Proc. Natl. Aced. Sci. USA Vol. 83, pp. 6954-6958, September 1986 Genetics Frameshift mutations produced by proflavin in bacteriophage T4: Specificity within a hotspot (acridine/topoisomerase /IllB gene/mutational specificity) LYNN S. RIPLEY*t AND ALAN CLARKt *Department of Microbiology, University of Medicine and Dentistry of New Jersey, 100 Bergen Street, Newark, NJ 07103; and tLaboratory of-Genetics, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 Communicated by Fred Sherman, June 6, 1986

ABSTRACT Frameshift mutations were induced by runs of APT base pairs (7). However, the genetic locations of proflavin in the rnIB gene ofbacteriophage.T4. rnIB DNA from proflavin-induced frameshifts in the rII cistron isolated in a each of 48 independent frameshifts was inserted into Mlimp8 forward mutation assay (8) clearly demonstrate that the most and sequenced. Two-thirds of the frameshifts (33/48) lie frequent proflavin-induced mutations occur in sites distinct contiguous to one another in 10 base pairs ofthe rnIB sequence. from the long runs of ANT base pairs that are hotspots for This hotspot differs markedly friom previously characterized spontaneous frameshifts (9). Some proflavin-induced mutagen-induced frameshift hotspots. Distinctive features of frameshifts in the lysozyme gene of T4 were sequenced at the the hotspot include the absence of locally repetitive sequences, level of the protein (6), and the DNA sequences of several particularly GC runs, and the fact that many different proflavin-induced lysozyme frameshifts have been deter- sequence changes are induced within the hotspot sequence at mined (10). Among these lysozyme mutants none lie in appreciable frequencies. Among the 33 mutants at the hotspot, G-C-rich sequences, and many would not have been predict- 8 distinguishable DNA sequence changes were seen. All of the ed by misalignments of DNA.sequence repeats. mutations were deletions of a single base or duplications of one We have begun to address the question of potential or more bases. Duplications were more frequent than deletions. specificity differences between proflavin-induced mutation The patterns of the base se4uehce chahges suggest that two in bacteriophages T4 and X by determining the sequences of specific phosphodiester bonds within th libtspot sequence are proflavin-induced frameshifts in part of the rIIB gene of sites at which proflavin-induced mutation is initiated. bacteriophage T4. Our genetic system permits the selective isolation offrameshifts in a region of approximately 130 base Classical intercalating chemicals have often been shown to pairs (bp) of DNA encoding a portion of the amino terminus enhance the frequency of frameshift mutation (1, 2). How- of the rIIB gene product. The proflavin-induced mutation ever, the molecular intermediates and the enzymology of the spectrum reported here identifies a different type of frame- mutagenic process remains unidentified. Several studies shift hotspot and offers no evidence for proflavin-induced have addressed this question by determining the sequences of frameshifts in G-C runs in T4. Instead, the spectrum identifies the induced mutations. The sequences offrameshifts induced a frameshift hotspot that is distinctive in the diversity of by ICR-191, 9-aminoacridine, proflavin, and N-acetoxy-N- frameshift mutations located at the site. The most frequent acetylaminofluorene have been determined in F' or pBR322 mutant was the duplication of a guanosine surrounded by plasmids of Escherichia coli and in bacteriophage X (3-5). thymidines. This sequence change is inconsistent with pre- Very strong specificity is exhibited in each of these systems dictions of the Streisinger model based on misaligned pairing for the production of frameshifts in repeated sequences of of a repeated sequence. An alternative mechanism consistent G-C pairs. The G-C specificity exhibited by 9-aminoacridine with the observed T4 specificity is proposed. and proflavin is particularly notable, since GC specificity is not expected in these instances to reflect covalent attachment MATERIALS AND METHODS of the drug to the DNA. All ofthe chemically-induced frkmbshift sequences report- Bacteriophage and E. coli Strains. rFCJJ and rFC47 are ed in the E. coli and phage X systems have DNA sequence rIIB frameshift