TIP60 REGULATION OF ΔNp63α IS ASSOCIATED WITH CISPLATIN RESISTANCE

A Thesis submitted in partial fulfillment of the requirement for the degree of Master of Science

By

AKSHAY HIRA B. Tech., Amity University, 2014

2019 Wright State University

WRIGHT STATE UNIVERSITY

GRADUATE SCHOOL July 30, 2019

I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY Akshay Hira ENTITLED TIP60 Regulation of ΔNp63α is Associated with Cisplatin Resistance BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF Master of Science.

Madhavi Kadakia, Ph.D. Thesis Director

Madhavi Kadakia, Ph.D. Department Chair

Committee on Final Examination

Madhavi Kadakia, Ph.D.

Michael P. Markey, Ph.D.

Hongmei Ren, Ph.D.

Barry Milligan, Ph.D. Interim Dean of the Graduate School ABSTRACT

Hira, Akshay. M.S. Department of Biochemistry and Molecular Biology, Wright State University, 2019. TIP60 Regulation of ΔNp63α is Associated with Cisplatin Resistance.

ΔNp63α, a member of the p53 transcription factor family, is overexpressed in non- melanoma skin cancer and regulates cell survival, migration and invasion. TIP60 is histone acetyltransferase (HAT) which mediates cellular processes such as transcription and the

DNA damage response (DDR). Previous studies in our lab have shown that overexpression of TIP60 induces ΔNp63α protein stabilization in a catalytic-dependent manner. Since

ΔNp63α is known to transcriptionally regulate several DDR genes and promote cisplatin resistance, its stabilization by TIP60 may contribute to the failure of platinum-based drugs in squamous cell carcinoma (SCC). We hypothesize that TIP60 regulates the transcriptional activity of ΔNp63α thereby modulating chemoresistance. In this study, we showed that overexpression of TIP60 in both H1299 and A431 cells led to increase in the levels of ΔNp63α, while TIP60 silencing in A431 cell lines led to a decrease in endogenous

ΔNp63α transcript and protein levels, thus confirming that TIP60 positively regulates

ΔNp63α in these cell lines. Increased levels of ΔNp63α and TIP60 were observed in a cisplatin resistant A431 SCC line. Further, stable expression of TIP60 or ΔNp63α individually promoted resistance to cisplatin, whereas loss of ΔNp63α and TIP60 sensitized cells to cisplatin. Higher acetylation of ΔNp63α and TIP60 were seen in cisplatin resistant cells. High-throughput transcriptome sequencing was performed using the Ion

iii ProtonTM AmpliSeq panel to identify downstream mRNA targets of TIP60. An NGS data set generated from Lenti viral transduced A431 cells resulting from overexpression of

TIP60 and eGFP as a control identified 228 mRNA showing differential gene expression.

Taken together, our data suggest that TIP60-mediated regulation of ΔNp63α increases cisplatin resistance and has potential implications for cancer treatment and drug design.

Additionally, since ΔNp63α confers cisplatin resistance through regulation of genes involved in DNA damage repair, our findings provide critical insight into the mechanism by which genes involved in cisplatin resistance are regulated and may lead to strategies for treating resistant tumors with increased efficacy.

iv TABLE OF CONTENTS

I. INTRODUCTION ...... 1

A. ΔNp63α ...... 1

B. ΔNp63α and cancer ...... 5

C. TIP60 ...... 6

D. TIP60 and cancer ...... 7

E. DNA Damage repair and cisplatin resistance ...... 11

F. ΔNp63α and TIP60 in DNA Damage repair ...... 11

G. Screening for transcriptional targets of ΔNp63α and TIP60 by AmpliSeq 13

H. Rationale ...... 14

II. MATERIALS AND METHODS ...... 16

A. Cell culture and reagents ...... 16

B. Silencing/siRNA transfection ...... 16

C. DNA constructs and transient transfection ...... 17

D. Generation of A431 stable cell lines via lentivirus infection ...... 17

E. Immunoblot analysis ...... 19

F. Immunoprecipitation ...... 19

G. MTS proliferation assays ...... 20

H. Quantitative Reverse transcription PCR (qRT-PCR) ...... 21

I. Next generation Sequencing ...... 21

v III. RESULTS ...... 25

A. TIP60 silencing reduces ΔNp63α transcript and protein levels ...... 25

B. TIP60 overexpression increases ΔNp63α protein levels ...... 28

C. Cisplatin resistance cells exhibit elevated levels of TIP60 and ΔNp63α....31

D. Overexpression of TIP60 protects ΔNp63α protein levels upon cisplatin

treatement ...... 34

E. Cisplatin resistant cells retain more level of ΔNp63α and TIP60 following

cisplatin treatment ...... 37

F. TIP60 silencing reduces ΔNp63α mRNA and protein levels in cisplatin

resistant cells ...... 40

G. Silencing of TIP60 and/or ΔNp63α sensitize Pt cells to cisplatin ...... 43

H. Stable expression of either ΔNp63α or TIP60 increases resistance to

cisplatin ...... 46

I. ΔNp63α contributes to cisplatin resistance and its reduced expression

sensitize cells to cisplatin ...... 49

J. Acetylation of ΔNp63α is evident in cisplatin resistant cells ...... 52

K. RNA-Seq Analysis of TIP60 and ΔNp63α targets ...... 55

IV. DISCUSSION...... 60

V. CONCLUSION ...... 69

VI. APPENDIX ...... 70

VII. BIBLIOGRAPHY ...... 82

vi LIST OF FIGURES

Figure 1: p63 isoforms ...... 3

Figure 2: KAT5 (HIV-1, Tat interacting protein) ...... 9

Figure 3: TIP60 silencing reduces ΔNp63α transcript and protein levels ...... 26

Figure 4: TIP60 overexpression increases ΔNp63α protein levels ...... 29

Figure 5: Cisplatin resistant cells exhibit elevated levels of TIP60 and ΔNp63α ...... 32

Figure 6: Overexpression of TIP60 protects ΔNp63α levels upon Cisplatin treatment ....35

Figure 7: Cisplatin resistant cells retain more level of ΔNp63α and TIP60 following cisplatin treatment ...... 38

Figure 8: TIP60 knockdown reduces ΔNp63α mRNA and protein levels in cisplatin resistant cells...... 41

Figure 9: Silencing of TIP60 and/or ΔNp63α sensitizes Pt cells to cisplatin ...... 44

Figure 10: Stable expression of either ΔNp63α or TIP60 increases resistance to cisplatin.

...... 47

Figure 11: ΔNp63α contributes to cisplatin resistance and its reduced expression sensitize cells to cisplatin...... 50

Figure 12: Acetylation of ΔNp63α is elevated in cisplatin resistant Pt cells ...... 53

Figure 13: AmpliSeq experimental design and workflow ...... 56

Figure 14 Model describing TIP60-mediated regulation of cisplatin resistance and the response to DNA damage via ΔNp63α ...... 63

vii

LIST OF TABLES

Table 1: Quality control metrics of AmpliSeq samples and data obtained from Lenti-

A431 cells overexpressing eGFP or TIP60 ...... 58

Appendix

Table A1: mRNA differentially regulated by stable TIP60 expression in A431 cells ...... 70

viii ACKNOWLEDGMENTS

I would like to express my special thanks of gratitude to my advisor, Dr. Madhavi

Kadakia, who exudes confidence and strength in me. I honestly could not have wished for a better mentor than Dr. Madhavi Kadakia. I cannot even mention in words how much I have learned working with her. I matured personally and professionally while working under her guidance. Thank you for all your help, support and guidance, Dr. Kadakia! I would also like to sincerely thank my committee members, Dr. Michael P. Markey and Dr.

Hongmei Ren, for their expertise on my research projects and guidance in completing my thesis.

A special thanks to all the past and present Kadakia lab members who I have had the pleasure to work with. I would like to recognize Dr. Michael Craig, Dr. Jin Zhang,

Andrew Stacy, Amjad Aljagthmi and Nabaa H. Hmood. I thank you for all the support and guidance you have given me. I would also like to thank the Biochemistry and Molecular

Biology department for providing such a great platform to obtain technical expertise.

I am also very thankful for all my friends whose love and support have been with me throughout my time at graduate school. Lastly, and most importantly I would like to sincerely thank my family for all their love and continuous support. My aunt, who cares for me deeply and has a unique ability to support, challenge and advise all at once. My brother and sister, for always being so helpful and concerned; my father for always encouraging and motivating me and my loving and caring mother for her endless love and blessings. Each day I feel blessed and lucky enough to have them in my life. Thank you for everything!

ix

DEDICATIONS

I would like to dedicate this thesis to my Aunt Dr. Monika Bhola.

She inspires me to be my best self.

x I. INTRODUCTION

A. ΔNp63α p63, a member of p53 family, is the most ancient member of the p53 family of transcription factors (Yang and McKeon 2000, Dötsch, Bernassola et al. 2010). The p63 gene is expressed in six major transcripts, three of which are transcribed from the P1 promoter and encode proteins with full-length transactivation (TA), DNA binding and oligomerization domains (Figure 1). The other three transcripts are transcribed from a downstream (P2) promoter resulting in transcripts with a truncated N-terminal domain (ΔN). Alternative splicing at the carboxy-terminus yields α, β and γ isoforms (Yang, Kaghad et al. 1998,

Urist, Di Como et al. 2002). The TA isoforms of p63 (TAp63) are capable of transactivating p53 target genes resulting in induction of apoptosis and growth arrest by inducing anti- proliferative genes. The ΔN isoforms (ΔNp63), by contrast, generally act in a dominant- negative manner to repress p53 and TA isoforms by inducing proliferation and survival genes (Westfall, Mays et al. 2003, Wu, Nomoto et al. 2003, Leonard, Kommagani et al.

2011).

p63 is expressed in the embryonic ectoderm that gives rise to progenitor cells of the epidermis (Yang, Kaghad et al. 1998, Mills, Zheng et al. 1999). Accordingly, p63 is expressed in epidermally derived tissues including the skin, oral epithelium, tongue, and kidney but not in liver, intestine, testis, skeletal muscle, or heart. p63 deficient mice do not develop limbs, hair follicles or teeth and have skin that lacks stratification and does

1 not express differentiation markers (Mills, Zheng et al. 1999, Koster, Kim et al. 2004).

Importantly, a switch from TAp63 to ΔNp63 isoforms occurs during later stages of embryonic development and is required for epidermal maturation to take place (Koster and Roop 2004).

ΔNp63α is the predominant p63 isoform expressed in the skin (Bamberger, Hafner et al. 2005). ΔNp63α is most highly expressed in the basal cell layer of normal adult epithelium where it plays a crucial developmental role in maintaining stem cell proliferation (Yang, Kaghad et al. 1998, Koster, Kim et al. 2004, Castillo-Martin,

Domingo-Domenech et al. 2010, Sethi, Romano et al. 2015). ΔNp63α regulates many target genes involved in cell proliferation, differentiation and adhesion (Truong, Kretz et al. 2006, Soares and Zhou 2018). Accordingly, loss of ΔNp63α results in a decrease in cell proliferation (Leonard, Kommagani et al. 2011). ΔNp63 inhibits the transcription of p21,

PUMA and Bax genes and causes enhanced proliferation and cell survival (Osada, Ohba et al. 1998, Yang, Kaghad et al. 1998). p63 also regulates the cell cycle via cyclin D1 and

E1 and thus contributes to cancer progression (Ye, Lee et al. 2014).

ΔNp63α transcriptional activity and stability are modulated by a variety of post- translational modifications (PTMs), including phosphorylation (Westfall, Joyner et al.

2005), ubiquitination (Fomenkov, Zangen et al. 2004) and acetylation (Chae, Kim et al.

2012). These PTMs appear to be a primary way in which p63 stability and transcriptional activity are regulated and delineating the effects of these modifications is key to understand the role that ΔNp63α plays in skin homeostasis and in cancer.

2

p53 TA DBD OD ~25% ~65% ~35%

TAp63 TA DBD OD SAM TID a

TAp63 TA DBD OD b

TAp63 TA DBD OD g

DNp63 TA DBD OD SAM TID a

DNp63 TA DBD OD b

DNp63 TA DBD OD g

3 Figure 1: p63 isoforms. Schematic of the p63 gene comprising of the two promoter sites,

3’ splicing segments, and the resulting six main p63 isoforms (TAp63α, TAp63β,

TAp63γ, ΔNp63α, ΔNp63β and ΔNp63γ). The domains are as follows: transactivation domain (TA), DNA-binding domain (DBD), oligomerization domain (OD), sterile alpha motif (SAM), and transactivation inhibitory domain (TI).

4 B. ΔNp63α and Cancer

Nonmelanoma skin cancer (NMSC) is the single most common human malignancy

(Christenson, Borrowman et al. 2005, Rogers, Weinstock et al. 2010). In 2019, 1,762,450

new cancer cases and 606,880 cancer deaths are projected to occur in the United States

(Siegel, Miller et al. 2019). Approximately 80% of all NMSC cases are basal cell

carcinoma (BCC), while 20% are squamous cell carcinomas (SCC) ΔNp63α is

overexpressed in 80% of head and neck squamous cell carcinomas (HNSCCs) and NMSC

(Chung, Lau et al. 2010, Leonard, Kommagani et al. 2011, Hill, Zhang et al. 2015).

ΔNp63α is also overexpressed in pancreatic cancer cell lines (Danilov, Neupane et al.

2011).

While p63 is rarely mutated in cancer (Yoshikawa, Nagashima et al. 1999),

overexpression of ΔNp63α generally is a result of amplification of the p63 gene and not

from gain-of-function mutations (Hibi, Trink et al. 2000). In fact, p63 genomic

amplification has an early role in lung tumorigenesis (Massion, Taflan et al. 2003).

ΔNp63α plays important cell survival and anti-apoptotic functions in cancer. Since

ΔN isoform antagonize the activity of the TA isoforms, upregulation of ΔNp63α interferes

with the tumor suppressor function of TAp63 and inhibits activation of apoptotic pathways.

Chemotherapeutic treatment induces expression of Bax, Bim, Noxa, Puma and Perp.

These apoptotic genes are antagonized by ΔNp63α (Mundt, Stremmel et al. 2010), thus

potentially contributing to chemoresistance.

Interestingly, p63 may also play a role in cancer progression through regulation of genes involved in EMT. Loss of p63 expression results in up-regulation of genes associated with invasion and metastasis and predisposes acquisition of mesenchymal characteristics

5 (Barbieri, Tang et al. 2006, Yoh, Regunath et al. 2016). EMT is the phenotypic conversion of epithelial cells into mesenchymal-like cells (Zheng, Carstens et al. 2015). EMT is a very complex and highly regulated process controlled by various families of transcriptional regulators (Yoh, Regunath et al. 2016). Several studies have shown the upregulation of factors involved in EMT (Zhang, Lu et al. 2019) are linked to the development of chemoresistance (Choi, Kim et al. 2019, Zhan, Wang et al. 2019, Zhang, Lu et al. 2019).

The contribution of ΔNp63α upregulation in NMSC to chemoresistance through EMT pathways remains unclear.

C. TIP60

Tat-interactive protein 60 (TIP60), also known as KAT5, is an acetyltransferase and the

founding member of MYST family of histone acetyltransferases. TIP60 serves a myriad of

functions including regulation of DNA damage repair, cell cycle and apoptosis. It elicits

these functions by directly acetylating histones to open chromatin for transcription, serving

as a co-factor for transcription factors such as c-Myc, and by acetylating non-histone

substrates like p53 (Frank, Parisi et al. 2003, Patel, Du et al. 2004, Zhang, Wu et al. 2017).

The cellular TIP60 exists as a multiprotein complex, called as mammalian TIP60

complex, which consists of at least 18 subunits (Doyon, Selleck et al. 2004). Several studies

have shown that TIP60/NuA4-type complexes are involved in diverse cellular processes

including transcription, cell cycle control, apoptosis, cell proliferation and DNA repair

(Sapountzi and Cote 2011). The TIP60 protein contains a chromodomain, a nuclear

receptor box, and a MYST-type histone acetyltransferase (HAT) domain (MYST domain)

(Figure-2). The MYST domain contains an acetyl CoA binding domain and a zinc finger

6 motif, both important for the acetyltransferase activity of TIP60 (Koonin, Zhou et al. 1995,

Kim, Ann et al. 2007).

TIP60 plays a crucial role in transcriptional regulation (Kamine, Elangovan et al.

1996, Sapountzi, Logan et al. 2006, Zhang, Wu et al. 2017). TIP60 acetylation of the p53 core domain at Lysine 120 (K120) triggers p53-dependent apoptotic response by inducing expression of PUMA (Tang, Luo et al. 2006, Sykes, Stanek et al. 2009, Wang, Bao et al.

2019). TIP60 also interacts with and acetylates non-histone proteins, such as MYC and p53 resulting in changes in activity and / or stability (Patel, Du et al. 2004, Yang, Xue et al.

2018). TIP60 is targeted to proteasome-mediated degradation by MDM2 under stress

(Legube, Linares et al. 2002)

D. TIP60 and cancer

TIP60 is significantly down-regulated in many cancers, including prostate, breast, colorectal cancer and lymphoma (Mattera, Escaffit et al. 2009, Litvinov, Netchiporouk et al. 2014, Pandey, Zhang et al. 2015). Overexpression of TIP60 in melanoma cells resulted in significantly increased chemosensitivity (Chen, Cheng et al. 2012). Many studies focus on TIP60 as a therapeutic targeted to study for cancer because of its role in cell cycle regulation, proliferation and apoptosis (Hirano, Izumi et al. 2010, Brown, Bourke et al.

2016, Cregan, McDonagh et al. 2016). Aberrant lysine acetyltransferase functions promote or suppress tumorigenesis in different cancers such as colon, breast and prostate tumors

(Judes, Rifai et al. 2015). Further, TIP60 coordinates with BMI1 to drive expression of multidrug resistance protein 1 (MDR1) in response to cisplatin treatment, thus potentially

7 contributing to resistance to a spectrum of chemotherapeutics (Banerjee Mustafi,

Chakraborty et al. 2016).

8

MYST domain

Chromodomain Zn Finger HAT domain NR box

9 Figure 2: KAT5 (HIV-1, Tat interacting protein). Schematic of the TIP60 protein comprising of the domains as follows: Chromodomain, Zinc finger motif

(Zn Finger), Histone acetyltransferase domain (HAT domain) and Nuclear receptor box (NR box). The MYST domain, comprised of an acetyl-coenzyme A binding domain and a zinc finger motif, is responsible for catalytic activity.

10 E. DNA Damage repair and Cisplatin Resistance

Cisplatin was discovered in the 1980’s and has since shown efficacy in the treatment of solid malignancies, including testicular, ovarian, head and neck, colorectal, bladder and lung cancers. Cisplatin has since become the conventional treatment for advanced SCCs

(Bejar and Maubec 2014). Cisplatin elicits its cytotoxic effect by covalent binding to purine DNA bases causing interstrand and intrastrand DNA adducts, thus leading to activation of DNA damage repair pathways or the induction of cell apoptosis if the damage cannot be repaired (Kelland 2007). Cisplatin-induced DNA lesions are primarily repaired by the nucleotide-excision (NER) pathway, although mismatch repair

(MMR), homologous recombination (HR) and nonhomologous end joining (NHEJ) may be utilized in repairing cisplatin-induced DNA damage (Rocha, Silva et al. 2018).

Unfortunately, cisplatin treatment often results in the development of chemoresistance and therapeutic failure, and the mechanisms underlying this resistance are widely studied

(Galluzzi, Senovilla et al. 2012). Increased efflux or reduced uptake of cisplatin, altered

DNA methylation status, changes in miRNA expression, and increased levels of DNA repair proteins have all been reported to contribute to cisplatin resistance (Dasari and

Tchounwou 2014).

