(2) Patent Application Publication (10) Pub. No.: US 2007/0281906 A1 Dalton Et Al

Home , PPAR agonist

US 20070281906A1 (19) United States (2) Patent Application Publication (10) Pub. No.: US 2007/0281906 A1 Dalton et al. (43) Pub. Date: Dec. 6, 2007

(54) SELECTIVE ANDROGEN RECEPTOR (60) Provisional application No. 60/712,390, filed on Aug. MODULATORS FOR TREATING DLABETES 31, 2005. Provisional application No. 60/529,573, filed on Dec. 16, 2003. Provisional application No. (76) Inventors: James T. Dalton, Arlington, OH (US); 60/510,138, filed on Oct. 14, 2003. Provisional appli Duane D. Miller, Germantown, TN cation No. 60/336,185, filed on Dec. 6, 2001. (US) Correspondence Address: Publication Classification PEARL COHEN ZEDEK LATZER, LLP (51) Int. Cl. 1500 BROADWAY 12TH FLOOR A61 K. 3 1/167 (2006.01) NEW YORK, NY 10036 (US) A61R 3 1/277 (2006.01) Appl. No.: 11/785,064 A61 K. 3 1/32 (2006.01) (21) A61 K. 3 1/404 (2006.01) (22) Filed: Apr. 13, 2007 A61 K. 3 1/47 (2006.01) A61R 3 I/555 (2006.01) Related U.S. Application Data A61 K. 3 1/66 (2006.01) A61 K. 3 1/675 (2006.01) (63) Continuation-in-part of application No. 11/634,380, A6IP 25/02 (2006.01) filed on Dec. 6, 2006, which is a continuation-in-part A6IP 3/10 (2006.01) of application No. 11/510,844, filed on Aug. 28, 2006, A6IP 9/00 (2006.01) and which is a continuation-in-part of application No. 11/013,214, filed on Dec. 16, 2004. (52) U.S. Cl...... 514/80: 514/119: 514/184; Said application No. 11/510,844 is a continuation-in 514/312; 514/419; 514/493; part of application No. 11/505,363, filed on Aug. 17, 514/521: 514/619 2006, and which is a continuation-in-part of applica tion No. 11/505,499, filed on Aug. 17, 2006, which is a continuation-in-part of application No. 11/355,187, (57) ABSTRACT filed on Feb. 16, 2006, which is a continuation-in-part of application No. 11/220,414, filed on Sep. 7, 2005, which is a continuation-in-part of application No. This invention provides use of a SARM compound or a 11/146,427, filed on Jun. 7, 2005, which is a continu composition comprising the same in treating a variety of ation-in-part of application No. 10/961,380, filed on diseases or conditions in a subject, including, inter-alia, a Oct. 12, 2004, and which is a continuation-in-part of diabetes disease, and/or disorder such as cardiovascular application No. 10/861,923, filed on Jun. 7, 2004, disease, atherosclerosis, cerebrovascular conditions, dia which is a continuation-in-part of application No. betic nephropathy, diabetic neuropathy and diabetic retin 10/310,150, filed on Dec. 5, 2002. opathy. Patent Application Publication Dec. 6, 2007 Sheet 1 of 26 US 2007/0281906 A1

180

160 140 120

100

FIGURE 1 Patent Application Publication Dec. 6, 2007 Sheet 2 of 26 US 2007/0281906 A1

Prostate Seminal Vesicles Levator Ani

FIGURE 2 Patent Application Publication Dec. 6, 2007 Sheet 3 of 26 US 2007/0281906 A1

160

100

20 Compound Ill I Oxandrolone Dose (mg/day)

FIGURE 3 Patent Application Publication Dec. 6, 2007 Sheet 4 of 26 US 2007/0281906 A1

160 Levator Ani 140 Emax = 1.31% + 2% ED, a 0.02+ 0.01 120

100

Prostate 60 Emax = 83% + 25% ED, -0.09 + 0.07% 40 2Seminal Vesicles Emax = 85% + 1.1% 20 _x: EDs, - 0.17 ± 0.05

Compound of Formula III (mg/day)

