DOCSLIB.ORG

Chloroplast Microsatellite Primers for Cacao

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chloroplast Microsatellite Primers for Cacao American Journal of Botany: e372–e374. 2011. AJB Primer Notes & Protocols in the Plant Sciences C HLOROPLAST MICROSATELLITE PRIMERS FOR CACAO ( T HEOBROMA CACAO ) AND OTHER MALVACEAE 1 Ji Y. Yang 2,5 , Lambert A. Motilal 3 , Hannes Dempewolf2 , Kamaldeo Maharaj 4 , and Q. C. B. Cronk 2 2 Department of Botany, University of British Columbia, 6270 University Boulevard, Vancouver, British Columbia, V6T 1Z4 Canada; 3 Cocoa Research Unit, University of the West Indies, St. Augustine, Trinidad, Republic of Trinidad and Tobago, West Indies; and 4 Ministry of Agriculture, Land, and Marine Resources, Central Experiment Station, Centeno, Via Arima P.O., Republic of Trinidad and Tobago, West Indies • Premise of the study: Chloroplast microsatellites were developed in Theobroma cacao to examine the genetic diversity of cacao cultivars in Trinidad and Tobago. • Methods and Results: Nine polymorphic microsatellites were designed from the chloroplast genomes of two T. cacao acces- sions. These microsatellites were tested in 95 hybrid accessions from Trinidad and Tobago. An average of 2.9 alleles per locus was found. • Conclusions: These chloroplast microsatellites, particularly the highly polymorphic pentameric repeat , were useful in assessing genetic variation in T. cacao . In addition, these markers should also prove to be useful for population genetic studies in other species of Malvaceae. Key words: chloroplast haplotype; chocolate; Malvaceae; microsatellites; Theobroma cacao ; Trinitario . Theobroma cacao L. (Malvaceae) is one of the most eco- including barley ( Provan et al., 1999 ) and grapevine ( Arroyo- nomically important crops grown in tropical regions of the Garcia et al., 2002 ). In addition, because of their nonrecombi- world. There are three major varietal groups of cacao: the nant and uniparentally inherited nature, cpSSRs are the ideal Forastero, the Criollo, and the Trinitario. The Forastero is the markers for cultivar origin and pedigree studies. Thus, cpSSR most common; the Criollo is the most prized and expensive, markers should be useful to unravel the history of crosses that but has a lower yield and is more susceptible to diseases than produced the many Trinitario accessions currently found today. the Forastero; and the Trinitario is thought to be of hybrid In this study, we designed and characterized nine cpSSR origin with Criollo and Forastero parents. The Trinitario is markers to estimate the genetic variation of Trinitario cultivars considered to combine the high fl avor quality of Criollo with in Trinidad and Tobago. the high-yield and disease-resistant properties of Forastero (http://www.icco.org/about/growing.aspx; Wood and Lass, 1985 ). As the name implies, Trinitario varieties arose through METHODS AND RESULTS accidental hybridization in Trinidad and Tobago, and it is the most common varietal group planted in the country. Further- Using the two complete cpDNA genome sequences from two accessions of more, there is a large germplasm collection of Trinitarios at T. cacao ( Sveinsson et al., 2010 ; Jansen et al., 2011 ), we selected for polymor- phic cpSSR markers. The most common repeat motifs found were mononu- the International Cocoa Genebank, Trinidad (ICG, T). How- cleotides, and we selected for ones with the longest repeat