1 Zinc-Finger Endonuclease Targeting PSIP-1 Inhibits HIV-1 Integration 1 2

1 Zinc-finger endonuclease targeting PSIP-1 inhibits HIV-1 integration

2 3 Roger Badia, Eduardo Pauls, Eva Riveira-Munoz, Bonaventura Clotet, José A. Esté*

4 and Ester Ballana

6 IrsiCaixa, Hospital Universitari Germans Trias i Pujol, Universitat Autònoma de

7 Barcelona, 08916 Badalona, Spain.

9 Running title: ZFN targeting PSIP1 inhibits HIV-1 integration

13 * Corresponding author mailing address:

14 José A. Esté 15 IrsiCaixa, Hospital Germans Trias i Pujol, C. Canyet s/n, 08916 Badalona, Spain 16 Phone: 34 934656374 17 FAX: 34 934653968 18 E-mail: [email protected] 19

20 Key words

21 Zinc finger endonuclease, Ledgf/p75, integrase, HIV-1

1 23 ABSTRACT

24 Genome editing using zinc-finger nucleases (ZFN) has been successfully 25 applied to disrupt CCR5 or CXCR4 host factors, inhibiting viral entry and infection. 26 Gene therapy using ZFN to modify PSIP1 gene, encoding for LEDGF protein, might 27 restrain an early step of viral replication cycle at the integration level. ZFNs targeting

28 the PSIP1 gene (ZFNLEDGF) were designed to specifically recognize the sequence after

29 the integrase binding domain (IBD) of LEDGF/p75 protein. ZFNLEDGF 30 successfully recognized the target region of the PSIP1 gene in TZM-bl cells by 31 heteroduplex formation and DNA sequence analysis. Gene editing induced a frame 32 shift of the coding region and resulted in the abolishment of LEDGF expression at 33 mRNA and protein level. Functional assays revealed that infection with HIV-1 R5 BaL 34 or X4 NL4-3 viral strains was impaired in LEDGF/p75 knock-out cells regardless of 35 entry tropism, due to a blockade in HIV-1 provirus integration into host genome. 36 However, residual infection was detected in LEDGF knock-out cells. Indeed, LEDGF 37 knock-out restriction was overcome at high multiplicity of infection, suggesting 38 alternative mechanisms for HIV-1 genome integration rather than LEDGF/p75. 39 Observed residual integration was, however, sensitive to the integrase inhibitor

40 Raltegravir. These results demonstrate that the described ZFNLEDGF effectively targets 41 PSIP1 gene which is involved at early steps of viral replication cycle and thus

42 ZFNLEDGF may become a potential antiviral agent to restrict HIV-1 integration. 43 Moreover, LEDGF knock-out cells represent a potent tool to elucidate the role of HIV 44 integration cofactors in virus replication. 45

2 46 INTRODUCTION 47 Human immunodeficiency virus (HIV) requires the host cellular machinery to 48 successfully replicate (1). Developing of genome editing tools, such as zinc finger 49 endonucleases (ZFNs) (2), transcription activator-like [TAL] effector nuclease 50 (TALEN) (3) or clustered regulatory interspaced short palindromic repeat (CRISPR) 51 (4-6) become a promising alternative to modify essential host factors along the 52 replication cycle of HIV (7, 8). ZFNs have demonstrated their applicability to 53 reproduce in vitro the CCR5Δ32 phenotype by successfully cleaving the CCR5 gene, 54 generating human CD4+ T cells refractory to HIV-1 infection (9-12). Similarly, ZFNs 55 approach successfully cleaved the alternative HIV-1 coreceptor CXCR4 in CD4+ T 56 cells from humanized mice model resulting in impaired HIV-1 infection (13). Genome 57 editing as anti-HIV therapy is currently under study in at least 2-3 clinical trials using 58 ZFNs targeting CCR5. However, similar strategies targeting host cellular factors 59 affecting later steps of the virus replication cycle have not been evaluated. 60 A crucial step of the viral replication cycle is exerted by the lens epithelium- 61 derived growth factor (LEDGF/p75), a member of the hepatoma-derived growth factor 62 (HDGF) related protein (HRP) family. HRPs are characterized by a conserved N- 63 terminal PWWP domain, an ,90– to 135–amino acid module found in a variety of 64 nuclear proteins (14). Six human HRP family members have been described: HDGF, 65 HRP1, HRP2, HRP3, LEDGF/p75, and LEDGF/p52. Two of them, LEDGF/p75 and 66 HRP2, possess affinity for HIV-1 integrase (IN), given by a second evolutionary 67 conserved domain within their C-termini that mediates the interaction with HIV-1 IN, 68 hence the term ‘‘IN-binding domain (IBD)’’(15). Initially identified as IN associated 69 protein (16), LEDGF/p75 was revealed as a lentivirus-specific cellular cofactor 70 required for HIV integration into the host genome (see references (17, 18) and (19) for 71 review). LEDGF/p75 directly interacts with viral HIV-IN, tethering viral preintegration 72 complex into active transcription units of the cellular chromatin. The role of 73 LEDGF/p75 in HIV-1 replication was studied using RNA interference (RNAi) 74 targeting LEDGF/p75 and LEDGF KO murine embryonic fibroblasts (MEF). Although 75 both strategies potently downregulate or completely abolished LEDGF/p75 expression, 76 residual replication was observed. Thus, all studies point to a key but not essential role 77 for LEDGF/p75 in lentiviral replication and suggested that the existence of alternative 78 cellular cofactors, such as HRP2, were responsible for the residual replication observed 79 in the absence of LEDGF/p75 (20, 21).

3 80 Nevertheless, the LEDGF/p75 interaction with HIV-IN has been suggested as valid 81 target for antiviral therapy (22-24). In that sense, recently developed allosteric 82 LEDGF/p75-IN interaction inhibitors (LEDGINs and ALLINIS) have been proved to 83 target the LEDGF/p75 binding pocket of HIV-IN and to inhibit the catalytic activity of 84 the IN. Moreover, LEDGINs and ALLINIS also exert antiviral activity by promoting 85 IN multimerisation. Aberrant IN complexes lead to the formation of defective regular 86 cores during the maturation process, resulting in an impaired the infectivity of the new 87 viral particles (25-27) 88 On the other hand, a series of PSIP1 single nucleotide polymorphisms (SNP) 89 were associated to HIV-1 disease progression in cohorts of African and Caucasian 90 HIV-1 positive individuals (28) (29). In addition, two missense mutations were 91 identified in two samples belonging to a LTNP cohort (30). All missense mutations 92 identified are located in the helix-turn-helix (HTH) motifs at the C-terminal region of 93 the protein, after the IBD domain. Although none of the mutations restricted HIV 94 replication in vitro (29, 31, 32), these findings suggested that genetic variation in PSIP1 95 may influence susceptibility to HIV-1 infection and disease progression. 96 Here, we describe a novel genome editing ZFN that specifically disrupt the 97 PSIP1 gene encoding LEDGF/p75 in its C-terminus, after all relevant functional

98 domains and nearby the missesense mutations described in patients (ZFNLEDGF).

