Eukaryotic Initiation Factor 2-Associated Glycoprotein P67 Inhibits the Tumorigenicity Of

Home , EIF2B, Gcn2, Initiation factor

Eukaryotic Initiation Factor 2-associated glycoprotein P67 inhibits the tumorigenicity of

Alveolar Rhabdomyosarcoma (ARMS) and involves its differentiation and migration

A dissertation submitted to

Department of Chemistry and Biochemistry

Kent State University in partial

fulfillment of the requirements for the

degree of Doctor of Philosophy

He Liu

August 2019

Dissertation written by

He Liu

B.S., Lanzhou University, 2007

Ph.D., Kent State University, 2019

Approved by

______, Chair, Doctoral Dissertation Committee Bansidhar Datta, Ph.D.

______, Member, Doctoral Dissertation Committee Robert Twieg, Ph.D.

______, Diane Stroup, Ph.D.

______, Wilson Chung, Ph.D.

______, Almut Schroeder, Ph.D.

Accepted by

______, Chair, Department of Chemistry & Biochemistry Soumitra Basu, Ph.D.

______, Dean, College of Arts and Sciences James L. Blank, Ph.D.

TABLE OF CONTENTS

Page

Table of Contents ...... iii

List of Figures ...... v

List of Abbreviations ...... ix

Acknowledgements ...... xi

Chapter I Introduction and Background

1.1 Eukaryotic initiation factor 2-associated glycoprotein P67 ...... 1

1.2 P67 shares extensive sequence identity with eukaryotes and sequence similarity within

prokaryotes ...... 8

1.3 Involvement of P67 and its inhibitors in angiogenesis ...... 10

1.4 Involvement of P67 in cell growth, proliferation, and cell cycle regulation ...... 12

1.5 Involvement of P67 in tumor suppression ...... 16

1.6 Research prospectus ...... 18

Chapter II Inhibition of tumorigenicity of Alveolar Rhabdomyosarcoma (ARMS) by P67 ex vivo and in vivo

2.1 Introduction ...... 20

2.2 Materials and Methods ...... 22

2.3 Results ...... 27

2.3.1 Plasmid construction of EGFP and EGFP-tagged P67 ...... 27

2.3.2 Constitutive expression of P67 changes the morphology of Rh30 cells ...... 28

2.3.3 Expression and activity of MEK1/2 are decreased in Rh30 cells constitutively expressing

P67 ...... 30

iii

2.3.4 Increased levels of interactions within MEK1/2, ERK1/2 and P67 were detected in Rh30

cells constitutively expressing P67 ...... 34

2.3.5 Ex vivo studies: cell growth of Rh30 cells constitutively expressing EGFP and EGFP-

P67 ...... 37

2.3.6 Ex vivo studies: Rh30 cells constitutively expressing EGFP and EGFP-P67 were subject

to serum deprivation ...... 39

2.3.7 Ex vivo studies: anchorage independent growth of Rh30 cells expressing EGFP and

EGFP-P67 ...... 41

2.3.8 Constitutively expression of P67 in Rh30 cells showed significant suppression of tumor

growth in athymic nude mice ...... 43

2.4 Discussion ...... 50

Chapter III Examination of the eukaryotic initiation factor 2-associated glycoprotein P67’s involvement in the differentiation of alveolar rhabdomyosarcoma (Rh30 cell line)

3.1 Introduction ...... 54

3.2 Materials and Methods ...... 56

3.3 Results ...... 57

3.3.1 Summary of both stable cell lines in the presence of DM ...... 57

3.3.2 Summary of both stable cell lines in the presence of DM and insulin ...... 69

3.4 Discussion ...... 81

Chapter IV Investigation of P67’s involvement in migration of ARMS Rh30 cells

4.1 Introduction ...... 86

4.2 Materials and Methods ...... 89

4.3 Results ...... 91

4.4 Discussion ...... 95

Chapter V Conclusions and future work ...... 96

References ...... 104

LIST OF FIGURES

Page

Chapter I Introduction and Background

Figure 1.1 The POEP activity of P67 ...... 3

Figure 1.2 Anatomy of P67 ...... 7

Figure 1.3 P67 orthology ...... 9

Figure 1.4 P67 Chemical structures of fumagillin and TNP-470 and a schematic view of P67’s covalently binding with both anti-angiogenic drug ...... 11

Figure 1.5 ERk1/2 MAP kinase signaling pathway ...... 13

Figure 1.6 A schematic review of association between P67 and ERK1/2 MAP kinases ...... 15

Chapter II Inhibition of tumorigenicity of Alveolar Rhabdomyosarcoma by P67 ex vivo and in vivo

Figure 2.1 A schematic view of plasmids for transfection to Rh30 cells: pEGFP-C3 and pEGFP-

C3-P67 ...... 27

Figure 2.2 Constitutive expression of P67 changes the morphology of Rh30 cells...... 29

Figure 2.3 Expression and activity of MEK1/2 are decreased in Rh30 cells constitutively expressing

P67 ...... 31

Figure 2.4 Increased levels of interactions with MEK1/2, ERK1/2, and P67 were detected in Rh30 cells constitutively expressing P67 ...... 35

Figure 2.5. Rh30 cells constitutively expressing P67 showed reduced growth as compared to control

...... 38

Figure 2.6. Rh30 cells constitutively expressing either EGFP or EGFP-P67 were subject to serum deprivation ...... 40

Figure 2.7. ex vivo studies: anchorage independent growth of Rh30 cells expressing EGFP and

EGFP-P67, followed by statistical studies of the number of foci per 100 mm plate ...... 41-42

Figure 2.8 Constitutive expression of P67 in Rh30 cells showed significant suppression of tumor growth in athymic nude mice...... 45-48

Figure 2.7 Proposed working model for the role of P67 in Rh30 cells ...... 53

Chapter III Examination of the eukaryotic initiation factor 2-associated glycoprotein P67’s involvement in the differentiation of alveolar rhabdomyosarcoma (Rh30 cell line)

Figure 3.1 Morphologies of Rh30 constitutively expressing EGFP and EGFP-P67 treated with DM

...... 58

Figure 3.2 Cyclin D1 expression levels showed no significant change in both stable cell lines in the presence of DM ...... 59

Figure 3.3 CDK4 expression levels showed increased levels for both stable cell lines in the presence of DM ...... 60

Figure 3.4 Activation of Caspase-3 showed no sign of apoptosis for both stable cell lines in the presence of DM ...... 61

Figure 3.5 Myf5 Expression levels increased for both stable cell lines in the presence of DM .... 62

Figure 3.6 MyoD expression levels showed no significant difference for both stable cell lines in the presence of DM ...... 63

Figure 3.7 Myogenin expression levels showed increased levels for both stable cell lines in the presence of DM...... 64

Figure 3.8 The ratio of p-IRS-1/IRS-1 showed no significant difference in both stable cell lines in the presence of DM ...... 65

Figure 3.9 The ratio of p-AKT/AKT showed a significant decrease in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM...... 66

Figure 3.10 The ratio of p-FAK/FAK showed no significant change for both stable cell lines in the presence of DM...... 67

Figure 3.11 The ratio of p-SRC/SRC increased in both stable cell lines in the presence of DM .. 68

Figure 3.12 Morphologies of Rh30 constitutively expressing EGFP and EGFP-P67 in the presence of DM and insulin...... 70

Figure 3.13 Cyclin D1 expression levels showed a significant decrease in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 71

Figure 3.14 CDK4 expression levels showed no significant change in both stable cell lines in the presence of DM and insulin ...... 72

Figure 3.15 Activation of Caspase-3 showed dramatically increased in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 73

Figure 3.16 Myf5 expression levels significantly decreased in Rh30 cells constitutively expressing

EGFP-P67 in the presence of DM and insulin ...... 74

Figure 3.17 MyoD expression levels showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 75

Figure 3.18 Myogenin expression levels were consistent in Rh30 cells constitutively expressing

EGFP-P67 in the presence of DM and insulin ...... 76

Figure 3.19 The ratio of p-IRS-1/IRS-1 showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 77

Figure 3.20 The ratio of p-AKT/AKT showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 78

vii

Figure 3.21 The ratio of p-FAK/FAK showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 79

Figure 3.22 The ratio of p-SRC/SRC showed a marked increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin ...... 80

Chapter IV Involvement of P67 in migration of Rh30 cells

Figure 4.1 Rh30 cells constitutively expressing P67 showed increased cell migration rate by in vitro scratch assay ...... 92

Figure 4.2 Statistical analysis of the number of migrating cells for EGFP-Rh30 and EGFP-P67-

Rh30 cells ...... 93

Figure 4.3 F-actin staining for migrated EGFP-Rh30 and EGFP-P60-Rh30 cells in leading edges of scratch areas by confocal microscopy ...... 94

Chapter V Conclusions and future work

viii

LIST OF ABBREVATIONS

P67 Eukaryotic initiation factor 2 (eIf2)-associated glycoprotein

ERK1/2 extracellular signal-regulated kinases1 and 2 p-ERK1/2 phosphorylated forms of ERK1/2

MEK1/2 Mitogen-activated protein kinase kinase p-MEK1/2 phosphorylated forms of MEK1/2

EGFP Enhanced green fluorescence

EGFP-P67 EGFP tagged P67

EGFP-Rh30 Rh30 cells constitutively expressing EGFP

EGFP-P67-Rh30 Rh30 cells constitutively expressing EGFP-P67

MAP mitogen-activated protein

H&E Hematoxylin and Eosin staining

IP immunoprecipitation

IB immunoblotting

AB antibody

FBS fetal bovine serum

cDNA complementary DNA

ATP Adenosine triphosphate

GTP guanosine triphosphate

GDP guanosine diphosphate

mRNA messenger ribonucleic acid

tRNA transfer ribonucleic acid

IGF-1 Insulin-like growth factor 1

DM differentiation media

TBS Tris-Buffered Saline

TBST Tris-Buffered Saline with Tween 20

ACKNOWLEDGEMENTS

I would like to express my sincere appreciation to those who have helped me through my journey during my graduate study.

First, I would like to thank Dr. Datta deeply for his kind mentorship in my graduate research. I appreciate his support, trust and guidance for me to develop my research projects. Without Dr.

Datta, I am nothing but a confused person in the department. He adopted me during my low time, mentoring me cell-signaling pathways, raising antibodies, xenograft studies, etc. My appreciation of life cannot express enough to thank Dr. Datta for everything he has done for me.

I would like to thank Dr. Stroup, Dr. Chung, Dr. Twieg, and Dr. Schroeder for their valuable time to serve as my committee members. These three professors are amazingly kind. Dr. Stroup is one of the best professors in this department. It was so comfortable to discuss any aspect of life. Dr.

Chung is visionary and advice from him is concise and critical to benefit my near future. Dr. Twieg is the nicest person ever and would like to be in my committee even when I requested it out of blue.

I also want to thank Dr. Schroeder for her kindness to help me during this journey. These stories will run deep in my blood. I will pass on these kindness to the next person, as what I was treated by these outstanding people.

I would like to thank my previous colleague Kaitlin Bocian for her help at the beginning of training in Datta’s lab for molecular biology techniques. I would like to thank Dr. Michael Model for his help towards strength of my microscopic skills.

I would like to thank Erin Michael McLaughlin for her support and kindness she delivered when I needed help.

My special thanks to my family and my in-laws for their unconditional love, support and encouragements. I would like to thank my family for love, support, encourage, patience and inspiration in past years.

I would like to thank Dr. Peter Houghton from University of Texas Health Science Center at San

Antonio for Rh30 cell line as a kind gift. I also appreciate the Chemistry and Biochemistry

Department, Kent State University for financial support for my research.

xii

Chapter I

Introduction and Background

1.1 Eukaryotic initiation factor 2-associated glycoprotein P67

In cells, protein synthesis is the critical step for gene expression and is a process to translate mRNA sequence into amino acids that are building blocks of proteins. Translation of mRNA into amino acids are involved into three steps 1. Initiation, 2. Elongation and 3. Termination. In particular, translation initiation is composed of three steps: 1. The small ribosomal subunit binds to Met- tRNAiMet (the initiator tRNA charged with methionine), 2. This complex then attaches to the cap structure at 5’ end of an mRNA and recognizes the start codon AUG (complementary to methionine charged tRNA’s codon). 3. The large subunit joins the complex at the start codon and all initiation factors are discharged. Proteins as known as initiation factors facilitate each step of translation initiation.

In eukaryotes, at least eleven initiation factors are required and necessary for translation initiation.1

Among these translation factors in eukaryotes, Eukaryotic Initiation Factor 2 (eIF2) is primarily

Met responsible for binding of tRNAi to the 40s small subunit, forming a stable ternary complex with

Met 2 GTP and Met-tRNAi . Upon the start codon recognition, the GTP associated with eIF2 is hydrolyzed to GDP in a reaction that may require other initiation factors. After GTP hydrolysis, all initiation factors are released and the initiation step is considerably complete. In eukaryotes, eIF2 is released from the ribosome as an inactive binary complex with GDP. In order to participate in another round of translation initiation, eIF2.GDP complex must be exchanged to eIF2.GTP by eIF2B that is the guanine nucleotide exchange factor for the eIF2 to be active. eIF2 consists of three subunits α, β, γ, which plays a pivotal role in global protein synthesis initiation. Upon phosphorylation at serine 51 residue of α subunit of eIF2 by its kinases, its phosphorylation reduces general protein synthesis initiation, therefore, global rate of protein synthesis is significantly

decreased. There are four kinases that have been identified phosphorylate the serine 51 site of eIF2α, including the heme regulated inhibitory kinase (HRI), protein kinase RNA-activated (PKR), PKR- like endoplasmic reticulum kinase (PEK) and general control nonderepressible 2 (Gcn2).3 Each of these kinases phosphorylates the eIF2α through mechanism by which each senses different stresses.

HRI is activated by heme deprivation in erythroid cells, heat shock, and osmotic stress, leading to phosphorylation at α subunit of eIF2.4 PKR is stimulated by the double stranded RNA accumulation during the viral infection.5 PEK is turned on, when the accumulation of misfolded protein occurs in the endoplasmic reticulum.6 The protein kinase Gcn2 is present in virtually all eukaryotes, and involved in many ubiquititous and fundamental biological functions. Gcn2 is induced in response to nutritional stress, such as amino acid deprivation by phosphorylating eIF2α at serine 51, leading to the restriction of protein synthesis.7

The serendipitous discovery of P67 was reported by Datta et al. back in 1988. When the isolation and purification of eIF2 was carried out; a protein was always associated with eIF2. After SDS-

PAGE analysis, the molecular weight of this protein was determined 67 kDa. This 67 kDa protein protects α subunit of eIF2 from phosphorylation by its kinases.8 Later, P67 was evidenced containing o-linked N-acetylglucosmine (GlcNAc) residues due to the fact P67 binds specifically to wheat germ agglutinin, indicating P67 is a cellular glycoprotein. The binding of P67 to wheat germ agglutinin leads to complete loss of P67 activity to protection of eIF2α, so it suggests glycosyl moiety is required for P67 to protect the α subunit of eIF2.9 As time went on, there were several articles reported that the increased P67 level in mammalian cells correlates with the increase in the global protein synthesis, due to the protection of eIF2α from phosphorylation or POEP activity.

(Figure 1.1)

γ KINASE γ β β α α P

P67

Active Inactive

P67-DG

Fig 1.1. The POEP activity of P67

In 1993, cloning and characterization of P67 cDNA in rats was reported.10 In this study, the primary structure of rat P67 is determined by cDNA cloning. From the cDNA sequence, an open reading frame that encodes P67 as a 480-amino acid protein with a molecular weight of 53 kDa for the unglycosylated protein. The amino acid sequence of translated protein from rat P67 cDNA showed a highly charged N-terminal region composed of two basic polylysine blocks and an acidic aspartic acid block. This N-terminal region of rat P67 protein shared a significant sequence identity with human eIF2β subunit.10 A year later, a cDNA that encodes a homologue of rat P67 was isolated from a human liver cDNA library. The encoded protein contained 478 amino acids and showed the sequence 92% identity of that of rat P67. The mRNA of human P67 has a size of ~ 2.1kb and is present in all tested human tissues.11 The activity of P67 was modulated by P67-deglycosylase

(P67-DG). Under different physiological conditions in cells, the P67 level differs. At low expression level of P67, P67-DG is activated, leading to deglycosylation of P67 activated, therefore, the phosphorylation of eIF2α increased, resulting in the shut off protein synthesis. Whereas at high level of P67 the activation of P67-DG is prevented, leading to the prevention of the shut off of protein synthesis.12 In the meantime, during viral infection, hemin induces overexpression of P67 as hemin partially prevents appearance of an active P67-DG in baculovirus-infected insect cells.

