 13:7-27. 3002. and livercopperstores copper onperformance Lactobacillus acidophilus strain LB decreases bacterialinvasion.FEMSMicrobiol. strainLBdecreases Monegue. 1989. Effects ofsourceandlevel 182 nd J.M.Tiedje.2003.The RibosomalDatabase al microbiota. Gastrointestinal microbes and Gastrointestinal al microbiota. microbes and Cordoba, J. Fernandez-Garayzbal, P.Garcia, J.Fernandez-Garayzbal, Cordoba, H. R.Gaskins.2003.Molecularecological A. and Isaacson, R. E., eds. Gastrointestinal A. andIsaacson,R.E.,eds.Gastrointestinal pathogens tohuman intestinalCaco-2cells êle. J. C.Rambaud, R.Modigliani,eds. êle. J. r thatallowsregularupdatesandthenew ecies combinations. Int. J. Syst. Bacteriol. Bacteriol. Int.J.Syst. combinations. ecies al densities.J.Anim. Sci.61:111 (abs). adherence et facteurs de colonisation des adherence etfacteursde in weanlingpigs. J.Anim. Sci.67:2996- Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED
Lentinus Escherichia coli unocompetence unocompetence of early-weaned pigs. J. phological aspects of the small intestine in phological aspects of the small improves growth response and modulates response and modulates growth improves pharmacological additions of zinc oxide on n oligosaccharide addition at two leels of n oligosaccharide addition at nishing pigs. J. Anim. Sci. 80:2887-2894. Sci. 80:2887-2894. pigs. J. Anim. nishing sulfate on growth performance and Z. de Rodas, K. G. Friesen, D.de Rodas, K. H. Hellwig, Z. G. T. Macfarlane, eds. Boca Raton, FL: CRC G. T. B. Johnson, E. B. KegleyR. A. Dvorak. E. B. and B. Johnson, Miller, and D. F. Mangan. 2003. Host tissues 2003. Mangan. and D. F. Miller, rmentation in the human large intestine and the intestine and in the human large rmentation 183 r sub-clinical salmonella infections. Veterinæn infections. salmonella r sub-clinical Diblikova. 1991. Administration of the probiotics of Administration 1991. Diblikova. k, and K. Molly. 2002. The influence of The influence k, and K. Molly. 2002. ling pigs. J. Anim. Sci. 82:581-587. Sci. 82:581-587. J. Anim. ling pigs. older pigs. Infect. Immun. 58:4030-4035. 58:4030-4035. Immun. pigs. Infect. older . J. Anim. Sci. 82:1882-1891. Sci. 82:1882-1891. . J. Anim. CCM-4160 to sows –its effects on CCM-4160 to piglet efficiency. Vryoba Zivocisna
preparations on bacteriological and mor preparations on bacteriological H. Hellwig and R. A. Dvorak. 2002. Effect of dietary mannan oligosaccharides and (or) Effect of dietaryH. Hellwig and R. A. Dvorak. 2002. mannan pharmacological additions of copper maybeneficial activelymicrobes.respond to ASM News 69:186-191. and R. A. Dvorak. 1999. Efficacy of manna performance supplemental copper on and imm Sci.77(suppl.1):63(abs). Anim. performance and growth of weanling copper sulfate on inmunocompetence growing/fi weanling and of inmunocompetence pigs function of weanling immune in the small intestines of neonatal and characterization activebacteria in nitrite-oxidizing of Nitrospira-like wastewater treatment 67:5273-5284. Microbiol. Environ. plants. Appl. supplementation mannans with phosphorylated information. 17-20 (abs). information. casei Lactobacillus (abs). 36:411-415 89:5685-5689. 89:5685-5689. available substrates.Am.available J. 45:1243S-1255S. Clin. Nutr. piglets. Reprod. Nutr. Dev. 42:S18. 42:S18. piglets. Reprod. Nutr. Dev. growth and inmunocompetence of wean growth and inmunocompetence 2004b. Effect of phosphorylated mannans and mannans 2004b. Effect of phosphorylated edodes physiology and pathology. and G. R. Gibson Press. ahl, J. 1997. Feed related risk factoris fo ahl, J. 1997. Feed Davis, M. E., C. V. Maxwell, E. B. Kegley, B. Davis, M. E., C. V. Maxwell, E. B. B. Kegley, D. Johnson, E. Rodas, Z. B. Brown, B. Z. de Davis, M. E., C. V. Maxwell, D. C. Danek, P., J. Novak, H. Semradova and E. Daims, H., J. L. Nielsen, P. H. Nielsen, K. H. Schleifer, and M. Wagner. 2001. In situ situ In 2001. Wagner. M. and Nielsen, P. H. Nielsen, K. H. Schleifer, Daims, H., J. L. E. Ruby, Darveau, R. P., M. McFall-Ngai, S. Davis, M. E., C. V. Maxwell, G. F. J. Wistuba. 2004a. Dietary Erf, D. C. Brown and T. Decuypere, C. J., N. Van Nevel, K. Dieric Davis, M. E., D. C. Brown, C. V. Maxwell, Z. D. 1992. Archaea in coastal Proc. Natl Acad. Sci. USA. environments. DeLong, E. marine Dean, E. of receptorsA. 1990. Comparison for 987P pili of enterotoxigenic Chapter 11 Chapter Cummings J. H., and H. Fe 1987. N. Englyst. Short chain fatty J. H. 1995. Cummings, In: acids. Human Colonic nutrition, Bacteria.: role in D
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Dove, C.R.1995.Theeffectofcopperlevel Dove, C.R., andK.D.Haydon. 1991. Theeff Dorman H.J.,andS.G.Deans.2000.Antimicr Dunbar, J.,L. O.Ticknor, and C. R.Kuske. Drasar, B.S., andP. A. Barrow. 1985. Intes M.E. 2001.Doyle, Alternativestoantibioticu Sghir, G.Hannequart-Gramet, Doré, J.,A. N.,L. ofthymol, Dubreuil,andM.Pinkas.1994. carvacrol,cinnamaldehyde Didry, Activity Dierick, N. A., I. J. Vervaek A., I.J. Dierick, N. Dvorak, R., and K.A.Jacques. 1998.Manna K. C. Pramanik,andS.K. S. Roy, Rajendran, P. Dutta, K. Chatterjee, Dutta, S.,A. Durst, L., M. Feldner, B.Gedek, andB. Durmic Z.,D.W.Pethick, J.R.Pluske, D.J. Hampson. 1998.Changes inbacterial Duncan, S.H.,H.J.Flint and C.S.Stewart.1998. Inhibitory ofgut activity bacteria against and eugenol on oralbacteria.Pharmaceu 2019. iron levelson theperformance andhaematolog of plantvolatileoils.J.Appl.Microbiol.88:308-316. Microbiology. Washington D. C. FRI Briefings. Anim. Sci.73:166-171. quantitation of human faecalBacteroidespopul evaluation of a16SrRNA-targetedoligonucleotide probeforspecificdetectionand supply.energy Anim. FeedSci.Techol. 23:141-167. energetic importance offibredigestioninpigs Indian J.Med. Microbiol. 50:667-674. enteroinvasive of to conventional techniquesfordiagnosis samples comparison in 2001. SensitivityBhattacharya. and performance sauenfütterng und der Ferkelaufzucht. afterexperimentalof swinedysentery infection. J.Appl.Microbiol. 85:574-582. populations inthecolonofpigsfeddifferent 283-288. Escherichia coli Microbiol. 66:2943-2950. Appl.Environ. terminalsouthwestern U.S.soils restrictionfragmentanalysis. by Carbadox for pigs days 0-21 post-weaning. Escherichia coli Escherichia O157 mediated by dietary plantmetabolites. dietary O157mediated by FEMSMicrobiol.Lett.164: e, D. I. Demeyer, J. A. De J. Demeyer, e, D.I. infectioninchildren withacutediarrhoeainCalcutta, Krauftfutter 9:356-364 (abs). tica ActaHelvetiae.69:25-28 (abs). 184 J.Anim. Sci. 76(Suppl.2) :64(abs). 2000. Assessment of microbial diversity in2000. Assessment two ofmicrobialdiversity se forgrowthpromotion inanimal husbandry. obial agents from plants: antibacterialactivity agents from plants: obial Corthier, and P. Pochart. 1998. Design and Corthier, andP.Pochart.1998. Designand tinal Microbiology In: American Society tinal of Society Microbiology In:American Eckel.1998. Bakterien alsprobiotikum sources of dietary fibre, andthedevelopmentof dietary sources . 1.Importance offermentationintheoverall noligosaccharide, fructooligosaccharide and ect ofcopperaddition to diets with various on nutrientutilizationofweanlingpigs. J. y of weanlingswine.J.Anim.y Sci.69:2013- ations. Appl. Syst. Microbiol. 21:65-71. characteristics of a direct PCR with stool ofadirectPCR characteristics cuypere. 1989.Approachcuypere. tothe Literature cited Literature cited Shigella and
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED von Fumarsäure. Fumarsäure. von β acid on daily weight to early-weanedon performance pigs the rearing of piglets. J. Anim. Physiol. Physiol. the J. Anim. rearing of piglets. e human intestinal microbial flora. Science flora. intestinal e human microbial al flora during the first al flora during the of life: new months gestion of polysaccharides of potato in the the polysaccharides of potato in gestion of in aug tägliache zunahmen, fulteraufnahme,tägliache zunahmen, in aug gestibility. 1. Communication: Investigations 1. Communication: Investigations gestibility. . Physiol. Anim. Nutr. 68:82-92 (abs). Nutr. 68:82-92 Anim. . Physiol. 1992. Effect of formic ctooligosaccharides to Can. J. weanling pigs. metabolism of lipids and sterols. Proceedings Proceedings of lipids and sterols. metabolism I. Gordon. 1998. Creating and maintaining the the Creating and maintaining 1998. I. Gordon. s, and A. D. L. Akkermans. 2002. Molecular s, and A. D. L. Akkermans. 185 J. Clin. Nutr. 45:423-431. 45:423-431. J. Clin. Nutr. Bifidobacterium longum
small intestine of man. Am. small fructooligosaccharides and fructooligosaccharides Ewing and W. N. in nutrition. to microorganisms introduction An The living gut. 45-65 in D. J. A. Cole, eds. Context, Ireland, UK. Feeding Jerusalem artichokein fru flour rich 308:1635-1638. 308:1635-1638. Nutr. 46:S33-S50. starch fractions. Eur. J. Clin. important of nutritionally Sci. 82:607-609. Anim. and fecal bacterial Can. J. populations. of Nutrition Society 32:59-63. gnotobiology. from to know gastrointestinal ecosystem:need what we know and 62:1157-1170. Biol. Rev. Microbiol. Mol. Sci. 72:977-980. Anim. neonates. Appl. Environ. of succession of bacterial in human communities monitoring Microbiol. 68:219-226. Sci. Techol. 23:27-42. Sci. Techol. 23:27-42. Nelson, and D. A. Relman. 2005. Diversity of th 2005. Diversity D. A. Relman. Nelson, and feed conversiongain, feed intake, rate and di efficacyin acids about the nutritive of organic rapidly colonize and modulate healing of gastric ulcers in rats. Am. J. Physiol. 275:425- in rats. Am. healing of gastric ulcers and modulate rapidly colonize 432. Anim. Nutr. 67:198-205. Nutr. 67:198-205. Anim. J. Anim verdaulichkeit. und futterverwertung, Salzsäure Natriumformiat, tylosin and toyocer prospective. Br. J. Nutr. 88 Suppl. 1:S11-S18. 1:S11-S18. Suppl. Nutr. 88 prospective. Br. J. ckburg, P.B., C. N. Bernstein, E. Purdom, L. Dethlefsen, M. Sargent, S. R. Gill, K. E. R. Gill, K. E. S. M. Sargent, L. Dethlefsen, E. Purdom, C. N. Bernstein, ckburg, P.B., alk, P. G., L. V. Hooper, T. Midtvedt, and J. T. Midtvedt, V. Hooper, alk, P. G., L. Eyssen H. 1973. Role of the gut microflora in of the gut microflora Eyssen1973. Role H. Eckel, B., M. Kirckgessner, and F. W. Roth. Eckel, B., M. Kirckgessner, of dietaryEffect of the supplementation Kessel. 2001. Estrada, A., M. D. Drew, and A. van tract. Pages of the gastrointestinal The Ewing, W. N. and D. J. A. Cole. 1994. microbiology F Farnworth, E. R., H. W. Modler, J. D. Jones, N. Cave, H. Yamazaki, and A. V. Rao. 1992. de Vo Favier, C. F., E. E. Vaughan, W. M. Englyst, H. N., S. M. Kingman, H. N., Englyst, and J. H. Cummings. 1992. Classification and measurement Englyst, H. N. 1989. Classification and measurement of plant polysaccharides. Anim. Feedpolysaccharides. Anim. N. 1989. Classification and measurement of plant H. Englyst, Englyst, H. N., and J. H. Cummings. 1987. Di N., and J. H. Cummings. Englyst, H. Edwards C. Intestin A., and A. M. Parret. 2002. A. Buret, Elliot, S. E., W. McKnight, M. J. S. 1998. Bacteria Miller, and J. L. Wallace. Eidelsburger, U., M. Kirchgesner, M., and F. X. Roth. 1992. Zum Einglu M. Kirchgesner,Eidelsburger, U., Zum F. X. Roth. 1992. M., and Chapter 11 Chapter E
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Finlay, B.B.,andP.Cossart.1997. Explo Février, C.,G.Gotterbarm, U.Jaghelin-Peyraud, modifiers fordietary 2002.Useofoligosaccharidesandgut asreplacements Ferket, P.R. Fogel, G.B.,C.R.Collins,J.Li,and Foegeding P.M.,andF. F. Busta.1991. Fioramonti, J., V.Theodorou, and L. Bueno. 2003. Probiotics: what arethey? What aretheir Forstner, J. F., and G. G. Forstner. 1994. Gast Fonti, G.,and P. Gouet. 1989. Fibre-degrading microorganisms inthemonogastric digestive Fons, M., and T.Karjalainene.2000. MechanismsA. Gomez, ofcolonisationand Forsythe, S. J., and D. S. Parker. 1985. Nitr S.J.,andD. Forsythe, Frank, K.1994.Measurestopreservefoodand Franco, L.D.,M.Fondevila, M.B.Loberaand Fraser, D., B. N.Milligan, E. A.Pajor,P. Fraser, D.,B. Franks, A.H.,H.J.M.Harmsen, G.C.Raangs,J.Jansen,F.Shut,and W. Welling. Franklin, M. A., A.G.Mathew, J.R. Vickers, andR.A.Clift. 2002. Characterizationof Publishing, Oxon, UK. 136-138 in Digestive Physiology of Pigs.J.E.LindbergandB.Ogle,eds.CABI weanedpiglet.Pages 2001. Effectsofadding potassium diformateandphytaseexcessfor Microb. Ecol. 38, 93-113. number,copy microbialrDNA estimationof 169-182. antibiotics. Proc. 63rd Minnesota NutritionConference, September 17-18, Eagan, MN,pp Sterilization andPreservation.S.Block, ed.,Lea&Febiger.Philadelphia. effects ongutphysiology? Best Pract.Res.Clin.Gastroenterol.17:711-724. bacterial pathogens.Science276:718-725. tract. Anim.Feed Sci.Techol.23:91-107. colonisation resistance ofthedigestivetract.Microb.Ecol.HealthDis.2:240S-246S. Gastrointestinal Tract.ThirdEdition.L. Gastrointestinal response on digestibility. J.Anim.response ondigestibility. Anim. Physiol. Nutr.89:88-93. contentsandtheir tract microbial ofdigestive species pigdietson inweaned organic acids J. Appl.Bacteriol.58:363-369. rabbit caecum. Behavioural perspectives on weaning in domestic pigs. Pages121-138inon weaning indomestic pigs. Behavioural perspectives : Progress Pig Environ. Microbiol. 64:3336-3345. rRNA-targetedoligonucleotidehybridization withgroup-specific probes.Appl. 16S 1998. Variationsofbacterialpopulationsinhum vs.24days of age.J.Anim.cecum ofpigsweanedat17 80:2904-2910. Sci. microbial populationsandvolatilefatty acid Tierernähr. 22:149-163 F.Brunk, 1999. Prokaryotic genome sizeandSSU R. Johnson, ed. RavenPress.NewYork. Chemical food preservatives. In: Disinfection, 186 ogen metabolism by the microbial flora of the microbialflora ofthe the metabolism by ogen Philips, A. A. Taylor, a Philips, A.Taylor, itation of mammalian host cell functions by hostcellfunctionsby itation of mammalian feeds from bacterial damage. Übersichten zur feeds from damage.Übersichtenzur bacterial relative abundancefromrelative C. Castrillo. 2005. Effect of combinations ofC. Castrillo.2005. Effect ofcombinations Y. Lebreton, F. Legouvec, and A.Aumaitre. concentrations inthe jejunum, ileum, and rointestinal mucus. In:Physiology of the an feces measured by measured by an feces nd D. M. Weary. 1998. nd D.M. Weary. a mixed population. fluorescence insitu Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED , Campylobacter jejuni . J. Food Prot. 65:1545- nce on swine growth. In: Swine nce on swine growth. In: Swine for deliverya probiotic strain to the of ne pathogens in stools. J. Clin.Microbiol. ell. 2002. Bactericidal activities of plantell. 2002. Bactericidal Duplex real-time SYBR green PCR assays real-time SYBR Duplex different dry matter concentrations. J. Sci. concentrations. J. Sci. different dry matter Salmonella enterica ation pattern in intestinal mouse pattern in intestinal mucosa. mouse ation Varley, ed. CAB International, Wallingford, e composition of the commensal flora of the commensal in the e composition aecal flora. J. Appl. Bacteriol. 23:195-205. aecal flora.Bacteriol. 23:195-205. J. Appl. Chadwik, eds. Nottingham UniversityPress, eds. Nottingham Chadwik, ner, E. Crespo and 2001. J-R. Malagelada. Immunology and neonatal mortality. In: The In: The neonatal mortality. and Immunology 187 iggs, R. The Braude, and K. G. Mitchell. 1960. Midtvedt, and G. Trugnan. 2002. Microbial-host Trugnan. 2002. Microbial-host Midtvedt, and G. , and vis. 1992. Novel major archebacterial group from archebacterial group from Novel vis. 1992. major isolated constituents against isolated constituents al bacteria and their influe al bacteria and their influe Listeria monocytogenes , edition. A. J. Lewis and L. Lee Southern, eds. CRC Press, USA. Lewis and L. Lee edition. A. J. nd