99 ZFNLEDGF was able to generate LEDGF/p75 cells expressing a truncated protein that 100 become refractory to HIV-1 integration. Generated LEDGF/p75 knock-out cells 101 represent a potent tool to further investigate the function of LEDGF/p75 protein and 102 may help to elucidate the role of HIV integration cofactors in virus replication.

103 Moreover, the ZFNLEDGF may become a potential antiviral strategy to restrict HIV-1 104 integration and virus replication in vivo. 105 106 107

4 108 MATERIALS AND METHODS 109 Vectors. CompoZr™ Knockout Zinc Finger Nucleases targeting the PSIP1 gene

110 (ZFNLEDGF) were obtained from Sigma-Aldrich Biotechnology (St. Louis, Missouri,

111 USA). Briefly, ZFNLEDGF were designed to target the sequence 112 AACATGTTCTTGGTTGGTGAAGGAGATTCCGTG (Fig. 1A), according to 113 Mussolino and Cathomen guidelines (33) to ensure minimal homology of ZFN DNA- 114 binding domain to any other site in the genome. The FokI and zinc finger domains of

115 each ZFNs pair were assembled as previously described (34). Next, ZFNLEDGF pairs 116 were cloned into the pLVX-IRES-ZsGreen1 vector (Clontech, Takara Bio Company),

117 by replacing the EcoRI-XbaI fragment, to obtain ZFNLEDGF tagged with the green 118 fluorescent reporter gene (pLVX-ZFNLEDGF-ZsGreen). 119 120 Cells. Human K562 cells were obtained from ATCC (CCL-243) and grown in Iscove’s 121 Modified Dulbecco’s Medium, supplemented with 10% FBS and 2 mM L-glutamine. 122 TZM-bl cell line (NIH AIDS Research and Reference Program), was grown in 123 Dulbecco's modified Eagle's medium (DMEM, Gibco, Life Technologies, Madrid, 124 Spain) supplemented with 10% of heat-inactivated foetal calf serum (FCS, Gibco, 125 Thermofisher, Madrid, Spain) and antibiotics 100 U/ml penicillin, 100 μg/ml 126 streptomycin (Life Technologies) and maintained at 37ºC in a 5% CO2 incubator. 127

128 ZFN Transfection. TZM-bl cells were transfected with ZFNLEDGF expressing plasmids 129 as described previously (35, 36). Briefly, 1.5x105 cells were seeded in 24 well plates.

130 After overnight culture, 0.5μg of each ZFNLEDGF plasmids was mixed with 131 Lipofectamine 2000 reagent (Invitrogen) in serum-free medium OptiMEM (Invitrogen) 132 and then added to previously washed cells. Media was replaced by fresh DMEM 4 133 hours after transfection and left in the incubator for 3 days, when ZsGreen positive cells 134 were sorted were sorted using a FACSAria II (BD Biosciences) flow cytometer. Single 135 cell clones were obtained by limiting dilution seeding of sorted cells in 96-well plates. 136 137 Analysis of PSIP1 disruption by Cel-I Assay. The effect of ZFN on PSIP1 alleles 138 was assessed by performing PCR surrounding ZFN target site followed by digestion 139 with the Surveyor (Cel-1) nuclease assay (Transgenomic, Omaha, NE, USA), which 140 cleaves DNA heteroduplex at mismatch sites. Generated fragments were resolved by 141 10% polyacrylamide electrophoresis as previously described (10, 12).

5 142 Sequence analysis of targeted PSIP1 gene in TZMbl cells. Genomic DNA from 143 sorted cell clones was extracted using the QIAamp DNA Blood Mini Kit (Qiagen, 144 Barcelona, Spain). Extracted DNA was used to amplify the LEDGF gene using Expand 145 High Fidelity PCR System (Roche, Barcelona, Spain) and the following primers 146 (Forward 5’-TTCAAGTCATGTGGATTCTTTGA-3’ and Reverse 5’- 147 TCTAGCTTTTTGTTTGGCCC-3’). PCR products were cloned into the pGEM-T Easy 148 Vector System (Promega, Madrid, Spain) according to the manufacturer’s instructions. 149 Plasmid sequencing was carried out by the Macrogen Genomic Division, Seoul, Korea 150 using ABI PRISM Big Dye TM Terminator Cycle Sequencing technology (Applied 151 BioSystems), with the following internal primers of PSIP1 genomic sequence 152 (Forward: 5’-TTGGAAACGATCTTTAGAAACAGA-3’ and Reverse: 5’- 153 CAGTGAAACTATGTATGAAAGCCATT-3’). When bigger deletions where 154 observed, sequences were obtained directly from mRNA sequence (see above). 155 Sequences were analyzed with the Sequencher 4.5 software (Gene Codes Corporation, 156 Ann Arbor, MI USA). In addition, a bioinformatics algorithm (Sigma) was used to

157 evaluate the putative off-target effects for ZFNLEDGF throughout the human genome. 158 In silico prediction of mRNA and protein sequences of the edited cell clones was 159 perfomed using the Expasy: SIB bioinformatics resource portal (37). 160 161 Quantitative RT-polymerase chain reaction (qRT-PCR) and mRNA expression 162 assessment. Relative mRNA quantification of PSIP1 expression was assessed by qRT- 163 PCR as previously described (38, 39). Briefly, RNA was extracted using the Qiagen 164 RNeasy Mini Extraction kit (Qiagen) according to the manufacturer’s instructions, 165 including the DNase I treatment step. Reverse transcriptase was performed using the 166 High Capacity cDNA Reverse Transcription Kit (Life technologies, Madrid, Spain). To 167 assess presence of the predicted PSIP1 mRNA truncated forms, its mRNA sequence 168 was divided in two fragments of similar size, which were PCR amplified with the 169 following primers for the 5’-containing fragment, Forward: 5’- 170 GGCAAACCAAATAAAAGAAAAGG-3’ and Reverse: 5’- 171 CTTGCTTGCGTTTTCGATCT-3’; and 3’-containing fragment, Forward: 5’- 172 AAAAGGTGGGAGGAACTTTCA-3’ and Reverse: 5’- 173 GCAGTCTATTTCAAATGAAAACCAT-3’. Relative gene expression of PSIP1 wild- 174 type form was also measured by two-step quantitative RT-PCR and normalized to