number. We also ever, fi eld genebanks of cacao contain many mislabeled and selected one each of polymorphic penta-, hexa-, and octanucleotides because misidentifi ed plants ( Motilal et al., 2009 ; Irish et al., 2010 ). their alleles are easier to score. The nine primers were designed using Primer3 There is a need for a standardized, reliable method to geneti- software (Rozen and Skaletsky, 2000 ) with an expected product size range cally identify different Trinitario varieties and to estimate their from 150 to 450 bp. overall genetic diversity. Genomic DNA was extracted from fresh and silica gel – dried leaves using a QIAamp DNA Stool Mini Kit (QIAGEN, Valencia, California, USA). PCR Chloroplast simple sequence repeat (cpSSR) markers, or amplifi cations were performed in a fi nal volume of 15 μ L, containing 10 ng microsatellites, have proved useful as genetic markers for of DNA, 1 × reaction PCR buffer (10 mM Tris-HCl pH 8.3, 50 mM KCl), 200 μ distinguishing among different cultivars in several crop species M of each dNTP, 1.5 mM MgCl2 , 1 U of Taq DNA polymerase (Fermentas Canada, Burlington, Ontario, Canada ), 0.05 μ M forward primer, 0.5 μ M μ 1 reverse primer, and 0.5 M dye-labeled universal primer. Four dyes (VIC, Manuscript received 21 June 2011; revision accepted 26 July 2011. FAM, NED, and PET) were used (Applied Biosystems, Carlsbad, California, The authors thank Dapeng Zhang for sharing his knowledge on USA). PCR reactions were performed using a BIO-RAD thermocycler with a Theobroma cacao and Nolan Kane and Saimi Sveinsson for their help with touch-down program: 95 ° C for 3 min; followed by nine cycles of 94 ° C for 30 bioinformatics. The work was supported by a World Bank Development s, 65 ° C for 30 s (temperature decreased by 1 ° C for every cycle), and 72 ° C for Marketplace grant awarded to Q. C. B. Cronk and J. M. M. Engels. 45 s; followed by 29 cycles of 94 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 45 s; and 5 Author for correspondence: [email protected] a fi nal extension at 72 ° C for 20 min. Each microsatellite marker was amplifi ed singly and then pooled based on differences in fl uorescent labeling and ex- doi:10.3732/ajb.1100306 pected fragment size. The nine markers were arranged in two multiplex sets American Journal of Botany: e372–e374, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America e372 December 2011] AJB Primer Notes & Protocols — Cacao chloroplast SSRs e373 Table 1. Characterization of nine chloroplast microsatellite primers in Theobroma cacao . For each locus, the primer name, forward and reverse primer sequence, repeat motif, product size range, number of alleles, unbiased haplotype diversity index , annealing temperature, and GenBank accession number are shown. No. of ′ ′ ° Primers Primer sequence (5 – 3 ) Repeat motif Size range (bp) alleles h Ta ( C) GenBank Accession No. CaCrSSR1F: CATGGATTCAGCAGCAGTTC (CTTTA)11 359 – 409 7 0.78 55 JF979116 R: CGAGTCCGCTTATCTCCAAC CaCrSSR2F: TTCAACCCAATCGCTCTTTT (A)12 237 – 239 3 0.63 55 JF979117 R: AATTTGAATGATTACCCGATCT CaCrSSR3F: AGAACGAATCCGCTCCTCTT (TAAAAG)2 208 – 214 2 0.46 55 JF979118 R: GGTCACGGCAACATAACAAC CaCrSSR4F: GAACGACGGGAATTGAACC (T)10 180 – 181 2 0.44 55 JF979119 R: TGATGAATCGTAGAAATGGAAA CaCrSSR5F: TCACTTTCACTCCTTTTCCATTT (T)13 199 – 209 4 0.5 55 JF979120 R: TTTTGACTCCGTTTAGACATAGG CaCrSSR6F: CGAATCCCTTTCTTCATACAAA (C)8 175 – 176 2 0.47 55 JF979121 R: TTTCATGTTTTGATTGCATCG CaCrSSR7F: AGGGCTCCGTAAGATCCAGT (T)11 285 – 286 2 0.46 55 JF979122 R: GTCTTAGGCCTTGCGATTCA CaCrSSR8F: TTTCTGATTCACCGGCTCTT (T)11 299 – 300 2 0.46 55 JF979123 R: TGGTGGAATTCTTTGCATTG CaCrSSR9F: TCCACTCAGCCATCTCTCCT (TACTTTAT)11 338 – 346 2 0.73 55 JF979124 R: GTCCCTTTTGAGCGAAATCA Note : h = unbiased haploid diversity index; Ta = annealing temperature. (1) CaCrSSR1 (FAM), CaCrSSR2 (FAM), CaCrSSR3 (VIC), CaCrSSR8 (NED) ( Peakall and Smouse, 2006 ) was from 0.444 to 0.797. The pentameric cpSSR and (2) CaCrSSR10 (VIC), CaCrSSR4 (PET), CaCrSSR6 (NED), CaCrSSR5 was the most polymorphic with seven alleles and was the most informative in (FAM), CaCrSSR10 (FAM). An ABI 3730 automated DNA Sequencer (Applied identifying cultivars within the Trinitario varietal group. We detected eight hap- Biosystems) was used to genotype the multiplex sets. The software GeneMapper lotypes out of the 95 Trinitarios sampled by using all nine cpSSR markers ( Table version 3.2 (Applied Biosystems) was used to call the allele sizes. 2 ) . The eight haplotypes varied in frequency ranging from 0.011 (1 out of 95) Marker CaCrSSR1, the pentameric repeat, differed by eight repeats in to 0.326 (31 out of 95). These cpSSRs may also prove useful in identifying the two T. cacao accessions, from which we designed the cpSSR primers. cultivars within and among the 10 population groups said to be present in T. This marker was the only one to exhibit two alleles. These two alleles cacao ( Motamayor et al., 2008 ). differed in amplifi cation intensities and level of polymorphism. The lower The high degree of sequence conservation found in chloroplast genomes (Pro- intensity allele (362 bp) had about a third of the concentration. This allele van et al., 1999 ) should enable the primers to be used in other species of Malva- did not create a problem in scoring as it was monomorphic in all 95 samples ceae. We tested the nine cpSSR primers on Gossypium tomentosum Nutt. ex in the current study with a product size that was easily distinguished Seem . Out of the nine cpSSRs, six amplifi ed successfully (CaCrSSR1, CaCrSSR2, from the real pentameric product. The higher intensity allele was highly CaCrSSR5, CaCrSSR6, CaCrSSR7, and CaCrSSR8). A BLAST search was con- polymorphic. We hypothesize that the monomorphic allele may be a cross- ducted on the amplifi ed pentameric cpSSR sequence (CaCrSSR1) from the amplifying product found in nuclear DNA. Further investigation is, how- National Center for Biotechnology Information website (http://www.ncbi.nlm ever, necessary to establish defi nitively the monomorphic nature of this .nih.gov) and obtained nearly perfect hit scores to chloroplasts of three species of extra product. Gossypium L. The primer sequences matched completely, but the number of We tested for microsatellite polymorphism in 95 accessions from Trini- pentanucleotide repeats differed. Overall, Gossypium had fewer pentanucleotide dad and Tobago (see Appendix 1). Sixty-four individuals were collected repeats than T. cacao. GenBank accessions of G. thurberi Tod. and G. barbadense from 33 different farmers from Trinidad; eight individuals were collected from L. both showed three pentanucleotide repeats while G. hirsutum L. had two. In six different farmers from Tobago. The remaining 23 came from the ICG, T addition, we also tested the primers on four species of Sidalcea A. Gray collection (one sample from Grenada Selection [GS], 14 samples from Impe- ( S.