F. ΔNp63α and TIP60 in DNA damage repair

ΔNp63α has been shown to transcriptionally regulate genes involved in DNA damage repair (Hastak, Alli et al. 2010). ΔNp63α directly induces expression of several

FA and HR genes such as FAND2, BRCA2 and RAD51 (Shen, Oswald et al. 2013,

Bretz, Gittler et al. 2016). ΔNp63 also appears to regulate double strand break (DSB)

11 repair since it transcriptionally regulates ataxia-telangiectasia mutated kinase (ATM), a kinase which rapidly localizes to DSBs (Craig, Holcakova et al. 2010). Additionally, upon

UV-induced DNA damage, MDM2 and Fbw7 cooperate to regulate the levels of the

ΔNp63α (Galli, Rossi et al. 2010). Importantly, Cisplatin induces phosphorylation of

ΔNp63α and downregulation of intracellular ΔNp63α protein levels (Huang, Bell et al.

2012). Despite being downregulated in cisplatin-treated cells, ΔNp63α has been shown to enhance oncogenic potential and contribute to chemoresistance in melanoma and non- melanoma cancers (Zangen, Ratovitski et al. 2005, Danilov, Neupane et al. 2011, Huang,

Jeong et al. 2012, Matin, Chikh et al. 2013). ΔNp63α potentially also contributes to cisplatin resistance by promoting cell proliferation and inhibiting cell death (Lee, Lee et al.

2006, Chiang, Chu et al. 2009).

TIP60 is a central regulator of the homologous recombination (HR)-directed and

Fanconi anemia (FA) DNA repair pathways. TIP60 binds to the promoters of the FANCD2 and BRCA1 genes, both involved in HR and FA pathways, and induces their expression in cisplatin resistant cells (Su, Ho et al. 2017). Low TIP60 levels correlate with genomic instability and impaired DNA repair in mammary epithelial cells following genotoxic stress

(Bassi, Li et al. 2016). Similarly, TIP60-deficient nasopharyngeal carcinoma (HONE6) cells show an increase in the frequency of double strand breaks and stalled replication forks, consistent with impaired DNA damage response (Su, Ho et al. 2017). TIP60 binds the ATM kinase and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) and participates in their activation by DNA double-strand breaks (Squatrito, Gorrini et al. 2006,

Mattera, Escaffit et al. 2009). TIP60 acetyltransferase activity appears to be important for the activation of ATM's kinase activity in response to DNA damage (Sun, Jiang et al.

12 2005). Further, TIP60-mediated p21 acetylation is required for p21-dependent DNA damage-induced cell-cycle arrest in HCT116 and MEF cells (Lee, Seo et al. 2013). Since

TIP60 plays a central role in DNA damage response pathways, it follows that TIP60 expression is significantly correlated with cisplatin sensitivity in human nasopharyngeal cancer cell lines and contributes to chemoresistance (Su, Ho et al. 2017). Further, TIP60 expression and acetyltransferase activity appear to be crucial its role in modulating cisplatin chemoresistance (Miyamoto, Izumi et al. 2008), however the significance of

TIP60 to cisplatin resistance in SCC remains unclear.

G. Screening for transcriptional targets of ΔNp63α and TIP60 by AmpliSeq

Advances in Next-Generation sequencing have made it possible to sequence, map and quantify the transcriptome in less time and at lower cost. High throughput RNA-sequencing enables researchers to study the molecular constituents of the cells and transcriptional landscapes of cell quantitatively (Lahens, Ricciotti et al. 2017). AmpliSeq, a very sensitive and reliable approach for large scale transcriptome screening and the targeted approach used on the Ion Torrent sequencing platform, is a very sensitive and cost-effective approach for very large-scale gene expression analysis and mRNA marker screening with high accuracy (Li, Turner et al. 2015). The Ion Torrent platform provides higher speed and lower cost sequencing compared to other systems (Liu, Li et al. 2012). Ampliseq provides a mechanism for determining the global transcriptomic effects of TIP60 dysregulation, thereby providing critical insights into the contribution of TIP60 to downstream targets.

13 H. Rationale

SCC is commonly treated with a combination of cisplatin and radiotherapy, but SSC often become resistant to cisplatin (Galluzzi, Senovilla et al. 2012, Bejar and Maubec 2014).

ΔNp63α is highly expressed in SCC and is extensively studied as a proto-oncogene (Flores

2007), yet its role in the development of chemoresistance is not fully understood.

Preliminary data from our lab indicated that TIP60 positively regulates ΔNp63α, but it is unclear whether TIP60 also in plays a role in cisplatin-induced DNA damage through its regulation of ΔNp63α.

We hypothesize that TIP60 modulates the transcriptional activity and alters the functional contribution of ΔNp63α to the DDR, thereby contributing to chemoresistance.

We addressed this hypothesis by testing the following three specific aims:

• In Aim 1, we determined whether TIP60 regulates the expression of ΔNp63α

transcript and protein. TIP60 modifies the activity of p53 through acetylation (Tang,

Luo et al. 2006) and p53 shares high homology with ΔNp63α (Yang, Kaghad et al.

1998), suggesting that TIP60 may similarly regulate ΔNp63α. TIP60 also has been

shown to regulate the transcription and protein stability of non-histone proteins such

as p21. TIP60 acetylates and stabilizes p21 protein, while loss of TIP60 results in a

loss of p21 transcript in U2OS cells (Lee, Seo et al. 2013) Taken together, this led

us to assess the ability of TIP60 to regulate ΔNp63α transcript and protein.

• In Aim 2, we determined the role that TIP60 plays in mediating cisplatin resistance

via regulation of ΔNp63α. TIP60 and ΔNp63α directly regulate genes involved in the

repair of DNA damage (Bretz, Gittler et al. 2016, Su, Ho et al. 2017), but the potential

role that TIP60 plays in the regulation of ΔNp63α-mediated cisplatin resistance

14 remains unexplored.

• In Aim 3, we examined whether TIP60 contributes to cisplatin resistance by altering

the transcriptional activity of ΔNp63α. This aim is based, in part, on prior reports that

ΔNp63α regulate genes involved in cell cycle progression, inhibition of apoptosis and

cancer progression (Westfall, Mays et al. 2003, Moses, George et al. 2019) and that

ΔNp63α contributes to cisplatin resistance (Danilov, Neupane et al. 2011).

Taken together, our goal is to understand the mechanism by which ΔNp63α and TIP60 regulate genes involved in cisplatin resistance, which will further provide novel targets to treat cisplatin resistant tumors with increased efficacy. Identification of novel targets will lead to better understanding of role of TIP60-ΔNp63α association in development of chemoresistance.

15 II. MATERIALS AND METHODS

A. Cell culture and Reagents

The squamous cell carcinoma cell line A431 which has endogenous expression of ΔNp63α

(Higashikawa, Yoneda et al. 2007, Kommagani, Leonard et al. 2009) and TIP60 was used for silencing studies. The human non-small cell lung carcinoma H1299 which is null for p63 was used for overexpression studies. Both cell lines were purchased from American

Type Culture Collection (Manassas, Virginia, USA) and were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 8% fetal bovine serum (FBS) and

250 U penicillin and 250µg streptomycin (referred to as complete media) at 37°C in 5%

CO2. A431 Parental and a cisplatin resistant variant designated Pt were a generous gift from Dr. Paola Perego (Istituto Tumori di Milano) and were established as per (Lanzi,

Perego et al. 1998). These lines were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) but lacking antibiotics at 37°C in 5% CO2. Cisplatin

(cis-diammineplatinum (II) dichloride) used in this study was purchased from Sigma-

Aldrich (St. Louis, MO, USA). A 1 mg/ml cisplatin stock was prepared in 1X PBS.

B. Silencing/ siRNA transfection

TIP60 and p63 silencing was performed using two rounds of siRNA transfection as described previously using Lipofectamine RNA-iMax as per manufacturer’s instructions

(Life Technologies, Carlsband, CA, USA) with cells harvested 48 h post-transfection

16 (Kommagani, Leonard et al. 2009). Allstars non-silencing control (NSC), p63, and TIP60 siRNA were purchased from Qiagen (Valencia, CA). The target sequences used for siRNA were p63 siRNA_1 (CACCCTTATAGTCTAAGACTA) and siTIP60

(CACCACATTGCCTGTCCTCTA) For NSC control transfections, 40nM of Non- silencing control (NSC) alone was used. For transfections, 20 nM of siRNA against p63 and/or 20nM of siRNA against TIP60 and the balance made up with NSC siRNA.

C. DNA constructs and transient transfections

The FLAG-tagged TIP60 plasmid was graciously provided by Dr. Edward Seto (George

Washington University, Washington, DC). The expression plasmid encoding ΔNp63α was described earlier (Caserta, Kommagani et al. 2006). ΔNp63α and TIP60 expression vectors or the empty pCDNA3.1 control vector were transiently transfected into H1299 cells using

Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Cells were seeded at 4.0 x 105 into

6 well plates in antibiotic-free medium prior to the day of transfection with the desired plasmids (1:2 DNA to Lipofectamine 2000 in Opti-MEM solution) when cells reached approximately 90% cell confluency (Leonard, Kommagani et al. 2011). After 6 to 8 hours of incubation at 37°C, media was replaced with fresh complete medium. Cells were harvested 24 hours after transfection for analysis of protein or RNA.

D. Generation of Lenti-A431 stable cell lines

A431-eGFP, A431-ΔNp63α and A431-TIP60 stable cell lines were generated by lentiviral- mediated transduction of parental A431 cells. Replication-incompetent lentivirus capable of transducing the parental A431 cells was generated utilizing 3 packaging plasmids (pLP1,

17 pLP2 and pLP/VSVG) and a pLenti-based expression vector (pLB2V5) containing the cDNA of interest. The packaging plasmids provide the required structural and replication proteins in trans. pLP1 carries gag and pol genes, pLP2 carries the HIV-1 rev gene, and pLP-VSVG carries the vesicular stomatitis virus G glycoprotein. The pLB2V5-eGFP and pLB2V5-ΔNp63α plasmids had been generated previously (Kommagani, Leonard et al.

2009). The pLB2V5-TIP60 plasmid was generated by PCR amplification of an EcoR1-

Xho1flanked TIP60 cDNA from pCDNA3.1-TIP60 and subsequent subcloning into pLB2V5. To generate virus, 3x 106 HEK-293FT cells were seeded onto 10-cm dish 24 hours prior to transfection with 4.6 μg of pLP1, 1.8 μg of pLP2, 2.52 μg of pLP-VSVG and

9 μg of pLB2V5 containing the cDNA for eGFP, ΔNp63α or TIP60. At 24 hours post infection, HEK-293FT cell media was changed to fresh culture media. At 72 hours post transfection, conditioned medium containing virus was collected and centrifuged to remove cell debris, filtered through a 0.45µm filter to remove cellular debris and used immediately to transduce A431 cells. A431 cells were seeded at 3.5 x 105 cells per well in two wells of a 6-well dish 24 hours prior to virus infection. The next day, 1.5 ml of lentivirus containing media, 500 µl of complete media and 10 μg/ml of Polybrene (EMD

Millipore, Billerica, MA, USA) were added directly to the A431 cells. At 24 hours post infection, A431 cells were supplemented with fresh media. At 72 hours post-infection, transduced cells were selected in blasticidin antibiotic (3 µg/ml) (Life Technologies,

Carlsbad, CA USA) to select for A431 cells stably expressing eGFP or DNp63a or TIP60.

18 E. Immunoblot analysis

Cells were harvested using trypsin, washed in PBS, and lysed in ice-cold phosphatase inhibitor buffer (50mM Tris-HCl pH 8, 120 mM NaCl, 5mM sodium pyrophosphate phosphatase inhibitor, 10mM NaF, 30 mM paranitrophenylphosphate, 1mM benzamidine,

0.1% NP-40, 1% Triton X-100 and 0.2 PMSF, 100nM sodium orthovanadate) supplemented with 10% protease inhibitor cocktail (Sigma, St. Louis, MO). Total protein concentrations were determined by BCA assay (Thermo Fisher Scientific Inc., Waltham,

MA, USA). Equivalent amounts of protein were resolved on 10% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. Proteins were detected using rabbit polyclonal anti-GFP (FL) at 1:1,000, anti-p63 (4A4) generated from mouse hybridomas at 1:10,000, anti-TIP60 (C7, Santa Cruz Biotechnology, Santa Cruz, CA,

USA) at 1:1000, or mouse monoclonal anti-β-actin (Santa Cruz Biotechnology, Santa Cruz,

CA, USA) at 1:10,000. β-actin was used as a loading control. Appropriate horseradish peroxidase-conjugated secondary antibodies (Promega, Madison, WI, USA) were used for chemiluminescence detection with Western Lightning Plus chemiluminescent kit (Perkin

Elmer, Waltham, MA, USA). Fold change in protein expression was calculated by normalizing band intensity to β-actin followed by relative change from vehicle or NSC.

F. Immunoprecipitation

Whole cell lysates were prepared by lysing cells in a NP-40 lysis buffer (25 mM Tris, pH

8.0, 150 mM NaCl, 0.5 mM EDTA, 0.5 mM EGTA, 1% Nonidet P-40, 1 mM sodium orthovanadate, 1mM NaF, 1 mM NaPP and 1 mM DTT) supplemented with 10% protease inhibitor cocktail (Sigma, St. Louis, MO). Cell lysates were subjected to four 10-second

19 pulses on a 60 Sonic Dismembrator (Thermo Fisher Scientific Inc., Waltham, MA, USA).

Cell debris pellet was removed following centrifugation of the samples at 14,000 x g for

10 minutes. Total protein concentrations of the supernatant were determined by BCA protein detection method and equivalent protein concentrations ranging for 1.5 to 2 mg were used for Immunoprecipitation (IP). Immunoprecipitates were pre-cleared with 10 μL of protein A agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed by an overnight incubation with either monoclonal anti-acetylated lysine antibody (Cell

Signaling Technology, Danvers, MA, USA). The next day, protein-A beads were added, and the samples were rotated at 4⁰C for 1 hour, washed with PBS containing 0.05% Tween and analyzed by immunoblot.

G. MTS proliferation assays

Cells were seeded at 10,000 cells per well in a 96-well flat bottom culture dish for analysis of cell growth by MTS assay. At 24h post-plating, cells were treated with a 2-hour pulse of increasing concentrations of cisplatin ranging from 5 to 100 µg/ml and then returned to complete medium lacking antibiotics. Proliferation was measured using Promega Cell Titer

96 Aqueous One Solution Cell Proliferation Assay (MTS) (Thermo Fisher Scientific Inc.,

Waltham, MA, USA) at various time points post-treatment. Student’s t-tests were used to determine significant differences in mean A490 relative to vehicle control from three independent biological replicates. Significant differences (p ≤ 0.05) were identified using two-tailed Student’s t-tests assuming equal variances.

20 H. Quantitative Reverse transcription PCR (qRT-PCR)

RNA isolation was performed using the E.Z.N.A. Total RNA kit according to the manufacturer protocol (Omega Bio-Tek, Norcross, GA, USA). cDNA was synthesized from 1 µg of total RNA using the TaqMan reverse transcription kit (Life Technologies,

Carlsbad, CA USA). qRT-PCR was performed using the Applied Biosystem 7900HT or

QuantStudio 7 Flex Real-Time PCR systems using Assays on Demand (AOD) specific for human GAPDH (4325792), KAT5 (Hs00197310_m1) and pan-p63 (Hs00978340_ml)

(Life Technologies, Carlsbad City, CA, USA) with each sample run in triplicate. Relative expression was calculated using the ΔΔCT method with GAPDH used as an endogenous control as described previously (Livak and Schmittgen 2001, Pfaffl 2001).Significant differences (p ≤ 0.05) were identified using two-tailed Student’s t-tests assuming equal variances in samples compared to control.

I. Next Generation Sequencing

RNA isolation and analysis: Lentiviral transduced A431 eGFP and TIP60 stable cells were used for NGS analysis. Induction of ΔNp63α and TIP60 was confirmed in lenti-A431 cells by immunoblot before proceeding to RNA isolation. Total RNA was isolated using the mirVana™ PARIS™ Kit (Life Technologies, Carlsband, CA, USA) according to the manufacturer’s protocol. Total RNA samples were subjected to DNAse treatment using

DNA-freeTM Kit (Life Technologies, Carlsband, CA, USA) to remove genomic DNA contamination. RNA concentration and quality were measured on the Agilent 2100

Bioanalyzer with the Nano-RNA kit per the manufacturer’s instruction (Agilent

Technologies, Santa Clara, CA, USA).

21 Library Preparation: Ten nanograms of total-RNA was reverse transcribed to cDNA using the Superscript VILO cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). Simultaneous

PCR amplification of 20,000 human RefSeq genes was performed in 15 cycles using the

Ion AmpliseqTM Transcriptome Human Gene Expression Core Panel (ThermoFisher

Scientific, Carlsbad, CA, USA). The amplified targeted sequences were partially digested with FuPa and the resulting amplicons were ligated to Ion P1 adapter and unique barcode adapters (Ion XpressTM Barcode Adapter 1-16 Kit, ThermoFisher Scientific, Carlsbad, CA,

USA). Unamplified libraries were purified using AMPure paramagnetic beads and a

DynaMagTM -96 side magnet to remove contaminants (e.g. primers, dNTPs, and salts) and recover amplicons greater than 100 bp in length. Samples were washed in 70% EtOH and eluted in 45µl low TE buffer. Purified library yields were quantified using the Ion Library

TaqMan Quantitation Kit using E. coli DH10B Ion Control Library as per manufacturer recommendations (ThermoFisher Scientific, Waltham, MA, USA). Each Ion Ampliseq

Transcriptome library was diluted to 1:10,000 and 1:20,000 dilutions and quantified using

QuantStudio 7 Flex Real-Time PCR System.

Template Preparation: Barcoded cDNA library from individual samples was diluted to

100 pM and pooled together. Serial dilutions of the pooled libraries were performed to get a final concentration of 8 pM of pooled cDNA, which was clonally amplified onto the Ion

Sphere Particles (ISPs) by emulsion PCR using the Ion OneTouch 2 and the Template Kit v2 (Catalog #4485146) per manufacturer’s instructions (Life Technologies, Carlsband,

CA, USA). ISP library quality was assessed on the Qubit 2.0 Fluorometer (ThermoFisher

Scientific, Waltham, MA, USA) by hybridizing Qubit probes to a 2μL aliquot of freshly washed ISPs. In this quality test, an Alexa Fluor 488 labeled probe anneals to primers on

22 the ISPs, and a second Alexa Fluor 647 labeled probe binds to the template cDNA. The ratio of the 647nm to 488nm fluorescence gives an estimate of the percentage of template

ISPs. Templated ISPs with a percentage between 10%-25% were used for enrichment with the Ion OneTouch™ ES (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s guidelines.

Sequencing- Templated ISPs consisting of the barcoded libraries were loaded onto a P1

Chip and sequenced on the Ion Torrent Proton sequencing using the Sequencing kit v.2

(Catalog #4485149) (Life Technologies, Carlsband, CA, USA) as per manufacturer’s instructions. The P1 Chip was prepared by three multiple step washes 50% Annealing buffer and flushing solution. The template positive IPSs were hybridized to the sequencing primers and loaded on to the P1 chip along with the sequencing polymerase following chip calibration. ISPs were sequenced on the Ion Torrent Proton with 520 dNTP flows across the P1 Chip.

RNA-SEQ Analysis- Raw reads generated by the sequencer were uploaded as FASTQ files into Partek Flow (Partek Incorporated, St. Louis, MS). Sequences were trimmed up to an average Phred quality score of ≥20 and a minimum read length of 25 bases to retain high quality reads. Trimmed reads were aligned to the AmpliSeq Transcriptome reference index using the Bowtie-2 algorithm. Next, reads were quantitated using the AmpliSeq

Transcriptome model and normalized using counts per million (CPM) with a 0.0001 offset.

CPM normalization accounts for differences in sequencing depth between samples by scaling read counts based on the total number of reads assigned to that sample. The CPM normalized read count for a given gene is calculated as the number of reads mapped to that gene divided by the total number of mapped reads in the sample multiplied by 1 million.