mutations in bacteriophage T4. Their use to changes that are fully consistent with the classical proposal detect frameshift mutations in the amino terminus of the rIIB of Streisinger et al. (6) that framdsbifts arise as the conse- gene has been described in detail (11). Frameshift mutations quence of the misalignment of one._NA strand upon its were selected on E.. coli strain K38, which is nonpermissive complement during the course of bNA metabolism. Such for rFCJJ or rFC47 but which permits these rII mutants to misalignments speifically predict the duplication or deletion grow if an additional frameshift mutation occurs that permits of a repeating unit in the repeated DNA sequence. For the production of the rnIB gene protein. example, in the bNA sequence OGGO, the model is fully Cloning and Sequencing. Cloning and sequencing of T4 rII consistent with the deletion or dtplication of a guanosine. frameshifts were carried out as described (12). T4 DNA was However, in the sequence GCGCGC, the model does not digested with Taq I enzyme, shotgun cloned into M13mp8, predict the deletion or duplication of a guanosine, but instead identified by plaque hybridization, and sequenced. predicts the deletion or duplication of the 2-base repeating Isolation of Independent Frameshift Mutants. Independent sequence OC. stocks of rFCJJ and of rFC47 were grown from single The sequences of acridine-induced frameshifts in plaques. Each stock was mutagenized independently, and a bacteriophage T4 have been defined for only a few mutants. single frameshift mutant, isolated as a consequence of its Reversion studies implicate the ability of proflavin to en- ability to grow on K38, was selected from each stock. Neither hance the frequency of frameshift mutation in monotonous rFC I nor rFC47 grow on K38 as a consequence of rIIB gene frameshifts. Newly arising frameshifts that restore the cor- rect reading frame permit growth on K38. The revertant The publication costs of this article were defrayed in part by page charge payment. This article must therefore be fiereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviation: bp, base pair(s). 6954 Downloaded by guest on September 24, 2021 Genetics: Ripley and Clark Proc. Natl. Acad. Sci. USA 83 (1986) 6955

frequencies were measured after treatment of each stock to 435 450 465 the mutagenesis protocol, in the presence or absence of proflavin. ATGTACAATATTAAATGCCTGACCAAAAACGAACAA Proflavin Mutagenesis. Logarithmic-phase BB cells at ap- . proximately 2 x 108 cells per ml grown in M9/CA medium (3 g of KH2PO4/6 g of Na2HPO4/1 g of NH4Cl/3.5 g of NaCl/0.16 mg of FeCl3/0.133 g of MgSO4/4 g of glucose/8 g of Bacto Casamino acids/H20 to 1 liter) were concentrated to 109 cells per mljust before the experiment. Phage particles (109) were added to 0.5 ml of cells at 30'C to initiate infection. l a 475 O - 490 500 After a 10-min incubation on a rotary shaker, the phage/cell Ol mixture was diluted 1:10 into M9/CA with or without 0 proflavin. After another 15-min incubation, a 1:50 dilution G C T G;AAATTGTTAAACT 5TATTCAAGT G G T A A T T A C into M9/CA was made to permit further intracellular devel- * U opment of the phage. After 70 min, cell lysis was completed *Em U by the addition of chloroform. Plating medium contained 1 g Em* U of Bacto tryptone, 1 g of Bacto yeast extract, 8 g of NaCl, 0.2 : 0 g of glucose, 10 g of Bacto agar, and H20 to 1 liter. Soft agar overlays were the same medium diluted 1:1.54 with water. All U plating cells were in logarithmic phase. The 2 ,ug/ml concentration of proflavin used for these 510 525 535 experiments was selected to maximize mutagenesis without leading to excessive reduction of average phage burst sizes. AC C CAACAGGAATTGGCCTGATTG G CAAGGTGTAT The average titer of both rFCIJ and rFC47 phage was five m times lower when proflavin was present than when it was U absent. 