6 175 GADPDH gene expression using the delta-delta Ct method. Primers and DNA probes 176 were purchased from Life Technologies. 177 178 Western blot. Treated cells were rinsed in ice-cold PBS, nuclear proteins were 179 enriched using the CelLytic Nuclear Extraction Kit (Sigma) and extracts were prepared 180 in lysis buffer (50 mM Tris HCl pH 7.5, 1 mM EDTA, 1 mM EGTA, 1 mM Na3VO4, 181 10 mM Na β-glycerophosphate, 50 mM NaF, 5 mM Na Pyrophosphate, 270 mM 182 sucrose and 1% Triton X-100) supplemented with protease inhibitor cocktail (Roche) 183 and 1 mM phenylmethylsulfonyl fluoride. Samples were run using NuPage 4-12% Bis- 184 Tris gel (Novex, Lifetechnologies) and blotted onto nitrocellulose membranes. Blocked 185 membranes were incubated overnight with monoclonal antibodies (mAbs) against 186 human C-terminus LEDGF protein (C57G11, Cell Signalling Technologies), human N- 187 terminus LEDGF protein (Clone 26, 611714, BD transduction laboratories) and β-actin 188 (Sigma-Aldrich) at 4°C. After washing, the membranes were incubated with a 189 secondary conjugated horseradish peroxidase antibody for 1 hour at room temperature 190 and then revealed with SuperSignal West Pico Chemiluminescent Substrate (Pierce 191 Chemical, Rockford, IL). 192 193 Virus production and infections. VSV-pseudotyped NL4-3 GFP-expressing virus 194 (40) was produced as described previously (39). The HIV-1 viral strains BaL (R5- 195 tropic) and NL4–3 (X4-tropic) were obtained from the MRC Centre for AIDS Reagents 196 (London, UK). BaL and NL4-3 strains were grown in PBMCs or lymphoid MT-4 cell 197 line, respectively. Both viral stocks were titrated for its use in TZM-bl cells. For 198 infections, 1.5x104 TZM-bl cells were seeded in 96-well plates and infected with BaL 199 and NL4-3 viral strains at a multiplicity of infection of 0.01. The CXCR4 antagonist 200 AMD3100 (Sigma-Aldrich), the reverse transcriptase inhibitor 3-azido-3- 201 deoxythymidine (zidovudine; AZT, Sigma-Aldrich) and the IN strand transfer inhibitor 202 Raltegravir (Ral, Merck) were used as controls. For the β-galactosidase assays, cells 203 were lysed 72 h after infection and kept frozen until the β-galactosidase determination.

204 To assess ZFNLEDGF effect on viral integration, cells were infected with NL4-3 and 205 after 8 h of infection, cells were lysed and DNA was harvested to measure viral DNA. 206 To determine viral integration, cells were infected and 8 h after infection fresh growth 207 medium supplemented with 10 μg/ml of the neutralizing anti-gp120 mAb IgGb12

7 208 (Polymun Scientific) was added and left in the incubator for 24 h, when DNA was 209 harvested and stored at -20 ºC until the viral integrated DNA was determined. 210 211 β-Galactosidase detection assay. β-galactosidase activity in 30 μl cell extracts was 212 quantified by a colorimetric assay as described elsewhere (39, 41). Absorbance (405- 213 620 nm) of non-infected samples was subtracted from the rest of samples and values 214 expressed as percentage of β-galactosidase activity relative to non-drug treated control. 215 216 Viral and integrated DNA determination. Viral DNA was extracted using a QiaAmp 217 DNA extraction kit (QIAmp DNA Blood Mini kit; Qiagen). Total viral DNA was 218 quantified by amplifiying a Gag fragment as described elsewhere (primers, 219 5′CAAGCAGCCATGCAAATGTT-3′[forward] and 5′- 220 TGCACTGGATGCAATCTATCC-3′[reverse]; probe, 5′- 221 [FAM]AAAGAGACCATCAATGAGGAAGCTGCAGA[TAMRA]-3′) (39, 41). 222 Integration was detected by Alu-long terminal repeat (LTR) preamplification (primers, 223 5’-GCCTCCCAAAGTGCTGGGATTACAG-3’ [forward, Alu] and 5’- 224 AGGGTTCCTTTGGTCCTTGT-3’ [reverse, LTR] followed by gag qPCR. 225 226 Statistical analyses. Experimental data are presented as mean  SD. Paired Student’s t 227 test was used for comparison between two groups, using the GraphPad Prism software 228 (GraphPad Software, San Diego, California, USA). A p-value of 0.05 was considered 229 to be statistically significant. 230 231

8 232 RESULTS 233

234 Design and efficiency of the ZFNLEDGF. ZFNs targeting PSIP1 were designed to 235 specifically disrupt the C-terminal region where mutations in HIV patients have been 236 identified, after the sequence coding for the IBD of LEDGF/p75 (Fig. 1 A) (30, 32).

237 The endonuclease activity of the ZFNLEDGF was determined in vitro in K562 cells and 238 by assessment of heteroduplex formation in the surrounding region of the targeted 239 DNA sequence within the PSIP1. Endonuclease activity in human K562 cells was 240 estimated as 6.6% when transfecting plasmids encoding the ZFN, increasing to 12% 241 when using ZFN mRNA. Applicability of ZFNs is hampered by the potential risk of 242 off-site cutting events leading to undesired side-effects (42). Since off-target events 243 have been reported for the previously described ZFNs targeting the CCR5 gene (43,

244 44), the possibility of off-site cutting events for the ZFNLEDGF was in silico assessed.

245 The in silico analysis predicted up to 19 potential off-target sites for ZFNLEDGF, all with 246 at least 4 mismatches compared to target sequence and corresponding to 9 coding 247 regions distributed in 7 different chromosomes of the human genome (Suppl. Table 1). 248 To improve ZFN efficiency and speed up the selection of single cell clones

249 edited by ZFNLEDGF, the sequence encoding ZFNLEDGF was cloned in plasmids carrying 250 a ZsGreen reporter gene, whose expression was transient. After transfection, 15% of 251 cells were ZsGreen positive, a population that was enriched to 95% of ZsGreen positive

252 cells by cell sorting. Monoclonal cell populations of ZFNLEDGF-treated cells were 253 obtained by limiting dilution, resulting in 38 single clonal cell lines of which 6 254 presented slow growth kinetics and were discarded. Thus, further functional 255 characterization was performed in 32 clonal cell lines.

256 The ZFNLEDGF treated monoclonal cell lines were screened for its capacity to 257 restrict single round HIV-1 infection by measuring the fluorescence induced by a VSV- 258 pseudotyped NL4-3 GFP-expressing virus. Although different degrees of HIV infection 259 were identified, 25 out of 32 cell lines blocked HIV replication over 50% compared to 260 wild-type control cells, suggesting that PSIP1 gene has been effectively targeted and 261 genomically edited (Table 1). Only in 7 cell lines residual or no effect on HIV 262 replication was observed, representing an efficiency of 70% for the overall 263 experimental procedure. Then, three of the cell lines were chosen for further validation, 264 taking into account their different degrees of HIV infection impairment with a full

265 replication virus (Fig. 1C). The deletions/insertions induced by ZFNLEDGF were

9 266 additionally confirmed using the heteroduplex formation assay in the three selected cell 267 lines (Fig. 1D). 268

269 Molecular characterization of ZFNLEDGF edited cell lines. To characterize the

270 genomic defects introduced by ZFNLEDGF, the PSIP1 genomic sequence surrounding 271 the target site of the selected monoclonal cell lines was amplified, cloned and 272 sequenced. At least 16 different PSIP1 sequences were obtained from each selected cell

273 line, sequences were aligned thus confirming that ZFNLEDGF successfully recognized 274 and cleaved the target sequence. Two cell lines harbored large modifications in both 275 alleles (LEDGF-/- KO, cell lines 2 and 3), whereas another cell line, together with a 276 large modification, presented a 3-bp deletion that led to a single aminoacid deletion at 277 protein level, and thus resembled an heterozoygote phenotype (hereafter LEDGF+/-, cell

278 line 1) (Fig. 2A). Sequencing analysis and alignment confirmed that ZFNLEDGF 279 introduced genomic defects located in exon 13, in most cases after the IBD domain. 280 The genomic defects detected were three deletions of 3-bp, 41-bp and 17-bp 281 respectively, one insertion of 155 bp and two very large deletions that could not be well 282 characterized at genomic level, but were characterized at mRNA level (Fig. 2A and 283 data not shown). In silico prediction of putative mRNA and protein sequences of 284 LEDGF-/- KO cell lines, suggested the presence of a truncated protein with conserved 285 functional PWWP domain (both alleles of cell lines 1, 2 and 3) and IBD (cell line 1 – 286 allele A and cell line 2 – allele B) but lacking the C-terminal part (Fig. 2B and 2C).