23 The 0.0001 offset is applied after CPM normalization so that none of the values used in the

Gene Specific Analysis (GSA) algorithm equal zero, thus avoiding instances in which a fold-change cannot be calculated due to a zero-value denominator. GSA analysis was performed in Partek Flow using the lognormal with shrinkage model and the default lowest average coverage (LAC) of 1.0 with p-values calculated using multiple test correction by

False-Discovery Rate (FDR) step-up. The LAC is set such that the shrinkage plot generated by Partek Flow shows a monotone decreasing trend thus removing mRNA that are not adequately modeled by the lognormal with shrinkage model (Law, Chen et al.

2014). Adjustment of the LAC value, normally done to remove mRNA with low read counts that are less likely to be of interest, was not necessary according to the guidelines described in online Partek Flow Documentation (https://documentation.partek.com) Partek

Incorporated, St. Louis, MS). GSA lists were uploaded into Partek Genomic Suite (PGS) for further analysis. GSA lists were filtered on false-discovery rate (FDR) adjuted p-value

(p=<0.05), fold change ≥ 1.5, and reads ≥ 10 in at least two of the lenti-eGFP or two of the

Lenti-TIP60 samples to find significantly differentially regulated genes. Filtering on a minimum read count of 10 reads was performed to limit the number of differentially expressed mRNA to a reasonable dataset of 228 mRNA.

24 III. RESULTS

A. TIP60 silencing reduces ΔNp63α transcript and protein levels.

To confirm if TIP60 positively regulates ΔNp63α, we silenced TIP60 in A431 cells and measured ΔNp63α transcript and protein levels. A431 cells were transfected with 40nM of non-silencing control (NSC), siRNA to p63 and/ or TIP60 and harvested at 48 hours.

Silencing of TIP60 caused a significant reduction in both ΔNp63α transcript levels, whereas silencing of ΔNp63α had no effect on transcript levels of TIP60 (Fig. 3A). Further, silencing of TIP60 in cells in which ΔNp63α was silenced resulted in a further decrease in

ΔNp63α transcript levels (Fig. 3A). Silencing of TIP60 similarly caused a reduction in

ΔNp63α protein levels, while silencing of ΔNp63α had no effect on TIP60 protein (Fig.

3B). These results provide confirmation that TIP60 positively regulates ΔNp63α transcript and protein levels.

25

26 Figure 3: TIP60 silencing reduces ΔNp63α transcript and protein levels. A431 cells were transfected with non-silencing control (NSC) siRNA or siRNA against p63 (sip63) and/or TIP60 (siTIP60) and harvested at 48 hours post-transfection. (A) RNA levels were measured by TaqMan based qRT-PCR with assays on demand (AOD’s) specific to

ΔNp63α, TIP60 and normalized to GAPDH. Fold-changes are calculated relative to NSC.

Error bars represent ±1 standard deviation from the mean. *P<0.05 compared to respective

NSC control. (B) Protein levels were measured by immunoblot analysis performed with antibodies specific for p63, TIP60 or β-actin. β-actin was included as a loading control for equivalent protein in each lane.

27

B. TIP60 overexpression increases ΔNp63α protein levels

TIP60 regulates target protein levels both by direct interaction and by acting as a transcriptional co-activator. For instance, TIP60 regulates p53 stability by interfering with

Mdm2-mediated p53 degradation (Legube, Linares et al. 2002). Since p63 shares homology with p53 (Yang, Kaghad et al. 1998), we sought to determine if TIP60 also regulates ΔNp63α. H1299 were used for overexpression studies as this cell line is null for both TIP60 and ΔNp63α. H1299 cells were co-transfected with either 0.1 µg or 0.2 µg

ΔNp63α alone or in combination with 0.25 µg, 0.5 µg and 1.0 µg of TIP60. We observed a dose-dependent increase in exogenous ΔNp63α protein with increasing TIP60 levels

(Fig. 4A). To determine if TIP60 also increases endogenous ΔNp63α levels, we generated stable cell lines overexpressing eGFP (Lenti-A431-eGFP) and TIP60 (Lenti-A431-TIP60) using the squamous cell carcinoma cell line A431. Consistent with Figure 4A, A431 cells stably expressing TIP60 showed increased ΔNp63α protein levels (Fig. 4B). These results suggest that TIP60 overexpression increases ΔNp63α protein levels.

28

29 Figure 4: TIP60 overexpression increases ΔNp63α protein levels. (A) H1299 cells were transfected with empty vector (control), an expression plasmid encoding ΔNp63α and with or without TIP60 and harvested at 24 hours post transfection. Immunoblot analysis was performed using antibodies specific for ΔNp63α, TIP60 or β-actin. Immunoblot with β- actin was performed to confirm equivalent protein loading. ΔNp63α protein levels were normalized to β-actin and quantitated by densitometry relative to control cells for each dose of TIP60. (B) A431 cells were transduced with lentiviral-eGFP (control) or lentiviral-

TIP60 overexpression and harvested for immunoblot analysis and ΔNp63α quantitation as in panel A.

30

C. Cisplatin resistant cells exhibit elevated levels of TIP60 and ΔNp63α

TIP60 activates genes involved in the DNA damage response including those involved in homologous recombination and Fanconi Anemia pathways, thus increasing resistance to cisplatin (Su, Ho et al. 2017). ΔNp63α has also been shown to confer cisplatin resistance in melanoma (Matin, Chikh et al. 2013). It remains unclear, however, if both proteins are upregulated in SCC cells. We next sought to determine if cisplatin-resistant cells expressed higher levels of both proteins using a cisplatin resistant A431 cell line. The cisplatin resistant (Pt) cells utilized for this analysis were obtained from a previous study. The cell line was generated by exposing cells to increasing concentrations of cisplatin ranging from

0.1µg/ml - 2µg/ml until a 2.5 increase in cisplatin resistance was achieved (Lanzi, Perego et al. 1998). An initial confirmation of cisplatin resistance was performed by treating cells for 2 hr with increasing doses of cisplatin and measuring cell proliferation by MTS assay.

Consistent with values reported by Lanzi et al, we observed a 3.3-fold increase in IC50 in cisplatin resistant cells (IC50= 47µg/ml) relative to cisplatin-sensitive parental cells (IC50=

14µg/ml) (Fig 5A, B). Interestingly, Pt cells showed higher expression of ΔNp63α and

TIP60 than parental cells (Fig. 5C). This data is consistent with our hypothesis that

ΔNp63α and TIP60 contribute to cisplatin resistance.

31

32

Figure 5: Cisplatin resistant cells exhibit elevated levels of TIP60 and ΔNp63α. (A)

A431 Parental (control) and Pt (cisplatin-resistant) cells were subjected to a 2 hr cisplatin pulse using increasing concentrations of cisplatin. At 48 h post-treatment, cell viability was measured by MTS assay. The y-axis indicates fold change compared to vehicle treated cells. Error bars represent ±1 standard deviation from the mean value of two representative experiments. *P<0.05 compared to parental A431 at the same cisplatin dose. (B) Cisplatin

IC50 values calculated from panels A in Parental and Pt cells. Error bars represent ±1 standard deviation from the mean value of two representative experiments. *P<0.05 compared to parental A431 IC50 value (C) Immunoblot analysis performed on A431 parental and Pt cells using antibodies specific for ΔNp63α, TIP60 or β-actin. Immunoblot with β-actin was performed to confirm equivalent protein loading. Densitometry quantitation of protein levels relative to Parental cell vehicle controls is indicated.

33 D. Overexpression of TIP60 protects ΔNp63α protein levels upon Cisplatin

treatment

Cells exposed to cisplatin display a dramatic downregulation of ΔNp63α via ATM- dependent phosphorylation and subsequent ubiquitin-mediated degradation (Huang, Sen et al. 2008). To determine if TIP60 protects ΔNp63α upon cisplatin treatment, Lenti-A431 eGFP and Lenti-A431-TIP60 stable cells line were incubated with either vehicle (PBS) or at two IC50 doses obtained as shown in Fig. 10 of Lenti-A431-eGFP (IC50=14 µg/ml), or the IC50 for Lenti-A431-TIP60 (IC50=21 µg/ml) for a 2-hr pulse and subjected to immunoblot analysis to measure TIP60 and ΔNp63α protein levels. Band densitometry reveals that the levels of ΔNp63α are stabilized in the presence of TIP60 as compared to levels in Lenti-A431 eGFP (Fig. 6A and 6B). Upon Cisplatin treatment we observed an increase in TIP60 protein levels in Lenti-A431-TIP60 cells relative to vehicle treated controls (Fig. 6C).

34

35

Figure 6: Overexpression of TIP60 protects ΔNp63α levels upon Cisplatin treatment.

(A, B) Lenti-A431 e-GFP and Lenti-A431-TIP60 stable cells were treated with either

DMSO (vehicle) or at two cisplatin dosage in a 2-hours pulse and harvested 24 hours later.

Immunoblot analysis was performed using antibodies specific to ΔNp63α, TIP60, eGFP or

β-actin. Immunoblot with β-actin was performed to confirm equivalent protein loading. (C)

Densitometry quantitation of protein levels relative to the corresponding vehicle control is indicated.

36 E. Cisplatin resistant cells retain more ΔNp63α and TIP60 following cisplatin

treatment

Chemoresistant nasopharyngeal carcinoma cells show elevated expression of TIP60 (Su,

Ho et al. 2017) . Conversely, cisplatin treatment causes a dramatic reduction of ΔNp63α protein levels in head and neck squamous cell carcinoma (HNSCC) cells as a result of degradation through ATM dependent phosphorylation (Huang, Sen et al. 2008). Since we observed elevated expression of ΔNp63α and TIP60 in cisplatin resistant cells, we next sought to determine if Pt cells retain higher levels of TIP60 and ΔNp63α after cisplatin treatment. A431 Parental and Pt cells were incubated with either vehicle (PBS) or increasing concentrations of cisplatin ranging from 5µg/ml to 40µg/ml in a 2-hr pulse and subjected to immunoblot analysis to measure TIP60 and ΔNp63α protein levels at 24h post- treatment. Densitometry quantitation of the p63 and TIP60 bands revealed a higher level of both proteins in cisplatin resistant cells (compare Fig. 7B to Fig. 7A). Quantitation of the percentage of p63 protein remaining after cisplatin treatment is summarized in Fig. 7C.

37

38 Figure 7: Cisplatin resistant cells retain more level of ΔNp63α and TIP60 following cisplatin treatment. A431 Parental (control) (A) and cisplatin resistant (Pt) cells (B) were subjected to a 2-hour pulse of DMSO (vehicle) or cisplatin at the indicated concentrations and harvested 24 hours later for immunoblot analysis using antibodies specific to ΔNp63α,

TIP60 or β-actin. Immunoblot with β-actin was performed to confirm equivalent protein loading. (C) Densitometry quantitation of protein levels relative to vehicle controls of each cell line is indicated.

39 F. TIP60 silencing reduces ΔNp63α and mRNA and protein levels in cisplatin

resistant cells

Since we showed that silencing of TIP60 reduces ΔNp63α transcript and protein in A431 cells, we next wanted to determine if silencing of TIP60 similarly reduced ΔNp63α expression in cisplatin resistant A431 Pt cells. A431 Pt cells and parental A431 control cells were transfected with 40nM of non-silencing control, 20nM of siRNA against p63 alone and /or 20nM of siRNA against TIP60 and harvested at 48 hours. Consistent with previous silencing data (Fig. 3A), siTIP60 silencing significantly reduced p63 transcript levels in cisplatin-sensitive A431 Parental cells, while p63 silencing had little effect on

TIP60 transcript levels (Fig. 8A). Silencing both p63 and TIP60 caused a further reduction in p63 transcript levels, as expected (compare Fig. 3A with Fig 8A). Interestingly, silencing TIP60 similarly reduced p63 levels in cisplatin resistance cells (Fig. 8B). TIP60 silencing also caused a reduction in ΔNp63α protein levels, while p63 silencing had little effect on TIP60 protein levels (Fig. 8C). These results suggest that TIP60 positively regulates ΔNp63α levels in both cisplatin resistant A431 Pt cells and parental controls.

40

41 Figure 8: TIP60 knockdown reduces ΔNp63α mRNA and protein levels in cisplatin resistant cells. A431 Parental and Pt cells were transfected with non-silencing control

(NSC), siRNA against p63 (sip63) and/or TIP60 (siTIP60) and harvested at 48 hours post- transfection. RNA levels were measured by TaqMan based qRT-PCR with assays on demand (AOD’s) specific to ΔNp63α, TIP60 and GAPDH in Parental (A) and Pt (B) cells.

Error bars indicate ±1 standard deviation from the mean. *P<0.05 compared to the respective NSC control. (C) Immunoblot analysis was performed using antibodies specific for ΔNp63α, TIP60 or β-actin. Immunoblot with β-actin was performed to confirm equivalent protein loading. Densitometry quantitation of protein levels relative to the corresponding NSC control is indicated.

42 G. Silencing of TIP60 and/or ΔNp63α sensitizes Pt cells to cisplatin

Next, we sought to determine whether silencing of ΔNp63α alone and/or TIP60 increased cisplatin sensitivity in A431 parental and Pt cells. Both cell lines were transfected with no silencing control, siTIP60 and or sip63 in two rounds of silencing. Cells were re-plated 48 hours after transfection and subjected to 2-hour cisplatin pulse at doses ranging from 20µg-

60µg/ml. At 48 hr post treatment, cell viability was measured by MTS. As expected, A431 parental cells transfected with NSC were very sensitive to cisplatin, exhibiting an IC50 around 18 µg/ml (Fig. 9A, B). Silencing of p63 and/or TIP60 had little detectable effect on cisplatin sensitivity in these cells since all cisplatin concentrations tested killed parental

A431 cells effectively (Fig. 9A, B). A431 Pt transfected with NSC showed the expected cisplatin resistance (IC50 = 43µg/ml). Silencing ΔNp63α or TIP60 in A431 Pt cells sensitized cells to cisplatin (IC50 = 23 and 19 µg/ml, respectively), although not quite to baseline levels observed in A431 parental cells. Silencing both p63 and TIP60 did not further sensitize cells to cisplatin (Fig. 9A, B), possibly because transient transfections were used for silencing in this experiment. Immunoblot analysis was performed on the cell lysates as shown in Fig. 6A to confirm ΔNp63α and TIP60 silencing and to further show that TIP60 silencing reduced ΔNp63α protein expression as before (Fig. 9C). These results confirm that silencing of ΔNp63α alone or with TIP60 sensitizes Pt cells to cisplatin.

43

44 Figure 9: Silencing of TIP60 and/or ΔNp63α sensitizes Pt cells to cisplatin. (A) A431

Parental (control) and cisplatin-resistant (Pt) cells were transfected with non-silencing control (NSC) siRNA or siRNA against p63 (sip63) or TIP60 (siTIP60) followed by treatment with a 2-hour pulse of vehicle at the indicated cisplatin doses. Cell viability was measured by MTS assay at 48 hours. The y-axis indicates the fold change compared to vehicle treated cells. Error bars represent ±1 standard deviation from the mean. (B)

Cisplatin IC50 values calculated from panels A and B in Parental and Pt cells. (C)

Immunoblot analysis was performed using antibodies specific for ΔNp63α, TIP60 or β- actin. Immunoblot with β-actin was performed to confirm equivalent protein loading.

45 H. Stable expression of either ΔNp63α or TIP60 increases resistance to cisplatin.

Since silencing of ΔNp63α and/or TIP60 sensitized A431 Pt cells to cisplatin, we next sought to determine if overexpression of ΔNp63α and TIP60 could conversely increase cisplatin resistance. We examined this by generating A431 stable cell lines by lentiviral- mediated transduction of ΔNp63α, TIP60 and an eGFP control. All three cell lines were subjected to 2-hour cisplatin pulse treatment at doses ranging from 5µg - 40µg/ml. Lenti-

ΔNp63α were more resistant to cisplatin than Lenti-eGFP controls, although the effect of stable ΔNp63α expression was more modest than the effect caused by ΔNp63α silencing.

Interestingly, Lenti-TIP60 showed even greater cisplatin resistance compared to Lenti- eGFP controls (Fig. 10). Since stable expression of TIP60 showed the highest resistance to cisplatin, it is possible that TIP60 also has a ΔNp63α-independent role in cisplatin resistance.

46

47

Figure 10: Stable expression of either ΔNp63α or TIP60 increases resistance to cisplatin. (A) Lenti-A431-eGFP (control), ΔNp63α and TIP60 were subjected to a 2-hour cisplatin pulse treatment at the indicated doses. Cell viability was measured by MTS assay at 24 hours. The y-axis indicates fold change compared to the vehicle treated cells. Error bars represent ±1 standard deviation from the mean of two representative experiments. (B)

Cisplatin IC50 values calculated from Lenti-eGFP, lenti-ΔNp63α and lenti-TIP60 cells as indicated. Error bars represent ±1 standard deviation from the mean value of two representative experiments. *P<0.05 compared to Lenti-A431 eGFP IC50 value.

48 I. ΔNp63α contributes to cisplatin resistance and its reduced expression sensitize

cells to cisplatin

Since we found that overexpression of either TIP60 or ΔNp63α confers resistance to cisplatin, we next sought to determine if stable ΔNp63α expression made A431 cells resistant to cisplatin in the absence of TIP60. To investigate this, we used lentiviral stable expression cell line Lenti-A431 ΔNp63α and Lenti-A431 eGFP as a control. TIP60 was silenced in both the cell lines in 2 rounds of silencing, and cells were subjected to a 2hr pulse of cisplatin at doses ranging from 5µg/ml to 40µg/ml. IC50 value were calculated after cisplatin treatment for each cell lines as the readouts for the cisplatin resistance. Silencing of TIP60 sensitized both Lenti-eGFP and Lenti-ΔNp63α cells to cisplatin (Fig. 11A).

Stable expression of ΔNp63α in Lenti-eGFP controls increased cisplatin resistance, consistent with Fig. 10A. Importantly, silencing TIP60 sensitized Lenti-ΔNp63α to cisplatin (Fig. 11A), thus implying that the contribution of ΔNp63α to cisplatin resistance potentially is associated with TIP60. Immunoblot analysis was performed on the cell lysates used in Fig. 11A to confirm TIP60 silencing and to show that TIP60 silencing reduced ΔNp63α protein expression as before. Lenti-mediated expression of proteins typically yields a larger increase in gene expression. The modest increase in ΔNp63α expression in this experiment may be a result of diminishing expression as cells are repeatedly passaged, despite their being maintained under constant blasticidin selection. It is important to point out that the increase in cisplatin resistance attributed to stable expression of ΔNp63α occurred as the result of a modest increase in ΔNp63α expression

(+20%) relative to Lenti-EGFP controls (Fig. 11B).

49

50 Figure 11: ΔNp63α contributes to cisplatin resistance and its reduced expression sensitize cells to cisplatin. (A) Lenti-A431-eGFP (control) and lenti-A431-ΔNp63α were transfected with non-silencing control (NSC) or TIP60 (siTIP60) followed by a 2-hour pulse of vehicle or the indicated doses of cisplatin. Cell viability was measured by MTS assay at 24 hours. The y-axis indicates fold change compared to the vehicle treated cells.

Error bars represent ±1 standard deviation from the mean of two representative experiments. (B) Cisplatin IC50 values calculated from Lenti-eGFP and Lenti-ΔNp63α as indicated. Error bars represent ±1 standard deviation from the mean value of two representative experiments. C) Immunoblot analysis was performed on cell lysates collected prior to cisplatin treatment to confirm successful TIP60 silencing and stable expression of eGFP or ΔNp63α. Immunoblot was performed using antibodies specific to

ΔNp63α, TIP60, eGFP or β-actin. β-actin was included to confirm equivalent protein loading.

51 J. Acetylation of ΔNp63α is elevated in cisplatin resistant cells

The best characterized function of TIP60 is its role in acetylating histones to facilitate gene transcription, but TIP60 also acetylates non-histone proteins such as MYC and p53 in response to cell stress leading to changes in protein stability or activity (Tang, Luo et al.