nutrition, 2 neonatal pig: development and survival. M. A. and survival. development neonatal pig: UK. Modulation of colonic barrier function byModulation of colonic barrier function th gastrointestinal tract. J. Dairy 82:1379-1387. Sci. Evaluation of cheddar cheese as a food carrier Evaluation rat. Gut 48:503-507. rat. Gut 48:503-507. normal intestinal flora of the pig. IV. The effect normal of dietary supplements of penicillin, chloratetracycline or copper sulphate on the f marine plankton. Nature 356:148-149. for detection of 17 species of food or waterbor for detection of 17 species of food 1560. 1560. 41:5134-5146. essential oils and some of their some essential oils and Escherichia coli interactions specifically control the glycosyl Cell Biol. 118:149-161. Histochemi. Food Agric. 72:17-24. 72:17-24. Food Agric. weaner pigs fed ad libitum with liquid feed at Nutrition 2nd ed. A. J. Lewis and L. Lee Southern, eds. CRC Press. NY. Nutrition 2nd ed. A. J. Lewis and L. Lee Southern, eds. Science, J. Science, Varley,Wiseman, M. A. P. and Nottingham, UK. Nottingham, mode of action. Anim. Biotechnol. 13:29-42. Biotechnol. 13:29-42. of action. Anim. mode Acta Vet. Hung. 38:3-17. Acta Vet. Hung. 38:3-17. alfi, P., and J. Bokori. 1990. Feeding trial in pigs with a diet containing sodium n-butyrate. sodium with a diet containing trial in pigs Feeding 1990. J. Bokori. alfi, P., and Gaskins, H. R. 2001. Intestin Gaskins, H. R. and K. W. Kelley.1995. Gaskins, H. R. and K. Gardiner, G., C. Stanton, P. B. Lynch, J. K. Collins, G. Fitzgerald, and R. P. Ross. 1999. Ross. 1999. G. Fitzgerald, and R. P. J. K. Collins, P. B. Lynch, Gardiner, G., C. Stanton, García-Lafuente, A., M. Antolín, F. Guar García-Lafuente, A., M. Antolín, G Furham, J. A., K. McCallum,Furham, and A. A. Da Fukushima, H., Y. Tsunomori, and R. H., Y. Tsunomori, Seki. 2003. Fukushima, 18:385. Rev. Nutr. Ann. in the gut. cycling Nitrogen and P. J. Reeds. 1998. Fuller, M. F., A. E. Br Fuller, R., L. G. M. Newland, C. Friedman, M., P. R. Henika, and R. E. Mandr and R. Henika, M., P. R. Friedman, Geary, T. M., P. H. Brooks, T. Morgan, A. Campbell, and P. J. Russel. 1996. Performance of and P. J. Russel. 1996. Performance A. Campbell, Geary, T. Morgan, T. M., P. H. Brooks, Freitas, M., L. G. Axelsson, C. Cayuela,Freitas, M., L. G. T. Gaskins, H. R. 2003. Intestin Gaskins, H. R., C. T. Collier and D. B. Anderson. 2002. Antibiotics as growth promotants: as growth promotants: Antibiotics and D. B. Anderson. 2002. Gaskins, H. R., C. T. Collier Chapter 11 Chapter
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED GrahamK. Hesselman,P. Aman.1986. H., Th Sabour, R.Wheatcroft,Gong, J.,R.J.Forster,H.Yu,Chambers, S.Chen.2003. P.M. Gokarn, R.R.,M.A.Eitnan, S.A.Martin, andK.E. Eriksson. 1997. Production ofsuccinate andK.H. K.Trebesius, R.Psenner, J.Pernthaler, A. Alfreider, Glöckner, F.O.,R.Amann, Gleed P.T., and B.F.Sansom. 1982. Ingestion of iron inpiglets sow'sfaeces by rearedin Giovanonni, S. J.,E.F. DeLong, G. J. Olson, B. Roberfroid.1995. R., andM. Gibson, G. Gianella, R.A.1983. Gedek B., M. Kirchgessner, S. Wiehler, A. Bo Gedek B.,M.Kirchgessner,S.Wiehler, S.Wi Gedek B,F.X.Roth,M. Kirchgessner, Griffiths, E., and R.S.Gupta. 2001. The useofsignature sequencesindifferentproteinsto ofdietsGrela, E.R.,R.Krusinska,andJ.Matras.1998.Efficacy withantibiotic andherb Gherna, R., and C. R. Woese. 1992.Apartial and C.R.Woese. Gherna, R., 68:69-80. Fibrobacter succinogenes from cellobiose,andvariouscellulosic glucose, 521. Bacteroides” phylum: basisfortaxonomic Appl. restructuring.Syst. Microbiol. 15:513- division. Microbiol. 147:2611-2622. diverged ata similar time toChlamydia Fibrobacter branchingorder relative divisions:evidence that ofbacterial determine the comparison with bacteria in thececallumen.FEMSMicrobiol.Lett. withbacteria comparison 208:1-7 and ceca mucosa ofchicken the in of bacteria analysis andphylogenetic Diversity planctonic bacteria. Appl. Microbiol. Syst. 19:403-406. Schleifer. 1996.Aninsitu hybridization pr farrowing crateswithslottedfloors.Br.J. Nutr.47:113-117. Bacteriol. 170:720-726. microbialspecific oligodeosynucleotideJ. probesforidentificationof single cells. microbiota: introducing the conceptofprebiotics.J.Nutr.125:1401-1412. Food Nutr.effects. Proc.Sci. 7:147-153. acids inpigletrearing.J.Anim. Physiol. Anim. Nutr.68:209-217. microflora indifferentsegmentsofthegastro Influence offumaricacid,hydrochloric acid, mixture additivesinfeedingofgrowing-finishing pigs. J.Anim. FeedScience7:171-175. on thedigestibility components of pigdiet. dietary J. Nutr.116:242-251. inacereal-based microflora. ArchTierernahr.44:215-226 (abs). ofgastrointestinalandfecal composition andresistancedetermination microbial count, nutritive effectof Bacillus cereus Escherichia coli and Ruminococcus flavefaciens asaprobioticin theraisingofpiglets.2. Effectand best stableenterotoxin: 188 and theCytophaga-Flavobacterium-Bacteroides tt, U.Eidelsburger,andF.X.Roth.1993.The e infuence ofwheatbranand sugar-beetpulp andN.R.Pace.1988.Phylogeneticgroup- intestinal tract.14.Nutritivevalue oforganic sodium andtoyocerinformate, tylosin onthe ehler, A.Bott,andU.Eidelsburger.1992. Dietary modulationDietary ofthehumancolonic otocol fordetectionandidentification of phylogenetic analysis ofthe“Flavobacter- analysis phylogenetic materials by the ruminal anaerobic bacteria bacteria the ruminalanaerobic by materials . Appl.Biochem. Biotechnol. Biochemical physiological and Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED ID on the nd disease. Lancet Lancet 361:512-569. nd disease. Clostridium butyricum the faeces and intestinal contents of the the faeces and intestinal contents of the bifidobacteria in human fecal samples. fecal samples. in human bifidobacteria it lymphocyte-dependent activation of it lymphocyte-dependent in the piglet small intestine after weaning. the piglet in on of viable cell counts and fluorescence inviable cell counts and fluorescence on of obial agents against bloodstream isolates of in germfree rats. N. Y. Acad. Sci. Ann. in ffect of fumaric acid and sodium fumarate sodium acid and ffect of fumaric rg. 1970. Effects of microbial contamination microbial Effects of contamination rg. 1970. bean meal diets for growing pigs may replace on amino acid digestibility fatty and volatile on amino nd C. Rotstein. 2000. Comparative in vitro in vitro Comparative Rotstein. 2000. nd C. thick. 2001. Dietary manipulation of enteric of enteric Dietary manipulation 2001. thick. G. C. Raangs, A. Wildeboer-Veloo, M. B. and plasma zinc responses of young pigs fed young zinc responses of and plasma livestock industry: what have we learned? 2002. what have we learned? 2002. livestock industry: 189 1999. Antimicrobial activity1999. Antimicrobial of essential oils and m, P. K. Jung, and J. C. Lee. 1984. Studies on the and J. C. Lee. 1984. Studies on the P. K. Jung, m, bacteria. Microbiol. Immunol. 46:195-205. 46:195-205. bacteria. Microbiol. Immunol. ents. Chemother. 44:802-805. Chemother. ents. J. Anim. Sci. 71:3020-3024. Sci. 71:3020-3024. J. Anim. da. 2003. Gut flora in health a health Gut flora in da. 2003.
78:166-173. 78:166-173. on the cecum enlargement of germ-free on the cecum rats. Scand. J Gastroenterol. 5:309-314. pharmacologic levels of zinc. microbial phytase, and citric acid to corn-soy inorganic phosphorus supplementation. J. Anim. Sci. 76:2649-2656. Sci. 76:2649-2656. J. Anim. supplementation. inorganic phosphorus disease. Pig News Inform. 22:21-28. Appl. Environ. Microbiol. 70:4165-4169. 70:4165-4169. Microbiol. Appl. Environ. intestinal epithelial cells by commensal quantitative PCR procedure for quantification of quantification PCR procedure for quantitative inhib CD14low monocytes IL-10 producing supplementation to diets for weanling supplementation to pigs Sci. Technol. 53:243-254. Feed inileal digesta. Anim. acid concentrations Res.Vet. Sci. 40:313-317. Res.Vet. Sci. 40:313-317. Roberfroid and G. W. Welling. 1999. Comparis Roberfroid and G. W. Welling. growth promoting effects II. The effect of of probiotics flora of performance and changes in the microbial Sci. 26:159-165. broiler chicks. Korean J. Anim. Anim. Biotechnol. 13:129-147. 13:129-147. Biotechnol. Anim. other plant extracts. J. Appl. Microbiol. 86:985-990. 86:985-990. J. Appl. Microbiol. other plant extracts. activities of ciprofloxacin, gemifloxacin, grepafloxacin, moxifloxacin, ofloxacin, activities of ciprofloxacin, gemifloxacin, moxifloxacin, grepafloxacin, and other antimicr sparfloxacin, trovafloxacin, cocci. Antimicrob. Ag gram-positive ahn, J. D., and D. H. Baker. 1993. Growth ahn, J. D., and D. H. Baker. 1993. Gustaffson, B. E., T. Midvedt, and K. Strandbe Gustaffson, B. E., H Han, Y. M., K. R. Roneker, W. G. Pond, and X. G. Lei. 1998. Adding wheat middlings, Adding wheat Han, Y. M., K. R. Roneker, W. G. Pond, and X. G. Lei. 1998. middlings, Hardy, B. The issue of antibiotic use in the Han, I. K., S. C. Lee, J. H. Lee, J. D. Ki Gubert, V. Gubert, V. e Sauer. 1995. The M., and W. C. K deficiency Vitamin 1959. Gustaffson, B. E. Gueimonde, M., S. Tölkkö, T. Korpimäki, and S. Salminen. 2004. New real-time M., S. Tölkkö, New real-time and S. Salminen. 2004. T. Korpimäki, Gueimonde, Haller D., P. Serrant, G. Peruisseau, C. Bode, W. P. Hammes, E. 2002 Schiffrin and S. Blum. Hammer, K. A. , C. F. Carson, T. V. Riley. Hardy, D., D. Amsterdam, L. A. Mandell, a Hardy,D. Amsterdam, D., Hampson D. J. 1986. Attempts to modify changes to modify Attempts J. 1986. D. Hampson and D. W. Pe D. J., J. R. Pluske Hampson, Chapter 11 Chapter F., and J-R. Malagela Guarner, Harmsen, H. J., G. R. Gibson, P. Elfferich,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Hill, G.M., G. L.Cromwell, T.D.Crenshaw, C. Hill, M.J.1997.Intestinal floraand endogeno Hill J. E., S. M. Hemmingsen, B. G. Goldade, T. Hill J.E.,S.M.Hemmingsen,B.G.Goldade,
Hill, G. M., G. L. Cromwell, T.D.Crenshaw,R. G. L.Cromwell, Hill, G.M., Held, S.,and M.Mendl. 2001. Behaviour of the young weanedpig. In:The weanerpig: Harmsen, H.J.M.,G.C. Raangs, T.He,J. andG.W. J. M.,A.C.Wildeboer-Veloo, J.Grijpstra,Knol,E.Degener H. Harmsen, Harmsen, H.J.,A.C.M. Wildeboer-Veloo, H. Hebeler, S.D.,Kulla, F. Winkenwerder, J. Havenaar, R.,andM. J.H. Huis In’t Veld.1992. Hein, I.,A.Lehner,P.Rieck,K.Klein,E.Brandl, andM.Wagner, 2001. ofComparison USA. and nutrition andmanagement.M.A.Varley Hannover 54th Proc.Soc. Nutr. Physio 6:S43-S45. Environ. Microbiol. 71:867-875. chaperoni dietsby wheat-, orbarley-based S. H.Goh, ofileumA. G.VanKessel.2005.Comparison microflora ofpigs fedcorn-, zinc andcopper toweanlingpigs(re Growth promotioneffectsandplasma changes Lewis, G.W.Libal,D.C. Mahan, G.C.Shurson, L. L. Southern, and T.L.Veum. 2000. intakes ofzincand/orcopper onperformance Mahan, G.C.Shurson,L. L. Southern, a 67:3122-3126. and applicationof this technique for exam Microbiol. 66:4523-4527. volunteers of differentagegroups.Appl.Environ. Coriobacteriaceae inhumanfecesfrom group and theAtopobium clusterandthei Welling GW.2000b.Developmen Gastroenterol. Nutr.30:61-67. and formula-fed sing molecular infantsby iden bacterial. FEMSMicrobiol. Lett.183:125-129. usingspecificrRNA-based situ hybridization Bindels, and G. W. Welling. 2000a. Analysis of 2000a.Analysis G. W.Welling. Bindels, and Bacteria inhealthanddisease.Vol.1.Elsev Bacteria 68:2982-2990. probes fordetectionin set of16SrRNA-based different approaches to quantify different approachestoquantify Staphylococcus aureus t of 16S rRNA-based probes for the Coriobacterium t of 16S rRNA-basedprobesfortheCoriobacterium gional JAnim. study). Sci.78:1010-1016. l. 7-3-2000. Gottingen, Germany. nd T.L.Veum. 1996.Impactofpharmacological E. Degener,andG. W. Welling. 2002. Extensive 190 Kamphues, J.Zentek, andG. Amtsberg. 2000. ier Applied SciencePublishers,Amsterdam.ier Applied n-60 sequencingandquantitative PCR.Appl. ination of cheese. Appl. Environ.Microbiol. ination ofcheese.Appl. of weanlingpigs. J.Anim. Sci.74:181(abs.). C. Raangs, A.Wagendorp, N. Klijn,J.G. Probiotics : ageneralview.In : Lactic Acid robes for the quantification of human fecal robes forthequantificationofhumanfecal from concentrationsfeeding high of dietary J. Dumonceaux, J. Klassen, R. T. Zijlstra, R. T.Zijlstra, J.Dumonceaux, J.Klassen, tification anddetectionmethods.J.Pediatr. C. Ewan, D. A.Knabe, C. A. J.Lewis,D. C. us vitamin synthesis. Eur.J. Cancer Prev. us vitamin Eur.J.CancerPrev. synthesis. R.Dove,C. Ewan, D.A. Knabe, A. J. intestinal flora development in breast-fed breast-fed in intestinalfloradevelopment human feces.Appl.Environ. Microbiol. J. Wiseman,eds.CABIPublishing,NY, r applicationforenumerationof cells by real-time cellsby quantitativePCR Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED Thermus their alternatives in their alternatives in in vitro continuous continuous vitro in in diarrhea in pigs after E. coli Escherichia coliEscherichia populations in growing pigs. Acta Vet.growing pigs. populations in al host bacterial relationships in the gut. al host bacterial relationships in the gut. groups of butyrate-producing bacteria in e use of antibiotics and e use of antibiotics denaturation by chain polymerase reaction- for pigs- Garlic II. 2000 ISU Swine Research Use of nucleopore filters for counting bacteria for counting nucleopore filters Use of fluorescence resonance energytransfer. Anal ecent Advances in Animal Nutrition. P. C. ecent Advances Wallgren. 2004. Influence of cereal non-starch 2004. Influence Wallgren. g. 1998. Botanicals for pigs- Garlic. 1998 ISU Botanicals for pigs- Garlic. 1998 g. 1998. 191 estinal ecosystem. BioEssays 20:336-343. spp. on the survival of enterotoxigenic enterotoxigenic of survival the spp. on