287 The effect of ZFNLEDGF on gene expression was assessed both at mRNA and 288 protein LEDGF/p75 level by RT-qPCR and Western-blot, respectively. In silico 289 prediction of a truncated mRNA was confirmed by testing mRNA expression of 5’ and 290 3’ fragments of PSIP1. Expression of PSIP1 5’ mRNA fragment (from PSIP1 mRNA 291 position +204 to +951) was detected in cDNA samples of all selected cell lines (Fig. 292 2D). Conversely, expression of PSIP1 3’ mRNA (from PSIP1 mRNA position +864 to

293 position *66 after the stop codon), which included the ZFNLEDGF cutting site, was not 294 detected in the LEDGF-/- KO cell lines with larger deletions (cell lines 2 and 3) but was 295 present in cell line 1 resembling an heterozygote, compared to wild-type or mock 296 transfected controls (Fig. 2D). Cell line 1 also presented a lower size mRNA fragment 297 indicative of a large deletion, the boundaries of which cannot be characterized at 298 genomic level. However, we identified an mRNA form lacking exons 12, 13 and 14 by

10 299 cloning and sequencing the cDNA products, indicating that the induced deletion 300 expanded at least over the 700bp genomic region that includes all 3 exons (Fig. 2C). 301 To confirm mRNA truncation, quantitative analysis of gene expression 302 corresponding to the C-terminal end of the PSIP1 was performed, confirming a

303 significant decrease in C-terminal mRNA expression in ZFNLEDGF treated cells, 304 compared to the wild-type and mock transfected cells (60% reduction in heterozygote 305 cells, residual expression in homozygotes p<0.01, Fig. 2D). Similarly, when using an 306 antibody specifically recognizing LEDGF/p75 C-terminus no protein expression was 307 observed in cell lines 2 and 3 but was partly detected in cell line 1, further confirming

308 that ZFNLEDGF induces the formation of a truncated sequence that leads to a potent 309 abrogation of a complete LEDGF/p75 expression at mRNA and protein levels (Fig. 2D, 310 2E and 2F upper panel). 311 Deletions from the IBD C-terminus of LEDGF have been reported to affect protein 312 stability and reduce solubility of the protein (15). Thus, to determine whether the 313 predicted truncated proteins were effectively expressed, a monoclonal antibody 314 recognizing the N-terminus region of LEDGF was used. Expression of full length p75 315 and p52 isoforms was detected in control cell lines (wild-type and mock transfected, 316 Fig. 2F, lower panel, first two lanes), as well as in edited cell line 1 (forth lane), 317 whereas only the p52 isoform was detected in cell lines 2 and 3 (third and last lanes), 318 confirming the results obtained with the C-terminus antibody. However, a band of 319 intermediate molecular weight (MW) appeared in cell lines 1 and 3 (red arrows, lower 320 panel), which was in accordance with in silico predictions (predicted MW 321 LEDGF/p75=60.1 KD; LEDGF/p52=37 KD and truncated proteins=47-48 KD, based 322 on Expasy prediction tools (37)) and therefore suggested the expression of LEDGF 323 truncated proteins. No clear protein expression was detected in cell line 2, suggesting 324 that genomic modifications induced in this cell line compromised either protein 325 stability, solubility and/or folding, as previously reported for other truncated LEDGF 326 constructs (15). 327

328 HIV-1 infection. Functional assays to establish the effect of ZFNLEDGF were performed 329 with the LEDGF+/- (cell line 1) and one homozygote LEDGF-/- KO (cell line 2). No 330 differences in the growth kinetics of the cell line compared to control parental cells 331 were observed (data not shown). LEDGF+/- and LEDGF-/- KO were challenged with 332 either HIV-1 X4 tropic NL4-3 or R5 tropic BaL strains and infection was monitored by

11 333 β-gal production (Fig. 3). LEDGF+/- cell line slightly inhibited HIV-1 infection 334 compared to wild-type and mock-transfected controls (24% and 45% inhibition for 335 HIV-1 X4 NL4-3 and R5 BaL strain respectively, Fig. 3A and 3B). Conversely, HIV-1 336 infection in LEDGF-/- KO cells was strongly inhibited compared to wild-type and mock 337 transfected controls and regardless of the viral strain used (up to a 70%, p<0.01, Fig. 338 3A and 3B). Nevertheless and in line with previous reports, infection was not 339 completely abolished in the KO cell line and residual infection persisted, accounting for 340 roughly 30% of infection for both R5 BaL and X4 NL4-3 viral strains (Fig. 3A and

341 3B). To evaluate the effect of antiviral compounds in the ZFNLEDGF cell lines, antiviral 342 activity of the X4 entry inhibitor AMB3100, the reverse transcriptase (RT) inhibitor 343 AZT and the integrase inhibitor Raltegravir were determined (Fig. 3C and 3D). No 344 significant differences were observed in the efficacy of the different compounds in any 345 of the drugs tested. Interestingly, Raltegravir was able to inhibit residual replication 346 observed in LEDGF -/- KO, consistent with previous reports (20) (21) and confirming 347 the different mechanism of action of both strategies.

348 To further characterize the functionality of ZFNLEDGF, viral and integrated viral 349 DNA were determined in the LEDGF-/- KO cell line. No differences were observed in 350 HIV-1 viral DNA between mock-transfected cells and LEDGF-/- KO cells when 351 challenged with HIV-1 X4 NL4-3 (Fig. 4A). Conversely, integrated viral DNA was 352 inhibited up to 87% in LEDGF-/-KO cells compared to mock-transfected control 353 (p<0.001, Fig. 4B). Residual viral integration was also observed in the LEDGF-/-KO 354 cells (aprox. 12% of integration, p<0.001, Fig. 4B), which could be fully inhibited by 355 the IN inhibitor Raltegravir (Fig. 4B). 356 Taken together, these results suggest that a complete LEDGF/p75 protein, 357 including the C-terminal domain, is necessary to successfully tether HIV pre- 358 integration complex into active transcriptional units. Consistent with previous reports 359 (20) (19) (21), LEDGF-/-KO cells were able to support inefficient but detectable viral 360 integration and produce new viral particles confirming the presence of alternative 361 pathways for HIV-1 replication in the absence of LEDGF/p75. 362