550 560 575 RESULTS - I1 CGGTTGACACAATCCGTCGCTGTTTTGAAAAATGCTGA Proflavin-Induced Mutant Frequencies. Phenotypic revert- * U ants of rFCJ1 occur as the consequence of shifts to the +1 reading frame in rIIB sequence between bases 445 and 565 FIG. 1. Proflavin-induced frameshift mutations in the amino- (11) (see Fig. 1). Revertant frequencies after proflavin treat- terminal region of rlIB. Forty-eight frameshift mutations isolated as ment were compared to those after identical treatments in the suppressors of the frameshifts rFCII or rFC47 are shown. The DNA In the revertant sequence shown is the wild-type sequence and begins with the absence of proflavin. absence of proflavin, initiating ATG codon of the rIlB gene. Numbering of the sequence frequencies ranged from 50 to 1400 x 10-8 and reflected the is as in Pribnow et al. (9). Frameshifts isolated as suppressors of natural variation in revertant frequencies in independent rFC47 are shown above the wild-type sequence; suppressors of stocks. In the presence ofproflavin, the revertant frequencies rFCII are shown below. All mutations were either deletions or ranged from 2700 to 12,300 x 10-8. The mean proflavin- duplications. Deleted bases are indicated by open boxes; duplicated induced increase in mutant frequency was 43-fold; the me- bases by closed boxes. rFCIJ, itself, is a deletion of an adenosine in dian increase was 38-fold. a run of five adenosines (positions 458-462). This DNA sequence Similar measurements were carried out in rFC47. Pheno- change is thus present in all mutants illustrated below the line with typic revertants of rFC47 arise as a consequence of shifts to the exception of the single example where rFCII suppression the -1 reading frame in the rIIB sequence between bases occurred by the addition ofadenosine between positions 458 and 462, 453 restoring the wild-type DNA sequence. rFC47 differs from the and 576 (11) (see Fig. 1). Revertant frequencies in this assay wild-type sequence in that the two thymidines occupying positions ranged from 140 to 2500 x 10-8 in the absence of proflavin 561 and 562 are replaced by CTG for an increase of 1 bp. All of the and from 2500 to 9300 x 10-8 in the presence of proflavin. frameshift mutations illustrated above the line retain this mutation. The mean proflavin-induced increase was 18-fold, and the All suppressors of rFC47 occur between TGA termination codons at median increase was 16-fold. positions 453-455 and 574-576. Similarly termination codons at Proflavin-Induced Mutational Specificity. DNA from a positions 445-447 and 564-566 define the DNA sequence within single frameshift mutant from each of 24 proflavin-treated which suppression of rFCJ1 occurs. rFCJJ stocks and 24 proflavin-treated rFC47 stocks was inserted into M13mp8 and sequenced. Fig. 1 displays the treatment produces a large increase in mutant frequency over positions of these 48 sequenced mutants, relative to the the spontaneous frequency, all except 1 or 2 ofthe 48 mutants wild-type DNA sequence. The rFC47 mutation replaces the are expected to be induced by the proflavin treatment. thymidines at positions 561 and 562 with the sequence CTG. A comparison ofthe DNA sequence changes that occurred The rFCJ1 mutation is a deletion of one adenosine in the run in a set of spontaneous mutants isolated from each of these ofadenosines between bases 458 and 462. Frameshifts arising stocks (12) revealed two instances in which both the spon- in rFC47 are shown above the line and are shifts to the -1 taneous and the proflavin-induced mutants had the same reading frame with respect to the initial sequence. sequence change: the deletion of guanosine at position 495 Frameshifts arising in rFCJI are shown below the line and are and the addition of thymidine between positions 561 and 564. shifts to the + 1 reading frame. All of the proflavin-induced The guanosine deletion may well have been of spontaneous mutants are either deletions or duplications, none were origin in both instances. The spontaneous mutant frequency insertions. (2500 x 10-8) ofthis stock was higher than for any other stock Thirty-three of the 48 mutants (69%) lie within the contig- and was less than four times lower than the mutant frequency uous 10-bp sequence 5' TTGTTAAACT 3' at positions 477 to after proflavin treatment (9300 x 10-8). However, the stock 486. The remaining 15 mutants are dispersed throughout the yielding the addition of a thymidine had a spontaneous region. No more than four mutants occurred within any other mutant frequency of 300 x 10-8 and a proflavin-induced contiguous 10-bp sequence. Because each mutant was iso- mutant frequency of 3500 x 10-8. lated from an independent stock and because the proflavin Among the eight genotypes recovered from