DNA polymerase. Proceedings of the National Academy of Sciences USA mammalian int intestine: exploiring an Molecular analysis commensal of host-microbial relationships in the intestine. Science 291:881-884. probes that detect quantitatively significant Science 1115-1118 of dieary oxide and copper sulphate on the gastrointestinal ecosystem zinc in newly 71:2267-2277. Microbiol. weaned piglets. Appl. Environ. exonuclease activity5´-3´ of utilizing the chain reaction product by polymerase 88:7276-7280. polysaccharides rectal on ileo-caecal and microbial Scand.45:87-98. feces.69:4320-4324. human Microbiol. Appl. Environ. Swine Research Report. Iowa State University, USA. Ames, Report. Iowa State University, Ames, USA. aquaticus driven fluorescent label incorporation and label incorporation driven fluorescent 221:306-11. Biochem. the feed of non-ruminant animals. In: R animals. non-ruminant the feed of UniversityGarnsworthyand J. Wiseman, eds. Notthingam Press, Notthingam. weaning. Compend. Contin. Edu. Pract. Vet. 18:26-29. Pract. Vet. 18:26-29. Edu. Contin. weaning. Compend. by fluorescence microscopy. Appl. Environ. Microbiol. 33:1225-1228. 33:1225-1228. by Microbiol. fluorescence Appl. Environ. microscopy. Lactobacillus culture of porcine intestinal bacteria. Lett. Appl. Microbiol. 20:130-133. 20:130-133. Appl. Microbiol. intestinal bacteria. Lett. culture of porcine Hooper, L. V., and J. I. Gordon. 2001. Commens Hooper, L. V., and J. I. Gordon. 2001. Hooper, L. V., L. Bry, P. G. Falk, and J. I. Gordon. 1998. Host-microbial symbiosis in the Host-microbial symbiosis 1998. J. I. Gordon. G. Falk, and Hooper, L. V., L. Bry, P. L. Hansson, P. G. Falk, and J. I. Gordon. 2001. Hooper, L. V., M. H. Wong, A. Thelin, Hold, G. L., A. Schwiertz, R. I. Aminov, M. Blaut, and H. Flint. 2003. Oligonucleotide 2003. M. Blaut, and H. Flint. Hold, G. L., A. Schwiertz, R. I. Aminov, A., and H. D. Poulsen. 1996. Zinc oxide in treating Holm, Högberg, A., J. E. Lindberg, T. Leser and P. E. Lindberg, J. Högberg, A., M. S. Hedemann, and B. B. Jensen. 2005. Influence Höjberg, O., N. Canibe, H. D. Poulsen, Holden, P. J., J. McDean, and E. Franzenbur Botanicals and J. McKean. 2000. Holden, P. J., 1991. Detection of specific R. Watson, D. H. Gelwand. M., R. D. Abramson, Holland, P. Hobbie, J. E., R. J. Daley and S. Jasper. 1977. Hobbie, J. E., R. J. Hiyoshi 1994. Assay M, and S. Hosoi. of DNA Chapter 11 Chapter effect of The of Stewart. 1995. and C. S. K., mixtures A. Murdoch, R. J. Spencer, T. Hillman Hillman, K. aspects of th Bacteriological 2001. Hillman,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Huseby, E., Huseby, P. M.Hellstrom, andT.Midtvedt. 1994.microflora Intestinal stimulates R.Havenaar J. and Huis in’tVeld,J.H. C. M.J.E. Meuwissen, S. G.M. K. Linskens,M.Mak, X. W.,R. Huijsdens, Hozapfel, W.H.,P.Haberer,R.Geisen,J. Houdijk, J.G. M.,M.W. Bosch, M.W.A.Verstegen,and H.J. Berenpas. 1998.Effectsof Horton, G. M. J.,D.B.Blethen,andPrasad. 1991. The effectofgarlic( Houdijk, J.G. M.,R.Hartemink, K.M.J.VanLaere,B.A.Williams,W.Bosch, MucinglycoproteinHoskins, L.C.,E.T.Boulding,and degradation A. Gerken.1992. by E. T.Boulding,M.Driaris,andG. Hoskins, L.C.,M.Agustines,W.B.McKee, Hopwood, D. E., D. W. Pethick, andD.J.Hampson. oftheHopwood, D.E.,W.Pethick, 2002.Increasingtheviscosity Hopwood, D. E.andD.J.Hampson. 2003.Inte contributions Hooper, L.V.2004.Bacterial 953. 1985. MucinNiedermeyer. degradationin human J.Clin.Invest.75:944- colonecosystems. propagation of migrating Dig.Dis.Sci.39:946-956.myoelectric complexes. promoting initiationandaboral ofratwall by cyclic activity intestinal myoelectric eds. TheNetherlands. W. Mulder, R.W.A. H.Hintonand F. Jensen,M. J. meat processing. andpoultry poultry probiotic use.InPreventionandcontrol of PCR. J.Clin.Microbiol.40:4423-4427. real-time of gastrointestinalmucosaby P.H.M.Savelkoul. Vandenbroucke-Grauls, and 73(suppl):365-373. and important featuresofprobioticmicroorga growing pigs. Anim. FeedSci.Technol. 71:35-48. of onthe young oligosaccharides growth performance andfaecalcharacteristics dietary Non-digestible Oligosaccharides “Healthy Food “Healthy Non-digestible Oligosaccharides pigs’ diets. In:Pr oligosaccharides inweaner andS. A. Verstegen, Tamminga.1997. Dis. 5:193-207. mucin oligosaccharide strainsofhu degrading blood parametersinsheepandswine.Can.J.Anim.Sci. 71:607 (abs). sativum Brachyspira pilosicoli intestinal contents stimulates proliferation ofenterotoxigenic proliferation stimulates intestinal contents period. In:Weaningthepig.Conceptsandcon diet anddiarrhoea,theirinfluenceson M. W.A.Verstegen,eds.Wageningen Microbiol. 12:21-28. ) on feed palatability of horses and feed consumption, selected performance and and feedconsumption, selectedperformance of horses ) onfeedpalatability in weaner pigs.Br.J.Nutr.88:523-532. Academic Publishers, TheNetherlands. Academic Publishers, . 1993. Selection criteria for microorganisms. 1993.Selectioncriteriafor for Bjorkroth, andU.Schillinger. 2001. Taxonomy 192 piglet health in the immediate post-weaning piglet health post-weaning intheimmediate oceedings of the International Symposium of oceedings oftheInternationalSymposium of nisms infoodandnutrition.Am.J Clin.Nutr. to mammalian gut development. Trends gut development. to mammalian Trends potentially pathogenic potentially microorganisms in man fecal bacteria. Microb.Ecol.man Health. fecal bacteria. Fructooligosaccharides andtransgalacto- sequences. J.R.Pluske,LeDividichand ractions between the intestinal microflora,the intestinal ractions between for the Colon”? Wageningen, Nederlands. Wageningen,Nederlands. Colon”? for the 2002. Quantificationofbacteriaadherent Escherichia coli Escherichia Literature cited Literature cited Allium and and
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED O157:H7 in O157:H7 adhesin binding adhesin binding E. coli Mattila-Sandholm, and K. Mattila-Sandholm, Helicobacter pylori n oligosaccharide. J. Sci.n oligosaccharide. Food Agric. Pigs. Piva, A., Bach Knudsen, K. E. and position in back fat. In: Skatole and Boar n hydrolysates as selective n hydrolysates substrates for event intestinal disease. In: 9th International D. Kersulyte,E. Berg, A. E. T. Incecik, D. Wiseman, eds. Nottingham University Press, Wiseman, eds. Nottingham Ushida. 2005. Development of the intestinal of Ushida. 2005. Development on to skatole deposition in backfat. Anim. Sci. backfat. Anim. deposition in on to skatole 1. Intestinal structure and function of broiler and function of broiler structure 1. Intestinal L. L. Mikkelsen, M. T. Jensen and A. Laue. 193 vealed by retagging. Science 279:373-377. 279:373-377. Science vealed by retagging. Jousimies-Somer, T. Jousimies-Somer, acteria. J. Microbiol. Methods 37:215-221. 37:215-221. acteria. J. Microbiol. Methods strains. Appl. Environ. Microbiol. Biotechnol. 49:175- Biotechnol. Microbiol. Environ. strains. Appl. 2003. Detection and quantification of and quantification 2003. Detection . 1994. Effect of dietary activity and on microbial fibre Meat Research Institute, Roskilde. Lactobacillus and
Symposium onPigs, Alberta, Canada. of Symposium Digestive Physiology Enhancing intestinal function to threat and pr to threat function Enhancing intestinal taint. W. K. Jensen, ed. Danish taint. W. K. Jensen, University eds. Nottingham Press, United Kingdom. Lindberg J. E., in Anim. Nutrition. P. C. Garnsworthyand J. Nutrition. P. C. in Anim. in the gut. In: Gut Environment of fermentation 1998. Effect of liquid feed on microbial production of skatole in the hind gut, skatole of skatole in the hind gut, Effect production 1998. of liquid feed on microbial absorption to portal vein blood and skatole de UK. Nottingham, young pigs. J. Anim. Feed Sci. Technol. 89:175-188. 89:175-188. Feed Sci. Technol. J. Anim. pigs. young 61:293-304. 61:293-304. gut of pigs given different diets and its relati diets different given pigs gut of 181. of pigs. Appl. gastrointestinal tract of the in various regions microbial gas production 60:1897-1904. Microbiol. Environ. Covacci, L. 1998. Engstrand, and T. Boren. re antigens group fucosylated histo-blood Bifidobacterium chickens on diets supplemented with supplemented chickens on diets a manna 81:1138-1192. beta-glucan and xyla Oat Poutanen. 1998. environmental samples by real-time PCR. J. Appl. Microbiol. 94:421-431. 94:421-431. by Microbiol. PCR. J. Appl. real-time samples environmental microbiota in the piglet. J. Gen. Appl. Microbiol. 51:257-265. 51:257-265. Microbiol. Gen. Appl. piglet. J. microbiota in the andan automated, of validation microscopy-based1999. Development for method b of intestinal enumeration of groups ansen, G. J., A. C. M. Wildeboer-Veloo, R. H. J. Tonk, A. H. Franks, and G. W. Welling. R. H. J. Tonk, A. H. Franks, ansen, G. J., A. C. M. Wildeboer-Veloo, bevkwe, A. bevkwe, M., and C. M. Grieve. Jensen, B. Mikkelsen, M. S. Hedemann, and N. Canibe. 2003. B., O.Höjberg, L. L. Jensen, B. B., and L. L. Mikkelsen. 1999. Feeding liquid diets to pigs. In: Recent Advances Jensen, B. B., to diets and L. L. Mikkelsen. 1999. Feeding liquid products from microbial of and amount ways type Jensen, B. B. of Possible 2001. modifying Jensen, B. B., N. Agergaard, L. L. Hansen, Jensen, B. B. 1998. The impact of feed additives on the microbial ecology of feed additives on the Jensen, B. of the gut inmicrobial B. 1998. The impact Jensen, B. B. and H. Jorgensen of skatole in the hind Jensen, M.T., R. P. Cox and Microbial production B. B. Jensen. 1995. Ilver, D., A. Arnqvist, J. Pgren, I. M. Frick, Pgren, I. M. Arnqvist, J. Ilver, D., A. Chapter 11 Chapter I Saki, andIji, P. A., A. A. D. R. Tivey. 200 Inoue, R., T. Tsukahara, N. Nakanishi, and K. Tsukahara, Inoue, R., T. J Jaskari, J., P.H. Kontula, A. Siitonen,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Jürgens, K.,J. Pernthaler, S. Schalla,and Johnson, R. 1992. Role of acidifiers andenzymes inassuringperformanceand health ofpigs M.,L.Melin, R.Lindberg,A. Jensen-Waern S.E.Jorsal.2000.Scanning electron T.D.Leser,and M. Boye, K., K.Moller, Jensen, T. Katouli M.,A.Lund,P. Wallgren, I.Kuhn,O. K Katouli M.,A.LundA,P.Wallgren,I.Kuhn,O.Soderlind, and 1995.R. Mollby. Phenotypic A. 1989.AnimalKarlsson, K. glycosphingolipid R.W. Hutkins.2000. Kaplan, H.,and Fermen Katouli, M., P.Wa L. Melin,M.Jensen-Waern, Kelly, D. and T. P. King. 1994. Luminal D.andT.P.King. bacter Kelly, Kelly, D., Kelly, and T. P. King. 1991. The influenceoflactationproductson the temporal Kaufmann andP.J.Rousseeuw.1990.Finding L. aplan, C. W., J.C.Astaire,M.E.Sande aplan, C. fattening periods. Appl.Environ. Microbiol. 61:778-783. characterization ofintestinal characterization analysis. John Wiley &Sons.NewYork. JohnWiley analysis. symposium, Alltech Technical Publications,Nicholasville,KY(abs). symposium,Alltech Technical in Proc.post-weaning. InBiotechnology the Feedindustry. Alltech’s8thannual morphology, neutrophil functionsandfaecal zinc1998. oxide Dietary in weanedpigs-e pilosicoli infection in growing pigs. Vet.Pathol.37:22-32. andfluorescentinsituhybridizati microscopy Appl. Environ. Microbiol. 65:1241-1250. community planktonic bacterial changes ina Ann. Rev.Biochem. 58:309-350. bacteria andbifidobacteria.Appl.Environ. Microbiol. 66:2682-2684. 1939. fed ofrats feces restriction fragmentpa ribosomalDNA terminal weaning periods.J.Appl. Microbiol. 83:147-154. fingerprinting andfermentative of theintestinal capacity flora ofpigs during pre- and post- histochemical andimmunohistochemical sucklingpigs:lectin expression ofhisto-bloodgroupantigensinthe intestinesof composition of coliforms inweanedpigs. J.Appl.Microbiol. 87:564-573. ofth onthestability zinc oxidesupplementation Nottingham University Press,Nottingham UK. University In: GutEnvironmentpigs. A.Piva, K.E.BachKnudsen,andJ.Lindberg,eds. of Lactobacillus acidophilus Escherichia coli Escherichia R. Amann. 1999.Morphological and compositional analysis. Histochem. analysis. J.23:55-60 194 rs, B. S., Reddy, andC.L.Kitts.2001. 16S S., Reddy, rs, B. NCFM.Appl.Environ. Microbiol. 67:1935- microflora. Res. Vet. Sci.64:225-231. Res.Vet. microflora. tation of fructooligosaccharides by lacticacid by offructooligosaccharides tation ffects on performance, tissueconcentrations, ffects on Johannisson, L. Petersson, andP.Wallgren Soderlind, and 1997.R. Mollby. Metabolic ia: regulationofgut s as membranesites forbacteria. s as attachment in responsetoenhancedprotozoangrazing. ofpigs duringsuckling, postweaning, and on of experimental Brachyspira (Serpulina) (Serpulina) Brachyspira on ofexperimental llgren andR. Möllby. 1999. The effectof groups indata.Anintroduction tocluster e intestinal flora with special reference to reference with special e intestinalflora ttern analysis of ttern analysis bacterial communities in function andimmunity. Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED tive interaction with Proceedings of the Nutrition intestinal bacterial species by terminal Curr.2:17-25. Issues Intest. Microbiol. ll intestinal enterocytes. Immun. Infect. Maintanance in vitro of the microflora and in vitro of the Maintanance 8th Digestive Physiology of Pigs, Alberta, Alberta, of Pigs, 8th Digestive Physiology t patterns: a tool for comparing microbial microbial t patterns: a tool for comparing nd B. Gedek. 1993. The nutritive efficiencyB. Gedek. 1993. nd rrier function: coopera rrier function: h-Devaney, and D. K. Podolski. 1995. Trefoil Trefoil 1995. Podolski. K. h-Devaney, and D. Nutritional influences on interactions influences on Nutritional between rapid, PCR based method. Mol. Cell. Probes rapid, PCR based Cell. method. Mol. e. Pig News and Information 19:111N-114N. 19:111N-114N. e. Pig News and Information 1987. Identification of a new fimbrial structure 195 e dysentery.Swine Health8:73-76. Prod. onment. Arch. Tierernahr. 44:111 (abs). Arch. Tierernahr. 44:111 onment. cosa. Nutr. Res. Rev. 7:233-257. Res. Rev. 7:233-257. cosa. Nutr. (ETEC) serotypes 0148:HL 28 which adheres to human ng porcine small intestine. porcine small ng ds Immunol. 26:326-333. ds Immunol. 26:326-333. Escherichia coli
of Bacillus cereus as a probiotic in the raising of piglets. 1. Effect on the growth the raising of piglets. of Bacillus cereus as a probiotic in andparameters envir gastrointestinal influence the clinical expression of swin in enterotoxigenic in enterotoxigenic glycoconugates in the developi Biomedical perspectives. UK. A. Putzai, and S. Bardozc, eds. Taylor and Francis, London, peptide protection of intestinal epithelial ba intestinal of peptide protection 109:516-523. Gastroenterology glycoprotein. mucin Society 52:195. immune modulation. Tren modulation. immune Weaner Pig. Nutrition and Management. M. A. Varley and Management. M. A. Weaner Pig. Nutrition J. Wiseman, eds. CABI and U.K. Publishing, bacteria and the small intestinal mu the small bacteria and communities and assessing community dynamics. Identification of predominant human andIdentification of predominant animal Kelly, of oligosaccharides in weanling pig diets on and M. W. A. Verstegen. 2003. Effects health. intestinal andperformance, microflora enterotoxigenic Escherichia coli to human sma restriction fragments patterns (TRFPs): a restriction fragments 15:349-355. Canada. 48:824-831. fermentation patterns of the porcine intestin of the patterns fermentation Kirkwood, R. N., S. X. Huang, M. McFall, and R. X. Aheren. 2000. Dietaryfactors do not Kirchgessner, R. X. Roth, U. Eidelsburger a M., King, T. P., R. Begbie, R. Spencer and D. Kelly. 1993. Diversity of membrane sialo- of membrane Diversity 1993. R. Spencer and D. Kelly. R. Begbie, P., King, T. Lectins: In epithelial cell biology. and intestinal cytochemistry Lectin 1995. P. King, T. Kelly, D., S. Conway, and R. Aminov. 2005. Commensal gut bacteria mechanisms of Commensal 2005. gut bacteria Kelly, Conway,mechanisms R. Aminov. D., S. and A. Reid, and K. Hillman, 1998. C. Khaddour, R., Kelly, D., and T. P. King. 2001. Digestive physiology and development in pigs. In The The In pigs. in development Digestive physiology and 2001. King. T. P. Kelly, and D., restriction fragmen Kitts, C. L. 2001. Terminal Khan, A. A., M. S. Nawaz, L. Robertson, S. A. Khan, and C. E. Cerniglia. 2001. C. E. Cerniglia. 2001. A. Khan, and S. Nawaz, L. Robertson, S. Khan, A. A., M. K. Lync L. Thim, Pothoulakis, C. Kindon, H., Klein Gebbink, G. A. R., A. L. Sutton, B. A. Williams, J. A. Patterson, B. T. Richert, D. T. D. R. Lloyd,Adhesion of Knutton, S., D. C. A. Candy, A. S. McNeish. 1985. and D. R. Lloyd,and A. S. McNeish. Knutton, S., Chapter 11 Chapter Kelly, 1994. and T. P. King. D., R. Begbie,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED
Konstantinov, S. R., A. Awati, H. Smidt, B.A. Konstantinov, S.R.,A.Awati,H.Smidt, Konstantinov, S.R.,C.F. Favier, W.Y.Zhu,B.A. Williams,Klub, W.B. Souggrant, J. W. Konstantinov, S.R.,W.Y.Zhu,B.A.Williams,Tamminga,W. M.deVos,andA.D.L. S. Kopp E.B.,andR.Medzhitov.1999.The Kotarski S. F., and D. C. Savage. 1979. M C. Savage.1979. F., andD. Kotarski S. Krogfelt K. A., L. K. Poulsen, and S. Molin. 1993. andS. Identificationofcoccoid A., L.K.Poulsen, Krogfelt K. D. O.,R.A.Easter,B.White,and Krause, and W.Zollitsch.1994. Kowarz, M.,F.Lettner, L S. J.VlemmKyriakis, C., V.K.Tsiloyiannis, major stress S.C.1989.Newaspectsofthepreventionand/ortreatment Kyriakis, ofthe Kumprecht, I.,andP.Zobac.1998.Theroleof Kühn, I.,M. Katouli,L.Melin,A.Lund,P. ane, D. J. 1991. 16S/23Sane, D.J. rRNAsequencing. In:acid techniquesinbacterial Nucleic 73:2347-2354. the ecology of adherentlactobacilli inthegastro induced diseases of the early weanedpiglet.PigNewsandInformation 2:177-181.induced diseasesoftheearly Vos. 2004b. ofa novelSpecific response andabundant porcine gastrointestinalecosystem duringweaningtransition. Anim.Res. 53:317-324. A. D.L.Akkermansand H.Smidt.M. DeVos, studies 2004a.Microbial onthe diversity ribosomal DNA.FEMSMicrobiol.Ecol. 43:225-235. denaturing of16S gradient communities asrevealedby gel electrophoresisanalysis Akkermans. 2003.Effect offermentablecar 55:86-92. newhuman colonizationfactor.Infect.Immun. mucosa: ETEC intestinal apotentially 70:3821-3830. phylotipe to prebioticsdietary inthe guts ofweaningpiglets. Appl.Environ. Microbiol. immunity. Curr. Opin.Immunol. 11:13-18. feeding sowsandpiglets.Bodenkultur. 45:85 (abs). murineindigenous lactobacilliadhereto diarrhoea syndrome ofpiglets.Res.Vet.Sci.67:223-228. 1999.The L. Jansegers. effect ofprobioticLSP 122 onthecontrol of post-weaning UK. E. HughesandA.H.Rose,eds.Cambridge UniversityPress,Cambridge, Microbes andBiologicalProductivity, forGeneralMicrobiol.Symposium Society 21.D. age. Microb. Ecol. Health.Disease6:101-107. diversity and stability ofthe intestinalcoliform Immun. mice.BJ4 cellsinthelargeintestineofstreptomycin-treated Infect. 61:5029-5034. systematics. E. StackebrandtandM.Goodfellow, eds.JohnWiley & Sons,NewYork. systematics. gastric epithelia.Infect.Immun. 26:966-975. 196 as, K.Sarris,A.C.Tsinas,Alesopoulos, and Wallgren, 1993. andR.Möllby. Phenotypic R. I. Mackie. 1995. Effect of weaning diet on weaning diet Mackie. 1995.Effectof R. I. odels for study of the specificity by which by odels of thespecificity forstudy Williams,D. L.Akkermans,and W.M.de A. Toll-receptor family andcontrol Toll-receptorof innate family intestinal microflora in animal nutrition. In: microflora inanimal intestinal flora inpiglets during the first3months of Use of a microbial growthpromotorUse ofa in bohydrates on pigletfaecalbacterial bohydrates intestinal tractofthe pig. J.Anim. Sci. Lactobacillus amylovorus Escherichia coli Literature cited Literature cited -like
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED
Bifidobacterium mental diets and aftermental ecology of the gastrointestinal tract. In: ecology of the e pig gastrointestinal microbiota revisited. gastrointestinal e pig microbiota ine dysentery infection. upon experimental gs fed different experi Gibson R. Roberfroid, eds. Kluwer and M. C. Raangs, G. R. Kamphuis, M. H. F. M. H. G. R. Kamphuis, C. Raangs, D. Leser, W. Jiufeng, and K, Moller. 2003. B. Jensen, and K. Moller. 2000. Changes in 3. Allelic discrimination by nick-translation nick-translation 3. Allelic discrimination by novel gut-associated Fibrobacter. Syst. Appl. s of climatic conditionss of on the performance, climatic Leff. 1997. Comparison of Leff. Comparison methods for the 1997. 197 dobacterium strains from resident infant human resident infant human strains from dobacterium . Appl. Environ. Microbiol. 66:3290-3296. 66:3290-3296. Microbiol. . Appl. Environ. Bidner. 2003. Effect of mannan oligosaccharides oligosaccharides Bidner. 2003. Effect of mannan timicrobial activity. Gut 47:646-652. Gut 47:646-652. activity. timicrobial lleck, M. Blaut, and lleck, M. Blaut, Colonic microflora J. Doré. 2005. Brachyspira hyodisenteriae
Microbiol. 17:418-424. Microbiol. 17:418-424. probes for fiber-digesting bacteria suggest gastrointestinal microflora exert an exert gastrointestinal microflora development of sw The influence of diet on the Sci.76:81-87. Anim. Appl. Environ. Microbiol. 68:673-690. 68:673-690. Microbiol. Appl. Environ. Culture-independent analysis of gut bacteria: th bacteria: analysis of gut Culture-independent infection with bacterial community in the colon structure of pi concentration of bacterioplancton for in situ hybridization. J. Microbiol. Methods 29:23- Methods J. Microbiol. situ hybridization. for in concentration of bacterioplancton 29. on growth performance of weanling pigs. J. Anim. Sci. 81:2482-2487. 81:2482-2487. Sci. J. Anim. of weanling pigs. performance on growth York. John Willey Inc. York. John and Sons, PCR with fluorogenic probes. Nucleic Acids Res. 11:3761-3766. Nucleic Acids Res. 11:3761-3766. PCR with fluorogenic probes. Advances in Microbial Ecology, K. Marshall, ed. Plenum Press. New York. Marshall, ed. Plenum Advances in Microbial Ecology, K. Wilkinson, and G. W. Welling. 1995. Quantitative in situ hybridization of in situ hybridization Quantitative 1995. G. W. Welling. and Wilkinson, 71:4153- Appl. Environ. Microbiol. five northern european countries. signatures across 4155. Sci. 38:79-90. and health status of weaned piglets: a review. Livest. Prod. metabolism Collins, R. Thiel, P. Namso Collins, R. Thiel, spp. with genus-specific 16Sspp. with genus-specific rRNA-targeted probes and its application in faecal samples. 61:3069-3075. Microbiol. Appl. Environ. Colonic microbiota, G. R. nutrition and health. Academic Publishers, Dordrecht, The Netherlands. Lindecrona, R. H., T. J. Jensen, B. B. Jensen, T. Lindecrona, Lin, C., B. Flesher, W. C. specific R. Capman, hybridization I., and D. A. Stahl. 1994. Taxon Lievin, V., I. Peiffer, S. Hudault. 2000. Bifi Lievin, V., I. Peiffer, S. Hudault. 2000. Leser, T. D., J. Z. Amenuvor, T. K. Jensen, R. H. Lindecrona, M. Boye, and K. Moller. 2002. Lindecrona, M. Boye, T. K. Jensen, R. H. Leser, T. D., and K. J. Z. Amenuvor, Leser, T. D., Jensen, B. R. H. Lindecrona, T. K. Lemke, M. J., C. J. McNamara, and L. G. M. J., C. J. McNamara, Lemke, LeMieux, F. M., L. L. Southern and T. D. LeMieux, F. M., L. L. Southern and Lee, Y. K., K. Nomoto, S. Salminen, S. L. Gorbach. 1999. Handbook of probiotics. New of probiotics. Handbook 1999. S. L. Gorbach. S. Salminen, Lee, Y. K., K. Nomoto, Chapter 11 Chapter G. G. J. Jansen, P. S., F. Schut, Langendijk, Lee, L. G., C. R. Connell, and W. Bloch. 199 Le Dividich, J., and P. Herpin. 1994. Effect Lee, A. 1984. Neglected Niches: the microbial Lawson, P. A. 1999. Taxonomy and systematics of the predominant gut anaerobes. In: gut of the predominant systematics Lawson, P. anaerobes. In: and A. 1999. Taxonomy M. M de Vos, M. D. Rajilic, E. E. Vaughan, W. Lay, K. Holmstrøm, Rigottier-Gois, C., L.
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Lu, L.,andW.A.Walker.2001.Pathologic andph Makkar, H.P.S.and K. Becker. 1999. Purinequantification in digesta fromruminants by M.Hill,R.L. Harrold,A.J.Lewis,andT.L. G. Cromwell, G.C. Carter, S.D. Mahan, D.C., KD.2005.Imm Macpherson AJ,Geuking MB, McCoy Mackie R.I.,A.Sghir, and H.R.Gaskins1999. Developmental microbial ecology ofthe and G.T. Cummings S., J.H. MacFarlane, G. T.andA.J.McBain.1999.The humanMacFarlane, microflora. colonic In:Colonic S., andG.T.MacFarlane.1995. MacFarlane, M Lueck, E.1980.Antimicrobial Food Additives: Livak, K.J.,S.J.Flood,Marmaro,W. Gi Liu, W.T., 1997.microbialT. L.Marsh,H.Cheng,andJ.Forney. Characterizationof MacFarlane, G. T.,and J.H.Cummings.1991.MacFarlane, Gibson, E.Beatty G. T.,R. MacFarlane, spectrophotometricmethods. andHPLC Br. J.Nutr. 66:313-329. the postweaningdietsof pigs. J.Anim.Sci. 78:61 (abs.). ofaddedzinc oxideVeum. 2000. levels Efficacy intestinal bacteria.Immunology 115:153-162.mucosa tocommensal neonatal gastrointestinaltract.Am. J.Clin.Nutr.69:1035S-1045S. and M.B.Roberfroid,eds. Kluwer Academic Publishers,UK. In:Colonic Intestine. Large inthe surfaces TheNetherlands. Academic Publishers, microflora, nutritionand health. G.R.Gi Raton, FL. Press, Boca eds.CRC T. MacFarlane, roleinnutrition,phys Human colonicbacteria: Verlag Germany. gastrointestinal epithelium. Am. JClin.Nutr.73:1124S-1130S. encoding 16S rRNA.Appl.Environ. Microbiol. 63:4516-4522. by determiningdiversity TerminalRestric Intestine: Physiology, Patophysiology Intestine: Physiology, bowel digestivefunction.In: Phillips,S.F.Pemb acidchain fatty measurements. FEMSMicrobiol. Ecol. 101:81-88. human acidproductionfromproteinby chain fatty blood cells.J.Immunol.122:2426-2429. generates cellscapableofmediatingthede PCR product and nucleicacidhybridiza fluorescent dyes atopposite endsprovideaquenc fluorescent dyes acDonald, T. T. and P. B. Carter. 1979. Requi T. andP.B.Carter.1979. acDonald, and York. Press,New Disease.Raven tion. PCRMethodsAppl. 4:357-362. and J. H. Cummings. 1992.Estimationofshort- H. Cummings. andJ. usti, andK.Deetz.1995.Oligonucleotides with 198 tion Fragment Length polymorphisms ofgenes microbiota, nutrition and health. G. R. Gibson microbiota,R. Gibson nutritionandhealth.G. MacFarlane. 1999.Bacterialcolonisationof layed hypersensitivity reaction to sheep red hypersensitivityreactiontosheepred layed Proteolysis andaminoProteolysis acidfermentation.In: bson andM.B.Roberfroid,eds. Kluwer iology andpathology.G.R.Gibson The colonic flora, fermentation, andlarge The colonicflora,fermentation, with andwithout anantibacterialagentin with erton, J. H. Shorter, R. G., eds. TheLarge J.H.Shorter,R.G.,eds. erton, rement for a bacterial flora before mice florabefore a bacterial rement for ysiologic interactions of bacteria with the with the ysiologic interactionsofbacteria Characteristics, uses, effects. Springer- uses, Characteristics, intestinal bacteria basedonbranched– intestinalbacteria hed probe system useful for detecting hed probesystem usefulfor une responses thatadapttheintestinal une Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED tterson, and D. T. Kelly. es designed to investigate bacteria of thees designed to investigate bacteria of astillo, J. F. Pérez, S. M. C. Martín-Orúe, the natural environment. Microbiol. Microbiol. natural environment. the eed additive on performance and eed additive on performance intestinal yt, and K. H. Shleifer. 1996. Application of 1996. yt,and K. H. Shleifer. i, F. F. Cozzolino, and R. P. Torres. 1998. i, F. F. Cozzolino, E. Creus, and J. -term F. Pérez. 2006. Long rsity among homologous populations of populations homologous rsity among mel, F. Baucells, and J. Gasa. 2004. Effect of ly-weaned pigs. Submitted to the ly-weaned Journal of pigs. Submitted lva. 2003. PCR of real-time with Comparison al equilibrium of early-weaned pigs. J. Anim. of early-weanedpigs. al equilibrium selected faecal bacteria.Microbiol. 149:269- M. Forsyyth, J. A. Pa M. Forsyyth, J. A. Martin, J. C. Fry, S. J. Hiom, D. Dymock,J. Hiom, and Martin, J. C. Fry, S. A. Andaluz, M. Anguita, and J. Gasa. 2003. A. Andaluz, M. Anguita, and J. bonds and the 118,000 glycoprotein of human glycoprotein and the 118,000 bonds 199 on fragment length polymorphism (T-RFLP): an polymorphism length on fragment
1991. Effects of a propionic acid containing f propionic 1991. Effects of a on Digestivemicrobial fermentation of the weanling pig. In: Proc. 6th Int. Symp. The Netherlands. Pigs. Wageningen, Physiology in effects of feeding large amounts of resistant starch on the digestive tract of growing pigs. pigs. tract of growing digestive of resistant starch on the large amounts effects of feeding to the J. Sci. Food Agric. Submitted Consumption of Raw Potato Starch IncreasesConsumption Colon Length and Fecal Excretion of Purine Nutr. 133:134-139. Bases in Growing Pigs. J. amplification products. Curr.Opin. Microbiol. 2:323-327. 2:323-327. Microbiol. products. Curr.Opin. amplification plant extracts and formic acid on the intestin plant extracts and formic method for characterizingemerging dive Sci. 82:3210-3218. Sci. 82:3210-3218. 277. SYBR Green I or 5’ nuclease assays with rDNA targeted hybridization and dot-blot in quantification of oligonucleotide probes intestinal mucin. Symp. Soc. Exp. Biol.43:279-287. Soc. Exp. Biol.43:279-287. Symp. intestinal mucin. prob a suite of 16S rRNA-specific oligonucleotide cytophaga-flavobacter-bacteroides in phylum 142:1097-1106. Kamel and J. Gasa. 2006. Effects of butyrate, avilamycin, and a combination of plant a combination of plant and of Kamel and J. Gasa. 2006. Effects butyrate,avilamycin, extracts on the intestinal of ear equilibrium Science.Animal of useful bacterium-specificW. G. Wade, 1998. Design and evaluation that PCR primers 64 :795-799. Microbiol. 16S rRNA. Appl. Environ. bacterial coding for genes amplify Antioxidant activity of cinnamon (Cinnamomum Zeylanicum, Breyne) extracts. Zeylanicum, cinnamon (Cinnamomum of activity Antioxidant 137:443-447. Farm. Boll. Chim. Mathew, A. G., A. L. Sutton, A. B. Scheidt, D. Martinez-Puig, D., M. Castillo, M. Nofrarias, Martinez-Puig, D., J. F. Pérez, M. Castillo, Marchesi, J., T. Sato, A. J. Weightman, T. A. Weightman, Marchesi, J., T. Sato, A. J. restricti Marsh, T. L. 1999. Terminal Manzanilla, E. G., M. Nofrarias, M. Anguita, M. C Chapter 11 Chapter E., A. Kassinen, Malinen, Rinttilä andT. A. Pa Mancini-Filho J., A. Van-Koiij, D. A. Mancin Mancini-Filho J., Manz, W., R. Amann, W. Ludwig, M. Vancanne Ludwig, M. W. Amann, Manz, W., R. Manzanilla, E. G., J. F. Pérez, M. Martín, C. Ka Mantle, M., and G. Stewart. 1989. Disulphide Stewart. 1989. Mantle, M., and G.