The results showed hemin prevents the conversion of an inactive P67-DG into an active form and does not have any effect on P67 gene transcription.13

In one study, upon serum starvation in KRC-7 cells (rat hepatoma), it caused the loss of almost completely P67 mRNA, P67 synthesis, and protein synthesis activity. After the addition of mitogen, the same serum-starved cells regained P67 mRNA, P67 protein, and protein synthesis activity.14

By expression of a P67 cDNA, the P67 mRNA is synthesized in serum-starved cells. The appearance of P67 mRNA is accompanied by the appearance of P67 protein. Essentially, the rates of protein synthesis in the serum-starved cells were restored nearly to the level observed in the

complete medium. These results suggest during serum starvation the loss of P67 activity is attributable to the loss of P67 transcription level.14 One study showed expression and activity of

P67 are induced during heat shock. During this study, the presence of the heat shock element was verified at the P67 promoter region and it is required for P67 expression during heat shock of KRC-

7 cells. The activity of P67 correlates with the decrease level of eIF2α phosphorylation by induced glycosylation modification at the later stages of the heat-shock.15 During cloning and characterization of the promoter region of a gene encoding P67, the promoter activity of P67 is enhanced by mitogen activation. In addition, this enhancement requires an AP-1 sequence in the promoter region of P67. Deletion of AP-1 elements significantly reduced the enhancement of mitogen.16

On the other hand, the plant homologue of P67, named PKI, was identified and it was shown to bind with plant double stranded RNA activated protein kinase, PKR. The level of PKI was maximized during seed germination and its level declined rapidly to a non-detectable level soon after leaf emergence. Then at the mid-milk in seed development, the level of PKI is detectable again.17 These transitions were strongly associated with the level of PKI which is in a good correlation with level of eIF2α phosphorylation. These results demonstrate the involvement of PKI, the plant homologue of P67, is crucial for the plant development and the mechanism of action in plants is very similar to that of P67 in mammalian cells.

Essentially, apart from the protection of eIF2α from phosphorylation, P67 is a cellular glycoprotein that has multi-faceted functions. As of now, significant progress has been made to understand the structure-function relationship of P67. For instance, the rat P67 contains 480 amino acids long encoded by ~1.4 kb cDNA fragment. A summary of the functions of the different motifs and domains of P67 is shown in Fig.1.218 This whole sequence can be characterized into two major segments by auto-proteolytic activities: P26 and P52. The p26 segment, N-terminal domain of P67

molecule, consists of three conserved domains namely the lysine residue rich domain I (KI domain) spanning from 36 to 44 amino acid residues, the acidic residue rich domain (D domain) from 77-

91 amino acid residues and the lysine residue rich domain II (KII domain) ranging from 98-107 amino acid residues. The 1-97 amino acid segment is responsible for the enhanced level of PEOP

(protection of eIF2α phosphorylation) activity, when expressed in the mammalian cells. Under mutational studies, one study in our group showed the protection of eIF2 phosphorylation correlates with P67 levels and requires the lysine-rich domain I of P67.19

Followed by one study by our group, the negative regulation of the protection of eIF2α phosphorylation activity is controlled by a unique acidic domain (ARD domain) which is present at the N-terminus of P67.20 Another study showed mutation at the acidic residue–rich domain of

P67 increases PEOP activity during heat shock.21 In particular, one study from our group showed a glycosylation site, 60SGTS63, of P67 is identified and this site is required for its ability to regulate the phosphorylation and activity of eIF2α.22 A fine molecular study of the interaction of P67 with eIF2 showed that P67 binds to C-terminal of the γ subunit of eIF2 by utilizing its KII domain as well as a C-terminal segment of P67 from 340-430 amino acids. (The N-terminal). In fact, the interaction between P67 and eIFγ is stronger than the interaction with α subunit of eIF2. GST pull- down assays showed that the interaction between P67 and eIF2γ is direct. The interaction between

P67 and eIF2γ enables P67 to protect the phosphorylation of the eIF2α subunit by its kinase and modulates the phosphorylation of eIF2α. The five conserved amino acid residues of P67 (shown in

Fig 1.2.) are involved in the regulation of eIF2α phosphorylation during heat shock.21

It is shown that overexpression of P67 in the mammalian cells leads to a decrease in the activation of ERK1/2. The amino acids spanning from 211-430 bind to ERK1/2, as shown in the Fig 1.2. We also reported the treatment of cells with the angiogenesis inhibitor fumagillin results in increased stability of P67 and reduced phosphorylation of Extracellular signal regulated kinases.23 The

fumagillin binding site is H231. ARD segment plays a role in negative regulation POEP activity.20

(As shown in Fig 1.2)

Fig 1.2.18 Anatomy of P67. Rat P67 is 480 amino acid residues long. This sequence can be divided into two major segments-P26 (the N-terminal 1-107 amino acid residues) and P52 (the down stream 108-480 amino acid residues). Within P26 segment, there are several unique domains:

(i) the lysine residue-rich, K1 domain; (ii) O-GlcNAcylation site, O-GS; (iii) the acidic residue- rich, ARD domain and (iv) the lysine residue-rich, K2 domain. At the P52 segment, the H231 residue is the binding site for fumagillin; the 310-430 region binds to eIF2γ (GBR); the 211-430 binds to ERK1/2 MAP kinases; and five amino acid residues, D251, D262, H331 E364, and E459

(the numbering system is for mammalian P67) are highly conserved from lower to higher organisms.

The “pita bread fold” brings these amino acid residues in close proximity to form a putative catalytic pocket for P67’s auto-proteolytic activity. POEP; Protection of eIF2α phosphorylation.

1.2 P67 shares extensive sequence identity with eukaryotes and sequence similarity within prokaryotes

The sequence homology of P67 across different species is shown below in Fig 1.3. Based on genomic sequence database searches, the results show P67 from mouse, rat and human has 478 or

480 amino acid residues. In comparison, notable differences of amino acid residues between human and rat P67 come from variation at their N-terminal. The N-terminal amino acid sequence of mouse

P67 also shows very similar variations, compared with rat and human. Altogether, in comparison to amino acid sequence identity from rats, mouse and human P67 gave rise to ~92 identity. These variations at the N-terminal sequences within these mammals could be attributable to species- specific variations. Moreover, there is a ~99.5% amino acid sequence identity within 108-478 segment from the above mammal species. Therefore, natural selection must keep this segment highly conserved during evolution. In addition to the above mammals mentioned, P67 orthology may also be better known as methionine aminopeptidase (MetAP) in prokaryotes the cellular function of which is to remove initiator methionine from nascent peptides when these peptides are

~15-20 amino acid long. These P67 orthologues have been cloned from various non-mammalian organisms which showed different degrees of amino acid sequence identity, such as Drosophila

(66% identity), plants (60% identity), and saccharomyces cerevisiae (55% identity), E. coli (40% similarity), plasmodium falciparum (40% similarity) (Fig 1.3.) The most significant shared features in P67/MetAP2 sequence within these mentioned species is the presence of a consensus

D(X)mD(X)nH(X)oE(X)pE(X)q motif, where m, n, o, p, and q are variable number of amino acids in different organisms. These five amino acid residues shown in bold are highly conserved (Fig

1.3.)18 Regardless of different names, this molecule has evolved from prokaryotes to eukaryotes, along with an addition of unique domains at its N-terminus.

Fig 1.3.18 P67 orthology. Rat P67 shares extensive amino acid sequence identity within mammal. This sequence identity is also quite significant in insects, plants, and yeast. Prokaryotic organisms such as E. coli and P. falciparum encode a protein that shows a good amino acid sequence similarity.

1.3 Involvement of P67 and its inhibitors in angiogenesis

Angiogenesis is the process of forming new blood vessels from existing ones by splitting or sprouting. The meaning of angiogenesis under physiological condition is but not limited to regulate such as the female reproductive cycle and wound healing process.24 Whereas, under pathological conditions, such as cancer, angiogenesis plays an important role in the progression of cancer, tumor growth, metastasis. Angiogenesis is required for tumor tissues to acquire nutrients and oxygen.

Without angiogenesis for vascular support, tumors may ultimately become necrotic or apoptotic.24

There are several angiogenesis inhibitors reported mainly divided into two categories: protein angiogenesis inhibitors and small molecule inhibitors of angiogenesis. Among the latter one, fumagillin, originally isolated from the fungus Aspergillus fumigatus Fresenius, is classified as one of the most potent small molecule angiogenesis inhibitors. Biochemical studies showed fumagillin or its synthetic analog TNP 470 (Fig 1.4) binds to its potent and selective cellular target

P67/MetAP2, resulting in endothelial cell cycle arrest in the G1 phase of cell cycle. By virtue of that, angiogenesis is inhibited.25 Structure of human P67 with fumagillin was reported in 1998. In addition, X-ray crystallographic studies showed a covalent bond formed between active epoxide of fumagillin and histidine 231 in the active site of P67 or called MetAP2 by facilitation from other conserved amino acids.26

Fig 1.4.25 Chemical structures of fumagillin and TNP-470 and a schematic view of P67’s covalent binding with anti-angiogenic drug or TNP-470. The full-length P67 showing its N- terminal P26 segment wraps around its P52 segment that forms the shallow groove juxtaposing the

H231 catalytic residue with the cleavage site at R-107, which is located at the end of KI domain.

Either lysine-residues or the arginine residues are coordinating with the conserved D251, D262,

E364, and E459 residues via positive and negative charges. An arrow shows the N-C bond formation between H231 and the sterically constrained epoxy group of either fumagillin or TNP-

470.

1.4 Involvement of P67 in cell growth, proliferation, cell cycle regulation

A protein kinase is an enzyme that functions to modify other substrates, mostly proteins, by chemically transferring phosphate groups from ATP to them producing phosphorylated proteins.

Phosphorylation leads to a functional change of the target protein by altering enzymatic activity, cellular location, and original interaction with other proteins. These kinases are mostly involved in cell signaling pathways. The Ras Raf MEK1/2 ERK1/2 pathway, as known as ERK1/2

MAP kinase pathway, is one of a series of cellular pathways in mammalian cells that play a pivotal role in cell growth, proliferation, differentiation, and cell death. (shown in Fig 1.5) In this particular cascade, upon tyrosine kinase receptors binding with growth factors or ligands such as EGF

(Epidermal growth factor), PDGF (platelet derived growth factor), receptors are dimerized, intracellular domains of which are activated through transphosphorylation. This recruits Grb2, an adapter protein, which interacts with a GDP/GTP (guanidine diphosphate/guanidine triphosphate) exchange protein called SOS (son-of-sevenless). SOS in turn replaces the GDP from Ras-GDP with

GTP, resulting in the GTP-bound form of Ras. Ras-GTP activates Raf kinase by relocalization and phosphorylation of Raf within the cytoplasm. Raf, a serine/threonine kinase, then phosphorylates the downstream effector, MEK1/2 which is the upstream activator of ERK1/2. The phosphorylated form of ERK1/2 translocate into the nucleus to induce the expression of several oncogenes, whose protein products regulate cyclins/cyclin-dependent kinases (Cdks) in the different phases, and early genes including not limited to c-Myc, ELK-1.25

Fig 1.5 ERK1/2 MAP Kinase signaling pathway. The overall schematic view of this particular pathway is illustrated here. Upon stimulation, signal transduction passes along to Grb2, SOS, and then Ras-GDP, which is later converted, into Ras-GTP. This leads to the phosphorylation of Raf, resulting in the phosphorylation of MEK1/2, which is the upstream effector of ERK1/2. Once

ERK1/2 is phosphorylated, it migrates into the nucleus, regulating the expression of the downstream effectors depicted at bottom of this illustration.

The ERK1/2 binds almost at the same region where γ-subunit of eIF2 binds, at the 211-480 amino acid segment of P67 (shown in Fig 1.2.) This binding covers the whole-substrate-binding pocket region along with the catalytic histidine-231 residue, allowing the N-terminal sequences (P26 segment) to wrap around of ERK1/2 to inhibit their T183/202EY185/204 phosphorylation sites. (Fig 1.6)

By virtue of that, the activation and activity of ERK1/2 is inhibited. If under fumagillin treatments, which prevents the auto-proteolysis of P67, leading to P26 segment actively blocking the phosphorylation sites of ERK1/2 kinases.

The N-terminal P26 segment once generated by auto-proteolysis activity of P67 localizes almost everywhere in the cell, as opposed to the fact P67 whole segment is restricted to cellular cytoplasm.

Amino acid mutational studies showed KI and KII domains either alone or together are capable of suppression of the phosphorylation of several kinases including but not limited to eIF2α-specific kinases, cell cycle-specific kinases.25

Fig 1.625 A schematic review of association between P67 and ERK1/2 MAP kinases. The binding region of ERK1/2 MAP kinases is located in the shallow groove of P52 segment of P67.

The ERK1/2 MAP kinases’ high affinity for this site displace the P26 segment of the molecule that wraps around the phosphorylation sites of these kinases to inhibit its activation by MEK1/2 kinases.

Fumagillin binds to H231 residue irreversibly and this inhibits its auto-proteolysis shown by ‘X’.

1.5 Involvement of P67 in tumor suppression

Unique interactions of P67 and ERK1/2 MAP kinases not only are involved in growth promoting signals to specific gene expressions and cell cycle regulations, but also suppress tumor growth both in ex vivo and in vivo experiments.27

Ras proteins are one of potent components in ERK1/2 MAP kinase pathways, which are frequently mutated in human cancers.28 These proteins function as molecular switches between Ras-GDP and

Ras-GDP states regulating cell-signaling pathways to promote cell growth, proliferation, in response to mitogens. Ras-GDP is an inactive state regulated by guanine nucleotide exchange factors (GEFs) to stimulate the formation of the active state Ras-GTP. Whereas, Ras GTP bound state is regulated by the GTPase activating proteins (GAPs) which hydrolyze the bound GTP to

GDP, resulting in the inactive Ras state. There are three isoforms of Ras proteins with 188 or 189 amino acids encoded by three ubiquitously expressed genes responsible for, namely, H-Ras, N-Ras,

K-Ras. Among them, K-Ras is the most frequently mutated isoform in most cancers with an extreme example of pancreatic cancer where 90% of tumors harbored K-Ras mutations. 80% of K- ras mutations harbor at condon 12 (K-ras V12) where very few mutations occur at condon 61.29

Once mutations occur to Ras proteins in tumors, they become insensitive to the regulation by

GTPase activating protein (GAPs) which stimulate the hydrolysis of Ras-GTP to Ras-GDP. As such, Ras proteins remain in the active state even in the absence of ligands or extracellular stimuli, leading to hyperactive downstream effectors in ERK1/2 MAP kinase pathways, ultimately resulting in hyper-proliferative developmental disorders such as neoplasia, or cancer.

In our previous study, K-RasV12 was expressed constitutively in mouse NIT3T3 fibroblasts to transform cells. These transformed cells are capable of forming in situ-tumor in cell plates. They were subsequently transfected with a plasmid expressing the exogenous P67 cDNA to evaluate the role of P67 in suppression of tumorigenic phenotype in ex vivo cell culture and in vivo athymic

nude mice.27 To test that, both transfected and non-transfected K-RasV12 cells were transplanted into both sides of the dorsal linings of the athymic nude mice. After thirteen days, mice were sacrificed and tumors were harvested from the mice, weighted, and then analyzed for new blood vessel formation by hematoxylin and eosin (H&E) staining. Experimental results showed the fact that overexpression of P67 in transformed cells can suppress the tumor by inhibiting angiogenesis due to its involvement in ERK1/2 MAP kinase pathway.27

1.6 Research prospectus.

Rhabdomyosarcoma (RMS) is a soft tissue tumor that arises from connective tissue predominantly among children and adolescents.30,31 RMS may occur anywhere in the body with two main subtypes:

Embryonal RMS (ERMS) and Alveolar RMS (ARMS), which are originally distinguished by different pathological morphologies by light microscope. ARMS is a high-grade malignant neoplasm and often time associated with a worse outcome than in patients with ERMS due to chromosomal translocation.32 Even though various approaches were developed, the five-year survival rate is still less than 50%. Rh30 cell line is widely appreciated to represent ARMS, because it renders significant characteristics of ARMS.32

In human cancers, such as ARMS, K-Ras is the frequently mutated isoform, leading to aberrant activation of ERK1/2 MAP Kinase pathway.29 Additionally, overexpression of P67 in cells by gene transfer, which is equivalent of fumagillin treatment, can increase its protein level in cell, resulting in the increased binding affinity to ERK1/2, whereas the binding affinity of P67 to eIF2 remains unchanged.33 Particularly, P67 can suppress tumor growth in K-Ras transformed NIH3T3 fibroblast cells in ex vivo and in vivo.27 We propose that P67 can play an important role in ERK1/2 MAP

Kinase pathway to mediate Rh30 cell proliferation and tumor formation. We hypothesize P67 can function as a tumor suppressor which inhibits the tumorigenicity of Rh30 cells ex vivo and in vivo.