the 33 mutants Downloaded by guest on September 24, 2021 6956 Genetics: Ripley and Clark Proc. Natl. Acad. Sci. USA 83 (1986) located at the hotspot sequence, six have never been isolated more frequent sites of proflavin-induced mutation than the in our sequencing of hundreds of spontaneous frameshifts rIB frameshift hotspot described here. The occurrence of isolated as revertants of rFCJJ or rFC47 (ref. 12 and three to five hotspots within 3.65 kilobases of DNA suggests unpublished results). The two genotypes that do overlap in that if these hotspot sites are determined by a specific specificity are the deletion or addition of an APT base pair in primary DNA sequence, this sequence is approximately 5-6 the run of three adenosines from bases 482 to 484. bp long. Frameshifts of + 1 or -1 bp in the remainder of the rIIB The sequence specificity of proflavin-induced frameshift sequence have been found at lower frequencies in the mutations in T4 differs strikingly from the sequence speci- spontaneous spectrum (12). However, all of the proilavin- ficity of the most frequent classes of spontaneous frame- induced 2-base duplications or deletions were different from shifts. For example, the most frequent proflavin-induced those arising spontaneously. duplications (a guanosine at position 479 or a G-T at positions Because mutations were not uniformly distributed through 479 and 480) have not yet been found spontaneously (12). In the 10-bp hotspot sequence, a smaller portion of the sequence the specific T4 rnuB sequence examined here, the most could be primarily responsible for this hotspot. For example, frequent spontaneous frameshifts are the addition or deletion 25 of the 33 mutants at the hotspot occur within the TGT of an APT base pair within the longest runs of ART base pairs sequence at positions 478-480. However, this TGT sequence and the duplication or deletion of 8 bp in the sequence 5' is tot sufficient to explain the hotspot since this sequence ATTGGCTGATTGGC 3' (positions 517-530). These muta- occurs eight additional times (positions 466-468, 486-488, tions all represent the duplication or deletion of repeating 504-506, 511-513, 535-537, 546-548, 548-550, and 559-562), units of DNA and are fully consistent with the prediction of and in no instance did a proflavin-induced mutation occupy the model by Streisinger et al. (9, 12). After proflavin any of these other sites. We conclude that, although the most treatment, mutations in the longest runs of APT base pairs probable genetic outcome of proflavin-induced mutation is (positions 458-462, 561-564, and 566-570) were infrequent the duplication or deletion of bases in the TGT sequence at and neither duplication nor deletion of 8 bp at positions positions 478-480, the DNA sequence that is responsible for 517-530 occurred. We conclude that the misalignments that that high mutation frequency must include some additional may account for frequent spontaneous frameshift mutations feature. are not strongly promoted by proflavin and at most account for only a modest component of proflavin-induced DISCUSSION frameshifts in T4. A distinctive element of the rnIB proflavin hotspot is the Classical genetic techniques permit the specific selection of diversity of genetic outcomes within the hotspot sequence. frameshift mutations in bacteriophage T4 based on the ability We have identified a unifying feature within this diversity that of the framneshift to restore the correct reading frame to rIIB has provided a molecular clue to the mechanism that may be mutants having a frameshift near the beginning of the gene. responsible for these mutations. This feature is illustrated in Amino acid sequence changes in the amino terminus of the Fig. 2. Six DNA sequences representing 31 of the 33 mutants protein that can result from such reading frame corrections in the hotspot are shown as the deletion or the duplication of have no apparent consequence in the selection. This genetic specific bases in the sequence. There are two clusters of system permits us to examine frameshift mutation specificity mutants. Within each cluster, each mutant can be depicted as in approximately 130 bp of DNA sequence. Separate selec- being adjacent to a single phosphodiester bond. In the first tions using initial frameshift mutations that differ in