2006, Yang, Xue et al. 2018). Further, genotoxic stress induces post translational modifications of ΔNp63α which are known to modulate ΔNp63α function (Westfall, Mays et al. 2003, Chae, Kim et al. 2012), and PCAF is known to acetylate ΔNp63α in association with cell cycle arrest (Tang, Luo et al. 2006, Chae, Kim et al. 2012). However, it remains unclear whether acetylation of ΔNp63α occurs in cisplatin resistant cells. We assessed

ΔNp63α acetylation in A431 parental (control) and cisplatin-resistant (Pt) cells by growing cells in medium with and without Acetyl CoA. At 6 hours acetylated proteins were immunoprecipitated with an anti-acetylated lysine antibody. Acetyl CoA was used as a substrate for TIP60 (Montgomery, Sorum et al. 2015). Since acetylation and deacetylation is a very rapid process, we used the histone deacetylase inhibitor sodium butyrate to inhibit the action of histone deacetylases in the cell culture and cell extract which would remove existing acetylation (Katan-Khaykovich and Struhl 2002, Simon-O'Brien, Alaux-Cantin et al. 2015). Acetylation of both TIP60 and ΔNp63α was observed in the absence of Acetyl

CoA, presumedly the result of acetylation in cell culture prior to lysing cells. Consistently, we saw acetylation of TIP60 and ΔNp63α in the presence of Acetyl CoA. Importantly, cisplatin resistant Pt cells showed increased ΔNp63α acetylation compared to parental

A431 cells, suggesting that acetylation of ΔNp63α plays a role in cisplatin resistance.

52

53 Figure 12: Acetylation of ΔNp63α is elevated in cisplatin resistant Pt cells. A431

Parental (control) and cisplatin-resistant (Pt) cells were treated with 30mM sodium butyrate and 250µM of Acetyl-CoA for 6 hours and harvested 6 hours post treatment. Whole cell lysates were immunoprecipitated (IP) with an acetylated-lysine antibody followed by immunoblot analysis using antibodies specific for ΔNp63α, TIP60 or β-actin.

54 K. RNA-Seq analysis of TIP60 and ΔNp63α targets

In addition to regulating the transcription of target genes by acetylation of histones, TIP60 has been shown to regulate the transcriptional activity of various proteins. For instance,

TIP60 acetylates p53 in response to DNA damage, resulting in a shift in p53 promoter occupancy in favor of pro-apoptotic genes (Tang, Luo et al. 2006). We next sought to determine if TIP60-mediated stabilization of ΔNp63α alters the transcriptional activity of

ΔNp63α. Four plates each of Lenti-eGFP and lenti-TIP60 cells maintained under 3 µg/ml blasticidin were harvested and subjected to immunoblot analysis for TIP60 and eGFP. As expected, all 4 Lenti-eGFP samples robustly expressed eGFP, and all 4 lenti-TIP60 samples robustly expressed TIP60. The immunoblot data shown in Fig. 4B was collected from one of the samples used in this AmpliSeq study and is representative of the full set.

Total RNA was isolated from all 8 samples, DNAse-treated to remove genomic DNA contamination, assessed for quality on the Agilent 2100 Bioanalyzer and processed for

AmpliSeq Transcriptome RNA-Seq analysis. RNA-Seq was performed on the Ion Torrent platform using A431 cells stably expressing TIP60 and EGFP (controls) with each condition run in quadruplicate, sequenced on the Ion Torrent and analyzed in Partek softwares as outlined in Fig. 13. All samples yielded over 11.1 million reads with an average amplicon length of 140-150 nucleotides with PHRED quality scores >24.7 and

>98% of total reads aligning to known cDNA (Table 1). Out of a total 20,000 amplicons in the AmpliSeq panel, 12,239 were successfully quantitated, with 228 of these showing significant differential expression between samples (FDR adjusted p≤0.05, absolute fold- change ≥ 1.5, and reads ≥ 10 in 2 or more samples in either group). The full list of dysregulated mRNA are provided in Appendix 1.

55

A. Confirmation of eGFP and TIP60 overexpression (immunoblot shown in Figure 2B). Lenti-eGFP Lenti-TIP60 (n=4) (n=4) B. RNA isolation, DNAase treatment, cDNA preparation

C. Barcoded library preparation and pooling of samples Pooled Library D. Template preparation

(i.e. amplification onto ISPs and quality check Sample prep Sample Sequencing and

E. Sequencing on IonTorrent Raw reads F. Analysis of FASTQ files in Partek Flow using AmpliSeq pipeline - Trim reads: Both ends, ≥25nt, fixed length of 300nt - Align reads: AmpliSeq Transcriptome reference, Bowtie2, 10nt seed, very sensitive local - Quantitate mRNA: AmpliSeq Transcriptome model mRNA counts - Dataset normalization: counts per million (CPM) Analysis - Gene-specific analysis (GSA): DE mRNA identified using lognormal with shrinkage model DE mRNA lists G. Analysis in Partek Genomics Suite - Filter of GSA lists: FDR adjusted p≤0.05, |FC|≥1.5, reads ≥ 10 in 2 or more samples in either group

56 Figure 13: AmpliSeq experimental design and workflow. Schematic of sample preparation, sequencing and data analysis used to assess mRNA profiles in Lenti-eGFP and

Lenti-TIP60 samples.

57 Avg. Avg. Avg. Sample read read % coverage name Total reads length quality % GC Aligned depth EGFP-1 12,345,907 145.9 24.7 50.9 98.5 571.1 EGFP-2 12,370,240 149.6 24.9 50.8 98.7 575.9 EGFP-3 13,929,963 144.1 24.9 50.8 98.5 644.0 EGFP-4 12,750,274 146.4 24.7 50.8 98.4 587.9 TIP60-1 13,010,283 145.7 24.9 50.9 98.6 603.4 TIP60-2 14,643,168 145.6 24.8 51.0 98.7 680.1 TIP60-3 13,716,792 140.1 24.8 51.3 98.3 631.0 TIP60-4 11,148,161 144.5 24.7 50.9 98.3 512.7

58 Table 1: Quality control metrics of AmpliSeq samples and data obtained from Lenti-

A431 cells overexpressing eGFP or TIP60. A431 cells were transduced with Lentiviral- eGFP (control) or Lentiviral-TIP60 and sequence using the Ion Torrent platform and

AmpliSeq pipeline as described in Fig 10. All sample yield and quality metrics provided were obtained from Partek Flow.

59 IV. DISCUSSION

Despite therapeutic advances, 90% of chemotherapy failure is related to drug resistance

(Mansoori, Mohammadi et al. 2017), so an improved understanding of the mechanisms driving chemoresistance is critical. Cisplatin resistance frequently develops due to dysregulation of genes involved in DNA damage response (DDR) and induction of apoptotic signaling cascade (Galluzzi, Senovilla et al. 2012), thus genes upstream of DNA damage repair genes are both potential mediators of chemoresistance and potential therapeutic targets. ΔNp63α and TIP60 are both known to play roles in cisplatin resistance and regulate an overlapping set of DNA repair genes in the homologous recombination and

Fanconi anemia pathways (Bretz, Gittler et al. 2016, Su, Ho et al. 2017). Thus, ΔNp63α and TIP60 potentially play an overlapping role critical to cisplatin resistance.

In this study, we showed the ectopic expression of TIP60 caused a dose-dependent increase in ΔNp63α levels in H1299 cells (Figure 4A). Consistently, we saw an increase in endogenous ΔNp63α levels as a result of stable TIP60 expression (Lenti-TIP60) in A431 cells (Figure 4B). Also, silencing of endogenous TIP60 led to significant reduction in transcript and protein levels of ΔNp63α in A431 SCC cells (Figure 3). Taken together, multiple lines of evidence suggest that TIP60 positively regulate ΔNp63α both at exogenous and endogenous levels. We showed that ΔNp63α alone and with TIP60 expression contributed to cisplatin resistance and increased cell viability (Figure 10), while silencing of TIP60 in Lenti-A431 ΔNp63α cells reduced cisplatin resistance (Figure 11).

60 This suggests that TIP60 mediated regulation of ΔNp63α contributes to cisplatin resistance. However, it’s also possible that TIP60 have p63 independent role in cisplatin resistance. since we saw that the stable expression of TIP60 yielded the highest resistance

(Figure 10). Finally, we showed that acetylated ΔNp63α levels are elevated in association with cisplatin resistance. Taken together, our findings indicate that TIP60-mediated regulation of ΔNp63α plays a crucial role in promoting cisplatin resistance as depicted in the model shown in Figure 14. Since the role that TIP60 plays in chemoresistance in SCC is unclear, delineating the mechanism(s) by which TIP60 and ΔNp63α modulate the cellular response to DNA damage will potentially aid in the identification of new strategies for reverting cisplatin resistance in cancer.

Overexpression of ΔNp63α is well documented in NMSC (Graziano and De

Laurenzi 2011), but a role for TIP60 in NMSC has not been reported. TIP60 is known to be down-regulated in lung cancer (Yang, Sun et al. 2017), colon cancer (Mattera, Escaffit et al. 2009) and melanoma (Chen, Cheng et al. 2012), suggesting that TIP60 deficiency leads to a loss of DNA repair capacity and cancer progression. Interestingly, elevated ornithine decarboxylase (ODC) levels are frequently observed in NMSC and murine skin tumors with high levels of ODC show increased TIP60 protein levels (Hobbs, Wei et al.

2006, Arumugam, Weng et al. 2013), suggesting that TIP60 levels may be elevated in

NMSC. Although our findings suggest that TIP60 increases ΔNp63α levels in squamous cell carcinoma A431 cells, it remains unclear from our studies whether TIP60 protein levels are altered in NMSC tumors and to what extent TIP60 contributes to the increased ΔNp63α levels observed in vivo. Additional studies are needed to determine if TIP60 protein levels

61 are increased in NMSC human SCC and BCC tumor samples and to identify the mechanistic basis of this upregulation.

Our findings suggest that TIP60 increases basal ΔNp63α protein levels in untreated cells

(Figures 3 and 4) and protects ΔNp63α protein in cisplatin treated cells (Figure 6). This protection may arise from direct interaction or indirectly through an intermediate such as

ATM. Upon DNA damage, TIP60 activates ATM in response to DSBs through its catalytic activity (Sun, Jiang et al. 2010). ΔNp63α gets phosphorylated at serine 385 by ATM, thus leading to its proteasomal degradation (Huang, Sen et al. 2008). TIP60 may thus interfere with ATM-directed phosphorylation of ΔNp63α in cisplatin resistant cells, thus protecting it from degradation.

Interestingly, our findings also indicate that silencing of TIP60 decreases ΔNp63α transcript levels in untreated A431 cells (Figure 3) and in cisplatin resistant cells (Figure

8). Since TIP60 is a histone acetyltransferase and is known to act as a transcriptional coregulator, it is possible that silencing TIP60 results in a loss of ΔNp63α transcription through loss of histone acetylation near the ΔNp63α promoter, thus resulting in closed chromatin at that loci. Alternatively, loss of TIP60 may indirectly reduce ΔNp63α transcript levels by regulating another gene upstream of ΔNp63α. Additional studies would be needed to clarify how TIP60 is regulating ΔNp63α transcript levels.

62

TIP60 DNp63a DNp63a ↑ ↑Cisplatin resistance Acetylated ↑DDR gene expression

DNp63a degradation

Figure 14: Model describing TIP60-mediated regulation of cisplatin resistance and the response to DNA damage via ΔNp63α.

63 ΔNp63α generally serves a pro-survival function, and thus the elevated ΔNp63α levels observed in TIP60-expressing cells may contribute to chemoresistance through a variety of mechanisms (Chung, Lau et al. 2010, Danilov, Neupane et al. 2011). In pancreatic cancer, ΔNp63α is upregulated resulting in enhanced anchorage-independent growth which increases cell invasion and resistance to cisplatin induced apoptosis

(Danilov, Neupane et al. 2011). ΔNp63α elicits these functions by transcriptionally activating EGFR which further activates ERK, Akt and JNK signaling (Danilov, Neupane et al. 2011). ΔNp63α also activates 14-3-3σ in cisplatin-treated pancreatic cancer cells

(Neupane and Korc 2008). Activation of 14-3-3σ has been reported to increase cisplatin resistance by inhibiting p53 activation and thus blocking p21 expression (Han, Dimas et al. 2009). Finally, ΔNp63α has been shown to contribute to chemoresistance in hepatocellular carcinoma by inhibiting activation of the p53-target apoptotic genes Bax,

Bim, Noxa, Puma and Perp (Mundt, Stremmel et al. 2010). Further studies are needed to determine the effect of TIP60 on these ΔNp63α-regulated pathways.

We observed elevated acetylation of ΔNp63α and TIP60 in A431 Pt cisplatin resistant cells compared to cisplatin-sensitive A431 (parental) cells (Figure 12). These results are consistent with previous reports that TIP60 is autoacetylated in response to DNA damage and this autoacetylation is critical for its activation (Wang and Chen 2010, Yang,

Wu et al. 2012). Activated TIP60 subsequently acetylates several non-histone proteins in response to DNA damage. TIP60 acetylates both c-Myc and E2F1 resulting in their stabilization (Patel, Du et al. 2004, Van Den Broeck, Nissou et al. 2011). TIP60 also acetylates C-ABL Proto-Oncogene 1, Non-Receptor Tyrosine Kinase to regulates its transcriptional activity in response to DNA damage (Jiang, Kamath et al. 2011). TIP60

64 acetylates p53 to regulate the decision between cell growth arrest and apoptosis (Tang, Luo et al. 2006). It therefore seems likely that TIP60 may similarly acetylate ΔNp63α, although additional studies are needed to confirm that the ΔNp63α acetylation observed in cisplatin- treated cells is a result of activated TIP60.

Previous studies have shown that ΔNp63α is acetylated at two different sites in the

ΔNp63α hinge region between the DNA binding and oligomerization domains by

P300/CBP-associated factor (PCAF), an acetyltransferase involved in transcriptional regulation and the response to DNA damage. This acetylation occurs in high-density cell culture and results in the cytoplasmic translocation of ΔNp63α and cell cycle arrest (Chae,

Kim et al. 2012). Interestingly, PCAF is overexpressed in cisplatin resistant cells (Hirano,

Izumi et al. 2010), thus raising the possibility that ΔNp63α acetylation may be part of a broader DNA damage response. ΔNp63α acetylation has not, however, been linked to cisplatin resistance and further studies are needed to determine the effects of acetylation on ΔNp63α downstream function. Further, since protein acetylation affects various aspects of protein function, including transcriptional or enzymatic activity, stability, DNA binding activity, and protein-protein interactions (Polevoda and Sherman 2002), acetylation of

ΔNp63α could contribute to cisplatin resistance through a variety of mechanisms.

TIP60 is a key regulator of DNA damage responsive genes (Kusch, Florens et al.

2004, Sapountzi, Logan et al. 2006, Bassi, Li et al. 2016). In response to DNA double stranded breaks, TIP60 is recruited to DNA lesions (Sapountzi, Logan et al. 2006) and binds to the promoter of FANCD2 and BRAC1, which are key players in the DNA damage repair pathway (Su, Ho et al. 2017). To identify additional genes differentially regulated by TIP60, RNA-Seq was performed using Ampliseq panel on the Ion Torrent platform

65 which is designed to assess expression of all known human genes (Figure 13). We identified 228 genes differentially regulated by Lenti-A431 TIP60 vs Lenti-A431 eGFP following analysis of the RNA-Seq data using Partek Flow and Partek softwares. Lists of differentially expressed genes will be further analyzed for enrichment of DNA repair genes with the use of Ingenuity Pathway Analysis (IPA). However, we didn’t see genes involved in apoptosis and DNA damage repair pathway because no DNA damage was introduced for this set of experiments.

Future directions

The main goal of this study was to determine the role of TIP60 mediated regulation of

ΔNp63α in cisplatin resistance. We hypothesized that TIP60 regulation of ΔNp63α expression plays a crucial role in conferring cisplatin resistance. Our study demonstrated that overexpression of TIP60 increases protein levels of ΔNp63α, whereas silencing of

TIP60 led to reduction in the transcript and protein expression of ΔNp63α. However, we have not yet determined whether TIP60 regulates ΔNp63α by physical interaction, direct acetylation or indirectly through the action of an unidentified intermediate protein.

Although we showed cisplatin resistant cells exhibit higher protein levels of ΔNp63α, it remains unclear whether this effect is TIP60-dependent. To determine if the increase in p63 levels in A431 Pt cells is dependent on TIP60, cycloheximide experiments will be performed in A431 Pt cells to assess the levels of ΔNp63α in presence and absence of

NU9056, a TIP60 specific activity inhibitor (Coffey, Blackburn et al. 2012). We expect to see higher levels of ΔNp63α in the absence of TIP60 inhibitor compared to NU9056 treated condition, this will confirm that TIP60 stabilizes ΔNp63α. We also showed that cisplatin resistant cells exhibit higher acetylated ΔNp63α levels. To determine if the acetylation of

66 ΔNp63α is TIP60-dependent, immunoprecipitation of acetylated proteins or ΔNp63α itself from cisplatin treated cells will be performed with and without TIP60 silencing.

Additionally, mass spectrometry analysis of cells with and without cisplatin treatment using PCAF as a acetylation control may help to identify potential acetylation target sites on ΔNp63α for further analysis as TIP60 targets. For all studies of ΔNp63α acetylation, overexpression of PCAF may be used as a positive control for the acetylation of ΔNp63α.

Finally, use of acetyl-site deficient ΔNp63α mutant(s) will help us determine whether loss of acetylation at key residues abolishes the ability of TIP60 to both stabilize and acetylate

ΔNp63α.

Future work will be focused on identifying the targets and mechanisms behind TIP60- mediated transcriptional regulation of ΔNp63α in cisplatin resistant cells using the high- throughput sequencing AmpliSeq methodology. Future NGS studies will be done with cisplatin treatment of vehicle controls, thus allowing us to identify the genes differentially regulated by cisplatin treatment. Another data set will be generated with stable knockdown of ΔNp63α in A431 Pt cells to perform RNA-Seq, again with and without cisplatin treatment. Results from this experiment will allow identify the transcriptional targets of

ΔNp63α involved in cisplatin resistance. Differentially regulated genes, particularly those in DNA damage response, will be validated using RT-PCR and subsequently confirmed as direct targets of ΔNp63α by ChIP assay in the presence and absence of TIP60. This will allow us to study the effect of TIP60 on genes regulated by ΔNp63α in cisplatin resistance.

It is also important to test the expression of known overlapping targets of ΔNp63α and

TIP60, including FANCD2 and homologous recombination genes. Expression of these genes will be assessed via RT-PCR technique using A431 Pt cells with silencing either

67 ΔNp63α or TIP60 in the presence and absence of cisplatin. This will allow us to assess the effect of altered ΔNp63α and TIP60 expression on key genes involved in DNA damage repair pathway and will provide critical insights into the possible mechanism of regulation in chemoresistance. Since we saw that silencing of both ΔNp63α and TIP60 did not further sensitize cells to cisplatin (Figure 9A, 9B), use of stable knockdown using shRNA will allow us to assess the dependent and independent effects of ΔNp63α and TIP60 in sensitizing cells to cisplatin. Additionally, use of an isobologram could be used to provide an estimation of an extent to which TIP60 and ΔNp63α could act in synergy to confer cisplatin resistance.

Recently, the role of microRNA has been extensively studied with a focus on chemoresistance (Magee, Shi et al. 2015). ΔNp63α has been shown to regulate several miRNAs (Lin, Li et al. 2015, Stacy, Craig et al. 2017). Small-RNA sequencing can be performed utilizing A431 Pt cells to determine the role of ΔNp63α regulated miRNA in chemoresistance. Both TIP60 and ΔNp63α are upregulated in cisplatin resistance

(Miyamoto, Izumi et al. 2008, Matin, Chikh et al. 2013). Therefore, it is possible that TIP60 regulates cisplatin resistance via regulation of ΔNp63α and its target microRNA.

68 V. CONCLUSION

ΔNp63α and TIP60 play important roles in development of chemoresistance. The work presented in this dissertation collectively demonstrates that TIP60 regulates ΔNp63α to promote cisplatin resistance. Specifically, we showed that TIP60 positively regulates

ΔNp63α protein and transcript levels. Conversely, we found that overexpression of

ΔNp63α and TIP60 increases cisplatin resistance. We showed that cisplatin resistant cells have increased levels of acetylated ΔNp63α and TIP60 and that silencing ΔNp63α and/or

TIP60 sensitizes cells to cisplatin. Taken together, our findings imply that TIP60 plays an important role in conferring cisplatin resistance in SCC through its positive regulation of

ΔNp63α. Lastly, we used AmpliSeq to identify a list of genes differentially regulated by

TIP60 overexpressed.