In addition, P67 is involved in the differentiation of C2C12 myoblasts into multinucleated myotubes.34 Moreover, P67 is required for stable expression of focal adhesion kinase (FAK)35, a direct substrate of insulin and insulin like receptor tyrosine kinase receptor,36 as well involves differentiation of C2C12 cells into myotubes.37 In Rh30 cells, there is a strong association with dysregulation of insulin-like growth factor receptor, due to chromosomal translocation.38 Insulin- involved signaling pathway is implicated for myogenic differentiation of Rh30 cells.39 Therefore, insulin plays a pivotal role in the regulation of Rh30 cell differentiation. Given that, we propose

P67 and insulin may contribute to differentiation of incomplete differentiated Rh30 cells. We hypothesize the combinatory treatment of overexpression of P67 and insulin will induce the differentiation of Rh30 cells. This will be tested by detecting differentiation biomarkers, such as

Myf-5, MyoD, Myogenin, and prosecuting insulin-involved signaling pathway through biochemical analysis.

Cell migration is a hallmark of complex biological processes during cell differentiation.40 P67 is involved in the regulation of Rho GTPase family, which are responsible for protrusive structures during migration.34,41–43 Based on these findings, we propose P67 is working through these GTPases to mediate its effect over protrusive structures during Rh30 cell migration. We hypothesize that overexpression of P67 can increase the migratory capacity of Rh30 cells through upregulation of specific small GTPases. This hypothesis will be tested by detecting in vitro scratch assay, F-actin staining, biochemical mechanism of Rh30 cells via P67 gene transfer.

To address these questions, we propose the following aims:

Aim 1: Examining whether P67 can suppress tumor growth of ARM in cell culture and nude mice.

Aim 2: Investigating induction of differentiation of Rh30 cells constitutively expressing P67 in the presence of DM and insulin.

Aim 3: Finding the involvement of P67 during Rh30 cell migration through Rho GTPase family and protrusive structures.

Taken together, our general goal is to evaluate whether P67 gene transfer can inhibit tumor formation ex vivo and in vivo, promote differentiation and migration of ARMS. If P67 gene therapy is indeed effective in treatment of this deadly disease, it may be applicable to other subtypes of

RMS, even other human cancers.

Chapter II

Inhibition of tumorigenicity of Alveolar Rhabdomyosarcoma (ARMS) by P67 ex vivo and in

vivo

2.1 Introduction

Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma among children and adolescents. It constitutes 3% of childhood tumors accounting for 50% of pediatric soft tissue sarcomas.30,31 RMS derives from the rhabdomyoblast by acquisition of genetic alteration, rendering an incomplete differentiation in skeletal muscle tissue.44 There are two low incidence of RMS that are pleomorphoric/anaplastic mixed and spindle cell subtypes, each of which constitutes less than

2% of children with RMS.31 Notably, there are two main histological subtypes: Embryonal RMS

(ERMS) and Alveolar (ARMS). Unlike embryonal subtype, which is the most common RMS, responsible for more than 72% of all rhabdomyosarcoma cases, ARMS is more aggressive and malignant, often times involved with a higher frequency of metastasis. Rh30 cell line is widely appreciated to represent ARMS, because it harbors TP53 mutation, amplifications of CDK4, and translocation (2; 13) leading to a gene fusion positive: PAX3-FOXO1 (paired box 3-forkhead box

O1).45

Several attempts have been made to suppress ARMS. There are several therapeutic approaches targeting PAX3-FOXO1 and its regulatory and transcriptional pathways,46 including direct inhibiting of PAX3-FOXO1 by small molecules,46 inhibition of PAX3-FOXO1 regulatory networks (targeting phosphorylation of PAX3-FOXO1,47–49 transcriptional co-Activators of PAX3-

FOXO1,50,51 the acetylation of PAX3-FOXO1,52–56 and targeting downstream effector of PAX3-

FOXO1.43–46 Apart from those approaches, there has been immunotherapy applications to target

PAX3-FOX1 and downstream pathways, in particular, targeting PAX3-FOXO1 by immunotherapy,57–60 targeting cell surface targets of PAX3-FOXO1 by monoclonal antibodies,61–

63 as well as targeting cell surface targets of PAX3-FOXO1 by CAR T-Cells.64–68 Most recently, adenoviral-expressed IL24, repressed by PAX3-FOXO1 in ARMS, has been directly injected into the ARMS tumors in athymic nude mice, resulting in decreased tumor growth and weight. These findings successfully lead to the phase I in clinical trials, as an alternative for treating ARMS patients suffering cytotoxic drug therapies.69

Moreover, sphingosine, an 18 carbon amino alcohol inhibits the growth of Rh30 cells and leads to cell death in a dose-dependent manner by inducing apoptosis without affecting the cell cycle.

Sphingosine itself exhibits anti-proliferation and apoptosis through MYCN down-regulation regardless of TP53 mutation status in ARMS Rh30 cell line.45 Last but not the least, a combined effort to an herb (Berberis orthobotrys) exerts a reduced ARMS Rh30 cell migration and proliferation, as well as the initiation of apoptosis.70

In this study, we constitutively expressed P67 gene in Rh30 cells and examined their tumorigenic potential. Eukaryotic initiation factor 2 (eIF2) associated glycoprotein, P67 has multifaceted activities.25,71 It regulates the phosphorylation of the smallest -subunit of eIF2 (eIF2) and thus, modulates protein synthesis initiation.18,25,72 P67 has auto-proteolytic activity that generates various fragments including the N-terminal p26 fragment, which binds to and blocks eIF2 phosphorylation from eIF2-specific kinases.73 Among these activities, its tumor suppression activity has been demonstrated ex vivo and in vivo in nude mice fairly recently.27 We propose this suppression activity of P67 can be translated to ARMS. We hypothesize P67 can suppress tumor growth of ARMS in cell culture and nude mice.

2.2 Materials and Methods

Chemicals and Reagents: M-MLV Reverse Transcriptase was purchased from Thermo Scientific

(Asheville, NC), Phusion High-Fidelity DNA Polymerase (Rockford, IL), DNA Loading dyes , and

DNA molecular markers were purchased from Thermo Fisher Scientific (Hanover Park, IL ).

Primers were purchased from IDT (Integrated DNA technology, Coralville, IA). The transfection reagent (TransIT®-2020) used to generate stable Rh30 cell lines was obtained from Mirus

(Madison, WI). G418 was purchased from ThermoFisher scientific (Asheville, NC). Protein A- agarose and HEPES solution were purchased from Fisher Scientific Co. (Hanover Park, IL).

Tris•HCl, NaCl, NP-40, sodium dodecyl sulfate (SDS), sodium deoxycholate, Sodium orthovanadate, protease inhibitors, Acrylamide, Ammonium persulfate, TEMED, Tris-base, glycine, Protein loading dyes, and Nitrocellulose membrane were purchased from Sigma-Aldrich

(St. Louis, MO). Pierce™ ECL Western Blotting Substrate was purchased from ThermoFisher scientific. X-ray films for Western Blot were purchased from DENVILLE Scientific (Holliston,

MA).

Antibodies: Mouse polyclonal antibodies against P67 were generated following the procedures as described (..). Mouse monoclonal antibodies specific for GFP (sc-9996), C-MYC (sc-40), K-Ras

(sc-30), Raf-1 (sc-7267), P-Raf-1 (sc-271929), ERK1/2 (sc-514302), P-ERK1/2 (sc-136521),

Cyclin D1 (sc-8396), CDK4 (sc-23896), Cyclin E (sc-247), and Cdk2 (sc-6248), ERK1/2 Antibody

(sc-514302), and MEK-2 Antibody (sc-13159) were purchased from Santa Cruz Biotechnology

(Dallas, TX). Rabbit polyclonal antibodies specific for MEK1/2 (sc-436), ERK2 (sc-154), MEK1/2

(sc-436) and goat polyclonal antibodies specific for P-MEK1/2 (sc-7995) were also purchased from

Santa Cruz Biotechnology (Dallas, TX). Goat anti-Mouse IgG (H+L)-HRP conjugate (cat# 31430) was purchased from Thermos Fisher Scientific (Asheville, NC), Goat Anti-Rabbit IgG (H + L)-

HRP Conjugate (cat# 1706515) was purchased from BIO-RAD (Hercules, CA), and Bovine anti- goat IgG-HRP (sc-2350) was purchased from Santa Cruz Biotechnology (Dallas, TX). SDS-

Loading dye and PageRuler™ Prestained Protein Ladder were purchased from Thermo Fisher

Scientific (Asheville, NC).

Plasmid Construction: Descriptions of plasmids expressing enhanced green fluorescence protein

(EGFP) and its in-frame fusion of P67 (EGFP-P67) were reported.19,23,27,33,74,75

Cell Culture: Rh30 cells were a kind gift from Dr. Peter Houghton from University of Texas Health

Science Center at San Antonio. Rh30 cells were skeletal muscle fibroblasts origin and generated from a child with rhabdomyosarcoma. Rh30 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 100 units/mL penicillin/streptomycin (GIBCO/Life Technologies) and 10% Heat-inactivated bovine serum (GIBCO/Life Technologies). Cells were then kept in a

37 °C incubator with 98% humidity and 7% CO2.

Transfection of Rh30 cells and Generation of the stable cell line: 80% confluent Rh30 cells were transfected with pEGFP vector and plasmid containing EGFP-P67 using the transfection reagent following TransIT®-2020 reagent protocol from Mirus (Madison, WI). After 48 hr., transfected cells were trypsinized, split into multiple 100 mm culture dishes, and maintained in growth media containing 500 µg/ml of G418 for 14 days. Well grown colonies were pooled together and maintained in the presence of G418. Morphologies of Rh30 cells expressing EGFP and EGFP-P67 were examined by 10X magnification of Olympus Inverted Microscope 81X.

Analysis of the growth rate: Stable Rh30 cells expressing EGFP and EGFP-P67 were seeded at a density of 1x105 cells in 60 mm culture dishes containing growth medium and placed in a 370C incubator with 98% humidity and 7% CO2. The number of cells were counted in a hemocytometer everyday up to 5 days from the day of seeding. These experiments were carried out in triplicate for each time interval.

Analysis of the growth rate at low serum: Stable Rh30 cells expressing EGFP and EGFP-P67 were seeded at a density of 1x105 cells in 60 mm culture dishes and allowed cells to attach for 5 hr. in growth medium supplemented with 10% fetal bovine serum. The media on the dishes were then changed to growth medium supplemented with 1% fetal bovine serum. The number of cells were counted in a hemocytometer every 2 days up to 6 days. These experiments were performed in triplicate for each time interval.

Focus formation assay: Rh30 cells expressing EGFP and EGFP-P67 were seeded at a density of

1x105 cells per 60 mm culture dishes in complete growth medium and kept in a 370C incubator with 98% humidity and 7% CO2 . For every 3 days, media were changed. After 10 days, cells were fixed in a phosphate-buffered saline (PBS) solution containing 0.4% glutaraldehyde and 0.8% formaldehyde for 15 min in the refrigerator and stained with 1 ml of 0.4% crystal violet for 20 min at room temperature. The number of foci were counted. These experiments were carried out in ten times at ten sets.

Cell lysate preparation and Western Blot analysis: Stable Rh30 cells expressing EGFP Rh30 and

EGFP-P67 were grown to 95% confluency, harvested, washed with phosphate buffered saline, and lyzed in RIPA buffer (25 mM Tris•HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulfate (SDS), and 1% sodium deoxycholate). Protein concentrations were determined by spectrophotometers using BSA solution as a control followed by Immunoblotting analysis. 100 microgram of total proteins from whole cell lysates were mixed with SDS loading dye, boiled for

10 minutes. And analyzed by 15% SDS-PAGE. Subsequently, proteins from the gels were transferred to Nitrocellulose membrane using Bio-rad electroblotting apparatus following manufacturer’s instructions. Nitrocellulose membranes were then blocked by 10% nonfat milk in

TTBS (Tris-buffered saline with 0.5% Tween 20, pH 7.5) for 2 hr. with constant shaking. All primary antibodies (1:1000) were added in blocking solution containing 5% non-fat dry milk in

TTBS and incubated for 2 hr. with constant shaking at room temperature. Membranes were then washed three times with TTBS - 15 min each. Washed membranes were then incubated with horse- radish peroxidase (HRP) conjugated secondary antibodies (1:2000) at room temperature for 1 hour. with constant shaking. Subsequently, membranes were washed two times for 5 min each with TBST and the last wash was with TBS for 5 min. Protein bands were detected by Pierce™ ECL Western

Blotting Substrate using X-ray films.

Quantification of Protein Bands from Immunoblottings: Protein bands from western blots were scanned by EPSON PERFECTION 1250, and relative intensities were quantified using ImageJ software 1.48V.

Co-immunoprecipitation Assays: For immunoprecipitation assays, 5 µg of antibodies were conjugated to protein A-agarose. After incubation, unbound antibodies were removed, and cell lysates containing 500 µg of proteins from both Rh30 stable cell lines were added to antibody- bound protein A-agarose beads and the mixtures were incubated overnight by gently rotating. The unbound proteins were removed and washed with HEPES buffer (5% v/v 1M Solution, pH 7.3).

Bead-bound proteins were resuspended with the gel running buffer and gel loading dye. The mixtures then were boiled and microcentrifuged quickly. The clear supernatants were aspirated and loaded on 15% SDS-PAGE followed by protein transfer to nitrocellulose membrane for immunoblot analyses.

Xenograft studies in nude mice: Ten homozygous female nude mice from the Jackson Laboratory

(stock number 007850) were housed and maintained in Nude mice facility at Northeast Ohio

Medical University. Rh30 cells constitutively expressing EGFP and EGFP-P67 were cultured in complete growth medium containing G418 in 100 mm culture dishes. When plates reached ~70-

80% confluence, cells were collected by trypsinization, resuspended in 1 mL PBS, and counted.

3x104 cells from both lines were injected into dorsal flanks of mice (four mice for cells expressing

EGFP and four mice for cells expressing EGPF-P67) using a 22G11/2 needle. Two mice were used for injection of 1xPBS. After 45 days of injection, mice were sacrificed and tumors were collected for measurement of size and weight.

Hematoxylin and Eosin (H&E) Staining: A small number of tumors from mice originally injected by Rh30 expressing EGFP and EGFP-P67 was prefixed by 4% paraformaldehyde in 1XPBS, transferred to 70% ethanol, subject to a tissue processor, and embedded in paraffin wax. Slices were prepared by microtome and stained by Hematoxylin and eosin followed by examination under inverted microscope.

2.3 Results

2.3.1 Plasmid constructions of (Enhanced green fluorescent protein) EGFP and EGFP-tagged

P67 (EGFP-P67)

The P67 cDNA was isolated from M13mp18, followed by digestion with XmaI. DNA inserts were ligated at XmaI site of pEGFP-C3 Vector. Plasmids with sense orientation were selected for further analysis. The specific fusion junction between cDNA of P67 and EGFP was verified by DNA sequencing.19

Fig 2.1: A schematic view of plasmids for transfection to Rh30 cells: pEGFP-C3 and pEGFP-

C3-P67.

2.3.2 Constitutive expression of P67 changes the morphology of Rh30 cells

Rh30 cells were transfected with EGFP and EGFP-P67 plasmids, by virtue of transfection reagents, when the confluence of these cells reached ~80% overnight culture. After transfection 48 h later, cells were trypsinized, and split into cell culture dishes, and subsequently subject to G418 selection.

After selection of 14 days, colonized cells were pooled together, and examined under a microscope, as well as Western Blot analysis.

Fig 2.2: Constitutive expression of P67 changes the morphology of Rh30 cells.

Morphologies of the stable Rh30 cell lines expressing EGFP (A) and its in-frame fusion EGFP-P67

(B) were examined under a microscope. Cell extracts from these lines were prepared and analyzed by western blots using antibodies against GFP (C) and P67 (D). As controls, levels of β-actin were measured in both cell lines. Both endogenous and EGFP fusion of P67 are marked (D). Scale bar is 100 µm.

2.3.3 Expression and activity of MEK1/2 are decreased in Rh30 cells constitutively expressing

P67

Cell lysates were generated from both cell lines and interrogated by Western Blot analysis with antibodies against K-Ras, Raf-1, MEK1/2, P-MEK1/2, ERK2, P-ERK1/2, C-MYC, Elk-1, Cyclin

D1, CDK4, Cyclin E, and Cdk2, along with β-actin detection as controls. These are pivotal components of ERK1/2 MAP Kinase pathway, transcription factors, and cell cycle regulatory complexes for G1 phase. In ERK1/2 MAP kinase pathway, K-Ras and Raf-1 were almost consistent with both stable cell lines. Whereas, the expression level and activity of MEK1/2 was significantly decreased. In addition to that, phospho-ERK1/2 in Rh30 constitutively expressing P67 was diminished compared to Rh30 carrying EGFP only. The expression level of C-MYC, Elk-1 was significantly different. Essentially, the expression levels of C-MYC and Elk-1 were alleviated in

Rh30 with EGFP-P67. In cell cycle, CDK4 and Cdk2 levels mostly remain constant in both stable cell lines, however, Cyclin D1 and Cyclin E expression levels were attenuated in Rh30 cells expressing EGFP-P67.