sign cluster each mutant is adjacent to the bond between bases 478 permit characterization of reading-frame shifts in the plus or and 479 and in the second cluster each is adjacent to the bond in the minus direction. Because all the mutants are between bases 483 and 482. When the two mutant clusters are frameshifts and all lie within a small portion of the gene, compared, the deletions and duplications are located sym- sequences of a relatively small number of mutants are metrically around these two phosphodiester bonds when the sufficient to identify frameshift hotspots. polarity of the DNA strands is taken into account. In each The 48 frameshift mutants induced by proflavin in the T4 cluster, the deletion and duplication mutations are on oppo- rIll gene did not include a single example of the addition or site sites of the error-prone phosphodiester bond. The bases deletion of a G-C base pair in a repeated G-C run. Thus, the that are duplicated are not the bases that are deleted. specificity of proflavin in this system is different from that This symmetry predicts that the deletions occurring in one reported in X (4) and different from the specificity of other mutant cluster occur in a different strand of the DNA than frameshift mutagens in E. coli plasmids (3, 5). The absence of their counterparts in the other mutant cluster. Similarly, it an added G-C base pair to the three consecutive G C base predicts that the duplications induced by the same mecha- pairs of positions 507-509 is particularly striking since this nism in the two clusters occur on different DNA strands. The mutation occurs frequently in the spontaneous background symmetry alone makes no direct prediction about which and accounts for approximately 10% of rFCJJ suppressors DNA strand is mutated, nor does it require that deletions and (12). duplications within a single cluster occur on the same DNA The genetic spectrum of proflavin-induced frameshift mu- strand. tants in the rII cistron, determined by Brenner et al. (13), The precise positions of the mutants in the DNA sequence suggests that the hotspot that we have analyzed in detail are unambiguous for the +G-C base pair at position 479 and represents not only a hotspot site for the 130 bp of DNA that at 482 and 481. ofDNA that for the. +T.A/A-T base pairs positions we have analyzed, but also for the 3.65 kilobases for the other are encode the rIIA and rIIB genes. In the forward genetic Although alternative positions genotypes spectrum, 55 mutants mapped to 39 recombinationally dis- possible, the symmetry of the illustrated placements predicts tinguishable sites; however, of these 39 sites, only 5 con- that the molecular intermediate of mutation at this hotspot tained more than a single mutant. One of these five sites had involves the symmetrical interaction of DNA with the two mutants and is the hotspot identified in this study. These mutagen and/or with enzymes that mediate the proflavin- mutants fail to recombine with frameshift r1074, and this induced frameshifts. The regular and distinctly different frameshift lies in the run of three ANT base pairs at positions positions of deletions relative to duplications within these 482-484 (9). Only two sites in the Brenner et al. (13) spectrum mutant clusters suggest that there are at least two alternative had more than two mutants, one had four and the other eight; intermediates and/or enzymatic processes at each error- thus even the most frequent sites appear to be only 2- to 4-fold prone phosphodiester bond in the hotspot. Downloaded by guest on September 24, 2021 Genetics: Ripley and Clark Proc. Natl. Acad. Sci. USA 83 (1986) 6957 another, and the molecular basis of cleavage specificity is not F-T preliminary results have shown the ability of +0 understood. Our 475 485 acridines to enhance DNA cleavage by the T4 type II topoisomerase within the rI hotspot sequence in vitro 5'-G A A A T T-G T T A-A A C T G- 3' 3'-C T T T A A-C A A T-T T G A C-5' (L.S.R., J. G. deBoer, and K. N. Kreuzer, unpublished +A results). Although little is known about other proflavin-induced hotspots in T4, the data available suggest that the properties 7-T of the rIIB site described here are not unique. A proflavin FIG. 2. The symmetrical arrangement of proflavin-induced hotspot in the T4 lysozyme gene is