DOCSLIB.ORG

Paraphyly of the Enoplognatha Ovata Group (Araneae, Theridiidae) Based on Dna Sequences

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Paraphyly of the Enoplognatha Ovata Group (Araneae, Theridiidae) Based on Dna Sequences 1999. The Journal of Arachnology 27:481±488 PARAPHYLY OF THE ENOPLOGNATHA OVATA GROUP (ARANEAE, THERIDIIDAE) BASED ON DNA SEQUENCES A.-M. Tan1, R.G. Gillespie1 and G.S. Oxford2: 1Center for Conservation Research and Training, University of Hawaii, 3050 Maile Way, Gilmore 409, Honolulu, Hawaii 96822, USA; 2Department of Biology, University of York, P.O. Box 373, York YO1 5YW, UK ABSTRACT: Five species of Enoplognatha Pavesi 1880 were recently recognized as a monophyletic Enoplognatha ovata group based on morphological data. We analyzed the E. ovata clade for monophyly using four species in the E. ovata group (E. ovata (Clerck 1757), E. latimana Hippa & Oksala 1982, E. margarita Yaginuma 1964 and E. afrodite Hippa & Oksala 1983) and three other closely related taxa (E. japonica BoÈsenberg & Strand 1906, E. thoracica (Hahn 1833), and E. intrepida Sùrensen 1898). Two species of the presumed sister genus (Steatoda Sundevall 1833) were employed as outgroups. The results indicate that the ``E. ovata clade'' is not monophyletic. The genus Enoplognatha Pavesi 1880 is (Hippa & Oksala 1979, 1981; Oxford 1983, characterized by the presence of a large col- 1985, 1989, 1991, 1992; Oxford & Reillo ulus, a plesiomorphic character for the family; 1993; Reillo & Wise 1988a, b). Consistent and accordingly, the genus is generally con- with most invertebrate color polymorphisms sidered one of the more primitive groups in (Haldane 1939) the dominance hierarchy of the Theridiidae. The spiders are medium-to- the expression of morphs in E. ovata follows large sized with a subspherical abdomen. Fe- the inverse of morph frequencies in nature, males have a tooth on the posterior margin of i.e., the least dominant (or most recessive) al- the chelicerae; males usually have enlarged lele is most frequent; the most dominant is the chelicerae, with enlarged teeth on the poste- rarest. For the mode of inheritance of the rior margin, and have the paracymbium on the polymorphism in E. ovata, Oxford (1983) has margin of the cymbium. The genus is very proposed a two locus model: one locus is con- close to Steatoda Sundevall 1833, medium-to- cerned with pattern and color, the other with large sized spiders, again characterized by a the regulation of this color locus during de- very large colulus (Levi 1962; Levy & Amitai velopment. When red-pigmented alleles are 1981). The chelicerae are often enlarged in linked to the late developing allele, the color males, and have one or more teeth on the an- morphs are sex-limited: males are lineata no terior margin, none on the posterior margin. matter which allele they carry. Enoplognatha Enoplognatha is well known because of the latimana Hippa & Oksala 1982 shares color, striking color and pattern polymorphism ex- regulatory, and black spotting polymorphisms hibited by representative species in the genus, with E. ovata (Oxford 1992), although E. la- which has been most intensively studied in E. timana lacks the ovata color morph. ovata (Clerck 1757). Three distinct morphs In the 1980s Hippa & Oksala (1982) erect- have been described in E. ovata (Locket & ed the E. ovata group to include E. ovata sen- Millidge 1951; Hippa & Oksala 1979; Oxford su stricto, E. latimana, and E. penelope Hippa 1976): lineata (all yellow), redimita (yellow & Oksala 1982. Members of the group share with two dorsolateral carmine stripes on the the following characters: trichobothrium on abdomen), and ovata (yellow with a solid the ®rst metatarsus subapical; elongated, shield of carmine on the dorsal surface of the sclerotized and subtubular tip of conductor in abdomen). The color pattern variation in E. male palp; female vulva with massive copu- ovata is genetically determined, and has been latory pockets and abdomen with sharply de- the subject of numerous studies on the genet- limited dorsolateral black spots (Hippa & ics and evolution of the color polymorphism Oksala 1982). Further examination of material 481 482 THE JOURNAL OF ARACHNOLOGY from Europe and Japan added another two METHODS species to the E. ovata group (Hippa & Oksala Spiders sequenced.