FIGURE 4 Patent Application Publication Dec. 6, 2007 Sheet 5 of 26 US 2007/0281906 A1

140

120

100

FIGURE 5 Patent Application Publication Dec. 6, 2007 Sheet 6 of 26 US 2007/0281906 A1

140

Levator Ani 120 Fmax = 1.26% + 4% ED, a 0.013 + 0.01 100

Prostate 60 Emax = 75% + 8% EDso a 0.22 + 0.05 40 22° 20 Seminal Vesicles Emax = 73% + 3% 0 EDso = 0.21 + 0.02

Compound of Formula III (mg/day)

FIGURE 6 Patent Application Publication Dec. 6, 2007 Sheet 7 of 26 US 2007/0281906 A1

120 110 1 0 O 90 80 70 60 50 40 O 3 10 30 100 Dose, mg/kg

• p < 0.05; **p-0.01

FIGURE 7

Patent Application Publication Dec. 6, 2007 Sheet 9 of 26 US 2007/0281906 A1

— C C O LO [(6) auliased uou?] afueuo eln[osqv ueew i Patent Application Publication Dec. 6, 2007 Sheet 10 of 26 US 2007/0281906 A1

Insulin Resistance

El FPG - Insulin D HOMA-IR

FIGURE 10 Patent Application Publication Dec. 6, 2007 Sheet 11 of 26 US 2007/0281906 A1

| o

In tact O V x O W X + 3 m g /d 024

FIGURE 11 Patent Application Publication Dec. 6, 2007 Sheet 12 of 26 US 2007/0281906 A1

3 (guo/5u)3 ; GWa8 5Jelnoaqe. § 8 ° : Patent Application Publication Dec. 6, 2007 Sheet 13 of 26 US 2007/0281906 A1

8 (guo/5u)3 ; GWa8 3Jelnoaqeu & 8 ° i Patent Application Publication Dec. 6, 2007 Sheet 14 of 26 US 2007/0281906 A1

º II. N = C | C) Il

É> C

; i Patent Application Publication Dec. 6, 2007 Sheet 15 of 26 US 2007/0281906 A1

Orchidectomized :

*P*0.05 VS. ORX Vehicle

Figure 12C Patent Application Publication Dec. 6, 2007 Sheet 16 of 26 US 2007/0281906 A1

.9 -E {1} > >< [I. O w; > tº) C c To V $: 2 5 E §C. +* 5 — O O H *% % + +:%

(uu/l) Jaqun N Jelmoedell Patent Application Publication Dec. 6, 2007 Sheet 17 of 26 US 2007/0281906 A1

10 —e— Male 1 mg/kg Soln. –A– Female 1 mg/kg Soln. —e— Male 1 mg/kg Cap. —A— Female 1 mg/kg Cap.

0.01 0 1000 2000 3000 4000 5000 6000 Time (min)

Figure 13 Patent Application Publication Dec. 6, 2007 Sheet 18 of 26 US 2007/0281906 A1

10 —e— Male 1 mg/kg Soln. —A— Female 1 mg/kg Soln. —e— Male 1 mg/kg Cap. —A- Female 1 mg/kg Cap.

0.01 0 1000 2000 3000 4000 5000 6000 Time (min)

Figure 13A Patent Application Publication Dec. 6, 2007 Sheet 19 of 26 US 2007/0281906 A1

DHT SARM

B Extracellular Matrix Cytoskeleton Reproduction 6% 11%

41%

34% 59% 63% 55% Development Growth (cell/organ/body) Transcription

9%º 29% 14

54% 37% º 46% . 71%

- 40%

Metabolism External Stimulus Total Unique Response 10% 10%

50%o 37%O %º 40% 63% % 49% 41%

FIGURE 14 Patent Application Publication Dec. 6, 2007 Sheet 20 of 26 US 2007/0281906 A1

C 300 Incomplete Annotation 250 HH Searchable and ARE found 200 Searchable and no ARE found

150

100

DHT SARM SARM and DHT

FIGURE 14 (cont) Patent Application Publication Dec. 6, 2007 Sheet 21 of 26 US 2007/0281906 A1

Figure-15 A B 5 4 - 2º

3 DHT 498 SARM

| || | G===l Extracellular Matrix Cytoskeleton Reproduction 6% * 17% 28% 33% 41%

67% 53% 55%

Development Growth (cell/organ/body) Transcription 9 % 8 9% g à 4.2% 39% 52%

External Stimulus Metabolism Response Total Unique

38% 39% 50% Patent Application Publication Dec. 6, 2007 Sheet 22 of 26 US 2007/0281906 A1

Figure-15 (Cont..)