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Mathew, A. G., M.A.Franklin,W.G. Upchurch Mathew, A. andK.A. Kelly D.T. A. Patterson, A.B.Scheidt,J. G., A.L.Sutton, Mathew, A. McDonald, D. E., J. R. Pluske, D.W.Pethic McDonald, D.E.,J.R. McCracken, V. J.,J.M.Simpson,McCracken, R.I.M B. A.,M.E.Spurlock,A.R McCracken B. A.,H.R.Gaskins,P.J.Ruwe McCracken E. 2005.McCartney, Countdown to 2006. McCartney, A. L.2002.McCartney, Application of mole McBurney, M. I.,and McBurney, W. C.Sauer.1993. Fiber absorption: andlargebowelenergy J. T.,C. Cremin R.I.Mackie, G.C.Fahey, May, andK.A.Garleb.1994. Effect offiber Maxwell, C.V.,andS.D. Carter.2001. Feeding the weanedpig.In: Swine Nutrition. Matzinger P.1998. Aninnate senseof Matsuo, K.,H.Ota,T.Akamatsu,Sugiyama A. and T.Katsuyama. 1997.Histochemistry of Matsuki, T., K. Watanabe,and Mathew, A.G.,S.E. Chattin,C.M. Robbings, microbiota. J.Nutr.131:1862-1870. andantibiotic-i ofdietary ecological analysis weanling pig. J.Anim. Sci.71:1503-1509. microbial populations of galactanonselected intheileum ofthe Meyerholtz. 1993. Effect J. Nutr.129:613-619. weaning. J.Nutr.125:2838-2845. Diet-dependent anddiet-independentmetabolic International, April2005:6-10. and thegut flora. Br.J.Nutr.88:S29-S37. 1999. Weaning anorexia may contribute1999. tolocal Weaninganorexiamay validation of the integratedileostomy-ferm Clostridium difficile acidproduction soured onshort-chainfatty and L.L.SouthernRaton, FL. A.J.Lewis eds.,CRCPress,Boca mucous gellayerthe surface ofthehumancolon.Gut40:782-789. 69. for thedetectionandidentificationIntest. Microbiol.4:61- ofbifidobacteria. Curr.Issues weanling pigs. J.Anim. Sci.76:2138-2145. microbial cultureonentericfed yeast populatio acidon ilealshort-chain fatty concentrationsinpigs. Nutr.Res.16:1689-1698. Association. Victoria, Australia. Association. Victoria,Australia. In: ManipulatingPigProduction VI.P.D. weaner with nonstarchpolysaccharides dietary . Scand.J.Gastroenterol.29:916 (abs). R. Tanaka.2003.PCR primers Genus-and species-specific danger.Semin. Immunol.10:399-415. entation usingpigs. J.Nutr.123:721-727. cular biologicalmethods forstudying probiotics 200 -Kaiser, K.C.Klasing,and D.E. Jewell.1995. ackie, and H.R.Gaskin k, andD.J.Hampson. 1997.of Interactions oos, F. A. Zuckermann, and H. R. Gaskins. oos, F.A.Zuckermann,andH.R.Gaskins. and on the growth and toxinproductionand on thegrowth by and D. A.Golden.1998. Effectsofadirect- , and S. E. Chattin. 1996. Effect of weaning , andS.E.Chattin.1996.Effectofweaning pig growthandpost-weaning colibacillosis. nduced alterations of the mouse intestinal mouse nduced alterationsofthe ns, fermentation acids,andperformance of responses underliegrowthstasisofpigsat responses EU considers AGP alternatives. Feed EU considersAGPalternatives.Feed Cranwell, ed. Australasian Pig Science Science Pig Australasian ed. Cranwell, inflammationinthepigletsmallintestine. s. 2001.Molecular Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED ealth. Doctoral thesis.ealth. Doctoral . J. Vet. Med. B Infect. Dis. in newly-weaned in pigs. Br. J. strains and rotavirus. J. Vet. ds in human ds inand rat feces. J. human Lipid Res. structure in the solid and liquid phases of Escherichia coli cus on the intestinal h A comparison of five methods for extraction methods for of five A comparison Escherichia coli Escherichia coli all intestinal structure and intestinal growth, al., eds. Japan Science Society Press. Tokyo. , and D. J. Hampson.D. Adverse effects 1999. , and of Miettinen. 1981. Thin layer and gas liquid layer Miettinen. 1981. Thin Wallgren. 2004. Development of post-weaning of post-weaning Development 2004. Wallgren. ary microflora and starches on the fermentation 201 health and growth. Pig Progress, 16:27-30. health and ademic Publishers, The Netherlands. Publishers, ademic ng. Res. Vet. Sci. 67:245-250. ng. Res. Vet. Sci. Thesis, SAC/University of Aberdeen. ecal microfloras and of phagocytic and killing capacityecal of microfloras and of phagocytic functional state of the microflora. In Recent Advances in functional rae Sueciae Veterinaria. 112. Swedish Universityrae Sueciae Veterinaria. 112. Swedish of In: Colonic microbiota, nutrition and health. G. R. Gibson nutrition In: Colonic microbiota,
pattern of the porcine colon. M. Sc. porcine colon. pattern of the Nutr. 86:487-498. Nutr. 86:487-498. and stimulate proliferation of enterotoxigenic of enterotoxigenic proliferation and stimulate viscosity intestinal contents alters smof the soluble non-starch polysaccharide (guar-gum) on piglet growth and experimental on piglet (guar-gum) polysaccharide non-starch soluble colibacillosis immediatelyafter weani surfaces in the large intestine. and M. B. Roberfroid, eds. Kluwer Ac and M. B. Roberfroid, eds. Microbial Ecology. T. Hattori, Y. Ishida, et Microbial Ecology. T. Hattori, Y. Ishida, Acta Universitatis Agricultu Agricultural Sciences. Sweden. 1997. Development of selected fa neutrophils in young pigs. Vet. Microbiol. 54:287-300. Vet. Microbiol. 54:287-300. young pigs. neutrophils in 22:474-484. 22:474-484. chromatographic identification of neutral steroi neutral chromatographic identification of York. Vet. Public Health 47:663-675. Vet. Public Health 47:663-675. Effects of an exposure to a pathogenic strain of Effects of an exposure to a pathogenic strain of bacterial DNA from human faecal samples. J. Microbiol. Methods 50:131-139. activities and cellulolytic bacterial communitycellulolytic activities and rumen contents. Repr. Nutr. Dev. 41:187-194. diarrhoea in piglets. Relation to presence of diarrhoea in Med. 51:12-22. McFarland, S. P. 1998. The influence of diet The 1998. McFarland, S. P. McDonald, D. E., D. W. Pethick, B. Mullan, P. Increasing 2001. and D. J. Hampson. McFarlane, S., J. H. Cummings, and G. T. Marcfarlane. 1999. Bacterial colonisation of colonisation Bacterial McFarlane, Marcfarlane. 1999. and G. T. H. Cummings, S., J. Chapter 11 Chapter J. R. Pluske D. E., D. W. Pethick, McDonald, Melin, L., S. Mattsson, M. Katouli, and P. M. Katouli, Mattsson, Melin, L., S. Melin, L. 2001. Weaning of pigs with special fo with special of pigs Weaning 2001. Melin, L. Melin L., M. Jensen-Waern, A. Johannisson A, M. Ederoth, M. Katouli, and P. Wallgren. Katouli, and M. Ederoth, A, M. Jensen-Waern, A. Johannisson Melin L., M. Weaning of piglets. and P. Wallgren. 2000. Fossum, C. Melin L., M. Katouli, A. Lindberg, McNamara, D. J., A. Prosa, and T. A. McNamara, D. J., A. Prosa, and and A. L. Bird. 2002. McOrist, A., M. Jackson, Midvedt, T. 1974. Microbial bile acid transformation. Am. J. Clin. Nutr. 27:1341-1347. J. Clin. Nutr. 27:1341-1347. Am. bile acid transformation. Microbial 1974. Midvedt, T. 1989. Monitoring the Midvedt, T. Michalet-Doreau, B., I. Fernandez, C. Peyron, L. Millet and G. Fonty. 2001. Fibrolytic 2001. Fibrolytic Michalet-Doreau, B., I. Fernandez, C. Peyron,Millet and G. Fonty. L. Metchinkoff, E. 1908. The prolongation of life. G. P. Putnam, ed. G. Putnam’s Sons, New P. Putnam, of life. G. prolongation The E. 1908. Metchinkoff, Mellor, S. 2000. Herbs and spices promote
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Miguel, J. C., S. L. Rodríguez-Zas, and J. E. and Miguel, J.C.,S.L.Rodríguez-Zas, mannan ofa 2004.Efficacy Miguel J.C.,S.L.Rodriguez-Zas,andE.Pettigrew. Mikkelsen, L.L.,M.Jakobsen,andB. B. Jen Moran, E.T. 1982. Comparative nutrition of fo A. Campbell,Moran, C.A.,G.Ward,J.D.Beal, P.H.Brooks,andB.G.Miller.2000. J. F.Pérez,S.M.Martín-Orú Morales, J., 1987. H. Moore,E.P.,Cato,T.D.WilkinsandKornegay. Moore, W.E.C.,L.V. Moore, W.E.,andL.Holdeman.20 Japanese- flora: thenormalfloraof 1974.Human fecal andM. D.Lindemann. R.L.Grayson 1988.Moore, R.J.,E.T.Kornegay, Growth,nutrient Montagne, L., J.R.Pluske, andD.J.Hamp Molis, C.,B.Flourié,F. Ouarne, M.Gailing,S.Lartigue, A.Guibert,F.Bornet,andJ.P. P.S.James, M.W.SmithMiller, B.G., andF.J.Bourne.1986. Effect ofweaningonthe Office of Educcational Practice. University ofGuelph,ON. University Office ofEduccationalPractice. Prod. 12:296-307. oligosaccharide (Bio-Mos)forimproving nurser Lyons and K. A. Jacques, Eds., Nottingham Press,U.K. Lyons andK.A.Jacques, University Eighteenth AnnualSymposium. T.P. of Alltech’s Industries.Proceedings Feed andFood Pa pigs:ameta-analysis. Mos® innursery symposium Pig Digestive Physiology. Uppsala, Sweden. Uppsala, Sweden. symposium DigestivePhysiology. Pig oftheterminalthe ecophysiology ileum, caecum Influence ofliquid feed,fermented feed liquidfeed,dry andsow’s milk fedadlibitum on Landrace andIberianpigs. Br. J.Nutr.88:489-497. fermentationof maizeorsorghum-acorn dietsfedasdifferentsourceofcarbohydratesto Microbiol. 53:1638-1644. Effect ofhigh-fiberand high-oil diets onthefecal floraofswine.Appl.Environ. Hawaiians. Appl.Microbiol. 27:961-979. 1579. utilization andintestinalmorphology of pigs young and non-ruminant animals.Anim.FeedSci.Tech.108:95-117. a fibremucosa, andtheintestinal dietary healthy humans. Am. J.Clin. Nutr. 64:324-328. 1996.Digestion,excretion,and Galmiche. Science, Cambridge10:579-589. ofthe pigintestinal villitodigestcapacity post-weaning. Anim. Feed Sci.Tech.109:133-150. ofpiglets degrading bacteriafaeces in andfructo-oligosaccharide on microbial diversity e, M.Fondevila,andJ.Gasa.2002.Largebowel ges 425-433in:Nutritional Biotechnology in the Pettigrew,J.E.2003. PracticalresponsetoBio- 202 nd their consequences on digestive health in nd theirconsequencesondigestivehealthin son. 2003. A review of interactions between son. 2003.Areviewofinteractionsbetween sen. 2003. Effects of dietary oligosaccharides sen. 2003.Effectsofdietary and absorbnutrients.Journalof Agricultural fed high-fiberdiets. J.Anim. Sci.66:1570- energy value of fructooligosaccharides in energy valueoffructooligosaccharidesin wl and swine. In Gastrointestinal Systems. wl and swine.InGastrointestinalSystems. and colonofthepotweanedpiglet.In:8th y pig performance. J. Swine Health and Health and J.Swine pigperformance. y Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED posium. T.P. Lyons and K.A. Jacques, eds. posium. owing pigs. In: Biotechnology in the Feed pigs. In: Biotechnology owing er, D. C. England, and W. E. Sandine, 1977. 1977. er, D. C. England, and W. E. Sandine, ckling pigs. Japanese Science Feedstuffs. B. K. Choi, M. Wagner, and U. B. Göbel. U. B. Göbel. Wagner, and M. Choi, B. K. s-mediated binding of bovine enterotoxigenic of bovine s-mediated binding J. Huis, and R. Fuller. 1997. Intervention J. Huis, and R. 2004. Influence of the form and rate of Cu and Influence of the form 2004. igin and physicochemical forms as potential igin and physicochemical hows spatial distribution of as yet uncultured of as yet hows spatial distribution 203 nd poulty. Probiotics-2. G. W. Tannock, ed. W. Tannock, G. Probiotics-2. nd poulty. nd U. B. Göbel. 1998a. Molecular nd U. B. Göbel. 1998a. epidemiology atitis lesions. Microbiol. 144:2459-2467. 144:2459-2467. atitis lesions. Microbiol. dontal disease. J. Clin. Microbiol. 36:1399-1403. Clin. Microbiol. dontal disease. J. to calf small intestinal mucis. Infect.Immun. 55:1216-1223. 55:1216-1223. Infect.Immun. to calf small intestinal mucis.
Nottingham University UK. Nottingham Press, strategies: the competitive use of probiotics and exclusion microfloras against a in pigs with pathogens contamination 20th Annual Sym Proceedings of the Industry, weaner pig diets with zinc oxide or Bioplex™ Zinc. Pages 419-424 in: Nutritional Nutritional Zinc. Pages 419-424 in: Bioplex™ or weaner pig diets with zinc oxide and Food Industries. Proceedings of Alltech’s Eighteenth Biotechnology the Feed in T. P. LyonsAnnual Symposium. and K. A. Jacques, eds. Nottingham University Press, U. K. growth promoters for pigs. In: 9th Symposium Digestive Physiology in Pigs. Banff, Banff, in Pigs. Digestive Physiology Symposium In: 9th for pigs. growth promoters Canada. Horizon Scientific Press, UK. of gr performance on the Zn supplementation Escherichia coli visualization of microorganisms. J. Microbiol. Methods 41:85-112. 41:85-112. J. Microbiol. Methods visualization of microorganisms. 1998b. Fluorescence in siru1998b. Fluorescence hybridization s digital derm treponemes in biopsies from continuous SYBR Green I monitoring during amplification. Biotechniques. 246:954-962. Biotechniques. 246:954-962. amplification. during I monitoring Green SYBR continuous fructooligosaccharides (Neosugarfructooligosaccharides G) in su 59-88:1-17. Association Report associated with perio of oral treponemes gastrointestinal tract of “monoxenic” rats: effect of immunization with strains of ureolytic of ureolytic with strains effect of immunization rats: tract of “monoxenic” gastrointestinal 13:9-15. bacteria. Infect. Immun. Effect of feeding lactobacilli on the coliform flora of intestinal tissue andand lactobacillus coliform on the Effect of feeding lactobacilli feces from J. Food Prot. 40, 288-295. piglets. Muralidhara, K. S., G. G. Sheggeby, P. R. Ellik Mullan, B. P., A. Hernandez, R. and J. Pluske. Mulder, R. W. A. W., R. Havenaar, A. W., W. H. J. Mulder, R. Mullan, B. P., R. H. Wilson, of D. Harris., J. G. Allen and A. Naylor. 2002. Supplementation Mroz, Z. 2003. Organic acids of various or Mroz, Z. 2003. Organic acids of Mouricout, M. A., and R. A. Julien. 1987. Pilu M. Mouricout, Moter, A., and U. B. Göbel. in 2000. Fluorescence situ hybridization (FISH) for direct Moter, A., C. Hoenig, B. K. Choi, B. Riep, a Moter, A., C. Hoenig, Morrison T.B., J. J. Weis,Morrison T.B., J. of low-copy T. Wittwer. 1998. Quantification and C. by transcripts Morimoto, H., H. Noro, H. Ohtaki, and H. Yamazaki. 1984. Study on feeding on feeding H. Yamazaki. 1984. Study H., H. Noro, H. Ohtaki, and Morimoto, Chapter 11 Chapter urea in the of Hydrolysis Raibaud. 1976. and P. M. C., R. Ducluzeau, Moreau, K. Schrank, Moter, A., G. Leist, R. Rudolph,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Muyzer, G.,andK.Smalla.Muyzer, 1998.Applicati G.,andE.C.deMuyzer, Waal.1994. Determin Muyzer, G., E. C. de Waal, and A. G. Uitte andA. E. C.deWaal, G., Muyzer, Myers, R.M.,S.G.Fischer,L.LermanMyers, Nousiainen, J.T.1991.Comparative onselectedprobioticsandolquindox as observations 2001.Ev E.,andM. C. Newman. Newman, K. Newman, K.1994.Mannan-oligosaccharides: significantimpact naturalpolymers onthe with Netea M.G.,R.Sutmuller, C.Hermann,A.Van der Graaf,J.W.Van der Meer, J. H. Nemcova, R.A.,S.Boma,Gancarikova,He National ResearchCouncil.1998. Nutrient re J. M.Sato,and K., T.Hisada, Nagashima, N adkarni, M.A.,E.F. Martin, N. A. Jac Academy Press, Washington,DC. Press, Academy G35:207-214. ASI Series ofPCR amplified 16SrRNA. communities usingDGGEanalysis NATO Antonie van Leeuwenhoek. 73:127-141. (DGGE) andtemperature gradient gel electrophoresis (TGGE)inmicrobial ecology. jejunum, colon. ileum,caecum J.Anim. and Physiol. Anim. Nutr. 66:224-230. feed additivesforpigletsaround weaning.2. Effectonvillus length and crypt depthinthe 189 (abs). immunoglobulin statusof sows microflora and Notthingham Press,Jacques, eds. Nottingham, University UK. TenthAnnualSymposium. andK.A.Feed Industry.ProceedingsofAlltech’s T.P.Lyons microfloraand the immune system.gastrointestinal Pages167-174in: Biotechnology inthe T cells.J.Immunol. 15:3712-3718. against suppresses immunity Kullberg. 2004. Toll-like J. Adema, andB. VanKrieken, T.Hartung, receptor2 G. pigs. Ber.Mucnch. Tierdrztl.Wschr.112:225-228. and fructooligosacchar of Lactobacillusparacasei bacterial populationin human feces.Appl.Environ. Microbiol. 69:1251-1262. toenzyme combinations Terminal RestrictionFragment Length Polymorphism profilingof Microbiology 148:257-266. real-timePCRusing abroa by bacterial load gradient gelelectrophoresis.NucleicAcidsRes.13:3131-3145. substitutions joinedtoaGC in DNAfragments genesencodingfor16Sr reaction-amplified populations denaturing ofpolymerasechain gradients by gel electrophoresisanalysis Candida albicans , and T. Maniatis. 1985. Nearly allsinglebase , andT.Maniatis.1985.Nearly 204 ques, and N.Hunter.ques, 2002. Determination of Mochizuki. 2003. Applicationof newprimer- DNA. Appl.Environ.Microbiol.59:695-700. rlinden. 1993.Profilingmicrobial ofcomplex on of denaturing gradient gelelecrophoresis quirements ofswine.10thedition. National d-range (universal)probeand primers set. aluation ofmannanoligosaccharideonthe through induction ofIL-10and regulatory and piglet performance.J.Anim. andpiglet Sci.79. ation of the genetic diversity ation ofthe of microbialgenetic diversity rich andP.Guba. 1999.rich Study of theeffect ides on the faecal microflora in weanling microflorain weanling ides onthefaecal -clamp can be detected by denaturing denaturing -clamp canbedetectedby Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED ement in pig diets. ns of growing pigs fed diets containing fed pigs growing ns of r’s patches in normal and gnotobiotic pigs. and gnotobiotic in normal patches r’s traits, sensory quality, intestinal microflora form performance enhanc form performance mper, O. Brant, U. R. Folsch, K. N. Timmis, O. Brant, U. R. Folsch, K. N. mper, Prebiotic feed additives: rationale and use in F. J. Fritz. 1988. Postnatal development and development F. J. Fritz. 1988. Postnatal 205 Swinkels. 2000. Enteroguard as an alternative Swinkels. 2000. Enteroguard mpe, andmpe, of S. Schreiber. 2004. Quantification nd T. Granli. 1999. Formi™LHS- An alternative Formi™LHS- nd T. Granli. 1999. ing pigs. J. Anim. Sci. 78:1875-1884. Sci. 78:1875-1884. Anim. pigs. J. ing el. J. Anim. Sci.el.75:170-175. J. Anim. ammatory bowel disease. Gut 53:685-693.