ÐEnoplognatha: E. 1983): E. afrodite Hippa & Oksala 1983 and ovata, two individuals from two localities: E. margarita Yaginuma 1964. E. margarita Grimes Graves, Norfolk, U.K., collected by shares the subapical trichobothria and sclero- G.S. Oxford, June 1991; and Berceto, Italy, tized subtubular tip of the conductor with E. collected by G.S. Oxford & P.R. Reillo, Au- ovata, E. latimana and E. penelope. However, gust 1991. E. latimana, one individual: it lacks the massive copulatory pockets. Con- Grimes Graves, Norfolk, U.K., collected by sidering all of these characters as synapomor- G.S. Oxford, June 1991. E. afrodite, one in- phies, Hippa & Oksala (1983) hypothesized dividual: near Carcassonne, S. France, col- that E. margarita was the closest sister to (E. lected by S. Peet, July 1988. E. margarita, one ovata 1 E. latimana 1 E. penelope). Eno- individual: Nukabira, Kamishihoro-cho, Hok- plognatha afrodite has a similar body shape, kaido, Japan, collected by M. Matsuda, Au- ground color and spotting pattern to (E. ovata gust 1992. Other Enoplognatha species ex- 1 E. latimana 1 E. margarita) but lacks these amined: E. japonica, one individual: synapomorphies. Accordingly, Hippa & Oks- Hokkaido, Japan, collected by M. Matsuda, ala considered E. afrodite as the most ances- July 1989; E. thoracica, one individual: Flat- tral species in the group. ford Mill, Suffolk, U.K., collected by C.J. More recently, Oxford & Reillo (1994) questioned the phylogeny of the E. ovata Smith, May 1978; E. intrepida, one individ- group proposed by Hippa & Oksala. Their ual: Third Hill Mountain, Berkeley County, concern arose because E. ovata, E. latimana, West Virginia, USA, collected by P.J. Martin- E. penelope and E. afrodite all have European at, May 1986 (det. D.T. Jennings, deposited in distributions (although the former two have Smithsonian, Museum of Natural History). been introduced into North America). All oc- We also extracted DNA from E. penelope, one cur in the Mediterranean region; but only E. individual: Sami, Kefallinia, Greece, collected latimana and E. ovata occur further north, by J. Murphy, May 1987. However, we were with E. ovata alone extending well into north- not successful in amplifying the product. Out- ern Europe. Based on this distributional infor- groups: We used two species of Steatoda as mation, Oxford & Reillo hypothesized a pos- the outgroup: Steatoda grossa: Molokai, Ha- sible Mediterranean origin of the E. ovata waii, collected by A.-M. Tan & G.S. Oxford group, suggesting that the Asian E. margarita October 1993 and S. bipunctata: Yorkshire, may have been phylogenetically misplaced by U.K., collected by G.S. Oxford, January 1994. Hippa & Oksala. Indeed, the phylogeny pre- Voucher specimens for all species used are at sented by Hippa & Oksala was open to criti- the Center for Conservation Research and cism because of the lack of a suitable out- Training, University of Hawaii. group for character polarization, few (only DNA extraction and sequencing.