Load more

Recommended publications
  • Polyploidy and the Evolutionary History of Cotton
    POLYPLOIDY AND THE EVOLUTIONARY HISTORY OF COTTON Jonathan F. Wendel1 and Richard C. Cronn2 1Department of Botany, Iowa State University, Ames, Iowa 50011, USA 2Pacific Northwest Research Station, USDA Forest Service, 3200 SW Jefferson Way, Corvallis, Oregon 97331, USA I. Introduction II. Taxonomic, Cytogenetic, and Phylogenetic Framework A. Origin and Diversification of the Gossypieae, the Cotton Tribe B. Emergence and Diversification of the Genus Gossypium C. Chromosomal Evolution and the Origin of the Polyploids D. Phylogenetic Relationships and the Temporal Scale of Divergence III. Speciation Mechanisms A. A Fondness for Trans-oceanic Voyages B. A Propensity for Interspecific Gene Exchange IV. Origin of the Allopolyploids A. Time of Formation B. Parentage of the Allopolyploids V. Polyploid Evolution A. Repeated Cycles of Genome Duplication B. Chromosomal Stabilization C. Increased Recombination in Polyploid Gossypium D. A Diverse Array of Genic and Genomic Interactions E. Differential Evolution of Cohabiting Genomes VI. Ecological Consequences of Polyploidization VII. Polyploidy and Fiber VIII. Concluding Remarks References The cotton genus (Gossypium ) includes approximately 50 species distributed in arid to semi-arid regions of the tropic and subtropics. Included are four species that have independently been domesticated for their fiber, two each in Africa–Asia and the Americas. Gossypium species exhibit extraordinary morphological variation, ranging from herbaceous perennials to small trees with a diverse array of reproductive and vegetative
    [Show full text]
  • Invasive Aphids Attack Native Hawaiian Plants
    Biol Invasions DOI 10.1007/s10530-006-9045-1 INVASION NOTE Invasive aphids attack native Hawaiian plants Russell H. Messing Æ Michelle N. Tremblay Æ Edward B. Mondor Æ Robert G. Foottit Æ Keith S. Pike Received: 17 July 2006 / Accepted: 25 July 2006 Ó Springer Science+Business Media B.V. 2006 Abstract Invasive species have had devastating plants. To date, aphids have been observed impacts on the fauna and flora of the Hawaiian feeding and reproducing on 64 native Hawaiian Islands. While the negative effects of some inva- plants (16 indigenous species and 48 endemic sive species are obvious, other species are less species) in 32 families. As the majority of these visible, though no less important. Aphids (Ho- plants are endangered, invasive aphids may have moptera: Aphididae) are not native to Hawai’i profound impacts on the island flora. To help but have thoroughly invaded the Island chain, protect unique island ecosystems, we propose that largely as a result of anthropogenic influences. As border vigilance be enhanced to prevent the aphids cause both direct plant feeding damage incursion of new aphids, and that biological con- and transmit numerous pathogenic viruses, it is trol efforts be renewed to mitigate the impact of important to document aphid distributions and existing species. ranges throughout the archipelago. On the basis of an extensive survey of aphid diversity on the Keywords Aphid Æ Aphididae Æ Hawai’i Æ five largest Hawaiian Islands (Hawai’i, Kaua’i, Indigenous plants Æ Invasive species Æ Endemic O’ahu, Maui, and Moloka’i), we provide the first plants Æ Hawaiian Islands Æ Virus evidence that invasive aphids feed not just on agricultural crops, but also on native Hawaiian Introduction R.
    [Show full text]
  • Methods to Enable the Coexistence of Diverse Cotton Production Systems
    AGRICULTURAL BIOTECHNOLOGY IN CALIFORNIA SERIES PUBLICATION 8191 Methods to Enable the Coexistence of Diverse Cotton Production Systems ROBERT B. HUTMACHER, Extension Agronomist, University of California Shafter Research and Extension Center and University of California, Davis, Department of Plant Science; RON N. VARGAS, County Director and Farm Advisor, University of California Cooperative UNIVERSITY OF Extension, Madera and Merced Counties; STEVEN D. WRIGHT, Farm Advisor, University of CALIFORNIA California Cooperative Extension, Tulare and Kings Counties Division of Agriculture Upland cotton (Gossypium hirsutum) and Pima cotton (G. barbadense) are the two and Natural Resources types of cotton produced commercially in California. In acreage as well as crop http://anrcatalog.ucdavis.edu value, over the past 5 years cotton has typically ranked in the top three in agronomic field crops grown in California. During that period, plantings of upland cotton in California have ranged from about 400,000 to over 650,000 acres (160,000 to 260,000 ha), while Pima plantings have ranged from about 140,000 to over 250,000 acres (56,000 to 101,000 ha). Does cross-pollination occur in cotton? Both upland and Pima cotton are variously referred to as “largely self-pollinated” or “partially cross-pollinated.” These descriptions acknowledge that these types of cotton are mostly self-pollinated but some cross-pollination can occur, albeit at relatively low incidence rates, through activity of pollinating insects or by wind dispersion. The pol- len of both wild and cultivated Gossypium species is large in size and among the heaviest among angiosperms, the group of plants that produces flowers, fruit, and seeds.