Fig 2.3: Expression and activity of MEK1/2 are decreased in Rh30 cells constitutive expressing P67.

Cell extracts from stable Rh30-EGFP and Rh30-EGFP-P67 cell lines were analyzed on Western blots for the levels of K-Ras (A), Raf-1 (B), P-MEK1/2 (C, upper panel), MEK1/2 (C, lower panel),

P-ERK1/2 (D, upper panel), ERK2 (D, lower panel), c-Myc), Elk1 (F), cyclin D1 (G, upper panel),

CDK4 (G, lower panel), cyclin E (H, upper panel), and cdk2 (H, lower panel) using specific antibodies to these proteins and phospho-proteins. As controls, levels of -actin were also measured on Western blots using its mono-specific antibody. Proteins bands in different panels were quantified and relative ratios as compared to -actin were given under individual protein bands. An unknown protein marked as X was identified with MEK1/2 antibodies (C, lower panel) and c-Myc antibodies (E).

2.3.4 Increased levels of interaction within MEK1/2, ERK1/2 and P67 were detected in Rh30 cells constitutively expressing P67

Cell lysates from both stable cell lines are subject to Co-immunoprecipitation studies, in order to test the interactions between P67, MEK1/2, and ERK1/2, since the expression level and activities were decreased from previous figure. The immunoprecipitates pulled down by P67, MEK1/2,

ERK1/2 antibodies were immunoblotted by these three antibodies. Rh30 cells constitutively expressing P67 showed increased levels of interaction within these three proteins, compared to

Rh30 cells expressing EGFP only, shown in these panels A, B, and C.

Fig 2.4: Increased levels of interactions within MEK1/2, ERK1/2, and P67 were detected in

Rh30 cells constitutively expressing P67.

Cell extracts from both Rh30 cell lines constitutively expressing EGFP and EGFP-P67 were used for immunoprecipitations with P67 antibodies (A), MEK1/2 antibodies (B), and ERK1/2 antibodies

(C). Immunoprecipitates from P67 antibodies were then analyzed by immunoblotting for P67 (A, upper panel), MEK1/2 (A, middle panel), and ERK1/2 (A, lower panel); Immunoprecipitates from

MEK1/2 antibodies were analyzed by immunoblotting for P67 (B, upper panel), MEK1/2 (B, middle panel), and ERK2 (B, lower panel); and Immunoprecipitates from ERK1/2 antibodies were analyzed by immunoblotting for P67 (C, upper panel), MEK1/2 (C, middle panel), and ERK2 (C, lower panel).

2.3.5 Ex vivo studies: cell growth of Rh30 constitutively expressing EGFP and EGFP-P67

In order to investigate the cell growth of both Rh30 stable cell lines after transfection, Rh30 cells expressing EGFP and EGFP-P67 were grown in growth media over a course of 5 days. The red columns represent Rh30 expressing EGFP, whereas the grey columns indicates Rh30 cells constitutively expressing EGFP-P67. The results showed the growth of Rh30 cells transfected with plasmids containing P67 was significantly suppressed.

2.3.6 Ex vivo studies: Rh30 cells constitutively expressing either EGFP or EGFP-P67 were subject to serum deprivation.

Most normal cells require serum for their growth; however, malignant cells can grow without serum due to abnormal self-promoting alterations in genes.76 To test whether the serum deprivation would affect the cell growth of both Rh30 stable cell lines after transfection, Rh30 cells expressing EGFP and EGFP-P67 were grown in growth media lacking of nutrients over a course of 6 days. The red columns represent Rh30 expressing EGFP, whereas the grey columns indicates Rh30 cells constitutively expressing P67. The results showed the growth of Rh30 cells constitutively expressing P67 was inhibited, compared to Rh30 cells expressing EGFP only which grew without restriction from low serum media.

2.3.7 ex vivo studies: anchorage independent growth of Rh30 cells expressing EGFP and

EGFP-P67, followed by statistical studies of the number of foci per 100 mm plate.

Normal fibroblasts or epithelial cells cannot grow in suspension culture and have to adhere on a substratum for their growth.77 However, malignant cells can grow even in suspension cultures such as soft agar plates shown below panel C and D. All of foci from Rh30 expressing EGFP and EGFP-

P67 were counted, and analyzed, respectively, followed by statistical analyses, shown in Panel E

C D

EGFP EGFP-P67

Fig 2.5: Rh30 cells constitutively expressing P67 showed reduced growth as compared to control.

Equal number of cells constitutively expressing EGFP and its in-frame fusion of P67 were seeded in triplicate culture dishes in complete growth medium. Every 24 hours, cells were harvested by trypsinization and counted over a period of 5 days. Average values from three plates for each experiment were taken. These experiments were repeated at least three times. (B) Equal number of cells from the above two lines were seeded in triplicate on culture dishes in growth medium containing 1.0% bovine serum. Every 48 hours, cells were harvested by trypsinization and counted for a period of 6 days. (C) For anchorage independent growth of Rh30 cells expressing EGFP and

EGFP-P67, we followed procedures as described in “Materials and Methods.” A set of representative data for focus formation of control Rh30 cells (C, left panel) and P67 expressing cells (D, right panel) is shown. Statistical analysis of the number of foci per 100 mm plate is presented in panel D.

2.3.8 Constitutive expression of P67 in Rh30 cells showed significant suppression of tumor growth in athymic nude mice.

Previously, ex vivo studies showed suppression of Rh30 cells by constitutively expressing P67 in growth rate, serum-independent growth, as well as anchorage-independent growth. We asked whether this suppression could be translated into animal models, so we tested Rh30 cells expressing

EGFP and EGFP-P67 in athymic nude mice, by injections of these cells into both sides of the dorsal ventral linings of the nude mice. After injection of transfected cells, these mice were constantly checked on a daily basis, and the experiment was terminated after six weeks. Tumors were surgically removed, weighted, and diameters of them were measured. The results showed bulky, rapidly proliferating tumors formed by Rh30 cells carrying the EGFP only, however, the mice transplanted with Rh30 cells constitutively expressing P67 exhibited significant downsized tumors, as shown with arrows in Fig 2.6 B and C. Control mice represented by Fig 2.6 A were treated with

1X PBS buffer. There were two injection sites for each nude mice, and the four nude mice used to inject with Rh30 carrying EGFP showed all mice developed tumors, the total number of which is seven Whereas, only two of four nude mice injected with Rh30 constitutively expressing P67 showed two diminished tumors from two different nude mice, as shown in D and E. These tumors were analyzed by average weight of tumors per injection sites, and average volume of tumors per injection sites, as shown in Fig 2.6 F and G. To evaluate histology of these tumors from different transfections. Tumors generated from Rh30 expressing EGFP and EGFP-P67 were sectioned and stained by Hematoxylin and Eosin (H&E) Staining. Histological analyses of tumor sections from both Rh30 cells expressing EGFP (H) and Rh30 cells expressing EGFP-P67 (I) were examined under inverted microscope at 100X magnification (H & I) and at 20x magnification (J & K) after staining with H&E. Scale bar is 20 µm for panels A & B and 100 µm for C & D. Therefore, we conclude P67 can inhibit tumorigenicity of Rh30 in vivo and may play a role in angiogenesis.

Fig 2.6: Constitutive expression of P67 in Rh30 cells showed significant suppression of tumor growth in athymic nude mice.

Procedures for mouse xenograft studies are described in “Materials and Methods.” Two mice from each group – control group receiving 1XPBS (A), EGFP group receiving Rh30 cells expressing

EGFP (B), and EGFP-P67 group receiving Rh30 cells expressing EGFP-P67 (C), were shown on the top panel. Red arrows indicate tumors. Tumors developed on dorsal flanks of the mice were excised and total number of tumors obtained from EGFP-expressing cells were shown in panel D, and EGFP-P67 expressing cells were shown in panel E. Weight and volume of tumors per injection site were measured, calculated, and plotted on graphs (F & G). Tumor slices from both EGFP expressing Rh30 cells (H) and EGFP-P67 expressing Rh30 cells (I) were examined under inverted microscope at 100X magnification (H & I) and at 20x magnification (J & K) after staining with

Hematoxylin and Eosin. Scale bar is 20 µm for panels H & I and 100 µm for J & K.

2.4: Discussion

Rhabdomyosarcoma (RMS) is characterized by incomplete differentiation in skeletal muscle tissue.

Alveolar rhabdomyosarcoma (ARMS) is aggressive and malignant with a higher frequency of metastasis. The ARMS Rh30 cells incurred a chromosomal translocation, loss of P53, and metastasis, resulting in aggressive malignancy of tumorigenic growth.78 Previously, we have shown that eukaryotic initiation factor-2 associated protein, P67 can suppress tumor growth in Ras- transformed NIH/3T3 cells ex vivo and in vivo.27 Therefore, we asked whether P67 could inhibit the tumorigenicity of ARMS Rh30 ex vivo and in vivo.

To start with, we have generated two stable Rh30 cell lines constitutively expressing EGFP or

EGFP-P67. Both two stable cell lines were examined under microscopy, showing a significant difference in morphology. These morphological changes could be attributable to exogenous expression of P67, shown in Fig 2.1. The exogenous level of P67 in Rh30 transfected with EGFP-

P67 was lower when compared to endogenous levels of P67. This exogenous level of P67 may be max level that Rh30 cells can endure intracellularly after transfection. (Fig 2.1)

To investigate the role of overexpressed P67 in cell signaling pathways and cell cycle regulations, the ERK1/2 MAP kinase pathway was interrogated by western blots, along with G1 phase regulatory complexes, such as Cyclin D1/CDK4, Cyclin E/Cdk2. Our results indicated the tentative working model (Fig 2.7), showing the morphological changes may be eventually due to a series of transcription factors and cell cycle regulatory proteins. Expression levels of Ras, Raf-1 were consistent with both stable cell lines, whereas, expression levels and activities of MEK1/2, ERK1/2 were decreased, as shown in Fig 2.3. These observations had good agree agreement with in D-

RasV12-mediated transformation of NIH3T3 mouse fibroblasts.27 Furthermore, in figure 2.3, expression levels of cell cycle components in G1 phase were also detected. The protein levels of cyclin D1 and cyclin E were diminished in Rh30 cells constitutively expressing P67 compared to

Rh30 cells with EGFP transfection. The expression levels of early genes, such as c-Myc, Elk-1, were decreased in Rh30 cells constitutively expressing P67, as opposed to expressing EGFP. It is not surprising to see such observation, since P67 interacts with MEK1/2 and ERK1/2, which in turn regulate the downstream effectors including transcription factors, cell cycle regulatory proteins, and so on.

The following question was raised against interactions among these three proteins: P67, MEK1/2, and ERK1/2. (Fig 2.4) Therefore, we carried out the pull-down assays, as known as co- immunoprecipitations. We found out these proteins formed ternary complex by pull-down experiments. Previous mutational studies from our lab demonstrated the mechanism of interactions between P67 with ERK1/2,33 by blocking the phosphorylation sites of ERK1/2 with P26 segment, allowing P52 segment to position ERK1/2 prior to blocking. To date, the interactions between P67 and MEK1/2 are direct or indirect remains elusive. In these ex vivo studies including the growth rate study, serum-independent assay, and anchorage-independent assay, as shown in Fig 2.5, the results showed P67 significantly inhibited Rh30 cell growth and proliferation by exogenous expression via P67 gene transfer. It is not surprising these observations were consistent with previous studies.

In xenograft studies, mice were subject to injections of 1 X PBS, and Rh30 expressing either EGFP or EGFP-P67. After one week, the injection sites on the mice transplanted with Rh30 cells expressing EGFP were shown a different color underneath the skin, whereas, the mice injected with

Rh30 expressing EGFP-P67 showed no sign of tumors until one month later. Since the number of cells for these injection was only 3*105 cells , the rise and development of tumors continued much longer compared to our previous studies which was in the process of 13 days.27 However, the results are evident, showing the mass and volume of tumors were significantly reduced. It indicates that

the expression of P67 modulates the initiation and progression of Rh30 tumorigenesis, by involving the ERK1/2 MAP kinase pathway.

To investigate the histology of these tumors, tumors were sectioned and stained by H&E. Tumors generated by Rh30 cells expressing EGFP were shown as well-developed vasculatures. The blood vessels of these tumors were mature to provide the nutrients and oxygen to these tumors. On the other hand, tumors formed by Rh30 cells constitutively expressing P67 were poorly developed.

These less mature blood vessels were subject to less nutrients and oxygen for the tumors with P67 gene transfer. Our study indicates P67 indeed functions as a tumor suppressor, which inhibits the tumorigenicity of Rh30 cell ex vivo and in vivo. These tumor suppression activities of P67 in in vivo may be in part due to inhibition of angiogenesis.

Taken together, involvement of P67 alone in cellular processes, or in combination of other drugs, can be employed as an alternative for the treatment of cancer.

Fig 2.7 Proposed working model for the role of P67 in Rh30 cells. The mechanism of P67’s action is by which P67 inhibits the phosphorylation of MEK1/2 and ERK1/2 in the ERK1/2 MAP kinase pathway. Thereby, P67 in turn inhibits the expression of Cyclin D1, Cyclin E, and Early genes, including c-MYC, Elk-1, and so on. These downregulated effectors contribute to the overall new characteristics of Rh30 cells.

Chapter III

Examination of the eukaryotic initiation factor 2-asscociated glycoprotein P67’s

involvement in the differentiation of alveolar rhabdomyosarcoma (Rh30 cell line)

3.1 Introduction

Alveolar Rhabdomyosarcoma (ARMS) is characterized phenotypically as immature and undifferentiated skeletal muscle cells in the pediatric populations.79 Like many human cancers, there is a strong association with dysregulation of insulin-like growth factors (IGF) signaling, which is disrupted in ARMS because of chromosomal translocations.38 IGF-1 has been found it has effects on enhancement of myogenin induction in Rh30 cells, however, these myogenin inductions could not induce terminal myogenic differentiation.39,61

During myogenesis, myogenic differentiation is governed by muscle-specific determining factors, which include Myf5, MyoD, myogenin, and MRF4, express their protein coordinately.80,81 These myogenic transcription factors form a family of proteins known as myogenic regulatory factors, and express sequentially during myogenic differentiation. Previous studies from our lab showed the level of P67 increases during skeletal muscle differentiation in C2C12 (mouse myoblast) cell culture, and this increased level of P67 during skeletal muscle myogenesis is controlled at the translational level.34 Moreover, several protein expressions that are involved with P67 during the differentiation of C2C12 were also studied.82,83

Additionally, Focal Adhesion Kinase (FAK), a cytoplasmic non-receptor tyrosine kinase, P67 is required for its stable expression of FAK35 which plays a critical role in the regulation of C2C12 differentiation, in particular, the phosphorylation of tyrosine 397 is involved in initiation of myogenic genetic program, the action of which is critical to terminal differentiation from myoblasts into myotubes.37,84,85 FAK is a direct substrate for the insulin and insulin –like growth factor-I

tyrosine kinase receptors.36 Once it is activated by tyrosine kinase receptors for growth factors, such as insulin and IGF-1, and it can subsequently regulate skeletal muscle differentiation. Upon activation, the phosphorylation of Y397 of FAK creates strong binding affinities for proteins containing SH2-domain, mainly SRC and PI3K. Binding of Src induces more phosphorylation of tyrosine residues, resulting in the full activation of FAK.37 FAK subsequently is involved in the regulation of tumor formation and cell differentiation. In addition, IRS-1 (Insulin receptor substrate

1) plays a dominant role in skeletal muscle and it is critical for normal growth and differentiation.86

Expression levels of AKT1/2, one of several downstream effectors of IRS-1, gradually increased during the differentiation of C2C12.83 The elevated activation of AKT can in turn inactivate PAX3-

FOXO-1 and entails for differentiation.87

Our previous studies also showed P67 is required for stable expression of FAK, as well involves differentiation of C2C12 cells into myotubes.35 Taken together, we propose whether P67 is involved in expression of myogenic proteins such as Myf5, MyoD, Myogenin, and expression and activity of IRS-1, FAK, SRC, and AKT in Rh30 cells during differentiation.

We propose whether P67 and insulin can play an important role in differentiation of incomplete differentiated Rh30 cells. We hypothesize the combinatory treatment of overexpression of P67 and insulin will induce the differentiation of Rh30 cells. This will be justified by detecting differentiation biomarkers, such as Myf-5, MyoD, Myogenin, and prosecuting insulin-involved signaling pathway by biochemical analysis.