Delineating the signaling relay involved in cisplatin resistance remains a critical goal for designing anticancer therapeutics against non-melanoma skin cancer (NMSC) progression. Defining the mechanism by which TIP60 regulates ΔNp63α will provide critical insights into the role they play in driving cancer progression and will aid in identification of new therapeutic targets for the treatment of squamous cell carcinoma.

However, the mechanism by which TIP60 regulates ΔNp63α in response to DNA damage still needs to be explored. TIP60 may directly regulate ΔNp63α or it could be through indirect mechanism, leading to stabilization of ΔNp63α and modulating its activity.

69 VI. APPENDIX

Appendix 1: mRNA differentially regulated by stable TIP60 expression in A431 cells. 228 mRNA were identified as differentially regulated between Lenti-TIP60 and Lenti-eGFP cell lines.

The following table is sorted on FDR adjusted p-value (from highest to lowest).

Lenti-eGFP Lenti-TIP60 Amplicon Fold read count read count ID NCBI NAME P-value change (Avg±SD) (Avg±SD) KAT5 K lysine acetyltransferase 5 5.16E-11 5.58 117.68 ± 4.36 657.09 ± 85.15 bone marrow stromal cell antigen RHOB 2 7.06E-09 5.32 9.77 ± 2.08 51.95 ± 5.93 PLSCR4 butyrylcholinesterase 7.50E-09 10.46 2.00 ± 0.57 20.89 ± 1.45 DnaJ Hsp40 homolog subfamily C FLRT2 member 12 9.16E-09 3.97 4.95 ± 0.51 19.64 ± 1.71 protein tyrosine phosphatase ADCK1 receptor type M 3.76E-08 5.21 2.33 ± 0.50 12.13 ± 0.81 NME1 protocadherin 7 5.17E-08 3.09 5.92 ± 0.70 18.32 ± 0.45 PPIC neuronal growth regulator 1 5.17E-08 7.85 1.55 ± 0.42 12.20 ± 2.02 BCL2 adenovirus E1B 19kDa PROCA1 interacting protein 3 8.09E-08 6.17 5.23 ± 1.34 32.25 ± 7.64 solute carrier family 1 neuronal epithelial high affinity glutamate TOP3B transporter system Xag member 1 1.84E-07 2.60 5.61 ± 0.36 14.61 ± 0.78 ACOT1 collagen type III alpha 1 2.25E-07 8.86 1.98 ± 0.70 17.58 ± 2.69 ICA1 islet cell autoantigen 1 69kDa 2.35E-07 2.61 12.83 ± 1.58 33.53 ± 3.70 pleckstrin homology-like domain PHLDA1 family A member 1 2.42E-07 1.77 176.94 ± 5.56 313.49 ± 13.81 radical S-adenosyl methionine RSAD2 domain containing 2 2.60E-07 2.75 23.97 ± 3.85 65.97 ± 8.42 EGF-like repeats and discoidin I- PHYH like domains 3 2.63E-07 6.60 6.41 ± 2.62 42.35 ± 4.24 TESK2 interleukin 32 3.21E-07 4.93 8.36 ± 2.44 41.23 ± 8.71 interferon alpha-inducible protein IFI6 6 3.91E-07 3.12 50.66 ± 5.29 158.04 ± 35.43 TMEM45 A transmembrane protein 45A 4.80E-07 2.23 12.37 ± 1.23 27.61 ± 1.80 HECT and RLD domain containing E3 ubiquitin protein DOHH ligase 5 4.80E-07 2.23 10.79 ± 0.81 24.10 ± 1.80 matrix metallopeptidase 12 MMP12 macrophage elastase 5.66E-07 1.78 129.32 ± 7.65 230.39 ± 12.39 CCL5 chemokine C-C motif ligand 5 7.35E-07 2.74 27.95 ± 5.40 76.47 ± 8.94 CC2D2A carbonic anhydrase IX 8.88E-07 8.72 2.90 ± 1.27 25.31 ± 7.90 plasminogen activator urokinase PLAUR receptor 9.80E-07 1.91 34.83 ± 3.41 66.52 ± 3.13

70 ZW10 interacting kinetochore 287.83 ± ZWINT protein 1.09E-06 -1.75 11.76 164.09 ± 14.08 IFI44 interferon-induced protein 44 1.53E-06 1.61 253.95 ± 2.66 408.80 ± 22.39 WFDC2 WAP four-disulfide core domain 2 1.55E-06 1.77 71.23 ± 5.46 126.20 ± 8.20 CCL22 chemokine C-C motif ligand 22 1.63E-06 3.93 20.63 ± 7.28 81.09 ± 9.53 277.61 ± CA2 carbonic anhydrase II 1.77E-06 -1.74 25.82 159.40 ± 6.89 AEN complement factor I 1.96E-06 4.10 4.46 ± 0.87 18.26 ± 5.34 EGR1 early growth response 1 1.99E-06 2.07 26.89 ± 2.39 55.62 ± 7.39 prolyl 4-hydroxylase alpha P4HA2 polypeptide II 2.20E-06 2.04 28.69 ± 1.85 58.61 ± 8.08 serpin peptidase inhibitor clade B SERPINB1 ovalbumin member 1 3.40E-06 2.16 41.21 ± 7.44 88.89 ± 9.00 major histocompatibility complex HLA-B class I B 3.47E-06 1.65 92.99 ± 5.57 153.28 ± 9.51 DSEL dermatan sulfate epimerase-like 3.56E-06 2.14 16.07 ± 2.00 34.38 ± 4.13 interferon induced transmembrane 255.18 ± IFITM3 protein 3 3.60E-06 1.61 12.38 412.07 ± 28.81 cerebellar degeneration-related CDR1 protein 1 34kDa 3.90E-06 -3.27 26.11 ± 1.77 7.99 ± 2.52 G protein-coupled receptor 37 HLA-L endothelin receptor type B-like 4.00E-06 3.18 4.42 ± 0.99 14.08 ± 2.10 ALDOC aldolase C fructose-bisphosphate 4.09E-06 2.41 24.64 ± 3.68 59.37 ± 11.45 HIST2H3D histone cluster 2 H3d 4.78E-06 2.07 54.74 ± 5.73 113.31 ± 17.08 ubiquitin associated and SH3 ZNF443 domain containing B 5.04E-06 2.18 6.02 ± 0.87 13.14 ± 0.28 114.78 ± PLXNA2 plexin A2 5.23E-06 -1.78 15.20 64.35 ± 2.05 TMEM11 toll-like receptor 4 5.62E-06 2.20 4.73 ± 0.34 10.38 ± 1.08 family with sequence similarity 129.03 ± FAM162A 162 member A 5.94E-06 1.74 12.91 224.84 ± 20.99 interferon-induced protein with IFIT1 tetratricopeptide repeats 1 7.82E-06 1.72 75.32 ± 8.29 129.77 ± 9.13 102.32 ± PLAT plasminogen activator tissue 7.85E-06 2.79 13.65 285.13 ± 81.02 APOL1 apolipoprotein L 1 7.90E-06 1.95 19.65 ± 2.29 38.23 ± 4.54 KLF4 Kruppel-like factor 4 gut 8.46E-06 2.08 15.47 ± 1.59 32.16 ± 4.97 ATPase Na K transporting beta 1 ATP1B1 polypeptide 9.34E-06 1.76 84.92 ± 11.91 149.12 ± 8.12 leucine-rich repeats and IQ motif PADI3 containing 3 9.57E-06 1.91 8.89 ± 0.65 16.98 ± 1.65 GULP engulfment adaptor PTB GULP1 domain containing 1 1.00E-05 1.70 51.45 ± 6.07 87.35 ± 4.32 KLHL36 kelch-like family member 36 1.12E-05 1.61 31.21 ± 1.27 50.28 ± 3.60 SEMA3F growth arrest-specific 1 1.13E-05 -2.48 10.69 ± 1.52 4.30 ± 0.70 glycosyltransferase-like domain PELI2 containing 1 1.20E-05 1.96 6.03 ± 0.33 11.81 ± 1.20 neural precursor cell expressed TYMP developmentally down-regulated 9 1.24E-05 4.08 6.27 ± 2.05 25.58 ± 8.04 ER membrane protein complex EMC10 subunit 10 1.24E-05 -2.30 12.90 ± 1.54 5.61 ± 1.02

71 ANKRD65 ankyrin repeat domain 65 1.45E-05 1.70 37.39 ± 2.29 63.48 ± 7.17 GPRASP2 placenta-specific 8 1.47E-05 3.60 3.72 ± 1.36 13.40 ± 2.80 ARL4C stanniocalcin 1 1.48E-05 4.31 4.56 ± 1.83 19.63 ± 5.25 ZNF160 zinc finger protein 160 1.59E-05 -2.57 20.56 ± 5.64 7.99 ± 0.83 erythrocyte membrane protein DHX58 band 4.1-like 3 1.68E-05 3.37 3.12 ± 0.82 10.51 ± 2.50 procollagen-lysine 2-oxoglutarate 186.26 ± PLOD2 5-dioxygenase 2 1.73E-05 1.51 15.21 281.43 ± 11.97 procollagen-lysine 2-oxoglutarate PLOD1 5-dioxygenase 1 1.80E-05 1.65 69.90 ± 7.86 115.37 ± 7.93 integrin alpha 5 fibronectin ITGA5 receptor alpha polypeptide 1.82E-05 2.38 19.41 ± 3.61 46.15 ± 9.79 INSIG1 insulin induced gene 1 1.97E-05 1.62 20.18 ± 1.83 32.75 ± 0.68 DEXH Asp-Glu-X-His box KCTD12 polypeptide 58 2.03E-05 1.77 7.11 ± 0.10 12.56 ± 0.84 v-akt murine thymoma viral AKT3 oncogene homolog 3 2.19E-05 1.59 79.90 ± 8.71 126.71 ± 7.30 protein phosphatase Mg2 Mn2 PPM1K dependent 1K 2.20E-05 1.93 14.64 ± 2.24 28.25 ± 3.33 ISG15 ISG15 ubiquitin-like modifier 2.27E-05 1.64 88.89 ± 6.09 145.92 ± 18.13 ALPP alkaline phosphatase placental 2.62E-05 -2.48 42.41 ± 11.07 17.13 ± 2.42 phosphatidic acid phosphatase type SH3KBP1 2B 2.87E-05 1.99 8.54 ± 1.15 16.99 ± 2.24 IVL involucrin 2.90E-05 -2.24 17.17 ± 1.80 7.68 ± 1.75 NFE2L3 Rho GTPase activating protein 44 3.33E-05 1.78 6.51 ± 0.50 11.55 ± 0.60 DEAD Asp-Glu-Ala-Asp box DDX60 polypeptide 60 3.73E-05 1.71 99.08 ± 10.72 169.91 ± 22.16 carbohydrate chondroitin 4 KRT16 sulfotransferase 11 3.79E-05 1.88 5.62 ± 0.28 10.54 ± 1.20 MEX3A anthrax toxin receptor 2 3.84E-05 2.17 6.67 ± 1.03 14.48 ± 2.69 transducin-like enhancer of split 1 TLE1 E sp1 homolog Drosophila 3.87E-05 1.91 20.57 ± 3.15 39.38 ± 5.59 purinergic receptor P2X ligand- P2RX4 gated ion channel 4 4.02E-05 1.62 22.58 ± 1.20 36.59 ± 3.95 SPINK5 keratin 16 4.11E-05 1.75 7.53 ± 0.47 13.17 ± 1.21 apolipoprotein B mRNA editing APOBEC3 enzyme catalytic polypeptide-like F 3F 4.27E-05 1.67 39.96 ± 3.75 66.68 ± 7.74 solute carrier family 2 facilitated TAGLN glucose transporter member 13 4.52E-05 2.02 10.47 ± 2.18 21.20 ± 2.76 butyrophilin subfamily 2 member BTN2A2 A2 4.70E-05 1.54 25.73 ± 1.67 39.62 ± 2.77 prostaglandin-endoperoxide synthase 2 prostaglandin G H SOX4 synthase and cyclooxygenase 5.53E-05 1.76 8.11 ± 0.59 14.30 ± 1.69 WNK2 G protein-coupled receptor 155 6.02E-05 2.43 5.64 ± 0.86 13.71 ± 3.96 KLF6 Kruppel-like factor 6 6.04E-05 1.57 22.72 ± 1.92 35.70 ± 2.73 phospholipase C gamma 2 PLCG2 phosphatidylinositol-specific 6.12E-05 2.25 13.48 ± 3.84 30.35 ± 4.20 large 60S subunit nuclear export LSG1 GTPase 1 6.30E-05 -1.52 27.31 ± 1.63 18.01 ± 0.72

72 CYBRD1 cytochrome b reductase 1 6.45E-05 1.61 57.21 ± 6.96 91.96 ± 8.19 LOXL2 lysyl oxidase-like 2 6.68E-05 1.98 28.88 ± 3.55 57.24 ± 12.47 lymphocyte antigen 6 complex ID2 locus D 6.75E-05 3.07 5.76 ± 1.63 17.72 ± 5.87 PVRL3 poliovirus receptor-related 3 7.57E-05 1.77 16.50 ± 2.61 29.29 ± 3.29 pre-B-cell leukemia homeobox PBXIP1 interacting protein 1 8.01E-05 1.68 41.08 ± 5.44 69.11 ± 8.38 retinoic acid receptor responder RARRES3 tazarotene induced 3 8.52E-05 1.75 54.18 ± 8.25 94.69 ± 13.96 myeloid-associated differentiation DLX2 marker 8.70E-05 1.79 9.74 ± 0.99 17.39 ± 2.43 TRAF2 and NCK interacting TNIK kinase 8.87E-05 1.59 16.97 ± 1.02 27.03 ± 2.87 SOSTDC1 sclerostin domain containing 1 8.92E-05 -1.73 21.87 ± 3.34 12.65 ± 0.65 protein kinase cAMP-dependent ATP8B3 catalytic inhibitor alpha 9.00E-05 1.78 8.63 ± 1.23 15.38 ± 1.54 interferon-induced protein with IFIT2 tetratricopeptide repeats 2 9.09E-05 1.72 150.90 ± 1.07 259.96 ± 51.90 protein phosphatase Mg2 Mn2 LRRIQ3 dependent 1L 9.99E-05 1.80 8.05 ± 1.07 14.45 ± 1.89 GAA glucosidase alpha acid 1.03E-04 1.57 50.89 ± 5.72 79.94 ± 8.35 interferon regulatory factor 2 161.47 ± IRF2BP2 binding protein 2 1.09E-04 1.53 13.70 247.11 ± 29.79 KIF3C kinesin family member 3C 1.14E-04 1.53 14.70 ± 0.63 22.49 ± 1.90 helicase with zinc finger 2 HELZ2 transcriptional coactivator 1.14E-04 1.58 25.61 ± 2.19 40.53 ± 4.82 MOCOS molybdenum cofactor sulfurase 1.15E-04 -1.57 52.27 ± 6.43 33.27 ± 2.20 MPI mannose phosphate isomerase 1.18E-04 1.50 38.99 ± 0.81 58.67 ± 6.90 pleckstrin homology domain containing family G with RhoGef PRDM10 domain member 1 1.20E-04 2.11 6.29 ± 1.32 13.26 ± 2.28 LCN2 lipocalin 2 1.29E-04 2.31 16.54 ± 6.02 38.24 ± 3.94 transcobalamin I vitamin B12 101.03 ± TCN1 binding protein R binder family 1.30E-04 2.31 25.54 233.68 ± 60.65 AKAP12 A kinase PRKA anchor protein 12 1.32E-04 1.61 23.04 ± 2.90 37.06 ± 3.61 TMPRSS1 5 transmembrane protease serine 15 1.37E-04 -1.64 64.05 ± 5.42 39.03 ± 6.51 phospholipase A2 group IVA PLA2G4A cytosolic calcium-dependent 1.48E-04 1.57 12.58 ± 0.36 19.69 ± 2.08 solute carrier family 36 proton SLC36A4 amino acid symporter member 4 1.53E-04 -1.63 28.01 ± 2.56 17.20 ± 2.34 BAH domain and coiled-coil P2RY1 containing 1 1.58E-04 1.80 6.56 ± 0.98 11.79 ± 1.33 DIO2 ring finger protein 122 1.63E-04 2.16 6.41 ± 1.49 13.85 ± 2.82 family with sequence similarity PPM1N 114 member A1 1.64E-04 1.69 9.87 ± 1.28 16.68 ± 1.75 HAS2 hyaluronan synthase 2 1.67E-04 1.63 13.75 ± 2.08 22.48 ± 1.61 BRCA1 breast cancer 1 early onset 1.74E-04 -1.50 73.21 ± 3.56 48.71 ± 6.22 OLFM4 olfactomedin 4 1.74E-04 -4.33 33.91 ± 3.72 7.83 ± 4.52 TUSC3 tumor suppressor candidate 3 1.75E-04 -1.68 14.23 ± 1.96 8.49 ± 0.46

73 MAPK8IP 2 SH3 and PX domains 2B 1.77E-04 1.99 9.44 ± 2.10 18.79 ± 3.37 wingless-type MMTV integration WNT10A site family member 10A 1.78E-04 -1.58 97.86 ± 10.84 62.02 ± 8.97 137.37 ± CLDN4 claudin 4 1.80E-04 1.66 12.26 228.47 ± 45.30 IL1B selenoprotein P plasma 1 1.80E-04 2.18 7.59 ± 1.77 16.54 ± 3.88 GPC6 nuclear factor erythroid 2-like 3 1.92E-04 1.55 7.94 ± 0.27 12.28 ± 0.75 guanylate binding protein 2 GBP2 interferon-inducible 1.94E-04 2.23 15.14 ± 4.38 33.77 ± 7.02 MTMR11 myotubularin related protein 11 1.98E-04 1.60 72.36 ± 5.61 115.75 ± 19.60 RPA2 replication protein A2 32kDa 2.00E-04 -1.56 36.23 ± 1.22 23.20 ± 3.66 IRF9 interferon regulatory factor 9 2.04E-04 1.82 24.38 ± 4.47 44.34 ± 7.85 H19 imprinted maternally expressed transcript non-protein 404.07 ± 1451.26 ± H19 coding 2.04E-04 3.59 226.21 432.67 family with sequence similarity FABP4 115 member C 2.10E-04 1.80 7.43 ± 1.28 13.36 ± 1.51 FZD4 frizzled family receptor 4 2.15E-04 1.66 16.78 ± 0.60 27.89 ± 4.83 adhesion molecule with Ig-like AMIGO2 domain 2 2.18E-04 1.59 19.25 ± 2.16 30.70 ± 3.94 PTGS2 5p-nucleotidase ecto CD73 2.20E-04 1.69 6.83 ± 0.78 11.53 ± 1.27 FAM171A family with sequence similarity 2 171 member A2 2.27E-04 1.54 19.29 ± 2.11 29.69 ± 2.63 240.68 ± CCND1 cyclin D1 2.34E-04 -1.54 33.45 155.92 ± 16.19 RBFA ribosome binding factor A putative 2.65E-04 -1.55 22.18 ± 1.50 14.36 ± 1.88 major histocompatibility complex HLA-A class I A 2.77E-04 1.57 15.41 ± 1.93 24.24 ± 2.61 LENEP thymidine phosphorylase 2.78E-04 2.35 7.86 ± 2.27 18.50 ± 4.80 C3 complement component 3 2.80E-04 2.54 31.18 ± 13.91 79.34 ± 15.49 DCN decorin 2.86E-04 -3.34 14.60 ± 6.70 4.38 ± 0.81 WDR77 WD repeat domain 77 2.86E-04 -1.57 61.60 ± 9.92 39.36 ± 3.06 ENO2 enolase 2 gamma neuronal 2.98E-04 2.66 30.98 ± 11.30 82.45 ± 25.94 ring finger protein 128 E3 RNF128 ubiquitin protein ligase 3.12E-04 1.64 47.18 ± 8.44 77.58 ± 10.13 GYS1 glycogen synthase 1 muscle 3.18E-04 1.53 92.53 ± 10.67 141.34 ± 18.40 ZNF407 zinc finger protein 407 3.24E-04 -1.55 27.77 ± 1.80 17.92 ± 2.87 126.06 ± QSOX1 quiescin Q6 sulfhydryl oxidase 1 3.33E-04 1.73 24.39 217.76 ± 39.28 RAB11FIP RAB11 family interacting protein 5 5 class I 3.41E-04 1.54 30.49 ± 1.64 46.89 ± 7.50 solute carrier family 6 neurotransmitter transporter 150.34 ± SLC6A8 member 8 3.49E-04 1.76 28.05 265.15 ± 51.97 IL4R interleukin 4 receptor 3.65E-04 1.63 12.72 ± 0.72 20.69 ± 3.65 KLF11 Kruppel-like factor 11 3.80E-04 1.51 12.44 ± 1.62 18.82 ± 0.80 MXD1 MAX dimerization protein 1 3.84E-04 1.64 37.64 ± 5.64 61.86 ± 10.14 6-phosphofructo-2-kinase fructose- PFKFB4 2 6-biphosphatase 4 4.15E-04 2.52 18.58 ± 6.87 46.78 ± 14.52