12 363 DISCUSSION 364 Genome editing is an emerging strategy to study virus-host interactions and to 365 combat and cure HIV-1 infection (7, 8). An ideal therapy for HIV, or other chronic 366 viral infections that course with latent reservoirs, is believed to involve the generation 367 of a source of long-lived, self-renewing and multilineage hematopoietic stem cells that 368 would repopulate the host with genetically modified cells refractory to infection (45, 369 46). Since the unique and exceptional case of HIV-1 sterilizing cure of a patient due to 370 bone marrow transplantation with a matched donor homozygote for the CCR532 371 mutation (47, 48), alternative strategies have aimed to reproduce the CCR532 372 phenotype using genome-editing tools. Indeed, ZFNs targeting the HIV coreceptors 373 gene have been successfully developed to generate human CD4+ T cells and human 374 embryonic cell precursors and induced pluripotent stem cells which were refractory 375 HIV-1 infection in different mice models (9-13). 376 Here, we have evaluated the feasibility and efficacy of generating LEDGF/p75 377 knockout cell, a key factor for the integration of viral DNA into the host genome, using 378 ZFN targeting at the C-terminal region of the LEDGF/p75 protein, outside the best 379 described functional domains PWWP and IBD. LEDGF/p75 has already been validated 380 as a candidate for gene therapy in a model where engraftment of lentiviral transduced

381 CD4+ T cells overexpressing LEDGF325-530 induced a 3-log reduction in plasma viral

382 load of HIV-1 infected mice (23). Overexpression of the deficient mutant LEDGF325-530 383 in primary CD4+ T cells impeded but did not completely block viral replication, due to

384 minimal wild type LEDGF/p75 expression. Thus, the use of ZNFLEDGF might be 385 advantageous in gene therapy settings as it confers a permanent disruption of the target 386 gene avoiding the presence of residual levels of the wild-type LEDGF/p75 form that

387 might be highjacked by the HIV-IN to successfully replicate.

388 Here, the use of the ZFNLEDGF generated TZM-bl cell lines carrying a truncated 389 form of PSIP1 at the genomic region encoding for the protein C-terminal region that 390 preserves the N-terminal functional domains. Although C-terminal region of 391 LEDGF/p75 is functionally poor characterized, several genetic variants in HIV infected 392 patients have been identified outside the known functional domains, variants which 393 might be related to different susceptibility to HIV infection and disease outcome (28- 394 30). Although identified LEDGF/p75 variants support efficient HIV-1 infection ex 395 vivo, the involved C-terminal amino acid positions are well conserved throughout the 396 evolution, suggesting an important role for protein functionality (31, 32). The induction

13 397 of large deletions in the sequence of PSIP1 gene coding for the C-terminal region of the 398 LEDGF/p75 resulted in a LEDGF-/- KO phenotype and provided a genetic barrier to 399 HIV-1 in vitro infection. 400 Previous work reported a decrease in protein stability, expression levels, and 401 solubility of recombinant LEDGF/p75 mutants lacking IBD and/or C‐terminus 402 (15). In accordance, stable expression of truncated proteins was detected in only 2 403 of the 5 edited alleles harbouring large modifications, pointing towards the need of 404 LEDGF/p75 C‐terminus domain for warranting protein stability and/or correct 405 folding. Our data reinforce the relevance of the C-terminal end region for the LEDGF 406 function and HIV infection outcome even if N-terminal functional domains and IBD of

407 the LEDGF/p75 remain intact. The inhibition of the HIV-1 infection in our ZFNLEDGF 408 clones might seem less apparent comparing to previously described LEDGF/p75 409 knockout models using mouse embryonic fibroblasts (MEFs) (19) and/or LEDGF KO 410 in human somatic Nalm-6 cells (pre-B acute lymphoblastic leukemia cells line) (20). 411 However, LEGDF/p75 KO were generated by the genetically modification at the exons 412 2 and 3 of the PSIP1 gene in the MEF model (19) and in human somatic Nalm-6 cells 413 were obtained by homologous recombination of exons 11 to 14 containing the IBD (20).

414 Contrary to previously models, our ZFNLEDGF was not designed against the functional 415 domains of the LEDGF protein, strengthening the relevance of the C-terminal end of the 416 protein. 417 The modulation of LEDGF/p75 expression by different approaches involving RNA 418 interference (49), short-hairpin RNA knockdown (50) and knockout models (19, 20), 419 provided strong evidence of how LEDGF/p75 interacts with the HIV-IN and tethers 420 HIV provirus into the host chromatin but also indicated that, in accordance to our 421 results, residual HIV infection occurred even in absence of LEDGF/p75. Indeed, HRP2, 422 which shares similar structural features with LEDGF/p75, has been postulated as an 423 alternative factor triggering HIV integration (21, 51). Nevertheless, double 424 PSIP1/HRP2 KO mice cells are still able to support HIV-1 integration (21), thus other 425 alternative pathways cannot be excluded which might allow virus to overcome 426 LEDGF/p75 deficiency. In that sense, and given that the TZM-bl cell line is a widely 427 accepted model of HIV infection research, our recently developed TZM-bl 428 LEDGF/p75-/- KO becomes a helpful tool to elucidate host factors involved in HIV 429 integration.

14 430 In summary, we describe the generation of LEDGF/p75 knockout cells using a 431 ZFN that successfully recognises and disrupts the sequence of the PSIP1 gene coding 432 for the C-terminal end of the LEDGF/p75 protein. The truncation of the C-terminal end 433 of the LEDGF/p75 results in a reduced protein stability that lead to the generation of 434 KO cells with an impaired HIV-1 replication independent of genetic modification 435 concerning the N-terminal functional domains or the IBD of LEGDF protein. Further 436 studies must be carried out to elucidate the functional role of genetic variants in the 437 coding regions of the PSIP1 gene in vivo. Our results confirm previous data indicating 438 that other pathways rather than LEDGF/p75 might allow HIV integration. Finally, the

439 ZFNLEDGF provides a new cellular model to study host factors involved in the HIV-1 440 integration process. 441

15 442 ACKNOWLEDGEMENTS 443 Cells, drugs and viruses were received from the EU Programme EVA 444 Centralised Facility for AIDS Reagents, NIBSC, UK or the National Institutes of 445 Health (AIDS Research and Reference Reagent Program). This work was supported by 446 the Spanish MINECO projects BFU2012-06958, FIS PI/01083 and Gala Contra la 447 SIDA. 448