ÐDNA nine) characters used, and because there was samples were prepared by the conventional no quantitative assessment of phylogeny. SDS-NaCl-Ethanol method (Medrano et al. In the current study we examined four spe- 1990; Tan & Orrego 1992). Tissues from the cies in the E. ovata group, and three other legs or prosoma were placed in a 1.5 ml tube species of Enoplognatha: E. japonica BoÈsen- and ground with a pipette tip. After adding 15 berg & Strand 1906 from Japan, E. thoracica ml of proteinase K, the tissues were incubated (Hahn 1833) from England, and E. intrepida at 55 8C overnight. Proteins were removed by Sùrensen 1898 from North America. As out- salt precipitation. DNA was precipitated, groups in the analysis we used two species of washed in alcohol and preserved in 13 TE Steatoda: S. grossa (C.L. Koch 1838) and S. buffer (pH 8.0). bipunctata (Linnaeus 1758). We examined the For both double and single stranded PCR pattern of sequence evolution in the E. ovata ampli®cation we used the following primers group to ascertain the monophyly of the clade. (Table 1): E and B2 for the less variable re- In this way we can evaluate the hypothesis gion of the 18S sequence; B and P for the that the Mediterranean served as the center of more variable region of the 18S sequence; A origin for the group as suggested by Oxford and B2 for the 16S sequence. PCR ampli®- & Reillo (1994). cation of double-stranded products was per- TAN ET AL.ÐPARAPHYLY OF ENOPLOGNATHA OVATA GROUP 483 Table 1.ÐPrimers used. Position obtained refers to Drosophila (Clary & Wolstenholme 1985). Gene Primer sequence in Position # Base primer Drosophila obtained pairs Reference 18S E CTGGTTGATCCTGCCAGTAG 24±553 529 modi®ed from 18S B2 GCTGGCACCAGACTTGCCCTCC Hillis & Dixon 1991 18S B TTCCAGCTCCAATAGCGTAT 606±916 325 W.C. Wheeler & C. Hayashi, 18S P GTCTTGCGACGGTCCAAGA pers. comm. 16S A CGCCTGTTTATCAAAAACAT 12864±13417 450 S.R. Palumbi & T. Hsiao, 16S B2 CTCCGGTTTGAACTCAGATCA pers. comm. formed in 12.5 ml volume with 38 cycles us- hood (ML) in PHYLIP (version 3.5c, Felsen- ing Thermus aquaticus DNA polymerase stein 1993), using a generalized Jukes & Can- (Saiki et al. 1985). Ampli®cation was done tor (1969) model to allow for unequal base with the following pro®le: 93 8C, 50 8C and frequencies (Felsenstein 1981) as well as dif- 72 8C each for 30 seconds. Single strand prod- ferent rates of transitions and transversions. ucts were prepared by asymmetric PCR (Gyl- Sequences were also analyzed by Maximum lensten & Erlich 1988) with 1:50 primer ratios Parsimony (MP) in PAUP (version 3.1.1, in 50 ml volumes and the same reaction pro- Swofford 1993). In both analyses gaps were ®les as above. The products were assessed by treated as missing data. Bootstrap analyses mini-gel electrophoresis using 5 ml aliquots, (Felsenstein 1985) were used to estimate the and washed in sterilized distilled water with statistical con®dence of the different nodes in three cycles of dialysis using Millipore MC the trees.
Load more

Recommended publications
  • Spider Biodiversity Patterns and Their Conservation in the Azorean
    Systematics and Biodiversity 6 (2): 249–282 Issued 6 June 2008 doi:10.1017/S1477200008002648 Printed in the United Kingdom C The Natural History Museum ∗ Paulo A.V. Borges1 & Joerg Wunderlich2 Spider biodiversity patterns and their 1Azorean Biodiversity Group, Departamento de Ciˆencias conservation in the Azorean archipelago, Agr´arias, CITA-A, Universidade dos Ac¸ores. Campus de Angra, with descriptions of new species Terra-Ch˜a; Angra do Hero´ısmo – 9700-851 – Terceira (Ac¸ores); Portugal. Email: [email protected] 2Oberer H¨auselbergweg 24, Abstract In this contribution, we report on patterns of spider species diversity of 69493 Hirschberg, Germany. the Azores, based on recently standardised sampling protocols in different hab- Email: joergwunderlich@ t-online.de itats of this geologically young and isolated volcanic archipelago. A total of 122 species is investigated, including eight new species, eight new records for the submitted December 2005 Azorean islands and 61 previously known species, with 131 new records for indi- accepted November 2006 vidual islands. Biodiversity patterns are investigated, namely patterns of range size distribution for endemics and non-endemics, habitat distribution patterns, island similarity in species composition and the estimation of species richness for the Azores. Newly described species are: Oonopidae – Orchestina furcillata Wunderlich; Linyphiidae: Linyphiinae – Porrhomma borgesi Wunderlich; Turinyphia cavernicola Wunderlich; Linyphiidae: Micronetinae – Agyneta depigmentata Wunderlich; Linyph- iidae:
