1 Zinc-Finger Endonuclease Targeting PSIP-1 Inhibits HIV-1 Integration 1 2
Total Page：16
File Type：pdf, Size：1020Kb
AAC Accepts, published online ahead of print on 12 May 2014 Antimicrob. Agents Chemother. doi:10.1128/AAC.02690-14 Copyright © 2014, American Society for Microbiology. All Rights Reserved. 1 Zinc-finger endonuclease targeting PSIP-1 inhibits HIV-1 integration 2 3 Roger Badia, Eduardo Pauls, Eva Riveira-Munoz, Bonaventura Clotet, José A. Esté* 4 and Ester Ballana 5 6 IrsiCaixa, Hospital Universitari Germans Trias i Pujol, Universitat Autònoma de 7 Barcelona, 08916 Badalona, Spain. 8 9 Running title: ZFN targeting PSIP1 inhibits HIV-1 integration 10 11 12 13 * Corresponding author mailing address: 14 José A. Esté 15 IrsiCaixa, Hospital Germans Trias i Pujol, C. Canyet s/n, 08916 Badalona, Spain 16 Phone: 34 934656374 17 FAX: 34 934653968 18 E-mail: [email protected] 19 20 Key words 21 Zinc finger endonuclease, Ledgf/p75, integrase, HIV-1 22 1 23 ABSTRACT 24 Genome editing using zinc-finger nucleases (ZFN) has been successfully 25 applied to disrupt CCR5 or CXCR4 host factors, inhibiting viral entry and infection. 26 Gene therapy using ZFN to modify PSIP1 gene, encoding for LEDGF protein, might 27 restrain an early step of viral replication cycle at the integration level. ZFNs targeting 28 the PSIP1 gene (ZFNLEDGF) were designed to specifically recognize the sequence after 29 the integrase binding domain (IBD) of LEDGF/p75 protein. ZFNLEDGF 30 successfully recognized the target region of the PSIP1 gene in TZM-bl cells by 31 heteroduplex formation and DNA sequence analysis. Gene editing induced a frame 32 shift of the coding region and resulted in the abolishment of LEDGF expression at 33 mRNA and protein level. Functional assays revealed that infection with HIV-1 R5 BaL 34 or X4 NL4-3 viral strains was impaired in LEDGF/p75 knock-out cells regardless of 35 entry tropism, due to a blockade in HIV-1 provirus integration into host genome. 36 However, residual infection was detected in LEDGF knock-out cells. Indeed, LEDGF 37 knock-out restriction was overcome at high multiplicity of infection, suggesting 38 alternative mechanisms for HIV-1 genome integration rather than LEDGF/p75. 39 Observed residual integration was, however, sensitive to the integrase inhibitor 40 Raltegravir. These results demonstrate that the described ZFNLEDGF effectively targets 41 PSIP1 gene which is involved at early steps of viral replication cycle and thus 42 ZFNLEDGF may become a potential antiviral agent to restrict HIV-1 integration. 43 Moreover, LEDGF knock-out cells represent a potent tool to elucidate the role of HIV 44 integration cofactors in virus replication. 45 2 46 INTRODUCTION 47 Human immunodeficiency virus (HIV) requires the host cellular machinery to 48 successfully replicate (1). Developing of genome editing tools, such as zinc finger 49 endonucleases (ZFNs) (2), transcription activator-like [TAL] effector nuclease 50 (TALEN) (3) or clustered regulatory interspaced short palindromic repeat (CRISPR) 51 (4-6) become a promising alternative to modify essential host factors along the 52 replication cycle of HIV (7, 8). ZFNs have demonstrated their applicability to 53 reproduce in vitro the CCR5Δ32 phenotype by successfully cleaving the CCR5 gene, 54 generating human CD4+ T cells refractory to HIV-1 infection (9-12). Similarly, ZFNs 55 approach successfully cleaved the alternative HIV-1 coreceptor CXCR4 in CD4+ T 56 cells from humanized mice model resulting in impaired HIV-1 infection (13). Genome 57 editing as anti-HIV therapy is currently under study in at least 2-3 clinical trials using 58 ZFNs targeting CCR5. However, similar strategies targeting host cellular factors 59 affecting later steps of the virus replication cycle have not been evaluated. 60 A crucial step of the viral replication cycle is exerted by the lens epithelium- 61 derived growth factor (LEDGF/p75), a member of the hepatoma-derived growth factor 62 (HDGF) related protein (HRP) family. HRPs are characterized by a conserved N- 63 terminal PWWP domain, an ,90– to 135–amino acid module found in a variety of 64 nuclear proteins (14). Six human HRP family members have been described: HDGF, 65 HRP1, HRP2, HRP3, LEDGF/p75, and LEDGF/p52. Two of them, LEDGF/p75 and 66 HRP2, possess affinity for HIV-1 integrase (IN), given by a second evolutionary 67 conserved domain within their C-termini that mediates the interaction with HIV-1 IN, 68 hence the term ‘‘IN-binding domain (IBD)’’(15). Initially identified as IN associated 69 protein (16), LEDGF/p75 was revealed as a lentivirus-specific cellular cofactor 70 required for HIV integration into the host genome (see references (17, 18) and (19) for 71 review). LEDGF/p75 directly interacts with viral HIV-IN, tethering viral preintegration 72 complex into active transcription units of the cellular chromatin. The role of 73 LEDGF/p75 in HIV-1 replication was studied using RNA interference (RNAi) 74 targeting LEDGF/p75 and LEDGF KO murine embryonic fibroblasts (MEF). Although 75 both strategies potently downregulate or completely abolished LEDGF/p75 expression, 76 residual replication was observed. Thus, all studies point to a key but not essential role 77 for LEDGF/p75 in lentiviral replication and suggested that the existence of alternative 78 cellular cofactors, such as HRP2, were responsible for the residual replication observed 79 in the absence of LEDGF/p75 (20, 21). 