16 449 REFERENCES 450 451 1. Ballana E, Este JA. 2013. Insights from host genomics into HIV infection and 452 disease: identification of host targets for drug development. Antiviral. Res. 453 100:473-786. 454 2. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, Gregory PD. 2010 Genome 455 editing with engineered zinc finger nucleases. Nat Rev Genet 11:636-646. 456 3. Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, Meng X, Paschon 457 DE, Leung E, Hinkley SJ, Dulay GP, Hua KL, Ankoudinova I, Cost GJ, 458 Urnov FD, Zhang HS, Holmes MC, Zhang L, Gregory PD, Rebar EJ. 2010. 459 A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 460 29:143-148. 461 4. Gaj T, Gersbach CA, Barbas CF, 3rd. 2013. ZFN, TALEN, and CRISPR/Cas- 462 based methods for genome engineering. Trends Biotechnol. 31:397-405. 463 5. Wiedenheft B, Sternberg SH, Doudna JA. 2012. RNA-guided genetic 464 silencing systems in bacteria and archaea. Nature 482:331-338. 465 6. Gijsbers R, Ronen K, Vets S, Malani N, De Rijck J, McNeely M, Bushman 466 FD, Debyser Z. 2010. LEDGF hybrids efficiently retarget lentiviral integration 467 into heterochromatin. Mol. Ther. 18:552-560. 468 7. Buchholz F, Hauber J. 2012. Engineered DNA modifying enzymes: 469 components of a future strategy to cure HIV/AIDS. Antiviral Res. 97:211-217. 470 8. Manjunath N, Yi G DY, Shankar P. 2013. Newer gene editing technologies 471 toward HIV gene therapy. Viruses 5:2748-2766. 472 9. Perez EE, Wang J, Miller JC, Jouvenot Y, Kim KA, Liu O, Wang N, Lee G, 473 Bartsevich VV, Lee YL, Guschin DY, Rupniewski I, Waite AJ, Carpenito 474 C, Carroll RG, Orange JS, Urnov FD, Rebar EJ, Ando D, Gregory PD, 475 Riley JL, Holmes MC, June CH. 2008. Establishment of HIV-1 resistance in 476 CD4+ T cells by genome editing using zinc-finger nucleases. Nat. Biotechnol. 477 26:808-816. 478 10. Holt N, Wang J, Kim K, Friedman G, Wang X, Taupin V, Crooks GM, 479 Kohn DB, Gregory PD, Holmes MC, Cannon PM. 2010. Human 480 hematopoietic stem/progenitor cells modified by zinc-finger nucleases targeted 481 to CCR5 control HIV-1 in vivo. Nat. Biotechnol. 28:839-847. 482 11. Yao Y, Nashun B, Zhou T, Qin L, Zhao S, Xu J, Esteban MA, Chen X. 483 2011. Generation of CD34+ cells from CCR5-disrupted human embryonic and 484 induced pluripotent stem cells. Hum. Gene Ther. 23:238-242. 485 12. Badia R, Riveira-Muñoz E, Clotet B, Este J, Ballana E. 2014. Gene editing 486 using a zinc finger nuclease mimicking CCR5 Delta32 mutation shows HIV-1 487 resistance. J. Antimicrob. Chemother. doi:10.1093/jac/dku072. 488 13. Wilen CB, Wang J, Tilton JC, Miller JC, Kim KA, Rebar EJ, Sherrill-Mix 489 SA, Patro SC, Secreto AJ, Jordan AP, Lee G, Kahn J, Aye PP, Bunnell BA, 490 Lackner AA, Hoxie JA, Danet-Desnoyers GA, Bushman FD, Riley JL, 491 Gregory PD, June CH, Holmes MC, Doms RW. 2011. Engineering HIV- 492 resistant human CD4+ T cells with CXCR4-specific zinc-finger nucleases. PLoS 493 Pathog. 7:e1002020. 494 14. Engelman A, Cherepanov P. 2008. The lentiviral integrase binding protein 495 LEDGF/p75 and HIV-1 replication. PLoS Pathog. 4:e1000046. 496 15. Cherepanov P, Devroe E, Silver PA, Engelman A. 2004. Identification of an 497 evolutionarily conserved domain in human lens epithelium-derived growth

17 498 factor/transcriptional co-activator p75 (LEDGF/p75) that binds HIV-1 integrase. 499 J. Biol. Chem. 279:48883-48892. 500 16. Cherepanov P, Maertens G, Proost P, Devreese B, Van Beeumen J, 501 Engelborghs Y, De Clercq E, Debyser Z. 2003. HIV-1 integrase forms stable 502 tetramers and associates with LEDGF/p75 protein in human cells. J. Bio.l Chem. 503 278:372-381. 504 17. Marshall HM, Ronen K, Berry C, Llano M, Sutherland H, Saenz D, 505 Bickmore W, Poeschla E, Bushman FD. 2007. Role of PSIP1/LEDGF/p75 in 506 lentiviral infectivity and integration targeting. PLoS One 2:e1340. 507 18. Astiazaran P, Bueno MT, Morales E, Kugelman JR, Garcia-Rivera JA, 508 Llano M. 2011. HIV-1 integrase modulates the interaction of the HIV-1 cellular 509 cofactor LEDGF/p75 with chromatin. Retrovirology 8:27. 510 19. Shun MC, Raghavendra NK, Vandegraaff N, Daigle JE, Hughes S, Kellam 511 P, Cherepanov P, A. E. 2007. LEDGF/p75 functions downstream from 512 preintegration complex formation to effect gene-specific HIV-1 integration. 513 Genes Dev. 21:1767-1778. 514 20. Schrijvers R, De Rijck J, Demeulemeester J, Adachi N, Vets S, Ronen K, 515 Christ F, Bushman FD, Debyser Z, Gijsbers R. 2012. LEDGF/p75- 516 independent HIV-1 replication demonstrates a role for HRP-2 and remains 517 sensitive to inhibition by LEDGINs. PLoS Pathog. 8:e1002558. 518 21. Wang H, Jurado KA, Wu X, Shun MC, Li X, Ferris AL, Smith SJ, Patel 519 PA, Fuchs JR, Cherepanov P, Kvaratskhelia M, Hughes SH, Engelman A. 520 2012. HRP2 determines the efficiency and specificity of HIV-1 integration in 521 LEDGF/p75 knockout cells but does not contribute to the antiviral activity of a 522 potent LEDGF/p75-binding site integrase inhibitor. Nucleic Acids Res. 523 40:11518-11530. 524 22. Christ F, Debyser Z. 2013. The LEDGF/p75 integrase interaction, a novel 525 target for anti-HIV therapy. Virology 435:102-109. 526 23. Vets S, Kimpel J, Volk A, De Rijck J, Schrijvers R, Verbinnen B, Maes W, 527 Von Laer D, Debyser Z, Gijsbers R. 2012. Lens epithelium-derived growth 528 factor/p75 qualifies as a target for HIV gene therapy in the NSG mouse model. 529 Mol. Ther. 20:908-917. 530 24. Greene WC, Debyser Z, Ikeda Y, Freed EO, Stephens E, Yonemoto W, 531 Buckheit RW, Esté JA, Cihlar T. 2008. Novel targets for HIV therapy. 532 Antiviral Res. 80:251-265. 533 25. Desimmie BA, Schrijvers R, Demeulemeester J, Borrenberghs D, Weydert 534 C, Thys W, Vets S, Van Remoortel B, Hofkens J, De Rijck J, Hendrix J, 535 Bannert N, Gijsbers R, Christ F, Z. D. 2013. LEDGINs inhibit late stage HIV- 536 1 replication by modulating integrase multimerization in the virions. 537 Retrovirology 10 57. 538 26. Christ F, Voet A, Marchand A, Nicolet S, Desimmie BA, Marchand D, 539 Bardiot D, Van der Veken NJ, Van Remoortel B, Strelkov SV, De Maeyer 540 M, Chaltin P, Z D. 2010. Rational design of small-molecule inhibitors of the 541 LEDGF/p75-integrase interaction and HIV replication. Nat. Chem. Biol. 6:442- 542 448. 543 27. Jurado KA, Engelman A. 2013. Multimodal mechanism of action of allosteric 544 HIV-1 integrase inhibitors. Expert Rev. Mol. Med. 15:e14. 545 28. Madlala P, Gijsbers R, Christ F, Hombrouck A, Werner L, Mlisana K, An 546 P, Abdool Karim SS, Winkler CA, Debyser Z, Ndung'u T. 2011. Association