    [Show full text]
  • Araneae, Theridiidae)
    Phelsuma 14; 49-89 Theridiid or cobweb spiders of the granitic Seychelles islands (Araneae, Theridiidae) MICHAEL I. SAARISTO Zoological Museum, Centre for Biodiversity University of Turku,FIN-20014 Turku FINLAND [micsaa@utu.fi ] Abstract. - This paper describes 8 new genera, namely Argyrodella (type species Argyrodes pusillus Saaristo, 1978), Bardala (type species Achearanea labarda Roberts, 1982), Nanume (type species Theridion naneum Roberts, 1983), Robertia (type species Theridion braueri (Simon, 1898), Selimus (type species Theridion placens Blackwall, 1877), Sesato (type species Sesato setosa n. sp.), Spinembolia (type species Theridion clabnum Roberts, 1978), and Stoda (type species Theridion libudum Roberts, 1978) and one new species (Sesato setosa n. sp.). The following new combinations are also presented: Phycosoma spundana (Roberts, 1978) n. comb., Argyrodella pusillus (Saaristo, 1978) n. comb., Rhomphaea recurvatus (Saaristo, 1978) n. comb., Rhomphaea barycephalus (Roberts, 1983) n. comb., Bardala labarda (Roberts, 1982) n. comb., Moneta coercervus (Roberts, 1978) n. comb., Nanume naneum (Roberts, 1983) n. comb., Parasteatoda mundula (L. Koch, 1872) n. comb., Robertia braueri (Simon, 1898). n. comb., Selimus placens (Blackwall, 1877) n. comb., Sesato setosa n. gen, n. sp., Spinembolia clabnum (Roberts, 1978) n. comb., and Stoda libudum (Roberts, 1978) n. comb.. Also the opposite sex of four species are described for the fi rst time, namely females of Phycosoma spundana (Roberts, 1978) and P. menustya (Roberts, 1983) and males of Spinembolia clabnum (Roberts, 1978) and Stoda libudum (Roberts, 1978). Finally the morphology and terminology of the male and female secondary genital organs are discussed. Key words. - copulatory organs, morphology, Seychelles, spiders, Theridiidae. INTRODUCTION Theridiids or comb-footed spiders are very variable in general apperance often with considerable sexual dimorphism.
    [Show full text]
  • The World Distributions of Species Within the Enoplognatha Ovata
    226 Bull. Br. arachnol. Soc. (1994) 9 (7), 226-232 The world distributions of species within the Hippa & Oksala (1983b) deduced the cladogenesis of Enoplognatha ovata group (Araneae: Theridiidae): species within this group on the basis of morphological implications for their evolution and for previous characteristics (Fig. 1). research Obviously the presence of previously unrecognised sibling species may complicate interpretation of the G. S. Oxford* results of the studies cited above, but this will depend on Department of Biology, the geographical ranges of the species concerned. In this University of York, York YO1 5DD paper, we present information'on the world distributions of the five sibling species presently placed in the Enop- and lognatha ovata group, and consider the implications for P. R. Reillo their evolution and for previous work. Rare Species Conservatory, 1222 'E' Road, Loxahatchee, Florida 33470, USA Materials Hippa & Oksala (1982, 1983a,b) gave the locations Summary of collected material in their original descriptions of species. We collected many specimens from France, The The world distributions of species within the Enoplog- Netherlands, Germany, Switzerland and Italy during natha ovata group (sensu Hippa & Oksala, 1983b) — E. ovata s.s., E. latimana, E. afrodite, E. penelope and E. August 1991 (Oxford & Reillo, in press). Information margarita — are described for the first time. E. ovata s.s. for the British Isles is based on a number of surveys and E. latimana are widespread in Europe and in North (Oxford, 1985a, 1991, 1992; Snazell, 1983), augmented America, while the other three species are more limited in with unpublished records from members of the British their ranges.