3.2 Materials and Methods

Chemicals and Reagents: Tris•HCl, NaCl, NP-40, sodium dodecyl sulfate (SDS), sodium deoxycholate, Sodium orthovanadate, protease inhibitors, Tween 20, Acrylamide, Ammonium persulfate, TEMED, Tris-base, glycine, and Nitrocellulose membrane were purchased from Sigma-

Aldrich (St. Louis, MO). PageRuler™ Prestained Protein Ladder(Cat:26616) and Lane Marker

Reducing Sample Buffer (5X) Prod# 39000 were purchased from Thermo Fisher Scientific

(Asheville, NC). Pierce™ ECL Western Blotting Substrate was purchased from ThermoFisher scientific. X-ray films for Western Blot were purchased from DENVILLE Scientific (Holliston,

MA).

Antibodies: MyoD (sc-760), Myf5 (sc-302), Myogenin (sc-576), Cyclin D1 (sc-8396), CDK4 (sc-

23896), FAK (sc-558), p-FAK (sc-81493), and AKT Antibody (sc-8312) were purchased from

Santa Cruz Biotechnology. Caspase-3 Antibody Rabbit #9662, Phospho-AKT Antibody Rabbit mAb #4060, SRC antibody Rabbit mAb #2123, Phospho-SRC Antibody #5473, IRS-1 Rabbit mAb #2390, and Phospho-IRS-1 Antibody Rabbit #2385 were purchased from cell signaling technology. Beta Actin Antibody Mouse Monoclonal with Catalog number: 60008-1-Ig was obtained from Proteintech Company,

Cell Culture: EGFP-Rh30 and EGFP-P67-Rh30 cell lines were cultured in Dulbecco’s modified

Eagle’s medium (DMEM) containing 100 units/mL penicillin/streptomycin (GIBCO/Life

Technologies) and 10% Heat-inactivated bovine serum (GIBCO/Life Technologies). Cells were then kept at 37 °C in a humidified 7% CO2 incubator.

Cell lysate preparations: For EGFP-Rh30 and EGFP-P67-Rh30 two stable cell lines in growth media, cell lysates were generated in a microcentrifuge tube after cells were collected from plates.

For both stable cell lines treated with differentiation media (growth media containing 2% horse

serum) and differentiation media containing 2 µM insulin, cells were harvested and cell lysates were created in corresponding experimental conditions independently. Protein concentrations were determined by using spectrophotometers, prior to Western Blot analysis. For consistency of detection, primary antibodies were used at 1:1000 concentration, whereas, secondary bodies were used at 1:2000 concentration according to manufacture’s instructions.

3.3 Results

3.3.1 Summary of both stable cell lines in the presence of DM

After Rh30 cells expressing EGFP and EGFP-P67 were obtained, these cells were treated DM over a period of 4 days. The morphological changes were monitored under microscope on a daily basis, as shown in Fig 3.1. For each day of treatment, cells were harvested and cell lysates were generated, concentrations of total proteins in each cell lysates were determined by spectrophotometer. Western

Blot analysis was used to evaluate key proteins present in cell cycle, cell survival conditions, and induction of differentiation by DM, as well as expression and activity of proteins that involve the insulin-mediated signaling pathway such as ISR-1, FAK, Src, and Akt. The results showed the protein expression levels of G1 phase cell cycle regulatory proteins Cyclin D1 (Fig 3.2), CDK4

(Fig 3.3), Caspase-3 (Fig 3.4), Mrf-5 (Fig 3.5), MyoD (Fig 3.6), Myogenin (Fig 3.7). In addition to that, the expression and activity ratios of: p-IRS-1/IRS-1 (Fig 3.8), p-AKT/AKT (Fig 3.9), p-

FAK/FAK (Fig 3.10), p-SRC/SRC (Fig 3.11), were also determined independently.

Fig 3.1 Morphologies of Rh30 constitutively expressing EGFP and EGFP-P67 treated with

DM (Differentiation Media).

Both stable Rh30 cell lines expressing EGFP (on top) and EGFP-P67 (at bottom) were treated with

DM for 4 days (96 hrs.). Time-lapse images from left to right (at 0, 1, 2, 3, 4 day) of both cell lines treated with DM were taken under an inverted microscopy. Scale bar is 100 µm.

Fig 3.2 Cyclin D1 expression levels showed no significant change in both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting Cyclin D1 (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were demonstrated by ratio of Cyclin D1/β- actin as a function of time (Day).

Fig 3.3 CDK4 expression levels showed increased levels for both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis using antibody against CDK4 (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of both stable cell lines, respectively. In (C, F) the results were from three independent experiments

(n=3). The graphs were demonstrated by ratio of CDK4/β-actin as a function of time (Day).

Fig 3.4 Activation of Caspase-3 showed no sign of apoptosis for both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting Caspase-3 (A, D). As controls, β-actin levels were measured in both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Capase-3/β-actin as a function of time (Day).

Fig 3.5 Myf5 Expression levels increased for both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting Myf5 (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Mrf5/β- actin as a function of time (Day).

Fig 3.6 MyoD expression levels showed no significant difference for both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting MyoD (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of MyoD/β- actin as a function of time (Day).

Fig 3.7. Myogenin expression levels showed increased levels for both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis using antibody Myogenin (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of

Myogenin/β-actin as a function of time (Day).

Fig 3.8 The ratio of p-IRS-1/IRS-1 showed no significant difference in both stable cell lines in the presence of DM.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated with DM over the course of 4 days indicated by an arrow for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis using antibodies against p-IRS-1 and IRS-1 as shown in (A&B, D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-IRS-1 over IRS-1 expression levels.

Fig 3.9 The ratio of p-AKT/AKT showed a significant decrease in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM.

D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-AKT over AKT expression levels.

Fig 3.10 The ratio of p-FAK/FAK showed no significant change for both stable cell lines in the presence of DM.

Fig 3.11 The ratio of p-SRC/SRC increased in both stable cell lines in the presence of DM.

3.3.2 Summary of both stable cell lines in the presence of DM and insulin

After Rh30 cells expressing EGFP and EGFP-P67 were obtained, these cells were treated with DM and 2 µM insulin over a period of 4 days. The morphological changes were recorded under microscope on a daily basis, as shown in Fig 3.12. For each day of treatment, cells were harvested and cell lysates were generated, concentrations of total proteins in each cell lysates were determined by spectrophotometer. Western Blot analysis was employed to evaluate key proteins present in cell cycle, cell survival conditions, and induction of differentiation by DM with insulin, as well as expression and activity of proteins that involve the insulin-mediated signaling pathway such as

ISR-1, FAK, Src, and Akt. The results showed the protein expression levels of G1 phase cell cycle regulatory proteins Cyclin D1 (Fig 3.13), CDK4 (Fig 3.14), Caspase-3 (Fig 3.15), Mrf-5 (Fig 3.16),

MyoD (Fig 3.17), Myogenin (Fig 3.18). In addition to that, the expression and activity ratios of: p-

IRS-1/IRS-1 (Fig 3.19), p-AKT/AKT (Fig 3.20), p-FAK/FAK (Fig 3.21), p-SRC/SRC (Fig 3.22), were also determined independently.

Fig 3.12 Morphologies of Rh30 constitutively expressing EGFP and EGFP-P67 in the presence of DM and insulin.

Both stable Rh30 cell lines expressing EGFP (on top) and EGFP-P67 (at bottom) were treated in the presence of DM and insulin for 4 days (96 hrs.). Time-lapse images from left to right (at 0, 1,

2, 3, 4 day) of both cell lines treated with DM and insulin were taken under inverted microscopy.

Scale bar is 100 µm.

Fig 3.13 Cyclin D1 expression levels showed a significant decrease in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated in the presence of DM and insulin over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting Cyclin D1 (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Cyclin D1/β-actin as a function of time (Day).

Fig 3.14 CDK4 expression levels showed no significant change in both stable cell lines in the presence of DM and insulin.

As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of CDK4/β-actin as a function of time (Day).

Fig 3.15 Activation of Caspase-3 showed dramatically increased in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated in the presence of DM and insulin over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis targeting Caspase-3 (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Capase-3/β-actin as a function of time (Day).

Fig 3.16 Myf5 expression levels significantly decreased in Rh30 cells constitutively expressing

EGFP-P67 in the presence of DM and insulin.

β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In

(C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Mrf5/β-actin as a function of time (Day).

Fig 3.17 MyoD expression levels showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

(C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of MyoD/β-actin as a function of time (Day).

Fig 3.18 Myogenin expression levels were consistent in Rh30 cells constitutively expressing

EGFP-P67 in the presence of DM and insulin.

Rh30 cells constitutively expressing EGFP and EGFP-P67 were treated in the presence of DM and insulin over the course of 4 days indicated by arrows for both panels (A-C, D-F). Cell lysates were generated independently, followed by Western Blot analysis using antibody Myogenin (A, D). As controls, β-actin levels were measured for both cell lines (B, E). Western Blot quantification analyses of bands (A, D) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of Myogenin/β-actin as a function of time (Day).

Fig 3.19 The ratio of p-IRS-1/IRS-1 showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

IRS-1 as shown in (A&B, D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-FAK over FAK expression levels.

Fig 3.20 The ratio of p-AKT/AKT showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

AKT as shown in (A&B, D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-AKT over AKT expression levels.

Fig 3.21 The ratio of p-FAK/FAK showed a significant increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

FAK as shown in (A&B, D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 cells constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-

FAK/FAK.

Fig 3.22 The ratio of p-SRC/SRC showed a marked increase in Rh30 cells constitutively expressing EGFP-P67 in the presence of DM and insulin.

SRC as shown in (A&B, D&E). Western Blot quantification analyses of bands (A&B, D&E) were carried out by a densitometry scanner and ImageJ (C, F). On the top of (C, F), there are indications of Rh30 constitutively expressing EGFP and EGFP-P67, respectively. In (C, F) the results were from three independent experiments (n=3). The graphs were illustrated by ratio of p-SRC/SRC.

3.4 Discussion

Treatment of Rh30 cells carrying EGFP in the presence of DM or DM/insulin showed consistency in morphology over a period of 4 days. Whereas Rh30 cells constitutively expressing P67 (EGFP-

P67-Rh30) in the presence of DM/insulin gave rise to staggeringly different morphologies when compared to the treatment of DM. In addition, Rh30 cells constitutively expressing P67 showed remarkably different morphologies compared to Rh30 cells carrying EGFP (EGFP-Rh30) in the presence of DM/insulin. These observations demonstrate two things: For one, both cell lines showed consistency of their morphologies in the absence of insulin. For the other, cells also remained their morphologies over the course of the treatment in the absence of P67. Taken together,

P67 and insulin as a complementary factor to each other play a crucial role in the induction of differentiation of Rh30 cells. (Fig 3.1 and Fig 3.12).

With these observations, biochemical analyses were carried out for a series of key regulatory proteins in cell cycle, myogenic regulatory family, and kinases involved in insulin pathways. In the presence of DM, cyclin D1 expression levels were consistent over a duration of treatment for both stable cell lines. (Fig 3.2), in contrast, in the presence of DM/insulin, cyclin D1 expression levels in EGFP-P67 underwent to a lower level after day 1, and achieved a much lower at day 4, whereas cyclin D1 expression levels in EGFP-P67-Rh30 decreased significantly since day 1 and continued to decline to an almost undetectable level at the end of treatment. (Fig 3.13) These results showed insulin is significantly involved in the regulation of Cyclin D1 expression levels. To evaluate the integral partner to Cyclin D1, CDK4 expression levels were not in a consistent fashion for EGFP-

Rh30 cells in the presence of insulin. (Fig 3.3) However, CDK4 expression levels were relatively consistent in the presence of DM/insulin compared to their levels in DM. (Fig 3.14) These data indicate CDK4 is an integral component of Cyclin D1/CDK4 complex for progression from G1 to

S phase in cell cycle, while Cyclin D1 levels are mainly involved in the regulation by insulin and

P67. As indicated, cell cycle was disrupted in EGFP-P67-Rh30 cells, and cell cycle progression was inhibited by combination of insulin and P67. Capase-3, the activation of which is biomarker of apoptosis, was evaluated in these experiments. We found its activation levels increased ~3.5 folds in Rh30 cells constitutively expressing P67 in the presence of DM/insulin. (Fig 3.15) In comparison, there is no sign of apoptosis for these cells in the presence of DM. (Fig 3.4) These data was such a revelation for us because it explained Rh30 cells constitutively expressing P67 that were detached from cell plates underwent apoptosis over a duration of 4 days in the presence of

DM/insulin, whereas cells from other experimental settings remained normal viability.

The following question was raised: What has happened to cells still attached to the plates with significant morphological changes? In order to address the question, a series of myogenic regulatory factors responsible for muscle differentiation were interrogated by biochemical analysis.

First biomarker under evaluation in the regulatory protein family is Myf5, a determination factor for commitment from myocytes to myoblasts. Surprisingly, EGFP-P67-Rh30 cells showed a significantly decreased Myf5 level in the presence of DM/insulin, (Fig 3.16) whereas other experimental settings showed a relative change in Myf5 levels. (Fig 3.5 and panel A, B, C in Fig

3.16) The results indicates EGFP-P67-Rh30 cells fully committed into differentiation program in the presence of DM/insulin, whilst the other three experimental settings failed to deliver this commitment. Therefore, morphological changes were observed in EGFP-P67-Rh30 cells in the presence of DM/insulin, not in the other experimental settings. (Fig 3.5 and Fig 16). Expression levels of MyoD significantly increased in response to insulin stimulation after 1 day, and then remained high levels in Rh30 cells constitutively expressing P67 in the presence of DM/insulin.

(Fig 3.17) These observations indicate MyoD expression levels correlates with the initiation of

apoptosis and promotes myogenic differentiation. Myogenin as a biomarker of myotubes is essential for proper terminal differentiation and its expression levels showed an increase for both stable cell lines in the presence of DM. (Fig 3.7) Whereas, Myogenin expression levels were consistent in Rh30 cells constitutively expressing P67 in the presence of DM/insulin. (Fig 3.18)

These biochemical analyses had good agreement with our observations that cells rendered elongated and spreading-like characteristics, but there was no multinucleated myotubes formed in

Rh30 cell constitutively expressing P67 in the presence of DM/insulin. (Fig 3.12) Collectively, these forced differentiation failed to induce terminal differentiation of Rh30 cells.

Since addition of insulin or not played a pivotal role in these morphological changes and apoptosis, insulin involved signaling pathways were necessarily interrogated by biochemical analysis. Rh30 cells, characterized by incomplete differentiated skeletal muscle cells, are implicated in the insulin/insulin-like growth factors (IGF) signaling pathway. Furthermore, because of chromosomal translocation in Rh30 cells, there is even much stronger association with dysregulation of insulin- like growth factors (IGF) signaling.38 There are two the most important representatives of the IRS protein family: Insulin Receptor Substrate 1 (IRS-1) and Insulin Receptor Substrate 2 (IRS-2). Even though they are quite similar structurally and functionally, they show divergent roles in a tissue- specific fashion.39,61,86 IRS-1 plays the dominant role in skeletal muscle including maintaining energy homeostasis, differentiation, and regulation of anabolic and catabolic mechanism, whereas

IRS-2 signaling is mostly dominant in the period directly after food intake and during fasting.38,39,61,86 Upon addition of insulin/DM, EGFP-P67-Rh30 cells showed continuously increased activities over the duration of 4 days and ratio of p-IRS-1/IRS-1 reached up to ~2.5 fold at the end of the treatment. Whereas, other experimental settings showed consistency in this ratio

(Fig 3.8 and Fig 3.19) These observations indicate insulin/IRS-1 signaling pathway indeed was

activated in EGFP-P67-Rh30 cells in the presence of DM/insulin. P67 and insulin may contribute to this particular pathway, leading to ultimate observations for morphologies, and apoptosis in these cells. After binding of insulin to the respective receptor, the receptor undergoes a conformational change that causes autophosphorylation of tyrosine residues thereby activating the intracellular kinase domain of the receptor. The activated receptor recruits the IRS-1 (maybe also other IRS family proteins), subsequently phosphorylates them on tyrosine residues that are located in specific domains thereby enabling phosphorylated IRS-1 to interact with SH2-domain containing proteins, such as Phosphoinositide 3-kinases (PI3Ks), which in turn phosphorylates protein kinase B (AKT).

Activated AKT inhibits PAX3-FOXO1 activity of ARMS, leading to cell cycle arrest or apoptosis.

In the meantime, elevated AKT activity inactivates PAX3-FOXO1 and promotes muscle differentiation.87 The proposed action model was validated by observations towards the significantly elevated ratio p-AKT/AKT in Rh30 cells constitutively expressing P67 in the presence of DM/insulin, and this ratio was continuously growing to ~6 folds towards the end of experiment.