    [Show full text]
  • *Wagner Et Al. --Intro
    NUMBER 60, 58 pages 15 September 1999 BISHOP MUSEUM OCCASIONAL PAPERS HAWAIIAN VASCULAR PLANTS AT RISK: 1999 WARREN L. WAGNER, MARIE M. BRUEGMANN, DERRAL M. HERBST, AND JOEL Q.C. LAU BISHOP MUSEUM PRESS HONOLULU Printed on recycled paper Cover illustration: Lobelia gloria-montis Rock, an endemic lobeliad from Maui. [From Wagner et al., 1990, Manual of flowering plants of Hawai‘i, pl. 57.] A SPECIAL PUBLICATION OF THE RECORDS OF THE HAWAII BIOLOGICAL SURVEY FOR 1998 Research publications of Bishop Museum are issued irregularly in the RESEARCH following active series: • Bishop Museum Occasional Papers. A series of short papers PUBLICATIONS OF describing original research in the natural and cultural sciences. Publications containing larger, monographic works are issued in BISHOP MUSEUM four areas: • Bishop Museum Bulletins in Anthropology • Bishop Museum Bulletins in Botany • Bishop Museum Bulletins in Entomology • Bishop Museum Bulletins in Zoology Numbering by volume of Occasional Papers ceased with volume 31. Each Occasional Paper now has its own individual number starting with Number 32. Each paper is separately paginated. The Museum also publishes Bishop Museum Technical Reports, a series containing information relative to scholarly research and collections activities. Issue is authorized by the Museum’s Scientific Publications Committee, but manuscripts do not necessarily receive peer review and are not intended as formal publications. Institutions and individuals may subscribe to any of the above or pur- chase separate publications from Bishop Museum Press, 1525 Bernice Street, Honolulu, Hawai‘i 96817-0916, USA. Phone: (808) 848-4135; fax: (808) 841-8968; email: [email protected]. Institutional libraries interested in exchanging publications should write to: Library Exchange Program, Bishop Museum Library, 1525 Bernice Street, Honolulu, Hawai‘i 96817-0916, USA; fax: (808) 848-4133; email: [email protected].
    [Show full text]
  • Vascular Plant Species with Documented Or Recorded Occurrence in Placer County
    A PPENDIX II Vascular Plant Species with Documented or Reported Occurrence in Placer County APPENDIX II. Vascular Plant Species with Documented or Reported Occurrence in Placer County Family Scientific Name Common Name FERN AND FERN ALLIES Azollaceae Mosquito fern family Azolla filiculoides Pacific mosquito fern Dennstaedtiaceae Bracken family Pteridium aquilinum var.pubescens Bracken fern Dryopteridaceae Wood fern family Athyrium alpestre var. americanum Alpine lady fern Athyrium filix-femina var. cyclosorum Lady fern Cystopteris fragilis Fragile fern Polystichum imbricans ssp. curtum Cliff sword fern Polystichum imbricans ssp. imbricans Imbricate sword fern Polystichum kruckebergii Kruckeberg’s hollyfern Polystichum lonchitis Northern hollyfern Polystichum munitum Sword fern Equisetaceae Horsetail family Equisetum arvense Common horsetail Equisetum hyemale ssp. affine Scouring rush Equisetum laevigatum Smooth horsetail Isoetaceae Quillwort family Isoetes bolanderi Bolander’s quillwort Isoetes howellii Howell’s quillwort Isoetes orcuttii Orcutt’s quillwort Lycopodiaceae Club-moss family Lycopodiella inundata Bog club-moss Marsileaceae Marsilea family Marsilea vestita ssp. vestita Water clover Pilularia americana American pillwort Ophioglossaceae Adder’s-tongue family Botrychium multifidum Leathery grapefern Polypodiaceae Polypody family Polypodium hesperium Western polypody Pteridaceae Brake family Adiantum aleuticum Five-finger maidenhair Adiantum jordanii Common maidenhair fern Aspidotis densa Indian’s dream Cheilanthes cooperae Cooper’s
    [Show full text]
  • Wildflower Guide