defined by the mutation frameshifts in the T4 rIIB hotspot. Six genotypes isolated at the J44 (7). Mutations at J44 occur approximately 100 times more hotspot are illustrated. The mutants can be described as two clusters frequently than do mutations within a nearby run of five of three sequence changes. Each separate DNA change represented consecutive A-T base pairs after proflavin treatment. The is immediately adjacent to the phosphodiester bond between bases frequency of proflavin-induced mutation at the J44 site is 478 and 479 or to the bond between bases 483 and 482. The similar to that at the rIB hotspot. Although the sequence of symmetrical pattern of mutants predicts that mutations near bases only one J44 site mutant has been determined (7), this 478 and 479 occur by mechanisms similar to those having the mutation is similar to the most frequent proflavin-induced corresponding placement near bases 482 and 483. For example, the mutation at the rI site. It is the duplication of a G&C base pair duplication of the G-C base pair at position 479 is predicted to occur not in a run of base pairs. The primary DNA in a manner similar to the duplication of the AT base pair at position that is G&C 482. The illustration of mutants adjacent to the bond between bases sequence surrounding J44 is 5' TTAATGCTGCT 3', the 478 and 479 in the top strand of the DNA and the mutants adjacent underlined "G" being the position of the duplication. This to the bond between bases 483 and 482 in the bottom strand illustrates DNA sequence is clearly distinct from the shown in Fig. 1 for these symmetrical predictions but does not define which DNA strand the T4 rIB sequence. We do not yet know whether this is the site of mutation. Not illustrated in this figure are two genotypes sequence can be cleaved by topoisomerase. The potentially (see Fig. 1) isolated once each. One of these, the duplication of 8 bp important primary sequence characteristics of T4 proflavin (positions 479-486) is immediately adjacent to the phosphodiester hotspots still remain to be determined. If the mechanism bond between bases 478 and 479 and thus may occur in a manner acting at the lysozyme site is similar to that at the T4 rI site, analogous to that of the other duplications adjacent to that sequence. by proflavin at The other frameshift is a duplication of C-T at positions 485 and 486. our result predicts that other mutants induced This mutant is not adjacent to the same phosphodiester bonds as the the J44 site will have different genotypes. other frameshifts at the hotspot and may not be a part of this hotspot. Previous studies of frameshift mutations in conjunction However, since the duplication of 8 bp described above and the C-T with the DNA contexts in which they occur have led to duplication are both adjacent to the phosphodiester bond between models that implicate repeated DNA sequences (3, 6), bases 486 and 487, it may be that these two mutations represent a quasipalindromic DNA sequences (19, 20), and combinations minor site for mutation located at that position. of repeated and palindromic sequences (21, 22) in the for- mation of misaligned DNA intermediates that ultimately lead We have considered the possibility that the error-prone to mutations. These models share the property of explaining phosphodiester bonds might represent sites of proflavin- the precise DNA sequence change of the mutant by a DNA stimulated nicking. If nicks have a 3'-OH terminus, duplica- misalignment that pairs a 3'-OH end of the DNA with a tions could be created by polymerase extension from the site template that could direct the observed DNA sequence of the nick, followed by aberrant ligation to the displaced change. These models do not predict the specificity of the strand. We have proposed a similar explanation for certain mutations at the proflavin-induced hotspot ofT4; there are no spontaneous duplications that also cannot be accounted for nearby sequences that offer a template for the diverse DNA by misalignment of DNA repeats (12). The deletion sequence changes seen. frameshifts might be accounted for by exonucleolytic degra- The striking distinction between the sequences of the most dation at the same nicks or by misalignment. The distinctly frequent frameshifts induced by proflavin in T4 and the different