18 547 of polymorphisms in the LEDGF/p75 gene (PSIP1) with susceptibility to HIV-1 548 infection and disease progression. AIDS 25:1711-1719. 549 29. Messiaen P, De Spiegelaere W, Alcami J, Vervisch K, Van Acker P, 550 Verhasselt B, Meuwissen P, Calonge E, Gonzalez N, Gutierrez-Rodero F, 551 Rodriguez-Martín C, Sermijn E, Poppe B, Vogelaers D, Verhofstede C, L. 552 V. 2012. Characterization of LEDGF/p75 genetic variants and association with 553 HIV-1 disease progression. PLoS One 7:e50204. 554 30. Ballana E, Gonzalo E, Grau E, Iribarren JA, Clotet B, Este JA. 2012. Rare 555 LEDGF/p75 genetic variants in white long-term nonprogressor HIV+ 556 individuals. AIDS 26:527-528. 557 31. Schrijvers R, Demeulemeester J, De Rijck J, Christ F, Gérard M, Debyser 558 Z, Gijsbers R. 2013. Characterization of rare lens epithelium-derived growth 559 factor/p75 genetic variants identified in HIV-1 long-term nonprogressors. AIDS 560 27:539-543. 561 32. Koh Y, Ballana E, Este J, A. E. 2013. Polymorphic LEDGF/p75 variants 562 support efficient HIV-1 infection ex vivo. AIDS 27:665-667. 563 33. Mussolino C, Cathomen T. 2011. On target? Tracing zinc-finger-nuclease 564 specificity. Nat. Methods 8:725-726. 565 34. Hansen K, Coussens MJ, Sago J, Subramanian S, Gjoka M, Briner D. 2012. 566 Genome editing with CompoZr custom zinc finger nucleases (ZFNs). J. Vis. 567 Exp:e3304. 568 35. Ballana E, Pauls E, Clotet B, Perron-Sierra F, Tucker GC, Este JA. 2010. 569 beta5 integrin is the major contributor to the alphaVintegrin-mediated blockade 570 of HIV-1 replication. J. Immunol. 186:464-470. 571 36. Ballana E, Senserrich J, Pauls E, Faner R, Mercader JM, Uyttebroeck F, 572 Palou E, Mena MP, Grau E, Clotet B, Ruiz L, Telenti A, Ciuffi A, Este JA. 573 2010. ZNRD1 (zinc ribbon domain-containing 1) is a host cellular factor that 574 influences HIV-1 replication and disease progression. Clin. Infect. Dis. 50:1022- 575 1032. 576 37. Artimo P, Jonnalagedda M, Arnold K, Baratin D, Csardi G, de Castro E, 577 Duvaud S, Flegel V, Fortier A, Gasteiger E, Grosdidier A, Hernandez C, 578 Ioannidis V, Kuznetsov D, Liechti R, Moretti S, Mostaguir K, Redaschi N, 579 Rossier G, Xenarios I, Stockinger H. 2012. ExPASy: SIB bioinformatics 580 resource portal. Nucleic Acids Res. 40:W597-603. 581 38. Ballana E, Riveira-Munoz E, Pou C, Bach V, Parera M, Noguera M, Santos 582 JR, Badia R, Casadella M, Clotet B, Paredes R, Martinez MA, Brander C, 583 Este JA. 2012. HLA class I protective alleles in an HIV-1-infected subject 584 homozygous for CCR5-Delta32/Delta32. Immunobiology 218:543-547. 585 39. Pauls E, Jimenez E, Ruiz A, Permanyer M, Ballana E, Costa H, 586 Nascimiento R, Parkhouse RM, Pena R, Riveiro-Munoz E, Martinez MA, 587 Clotet B, Este JA, Bofill M. 2013. Restriction of HIV-1 replication in primary 588 macrophages by IL-12 and IL-18 through the upregulation of SAMHD1. J. 589 Immunol. 190:4736-4741. 590 40. Clouser CL, Patterson SE, Mansky LM. 2010. Exploiting drug repositioning 591 for discovery of a novel HIV combination therapy. J. Virol. 84:9301-9309. 592 41. Ballana E, Pauls E, Senserrich J, Clotet B, Perron-Sierra F, Tucker GC, 593 Este JA. 2009. Cell adhesion through alphaV-containing integrins is required 594 for efficient HIV-1 infection in macrophages. Blood 113:1278-1286. 595 42. Palpant NJ, Dudzinski D. 2013. Zinc finger nucleases: looking toward 596 translation. Gene Ther. 20:121-127.

19 597 43. Gabriel R, Lombardo A, Arens A, Miller JC, Genovese P, Kaeppel C, 598 Nowrouzi A, Bartholomae CC, Wang J, Friedman G, Holmes MC, Gregory 599 PD, Glimm H, Schmidt M, Naldini L, von Kalle C. 2011. An unbiased 600 genome-wide analysis of zinc-finger nuclease specificity. Nat. Biotechnol. 601 29:816-823. 602 44. Pattanayak V, Ramirez CL, Joung JK, Liu DR. 2011. Revealing off-target 603 cleavage specificities of zinc-finger nucleases by in vitro selection. Nat. 604 Methods 8:765-770. 605 45. Kiem HP, Jerome KR, Deeks SG, McCune JM. 2012. Hematopoietic-stem- 606 cell-based gene therapy for HIV disease. Cell Stem Cell 10:137-147. 607 46. Hoxie JA, June CH. 2012 Novel cell and gene therapies for HIV. Cold Spring 608 Harb. Perspect. Med. 2:pii: a007179. 609 47. Hutter G, Nowak D, Mossner M, Ganepola S, Mussig A, Allers K, 610 Schneider T, Hofmann J, Kucherer C, Blau O, Blau IW, Hofmann WK, 611 Thiel E. 2009. Long-term control of HIV by CCR5 Delta32/Delta32 stem-cell 612 transplantation. N. Engl. J. Med. 360:692-698. 613 48. Allers K, Hutter G, Hofmann J, Loddenkemper C, Rieger K, Thiel E, 614 Schneider T. 2011. Evidence for the cure of HIV infection by 615 CCR5Delta32/Delta32 stem cell transplantation. Blood 117:2791-2799. 616 49. Llano M, Saenz DT, Meehan A, Wongthida P, Peretz M, Walker WH, Teo 617 W, Poeschla EM. 2006. An essential role for LEDGF/p75 in HIV integration. 618 Science 314:461-464. 619 50. Vandekerckhove L, Christ F, Van Maele B, De Rijck J, Gijsbers R, Van 620 den Haute C, Witvrouw M, Debyser Z. 2006. Transient and stable knockdown 621 of the integrase cofactor LEDGF/p75 reveals its role in the replication cycle of 622 human immunodeficiency virus. J. Virol. 80:1886-1896. 623 51. Schrijvers R, Vets S, De Rijck J, Malani N, Bushman FD, Debyser Z, 624 Gijsbers R. 2012. HRP-2 determines HIV-1 integration site selection in 625 LEDGF/p75 depleted cells. Retrovirology 9:84. 626 627 628