    Pussypaws (or Pussy Toes) Sierra Morning Glory Western Peony Calyptridium umbellatum Calystegia malacophylla Paeonia brownii Portulacaceae (Purslane) family Convolvulaceae (Morning Glory) family Paeoniaceae (Peony) family May-August July–August May-June The flower head clusters are reminiscent There are over 1,000 species of morning This flower’s petals are maroon to of fuzzy kitten paws. The stems and glory worldwide. Many bloom in the early brownish and the flower usually nods, flower heads are often almost prostrate morning hours, giving the family or points downward, so it can be easy (lying on the ground). Pussypaws are its name. Tahoe Donner is near the upper to miss. widespread and somewhat variable. elevation of the range for Sierra morning glory. Rabbitbrush Snow Plant Willow WILDFLOWER Ericameria sp. Sarcodes sanguinea Salix spp. Asteraceae (Sunflower or Aster) family Ericaceae (Heath) family Salicaceae (Willow) family GUIDE August–October May–June March–June This shrub is common throughout the Appears almost as soon as snow melts. There are several types of willow in Tahoe Donner area. The tips of the Saprophytic plant: obtains nutrients from the Tahoe Donner area, with blooming branches look yellow throughout the decaying organic matter in the soil (no seasons that extend from March at least blooming season. photosynthesis). through June. The picture shows typical early-spring catkins (buds) that are getting ready to bloom, and gives the smaller types of willow the familiar name pussy willow. Ranger’s Buttons Varileaf Phacelia Woolly Mule Ears Sphenosciadium capitellatum Phacelia heterophylla Wyethia mollis Apiaceae (Carrot) family Hydrophyllaceae (Waterleaf) family Asteraceae (Sunflower or Aster) family July–August April–July June–July Often found in wet or swampy places.
    [Show full text]
  • Cotton Facts
    CottonFacts M. Rafiq Chaudhry Andrei Guitchounts International Cotton Advisory Committee CottonFacts CottonFacts Technical Paper No. 25 of the Common Fund for Commodities M. Rafiq Chaudhry Andrei Guitchounts International Cotton Advisory Committee Cotton Producing Areas in the World Europe Americas iv Asia Africa Oceania by Carmen S. León v Copyright © 2003 Common Fund for Commodities International Cotton Advisory Committee All rights are reserved. "Fair use" of the information in this book is permitted provided the reference is properly acknowledged. For additional permission contact the International Cotton Advisory Committee at [email protected]. First Edition 2003 ISBN 0-9704918-3-2 Library of Congress Control No. 2003107604 Contents Cotton Map . .iv Foreword . .xi Introduction . .xiii Acknowledgements . .xv 1. The Cotton Plant and its Organs . .1 The Plant . .1 Taxonomy . .1 Nodes . .3 Branches . .3 Flower . .4 Root . .5 Seed . .6 Leaf . .10 Boll . .13 Yield . .14 Production Technology . .15 Organic Cotton . .15 Precision Agriculture . .16 2. Breeding . .17 Breeding Methods . .18 Hybrid Cotton . .22 Biotechnology . .25 Genetic Engineering . .25 Milestones in Genetic Engineering of Cotton . .31 Natural Outcrossing . .32 Gossypol . .33 Colored Cotton . .34 Contents vii 3. Agronomy and Physiology . .35 Growth and Fruit Formation . .35 Nutrition . .40 Weed Control . .43 4. Diseases . .45 5. Insects . .57 Insect Identification, Biology and Nature of Damage . .57 Sucking Insects . .57 Feeders . .62 Bollworms . .68 Natural Enemies (Beneficials) . .73 Insect Parasites . .76 Pathogens . .77 Insecticide Resistance . .77 Insect Control Methods . .79 Commonly Used Terms in Insect Pest Control . .83 6. Fiber Quality . .85 Fiber Formation . .85 Fiber Quality Parameters . .87 Machine Picking . .90 Ginning . .92 Cotton Cleaning .