specificity of proflavin-induced duplications com- proflavin-induced frameshifts in monotonous runs of G-C or pared to the spontaneous duplications argues for proflavin- A-T base pairs in X (4) predict organism-specific differences specific enhancement of nicking or aberrant synthesis or in the enzymes or DNA structures involved in the mutational ligation at the hotspot site. The potential importance of mechanism. This prediction is supported by the observation nicked DNA in proflavin-induced mutation has been suggest- that proflavin produces a substantial number of base substi- ed from early observations of low molecular weight T4 DNA tutions as well as frameshifts in Salmonella (23), whereas in produced after in vivo treatment with acridine (14) and from bacteriophage systems only frameshifts have been seen. genetic evidence that proflavin-induced mutations occurred Sequencing of ICR-170-induced mutations in yeast has iden- most frequently at DNA termini (15). However, direct tified both transversions and duplications of G C base pairs interaction of proflavin and proteins may offer an alternative within G C runs (24). It seems likely that acridines operate explanation since in vitro studies of polymerization suggest through their disruption of substantially different enzymatic that the destabilization of DNA synthesis by acridine occurs pathways in different organisms. not only through its interaction with DNA but also with DNA polymerase (16). We acknowledge the technical assistance of Ms. K. Price and Mr. The 4-base distance between the two error-prone D. Ferber. This work was funded in part by Grant MV-270 from the phosphodiester bonds and the opposite polarity of the two American Cancer Society to L.S.R. mutant clusters suggested to us the potential participation of II the mutational the bacteriophage T4 type topoisomerase in 1. Lerman, L. S. (1961) J. Mol. Biol. 3, 18-30. process. The T4 enzyme produces specific nicking and 2. Orgel, A. & Brenner, S. (1961) J. Mol. Biol. 3, 762-768. cleavage of double-stranded DNA, similar to that produced 3. Calos, M. P. & Miller, J. H. (1980) J. Mol. Biol. 153, 39-68. by other type II topoisomerases; single-stranded DNA nick- 4. Skopek, T. R. & Hutchinson, F. (1984) Mol. Gen. Genet. 195, ing has also been detected (17, 18). Cleavage is brought about 418-423. through a nick on one DNA strand that is 4 bp removed from 5. Koffel-Schwartz, N., Verdier, J., Bichara, M., Freund, A., the nick on the other strand. The sequences in which T4 Daune, M. P. & Fuchs, R. P. P. (1984) J. Mol. Biol. 177, topoisomerase cleavages are found are not identical to one 33-51. Downloaded by guest on September 24, 2021 6958 Genetics: Ripley and Clark Proc. Nati. Acad. Sci. USA 83 (1986)

6. Streisinger, G., Okada, Y., Emrich, J., Newton, J., Tsugita, 15. Lindstrom, D. M. & Drake, J. W. (1970) Proc. Natl. Acad. A., Terzaghi, E. & Inouye, M. (1966) Cold Spring Harbor Sci. USA 65, 617-624. Symp. Quant. Biol. 31, 77-84. 16. Topal, M. D. (1984) Biochemistry 23, 2367-2372. 7. Streisinger, G. & Owen, J. (1985) Genetics 109, 633-659. 17. Kreuzer, K. N. & Alberts, B. M. (1984) J. Biol. Chem. 259, 8. Benzer, S. (1961) Proc. Nati. Acad. Sci. USA 45, 1607-1620. 5339-5346. 9. Pribnow, D., Sigurdson, D. C., Gold, L., Singer, B. S., 18. Kreuzer, K. N. (1984) J. Biol. Chem. 259, 5347-5354. Napoli, C., Brosius, J., Dull, T. J. & Noller, H. F. (1981) J. 19. Ripley, L. S. (1982) Proc. Nati. Acad. Sci. USA 79, 4128- Mol. Biol. 149, 337-376. 4132. 10. Owen, J. E., Schultz, D. W., Taylor, A. & Smith, G. R. (1983) 20. deBoer, J. G. & Ripley, L. S. (1984) Proc. NatI. Acad. Sci. J. Mol. Biol. 165, 229-248. USA 81, 5528-5531. 11. Ripley, L. S. & Shoemaker, N. B. (1983) Genetics 103, 21. Ripley, L. S. & Glickman, B. W. (1983) Cold Spring Harbor 353-366. Symp. Quant. Biol. 47, 851-861. 12. Ripley, L. S., Clark, A. & deBoer, J. G. (1986) J. Mol. Biol., 22. Glickman, B. W. & Ripley, L. S. (1984) Proc. Natl. Acad. Sci. in press. USA 81, 512-516. 13. Brenner, S., Benzer, S. & Barnett, L. (1958) Nature (London) 23. Kohno, T. & Roth, J. R. (1974) J. Mol. Biol. 89, 17-32. 182, 983-985. 24. Ernst, J. F., Hampsey, D. M. & Sherman, F. (1985) Genetics 14. Altman, S. & Lerman, L. S. (1970) J. Mol. Biol. 50, 263-277. 111, 233-241. Downloaded by guest on September 24, 2021