feed additive to antibiotics in weanling pig diets. J. Anim. Sci. 78:S184 (abs). Sci. 78:S184 in weanling pig diets. J. Anim. feed additive to antibiotics pigs. In: 9th Symposium on Digestive Physiology in Pigs. Banff, Canada. on in Digestive Physiology Symposium 9th pigs. In: in: Gut environment of pigs. A. Piva, K. E. Bach Knudsen and J. E. Lindberg, eds. eds. and J. E. Lindberg, K. E. Bach Knudsen of pigs. A. Piva, in: Gut environment University UK. Press, Notthingham Nutr. Res. Rev. 12:117-145. Nutr. Res. Rev. 12:117-145. dietary formats on growth performance, dietarycarcass formats to antibiotic growth promoters. 50th annual meeting of the EAAP. meeting 50th annual promoters. growth to antibiotic alterations in growing-finish and stomach Manipulating pig production VII. P. D. Cranwell, ed. Australasian VII. P. D. Cranwell, Pig Science pig production Manipulating Association. Victoria, Australia. S. Schreiber. 2005. Reduction in diversity of the colonic mucosa associated bacterial colonic mucosa of the in diversity S. Schreiber. 2005. Reduction microflora in patients with active infl minor set and PCR with a universal primer by real-time intestinal bacterial populations 42:2566- J. Clin. Microbiol. flora. to the enteric approach probes: a global groove binder 2572. lymphocyte production of jejunal and ileal Peye and ileal jejunal of production lymphocyte Immunology 64:539-544. 64:539-544. Immunology sucrose thermal caram oligosaccharide performance and intestinal microbial populatio performance microbial and intestinal outside the gut? Trends Microbiol. 12:562-568. 12:562-568. Microbiol. Trends gut? outside the restriction fragment length polymorphism (t-RFLP) analysis study for the of polymorphism length microbial restriction fragment 2:39-50. Environ. Microbiol. community dynamics. and structure supplementation with mannan oligosaccharides on sow and litter performance in a on sow and litter performance in a supplementation oligosaccharides mannan with 1):212. Sci. 79 (Suppl. J. Anim. commercial production system. ’Quinn, P. R., D. W. Funderburke, and G. W. Tibetts. 2001. Effects of dietary and G. W. Tibetts. 2001. Effects D. W. Funderburke, R., ’Quinn, P. abst, R., M. Geist, and H. J. Rothkotter, Peet-Schwering, C. M. C. and J. W. G. M. Patterson, J. A., and K. M. Burkholder. 2003. Partanen, K. 2001. Organic acids- their efficacy and modes of action in pigs. Pages: 201-217 Pages: 201-217 Partanen, K. of action in pigs. Organic acids- their 2001. efficacymodes and Øverland, M., T. Granli, N. Kjos, O. Fjetland, S. H. Steien, and M. Stokstad. 2000. Effect of of Effect Fjetland, S. H. Steien, and M. Stokstad. 2000. Øverland, M., T. Granli, N. Kjos, O. Øverland, M., S. H. Stein, G. Gotterbarm, a Øverland, M., S. H. Stein, G. Gotterbarm, Ott, S. J., M. Musfeldt, W. Ullmann, J. Ha Ott, S. J., M. Musfeldt, W. Ullmann, : pigs. In K-difromate in diets for (Formi™LHS) Stein. 1999. Øverland, M. and S. H. P Partanen, K. acids and Z. Mroz. 1999. Organic Osborn, A. M., E. R. B. Moore, and K. N. Timmis. 2000. An evaluation of terminal- of An evaluation 2000. K. N. Timmis. B. Moore, and M., E. R. Osborn, A. J. Ha F. Wenderoth, Musfeldt, D. Ott, S. J., M. Orban, J. I., J. A. Patterson, O. Adeola., A. L. Sutton, and G. N. Richards. 1997. Growth 1997. Richards. G. N. and Adeola., A. L. Sutton, J. A. Patterson, O. Orban, J. I., O Chapter 11 Chapter immune regulate responses de microbiota Does 2004. Huffnagle. G. B. and C., Noverr, M.
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Pettigrew, J. E.2000. Mannan oligosacchar Pettigrew, J. Pluske, J.R.,D.E.Hopwood,and J. Pérez de Rozas, A., M. Roca, R. Carabaño, C. Roca, R.Carabaño, Rozas, A.,M. Pérez de Perdigón, G., R.Fuller,andRaya. 2001.Lacticeffect onthe acidbacteriaandtheir Piva, A.,A.Panciroli,E. Meola andA.Fo Pickard, K.M.,A.R.Bremner,N. Gordon,and T.MacDonald.2004. J. Immune Possemiers, S., K. Verthé, S. Uyttendaele, S. Bolca, T. Van de Wiele, N. Boon, and Wiele,N.W. S.Bolca,T.Vande S., K. Verthé,S.Uyttendaele, Possemiers, Pluske, J.R.,D.W.Pethick,E.Hopwood,and D.J.Hampson. 2002.Nutritional Pluske, J.R.,Z.Durmic, D.Pethick,B. P. Pluske, J.R.,D.Hampson andI.H.Williams. 1997.Factorsinfluencingthe structureand Pluske, J.R.P.M.Siba,D.W.Pethick, Z. Platel. K.andSrinivasan.2000.Influenceof Penders, J.,C.Vink,Driessen,N.London, C. Thijs,and E. Stobberingh. 2005. Pluske, J.R.,I.H.Williams,andE.X.Ah 2003. Octubrede Madrid, FEDNA. Curso deespecialización XIX diversidad intestinalporRFLP. 2003.Elestudiodela and I.Badiola. S.Campoy, J.Barbé, Martín-Orúe, J.Gasa, immune system. Curr. Issues Intest. Microbiol. Curr. IssuesIntest.Microbiol. immune2:27-42. system. Verstraete. 2004. Molecular techniquesforthest Verstraete. 2004. in vitrocultured Reprod. intestinal microbial community. Nutr. Dev. 44:S8. piglets inresponsetoincrease pancreatic digestiveenzymes 243:141-147. FEMSMicrobiol.Lett. real-time PCR. andformula-fed infantsby ofbreast-fed samples responses. Best Pract. Res. Clin. Gastroenterol.18:271-285.responses. BestPract.Res. Feedstuffs. 12. tras el destete. XIX Curso de Especialización Fedna.Madrid. XIXCursodeEspecialización tras eldestete. laincidencia dedia intestinal, elpienso y di major entericbacterial influences onsome after experimentalinfection.J.Nutr.128:1737-1744. the role of readily fermentable carbohydrates in the roleofreadily function of the smallintestineintheweanedpig:areview. Livest.Prod.Sci.51:215-236. rather thanhigh fibrediets. J.Nutr. 126:280-289. swinececalmicroflora acid andgasproductionby Quantification of amountentering th offermentablesubstrates inpigscan The incidenceofswinedysentery Bifidobacterium in albinorats.Nahrung:44:42-46 s in the cow’s milk weaning.Anim.s inthecow’s Sci.62:145-158. after spp., Escherichia coli Mullan and D.J.Hampson. 1998. Confirmation of rmigoni. 1995.Lactitol enhances short-chain fatty Durmic, B.P.Mullan,and D.J.Hampson.1996a. Hampson. 2003. Relaciónentrelamicrobiótica 206 rreas, y su influencia sobre la salud del lechón suinfluenciasobrelasaluddellechón rreas, y erne. 1996b. Villous height and crypt erne. 1996b.Villousheightand depth incrypt e largeintestine. J.Nutr.126:2920-2933. seases ofpigs.Nutr. Res. Rev.15:333-371. dietary spicesandtheiractiveprincipleson dietary be reduced by feeding bereducedby diet that limit the ide’s effects on performance reviewed. performancereviewed. on effects ide’s de Blas, M. Francesch, J. Brufau, S.M. J. deBlas,M.Francesch, the expression of swine dysentery inpigs expression ofswinedysentery the ructural analysis andquantification ofan to a greater extent whenfermentinglow toagreaterextent and Clostridium difficile Literature cited Literature cited in faecal infaecal
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED Microbiology, R. I. Mackie R. I. Microbiology, atile fatty acids in the intestinal tract of intestinal in the fatty acids atile digestion. In : In Vitro Digestion for Pigs : In In digestion. cation of weaner pig diets. A review. J. Sci. ied fjord quantified by in situ hybridization ied fjord quantified inants of bacterial virulence. In: Topley and Topley inants of bacterial virulence. In: species within the genus Ruminococcus. E. Ullrey, and A. J. Lewis, eds. Butterworth E. Ullrey, and A. J. and immunity. 8th ed. A. H. Linton and H. 8th ed. A. H. Linton and H. and immunity. Kovacs. 1990. The role of intestinal volatile volatile role of intestinal Kovacs. 1990. The meal-based diet for weanling pigs. J. Anim. eed additives, growth factors or unwanted factors eed additives, growth G. Newcombe, G. T. Williams, G. A. Allen, and G. Newcombe, T. Williams, ylogenetic analysis byylogenetic 16S rDNA sequence gs. Zentbl. Vetmed. Reihe B. 37:570 (abs.). (abs.). 37:570 Vetmed. Reihe B. gs. Zentbl. ter column. Appl. Environ. Microbiol. 62:1391- Microbiol. ter column. Appl. Environ. 207 ecosystems. In: Gastrointestinal . Zentralbl. Veterinarmed. Reihe B 33:166 (abs). (abs). Reihe B 33:166 Veterinarmed. . Zentralbl. Escherichia coli
45:159-167. 45:159-167. Heinemann, Boston, USA. acid, and their interactions in a corn-soybean D. Swine Nutrition. E. R. Miller, nutrition. In: in a stratif Distribution of bacterial populations environmental factors. J. Anim. Feed Sci. 7:135-142 Sci. 7:135-142 Feed factors. J. Anim. environmental of bacteriology, virology Wilson’s principles Arnold, UK. M. Dick, eds. Edward gel mucosa in humans and its on colonic of adherent mucus Thickness J. Rhodes. 1994. relevance to colitis. Gut 35:353-359. Sci. 76:1880-1886. wa in the gradients and related to chemical 1404. K. U. eds. CAB International, Edinburgh, F., Fuller, M. and Poultry, 62:313-322. Food Agric. pigs against pi shedding of fattythe Salmonella acids in microbial diversity present in the colonic wall, andcolonic lumen, cecal lumen of a pig. 65:5372-5377. Microbiol. Appl. Environ. comparison reveals two unrelated groups of 129:69-74. FEMS Microbiol. Lett. ecology of the gastrointestinal Series. New York. Microbiology eds. Chapman and Hall and B. A. White, adcliffe, The effectsJ. and E. T. Kornegay.1998. ofS., Z. Zhang, phytase, microbial citric Poulsen, H. D. 1998. Zinc and copper as f and D. 1998. Zinc Poulsen, H. Chapter 11 Chapter Sci. A Anim. Scand. Sect. Acta Agric. piglets. oxide for weanling H. D. 1995. Zinc Poulsen, Rainey,A. and P. H. Janssen. 1995. Ph F. Poxton, I. R., and J. P. Arburhnott. 1990. Determ 1990. and J. P. Arburhnott. I. R., Poxton, Antibacterial Prohaszka, L., 1986. of vol mechanism R and bacteria on swine Intestinal 1991. their influence Yokohama. Radecki, S. V., and M. T. 1996. F. Andersen, and B. Thamdrup. Ramsing, N. B., H. Fossing, T. G. Ferdelmann, Raskin, L., W. C. Capman, R. Sharp, L. K. Poulsen, and D. A. Stahl. 1999. Molecular Ratcliffe, B. The role of the 1991. microflora in 1993. Acidifi T. Kornegay. Ravindran, V., and E. Prohaszka, L., B. M. Jayarao,Prohaszka, L., B. A. Fabian, ans S. Pullan, R. D., G. A. O. Thomas, M. Rhodes, R. Pryde, S. E., A. J. Richardson,Pryde, S. E., C. S. Stewart, and H. J. Flint. 1999. Molecular analysis of the
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Reid, C.A.,andK.Hillman.1999. The effect Reisner, D.,G.Steger,U.Wiese,M.Wulfert, Requena, T.,J.Burton, T. Matsuki,K.Munro, Rolfe, R.D.2000. Therole ofprobiotic cultures andhostinteractions. microbes Rolfe, R.D.1996. Colonization resistance.Gastrointestinal Rigottier-Gois, L.,V.Rochet,N.Garrec,A. Richardson, A. J.,G.Calder,C.S.Stewart,andSmith. 1989. Simultaneous Roth, F. X., B. Eckel, M. Kirchgessner, and U. Eidelsburger. 1992. Influence of formic acid andU. Eidelsburger.1992.InfluenceofformicRoth, F.X., acid B. Eckel, M.Kirchgessner, Rodiger, W. E.W.,and A.Moore,1981. acids Effectofshortchain onsodium fatty bacteria cecal ofthe Bucklin.1981.Characterization andJ.A. Robinson, I. M., M.J.Allison, M.D. Linde C.R.,E.T.Kornegay, Risley, analysis R. P.Rasmussen, Productdifferentiationby Ririe K.M., andC.T.Wittwer. 1997. Robertsson, J.1994.Prohibiteduseofantibio M.D.Lindemann,M. Wood,and C.R.,E.T.Kornegay, W.N.Eigel.1992.Effect C. Risley, colon. Anim. Sci.68:503-510. fermentati ratio ofstarchesoncarbohydrate polymerase chainreaction.Electrophoresis13:632-636. gradient gelelectrophoresisforthedetectionofpolymorphic DNAandforquantitative Chapman andHall,London. UK. In: GastrointestinalMicrobiol.,vol.2.R.I. 26:100-106. Lett.Appl.Microbiol. gas 9:5-8. chromatography. capillary determination ofvolatileand Environ. PCRtargetingthetransaldolasegene.Appl. Microbiol. 68:2420-2427.species by Tannock. 2002. Identification, detection, on pH value, matterdry concentrations content, Nutr. 130:396S-402S. absorption inisolatedhumancolonperturbed of normal pigs.Appl.Environ. Microbiol. 41:950-955. 160. curvesduringthe melting polymerase reactionAnal.Biochem.245:154-of DNA chain flow cytometry using 16S Appl. rRNA probes.Syst. Microbiol. 26:110-118. byfluorescen inhumanfaces Bacteroides species effects onpiglethealthandproduction parame postweaning in pigs.Journal ofAnimalScience70:196-206. times atvarious contentmeasurements on selectedintestinal of feedingorganicacids measurementstract ofweanling pigs. Anim. FeedSci.Technol.35:259-270. microbialorganic acidswithorwithouta cultureontheperformance andgastrointestinal non-volatile acidicfermenta 208 mann, and S.M. Weakland. 1991. Effectsof Mackie, B. A. Whyte, and R. E. Isaacson, eds. andR.E.Isaacson,eds. Mackie, B.A.Whyte, M. Heiby, andK. M. Henco.1992.Temperature- Heiby, and enumeration of human Bifidobacterium and enumerationhuman of Bifidobacterium s ofretrogbradation andamylase/amylopectin on andmicrobialpopulationsinthe porcine Suau,andJ.Dore. 2003.Enumeration of ters. Proceedings of ters. Proceedings the IPVS,Thailand. tics as feedadditiveforgrowth promotion through the vascular bed. Digest. Dis. Sci. through thevascularbed.Digest.Dis.Sci. M. Simon,G. R.Tanaka,K.Watanabe, of volatile fatty acids andlacticacidin the of volatilefatty in thecontrolof gastro t in situ hybridisation combined with t insituhybridisationcombined with tion products of anaerobes by tion productsofanaerobesby intestinal health.J. Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED ffinity of the Bifidobacterium to intestinal of the Bifidobacterium ffinity des from the humandes from colon. Appl. Environ. anaerobic bacteria in the large intestine of anaerobic bacteria estigations about the nutritive efficacy nutritive of the about estigations bacterial flora of neonates with congenital bacterial flora of rumen bacteria. J. Dairy66:763-775. Sci. e effects of fermentation acids on bacterial e effects of fermentation e toxicity at low pH: of fermentation acids testinal fermentative anaerobes. Am. J. Clin.testinal fermentative Am. anaerobes. carbohydrate-limited continuous culture. J. continuous carbohydrate-limited estion of sow's faeces by piglets. Br. of sow's suckling estion the germ-free animal in biomedical research. the germ-free ki. 1982. Utilization of chondroitin sulfate byof chondroitin ki. 1982. Utilization 209 head. 1977. Isolation and identification of fecal head. 1977. Isolation and T. D. of mucin Wilkins. 1977. Fermentation Statistics. SAS Institute Ins., Cary,NC. J. Appl. Bacteriol. 73:363-370. Appl. Bacteriol. 73:363-370. J.