74 matrix metallopeptidase 16 DMBX1 membrane-inserted 4.22E-04 1.54 8.65 ± 0.84 13.35 ± 1.09 SLC43A2 ras homolog family member B 4.28E-04 2.03 10.14 ± 0.82 20.58 ± 6.25 TNFRSF1A-associated via death TRADD domain 4.58E-04 1.54 14.05 ± 0.78 21.71 ± 3.44 371.83 ± 838.76 ± NDRG1 N-myc downstream regulated 1 4.68E-04 2.26 119.68 264.77 SLCO4A1 STEAP family member 4 4.74E-04 1.75 8.23 ± 1.72 14.37 ± 1.75 2p-5p-oligoadenylate synthetase- 106.98 ± OASL like 4.81E-04 1.73 16.02 185.53 ± 41.20 STON2 stonin 2 4.88E-04 -1.99 17.55 ± 3.47 8.82 ± 2.35 INSIG2 insulin induced gene 2 5.02E-04 1.86 12.07 ± 2.37 22.41 ± 4.64 family with sequence similarity FAM102B 102 member B 5.06E-04 1.67 12.37 ± 1.68 20.66 ± 3.85 MSMO1 methylsterol monooxygenase 1 5.18E-04 1.54 63.64 ± 7.30 98.22 ± 16.34 METTL1 methyltransferase like 1 5.50E-04 -1.56 52.17 ± 8.29 33.40 ± 4.27 glutamate-rich WD repeat GRWD1 containing 1 5.62E-04 -1.55 62.17 ± 10.14 40.10 ± 4.52 solute carrier family 35 member SLC35G1 G1 5.83E-04 -1.60 17.10 ± 1.66 10.66 ± 1.79 tumor necrosis factor alpha- 104.06 ± TNFAIP2 induced protein 2 5.90E-04 1.95 30.09 203.21 ± 43.55 HERC5 lipin 2 6.19E-04 1.67 10.53 ± 0.73 17.62 ± 3.70 C12orf5 protocadherin 18 6.60E-04 1.59 8.25 ± 0.69 13.12 ± 1.87 VGLL3 vestigial like 3 Drosophila 6.67E-04 -1.56 18.98 ± 0.85 12.18 ± 2.48 ribosomal RNA processing 12 RRP12 homolog S. cerevisiae 6.78E-04 -1.50 65.79 ± 10.03 43.86 ± 4.24 LPHN2 latrophilin 2 6.93E-04 -1.58 34.41 ± 4.30 21.78 ± 3.56 sema domain transmembrane domain TM and cytoplasmic SEMA6B domain semaphorin 6B 7.06E-04 1.62 15.74 ± 2.38 25.51 ± 3.99 109.19 ± NOP2 NOP2 nucleolar protein 7.14E-04 -1.51 16.31 72.22 ± 8.43 ADAM metallopeptidase domain PCED1B 19 7.36E-04 1.65 9.80 ± 2.08 16.13 ± 1.13 PIM1 pim-1 oncogene 7.38E-04 2.19 55.34 ± 14.82 121.05 ± 38.89 sema domain immunoglobulin domain Ig transmembrane domain TM and short cytoplasmic domain 191.37 ± SEMA4B semaphorin 4B 7.38E-04 1.83 39.56 350.43 ± 87.56 IER3 immediate early response 3 7.56E-04 1.73 69.59 ± 11.81 120.27 ± 27.95 LOC10050 SH3-domain kinase binding 6844 protein 1 7.82E-04 1.54 9.39 ± 1.17 14.44 ± 1.58 MUC1 mucin 1 cell surface associated 7.98E-04 2.21 12.70 ± 4.43 28.00 ± 7.33 COL4A1 collagen type IV alpha 1 8.01E-04 1.53 17.52 ± 3.47 26.81 ± 0.22 ERO1L ERO1-like S. cerevisiae 8.24E-04 1.59 70.73 ± 13.69 112.39 ± 15.95 STEAP4 phospholipid scramblase 4 8.34E-04 1.55 6.94 ± 0.36 10.77 ± 1.53 LUM lumican 8.35E-04 -2.74 30.44 ± 13.23 11.13 ± 4.22 serpin peptidase inhibitor clade E nexin plasminogen activator SERPINE1 inhibitor type 1 member 1 8.42E-04 3.23 55.29 ± 19.46 178.37 ± 91.20

75 solute carrier family 52 riboflavin SLC52A3 transporter member 3 8.44E-04 1.52 16.67 ± 2.18 25.35 ± 3.11 ARMC6 armadillo repeat containing 6 8.74E-04 -1.50 24.98 ± 2.84 16.65 ± 2.25 Long Intergenic Non-Protein PKI55 Coding RNA 1963 8.80E-04 -1.62 23.10 ± 3.04 14.29 ± 2.62 solute carrier family 9 subfamily A NHE7 cation proton antiporter 7 SLC9A7 member 7 8.93E-04 1.60 24.94 ± 5.14 39.94 ± 4.97 NOP16 NOP16 nucleolar protein 9.02E-04 -1.56 28.50 ± 4.05 18.25 ± 2.64 FBJ murine osteosarcoma viral FOS oncogene homolog 9.17E-04 5.16 23.69 ± 15.97 122.24 ± 71.75 Ras association RalGDS AF-6 domain family N-terminal member PPAP2B 9 9.46E-04 1.63 7.77 ± 0.54 12.68 ± 2.24 BIK histone cluster 1 H2bl 9.48E-04 1.69 7.59 ± 1.96 12.86 ± 0.43 MMP16 phytanoyl-CoA 2-hydroxylase 9.76E-04 1.61 7.93 ± 1.56 12.78 ± 1.10 thiosulfate sulfurtransferase rhodanese -like domain containing TSTD1 1 1.06E-03 1.63 18.19 ± 3.20 29.69 ± 5.34 HMCN1 claudin 16 1.07E-03 1.60 10.83 ± 2.32 17.29 ± 1.68 mex-3 RNA binding family BARX2 member A 1.07E-03 1.55 8.01 ± 0.87 12.45 ± 1.80 v-erb-b2 avian erythroblastic leukemia viral oncogene homolog ERBB4 4 1.10E-03 -2.76 37.61 ± 17.32 13.62 ± 3.83 pseudouridylate synthase 7 PUS7 homolog S. cerevisiae 1.11E-03 -1.55 13.57 ± 0.26 8.74 ± 1.57 BCL2-interacting killer apoptosis- ZNF28 inducing 1.11E-03 1.53 8.43 ± 0.95 12.94 ± 1.68 peptidyl arginine deiminase type SNAPC5 III 1.15E-03 3.50 9.60 ± 5.01 33.62 ± 16.74 fatty acid binding protein 4 SFMBT1 adipocyte 1.16E-03 3.76 8.37 ± 3.85 31.46 ± 19.90 NOXA1 HRAS-like suppressor 2 1.20E-03 2.46 5.01 ± 1.24 12.32 ± 4.84 FAM114A Family With Sequence Similarity 1 114 Member A1 1.29E-03 1.68 9.43 ± 1.32 15.84 ± 3.26 protein tyrosine phosphatase receptor type f polypeptide PTPRF GAS1 interacting protein liprin alpha 4 1.30E-03 2.28 10.21 ± 3.63 23.27 ± 7.92 6-phosphofructo-2-kinase fructose- PFKFB3 2 6-biphosphatase 3 1.41E-03 1.89 50.87 ± 14.13 96.18 ± 24.97 patatin-like phospholipase domain PNPLA3 containing 3 1.46E-03 1.53 16.64 ± 2.11 25.53 ± 4.47 TTLL7 acyl-CoA thioesterase 1 1.46E-03 1.51 6.86 ± 0.84 10.36 ± 1.00 chromosome 5 open reading frame C5orf42 42 1.50E-03 -1.65 14.07 ± 2.45 8.51 ± 1.64 IGSF8 interleukin 1 beta 1.51E-03 1.50 8.53 ± 0.87 12.79 ± 1.57 CCNG2 cyclin G2 1.52E-03 1.50 43.50 ± 9.98 65.30 ± 3.81 solute carrier organic anion MYADM transporter family member 4A1 1.56E-03 1.71 9.00 ± 0.93 15.41 ± 4.22 ZNF808 zinc finger protein 808 1.58E-03 -1.77 34.46 ± 7.89 19.52 ± 4.96

76 kringle containing transmembrane BST2 protein 2 1.60E-03 1.62 9.27 ± 1.59 14.97 ± 2.50 MYC binding protein 2 E3 MYCBP2 ubiquitin protein ligase 1.65E-03 -1.56 32.48 ± 3.87 20.78 ± 4.32 IRF7 interferon regulatory factor 7 1.69E-03 1.85 15.07 ± 4.58 27.91 ± 6.17 unc-51 like autophagy activating ULK1 kinase 1 1.80E-03 1.69 46.15 ± 12.35 77.86 ± 15.01 TMPO thymopoietin 1.81E-03 -1.54 61.43 ± 10.50 39.92 ± 7.22 N4BP2L2 NEDD4 binding protein 2-like 2 1.87E-03 -1.78 13.78 ± 3.77 7.75 ± 1.08 LMF1 lipase maturation factor 1 1.91E-03 1.68 12.45 ± 1.99 20.95 ± 5.09 LOC10050 6190 PQ loop repeat containing 3 1.95E-03 1.60 8.56 ± 1.10 13.66 ± 2.57 ATP-binding cassette sub-family SEPP1 A ABC1 member 3 2.09E-03 1.87 5.87 ± 2.12 10.99 ± 1.67 143.54 ± TNNT1 troponin T type 1 skeletal slow 2.10E-03 1.55 31.56 222.03 ± 33.57 DLX1 keratin 14 2.10E-03 1.67 9.75 ± 1.18 16.27 ± 4.25 DPH2 DPH2 homolog S. cerevisiae 2.24E-03 -1.64 35.12 ± 6.50 21.45 ± 5.00 FYVE RhoGEF and PH domain FGD3 containing 3 2.24E-03 1.88 23.71 ± 4.49 44.45 ± 14.12 TBC1 tre-2 USP6 BUB2 cdc16 ANKRA2 domain family member 1 2.27E-03 1.71 6.21 ± 1.72 10.60 ± 1.15 RRS1 ribosome biogenesis RRS1 regulator homolog S. cerevisiae 2.33E-03 -1.61 81.52 ± 17.51 50.70 ± 9.75 RALBP1 associated Eps domain CLDN16 containing 2 2.35E-03 1.73 10.62 ± 1.86 18.39 ± 4.31 109.35 ± SLC43A3 solute carrier family 43 member 3 2.35E-03 -1.72 24.47 63.75 ± 16.99 RASSF9 Bcl2 modifying factor 2.40E-03 2.00 6.13 ± 1.45 12.25 ± 3.59 small nuclear RNA activating PDAP1 complex polypeptide 5 19kDa 2.50E-03 -1.74 10.03 ± 0.97 5.77 ± 1.81 dehydrogenase reductase SDR DHRS9 family member 9 2.59E-03 2.18 18.91 ± 6.71 41.12 ± 14.55 ATPase aminophospholipid transporter class I type 8B member ANKRD9 3 2.64E-03 2.07 9.48 ± 3.04 19.65 ± 6.51 prolyl 4-hydroxylase alpha P4HA1 polypeptide I 2.88E-03 1.62 83.54 ± 27.42 135.39 ± 14.58 EFNA3 ephrin-A3 2.88E-03 1.79 16.17 ± 5.24 28.97 ± 6.25 121.51 ± ZNF91 zinc finger protein 91 2.88E-03 -1.56 25.68 77.73 ± 14.42 thioredoxin-related transmembrane TMX4 protein 4 2.97E-03 -1.57 58.50 ± 7.65 37.36 ± 9.69 latent transforming growth factor LTBP4 beta binding protein 4 2.97E-03 1.66 59.01 ± 15.08 97.74 ± 21.13 EPB41L4A hemicentin 1 3.06E-03 1.88 11.44 ± 2.71 21.51 ± 6.05 nuclear factor of kappa light polypeptide gene enhancer in B- NFKBIZ cells inhibitor zeta 3.06E-03 1.57 45.13 ± 12.24 70.64 ± 9.59 sodium channel non-voltage-gated SCNN1A 1 alpha subunit 3.09E-03 1.72 77.93 ± 21.05 134.22 ± 34.32

77 PRSS22 protease serine 22 3.15E-03 2.07 13.10 ± 4.75 27.07 ± 9.35 ALPPL2 KIAA1462 3.18E-03 1.64 11.10 ± 2.72 18.19 ± 3.38 NLGN2 neuroligin 2 3.36E-03 1.68 43.01 ± 9.79 72.46 ± 18.52 HIST1H2B leucine-rich alpha-2-glycoprotein L 1 3.49E-03 2.43 5.79 ± 2.63 14.05 ± 6.55 TNNT3 troponin T type 3 skeletal fast 3.55E-03 2.88 12.29 ± 5.43 35.38 ± 17.50 VSNL1 visinin-like 1 3.55E-03 -1.73 41.41 ± 8.32 24.00 ± 7.32 matrix metallopeptidase 13 110.41 ± MMP13 collagenase 3 3.59E-03 1.57 24.14 173.83 ± 34.11 TENM1 teneurin transmembrane protein 1 3.76E-03 -1.70 22.78 ± 6.06 13.42 ± 2.42 interferon induced transmembrane IFITM10 protein 10 3.77E-03 1.66 18.70 ± 5.12 31.11 ± 6.11 egl-9 family hypoxia-inducible EGLN3 factor 3 3.77E-03 2.78 27.71 ± 15.68 77.00 ± 36.19 ARL14 ADP-ribosylation factor-like 14 3.77E-03 1.97 26.02 ± 5.80 51.21 ± 19.32 phosphoinositide-3-kinase PIK3IP1 interacting protein 1 3.82E-03 2.10 15.05 ± 5.14 31.55 ± 11.26 HAS3 hyaluronan synthase 3 3.85E-03 1.98 15.46 ± 3.89 30.57 ± 11.19 AT rich interactive domain 3A REPS2 BRIGHT-like 3.95E-03 1.58 10.17 ± 2.38 16.03 ± 2.48 DEAD Asp-Glu-Ala-Asp box 139.83 ± DDX21 helicase 21 3.95E-03 -1.52 27.31 91.97 ± 17.74 221.78 ± JUNB jun B proto-oncogene 4.03E-03 1.64 46.24 363.34 ± 98.37 polymerase DNA-directed epsilon POLE4 4 accessory subunit 4.16E-03 -1.51 16.42 ± 2.35 10.84 ± 2.21 mitogen-activated protein kinase 8 PPFIA4 interacting protein 2 4.21E-03 1.50 9.89 ± 2.07 14.88 ± 2.15 FAM115C peptidyl arginine deiminase type I 4.24E-03 3.93 5.52 ± 3.35 21.68 ± 13.91 KRT14 testis-specific kinase 2 4.36E-03 1.50 9.10 ± 1.28 13.66 ± 2.49 ZNF836 zinc finger protein 836 4.36E-03 -1.62 15.57 ± 3.77 9.58 ± 1.73 ankyrin repeat family A PQLC3 RFXANK-like 2 4.37E-03 1.63 7.80 ± 0.81 12.73 ± 3.36 FLJ23867 Uncharacterized protein FLJ23867 4.37E-03 1.59 54.80 ± 10.89 86.90 ± 20.82 DUSP1 dual specificity phosphatase 1 4.41E-03 2.36 16.54 ± 1.68 39.02 ± 19.60 GPATCH4 G patch domain containing 4 4.46E-03 -1.72 21.22 ± 3.80 12.32 ± 3.90 PPM1L leukemia inhibitory factor 4.48E-03 1.63 6.68 ± 1.56 10.86 ± 1.84 UTP20 small subunit SSU processome component homolog UTP20 yeast 4.62E-03 -1.82 34.89 ± 8.00 19.22 ± 6.01 family with sequence similarity FAM208B 208 member B 4.71E-03 -1.50 50.50 ± 3.69 33.60 ± 8.97 fucosyltransferase 11 alpha 1 3 FUT11 fucosyltransferase 4.78E-03 1.89 42.69 ± 14.92 80.87 ± 25.54 gem nuclear organelle associated GEMIN5 protein 5 4.79E-03 -1.57 43.50 ± 9.76 27.66 ± 5.44 2p-5p-oligoadenylate synthetase 1 OAS1 40 46kDa 5.09E-03 1.55 91.86 ± 28.56 141.93 ± 15.94 SFXN3 sideroflexin 3 5.18E-03 1.57 40.39 ± 6.08 63.27 ± 17.07 protease serine 12 neurotrypsin PRSS12 motopsin 5.37E-03 1.55 33.29 ± 7.36 51.73 ± 11.18

78 SELRC1 Sel1 Repeat-Containing Protein 1 5.45E-03 -1.62 84.57 ± 20.13 52.23 ± 13.43 HSPG2 heparan sulfate proteoglycan 2 5.56E-03 1.60 17.66 ± 4.43 28.19 ± 6.17 106.39 ± CTPS1 CTP synthase 1 5.59E-03 -1.73 26.52 61.49 ± 19.50 WNK lysine deficient protein CLMN kinase 2 5.64E-03 2.40 7.54 ± 4.68 18.09 ± 4.97 ADAMTS ADAM metallopeptidase with 1 thrombospondin type 1 motif 1 5.72E-03 1.75 13.87 ± 4.96 24.29 ± 5.21 IL32 ADP-ribosylation factor-like 4C 5.73E-03 1.61 7.22 ± 1.35 11.61 ± 2.88 ATHL1 ATH1 acid trehalase-like 1 yeast 5.78E-03 1.68 43.12 ± 10.99 72.33 ± 19.36 DNA-damage-inducible transcript 590.34 ± 971.77 ± DDIT4 4 6.02E-03 1.65 183.05 227.23 F-box and leucine-rich repeat FBXL8 protein 8 6.04E-03 1.96 24.00 ± 8.77 46.93 ± 16.16 transmembrane and tetratricopeptide repeat containing TMTC2 2 6.09E-03 1.55 28.16 ± 7.49 43.54 ± 8.19 immunoglobulin superfamily ADAM19 member 8 6.26E-03 1.57 9.36 ± 1.07 14.67 ± 3.86 solute carrier family 27 fatty acid SLC27A1 transporter member 1 6.32E-03 1.50 17.98 ± 4.15 27.01 ± 4.68 deoxyhypusine hydroxylase ATP9B monooxygenase 6.39E-03 -1.60 11.39 ± 2.73 7.11 ± 1.09 111.81 ± LYAR Ly1 antibody reactive 6.41E-03 -1.53 20.67 73.26 ± 18.37 adenosine monophosphate AMPD3 deaminase 3 6.58E-03 1.60 12.89 ± 2.63 20.63 ± 5.20 ribosomal RNA processing 9 small subunit SSU processome RRP9 component homolog yeast 6.71E-03 -1.54 27.78 ± 4.93 18.06 ± 4.35 URB2 ribosome biogenesis 2 URB2 homolog S. cerevisiae 6.78E-03 -1.52 18.82 ± 3.71 12.36 ± 2.19 ARHGEF1 Rho guanine nucleotide exchange 0L factor GEF 10-like 6.78E-03 1.58 26.06 ± 4.96 41.30 ± 10.74 KREMEN calmin calponin-like 2 transmembrane 6.86E-03 1.72 8.41 ± 2.44 14.48 ± 4.01 coiled-coil-helix-coiled-coil-helix CHCHD4 domain containing 4 7.27E-03 -1.53 26.52 ± 6.01 17.31 ± 3.37 LBH limb bud and heart development 7.34E-03 1.51 12.89 ± 2.48 19.51 ± 4.66 KAT6B K lysine acetyltransferase 6B 7.51E-03 -1.52 12.03 ± 1.36 7.92 ± 2.14 procollagen C-endopeptidase PCOLCE enhancer 7.82E-03 1.61 16.91 ± 4.08 27.29 ± 7.46 378.28 ± 567.57 ± CALB1 calbindin 1 28kDa 7.89E-03 1.50 99.65 108.29 EYA1 eyes absent homolog 1 Drosophila 7.90E-03 1.54 20.58 ± 3.23 31.77 ± 7.74 vascular endothelial growth factor 114.63 ± VEGFA A 8.44E-03 1.83 45.57 209.73 ± 62.93 protein tyrosine phosphatase SLC2A13 receptor type Q 8.74E-03 2.52 9.97 ± 4.79 25.17 ± 12.65 FOXQ1 forkhead box Q1 8.96E-03 -1.77 21.81 ± 5.79 12.34 ± 4.50