    [Show full text]
  • Origin and Evolution of Hawaiian Endemics: New Patterns Revealed by Molecular Phylogenetic Studies
    4 Origin and evolution of Hawaiian endemics: new patterns revealed by molecular phylogenetic studies S t e r l i n g C . K e e l e y a n d V i c k i A . F u n k The current high islands of the Hawaiian archipelago are among the most remote land masses in the world. They lie 3500 km from California, the nearest contin- ental source, and approximately 2300 km from the Marquesas , the nearest islands ( Fig. 4.1 ). They are the southernmost islands in the Hawaiian Ridge , formed succes- sively over a ‘hot spot’ that has allowed magma to penetrate the Pacifi c Plate. The plate has moved gradually north and northwestwards over the past 85 Ma, leaving the previously formed islands to gradually erode and subside (Clague, 1996 ). The current high islands ( Fig. 4.1 , inset) range in age from Kauai /Niihau (5.1–4.9 Ma), to Oahu (3.7–2.6 Ma), to Maui Nui (2.2–1.2 Ma), during the Pleistocene compris- ing several islands – West Maui (1.3 Ma), East Maui (0.75 Ma), Molokai (1.76–1.90 Ma), Lanai (1.28 Ma) and Kaho’olawe (1.03 Ma) – and Hawaii (0.5 Ma to present) (Price & Clague, 2002 ). Important for the establishment and evolution of the extant Hawaiian fl ora is the historic pattern of island formation within the archipelago. For example, islands with elevations greater than 1000 m did not exist from 30 to 23 Ma and from c . 8 to 5 Ma when the current high islands began to emerge (Clague, 1996 ; Price & Clague, 2002 ; Clague et al ., 2010 ).
    [Show full text]
  • Evolution and Natural History of the Cotton Genus
    Evolution and Natural History of the Cotton Genus Jonathan F. Wendel, Curt Brubaker, Ines Alvarez, Richard Cronn, and James McD. Stewart Abstract We present an overview of the evolution and diversity in Gossypium (the cotton genus). This framework facilitates insight into fundamental aspects of plant biology, provides the necessary underpinnings for effective utilization of cotton genetic resources, and guides exploration of the genomic basis of morphological diversity in the genus. More than 50 species of Gossypium are distributed in arid to semi-arid regions of the tropics and subtropics. Included are four species that independently have been domesticated for their fiber, two each in Africa-Asia and the Americas. Gossypium species exhibit extraordin- ary morphological variation, ranging from trailing herbaceous perennials to 15 m trees with a diverse array of reproductive and vegetative characteris- tics. A parallel level of cytogenetic and genomic diversity has arisen during the global radiation of the genus, leading to the evolution of eight groups of diploid (n 13) species (genome groups A through G, and K). Data implicate an origin for¼Gossypium about 5–10 million years ago and a rapid early diversification of the major genome groups. Allopolyploid cottons appear to have arisen within the last 1–2 million years, as a consequence of trans-oceanic dispersal of an A-genome taxon to the New World followed by hybridization with an indigen- ous D-genome diploid. Subsequent to formation, allopolyploids radiated into three modern lineages, two of which contain the commercially important species G. hirsutum and G. barbadense. 1 Introduction to Gossypium diversity Because the cotton genus (Gossypium L.) is so important to economies around the world, it has long attracted the attention of agricultural scientists, taxono- mists, and evolutionary biologists.
    [Show full text]
  • Plants of Hot Springs Valley and Grover Hot Springs State Park Alpine County, California
    Plants of Hot Springs Valley and Grover Hot Springs State Park Alpine County, California Compiled by Tim Messick and Ellen Dean This is a checklist of vascular plants that occur in Hot Springs Valley, including most of Grover Hot Springs State Park, in Alpine County, California. Approximately 310 taxa (distinct species, subspecies, and varieties) have been found in this area. How to Use this List Plants are listed alphabetically, by family, within major groups, according to their scientific names. This is standard practice for plant lists, but isn’t the most user-friendly for people who haven’t made a study of plant taxonomy. Identifying species in some of the larger families (e.g. the Sunflowers, Grasses, and Sedges) can become very technical, requiring examination of many plant characteristics under high magnification. But not to despair—many genera and even species of plants in this list become easy to recognize in the field with only a modest level of study or help from knowledgeable friends. Persistence will be rewarded with wonder at the diversity of plant life around us. Those wishing to pursue plant identification a bit further are encouraged to explore books on plants of the Sierra Nevada, and visit CalPhotos (calphotos.berkeley.edu), the Jepson eFlora (ucjeps.berkeley.edu/eflora), and CalFlora (www.calflora.org). The California Native Plant Society (www.cnps.org) promotes conservation of plants and their habitats throughout California and is a great resource for learning and for connecting with other native plant enthusiasts. The Nevada Native Plant Society nvnps.org( ) provides a similar focus on native plants of Nevada.