    [Show full text]
  • Spiders from the Ionian Islands of Kerkyra (Corfu) and Lefkada, Greece (Arachnida: Aranei)
    Arthropoda Selecta 23(3): 285–300 © ARTHROPODA SELECTA, 2014 Spiders from the Ionian islands of Kerkyra (Corfu) and Lefkada, Greece (Arachnida: Aranei) Ïàóêè Èîíè÷åñêèõ îñòðîâîâ Êåðêèðà (Êîðôó) è Ëåâêàäà, Ãðåöèÿ (Arachnida: Aranei) Anthony Russell-Smith Ý. Ðàññåë-Ñìèò 1, Bailiffs Cottage, Doddington, Sittingbourne, Kent ME9 0JU, the UK. KEY WORDS: Aranei, Greece, Ionian islands, faunistic list. КЛЮЧЕВЫЕ СЛОВА: Aranei, Греция, Ионические острова, фаунистический список. ABSTRACT. A list of spiders collected from the remains limited compared to that for most of central Ionian islands of Kerkyra and Lefkada is provided and NW Europe, as is the case for all areas of the together with a list of all previously published records. eastern Mediterranean. An important recent advance Information is provided on collection localities, habi- was the publication of an annotated catalogue of the tats and geographic distribution of all species record- Greek spider fauna [Bosmans & Chatzaki, 2005]. This ed. A total of 94 species were collected in Kerkyra, of listed a total of 856 valid species for the country, which 37 had not been previously recorded. 98 species although that figure has been substantially increased by were collected in Lefkada, of which 71 were new records subsequent work. Since then, provisional checklists for the island. Currently, 243 spider species are record- have been published for the islands of Lesbos [Bos- ed from Kerkyra and 117 species from Lefkada. Five mans et al., 2009], Chios [Russell-Smith et al., 2011] species collected were new records for Greece: Agyne- and Crete [Bosmans et al., 2013]. These checklists ta mollis, Tenuiphantes herbicola (Lefkada), Trichon- apart, there has been little published on the spider cus sordidus (Kerkyra), Tmarus stellio (Kerkyra) and faunas of individual regions of Greece.
    [Show full text]
  • SA Spider Checklist
    REVIEW ZOOS' PRINT JOURNAL 22(2): 2551-2597 CHECKLIST OF SPIDERS (ARACHNIDA: ARANEAE) OF SOUTH ASIA INCLUDING THE 2006 UPDATE OF INDIAN SPIDER CHECKLIST Manju Siliwal 1 and Sanjay Molur 2,3 1,2 Wildlife Information & Liaison Development (WILD) Society, 3 Zoo Outreach Organisation (ZOO) 29-1, Bharathi Colony, Peelamedu, Coimbatore, Tamil Nadu 641004, India Email: 1 [email protected]; 3 [email protected] ABSTRACT Thesaurus, (Vol. 1) in 1734 (Smith, 2001). Most of the spiders After one year since publication of the Indian Checklist, this is described during the British period from South Asia were by an attempt to provide a comprehensive checklist of spiders of foreigners based on the specimens deposited in different South Asia with eight countries - Afghanistan, Bangladesh, Bhutan, India, Maldives, Nepal, Pakistan and Sri Lanka. The European Museums. Indian checklist is also updated for 2006. The South Asian While the Indian checklist (Siliwal et al., 2005) is more spider list is also compiled following The World Spider Catalog accurate, the South Asian spider checklist is not critically by Platnick and other peer-reviewed publications since the last scrutinized due to lack of complete literature, but it gives an update. In total, 2299 species of spiders in 67 families have overview of species found in various South Asian countries, been reported from South Asia. There are 39 species included in this regions checklist that are not listed in the World Catalog gives the endemism of species and forms a basis for careful of Spiders. Taxonomic verification is recommended for 51 species. and participatory work by arachnologists in the region.