3 80 Nevertheless, the LEDGF/p75 interaction with HIV-IN has been suggested as valid 81 target for antiviral therapy (22-24). In that sense, recently developed allosteric 82 LEDGF/p75-IN interaction inhibitors (LEDGINs and ALLINIS) have been proved to 83 target the LEDGF/p75 binding pocket of HIV-IN and to inhibit the catalytic activity of 84 the IN. Moreover, LEDGINs and ALLINIS also exert antiviral activity by promoting 85 IN multimerisation. Aberrant IN complexes lead to the formation of defective regular 86 cores during the maturation process, resulting in an impaired the infectivity of the new 87 viral particles (25-27) 88 On the other hand, a series of PSIP1 single nucleotide polymorphisms (SNP) 89 were associated to HIV-1 disease progression in cohorts of African and Caucasian 90 HIV-1 positive individuals (28) (29). In addition, two missense mutations were 91 identified in two samples belonging to a LTNP cohort (30). All missense mutations 92 identified are located in the helix-turn-helix (HTH) motifs at the C-terminal region of 93 the protein, after the IBD domain. Although none of the mutations restricted HIV 94 replication in vitro (29, 31, 32), these findings suggested that genetic variation in PSIP1 95 may influence susceptibility to HIV-1 infection and disease progression. 96 Here, we describe a novel genome editing ZFN that specifically disrupt the 97 PSIP1 gene encoding LEDGF/p75 in its C-terminus, after all relevant functional 98 domains and nearby the missesense mutations described in patients (ZFNLEDGF). 99 ZFNLEDGF was able to generate LEDGF/p75 cells expressing a truncated protein that 100 become refractory to HIV-1 integration. Generated LEDGF/p75 knock-out cells 101 represent a potent tool to further investigate the function of LEDGF/p75 protein and 102 may help to elucidate the role of HIV integration cofactors in virus replication. 103 Moreover, the ZFNLEDGF may become a potential antiviral strategy to restrict HIV-1 104 integration and virus replication in vivo. 105 106 107 4 108 MATERIALS AND METHODS 109 Vectors. CompoZr™ Knockout Zinc Finger Nucleases targeting the PSIP1 gene 110 (ZFNLEDGF) were obtained from Sigma-Aldrich Biotechnology (St. Louis, Missouri, 111 USA). Briefly, ZFNLEDGF were designed to target the sequence 112 AACATGTTCTTGGTTGGTGAAGGAGATTCCGTG (Fig. 1A), according to 113 Mussolino and Cathomen guidelines (33) to ensure minimal homology of ZFN DNA- 114 binding domain to any other site in the genome. The FokI and zinc finger domains of 115 each ZFNs pair were assembled as previously described (34). Next, ZFNLEDGF pairs 116 were cloned into the pLVX-IRES-ZsGreen1 vector (Clontech, Takara Bio Company), 117 by replacing the EcoRI-XbaI fragment, to obtain ZFNLEDGF tagged with the green 118 fluorescent reporter gene (pLVX-ZFNLEDGF-ZsGreen). 119 120 Cells. Human K562 cells were obtained from ATCC (CCL-243) and grown in Iscove’s 121 Modified Dulbecco’s Medium, supplemented with 10% FBS and 2 mM L-glutamine. 122 TZM-bl cell line (NIH AIDS Research and Reference Program), was grown in 123 Dulbecco's modified Eagle's medium (DMEM, Gibco, Life Technologies, Madrid, 124 Spain) supplemented with 10% of heat-inactivated foetal calf serum (FCS, Gibco, 125 Thermofisher, Madrid, Spain) and antibiotics 100 U/ml penicillin, 100 μg/ml 126 streptomycin (Life Technologies) and maintained at 37ºC in a 5% CO2 incubator. 127 128 ZFN Transfection. TZM-bl cells were transfected with ZFNLEDGF expressing plasmids 129 as described previously (35, 36). Briefly, 1.5x105 cells were seeded in 24 well plates. 130 After overnight culture, 0.5μg of each ZFNLEDGF plasmids was mixed with 131 Lipofectamine 2000 reagent (Invitrogen) in serum-free medium OptiMEM (Invitrogen) 132 and then added to previously washed cells. Media was replaced by fresh DMEM 4 133 hours after transfection and left in the incubator for 3 days, when ZsGreen positive cells 134 were sorted were sorted using a FACSAria II (BD Biosciences) flow cytometer. Single 135 cell clones were obtained by limiting dilution seeding of sorted cells in 96-well plates. 136 137 Analysis of PSIP1 disruption by Cel-I Assay. The effect of ZFN on PSIP1 alleles 138 was assessed by performing PCR surrounding ZFN target site followed by digestion 139 with the Surveyor (Cel-1) nuclease assay (Transgenomic, Omaha, NE, USA), which 140 cleaves DNA heteroduplex at mismatch sites. Generated fragments were resolved by 141 10% polyacrylamide electrophoresis as previously described (10, 12). 5 142 Sequence analysis of targeted PSIP1 gene in TZMbl cells.