Incomplete Annotation É Searchable and ARE found Searchable and no ARE found

SARM SARM and DHT Patent Application Publication Dec. 6, 2007 Sheet 23 of 26 US 2007/0281906 A1 II.

NFkB1E

STATSB APIG1

AXIN1 NFkB1E

Patent Application Publication Dec. 6, 2007 Sheet 24 of 26 US 2007/0281906 A1

24 SHC-1 to 20 ::

Qº y-4 16 P C} 12 2ºr: 8 4

Figure-16(cont..) US 2007/0281906 A1

SHC-1

Time (hrs) 12 24

FIGURE 17 Patent Application Publication Dec. 6, 2007 Sheet 26 of 26 US 2007/0281906 A1

DHT SARM

FIGURE 17 cont. US 2007/028 1906 A1 Dec. 6, 2007

SELECTIVE ANDROGEN RECEPTOR action of insulin. This impaired biological response to MODULATORS FOR TREATING DLABETES insulin is manifested in the metabolic and vascular effects of insulin. The most common presentation of Syndrome X is CROSS-REFERENCE TO RELATED associated with obesity. APPLICATIONS [0006] The adaptive response to insulin resistance (IR) in [0001] This Application is a Continuation-In-Part of U.S. individuals produces compensatory hyperinsulinaemia. As patent application Ser. No. 11/634,380, filed Dec. 6, 2006 subjects progressively insulin resistant, they manifest vary which is a Continuation-In-Part Application of U.S. patent ing degrees of change in clinical parameters, including application Ser. No. 11/510,844, filed Aug. 28, 2006 which blood pressure, and/or increased levels of serum glucose, claims priority of U.S. Provisional Application Ser. No. and/or cholesterol and/or triglycerides, and/or uric acid, 60/712,390, filed Aug. 31, 2005; and which is a Continua and/or factors that increase coagulation. Once these clinical tion-In-Part Application of U.S. patent application Ser. No. parameters have changed enough, the patient may differen 11/013,214, filed Dec. 16, 2004 which claims priority of tially manifest well-recognized clinical conditions, includ U.S. Provisional Application Ser. No. 60/529,573, filed Dec. ing: type 2 diabetes, hypertension (high blood pressure), 16 2003; and which is a Continuation-In-Part Application of hyperlipidemia or dyslipidemia, particularly (but not limited U.S. patent application Ser. No. 11/505,363, filed Aug. 17, to) hypertriglyceridemia, hyperuricemia or gout, and hyper 2006; and U.S. patent application Ser. No. 11/505,499, filed coagulability (defined as an abnormal, increased tendency on Aug. 17, 2006, which are Continuation-In-Part Applica for clots to form, particularly inside blood vessels). These tions of U.S. patent application Ser. No. 11/355,187, filed clinical conditions are well-recognized risk factors for car Feb. 16, 2006, which is a Continuation-In-Part of U.S. patent diovascular (coronary artery and cerebrovascular) disease. application Ser. No. 11/220,414, filed Sep. 7, 2005, which is a Continuation-In-Part of U.S. patent application Ser. No. [0007] The treatment of factors contributing to IR (e.g., 11/146,427, filed Jun. 7, 2005, which is a Continuation-In obesity) or the treatment of IR itself improves many of the Part Application of U.S. patent application Ser. No. 10/961, clinical conditions which at first glance appear to be unre 380, filed Oct. 12, 2004, which claims priority from U.S. lated. For example, dieting alone or pharmacotherapeutic Provisional Application Ser. No. 60/510,138, filed Oct. 14, agents that induce weight loss will decrease blood pressure, 2003; and which is a Continuation-In-Part Application of blood glucose and triglycerides. Agents that are designed to U.S. patent application Ser. No. 10/861,923, filed Jun. 7, improve insulin sensitivity can also favorably alter blood 2004, which is a Continuation-In-Part Application of U.S. pressure, lipids, and blood glucose. patent application Ser. No. 10/310,150, filed Dec. 5, 2002, [0008] Diabetes mellitus is characterized by metabolic which claims priority of U.S. Provisional Application