31:529-533. 31:529-533. mucosal epithelial cells. Bifidobacteriamucosal Microflora 1:51-54. J. Nutr. 46:451-456. J. Nutr. 46:451-456. and plant polysaccharidesand plant byBacteroi strains of Microbiol. 33:319-322. Bacteroides thetaiotaomicron growing in Bacteroides growing thetaiotaomicron Bacteriol. 150:1008-1015. Nutr. 32:158-163. Nutr. 32:158-163. M. E. Coates and B. E. Bustafsson, eds. Laboratory Animals, Ltd., London, UK. UK. eds. Laboratory Ltd., London, Animals, M. E. Coates and B. E. Bustafsson, anion accumulation versus uncoupling. versus uncoupling. anion accumulation from human feces. Appl. Environ. Microbiol. 34:355-362. feces. human Microbiol. 34:355-362. Appl. Environ. from bacteria from swine. Appl. Environ. Microbiol. 33:79-84. 33:79-84. bacteria from Microbiol. swine. Appl. Environ. pigs. Appl. Environ. Microbiol. 37:187-193. 37:187-193. Microbiol. Environ. pigs. Appl. degradation and utilization of casein bymixed degradation and utilization growth. Adv. Microbial Physiol. 39:205-234. 39:205-234. Microbial Physiol. growth. Adv. gastrointestinal tract. 3. Communication: Inv Communication: tract. 3. gastrointestinal Nutr. 67:148-156. Anim. Physiol. Anim. of piglets. J. in the rearing organic acids tract. J Hyg. 88:69-81. of the gastro-intestinal abnormalities gastrointestinal physiology and function. Br. J. Nutr. 80:147-171. Br. J. Nutr. 80:147-171. and function. gastrointestinal physiology adzikowski, M. R., J. F. reducing bacteriumSperry,Wilkins. 1977. Cholesterol T. D. and Sato, J., K. Mochizuki, and N. Homma. 1982. A of the gastrointestinal tract. Ann. Rev. Microbiol. ecology Microbial Savage, D. C. 1977. SAS Institute Inc. 1988. SAS User’s Guide: SAS Institute Inc. 1988. SAS Sansom B. F., and P. T. Gleed. 1981. The ing Gleed. 1981. B. F., and P. T. Sansom Salyers, A. A. 1979. Energy sources of major in major Energy sources of Salyers, 1979. A. A. Salyers, A. A., J. R. Vercellotti, S. E. West, Salyers A. A., M. O'Brien, and S. F. Kotars and S. Salyers M. O'Brien, A. A., Salanitro, J. P., I. G. Blake, and P. A. Muir Salanitro, J. P., I. G. Blake, and P. Salminen, S., C. Bouley, M. C., and B. Boutron-Ruault. 1998. Functional food science food and Functional 1998. S., C. Bouley, and B. Boutron-Ruault. M. C., Salminen, In: metabolism. Nitrogen Salter, D. N. 1984. Russell, J. B. 1992. Another explanation for th Another Russell, J. B. 1992. Russell, J. B., C. J. Sniffen, and P. J. Van Soest. 1983. Effect of carbohydrate limitation on carbohydrate limitation J. Van Soest. 1983. Effect of Russell, J. B., C. J. Sniffen, and P. Russell, J. B., and R. Diez-Gonzalez. Th 1998. S Roth, L. 2000. The battle of the bugs. Pig Progress 16:12-15. battle of the bugs. Pig Roth, L. 2000. The V. O., and B. I. Rotimi 1982. The Duerden. of and distribution Types Russell, E. G. 1979. Chapter 11 Chapter
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Seki, H.,M. Shiohara,T. Matsumura, N. Schuppler, M., M.Wagner,G.Schön,andU.B. Scholten, R.H.J.,C.M.VanderPeet-S Schmalenberger, A.,F.Schwieger,andC. Schiffrin E. J., andS. Blum. 2002.Interactions betweenthemicrobiota and the intestinal A.L.Servin,F.Rochat,andA,Donnet-Hughes.1997.ImmuneSchiffrin, E.J.,D.Brassart, Sen, S.,H.P.S.Makkar,Muetzel and K. Becker.1998.Effectof Selim, A.S.,P.Boonkumklao, T.Sone,A. Sghir, A.,J.M.Chow,andR.I.Mackie.1998. Sharp, R.and C.J.Ziemer. 1999. Application of taxonomy and systematics tomolecular Sharma, R.,andU.Schumacher.1995. The influe Shankar, A. H. andA.S.Prasad.1998.Zinc Suau, V.Rochet,P.Pochart,andJ.Doré. 2000.QuantificationSghir, A.,G. Gramet,A. of Kurata. 2003.Preventionofantibiotic- butyricum techniques in intestinalmicrobiology. In:Colonic microbiota, nutrition and health. G.R. oligonucleotide probes.Microbiology 144:249-259. nocardioform actinomycetes inactivatedsludgeusingfluorescentrRNA-targeted compounds diets forpigs: a review.Anim. FeedSci.Techol.82:1-19. P.C.Vesseu Hartog, J.W.Schramaand 3563. andgenetic analyses prof microbial community conserveddifferent evolutionarily regions mucosa. Eur.J.Clin.Nutr. 56:S60-S64. selection. Am.J.Clin.Nutr. 66:515-520. modulation inhumans ofbloodleukocytes lacticacidbacteria:criteriaforstrain by Environ. Microbiol. 71:4214-4219. a novelthermotolerant bacterium, Lactobacillu forrapidand andassessmentofareal-time sensitivedetectionof PCRassay Development saponins and Microbiol. 27:35-38. binding patternsmucins ofintestinal inrats.Lab.Invest.73:558-564. altered resistancetoinfection.Am. J.Clin.Nutr.68 (Suppl. 2):447S-463S. Environ. Microbiol. 66:2263-2266. withinhumanfecalfloraby bacterial groups Appl. Microbiol. 85:769-777.substrates. J. and lactobacillifromsample humanfaecal MIYAIRI.Pediatr.Int.45:86-90. Yucca schidigera plantextractongrowth of associated diarrhea in children by diarrhea inchildrenby associated 210 Miyagawa, M.Tanaka,A.Komiyama, andS. of the small-subunit rRNA gene in PCR-based PCR-based of thesmall-subunitrRNA genein r. 1999.Fermented coproducts and fermented Assavanig, M.Wada, Assavanig, andA. Yokota. 2005. Tebbe.2001. Effectofprimers hybridizingto Continuous culture selectionofbifidobacteria and immunefunction:the biological basisof chwering, M. W. A. Verstegen, L.A.,den chwering, M.W.A.Verstegen, s using fructooligosaccharides as selective s usingfructooligosaccharides oligonucleotide probehybridization. Appl. s thermotolerans, in chicken feces. Appl. inchickenfeces. s thermotolerans, iling. Appl.Environ.Microbiol.67:3557- nce of diets and gut microflora on lecting nce ofdietsandgutmicroflora onlecting Göbel. 1998. In situ identification of Göbel.1998. Insituidentification of Escherichia coli Quillaja saponaria Literature cited Literature cited . Lett.Appl. Clostridium
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED spp. spp. strain Leptospira Lactobacillus reuteri ted with oligofructose, probiotics or probiotics or ted with oligofructose, Academic Publishers, Dordrecht, The Dordrecht, Publishers, Academic The ructurallyrelated synthetic food additives on Digestive Physiology in Pigs, Canada. in Pigs, on Digestive Physiology intensive pig experience with bioplexes in bacteria. J. Appl. Microbiol. 100:296-305. 100:296-305. Microbiol. bacteria. J. Appl. degradation in the rumen. Br. J. Nutr. 57:407- rumen. the degradation in Dohnt, M. L. Symonds, L. J. Barnett, and D. L. Dohnt, M. L. Symonds, Microorganisms as feed additives- probiotics. Microorganisms ite, H. R. Gaskins, and R. I. Mackie. 1999. s, and R. I. Mackie. 2000. Denaturing gradient gradient Denaturing s, and R. I. Mackie. 2000. and copper sulphate on growth performance of uomi. 1998. Carbadox, formic acid and potato acid and potato Carbadox, formic 1998. uomi. 1987. Use of particle-bound microbial enzyme enzyme Use of particle-bound microbial 1987. 2005. Mucin dynamics in the chicken jejunum Mucin dynamics 2005. 211
fibre as feed additives for growing pigs. J. Anim. Feed Sci. 7:205-209. Feed Sci. 7:205-209. J. Anim. growing pigs. fibre as feed additives for gel electrophoresis analysis of 16S Ribosomal DNA amplicons to monitor changesgel electrophoresis analysis to of 16S Ribosomal in fecal monitor DNA amplicons of introduction after weaning pigs bacterial populations of Pages 295-318 in 9th International Symposium Symposium International in 9th Pages 295-318 Application of denaturant gradient gel electrophoresis for the analysis of the porcine porcine the electrophoresis for the analysis of gradient gel denaturant of Application 36:167-179. Methods. J. Microbiol. gastrointestinal microbiota. MM53. Appl. Environ. Microbiol. 66:4705-4714. 66:4705-4714. Microbiol. Environ. MM53. Appl. B. McKay. 2002. A quantitative PCR (Taqman) assay for pathogenic of the interrelationship between zinc oxide of the interrelationship between following dietary mannoligosaccharides (Bio-Mos)following dietary and antibiotic growth promoter mannoligosaccharides health and disease. T gut function, 52 in: Avian Page supplementation. (Virginiamycin) ed. WPSA, Bristol, UK. Acamovic, Sci. 75:1861-1866. early-weaned pigs. J. Anim. and K. A. Jacques, eds.T. P. Lyons industry. in the Feed Biotechnology In: production. UK. University Nottingham, Nottingham Press. BMC Infect. Dis. 2:13. Gibson and M. R. Roberfroid, eds. Kluwer and M. R. Roberfroid, Gibson of piglets increases composition gain and symbiotics to suckling the preweaning weight Nutr. 59:419-427. Anim. Arch. intestinal microbiota. activityessentialAntimicrobial of and st oils and beneficial gut towards selected pathogenic fibre of extent and the rate activity to predict feeding antibiotic-free creep feed supplemen creep feed feeding antibiotic-free Netherlands. Netherlands. 415. Siljander-Rasi, H., T. Alaviuhkola, and K. S Siljander-Rasi, H., Orskov. Silva, A.T., R. J. Wallace, and E.R. Chapter 11 Chapter Si, W., J. Gong, R. Tsao, T. Zhou, H. Yu, C. Poppe, R. Johnson, and Z. Du. 2006. Du. 2006. and Z. Poppe, R. Johnson, H. Yu, C. T. Zhou, R. Tsao, Si, W., J. Gong, Shim, S. B., M. W. Verstegen, I. H. Kim, O. S. Kwon, and J. M. Verdonk. 2005. Effects of Effects of 2005. Verdonk. S. B., O. S. Kwon, and J. M. I. H. Kim, M. W. Verstegen, Shim, O., W. Vahjen, and L. Scharek. 2003. Simon, Simpson, J. M., V. J. McCrcken, B. Simpson, A. Wh H. R. Gaskin J. M., V. J. McCrcken, Simpson, Smirnov A., R. Perez, M. Thein, and Z. Uni. A., R. Perez, M. Thein, and Z. Smirnov Smith, J. W., M. D. Tokach, R. D. Goodband, J. L. Nelssen, and B. T. Richert. 1997. Effects Nelssen, and B. T. Richert. 1997. J. L. M. D. Tokach, R. D. Goodband, J. W., Smith, G. A. Smith, M. F. Smith, L. D., I. L. Smithe, Smits, R. J., and D. J. Henman. 2000. Practical R. J., and D. J. Henman. 2000. Smits,
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Spring, P.2004.Impact ofmannanoligosacchar Spring, P., C. Wenk,K.A.Dawson,andE.Newman.2000.Theeffectsofdietary Specian R.D.,and M.G. Oliver. 1991. Functional biology of intestinal goblet cells. Am. J. R.Southwick, S. P. L.,L.A.Ernst,E.W.Tauriello,S.R.Parker,B.Mujumdar, Sordeberg, T.A.,B.Sunzel,S.Holm, Snaidr, J.,R. Amann, I.Huber,W.Ludwig, a Stokes, C. R., M. A. Vega-López, M. Bailey, E. Termo, and B. G. Miller. 1992. Immune E.Termo,G. Miller.1992. Bailey, andB. M. Vega-López, M.A. Stokes, C.R., Stewart, C. S., K. Hillman, F.Maxwell,D. Stewart, C.S.,K.Hillman, Stewart, C.S.,A.Chesson.Makingsenseofprobiotics. 1993. J.31:11-33. Pig Veterinary 1995.MicrobialprobioticsforpigsStarvic, S.,E.T.Kornegay,R.J.Wallace.A.Chesson. Starling, J. R., andE. Balish. 1981. Lysosomal enzyme activityinpulmonary alveolar Stewart, C.S.1997. Microorganisms inhindgut fermentors.In: Gastrointestinal Stewart, C. S. 1999. Microorganisms in hindgutStewart, C.S.1999.Microorganisms fermentors.2 in the ceca of Salmonella-challenged broile the cecaofSalmonella-challenged andth parameters cecal on mannanoligosaccharides Physiol. 260:183-193. carboxymethildocyanine succimidyl esters.Cytometry 11:418-430. Waggone Mujumdar,H. A.CleverandS. 24:193-197. zinc oxidein vitro. Antibacterial effectof 63:2884-2896. and in situ identification of bacteria inactivated sludge. Appl.Environ. Microbiol. A. Varley, P. E. V.Williams,andT.L. A. Varley, J. Lawrence, eds.Edinburgh, UK. of developmentin thegastrointestinaltract York. Microbiol., R.I. Mackie andB.A. White, and poultry. Biotechnol. Anim.Anim. Feeds F Reticuloendothelial Soc.30:497 (abs). macrophages from conventional, germfree,mono ,eds.NottinghamTaylor-Pickard Press,U.K. University 93-105 in Interfacing Immunity, Gut Health andPerformance. L.A.Tucker andJ.A. New York. Microbiology. R.I.Mackie andB. A.White, eds.Chapman andHallMicrobiology Series. Notthingam, UK. andD. Nutrition. P.C.Garnsworthy Animal probiosis inpig:Observationsonthemicrobi
r chicks.Poult. Sci.79:205-211. Kelly, andT.P.King.1993.Recentadvancesin Kelly, eds. Chapman and Hall Microbiol. Series. New eds.ChapmanandHallMicrobiol.Series.New 212 Elmros, G.Hallman,andS.Sjoberg.1990. nd K. H. Schleifer. 1997. Phylogenetic nd K.H.Schleifer. analysis the pigs.In: Neonatalsurvivalandgrowth. M. Scand. J.Plast.Reconstr.Surg. HandSurg. ology ofthepiggut.In:RecentAdvancesin ide on guthealth and pigperformance.Pages ide on eeding. Weinheim, Pp Germany. 205-231. J. Cole, eds. Notthingam University Press, Notthingam University eds. J. Cole, r. 1990. Cyanine dye labellingreagents.- r. 1990.Cyanine dye associated, and conventionalized rats. J. e concentrations of enteric bacteria in in ofentericbacteria e concentrations nd edition.In : Gastrointestinal Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED with real-time PCR. with real-time nction, ileal and total tract nutrient via 5’-nuclease assays.via Appl. Environ. as caused by template annealing in the annealing in the as caused by template trations of protein catabolites in the large ted species represents a dominant group in human feces. J. Microbiol. Methods feces. J. Microbiol. Methods in human tion of sow’s feces by peiglets. Br. J. Nutr. of sow’s feces bytion peiglets. Supplemental fruuctooligosaccharides Supplemental and errant expansion of segmented filamentous filamentous of segmented expansion errant on of the rumen revealed rumen on of the 2001. Development and function of the pig of the pig and function Development 2001. Brewaeys, and J. M. Sutren, L. Rigottier-Gois, Matsui, M. Nakamura, and Y. Benno. 2001. and Y. Benno. 2001. Matsui, M. Nakamura, 004. Development of multi-color FISH of multi-color method 004. Development rs oesophagia. J. Comp. Path. 80:359-367. Path. 80:359-367. rs oesophagia. J. Comp. D. Feigh Environm ner. 1989. Lactobacilli and ner. 1989. Lactobacilli D. Feigh Environm 213 c microflora. Biol. Neonate 63:191-200. Biol. Neonate 63:191-200. c microflora. ong, 2000. Quantitative analysis of small-subunit Quantitative analysis2000. of ong, al tract. Appl. Microbiol. 55:1848-1851. al tract. Appl. Microbiol. S rRNA from communities revealsmany complex
possible relationship to ulceration on the pa on the ulceration possible relationship to 58:413-421. 58:413-421. for analysis species of seven Bifidobacterium novel molecular species within the human gut. Appl. Environ. Microbiol. 65:4799-807. 65:4799-807. Microbiol. Environ. Appl. gut. human species within the novel molecular 1981-1986. Acad. Sci. U.S.A. 101; Natl. bacteria in IgA-deficient gut. Proc. Direct analysis 16 of genes encoding gastrointestinal immune system. In: Digestive physiology of pigs. J. E. Lindberg and B. and B. Lindberg J. E. of pigs. Digestive physiology In: system. immune gastrointestinal UK. Ogle, eds. CAB International, prausnitzii and rela Doré. 2001. Fusobacterium 24:139-145. Microbiol. fecal flora. Syst. Appl. within the human bile salt hydrolase in the murine intestin Appl. Environ. Microbiol. 67:2766-74. 67:2766-74. Microbiol. Appl. Environ. selected bacterial groups of the pig coloni selected bacterial groups of bowel of dogs. J. Nutr. 132:980-989. J. Nutr. 132:980-989. bowel of dogs. mannanoligosaccharides influence immune fu populationsdigestibilities, and concen microbial N. R. Merchen and G. C. FaheyN. R. Merchen and G. Jr. 2002. 46:451-456. 46:451-456. Diet-dependent shifts in the bacterial populati amplification of mixtures 62:625- of rRNA genes byof 16S Microbiol. mixtures Appl. Environ. PCR. amplification 630. 4605-4614. Microbiol. 66, rRNA genes in mixed microbial populations rRNA genes in mixed ajima K., R. I. Aminov, T. Nagamine, H. T. Nagamine, K., R. I. Aminov, ajima Tannock, G. W., and J. D. B. Smith. 1970. The micro-flora of the pig stomach and itsmicro-flora of the pig stomach The 1970. D. B. Smith. and J. W., Tannock, G. Suau, A., V. Rochet, A. Sghir, G. Gramet, S. Rochet, Suau, A., V. 1996. Bi Suzuki, M. T., And S. J. Giovannoni. Suau A., R. G. R. Bonnet, M. Sutren, J. J. Godon, M. D. Collins, and J. Dore. 1999. Gibson, Ab Meek, and Y. Dot. 2004. D. Suzuki, K., Tannock, G. W., M. P. Dashkevicz, and S. Takada, T., K. Matsumoto, and K. Nomoto. 2 Takada, T., K. Matsumoto, Swords W. E., C. C. Wu, F. R. Champlin, and R. K. Buddington. 1993. Postnatal changes in Postnatal 1993. and R. K. Buddington. Swords W. E., C. C. Wu, F. R. Champlin, Suzuki, M. T., L. T. Taylor and E. F. DeL F. and E. Taylor L. T. T., Suzuki, M. The inges Gleed. 1981. Swanson, B.F. and P. L. Swanson, K. L. Bauer, S., C. M. Grieshop, E. A. Flickinger, L. H. P. Healy, K. A. Dawson, Chapter 11 Chapter R., M. Bailey,Stokes, C. and H. Haverson. T