(Fig 3.20) In the presence of DM, the ratio of p-AKT/AKT for EGFP-Rh30 cells was consistent, while the same ratio for EGFP-P67-Rh30 cells slightly declined, due to the low level of activated

AKT and increased expression level of AKT. (Fig 3.9) In the presence of DM/insulin, this ratio

Rh30 reached up to almost 3 folds in Rh30 cells constitutively expressing P67. These results showed insulin significantly increased activation of AKT; in the meantime, P67 enhanced this outcome by facilitating insulin effect.

In addition, focal adhesion kinase (FAK), a cytoplasmic tyrosine kinase, is also known as a direct substrate of the insulin and IGF-1 receptor tyrosine kinase.36 In the presence of DM/insulin, the ratio of p-FAK/FAK was almost consistent in Rh30 cells carrying EGFP, however, under the same experimental condition, the ratio of p-FAK/FAK, for Rh30 cells constitutively expressing P67,

significantly increased compared to this ratio from other experimental settings. (Fig 3.21 and Fig

10). Interestingly, particularly for Rh30 cells constitutively expressing P67 in the presence of

DM/insulin, FAK expression level gradually decreased, whereas phosphor-FAK at Y397 site gradually increased. (Fig 3.21) As phosphorylation site of Y397 creates strong binding affinities for another tyrosine kinase, SRC. Binding of SRC induces phosphorylation of tyrosine in the kinase domain of FAK, resulting in FAK’s full activation.37 Once FAK is fully activated, modulated are focal adhesion complex, paxillin and integrins, which directly binding to FAK and link the extracellular matrix (ECM) to the cytoplasmic cytoskeleton, resulting in the increase of cell motility and spreading out of their morphologies.

These studies correlate with our observations that Rh30 cells constitutively expressing P67 showed altered cell morphologies in the presence of DM/insulin. These biochemical analyses showed P67 and FAK together were involved in the regulation of motility and morphological changes of Rh30 cells. SRC, the activator of FAK, resides in cytoplasm. The ratio of p-SRC/SRC for both stable cell lines transiently and rapidly increased in both experimental settings. (Fig 3.11 and Fig 3.22) The data indicate transiently and rapidly increased phosphorylated SRC is involved in the full activation of FAK, resulting in cell motility, morphological changes, and induction of differentiation of Rh30 cells.

Chapter IV

Investigation of P67’s involvement in migration of ARMS Rh30 cells

4.1 Introduction

During the skeletal muscle differentiation, myoblasts require a series of steps to be fully developed into myotubes,34,88 which consists of (1) inhibition of growth and proliferation to withdraw myoblasts from cell cycle,89,90 (2) expression of myogenic regulatory factors88 (3) detachment of anchored myoblasts from extracellular matrix (ECM)91 (4) migration and alignments of myoblasts,92–95 (5) regulation of actin cytoskeleton dynamics to form filopodia and lamillopodia96–

98 (6) fusions of myoblasts into multinucleated myotubes.99–101

Numerous cellular proteins are involved in these crucial cellular processes.88,100 During this period of time, eukaryotic initiation factor 2-assocatied glycoprotein P67 dissociates with eIF2 and associates with ERK1/2 kinases to modulate their activation and activity to inhibit cell growth and cell proliferation, thereby allowing myogenic cells to withdraw permanently from cell cycle and

18,25,34,102 enter into the quiescent stage of cell cycle G0. In particular, during differentiation of mouse

C2C12 myoblasts into myotubes, the expression of P67 increases by several folds and this increased level of P67 in myoblasts and myotubes is involved in many aspects of cellular proteins that modulate actin cytoskeleton dynamics and migration before fusions of myoblasts into myotubes.34

Overexpressing of P67 in C2C12 cells increased the levels of certain proteins that enable C2C12 cells to differentiate from myoblasts into myotubes, even in the presence of serum that provides growth factors to cells for division.34

During migration, protrusive structures are formed including lamellipodia and filopodia which are found on the leading edges of migrating cells. Lamillipodia, morphologically defined as flat broad membranous protrusions, are located at the leading edge of the migrating cells.42 Lamellipodia

purportedly play a major role in driving migrating cells by attaching to the substrate and generating force to pull the cell body forward. (lamellipodia) These pulling-cell-body-forward movements determined by protrusive force of lamellipodia arise from the actin network against cell membrane.43 Among the actin network in protrusive structures, abundant F-actin functions as building blocks of the cytoskeleton and is responsible for cytoskeleton reorganization which dynamically polymerizes and reassembles against cell membrane near the leading edge.42

Compared to lamellipodia, filopodia are the thin, spike-like protrusions containing parallel bunches of actin filaments. Along with lamellipodia, filopodia also function to produce the protrusive force through F-actin for leading edge advancement in the migratory direction of cells.103 Assembly and organization of F-actin is regulated by Rho GTPases family including Rho, Rac and Cdc42. Rac could be activated, leading to the reassembly of F-actin at the cell periphery to generate lamellipodia. Whereas, activation of Cdc42 induces the formation of filopodia.41,42,104

Previous studies in Datta lab showed P67 is involved in the increased level of Cdc42 by proteolytic processing of precursor of this protein, which suggests P67 is involved in the regulation of cytoskeleton dynamics during C2C12 myoblasts into multinucleated myotubes.82 Mouse C2C12 myoblasts have been employed as a widely appreciated ex vivo system to study molecular mechanism of a myriad of myogenic process for skeletal muscle differentiation. These myogenic processes share the same mode of action. Therefore, alveolar rhabdomyosarcoma Rh30 cells characterized by incomplete muscle differentiation are an excellent candidate to investigate P67’s involvement in migration. We propose P67 is working through these GTPases to mediate its effect over protrusive structures during Rh30 cell migration. We hypothesize that overexpression of P67 can increase the migratory capacity of Rh30 cells through upregulation of specific small GTPases.

This hypothesis will be tested by in vitro scratch assay, F-actin staining, biochemical analysis of

Rh30 cells via P67 gene transfer.

4.2 Materials and Methods

Chemicals and Reagents: Phalloidin, CF™488A was purchased from Biotium (Fremont, CA ).

DAPI (fisher scientific) (4′, 6-diamidino-2-phenylindole) was purchased from Thermo Fisher

Scientific (Hanover Park, IL). Tris•HCl, NaCl, NP-40, sodium dodecyl sulfate (SDS), sodium deoxycholate, Sodium orthovanadate, protease inhibitors, Tween 20, Acrylamide, Ammonium persulfate, TEMED, Tris-base, glycine, and Nitrocellulose membrane were purchased from Sigma-

Aldrich (St. Louis, MO). PageRuler™ Prestained Protein Ladder(Cat:26616) and Lane Marker

Reducing Sample Buffer (5X) Prod# 39000 were purchased from Thermo Fisher Scientific

(Asheville, NC). Pierce™ ECL Western Blotting Substrate was purchased from ThermoFisher scientific. X-ray films for Western Blot were purchased from DENVILLE Scientific (Holliston,

MA).

Antibodies: Cdc42 (sc-8401), Rac1 (sc-6084), Beta Actin Antibody Mouse Monoclonal with Catalog number: 60008-1-Ig was obtained from Proteintech Company.

Cell Culture: EGFP-Rh30 and EGFP-P67-Rh30 cell lines were cultured in Dulbecco’s modified

Eagle’s medium (DMEM) containing 100 units/mL penicillin/streptomycin (GIBCO/Life

Technologies) and 10% Heat-inactivated bovine serum (GIBCO/Life Technologies). Cells were then kept at 37 °C in a humidified 7% CO2 incubator.

Cell lysate preparations: For EGFP-Rh30 and EGFP-P67-Rh30 two stable cell lines in growth media, cell lysates were generated in a microcentrifuge tube after cells were collected from plates.

Protein concentrations were determined by using spectrophotometers.

In vitro scratch assay on transfected cells:105 Once both stable cell lines were established, EGFP and EGFPP67 Rh30 cells were plated to grow at 95-100% confluency to form a monolayer. A P200 pipet tip was used to generate a wound of the cell monolayer. Unwanted debris created by scratch was washed away and replaced by the fresh growth media. Cell plates were maintained under

normal cell culture condition and observed after 18 h under 4X magnification by Olympus Inverted

Microscope 81X.to examine both cell line migration activity. Images were taken when the scratch occurred, and after 18 h treatment. The leading edge of the wound was analyzed and cells were counted by ImageJ 1.52a software. Data were pooled from three independent experiments with three independent plates in each experiment for each cell line (n = 9). ***P < 0.001, two-tailed unpaired Student’s t-test.

F-actin filament staining (Actin distribution studies): Phalloidin, CF™488A was purchased from

Biotium (Fremont, CA), and the lyophilized solid was dissolved in methanol to yield a stock concentration 200 U/mL. When in vitro scratch assay was implemented on the coverslips at bottom of the chambers, after 18 h treatment, cells were washed 3 times with PBS. Cells were fixed on ice with 3.75% formaldehyde solution in PBS for 15 min, and then washed 3 times with PBS.

Subsequently, cells were permeabilized with 0.5% Triton X-100 in PBS at room temperature for

10 minutes, and then washed 3 times with PBS. We diluted 5-µL fluorescent phalloidin stock solution in 200 µL PBS for each chamber, placing the staining solution on the coverslips for 20 min at room temperature without evaporation in the dark room, and again washed 3 times with PBS.

In the following, cells were incubated with 300 nM DAPI (fisher scientific) (4′, 6-diamidino-2- phenylindole) stain solution for 5 min, and then cells were washed 3 times with PBS. Shortly, data acquisition were performed to detect DAPI and Phalloidin conjugates by Olympus Fluoview 1000 confocal microscope under 60X magnification with excitation wavelength 405nm, 488nm, respectively. Images were analyzed by ImageJ 1.52a software.

4.3 Results

Once both Rh30 cell lines constitutively expressing EGFP and EGFP-P67 were established, cells were under investigation for P67’s involvement in the migration of Rh30 cells. In vitro scratch assay was employed to test the number of migrating cells for both cell lines. When cell confluence reached up to ~95%, in vitro wounds were generated by P200 pipet tips by scratching through the monolayer of cells. Images were collected at 0 h and 18 h, (Fig 4.1) followed by statistical analysis of the migratory cells. Data were pooled from three independent experiments with three independent plates in each experiment for each cell line (n = 9). ***P < 0.001, two-tailed unpaired

Student’s t-test. (Fig 4.2) F-filament staining study was accomplished by using Phalloidin,

CF™488A and DAPI, which were performed to detect the distribution of F-actin and the nuclei, respectively. Data acquisitions were collected by confocal microscope under 60X magnification

Images were processed, analyzed, shown A and B in Fig 4.3. In the meantime, cell lysates from both cell lines were generated and Western Blot analysis of Rac1 and Cdc42 proteins were performed to investigate their expression levels shown C and D in Fig 4.3.

Fig 4.1: Rh30 cells constitutively expressing P67 showed increased cell migration rate by in vitro scratch assay. Collected images demonstrated the scratch assay on transfected cells in growth media as indicated by EGFP-Rh30 and EGFP-P67-Rh30 cells. Image acquisitions occurred at 0 and 18 h in in vitro scratch assay for both cell lines. Solid lines define the leading edges of scratch area. Scale bar is 100 µm.

Fig 4.2 Statistical analysis of the number of migrating cells for EGFP-Rh30 and4.3 res EGFP-

P67-Rh30 cells. The number of migrated cells after 18 h for EGFP-Rh30 and EGFP-P67-Rh30 were measured and data were evaluated by statistical analysis. *** P<0.001 performed through unpaired t-test, two-tailed, n=9 independent experiments from three different cultures for each cell line.

Fig 4.3 F-actin staining for migrated EGFP-Rh30 and EGFP-P67-Rh30 cells in leading edges of scratch areas by confocal microscopy. A and B represent morphologies of EGFP-Rh30 and

EGFP-P67-Rh30 cells in growth media, respectively. Blue indicates the nuclei stained by DAPI, whereas the green color indicates the distribution of F-actin stain by Phalloidin conjugates. Red arrows point out at the protrusive structures of EGFP-P67-Rh30 cells. Western Blot analysis showed the Cdc42 expression (D) was consistent with both cell lines, however, the expression of

Rac1 (C) increased in EGFP-P67-Rh30 cells compared to EGFP-Rh30.

4.4 Discussion

Cell migration is a hallmark of a series of complex cellular and biochemical processes. Particularly, during muscle cell differentiation, cell migration occurs to facilitate fusions of myoblasts into myotubes. Our data demonstrate Rh30 cells constitutively expressing P67 showed the significant number of migrating cells by in vitro scratch assay in growth media compared to control cells. (Fig

4.1 and 4.2) Cell migration involves interaction between extracellular matrix and intracellular cytoskeletal reorganization that are dictated by the actin network, specifically the redistribution of

F-actin in cells. F-actin plays a crucial role in regulation of protrusive structures in cells, such as lamellipodia and filopodia during migration. Phalloidin, derived from deadly mushroom, binds and stabilizes F-actin, eventually effectively preventing its depolymerization. It is widely appreciated that phalloidin containing fluorescent conjugates are employed in microscopic application to visualize the distribution of F-actin. In comparison, F-actin distributions of EGFP-Rh30 and EGFP-

P67-Rh30 were observed in Fig 4.3 A and B, respectively. There are more lamellipodia indicated by red arrows in Rh30 cells constitutively expressing P67 than control cells, whereas there was no significance for filopodia in both cell lines. Biochemical analyses showed the expression level of

Cdc42 responsible for filopodia was consistent in both cell lines; however, Rac1 expression level responsible for lamellipodia in Rh30 cells constitutively expressing P67 was higher than in control cells. These biochemical results had good agreement with our observations. It indicates P67 induces the migratory capacity of Rh30 cells, due to its involvement in the upregulated expression of Rac1.

Chapter V

Conclusions and future work

When Dr. Datta first discovered P67 during purification of eIF2, he could not have anticipated the remarkable convergence of eIF2-associated P67 with molecular mechanism of tumor suppression and induction of differentiation of cells.

P67 is now identified as a tumor suppressor. This particular role was also demonstrated in Ras transformed NIH3T3 fibroblasts and C2C12 myoblast mouse cell lines previously. In addition, P67 has intramolecular and intermolecular activities. Under stress conditions, P67 dissociates from eIF2 and associates with ERK1/2. Dissociation with eIF2 causes the phosphorylation of eIF2α, leading to the halt of initiation of global protein synthesis. Therefore, the global protein synthesis rate is decreased. In association with ERK1/2, P67 inhibits the phosphorylation of ERK1/2, thereby resulting in suppression of a series of gene expression, eventually leading to the suppression of cell growth, proliferation, and tumor formation. In addition, P67 level increases during skeletal muscle differentiation. Moreover, P67 is involved in actin cytoskeleton dynamics, survival, migration, and motility during differentiation of C2C12 myoblasts into multinucleated myotubes. What’s more,

P67 is required for stable expression of FAK and correlates with expression of AKT. Given this multifaceted P67, we aimed to not only demonstrate P67 tumor suppression activity and employ its function to suppress tumor formation in vitro and in vivo, but also verify its role during differentiation of tumor cells, and even during cell migration. With these purposes, sarcoma is our particular cancer type of interest due to tumor characteristics including tumorigenesis and lack of differentiation.

Rhabdomyosarcoma (RMS), the most common soft tissue sarcoma among children and adolescents, consists of two main subtypes: embryonal rhabdomyosarcoma (ERMS) (around 70-80%) and alveolar (ARMS) (around 20-30%), originally due to histological classification of RMS. ARMS is

generally associated with poor prognostic, aggressive, and metastatic outcomes of patients. Rh30, one cell line of ARMS, is greatly appreciated to study ARMS, due to chromosomal translocations generating fusion gene PAX3-FOXO1.

We investigated P67 cDNA of Rh30 cells, sequencing P67 cDNA was performed targeting these highly conserved seven amino acid residues, H231, D251, D262, H331, E364, E459, and H460 through Laragen Inc. (Culver City, CA). The analysis of KK domain in N-terminus was perform by PCR using forward and reverse primers (5'CTCTGTCTCATTCCCTCG3' and

5'GCCAGGCCTGCATTTAATCC3’, respectively), and P67 mRNA as a template. The C- terminus analysis (the rest of nucleotides) was carried out by the forward and reverse primers

(5'GGATTAAATGCAGGCCTGGC3' and 5’CCTCTGCTGACAACTTC3', respectively), with

P67 mRNA as a template. In particular, H231/D251/D262 segment was analyzed by the forward and reverse primers (5'GGATTAAATGCAGGCCTGGC3' and 5'CCAGCACACTTTATTCC3'), and P67 mRNA as a template. With the same template for analysis of H331/E364 segment, the forward primer (5'GGCCATCCAAGAAGTTATGG3') and reverse primer

(5'GCCTTATTGGCACATGTCC3') were used. Lastly, the forward and reverse primer (5

‘GCCGCAGATGGCTGGATCGC3’ and 5’CCTCTGCTGACAACTTC3', respectively) were used to evaluate E459/H460 segment. These sequencing procedures were performed in triplicate to verify the results. The purpose of sequencing is to confirm there is no single point mutation present in Rh30 cells. The sequencing results reassured endogenous P67 do not play a role during gene transfer events. The only culprit is attributable to exogenous expression of P67.