    [Show full text]
  • Black-Stripe Phenotypes in the Spide R Enoplognatha Ovata (Araneae, Theridiidae)
    Reillo, P. R . and D . H. Wise. 1987 . Black-stripe phenotypes in the spider Enoplognatha ovat a (Araneae, Theridiidae) . J. Arachnol ., 15 :419-423 . BLACK-STRIPE PHENOTYPES IN THE SPIDE R ENOPLOGNATHA OVATA (ARANEAE, THERIDIIDAE) Paul R. Reillo and David H . Wise Department of Biological Science s University of Maryland Baltimore County Campus Catonsville, Maryland 21228 ABSTRAC T In this paper we describe black-stripe phenotypes of the polymorphic theridiid Enoplognatha ovata (Clerck) found among reared broods and natural populations from coastal Maine . Among reare d spiders, black stripes were deposited over the typical color phenotypes lineata, redimita and ovata , and appeared to assort independently of the typical color morphs . Black stripes occurred more frequently among males than females, although the difference in incidence between the sexes was no t statistically significant . Among 17 natural populations, black-stripe morphs were far more frequen t among males than females, suggesting the possibility that black striping is associated with se x determination in E. ovata. INTRODUCTION AND METHOD S The theridiid spider Enoplognatha ovata (Clerck) displays a conspicuous colo r polymorphism characterized by three distinct phenotypes : (1) lineata, with a creamy yellow opisthosoma (Fig . la); (2) redimita, exhibiting two dorsolateral red stripes (Fig. lb); and (3) ovata, characterized by a solid red shield covering mos t of the dorsal opisthosoma (Fig . lc). The genetic basis of color expression i s detailed in a model by Oxford (1983) in which three color alleles (Ct , C`, C°) at a single autosomal locus determine the phenotypes lineata, redimita and ovata. The alleles exhibit a dominance hierarchy whereby ovata (C°) is dominant to redimita (C) which is in turn dominant to lineata (CI).
    [Show full text]
  • THE SPIDER GENERA STEATODA and ENOPLOGNATHA in AMERICA* (ARANEAE, THERIDIIDAE) by Herbert2" W
    THE SPIDER GENERA STEATODA AND ENOPLOGNATHA IN AMERICA* (ARANEAE, THERIDIIDAE) BY HERBErt2" W. Lvr Museum of Comparative Zoology, Harvard University The previous revisions (Levi, 957a, 957b) of the. two genera Enoploynatha and Steatoda considered only the North American species. Since the revisions were published, large South American collections have become available and the types of South American species could be consulted. The majority of species of both genera are found in the north temperate zone and are fairly well known. The additional species described here from the neotropical area are sometimes intermediate between the. two genera. Enoploynatha peruviana may lack the tooth on the posterior margin of the chelicerae as in Steatoda species. The. males of several Steatoda (e.g.S. andina) have the chelicerae enlarged as is characteristic of Enoplognatha. South American E.noplognatha species are found only in southern Peru and northern Chile (Map ). The genus has no representatives in Central America or the West Indies. Steatoda species are found in all parts of South America, with several endemic species, and several that are widespread (S. ancorata, 8. grossa, S. moesta). Unlike Anelosimus species (Levi, in press) Steatoda species cross the desert or mountain barrier into Chile (Map 2). The types of species could be exam/ned through the hospitality and cooperation of Dr. G. Owen Evans and Mr. D. Clark of the British Museum (Natural History) Prof. G. C. Varley of the Hope Depart- ment of Entomology, Oxford; Dr. L. Brundin of the Natural History Museum, Stockholm; Prof. M. Birab4n of the Museo de la Plata; Prof.