    [Show full text]
  • AFLP Mediated Genetic Diversity of Malvaceae Species
    Journal of Medicinal Plants Research Vol. 4(2), pp. 148-154, 18 January, 2010 Available online at http://www.academicjournals.org/JMPR ISSN 1996-0875© 2010 Academic Journals Full Length Research Paper AFLP mediated genetic diversity of malvaceae species Nighat Shaheen1, S. R. Pearce2, Mir Ajab Khan1, Tariq Mahmood1, Ghazalah Yasmin1 and Muhammad Qasim Hayat1 1Department of Plant Sciences, Quaid-i-Azam University, Islamabad-45320, Pakistan. 2School of Life Sciences, JMS Building, University of Sussex, Falmer, Brighton, BN19QG, United Kingdom. Accepted 22 December, 2009 AFLP (Amplified fragment length polymorphism) marker system is a reliable method in the evaluation of genetic diversity among different species. It was used to explore phenetic relationships and diversity within and between 13 Malvaceae species belonging to 5 different genera. The primary objective of the study was to evaluate the taxonomic potential, usefulness and applicability of AFLP marker system to reconstruct genetic relationships at interspecific and intergeneric level in Malvaceae. In total, 28 accessions comprising 13 species were included in the study but for assorted technical reasons five profiles remained incomplete or with ambiguous banding pattern. Therefore 23 accessions comprising 12 species were included in the final analysis. Two primer pairs produced a total of 73 bands, of which 70 were polymorphic. Neighbor Joining (NJ) tree showed that all 23 accessions were basically classified in three main clusters and several sub-clusters. The tree had well supported branches especially at the level of accessions and species. However, it also had poor bootsrap support at some intermediate and deeper branches. The informative value of the technique was evaluated by comparing the current results with earlier morphological and molecular investigations.
    [Show full text]
  • Downloaded from Genbank on That Full Plastid Genomes Are Not Sufficient to Reject Al- February 28, 2012
    Ruhfel et al. BMC Evolutionary Biology 2014, 14:23 http://www.biomedcentral.com/1471-2148/14/23 RESEARCH ARTICLE Open Access From algae to angiosperms–inferring the phylogeny of green plants (Viridiplantae) from 360 plastid genomes Brad R Ruhfel1*, Matthew A Gitzendanner2,3,4, Pamela S Soltis3,4, Douglas E Soltis2,3,4 and J Gordon Burleigh2,4 Abstract Background: Next-generation sequencing has provided a wealth of plastid genome sequence data from an increasingly diverse set of green plants (Viridiplantae). Although these data have helped resolve the phylogeny of numerous clades (e.g., green algae, angiosperms, and gymnosperms), their utility for inferring relationships across all green plants is uncertain. Viridiplantae originated 700-1500 million years ago and may comprise as many as 500,000 species. This clade represents a major source of photosynthetic carbon and contains an immense diversity of life forms, including some of the smallest and largest eukaryotes. Here we explore the limits and challenges of inferring a comprehensive green plant phylogeny from available complete or nearly complete plastid genome sequence data. Results: We assembled protein-coding sequence data for 78 genes from 360 diverse green plant taxa with complete or nearly complete plastid genome sequences available from GenBank. Phylogenetic analyses of the plastid data recovered well-supported backbone relationships and strong support for relationships that were not observed in previous analyses of major subclades within Viridiplantae. However, there also is evidence of systematic error in some analyses. In several instances we obtained strongly supported but conflicting topologies from analyses of nucleotides versus amino acid characters, and the considerable variation in GC content among lineages and within single genomes affected the phylogenetic placement of several taxa.
    [Show full text]