To initiate P67 gene therapy, we generated two stable cell lines that are Rh30 cells constitutively expressing EGFP and EGFP-P67. After two weeks of G418 selection, our results indicated Rh30 cells constitutive expression of P67 showed a significantly different morphology as opposed to control cells. Cell lasted from both stable cell lines were generated and interrogated by biochemical

analyses which showed these morphological differences are attributable to exogenous P67. As

ERK1/2 MAP kinase signaling pathway is implicated in numerous cancers, making it as an attractive research and therapeutic target due to the most highly frequent Ras mutations in all types of tumors. We prosecuted this particular pathway and found out K-Ras and Raf-1 protein expression levels were almost consistent in both stable cell lines, whereas expression and activity of MEK1/2 and ERK1/2 were significantly decreased in Rh30 cells constitutively expressing P67.

In logic progression, the downstream effectors of phosphor-ERK1/2 were detected as well. The results showed C-MYC and Elk-1 expression levels were significantly decreased in Rh30 cells constitutively expressing P67, and so did cyclin-D1 and cyclin E. To test whether interactions between MEK1/2, ERK1/2 and P67 are direct or not, co-immunoprecipitations were carried out.

The results showed not only did these three proteins pull down each other well, but also increased interactions between these proteins were detected in Rh30 cells constitutively expressing P67.

In cell culture, the growth of Rh30 cells constitutively expressing P67 was significantly inhibited.

In serum deprivation studies, the growth of Rh30 cells constitutively expressing P67 was remarkably reduced. In anchorage independent assays, foci formed from soft agars for both stable cell lines were counted and followed by statistical studies. The results showed the growth of Rh30 cells constitutively expressing P67 was significantly suppressed compared to control cells.

Then, we proposed whether this suppression can be translated into animal modes. Therefore, we tested those cells in nude mice by injection of those cells into the dorsal ventral linings of the mice.

For each subset experiments, four mice were used. Thereby, there are total eight injection sites for each subset experiment. After injection, six weeks later, tumors were surgically removed, weighted, measured, and analyzed by average weight and volume per injection site. These results showed tumors generated by Rh30 cells constitutively expressing P67 were significantly inhibited as opposed to control tumors.

To evaluate the histology of these tumors, tumors were sectioned and stained by H&E, followed by a careful examination under an inverted microscopy at 20X and 100X magnification, respectively. We found out tumors generated by Rh30 cells carrying EGFP plasmids were shown with well-developed vasculatures, whereas, tumors generated by Rh30 cells constitutively expressing P67 were shown with poorly-developed vasculatures. These results reveal the fact that

P67 indeed functions as a tumor suppressor, which inhibits the tumorigenicity of ARMS.

Furthermore, this suppression can be due in part to the inhibition of angiogenesis.

When inhibition of tumorigenicity was well established, we moved on to induce the differentiation of Rh30 cells, because RMS appears incomplete skeletal muscle differentiation due to chromosomal translocations. Previously, we demonstrated P67 levels correlate with the differentiation of myoblasts into myotubes in C2C12. Therefore, we proposed whether P67 plays a role in induction of Rh30 differentiation by gene transfer and in combination of insulin treatment.

To address this question, biochemical analyses were carried out. The very first protein we detected was cyclin-D1 whose levels were consistent in both stable cell lines in the presence of DM, whereas, cyclin D1 levels decreased gradually in both cell lines in the presence of DM and insulin. The results indicate insulin is involved in the regulation of cyclin D1 levels and inhibits cell cycle progression. Caspase-3, the activation of which is a biomarker for apoptosis, and its activation levels gradually increased in Rh30 cells constitutively expressing P67 in the presence of DM and insulin. Whereas, there was no sign of apoptosis from other experimental settings. These results were such a revelation for us, because it explains our observation that cells were getting fewer and fewer. The cells that were detached from plates were dead through apoptosis.

However, we proposed the following question: what happened to those cells that were attached had a significant morphological change in Rh30 cells constitutively expressing P67. To address that, we detected a series of biomarkers for differentiation. Myf-5 was the first differentiation marker

100

we detected and Myf-5 protein expression levels gradually decreased in Rh30 cells constitutively expressing P67 in the presence of DM and insulin. The results indicate these cells are fully committed to differentiation program. Whereas, other experimental setting failed to deliver this commitment. The biomarker after Myf-5 is MyoD, whose expression levels increased significantly after day one and remained high expression levels for the rest of treatment in Rh30 cells constitutively expressing P67, in the presence of DM and insulin. Myogenin as a biomarker for myotubes is essential for terminal differentiation. Myogenin expression levels were consistent in

Rh30 constitutively expressing P67, in the presence of DM and insulin. These results indicate forced differentiation failed to induce terminal differentiation of Rh30 cells. These biochemical analyses had a good agreement with our observation that Rh30 cells constitutively expressing P67, in the presence of DM and insulin, rendered elongated, spreading-like characteristics. However, there were no myotubes formed.

Since insulin plays a pivotal role in the regulation of apoptosis and differentiation, insulin-involved signaling pathway must be implicated and worth of investigation. Upon addition of DM and insulin,

IRS-1 (insulin receptor substrate 1) is phosphorylated. The ratio of p-IRS-1/IRS-1 gradually increased over the course of treatment in Rh30 cells constitutively expressing P67. Once IRS-1 is phosphorylated, it recruits SH-2 domain-like protein, such as PI3K, which in turn phosphorylates

AKT. The ratio of p-AKT/AKT gradually and significantly increased over the course of treatment in the presence of DM and insulin. This elevated activation of AKT (phosphor-AKT) can inactivate

PAX3-FOXO1 activity and promote differentiation, which was also reported by others. In the meantime, focal adhesion kinase (FAK) is well-known as a direct substrate of insulin and insulin- like tyrosine kinase receptors. In the presence of DM and insulin, the ratio of p-FAK/FAK significantly increased in Rh30 cells constitutively expressing P67. Once FAK is phosphorylated at Y397, it recruits another tyrosine kinase called SRC, resulting in the full activation of FAK. The

100

101

ratio of p-SRC/SRC transiently and rapidly increased in Rh30 cells constitutively expressing P67, in the presence of DM and insulin. This result indicates transient activation of SRC is necessary for full activation of FAK, in the presence of P67 which is involved in the regulation of expression and activity of FAK. Taken together, P67 and insulin work together to induce the differentiation of

Rh30 cells.

We also investigated the involvement of P67 during migration of Rh30 cells after gene transfer. In vitro scratch assays were employed to test migratory cells for both stable cell line. When cell confluence reached up to 95~100%, in vitro wounds were generated and images were taken at 0 hour and 18 hours later. Migratory cells were counted and followed by statistically studies. The results showed Rh30 cells constitutively expressing P67 had significant increased migratory capacity over control cells. F-actin plays an important role in the regulation of protrusive structures, such as filopodia and lamellipodia, during migration. Based on our observation, there were more lamellipodia in Rh30 constitutively expressing P67 than in control cells. Biochemical analysis showed cdc42 expression level, which is responsible for filopodia, was consistent in both stable cell lines. Whereas, Rac1 expression level, which is responsible for lamellipodia, was much higher in Rh30 cells constitutively expressing P67 than in control cells. These biochemical analyses had a good agreement with our observation. These results indicate P67 increased migratory capacity of

Rh30 cells, due to the upregulation Rac1 levels.

Given these remarkable experimental results, we propose a list of promising projects for future work:

First, sequencing P67 cDNA in specific cancers is essential prior to P67 gene therapy. Essentially, because this P67 cDNA screening gave rise to comprehensive information regarding transcriptional and translational dysregulation in cancers. As we sequenced P67 cDNA in Rh30 cells repeatedly to validate P67 protein is structurally normal in Rh30 cells. It would be of great interest to see

101

102

sequencing results of ERMS or other cancers, such as breast cancers, melanoma, prostate cancer, even in pancreatic cancer.

Secondly, we tested the role of P67 in ARMS, which features a suppressed cell cycle regulation and a downregulated ERK1/2 MAP Kinase signaling pathway. Furthermore, our xenograft studies in nude mice showed P67 significantly inhibits proliferation and tumorigenicity of Rh30 cells in vivo. Moreover, histological analyses revealed angiogenesis and malignancy of blood vessels were remarkably decreased in tumors transplanted with Rh30 cells constitutively expressing P67. We conclude P67 has significant tumor suppression activities on cell growth and proliferation of Rh30 cells ex vivo and in vivo, regardless of its genetic alterations. It would be of interest to test whether

P67 by its role in ERK1/2 MAP kinase pathway to suppress ERMS ex vivo and in vivo or even other types of tumors, such as carcinoma, melanoma, pancreatic cancers, and so on.

Thirdly, Rh30 cells are lack of differentiation of skeletal muscle cells, due to its gene alteration, which leads to the dysregulation of insulin-like growth factor (IGF) signaling. IGF-1 is responsible for inducing the enhancement of myogenin expression, which is the biomarker of terminal myogenic differentiation; however, myogenin induction by our experiments does not promote terminal myogenic differentiation. In the presence of DM and insulin treatment, overexpression of

P67 dramatically altered its morphology, decreased the expression of essential cell cycle proteins such cyclin D1, leading to cell-cycle dependent apoptosis from observations under microscope and an apoptosis biomarker (Caspase-3). With these forced differentiations, Rh30 cells showed full commitment to myogenic program indicated by no detectable Myf-5 expression, transient upregulation of MyoD, leading to further enhancement of expression of myogenin. In order to analyze the biochemical evidence that may lead to these effects, FAK was evaluated due to direct interaction with insulin or IGF-1 receptor. The expression level of FAK was decreased whereas phosphor-FAK levels increased, along with full activation from SRC. An alternative pathway to

102

103

express the insulin effect is through IRS-1 to AKT. Enhanced AKT activation induces apoptosis and differentiation of ARMS. It could be of significant interest to see whether ERMS and other cell lines (such as breast cancer, melanoma, pancreatic cancer, prostate cancer, lung cancer) could be consistent with these observations, since these cancers do not have chromosomal translocation.

Lastly but not least, constitutively expressing P67 induces the increased migratory capacity of Rh30 cells demonstrated by in vitro scratch assay, F-actin staining, and biochemical analysis of Rho

GTPase family. It would be of great interest to see whether these convenient experiments could be easily applied to future projects involved with gene transfer of P67 cDNA.

103

104

References:

1. Dever, T. E. Gene-Specific Regulation by General Translation Factors. Cell 108, 545–556 (2002).

2. Komar, A. A. et al. Novel Characteristics of the Biological Properties of the Yeast

Saccharomyces cerevisiae Eukaryotic Initiation Factor 2A. J. Biol. Chem. 280, 15601–15611

(2005).

3. Castilho, B. A. et al. Keeping the eIF2 alpha kinase Gcn2 in check. Biochim. Biophys. Acta BBA

- Mol. Cell Res. 1843, 1948–1968 (2014).

4. Han, A.-P. et al. Heme-regulated eIF2a kinase (HRI) is required for translational regulation and

survival of erythroid precursors in iron deficiency. EMBO J. 20, 6909-6918 (2001)

5. Nanduri, S. A dynamically tuned double-stranded RNA binding mechanism for the activation

of antiviral kinase PKR. EMBO J. 19, 5567–5574 (2000).

6. Kaufman, R. J. Stress signaling from the lumen of the endoplasmic reticulum: coordination of

gene transcriptional and translational controls. Genes Dev. 13, 1211–1233 (1999).

7. Dever, E. et al. Phosphorylation of Initiation Factor 2a by Protein Kinase GCN2 Mediates Gene-

Specific Translational Control of GCN4 in Yeast. Cell, 68, 585-596, (1992).

8. Datta, B., Chakrabarti, D., Roy, A. L. & Gupta, N. K. Roles of a 67-kDa polypeptide in reversal

of protein synthesis inhibition in heme-deficient reticulocyte lysate. Proc. Natl. Acad. Sci. 85,

3324–3328 (1988).

9. Datta, B. et al, Glycosylation of eukaryotic peptide chain initiation factor 2 (eIF-2)-associated

67-kDa polypeptide (p67) and its possible role in the inhibition of eIF-2 kinase-catalyzed

phosphorylation of the eIF-2 alpha-subunit. J Biol Chem. 34, 20620-4 (1989).

104

105

10. Ray, M. K. et al. Characteristics of the eukaryotic initiation factor 2 associated 67-kDa

polypeptide. Biochemistry 32, 5151–5159 (1993).

11. Li, X. & Chang, Y.-H. Molecular cloning of a human complementary DNA encoding an initiation

factor 2-associated protein (p67). Biochim. Biophys. Acta BBA - Gene Struct. Expr. 1260, 333–

336 (1995).

12. Bose, A., Saha, D. & Gupta, N. K. I. Regulation of Protein Synthesis during Vaccinia Viral

Infection of Animal Cells. Arch Biochem Biophys. 2, 362-72 (1997).

13. Saha, D. et al. Viral infection II. Hemin Induces Overexpression of p67 as It Partially Prevents

Appearance of an Active p67-Deglycosylase in Baculovirus-Infected Insect Cells. Arch Biochem

Biophys. 2, 373-82 (1997).

14. Gupta, S. et al. p67 Transcription Regulates Translation in Serum-starved and Mitogen-

activated KRC-7 Cells. J. Biol. Chem. 272, 12699–12704 (1997).

15. Chatterjee, M., Chatterjee, N., Datta, R., Datta, B. & Gupta, N. K. Expression and Activity of

p67 Are Induced during Heat Shock. Biochem. Biophys. Res. Commun. 249, 113–117 (1998).

16. Chatterjee, N., Zou, C., Osterman, J. C. & Gupta, N. K. Cloning and Characterization of the

Promoter Region of a Gene Encoding a 67-kDa Glycoprotein. J. Biol. Chem. 272, 12692–12698

(1997).

17. Langland JO et al. Developmental regulation of a plant encoded inhibitor of eukaryotic

initiation factor 2α phosphorylation. Plant J. 2, 393-400 (1997).

18. Datta, B. Roles of P67/MetAP2 as a tumor suppressor. Biochim. Biophys. Acta BBA - Rev.

Cancer 1796, 281–292 (2009).

105

106

19. Datta, R. et al. Protection of translation initiation factor eIF2 phosphorylation correlates with

eIF2-associated glycoprotein p67 levels and requires the lysine-rich domain I of p67.

Biochimie 83, 919–931 (2001).

20. Datta, R., Tammali, R. & Datta, B. Negative regulation of the protection of eIF2α

phosphorylation activity by a unique acidic domain present at the N-terminus of p67. Exp.

Cell Res. 283, 237–246 (2003).

21. Datta, B. & Datta, R. Mutation at the acidic residue-rich domain of eukaryotic initiation factor

2 (eIF2α)-associated glycoprotein p67 increases the protection of eIF2α phosphorylation

during heat shock. Arch. Biochem. Biophys. 413, 116–122 (2003).

22. Datta, R., Choudhury, P., Ghosh, A., Datta, B. A Glycosylation Site, 60SGTS63, of p67 Is

Required for Its Ability To Regulate the Phosphorylation and Activity of Eukaryotic Initiation

Factor 2α. Biochem, 18, 5453-5460 (2003).

23. Datta, B., Datta, R., Majumdar, A. & Ghosh, A. The stability of eukaryotic initiation factor 2-

associated glycoprotein, p67, increases during skeletal muscle differentiation and that

inhibits the phosphorylation of extracellular signal-regulated kinases 1 and 2. Exp. Cell Res.

303, 174–182 (2005).

24. Nishida, N., Yano, H., Nishida, T., Kamura, T., Kojiro, M., Angiogenesis in cancer. Vascular

Health and Risk Management. 3, 213–219 (2006).

25. Datta, B. Diversified roles of p67/MetAP2 as a regulator of cell growth and differentiation, in

tumor suppression, and in obesity. Current topics in Biochemical Research. 16, 41-52 (2014).

26. Liu, S. Structure of Human Methionine Aminopeptidase-2 Complexed with Fumagillin. Science

282, 1324–1327 (1998).

106

107

27. Majumdar, A., Ghosh, A., Datta, S., Prudner, B. C. & Datta, B. p67/MetAP2 Suppresses K-

RasV12-Mediated Transformation of NIH3T3 Mouse Fibroblasts in Culture and in Athymic

Mice. Biochemistry 49, 10146–10157 (2010).

28. Roberts, P. J. & Der, C. J. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade

for the treatment of cancer. Oncogene 26, 3291–3310 (2007).

29. Prior, I. A., Lewis, P. D. & Mattos, C. A Comprehensive Survey of Ras Mutations in Cancer.

Cancer Res. 72, 2457–2467 (2012).