    [Show full text]
  • Spider Community Composition and Structure in a Shrub-Steppe Ecosystem: the Effects of Prey Availability and Shrub Architecture
    Utah State University DigitalCommons@USU All Graduate Theses and Dissertations Graduate Studies 5-2012 Spider Community Composition and Structure In A Shrub-Steppe Ecosystem: The Effects of Prey Availability and Shrub Architecture Lori R. Spears Utah State University Follow this and additional works at: https://digitalcommons.usu.edu/etd Part of the Philosophy Commons Recommended Citation Spears, Lori R., "Spider Community Composition and Structure In A Shrub-Steppe Ecosystem: The Effects of Prey Availability and Shrub Architecture" (2012). All Graduate Theses and Dissertations. 1207. https://digitalcommons.usu.edu/etd/1207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@USU. It has been accepted for inclusion in All Graduate Theses and Dissertations by an authorized administrator of DigitalCommons@USU. For more information, please contact [email protected]. SPIDER COMMUNITY COMPOSITION AND STRUCTURE IN A SHRUB-STEPPE ECOSYSTEM: THE EFFECTS OF PREY AVAILABILITY AND SHRUB ARCHITECTURE by Lori R. Spears A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Ecology Approved: ___________________________ ___________________________ James A. MacMahon Edward W. Evans Major Professor Committee Member ___________________________ ___________________________ S.K. Morgan Ernest Ethan P. White Committee Member Committee Member ___________________________ ___________________________ Eugene W. Schupp Mark R. McLellan Committee Member Vice President for Research and Dean of the School of Graduate Studies UTAH STATE UNIVERSITY Logan, Utah 2012 ii Copyright © Lori R. Spears 2012 All Rights Reserved iii ABSTRACT Spider Community Composition and Structure in a Shrub-Steppe Ecosystem: The Effects of Prey Availability and Shrub Architecture by Lori R.
    [Show full text]
  • Spider-Ant Associations: an Updated Review of Myrmecomorphy, Myrmecophily, and Myrmecophagy in Spiders
    Hindawi Publishing Corporation Psyche Volume 2012, Article ID 151989, 23 pages doi:10.1155/2012/151989 Review Article Spider-Ant Associations: An Updated Review of Myrmecomorphy, Myrmecophily, and Myrmecophagy in Spiders Paula E. Cushing Department of Zoology, Denver Museum of Nature & Science, 2001 Colorado Boulevard, Denver, CO 80205, USA Correspondence should be addressed to Paula E. Cushing, [email protected] Received 3 October 2011; Accepted 18 December 2011 Academic Editor: Jean Paul Lachaud Copyright © 2012 Paula E. Cushing. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. This paper provides a summary of the extensive theoretical and empirical work that has been carried out in recent years testing the adaptational significance of various spider-ant associations. Hundreds of species of spiders have evolved close relationships with ants and can be classified as myrmecomorphs, myrmecophiles, or myrmecophages. Myrmecomorphs are Batesian mimics. Their close morphological and behavioral resemblance to ants confers strong survival advantages against visually hunting predators. Some species of spiders have become integrated into the ant society as myrmecophiles or symbionts. These spider myrmecophiles gain protection against their own predators, live in an environment with a stable climate, and are typically surrounded by abundant food resources. The adaptations by which this integration is made possible are poorly known, although it is hypothesized that most spider myrmecophiles are chemical mimics and some are even phoretic on their hosts. The third type of spider-ant association discussed is myrmecophagy—or predatory specialization on ants.
    [Show full text]
  • Mite Parasitism of the Polymorphic'spider, Enoplognatha Ovata (Araneae, Theridiidae , from Coastal Maine
    1989. The Journal of Arachnology 17 :246 MITE PARASITISM OF THE POLYMORPHIC'SPIDER, ENOPLOGNATHA OVATA (ARANEAE, THERIDIIDAE , FROM COASTAL MAINE INTRODUCTION AND METHODS The theridiid spider Enoplognatha ovata (Clerck), is a common inhabitant of weedy vegetation along the northeastern seaboard of North America . Recent research into the ecological genetics of color polymorphism in E. ovata in Maine populations (Reillo and Wise 1988a, b, c) has uncovered considerable parasitism of this species by larval Parasitengona mites. Here I' present parasitism frequencies for color morphs of mature female spiders from 15 natural populations. Thirty-five coastal Maine populations of E . ovata were censused during mid- August from 1986-1987 . Populations were distributed between Boothbay, ME (43°50' N . Lat./69°37'W, . Long.) and Acadia National Park at Mt . Desert Island (44°25' N. Lat ./68°15' W. Long.) (see map in Reillo and Wise [1988b]) . Descriptions of the color phenotypes and life history of E . ovata can be found elsewhere (Seligy 1971 ; Oxford 1976 ; Wise and Reillo 1985), and censusing techniques for estimating morph frequencies are discussed in Oxford (1976, 1985a, b) and Reillo and Wise (1988b). Spiders were examined for mites in the Figures 1-4 .-Scanning electr,,rn micr-Jr i phs of E. ovota host and Parasiten!_*ona mites : l, adult female spider with trombidiid mites JListered wi opisthosoma (32X magnification) ; 2, trombidiid mite with gnathosoma attached to host at left (260X); 3, gnathosoma of erythraeid mite, dorsal view (940X); 4, gnathosoma, ventral view, showing subcapitalum and palps (1500X). 1989 . The Journal of Arachnology 17 :247 field with the naked eye .