79 nucleolar protein 3 apoptosis NOL3 repressor with CARD domain 9.04E-03 1.72 16.91 ± 4.80 29.14 ± 8.82 metallophosphoesterase domain MPPED2 containing 2 9.56E-03 -1.53 60.99 ± 17.88 39.79 ± 4.08 Chromosome 10 Open Reading C10orf47 Frame 47 9.62E-03 1.58 43.48 ± 6.18 68.66 ± 22.37 FN1 fibronectin 1 9.67E-03 -1.75 13.89 ± 4.59 7.92 ± 1.81 zinc finger and BTB domain ZBTB10 containing 10 9.82E-03 1.58 12.11 ± 3.76 19.18 ± 4.30 major histocompatibility complex PCDH18 class I L pseudogene 9.84E-03 1.52 7.14 ± 1.40 10.83 ± 2.13 IL7R interleukin 7 receptor 1.01E-02 1.82 29.91 ± 7.87 54.37 ± 19.93 REC8 meiotic recombination REC8 protein 1.05E-02 1.65 12.71 ± 3.74 21.01 ± 6.09 basic helix-loop-helix family 317.60 ± 541.12 ± BHLHE40 member e40 1.07E-02 1.70 135.57 128.55 ATP-binding cassette sub-family C ABCC4 CFTR MRP member 4 1.08E-02 -1.52 12.60 ± 2.81 8.27 ± 1.41 protein phosphatase Mg2 Mn2 NCF2 dependent 1N putative 1.09E-02 1.61 10.17 ± 2.30 16.38 ± 4.41 TJP1 tight junction protein 1 1.11E-02 -1.68 19.04 ± 5.10 11.35 ± 3.54 TAF9B RNA polymerase II TATA box binding protein TBP - TAF9B associated factor 31kDa 1.12E-02 -1.58 65.26 ± 14.36 41.41 ± 13.34 LOC72973 Uncharacterized LOC729737 7 RNA 1.19E-02 1.53 32.33 ± 9.94 49.38 ± 10.48 nucleolar protein 6 RNA- NOL6 associated 1.27E-02 -1.53 45.42 ± 12.33 29.60 ± 5.68 dehydrogenase reductase SDR DHRS2 family member 2 1.27E-02 1.75 13.72 ± 6.04 23.95 ± 6.81 110.71 ± ODC1 ornithine decarboxylase 1 1.29E-02 -1.70 32.56 65.21 ± 23.69 CCDC86 coiled-coil domain containing 86 1.29E-02 -1.59 69.51 ± 20.84 43.71 ± 10.05 ANGPTL4 angiopoietin-like 4 1.32E-02 3.59 22.34 ± 15.83 80.10 ± 58.33 PLIN2 perilipin 2 1.34E-02 1.75 33.85 ± 8.92 59.29 ± 22.04 KIAA1462 neutrophil cytosolic factor 2 1.34E-02 1.50 10.65 ± 2.32 16.03 ± 3.74 SRY sex determining region Y - ESPNP box 4 1.38E-02 1.70 8.89 ± 1.88 15.14 ± 5.27 GLIS2 GLIS family zinc finger 2 1.40E-02 1.56 16.92 ± 3.16 26.36 ± 7.68 spermidine spermine N1- SAT1 acetyltransferase 1 1.42E-02 1.68 16.02 ± 4.44 26.95 ± 9.27 ARID3A AT-Rich Interaction Domain 3A 1.43E-02 1.50 9.84 ± 2.72 14.79 ± 2.15 CLSPN claspin 1.56E-02 -1.61 43.81 ± 10.35 27.25 ± 9.28 leucine carboxyl methyltransferase LCMT2 2 1.64E-02 -1.55 21.01 ± 4.36 13.53 ± 4.33 302.31 ± 471.82 ± ITGB6 integrin beta 6 1.65E-02 1.56 78.58 144.47 minichromosome maintenance 333.48 ± MCM6 complex component 6 1.67E-02 -1.51 77.86 221.23 ± 63.93

80 aminoacyl tRNA synthetase complex-interacting 143.54 ± AIMP2 multifunctional protein 2 1.69E-02 -1.51 37.15 94.76 ± 25.55 PKIA deiodinase iodothyronine type II 1.99E-02 1.67 7.89 ± 2.67 13.19 ± 4.37 inositol polyphosphate-5- INPP5D phosphatase 145kDa 2.00E-02 1.62 12.56 ± 4.34 20.32 ± 5.74 minichromosome maintenance 106.71 ± MCM10 complex component 10 2.05E-02 -1.52 20.35 70.16 ± 25.33 sema domain immunoglobulin domain Ig short basic domain GCNT3 secreted semaphorin 3F 2.05E-02 1.55 11.22 ± 3.48 17.36 ± 4.57 methionyl aminopeptidase type 1D METAP1D mitochondrial 2.10E-02 -1.53 14.06 ± 2.18 9.16 ± 3.53 ArfGAP with coiled-coil ankyrin ACAP1 repeat and PH domains 1 2.12E-02 1.84 20.07 ± 7.48 36.85 ± 14.73 MPV17 mitochondrial membrane MPV17L2 protein-like 2 2.13E-02 -1.53 14.15 ± 3.76 9.22 ± 2.60 ANKRD37 ankyrin repeat domain 37 2.16E-02 1.98 16.67 ± 8.65 33.09 ± 13.98 TMC4 transmembrane channel-like 4 2.45E-02 1.59 36.04 ± 13.14 57.40 ± 16.81 158.67 ± TXNIP thioredoxin interacting protein 2.55E-02 1.75 78.51 278.03 ± 96.91 ATF5 activating transcription factor 5 2.56E-02 -1.52 72.54 ± 19.33 47.70 ± 16.04 EPHX2 epoxide hydrolase 2 cytoplasmic 2.75E-02 -1.56 14.27 ± 4.88 9.12 ± 1.57 poly ADP-ribose polymerase PARP9 family member 9 2.81E-02 1.54 14.94 ± 4.71 22.94 ± 6.74 diencephalon mesencephalon PTPRQ homeobox 1 2.93E-02 1.88 9.50 ± 3.32 17.83 ± 8.27 LPIN2 PC-esterase domain containing 1B 3.16E-02 1.57 10.16 ± 3.48 15.94 ± 4.78 ARRDC3 arrestin domain containing 3 3.29E-02 1.98 17.91 ± 9.37 35.37 ± 17.20 SH3PXD2 B lens epithelial protein 3.49E-02 1.50 8.61 ± 2.09 12.92 ± 4.18 secretoglobin family 1A member 1 206.54 ± SCGB1A1 uteroglobin 3.76E-02 -1.84 105.95 112.36 ± 12.73 TBC1D3H TBC1 domain family member 3H 3.94E-02 1.80 14.37 ± 5.61 25.91 ± 12.15 YPEL3 yippee-like 3 Drosophila 3.96E-02 1.50 26.75 ± 10.49 40.22 ± 10.01 potassium channel tetramerization KCTD11 domain containing 11 4.34E-02 1.82 36.60 ± 15.15 66.78 ± 33.32 small nucleolar RNA H ACA box SNORA5C 5C 4.39E-02 1.55 22.98 ± 3.91 35.55 ± 13.60 SLFN11 ankyrin repeat domain 9 4.42E-02 2.13 9.94 ± 3.91 21.13 ± 12.70 TBC1D3C TBC1 domain family member 3C 4.60E-02 1.58 50.48 ± 19.27 79.75 ± 28.72 pyruvate dehydrogenase kinase PDK1 isozyme 1 4.68E-02 1.67 35.65 ± 20.12 59.58 ± 21.81

81

I. BIBLIOGRAPHY Arumugam, A., Z. Weng, S. S. Talwelkar, S. C. Chaudhary, L. Kopelovich, C. A. Elmets, F. Afaq and M. Athar (2013). "Inhibiting cycloxygenase and ornithine decarboxylase by diclofenac and alpha- difluoromethylornithine blocks cutaneous SCCs by targeting Akt-ERK axis." PLoS One 8(11): e80076. Bamberger, C., A. Hafner, H. Schmale and S. Werner (2005). "Expression of different p63 variants in healing skin wounds suggests a role of p63 in reepithelialization and muscle repair." Wound Repair Regen 13(1): 41-50. Banerjee Mustafi, S., P. K. Chakraborty, S. Naz, S. K. Dwivedi, M. Street, R. Basak, D. Yang, K. Ding, P. Mukherjee and R. Bhattacharya (2016). "MDR1 mediated chemoresistance: BMI1 and TIP60 in action." Biochim Biophys Acta 1859(8): 983-993. Barbieri, C. E., L. J. Tang, K. A. Brown and J. A. Pietenpol (2006). "Loss of p63 leads to increased cell migration and up-regulation of genes involved in invasion and metastasis." Cancer Res 66(15): 7589-7597. Bassi, C., Y. T. Li, K. Khu, F. Mateo, P. S. Baniasadi, A. Elia, J. Mason, V. Stambolic, M. A. Pujana, T. W. Mak and C. Gorrini (2016). "The acetyltransferase Tip60 contributes to mammary tumorigenesis by modulating DNA repair." Cell Death Differ 23(7): 1198-1208. Bejar, C. and E. Maubec (2014). "Therapy of advanced squamous cell carcinoma of the skin." Curr Treat Options Oncol 15(2): 302-320. Bretz, A. C., M. P. Gittler, J. P. Charles, N. Gremke, I. Eckhardt, M. Mernberger, R. Mandic, J. Thomale, A. Nist, M. Wanzel and T. Stiewe (2016). "DeltaNp63 activates the Fanconi anemia DNA repair pathway and limits the efficacy of cisplatin treatment in squamous cell carcinoma." Nucleic Acids Res 44(7): 3204-3218. Brown, J. A., E. Bourke, L. A. Eriksson and M. J. Kerin (2016). "Targeting cancer using KAT inhibitors to mimic lethal knockouts." Biochem Soc Trans 44(4): 979-986. Caserta, T. M., R. Kommagani, Z. Yuan, D. J. Robbins, C. A. Mercer and M. P. Kadakia (2006). "p63 overexpression induces the expression of Sonic Hedgehog." Mol Cancer Res 4(10): 759-768. Castillo-Martin, M., J. Domingo-Domenech, O. Karni-Schmidt, T. Matos and C. Cordon-Cardo (2010). "Molecular pathways of urothelial development and bladder tumorigenesis." Urol Oncol 28(4): 401-408. Chae, Y. S., H. Kim, D. Kim, H. Lee and H. O. Lee (2012). "Cell density-dependent acetylation of DeltaNp63alpha is associated with p53-dependent cell cycle arrest." FEBS Lett 586(8): 1128-1134. Chen, G., Y. Cheng, Y. Tang, M. Martinka and G. Li (2012). "Role of Tip60 in human melanoma cell migration, metastasis, and patient survival." J Invest Dermatol 132(11): 2632-2641. Chiang, C. T., W. K. Chu, S. E. Chow and J. K. Chen (2009). "Overexpression of delta Np63 in a human nasopharyngeal carcinoma cell line downregulates CKIs and enhances cell proliferation." J Cell Physiol 219(1): 117-122. Choi, H. S., Y. K. Kim and P. Y. Yun (2019). "Upregulation of MDR- and EMT-Related Molecules in Cisplatin- Resistant Human Oral Squamous Cell Carcinoma Cell Lines." Int J Mol Sci 20(12). Christenson, L. J., T. A. Borrowman, C. M. Vachon, M. M. Tollefson, C. C. Otley, A. L. Weaver and R. K. Roenigk (2005). "Incidence of basal cell and squamous cell carcinomas in a population younger than 40 years." Jama 294(6): 681-690. Chung, J., J. Lau, L. S. Cheng, R. I. Grant, F. Robinson, T. Ketela, P. P. Reis, O. Roche, S. Kamel-Reid, J. Moffat, M. Ohh, B. Perez-Ordonez, D. R. Kaplan and M. S. Irwin (2010). "SATB2 augments DeltaNp63alpha in head and neck squamous cell carcinoma." EMBO Rep 11(10): 777-783.

82 Coffey, K., T. J. Blackburn, S. Cook, B. T. Golding, R. J. Griffin, I. R. Hardcastle, L. Hewitt, K. Huberman, H. V. McNeill, D. R. Newell, C. Roche, C. A. Ryan-Munden, A. Watson and C. N. Robson (2012). "Characterisation of a Tip60 specific inhibitor, NU9056, in prostate cancer." PLoS One 7(10): e45539. Craig, A. L., J. Holcakova, L. E. Finlan, M. Nekulova, R. Hrstka, N. Gueven, J. DiRenzo, G. Smith, T. R. Hupp and B. Vojtesek (2010). "DeltaNp63 transcriptionally regulates ATM to control p53 Serine-15 phosphorylation." Mol Cancer 9: 195. Cregan, S., L. McDonagh, Y. Gao, M. P. Barr, K. J. O'Byrne, S. P. Finn, S. Cuffe and S. G. Gray (2016). "KAT5 (Tip60) is a potential therapeutic target in malignant pleural mesothelioma." Int J Oncol 48(3): 1290-1296. Danilov, A. V., D. Neupane, A. S. Nagaraja, E. V. Feofanova, L. A. Humphries, J. DiRenzo and M. Korc (2011). "DeltaNp63alpha-mediated induction of epidermal growth factor receptor promotes pancreatic cancer cell growth and chemoresistance." PLoS One 6(10): e26815. Dasari, S. and P. B. Tchounwou (2014). "Cisplatin in cancer therapy: molecular mechanisms of action." Eur J Pharmacol 740: 364-378. Dötsch, V., F. Bernassola, D. Coutandin, E. Candi and G. Melino (2010). "p63 and p73, the ancestors of p53." Cold Spring Harb Perspect Biol 2(9): a004887. Doyon, Y., W. Selleck, W. S. Lane, S. Tan and J. Cote (2004). "Structural and functional conservation of the NuA4 histone acetyltransferase complex from yeast to humans." Mol Cell Biol 24(5): 1884-1896. Flores, E. R. (2007). "The roles of p63 in cancer." Cell Cycle 6(3): 300-304. Fomenkov, A., R. Zangen, Y. P. Huang, M. Osada, Z. Guo, T. Fomenkov, B. Trink, D. Sidransky and E. A. Ratovitski (2004). "RACK1 and stratifin target DeltaNp63alpha for a proteasome degradation in head and neck squamous cell carcinoma cells upon DNA damage." Cell Cycle 3(10): 1285-1295. Frank, S. R., T. Parisi, S. Taubert, P. Fernandez, M. Fuchs, H. M. Chan, D. M. Livingston and B. Amati (2003). "MYC recruits the TIP60 histone acetyltransferase complex to chromatin." EMBO Rep 4(6): 575-580. Galli, F., M. Rossi, Y. D'Alessandra, M. De Simone, T. Lopardo, Y. Haupt, O. Alsheich-Bartok, S. Anzi, E. Shaulian, V. Calabro, G. La Mantia and L. Guerrini (2010). "MDM2 and Fbw7 cooperate to induce p63 protein degradation following DNA damage and cell differentiation." J Cell Sci 123(Pt 14): 2423-2433. Galluzzi, L., L. Senovilla, I. Vitale, J. Michels, I. Martins, O. Kepp, M. Castedo and G. Kroemer (2012). "Molecular mechanisms of cisplatin resistance." Oncogene 31(15): 1869-1883. Graziano, V. and V. De Laurenzi (2011). "Role of p63 in cancer development." Biochim Biophys Acta 1816(1): 57-66. Han, Z., K. Dimas, X. Tian, Y. Wang, H. Hemmi, K. Yamada, N. Kato, P. Pantazis, R. J. Ramanujam, S. Anant, J. H. Wyche and C. W. Houchen (2009). "14-3-3sigma-dependent resistance to cisplatin." Anticancer Res 29(6): 2009-2014. Hastak, K., E. Alli and J. M. Ford (2010). "Synergistic chemosensitivity of triple-negative breast cancer cell lines to poly(ADP-Ribose) polymerase inhibition, gemcitabine, and cisplatin." Cancer Res 70(20): 7970- 7980. Hibi, K., B. Trink, M. Patturajan, W. H. Westra, O. L. Caballero, D. E. Hill, E. A. Ratovitski, J. Jen and D. Sidransky (2000). "AIS is an oncogene amplified in squamous cell carcinoma." Proc Natl Acad Sci U S A 97(10): 5462-5467. Higashikawa, K., S. Yoneda, K. Tobiume, M. Taki, H. Shigeishi and N. Kamata (2007). "Snail-induced down- regulation of DeltaNp63alpha acquires invasive phenotype of human squamous cell carcinoma." Cancer Res 67(19): 9207-9213. Hill, N. T., J. Zhang, M. K. Leonard, M. Lee, H. N. Shamma and M. Kadakia (2015). "1alpha, 25- Dihydroxyvitamin D(3) and the vitamin D receptor regulates DeltaNp63alpha levels and keratinocyte proliferation." Cell Death Dis 6: e1781.