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Trebesius, K., D. Harmsen, A.Rakin,J.Chme Trebesius, K.,D.Harmsen, Tortuero F., J. Rioperez,E.Fernandez, andM.L. Rodriguez. 1995. Responseofpigletsto Topping, D. L., and P. M. Clifton. 2001. Short-chain acids and humanfatty colonic function: Thomlinson, J.R.,andT. manipulation L.Lawrence.1981. Dietary of gastricpHinthe Turini,S.Stella. S. Galletti,J. Tedesco, D., W. Vahjen,M.Macha,andO.Simon.Taras, D., of performance 2005. Response Tannock, G.W.,2000. Molecular assessmentof antimicrobial diet, stress, microbiota by Tannock, G.W.1999.Modificationofthenormal Umesaki, Y., Y. Okada, S. Matsumoto, A. Y.Okada, Umesaki, Y., U Gibson. 2005. Anoveland G.R. M. Gee, Goulas, J. Tzortzis, G.,A.K. Turck, D.,A. S. Feste,andC.H.Lifschitz Trowell, H.,D.A.Southgate,T.M.Wolever, Tsiloyiannis V. K., S. C. Kyriakis, J. Tsiloyiannis Vlemma V. K.,S.C.Kyriakis, mesaki, S.Matsumoto, Y.,H.Setoyama, andY.Okada.1993. Expansion ofa vivo. J.Nutr. 135:1726-1731. continuous andin in vitrofermentation system misture increases th galactooligosaccharide oral administration oflacticacidbacteria.J.FoodProtec. 58:1369–1374 starchandnonstarchpo roles ofresistant 122. prophylaxis ofentericdiseaseinweanedpigs: somefield observations.Vet.Rec.109:120- growth andintestinalmicroflora ofweanlingpiglets. Ital.J.Anim.Sci. 4:494 (abs). 417. probiotic strain to l consistency characteistics andfecal 73:410S-414S. Chapman andHallMicrobiol.Series.NewYork. Mi agents, andprobiotics.In Gastrointestinal lymphocytes andinduce MHCclassIImolecules andfucosyl asialoGM1glycolipids on filamentous bacteriaare indigenous intes porcine colonia mucin.porcine colonia Pediatr.Res.33:564-567. for detection of Yersiniaspecies.J.Clin.Microbiol. 36:2557-2564. 1976. Letter: dietary fibre1976. refined.Lancet1:967. Letter:dietary situhybridizati PCRandin rRNA-Targeted germ-freemice anditsindependence intestinalreceptor bearing intraepithelially acids onthecontrol of porcine post-weaning Bacillus cereus var-toyoitosowsand piglets. Arch.Anim. Nutr.9 :405- from thymus.79:32-37. Immunology lysaccharides. Physiol. Rev.81:1031-1064. Physiol. lysaccharides. . 1993. Age anddiet affectthecomposition of 214 Imaoka, and H. Setoyama. 1995. Imaoka,andH.Setoyama. Segmented ong-lasting dietary supplementationong-lasting dietary withthe 2005. Effects of new natural feed additives on 2005. Effectsnatural feed ofnew on with fluorescently labelledoligonucleotides on withfluorescently A. R.Leeds,M.Gassull,andD.J.Jenkins. diarrhoea. Res.Vet.Sci.70:287-293. lz, and J. Heesemann. lz, andJ.Heesemann. mphocytesmicrobial colonization alters in s, andK.Sarris.2001.The effectoforganic tinal bacteria that activate intraepithelial activateintraepithelial tinal bacteriathat crobiol., R. I. Mackie and B. A. White, eds. White, eds. crobiol., R.I.MackieandB.A. e bifidobacerial population numbers ina e bifidobacerialpopulationnumbers theproximalcolonic contentsofpigsin intestinal microflora. Am.intestinal J.Clin.Nutr. 1998. Developmentof Literature cited Literature cited β T-cell
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED in young chickens. Poult. Sci. Poult. Sci. in young chickens. . Ann. Rev. Microbiol. 43:69-87. 43:69-87. Ann. Rev. Microbiol. . . L. A. Tucker and J. A. Taylor-Pickard, . L. A. Tucker and J. A. Taylor-Pickard, s of feeding fermented feed (poultry-by-s of feeding fermented health of the gastrointestinal tract. M. health of the gastrointestinal tract. C. perspective on fiber utilization by swine. J. P. G. Bijker, J. G. P. G. Bijker, J. G. L. G. van Logstetijn, and ation and activity of cellulytic bacteria fromof cellulytic ation and activity e human intestine and its consequences fore human intestine ndal, W. M. de Vos, and A. D. L. Akkermans. ndal, em. Curr. Issues Intest. Microbiol. 1:1-12. 1:1-12. Curr. Issues Intest. Microbiol. em. acts of obese and lean genotype pigs. Appl. acts of obese and lean genotype 1987. Influence of dietary Influence fiber on xylanolytic 1987. 2002. Alternatives to the use of antibiotics as of use Alternatives to the 2002. 215 e ex – germ-free mouse. Microbiol. Immunol. Immunol. Microbiol. e ex – germ-free mouse. nkx. 2002. Structural and functional aspects of a aspects and functional Structural 2002. nkx. Salmonella enteritidis e. Appl. Environ. Microbiol. 49:858-862. 49:858-862. Microbiol. e. Appl. Environ. Clostridium difficile
growth promoters for monogastric animals. Anim. Biotechnol. 13:113-127. Biotechnol. 13:113-127. Anim. animals. for monogastric growth promoters overgrowth by pathogens such as overgrowth by pathogens healthy tract. In: gastrointestinal and Nutrition Blok, et al., eds. Wageningen Academic Publishers, The Netherlands. piglets. Nutr. Res. 17:1517-1527. Res. 17:1517-1527. piglets. Nutr. products) to pigs. Vet. Q. 15:146-151. Vet. Q. 15:146-151. pigs. products) to van Gils. 1993. Microbial and nutritional aspect van Gils. 1993. Microbial 2000. A molecular view of intestinal ecosyst A molecular 2000. swine fed various levels of dietaryswine fed various levels of fibr Microbiol. 53:22-26. Appl. Environ. bacteria on adult pigs. and cellulolytic Sci. 75:2715-2722. Anim. intestine. Appl. Environ. Microbiol. 47:219-221. Microbiol. 47:219-221. intestine. Appl. Environ. bacterial populations in gastrointestinal tr bacterial populations in 44:107-112. Microbiol. Environ. H. Verheijden, and R. V. Knapen. 2001. Effect of fermented feed on the microbial feed on the 2001. Effect of fermented H. Verheijden, and R. V. Knapen. microbial 67:3071-3076. Microbiol. Environ. tracts of pigs. Appl. the gastrointestinal of population eds. Nottingham University Press, Nottingham, UK. University Press, Nottingham, eds. Nottingham Commensal bacteria and intestinal development. Studies using gnotobiotic pigs. In: Commensal pigs. In: bacteria and gnotobiotic using intestinal development. Studies health and performance Interfacing immunity,gut the samll intestinal epithelial cells in th intestinal epithelial the samll 39:555-562. Ducatelle. 2004. short-chain Microencapsulated fatty acids in feed colonization modify earlyand invasion after infection with 83:69-74. 83:69-74. alencia, Z., and E. R. Chavez. 1997. Lignin as a purified dietary fiber supplement for as a purified dietary Lignin fiber supplement 1997. Chavez. R. alencia, Z., and E. Van Dijk, J. E., J. Huisman, and J. F. Koni and Van Dijk, J. Huisman, E., J. Van Immerseel, F., V. Fievez, J. de Buck, Pasmans, F. A. Martel, F. Haesebrouck, and R. Van der Waaij, D. 1989. The ecology of th 1989. The ecology of Van der Waaij, D. V Verstegen, M. W. A. and B. A. Williams. Verstegen, B. A. Williams. M. W. A. and Varel, V. H., and J. T. Yen. 1997. Microbial Varel, V. H., and J. T. Yen. 1997. Microbial E., H. G. H. J. Heilig, E. G. Zoete Vaughan, E. Varel, V. H., and W. G. Pond. 1985. Enumer 1985. Pond. Varel, V. H., and W. G. Varel, V. H., S. J. Fryda, and I. M. Robinson. 1984. Cellulolytic bacteria from the large bacteria from Cellulolytic 1984. M. Robinson. I. and Varel, V. H., S. J. Fryda, Varel, V. H., W. G. Pond, J. C. Pekas, and Yen, J. T. 1982. Influence of high-fibre on Varel, of high-fibre on V. H., W. G. Pond, J. C. Pekas, and Yen, J. T. 1982. Influence Van Winsen, R. L., B. A. P. Urlings, L. J. A. Lipman,A. Snijders, J. M. J. D. Keuzenkamp, Van Kessel, A., T. W. Shirkey, R. H. Siggers, M. D. Drew, and B. Laarveld. 2004. 2004. M. D. Drew, and B. Laarveld. H. Siggers, R. Shirkey, Van Kessel, A., T. W. Urlings, H. A., A. J. Mul, A. T. van’t Klooster, Urlings, H. A., A. Chapter 11 Chapter Varel, V. H., I. M. Robinson, and H. J. Jung.
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Wang, R. F., W. W. Cao, andC.E.Cern Wang, R.F.,W.Cao, Wintzingerode, von,F., U. B.Göbel,and and A. Verstegen Williams,B. A.,M.W. White, L.A.,M.C.Newman,G.Cromwe Ward, T.L., G. A.Asche,F.Louis, and D.S. Pollman. 1996. Zinc-methionine improves Wang, M.,S.Ahrné,M.Antonsson,and G.Molin.2004.T-RFLP combined withprincipal Visek, W.J.1984.Ammonia:itseffectsonbi Wang, J.F.,Y.H.Zhu,D.F.Li,Z.Wang andB.Jensen.2004. Invitrofermentation of Wallgren, P. and L.Melin.20 McWilliamDuncan, E.C. Leitch,M.W.Child,andH.J.Flint.2005. S.H. Walker, A.W., situhybridisation forthe 2003.Fluorescencein Daims. andH. Wagner, M.,H.Matthias, W Walter, J., C. Hertel, G. W. Tannock, C.M.Lis,K.Munro,andW.P.Hammes.2001.Walter, J.,C.Hertel,G. and R.Amann.Wallner, G.,B.Fuchs,S.Spring, W. Beisker, 1997. Flow sortingof Appl. Environ. Microbiol. 67:2578-2585. using group-specificfeces by PCRprimers a Detection of 14:207-227. intestine ofsingle stomached Anim.s itsre and 2628. asasourceofmannan oligosaccharid yeast growth performance ofstarterpigs.J.Anim. Sci.74:S303. Microbiol. 62:1242-1247. Appl. Environ. samples. animal fecal inhumanand predominant anaerobicbacteria microbiota ininfantsofdiffere of fecal and 16S rRNAgene sequenc component analysis microbial diversity inenvironmentalmicrobial diversity samples: Microbiol. Rev. 21:213-229. various fiber and starch sources by various fiber pig fecal and starchsourcesby 71:3692-3700. colon.Appl.Environ. Microbiol. microbialcommunities fromthehuman ratios within pH andpeptide supply canradicallyalterb identification and characterisationofprokaryotes. Curr.Opin. Microbiol. 6:302-309. and offers adequatedetectionof with specificFNAprobes hybridization Sci. reproduction.67:373-380. J.Dairy microorganisms for molecular microorganisms for analysis. Appl. Environ. Microbiol. 63:4223-4231. Pig. Nutrition andmanagement. andJ. Wiseman, eds. CABIPublishing,UK. M.A.Varley aar, K., J. E. Degener, M. J. van Luyn, andH. E.Degener,M.J.vanLuyn, 2005.Fluorescentinsitu J. Harmsen. aar, K.,J. Enterococcus faecium Lactobacillus, Pediococcus,Leuconostoc, in clinicalsamples. J.Med.Microbiol. 54:937-944. 01. Weaning systems in relationto 01. Weaningsystemsdisease. In:TheWeaner in nt ages.J.Microbiol.Methods.59:53-69. iglia. 1996.PCRdectectionandquantitationof S. Tamminga. 2001. Fermentation in the large S. Tamminga.2001. Fermentationinthelarge 216 inocula.J.Anim. Sci.82:2615-2622. ll, and M.D.Lindemann.2002. Brewers dried ll, and acterial populationsacterial andshort acid chainfatty es forweanlingpigs.J.Anim. 80:2619- Sci. pitfalls of PCR-based rRNA analysis. FEMS pitfallsofPCR-basedrRNA analysis. E. Stackenbrandt. 1997. Determination of ological systems, metabolic hormones, and ological systems, nd denaturing gradient gel electrophoresis. nd denaturing gradient gelelectrophoresis. lationship to animal health. Nutr. Res. Rev. lationship toanimal health. Nutr.Res.Rev. ing: an effective strategy for comparisoning: aneffectivestrategy and Weissella Enterococcus faecalis Enterococcus species inhuman species Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED in Clostridium perfringens Clostridium . Surg. Infect. 6:185-195. 6:185-195. Infect. . Surg. velas bacterial shift during in vitro otic animal models: background and and background models: otic animal or solid-associated bacterial populations in la terrestris (L.) (Rodentia:Microtianae). la terrestris (L.) n 3-amino-1,4-dimethyl-5H-pyrido(4,3-b) n 3-amino-1,4-dimethyl-5H-pyrido(4,3-b) energy in conscious swine. requirement J. ea and feed efficiency in pigs. J. Appl. Santos, and C. Gil-Turnes. 1998. Effect of Santos, and C. Gil-Turnes. 1998. tabolic stress enhance the virulence of the n fatty isolated colon of the rat. acids on the ng piglet faeces as inoculum. Anerobepiglet faeces as inoculum. 9:175- ng 1994b. The role of feed consumption and feed The role of feed consumption 1994b. real-time PCR. Appl. Environ. Microbiol. Microbiol. PCR. Appl. real-time Environ. system and nutritional physiology. In: Swine 217 nd W. G. Pond. 1991. Potential contribution of of contribution Potential G. Pond. 1991. nd W. owth. J. Anim. Sci. 72:2385-2394 Sci. 72:2385-2394 J. Anim. owth. Pseudomonas aeruginosa
180. fermentation of fermentable carbohydrate of fermentable fermentation usi Akkermans, 2003. Analysis of 16S rDNA re of 16S 2003. Analysis Akkermans, efficiency in copper-stimulated gr efficiencycopper-stimulated in prevent absorption of the prevent absorption of the mutagen-carcinoge weanling in of copper injection intravenous by of growth Stimulation 1994a. A. Wong. Sci. 72:2395-2403. pigs. J. Anim. probiotic CenBiot on the control of diarrho probiotic CenBiot on the Microbiol. 84:68-71. 39:841-845. Microbiol. indole. Can. J. absorbed volatile fattyabsorbed volatile acids whole-animal to Sci. 69:2001-2012. Anim. Nutrition, 2nd ed. A. J. Lewis and L. Lee Southern, eds. CRC Press, NY, USA. A. J. Lewis and L. Lee Southern, eds. 2nd ed. Nutrition, J. Physiol. 368:667-678. 368:667-678. J. Physiol. human opportunistic pathogen pathogen opportunistic human J. C. Alverdy. 2005. Surgical injury and me and injury Surgical J. C. Alverdy. 2005. applications. Boca Raton, FL: CRC Press. applications. Boca and behaviour of captive water voles, Arvico of captive and behaviour the broiler fowl gastrointestinal tract fowl gastrointestinal the broiler by 71:3911-3916. A. 94:615-621. Physiol. Biochem. Comp. the rumen of dairy cows. J. Anim. Science. 79:2736-2746. Science. 79:2736-2746. of dairy Anim. the rumen cows. J. distribution and chemical composition of liquid- composition chemical distribution and ajima, T. 1985. Contractile effect of short-chai ajima, T. 1985. Contractile ani, J. L., F. Weykamp da Cruz, A. Freitas dos ani, J. L., F. Weykamp Zhu, W. Y., B. A. Williams, S. R. Konstantivnov, S. Tamminga, W. M. de Vos, and A. D. L. B. A. Williams, S. R. Konstantivnov,S. Tamminga, Zhu, W. Y., Zhou, W., E. T. Kornegay, M. D. Lindemann. Zhang, X. B., and Y. Ohta. 1993. Microorganisms in the gastrointestinal tract of the rat gastrointestinal tract of the rat in the Microorganisms 1993. Ohta. B., and Y. Zhang, X. J. W. G. M. Swinkels, M. K. Welton, and E. T. Kornegay, M. D. Lindemann, Zhou, W., E. Z Yen, J. T. 2001. Anatomyof the digestive Hill, a Yen, J. T., J. A. Nienaber, D. A. Yang, W. Z., K. A. Beauchemin and L. M. Rode, and L. Effect of dietary 2001. Yang, W. Z., K. A. Beauchemin factors on Y Wu, L. R., O. Zoborina, A. Zaborin, E. B. Chang, M. Musch, C. Holbrook, J. R. Turner, and Turner, and R. J. Musch, C. Holbrook, B. Chang, M. A. Zaborin, E. Zoborina, Wu, L. R., O. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271. Microbiol. Rev. BacterialWoese, C. R. 1987. evolution. effects of increased dietary The Woodall, P. F. 1989. the anatomy, cellulose on physiology Germfree gnotobi and S. 1996. B. Wostmann, Chapter 11 Chapter of Quantitative detection 2005. and G. R. Siragusa. G., Wise, M.
INTRODUCTION LITERATURE LITERATURE TRIAL I TRIAL II TRIAL III TRIAL IV TRIAL V REVIEW CITED Zoetendal, E. G., A. D. L. Akkermans, W. M. Akkermans, D. L. Zoetendal, E.G.,A. Zoetendal, E.G.,A.D.L.Akkermans,and Zijlstra, R. T., J. Odle, W. F. Hall, B. W. Pe F.Hall,B. J.Odle,W. Zijlstra, R.T., Zoetendal, E. G., K. Ben-Amor, H. J. M. Ha Zoetendal, E.G.,K.Ben-Amor,J. H. Zoetendal, E.G.,C.T.Collier,S.Koike,R.I. Zoetendal, E.G.,A.vonWright,T.Vilpponen-Sa infected with rotavirus. J. Pediatr. Gastroentero. Nutr. 19:382-390. infected withrotavirus.J.Pediatr.Gastroentero. administeredgrowth Effect oforally epidermal host-specific communities of activebacteria.Appl.Environ. Microbiol. 64:3854-3859.communities host-specific electrophoresis analysis of the16SrRNAelectrophoresis analysis from human tract.Microb.Ecol. gastrointestinal HealthDisease13:129-134. inthecommunity bacterial the 2001.Thehostgenotype affects W. M.deVos. and Visser, ecological analysis ofthe ecological analysis gastrointestinalNutr. 134:465-472. microbiota: Areview.J. Microbiol. 68:3401-3407. Appl. Environ. feces. are uniformly distributedalong the colon and differ from recovered from thecommunity and W.M.deVos.2002b. Mucosa-Associatedb rRNA-targeted probes.Appl. Environ. Microbiol. 68:4225-4232. fluorescentinsituh by samples human fecal M. deVos.2002a.Quantification ofuncultu 218 W. M.de Vos.1998. Temperaturegradient gel rmsen, F.Schut,A.D.L.Akkermans,andW. tschow, H.B.Gelberg,andR.E.Litov.1994. Mackie,andH.R.Gaskins.2004.Molecular Akkermans-van Vliet,J.A.Arjan,G.M.de fator of on intestinalrecovery neonatal pigs red Ruminococcus obeum-likebacteria in ybridization andflow lmela,D. L.Akkermans,K. Ben-Amor, A. acteria inthehumangastrointestinaltract human fecalsamples cytometry using cytometry 16 reveals stable and reveals stableand Literature cited Literature cited
TRIAL V TRIAL IV TRIAL III TRIAL II TRIAL I LITERATURE LITERATURE INTRODUCTION REVIEW CITED