30. Kaseb, H. & Babiker, H. M. Cancer, Rhabdomyosarcoma. tatPearls Publishing book, 507721,

(2019).

31. Dziuba, I., Kurzawa, P., Dopierała, M., Larque, A. B. & Januszkiewicz-Lewandowska, D.

Rhabdomyosarcoma in children – current pathologic and molecular classification. Pol. J.

Pathol. 69, 20–32 (2018).

32. Hinson, A. R. P. et al. Human Rhabdomyosarcoma Cell Lines for Rhabdomyosarcoma Research:

Utility and Pitfalls. Front. Oncol. 3, (2013).

33. Datta, B., Majumdar, A., Datta, R. & Balusu, R. Treatment of Cells with the Angiogenic

Inhibitor Fumagillin Results in Increased Stability of Eukaryotic Initiation Factor 2-Associated

Glycoprotein, p67, and Reduced Phosphorylation of Extracellular Signal-Regulated Kinases †.

Biochemistry 43, 14821–14831 (2004).

34. Involvement of p67 in Actin Cytoskeleton Dynamics, Survival, Migration, and Motility during

Differentiation of C2C12 Myoblasts into Multinucleated Myotubes. Int. J. Adv. Res. Chem. Sci.

3, (2016).

107

108

35. The N-Terminal Acidic Residue-Rich Domain and Lysine-Rich Domains I and II of P67 are

Required for Stable Expression of Focal Adhesion Kinase (FAK). Int. J. Adv. Res. Chem. Sci. 3,

(2016).

36. Baron, V., Calléja, V., Ferrari, P., Alengrin, F. & Van Obberghen, E. p125 Fak Focal Adhesion

Kinase Is a Substrate for the Insulin and Insulin-like Growth Factor-I Tyrosine Kinase Receptors.

J. Biol. Chem. 273, 7162–7168 (1998).

37. Graham, Z. A., Gallagher, P. M. & Cardozo, C. P. Focal adhesion kinase and its role in skeletal

muscle. J. Muscle Res. Cell Motil. 36, 305–315 (2015).

38. Kurmasheva, R. T. & Houghton, P. J. IGF-I mediated survival pathways in normal and

malignant cells. Biochim. Biophys. Acta BBA - Rev. Cancer 1766, 1–22 (2006).

39. Tsuchiya, K., Hosoi, H., Misawa-Furihata, A., Houghton, P. & Sugimoto, T. Insulin-like growth

factor-I has different effects on myogenin induction and cell cycle progression in human

alveolar and embryonal rhabdomyosarcoma cells. Int. J. Oncol. 31, 41-47 (2007).

40. Devreotes, P. & Horwitz, A. R. Signaling Networks that Regulate Cell Migration. Cold Spring

Harb. Perspect. Biol. 7, a005959 (2015).

41. Wang, G. & Beier, F. Rac1/Cdc42 and RhoA GTPases Antagonistically Regulate Chondrocyte

Proliferation, Hypertrophy, and Apoptosis. J. Bone Miner. Res. 20, 1022–1031 (2005).

42. Hall, A. Rho GTPases and the Actin Cytoskeleton. 279, 7 (1998).

43. Alblazi, K. M. O. & Siar, C. H. Cellular Protrusions - Lamellipodia, Filopodia, Invadopodia and

Podosomes - and their Roles in Progression of Orofacial Tumours: Current Understanding.

Asian Pac. J. Cancer Prev. 16, 2187–2191 (2015).

108

109

44. Camero, S. et al. PARP inhibitors affect growth, survival and radiation susceptibility of human

alveolar and embryonal rhabdomyosarcoma cell lines. J. Cancer Res. Clin. Oncol. 145, 137–

152 (2019).

45. Sphingosine Induces Apoptosis and Down-regulation of MYCN in PAX3–FOXO1-positive

Alveolar Rhabdomyosarcoma Cells Irrespective of TP53 Mutation. Anticancer Res. 38, (2018).

46. Nguyen, T. H. & Barr, F. G. Therapeutic Approaches Targeting PAX3-FOXO1 and Its Regulatory

and Transcriptional Pathways in Rhabdomyosarcoma. Molecules 23, 2798 (2018).

47. Zeng, F.-Y., Dong, H., Cui, J., Liu, L. & Chen, T. Glycogen synthase kinase 3 regulates PAX3–

FKHR-mediated cell proliferation in human alveolar rhabdomyosarcoma cells. Biochem.

Biophys. Res. Commun. 391, 1049–1055 (2010).

48. Liu, L., Wu, J., Ong, S. S. & Chen, T. Cyclin-Dependent Kinase 4 Phosphorylates and Positively

Regulates PAX3-FOXO1 in Human Alveolar Rhabdomyosarcoma Cells. PLoS ONE 8, e58193

(2013).

49. Thalhammer, V. et al. PLK1 Phosphorylates PAX3-FOXO1, the Inhibition of Which Triggers

Regression of Alveolar Rhabdomyosarcoma. Cancer Res. 75, 98–110 (2015).

50. Böhm, M. et al. Helicase CHD4 is an epigenetic coregulator of PAX3-FOXO1 in alveolar

rhabdomyosarcoma. J. Clin. Invest. 126, 4237–4249 (2016).

51. Gryder, B. E. et al. PAX3–FOXO1 Establishes Myogenic Super Enhancers and Confers BET

Bromodomain Vulnerability. Cancer Discov. 7, 884–899 (2017).

52. Sartorelli, V. et al. Acetylation of MyoD Directed by PCAF Is Necessary for the Execution of

the Muscle Program. Mol. Cell 4, 725–734 (1999).

53. Matsuzaki, H. et al. Acetylation of Foxo1 alters its DNA-binding ability and sensitivity to

phosphorylation. Proc. Natl. Acad. Sci. 102, 11278–11283 (2005).

109

110

54. Bharathy, N. et al. P/CAF mediates PAX3-FOXO1-dependent oncogenesis in alveolar

rhabdomyosarcoma: P/CAF regulates PAX3-FOXO1 stability. J. Pathol. 240, 269–281 (2016).

55. Dilworth, F. J., Seaver, K. J., Fishburn, A. L., Htet, S. L. & Tapscott, S. J. In vitro transcription

system delineates the distinct roles of the coactivators pCAF and p300 during MyoD/E47-

dependent transactivation. Proc. Natl. Acad. Sci. 101, 11593–11598 (2004).

56. Modak, R. et al. Probing p300/CBP Associated Factor (PCAF)-Dependent Pathways with a

Small Molecule Inhibitor. ACS Chem. Biol. 8, 1311–1323 (2013).

57. Dagher, R. et al. Pilot trial of tumor-specific peptide vaccination and continuous infusion

interleukin-2 in patients with recurrent Ewing sarcoma and alveolar rhabdomyosarcoma: an

inter-institute NIH study. Med. Pediatr. Oncol. 38, 158–164 (2002).

58. Rodeberg, D. A., Nuss, R. A., Heppelmann, C. J. & Celis, E. Lack of effective T-lymphocyte

response to the PAX3/FKHR translocation area in alveolar rhabdomyosarcoma. Cancer

Immunol. Immunother. 54, 526–534 (2005).

59. van den Broeke, L. T., Pendleton, C. D., Mackall, C., Helman, L. J. & Berzofsky, J. A.

Identification and Epitope Enhancement of a PAX-FKHR Fusion Protein Breakpoint Epitope in

Alveolar Rhabdomyosarcoma Cells Created by a Tumorigenic Chromosomal Translocation

Inducing CTL Capable of Lysing Human Tumors. Cancer Res. 66, 1818–1823 (2006).

60. Mackall, C. L. et al. A Pilot Study of Consolidative Immunotherapy in Patients with High-Risk

Pediatric Sarcomas. Clin. Cancer Res. 14, 4850–4858 (2008).

61. Mayeenuddin, L. H., Yu, Y., Kang, Z., Helman, L. J. & Cao, L. Insulin-like growth factor 1

receptor antibody induces rhabdomyosarcoma cell death via a process involving AKT and Bcl-

xL. Oncogene 29, 6367–6377 (2010).

110

111

62. Taniguchi, E. et al. PDGFR-A is a therapeutic target in alveolar rhabdomyosarcoma. Oncogene

27, 6550–6560 (2008).

63. Kashima, K. et al. Inhibition of metastasis of rhabdomyosarcoma by a novel neutralizing

antibody to CXC chemokine receptor-4. Cancer Sci. 105, 1343–1350 (2014).

64. Newick, K., O’Brien, S., Moon, E. & Albelda, S. M. CAR T Cell Therapy for Solid Tumors. Annu.

Rev. Med. 68, 139–152 (2017).

65. Yong, C. S. M. et al. CAR T-cell therapy of solid tumors. Immunol. Cell Biol. 95, 356–363 (2017).

66. Srivastava, S. & Riddell, S. R. Chimeric Antigen Receptor T Cell Therapy: Challenges to Bench-

to-Bedside Efficacy. J. Immunol. 200, 459–468 (2018).

67. Fesnak, A. D., June, C. H. & Levine, B. L. Engineered T cells: the promise and challenges of

cancer immunotherapy. Nat. Rev. Cancer 16, 566–581 (2016).

68. Topalian, S. L. et al. Immunotherapy: The Path to Win the War on Cancer? Cell. 161, 185-186

(2015).

69. Lacey, A. et al. Interleukin-24 (IL24) Is Suppressed by PAX3-FOXO1 and Is a Novel Therapy for

Rhabdomyosarcoma. Mol. Cancer Ther. 17, 2756–2766 (2018).

70. Adamus, A. et al. Berberis orthobotrys – A promising herbal anti-tumorigenic candidate for

the treatment of pediatric alveolar rhabdomyosarcoma. J. Ethnopharmacol. 229, 262–271

(2019).

71. Intra-molecular and Intermolecular Proteolysis Activity of p67. Int. J. Adv. Res. Chem. Sci. 3,

(2016).

72. Datta, B. MAPs and POEP of the roads from prokaryotic to eukaryotic kingdoms. Biochimie 82,

95–107 (2000).

111

112

73. Datta, B. et. al Autoproteolysis of Rat p67 Generates Several Peptide Fragments The N-

Terminal Fragment, p26, Is Required for the Protection of eIF2α from Phosphorylation.

Biochem. 11, 3465-3475 (2007).

74. Datta, B., Datta, R., Ghosh, A. & Majumdar, A. The binding between p67 and eukaryotic

initiation factor 2 plays important roles in the protection of eIF2α from phosphorylation by

kinases. Arch. Biochem. Biophys. 452, 138–148 (2006).

75. Datta, B., Datta, R., Ghosh, A. & Majumdar, A. Eukaryotic initiation factor 2-associated

glycoprotein, p67, shows differential effects on the activity of certain kinases during serum-

starved conditions. Arch. Biochem. Biophys. 427, 68–78 (2004).

76. Hanahan, D. & Weinberg, R. A. The Hallmarks of Cancer. Cell 100, 57–70 (2000).

77. Weinstein, I. B., Orenstein, J. M., Gebert, R., Kaighn, M. E. & Stadler, U. C. Growth and

Structural Properties of Epithelial Cell Cultures Established from Normal Rat Liver and

Chemically Induced. 35, 12 (1975).

78. Shern, J. F. et al. Comprehensive Genomic Analysis of Rhabdomyosarcoma Reveals a

Landscape of Alterations Affecting a Common Genetic Axis in Fusion-Positive and Fusion-

Negative Tumors. Cancer Discov. 4, 216–231 (2014).

79. Wang, C. Childhood Rhabdomyosarcoma: Recent Advances and Prospective Views. J. Dent.

Res. 91, 341–350 (2012).

80. Thulasi, R. et al. Alpha_2a-interferon-induced_differentiation_of_human Alveolar

Rhabdomyosarcoma cells: Correlation with Down-regulation of the insulin-like Growth factor

Type I Receptor. Cell growth & differentiation, 7, 531-541, (1996).

81. Weintraub, H. The MyoD family and myogenesis: Redundancy, networks, and thresholds. Cell

75, 1241–1244 (1993).

112

113

82. P67 is involved in the regulation of cytoskeleton dynamics by modulating the expression and

activity of Pak1 in differentiated C2C12 myoblasts. Int. J. Adv. Res. Chem. Sci. 3, (2016).

83. Clemente, C. F. M. Z., Corat, M. A. F., Saad, S. T. O. & Franchini, K. G. Differentiation of C 2 C

12 myoblasts is critically regulated by FAK signaling. Am. J. Physiol.-Regul. Integr. Comp. Physiol.

289, R862–R870 (2005).

84. Crossland, H. et al. Focal adhesion kinase is required for IGF-I-mediated growth of skeletal

muscle cells via a TSC2/mTOR/S6K1-associated pathway. Am. J. Physiol.-Endocrinol. Metab.

305, E183–E193 (2013).

85. Quach, N. L., Biressi, S., Reichardt, L. F., Keller, C. & Rando, T. A. Focal Adhesion Kinase

Signaling Regulates the Expression of Caveolin 3 and ␤1 Integrin, Genes Essential for Normal

Myoblast Fusion. Mol. Biol. Cell 20, 14 (2009).

86. Sadagurski, M. et al. Insulin receptor substrate 1 (IRS-1) plays a unique role in normal

epidermal physiology. J. Cell. Physiol. 213, 519–527 (2007).

87. Jothi, M. & Mal, A. K. Too much AKT turns PAX3-FKHR dead: A prospect of novel therapeutic

strategy for alveolar rhabdomyosarcoma. Oncotarget 3, (2012).

88. Buckingham, M. & Rigby, P. W. J. Gene Regulatory Networks and Transcriptional Mechanisms

that Control Myogenesis. Dev. Cell 28, 225–238 (2014).

89. Potthoff, M. J. & Olson, E. N. MEF2: a central regulator of diverse developmental programs.

Development 134, 4131–4140 (2007).

90. Duronio, R. J. & Xiong, Y. Signaling Pathways that Control Cell Proliferation. Cold Spring Harb.

Perspect. Biol. 5, a008904–a008904 (2013).

91. Dedieu, S. et al. Myoblast migration is regulated by calpain through its involvement in cell

attachment and cytoskeletal organization. Exp. Cell Res. 292, 187–200 (2004).

113

114

92. Wang, P.-Y., Yu, H.-T. & Tsai, W.-B. Modulation of alignment and differentiation of skeletal

myoblasts by submicron ridges/grooves surface structure. Biotechnol. Bioeng. 106, 285-94

(2010).

93. Ostrovidov, S. et al. Skeletal Muscle Tissue Engineering: Methods to Form Skeletal Myotubes

and Their Applications. Tissue Eng. Part B Rev. 20, 403–436 (2014).

94. Vaz, R., Martins, G. G., Thorsteinsdóttir, S. & Rodrigues, G. Fibronectin promotes migration,

alignment and fusion in an in vitro myoblast cell model. Cell Tissue Res. 348, 569–578 (2012).

95. Louis, M., Zanou, N., Van Schoor, M. & Gailly, P. TRPC1 regulates skeletal myoblast migration

and differentiation. J. Cell Sci. 121, 3951–3959 (2008).

96. Mattila, P. K. & Lappalainen, P. Filopodia: molecular architecture and cellular functions. Nat.

Rev. Mol. Cell Biol. 9, 446–454 (2008).

97. Stuhrmann, B., Huber, F. & Käs, J. Robust Organizational Principles of Protrusive Biopolymer

Networks in Migrating Living Cells. PLoS ONE 6, e14471 (2011).

98. Barreiro, O. Interactive protrusive structures during leukocyte adhesion and transendothelial

migration. Front. Biosci. 9, 1849 (2004).

99. Chal, J. & Pourquié, O. Making muscle: skeletal myogenesis in vivo and in vitro. Development

144, 2104–2122 (2017).

100. Okazaki, K and Holtzer, H. myogenesis fusion myosin synthesis and mitosis. Proc Natl Acad

Sci U S A. 56, 1484–1490 (1966).

101. Sampath, S. C., Sampath, S. C. & Millay, D. P. Myoblast fusion confusion: the resolution begins.

Skelet. Muscle 8, (2018).

102. Otabe, O. et al. MET/ERK2 pathway regulates the motility of human alveolar

rhabdomyosarcoma cells. Oncol. Rep. 37, 98–104 (2017).

114

115

103. Insall, R. H. & Machesky, L. M. Actin Dynamics at the Leading Edge: From Simple

Machinery to Complex Networks. Dev. Cell 17, 310–322 (2009).

104. Kamai, T. Overexpression of RhoA, Rac1, and Cdc42 GTPases Is Associated with

Progression in Testicular Cancer. Clin. Cancer Res. 10, 4799–4805 (2004).

105. Liang, C.-C., Park, A. Y. & Guan, J.-L. In vitro scratch assay: a convenient and inexpensive

method for analysis of cell migration in vitro. Nat. Protoc. 2, 329–333 (2007).

115