83 Hirano, G., H. Izumi, A. Kidani, Y. Yasuniwa, B. Han, H. Kusaba, K. Akashi, M. Kuwano and K. Kohno (2010). "Enhanced expression of PCAF endows apoptosis resistance in cisplatin-resistant cells." Mol Cancer Res 8(6): 864-872. Hobbs, C. A., G. Wei, K. DeFeo, B. Paul, C. S. Hayes and S. K. Gilmour (2006). "Tip60 protein isoforms and altered function in skin and tumors that overexpress ornithine decarboxylase." Cancer Res 66(16): 8116- 8122. Huang, Y., L. N. Bell, J. Okamura, M. S. Kim, R. P. Mohney, R. Guerrero-Preston and E. A. Ratovitski (2012). "Phospho-ΔNp63α/SREBF1 protein interactions: bridging cell metabolism and cisplatin chemoresistance." Cell Cycle 11(20): 3810-3827. Huang, Y., J. S. Jeong, J. Okamura, M. Sook-Kim, H. Zhu, R. Guerrero-Preston and E. A. Ratovitski (2012). "Global tumor protein p53/p63 interactome: making a case for cisplatin chemoresistance." Cell Cycle 11(12): 2367-2379. Huang, Y., T. Sen, J. Nagpal, S. Upadhyay, B. Trink, E. Ratovitski and D. Sidransky (2008). "ATM kinase is a master switch for the Delta Np63 alpha phosphorylation/degradation in human head and neck squamous cell carcinoma cells upon DNA damage." Cell Cycle 7(18): 2846-2855. Jiang, Z., R. Kamath, S. Jin, M. Balasubramani, T. K. Pandita and B. Rajasekaran (2011). "Tip60-mediated acetylation activates transcription independent apoptotic activity of Abl." Mol Cancer 10: 88. Judes, G., K. Rifai, M. Ngollo, M. Daures, Y. J. Bignon, F. Penault-Llorca and D. Bernard-Gallon (2015). "A bivalent role of TIP60 histone acetyl transferase in human cancer." Epigenomics 7(8): 1351-1363. Kamine, J., B. Elangovan, T. Subramanian, D. Coleman and G. Chinnadurai (1996). "Identification of a cellular protein that specifically interacts with the essential cysteine region of the HIV-1 Tat transactivator." Virology 216(2): 357-366. Katan-Khaykovich, Y. and K. Struhl (2002). "Dynamics of global histone acetylation and deacetylation in vivo: rapid restoration of normal histone acetylation status upon removal of activators and repressors." Genes Dev 16(6): 743-752. Kelland, L. (2007). "The resurgence of platinum-based cancer chemotherapy." Nat Rev Cancer 7(8): 573- 584. Kim, M. Y., E. J. Ann, J. Y. Kim, J. S. Mo, J. H. Park, S. Y. Kim, M. S. Seo and H. S. Park (2007). "Tip60 histone acetyltransferase acts as a negative regulator of Notch1 signaling by means of acetylation." Mol Cell Biol 27(18): 6506-6519. Kommagani, R., M. K. Leonard, S. Lewis, R.-A. Romano, S. Sinha and M. P. Kadakia (2009). "Regulation of VDR by deltaNp63alpha is associated with inhibition of cell invasion." Journal of cell science 122(Pt 16): 2828-2835. Kommagani, R., M. K. Leonard, S. Lewis, R. A. Romano, S. Sinha and M. P. Kadakia (2009). "Regulation of VDR by deltaNp63alpha is associated with inhibition of cell invasion." J Cell Sci 122(Pt 16): 2828-2835. Koonin, E. V., S. Zhou and J. C. Lucchesi (1995). "The chromo superfamily: new members, duplication of the chromo domain and possible role in delivering transcription regulators to chromatin." Nucleic Acids Res 23(21): 4229-4233. Koster, M. I., S. Kim, A. A. Mills, F. J. DeMayo and D. R. Roop (2004). "p63 is the molecular switch for initiation of an epithelial stratification program." Genes Dev 18(2): 126-131. Koster, M. I. and D. R. Roop (2004). "p63 and epithelial appendage development." Differentiation 72(8): 364-370. Kusch, T., L. Florens, W. H. Macdonald, S. K. Swanson, R. L. Glaser, J. R. Yates, 3rd, S. M. Abmayr, M. P. Washburn and J. L. Workman (2004). "Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions." Science 306(5704): 2084-2087.

84 Lahens, N. F., E. Ricciotti, O. Smirnova, E. Toorens, E. J. Kim, G. Baruzzo, K. E. Hayer, T. Ganguly, J. Schug and G. R. Grant (2017). "A comparison of Illumina and Ion Torrent sequencing platforms in the context of differential gene expression." BMC Genomics 18(1): 602. Lanzi, C., P. Perego, R. Supino, S. Romanelli, T. Pensa, N. Carenini, I. Viano, D. Colangelo, R. Leone, P. Apostoli, G. Cassinelli, R. A. Gambetta and F. Zunino (1998). "Decreased drug accumulation and increased tolerance to DNA damage in tumor cells with a low level of cisplatin resistance." Biochem Pharmacol 55(8): 1247-1254. Law, C. W., Y. Chen, W. Shi and G. K. Smyth (2014). "voom: Precision weights unlock linear model analysis tools for RNA-seq read counts." Genome Biol 15(2): R29. Lee, H. O., J. H. Lee, E. Choi, J. Y. Seol, Y. Yun and H. Lee (2006). "A dominant negative form of p63 inhibits apoptosis in a p53-independent manner." Biochem Biophys Res Commun 344(1): 166-172. Lee, M. S., J. Seo, D. Y. Choi, E. W. Lee, A. Ko, N. C. Ha, J. B. Yoon, H. W. Lee, K. P. Kim and J. Song (2013). "Stabilization of p21 (Cip1/WAF1) following Tip60-dependent acetylation is required for p21-mediated DNA damage response." Cell Death Differ 20(4): 620-629. Legube, G., L. K. Linares, C. Lemercier, M. Scheffner, S. Khochbin and D. Trouche (2002). "Tip60 is targeted to proteasome-mediated degradation by Mdm2 and accumulates after UV irradiation." EMBO J 21(7): 1704-1712. Leonard, M. K., R. Kommagani, V. Payal, L. D. Mayo, H. N. Shamma and M. P. Kadakia (2011). "DeltaNp63alpha regulates keratinocyte proliferation by controlling PTEN expression and localization." Cell Death Differ 18(12): 1924-1933. Li, W., A. Turner, P. Aggarwal, A. Matter, E. Storvick, D. K. Arnett and U. Broeckel (2015). "Comprehensive evaluation of AmpliSeq transcriptome, a novel targeted whole transcriptome RNA sequencing methodology for global gene expression analysis." BMC Genomics 16: 1069. Lin, C., X. Li, Y. Zhang, Y. Guo, J. Zhou, K. Gao, J. Dai, G. Hu, L. Lv, J. Du and Y. Zhang (2015). "The microRNA feedback regulation of p63 in cancer progression." Oncotarget 6(11): 8434-8453. Litvinov, I. V., E. Netchiporouk, B. Cordeiro, H. Zargham, K. Pehr, M. Gilbert, Y. Zhou, L. Moreau, A. Woetmann, N. Odum, T. S. Kupper and D. Sasseville (2014). "Ectopic expression of embryonic stem cell and other developmental genes in cutaneous T-cell lymphoma." Oncoimmunology 3(11): e970025. Liu, L., Y. Li, S. Li, N. Hu, Y. He, R. Pong, D. Lin, L. Lu and M. Law (2012). "Comparison of next-generation sequencing systems." J Biomed Biotechnol 2012: 251364. Livak, K. J. and T. D. Schmittgen (2001). "Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-408. Magee, P., L. Shi and M. Garofalo (2015). "Role of microRNAs in chemoresistance." Ann Transl Med 3(21): 332. Mansoori, B., A. Mohammadi, S. Davudian, S. Shirjang and B. Baradaran (2017). "The Different Mechanisms of Cancer Drug Resistance: A Brief Review." Adv Pharm Bull 7(3): 339-348. Massion, P. P., P. M. Taflan, S. M. Jamshedur Rahman, P. Yildiz, Y. Shyr, M. E. Edgerton, M. D. Westfall, J. R. Roberts, J. A. Pietenpol, D. P. Carbone and A. L. Gonzalez (2003). "Significance of p63 amplification and overexpression in lung cancer development and prognosis." Cancer Res 63(21): 7113-7121. Matin, R. N., A. Chikh, S. L. Chong, D. Mesher, M. Graf, P. Sanza, V. Senatore, M. Scatolini, F. Moretti, I. M. Leigh, C. M. Proby, A. Costanzo, G. Chiorino, R. Cerio, C. A. Harwood and D. Bergamaschi (2013). "p63 is an alternative p53 repressor in melanoma that confers chemoresistance and a poor prognosis." J Exp Med 210(3): 581-603.

85 Mattera, L., F. Escaffit, M. J. Pillaire, J. Selves, S. Tyteca, J. S. Hoffmann, P. A. Gourraud, M. Chevillard-Briet, C. Cazaux and D. Trouche (2009). "The p400/Tip60 ratio is critical for colorectal cancer cell proliferation through DNA damage response pathways." Oncogene 28(12): 1506-1517. Mills, A. A., B. Zheng, X. J. Wang, H. Vogel, D. R. Roop and A. Bradley (1999). "p63 is a p53 homologue required for limb and epidermal morphogenesis." Nature 398(6729): 708-713. Miyamoto, N., H. Izumi, T. Noguchi, Y. Nakajima, Y. Ohmiya, M. Shiota, A. Kidani, A. Tawara and K. Kohno (2008). "Tip60 is regulated by circadian transcription factor clock and is involved in cisplatin resistance." J Biol Chem 283(26): 18218-18226. Montgomery, D. C., A. W. Sorum, L. Guasch, M. C. Nicklaus and J. L. Meier (2015). "Metabolic Regulation of Histone Acetyltransferases by Endogenous Acyl-CoA Cofactors." Chem Biol 22(8): 1030-1039. Moses, M. A., A. L. George, N. Sakakibara, K. Mahmood, R. M. Ponnamperuma, K. E. King and W. C. Weinberg (2019). "Molecular Mechanisms of p63-Mediated Squamous Cancer Pathogenesis." Int J Mol Sci 20(14). Mundt, H. M., W. Stremmel, G. Melino, P. H. Krammer, T. Schilling and M. Muller (2010). "Dominant negative (DeltaN) p63alpha induces drug resistance in hepatocellular carcinoma by interference with apoptosis signaling pathways." Biochem Biophys Res Commun 396(2): 335-341. Neupane, D. and M. Korc (2008). "14-3-3sigma Modulates pancreatic cancer cell survival and invasiveness." Clin Cancer Res 14(23): 7614-7623. Osada, M., M. Ohba, C. Kawahara, C. Ishioka, R. Kanamaru, I. Katoh, Y. Ikawa, Y. Nimura, A. Nakagawara, M. Obinata and S. Ikawa (1998). "Cloning and functional analysis of human p51, which structurally and functionally resembles p53." Nat Med 4(7): 839-843. Pandey, A. K., Y. Zhang, S. Zhang, Y. Li, G. Tucker-Kellogg, H. Yang and S. Jha (2015). "TIP60-miR-22 axis as a prognostic marker of breast cancer progression." Oncotarget 6(38): 41290-41306. Patel, J. H., Y. Du, P. G. Ard, C. Phillips, B. Carella, C.-J. Chen, C. Rakowski, C. Chatterjee, P. M. Lieberman, W. S. Lane, G. A. Blobel and S. B. McMahon (2004). "The c-MYC Oncoprotein Is a Substrate of the Acetyltransferases hGCN5/PCAF and TIP60." Molecular and Cellular Biology 24(24): 10826. Patel, J. H., Y. Du, P. G. Ard, C. Phillips, B. Carella, C. J. Chen, C. Rakowski, C. Chatterjee, P. M. Lieberman, W. S. Lane, G. A. Blobel and S. B. McMahon (2004). "The c-MYC oncoprotein is a substrate of the acetyltransferases hGCN5/PCAF and TIP60." Mol Cell Biol 24(24): 10826-10834. Pfaffl, M. W. (2001). "A new mathematical model for relative quantification in real-time RT-PCR." Nucleic Acids Res 29(9): e45. Polevoda, B. and F. Sherman (2002). "The diversity of acetylated proteins." Genome Biol 3(5): reviews0006. Rocha, C. R. R., M. M. Silva, A. Quinet, J. B. Cabral-Neto and C. F. M. Menck (2018). "DNA repair pathways and cisplatin resistance: an intimate relationship." Clinics (Sao Paulo) 73(suppl 1): e478s. Rogers, H. W., M. A. Weinstock, A. R. Harris, M. R. Hinckley, S. R. Feldman, A. B. Fleischer and B. M. Coldiron (2010). "Incidence Estimate of Nonmelanoma Skin Cancer in the United States, 2006Incidence Estimate of NMSC in the US, 2006." JAMA Dermatology 146(3): 283-287. Sapountzi, V. and J. Cote (2011). "MYST-family histone acetyltransferases: beyond chromatin." Cell Mol Life Sci 68(7): 1147-1156. Sapountzi, V., I. R. Logan and C. N. Robson (2006). "Cellular functions of TIP60." Int J Biochem Cell Biol 38(9): 1496-1509. Sethi, I., R. A. Romano, C. Gluck, K. Smalley, B. Vojtesek, M. J. Buck and S. Sinha (2015). "A global analysis of the complex landscape of isoforms and regulatory networks of p63 in human cells and tissues." BMC Genomics 16: 584.

86 Shen, C., D. Oswald, D. Phelps, H. Cam, C. E. Pelloski, Q. Pang and P. J. Houghton (2013). "Regulation of FANCD2 by the mTOR pathway contributes to the resistance of cancer cells to DNA double-strand breaks." Cancer Res 73(11): 3393-3401. Siegel, R. L., K. D. Miller and A. Jemal (2019). "Cancer statistics, 2019." CA Cancer J Clin 69(1): 7-34. Simon-O'Brien, E., S. Alaux-Cantin, V. Warnault, R. Buttolo, M. Naassila and C. Vilpoux (2015). "The histone deacetylase inhibitor sodium butyrate decreases excessive ethanol intake in dependent animals." Addict Biol 20(4): 676-689. Soares, E. and H. Zhou (2018). "Master regulatory role of p63 in epidermal development and disease." Cell Mol Life Sci 75(7): 1179-1190. Squatrito, M., C. Gorrini and B. Amati (2006). "Tip60 in DNA damage response and growth control: many tricks in one HAT." Trends Cell Biol 16(9): 433-442. Stacy, A. J., M. P. Craig, S. Sakaram and M. Kadakia (2017). "DeltaNp63alpha and microRNAs: leveraging the epithelial-mesenchymal transition." Oncotarget 8(2): 2114-2129. Su, W. P., Y. C. Ho, C. K. Wu, S. H. Hsu, J. L. Shiu, J. C. Huang, S. B. Chang, W. T. Chiu, J. J. Hung, T. L. Liu, W. S. Wu, P. Y. Wu, W. C. Su, J. Y. Chang and H. Liaw (2017). "Chronic treatment with cisplatin induces chemoresistance through the TIP60-mediated Fanconi anemia and homologous recombination repair pathways." Sci Rep 7(1): 3879. Sun, Y., X. Jiang, S. Chen, N. Fernandes and B. D. Price (2005). "A role for the Tip60 histone acetyltransferase in the acetylation and activation of ATM." Proc Natl Acad Sci U S A 102(37): 13182-13187. Sun, Y., X. Jiang and B. D. Price (2010). "Tip60: connecting chromatin to DNA damage signaling." Cell Cycle 9(5): 930-936. Sykes, S. M., T. J. Stanek, A. Frank, M. E. Murphy and S. B. McMahon (2009). "Acetylation of the DNA binding domain regulates transcription-independent apoptosis by p53." J Biol Chem 284(30): 20197- 20205. Tang, Y., J. Luo, W. Zhang and W. Gu (2006). "Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis." Mol Cell 24(6): 827-839. Truong, A. B., M. Kretz, T. W. Ridky, R. Kimmel and P. A. Khavari (2006). "p63 regulates proliferation and differentiation of developmentally mature keratinocytes." Genes Dev 20(22): 3185-3197. Urist, M. J., C. J. Di Como, M. L. Lu, E. Charytonowicz, D. Verbel, C. P. Crum, T. A. Ince, F. D. McKeon and C. Cordon-Cardo (2002). "Loss of p63 expression is associated with tumor progression in bladder cancer." Am J Pathol 161(4): 1199-1206. Van Den Broeck, A., D. Nissou, E. Brambilla, B. Eymin and S. Gazzeri (2011). "Activation of a Tip60/E2F1/ERCC1 network in human lung adenocarcinoma cells exposed to cisplatin." Carcinogenesis 33(2): 320-325. Wang, J. and J. Chen (2010). "SIRT1 regulates autoacetylation and histone acetyltransferase activity of TIP60." J Biol Chem 285(15): 11458-11464. Wang, P., H. Bao, X. P. Zhang, F. Liu and W. Wang (2019). "Regulation of Tip60-dependent p53 acetylation in cell fate decision." FEBS Lett 593(1): 13-22. Westfall, M. D., A. S. Joyner, C. E. Barbieri, M. Livingstone and J. A. Pietenpol (2005). "Ultraviolet radiation induces phosphorylation and ubiquitin-mediated degradation of DeltaNp63alpha." Cell Cycle 4(5): 710- 716. Westfall, M. D., D. J. Mays, J. C. Sniezek and J. A. Pietenpol (2003). "The Delta Np63 alpha phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay-Wells syndrome-derived mutations." Mol Cell Biol 23(7): 2264-2276.

87 Wu, G., S. Nomoto, M. O. Hoque, T. Dracheva, M. Osada, C. C. Lee, S. M. Dong, Z. Guo, N. Benoit, Y. Cohen, P. Rechthand, J. Califano, C. S. Moon, E. Ratovitski, J. Jen, D. Sidransky and B. Trink (2003). "DeltaNp63alpha and TAp63alpha regulate transcription of genes with distinct biological functions in cancer and development." Cancer Res 63(10): 2351-2357. Yang, A., M. Kaghad, Y. Wang, E. Gillett, M. D. Fleming, V. Dotsch, N. C. Andrews, D. Caput and F. McKeon (1998). "p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities." Mol Cell 2(3): 305-316. Yang, A. and F. McKeon (2000). "p63 and p73: p53 mimics, menaces and more." Nature Reviews Molecular Cell Biology 1(3): 199-207. Yang, C., J. Wu and Y. G. Zheng (2012). "Function of the active site lysine autoacetylation in Tip60 catalysis." PLoS One 7(3): e32886. Yang, Y., J. Sun, T. Chen, Z. Tao, X. Zhang, F. Tian, X. Zhou and D. Lu (2017). "Tat-interactive Protein-60KDA (TIP60) Regulates the Tumorigenesis of Lung Cancer In Vitro." J Cancer 8(12): 2277-2281. Yang, Y., K. Xue, Z. Li, W. Zheng, W. Dong, J. Song, S. Sun, T. Ma and W. Li (2018). "c-Myc regulates the CDK1/cyclin B1 dependentG2/M cell cycle progression by histone H4 acetylation in Raji cells." Int J Mol Med 41(6): 3366-3378. Ye, S., K. B. Lee, M. H. Park, J. S. Lee and S. M. Kim (2014). "p63 regulates growth of esophageal squamous carcinoma cells via the Akt signaling pathway." Int J Oncol 44(6): 2153-2159. Yoh, K. E., K. Regunath, A. Guzman, S. M. Lee, N. T. Pfister, O. Akanni, L. J. Kaufman, C. Prives and R. Prywes (2016). "Repression of p63 and induction of EMT by mutant Ras in mammary epithelial cells." Proc Natl Acad Sci U S A 113(41): E6107-E6116. Yoshikawa, H., M. Nagashima, M. A. Khan, M. G. McMenamin, K. Hagiwara and C. C. Harris (1999). "Mutational analysis of p73 and p53 in human cancer cell lines." Oncogene 18(22): 3415-3421. Zangen, R., E. Ratovitski and D. Sidransky (2005). "DeltaNp63alpha levels correlate with clinical tumor response to cisplatin." Cell Cycle 4(10): 1313-1315. Zhan, J., P. Wang, S. Li, J. Song, H. He, Y. Wang, Z. Liu, F. Wang, H. Bai, W. Fang, Q. Du, M. Ye, Z. Chang, J. Wang and H. Zhang (2019). "HOXB13 networking with ABCG1/EZH2/Slug mediates metastasis and confers resistance to cisplatin in lung adenocarcinoma patients." Theranostics 9(7): 2084-2099. Zhang, P., X. Lu, Z. Shi, X. Li, Y. Zhang, S. Zhao and H. Liu (2019). "miR-205-5p regulates epithelial- mesenchymal transition by targeting PTEN via PI3K/AKT signaling pathway in cisplatin-resistant nasopharyngeal carcinoma cells." Gene 710: 103-113. Zhang, X., J. Wu and Y. Luan (2017). "Tip60: Main Functions and Its Inhibitors." Mini Rev Med Chem 17(8): 675-682. Zheng, X., J. L. Carstens, J. Kim, M. Scheible, J. Kaye, H. Sugimoto, C. C. Wu, V. S. LeBleu and R. Kalluri (2015). "Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer." Nature 527(7579): 525-530.

88