    [Show full text]
  • Evolution and Ecology of Spider Coloration
    P1: SKH/ary P2: MBL/vks QC: MBL/agr T1: MBL October 27, 1997 17:44 Annual Reviews AR048-27 Annu. Rev. Entomol. 1998. 43:619–43 Copyright c 1998 by Annual Reviews Inc. All rights reserved EVOLUTION AND ECOLOGY OF SPIDER COLORATION G. S. Oxford Department of Biology, University of York, P.O. Box 373, York YO1 5YW, United Kingdom; e-mail: [email protected] R. G. Gillespie Center for Conservation Research and Training, University of Hawaii, 3050 Maile Way, Gilmore 409, Honolulu, Hawaii 96822; e-mail: [email protected] KEY WORDS: color, crypsis, genetics, guanine, melanism, mimicry, natural selection, pigments, polymorphism, sexual dimorphism ABSTRACT Genetic color variation provides a tangible link between the external phenotype of an organism and its underlying genetic determination and thus furnishes a tractable system with which to explore fundamental evolutionary phenomena. Here we examine the basis of color variation in spiders and its evolutionary and ecological implications. Reversible color changes, resulting from several mechanisms, are surprisingly widespread in the group and must be distinguished from true genetic variation for color to be used as an evolutionary tool. Genetic polymorphism occurs in a large number of families and is frequently sex limited: Sex linkage has not yet been demonstrated, nor have the forces promoting sex limitation been elucidated. It is argued that the production of color is metabolically costly and is principally maintained by the action of sight-hunting predators. Key avenues for future research are suggested. INTRODUCTION Differences in color and pattern among individuals have long been recognized as providing a tractable system with which to address fundamental evolutionary questions (57).
    [Show full text]
  • Annotated Checklist of the Spiders of Turkey
    _____________Mun. Ent. Zool. Vol. 12, No. 2, June 2017__________ 433 ANNOTATED CHECKLIST OF THE SPIDERS OF TURKEY Hakan Demir* and Osman Seyyar* * Niğde University, Faculty of Science and Arts, Department of Biology, TR–51100 Niğde, TURKEY. E-mails: [email protected]; [email protected] [Demir, H. & Seyyar, O. 2017. Annotated checklist of the spiders of Turkey. Munis Entomology & Zoology, 12 (2): 433-469] ABSTRACT: The list provides an annotated checklist of all the spiders from Turkey. A total of 1117 spider species and two subspecies belonging to 52 families have been reported. The list is dominated by members of the families Gnaphosidae (145 species), Salticidae (143 species) and Linyphiidae (128 species) respectively. KEY WORDS: Araneae, Checklist, Turkey, Fauna To date, Turkish researches have been published three checklist of spiders in the country. The first checklist was compiled by Karol (1967) and contains 302 spider species. The second checklist was prepared by Bayram (2002). He revised Karol’s (1967) checklist and reported 520 species from Turkey. Latest checklist of Turkish spiders was published by Topçu et al. (2005) and contains 613 spider records. A lot of work have been done in the last decade about Turkish spiders. So, the checklist of Turkish spiders need to be updated. We updated all checklist and prepare a new checklist using all published the available literatures. This list contains 1117 species of spider species and subspecies belonging to 52 families from Turkey (Table 1). This checklist is compile from literature dealing with the Turkish spider fauna. The aim of this study is to determine an update list of spider in Turkey.
    [Show full text]