20 629 FIGURE LEGENDS 630

631 Figure 1. Experimental design and specificity of the ZFNLEDGF targeting PSIP1 gene. A.

632 Schematic representation of LEDGF/p75 protein highlighting the position of the ZFNLEDGF

633 targeted region. Cutting site of the ZFNLEDGF is located nearby the sequence coding for the 634 integrase binding domain of the LEDGF/p75 (IBD). B. Experimental design used to generate 635 and evaluate LEDGF/p75 knockout cells. C. Flow cytometry plots of wild-type, mock-treated

636 cells and cells transfected with ZFNLEDGF plasmids and challenged with VSV-pseudotyped

637 NL4.3 GFP-expressing virus. D. Gene editing by ZFNLEDGF induces heteroduplex formation 638 determined by the surveyor mutation assay (Cel-I). After genomic DNA extraction, 639 heteroduplex formation due to generation of insertions or deletions was assessed by the 640 surveyor mutation assay. DNA fragments were resolved in a 10% TBE-PAGE gel. Lower 641 migrating products (arrows) are a direct measure of ZFN-mediated gene disruption. 642 643 Figure 2. Generation and phenotypic characterization of LEDGF/p75 knockout cells. A. 644 Sequence analysis of the insertions and deletions identified in the three cell lines selected after

645 ZFNLEDGF treatment. At least 16 different sequences from each selected cell line were 646 sequenced and aligned. Consensus sequence of the modifications identified in each of the two 647 alleles of the selected cell lines is depicted as allele A and allele B of cell line 1-3. B and C. 648 Protein alignments of in silico predicted sequences based on the sequencing data obtained from

649 the two alleles of the ZFNLEDGF cell lines that introduce a premature stop codon (B) or of cell 650 line 1 - allele B that harbours an in-frame deletion of 3 exons (C). The IBD region is 651 highlighted in a red box. D. Gene expression of PSIP1 mRNA corresponding to the 5’ and 3’ 652 regions. Agarose gel where presence or absence of 5’ and 3’ fragments of PSIP1 mRNA was 653 identified. In the case of the cell line 1, the full length and a truncated form of 3’ mRNA 654 fragment could be identified. E. Quantification of gene expression (mRNA) corresponding to 655 the 3’ region of PSIP1 in the selected cell lines. Expression of LEDGF mRNA was completely 656 inhibited in LEDGF-/- KO cell lines tested compared to untreated or mock-transfected cell. 657 LEDGF+/- (cell line 1) showed a 50% decrease of the LEDGF mRNA compared to control cells. 658 Mean±SD of three independent determinations is shown. F. Assessment of protein levels of 659 LEDGF/p75 determined by Western-blot in the selected LEDGF/p75+/- and LEDGF/p75-/- KO 660 cell lines compared to control cells. Upper panel; antibody recognizing the C-terminus of 661 LEDGF/p75 protein. Lower panel; antibody recognizing the N-terminus of LEDGF/p75 and 662 LEDGF/p52 proteins. Molecular weight (MW) markers are depicted. Red arrows indicated 663 putative truncated proteins. 664

21 665 Figure 3. Infectivity of HIV in ZNFLEDGF treated cells and susceptibility to antiretroviral

666 compounds. A and B. Relative infection of ZNFLEDGF treated cells compared to wild-type 667 (WT) and mock transfected (Mock transf) controls for NL4-3 (A) and Bal (B) viral strains. 668 Mean±SD of three independent experiments is shown. *** p<0.001; **p<0.01; *p<0.05. C. 669 Percentage of HIV X4 using strain NL4-3 replication in LEDGF+/- and LEDGF-/- KO mutants 670 relative to wild-type and mock-treated controls, treated or not with the RT inhibitor AZT, the 671 CXCR4 antagonist AMD3100 and the IN strand transfer inhibitor Ral. Mean±SD of three 672 independent experiments is shown. D. Percentage of HIV R5 using strain BaL replication in 673 LEDGF+/- and LEDGF-/- KO mutants relative to wild-type and mock-treated controls, treated or 674 not with the RT inhibitor AZT, the CXCR4 antagonist AMD3100 and the IN strand transfer 675 inhibitor Ral. Mean±SD of three independent experiments is shown. WT, wild-type, Mock tr, 676 mock transfected, ND, no drug 677 678 Figure 4. Integration of HIV NL43 is impaired in LEDGF-/- KO cells. A. Viral DNA in 679 LEDGF-/- KO cells (white bars) related to Mock-treated cells (black bars) with or without the 680 RT inhibitor AZT (4 μM) and the IN inhibitor Raltegravir (RAL, 2 μM). Values are expressed 681 relative to mock-transfected cells. Mean±SD of three independent experiments is shown. B. 682 Integrated viral DNA in LEDGF-/- KO cells (white bars) related to Mock-treated cells (black 683 bars) with or without the RT inhibitor AZT (4 μM) and increasing concentrations of the IN 684 inhibitor Raltegravir. Values are expressed relative to mock-transfected cells. Mean±SD of 685 three independent experiments is shown. 686 687 688

22 689 Table 1. Inhibition of HIV replication of all monoclonal cell lines obtained. High efficacy 690 (roughly 70% effective impairment of HIV replication) is observed as a consequence of

691 ZNFLEDGF treatment. Cell line Mean GFP (%) Rel replication (%) Rel inhibition (%) 1 0,6 14 86 2 0,1 2 98 3 0,2 5 95 4 3,9 93 7 5 0,5 12 88 6 2 48 52 7 1,7 40 60 8 0,6 14 86 9 1,1 26 74 10 1,8 43 57 11 5,2 124 -24 12 5,1 121 -21 13 0,7 17 83 14 nd nd nd 15 2,7 64 36 16 1,7 40 60 17 0,8 19 81 18 5,5 131 -31 19 0,6 14 86 20 0,8 19 81 21 3,8 90 10 22 nd nd nd 23 0,8 19 81 24 nd nd nd 25 4,1 98 2 26 nd nd nd 27 0,9 21 79 28 1,1 26 74 29 nd nd nd 30 1 24 76 31 1,1 26 74 32 1,1 26 74 33 2 48 52 34 nd nd nd 35 0,6 14 86 36 1,4 33 67 37 0,7 17 83 38 0,6 14 86 Control 4,2 100 0 692 Values represent the mean of two independent determinations performed in duplicate. Rel 693 replication; % replication relative to control cell line, Rel inhibition; % inhibition relative to 694 control cell line, nd; not determined.