Ser. defects in production and utilization of carbohydrates, No. 60/336,185, filed Dec. 6, 2001; all of which are hereby resulting in elevated blood glucose or hyperglycemia due to incorporated by reference in their entirety. the failure to maintain appropriate blood sugar levels. Research in the treatment of diabetes has centered on GOVERNMENT INTEREST STATEMENT attempts to normalize fasting and postprandial blood glucose [0002] This invention was made in whole or in part with levels. Current treatments include administration of exog government support under grant number R29 CA068096, enous insulin, oral administration of drugs and dietary awarded by the National Cancer Institute, National Institute therapies and exercise regimens. of Health, and under grant number R15 HD35329, awarded [0009] Two major forms of diabetes mellitus are recog by the National Institute of Child Health and Human Devel nized. Type 1 diabetes, or insulin-dependent diabetes, is the opment, National Institute of Health. The government may result of an absolute deficiency of insulin, the hormone have certain rights in the invention. which regulates carbohydrate utilization. Type 2 diabetes, or non-insulin dependent diabetes, often occurs with normal, or FIELD OF THE INVENTION even elevated levels of insulin and appears to be the result [0003] This invention provides SARM compounds and of the inability of tissues to respond appropriately to insulin. uses thereof in treating a variety of diseases or conditions in Complications of type 2 diabetes include retinopathy, neph a subject, including, inter-alia, diabetes and associated dis ropathy, neuropathy, and coronary heart disease, and are eases, such as, for example, chronic kidney disease, neph believed to be triggered by excessive protein glycation, ropathy, neuropathy and retinopathy; diabetes, insulin resis which in turn results from excessive levels of circulating tance, cachexia, cardiovascular disease and associated glucose. conditions such as, atherosclerosis, cerebrovascular disease, and others. [0010] New innovative approaches are urgently needed at both the basic science and clinical levels to develop com BACKGROUND OF THE INVENTION pounds which are useful for treating, suppressing, inhibiting or reducing the incidence of a) Diabetes; b) glucose intol [0004] Obesity and its associated disorders, represent erance; c) hyperinsulinemia; d) insulin resistance; e) dys major health problems in all industrialized countries. Obe lipidemia; f) cachexia; g) hypercholesterolemia; h) high sity, defined as an excess of body fat relative to lean body mass, has been directly linked to increased incidences of blood pressure: i) cardiovascular disease or disorder, j) diseases such as coronary artery disease, stroke, and diabe atherosclerosis; k) stroke; 1) cerebrovascular conditions; and tes, and is one of the factors, whose presence defines diseases, disorders or conditions related thereto. “Syndrome X”. SUMMARY OF THE INVENTION [0005] At the center of “Syndrome X” and “Metabolic [0011] In one embodiment this invention provides a Syndrome”, is the common feature of tissue resistance to the method of treating, reducing the severity of reducing the US 2007/028 1906 A1 Dec. 6, 2007 incidence of delaying the onset of, or reducing pathogenesis incidence of delaying the onset of, or reducing pathogenesis of diabetes in a human subject, comprising the step of of glucose intolerance in a human subject having, compris administering to said subject a selective androgen receptor ing the step of administering to said subject a selective modulator (SARM) compound of formula I; androgen receptor modulator (SARM) compound of for mula I:

(I) Z (I) 2% O S Z C ) JTº 2% O S yS. NH X C)S/S 2——Q R! T y NH X R. T wherein [0012] X is a bond, O, CH2, NH, Se, PR, or NR; wherein [0013] Z is NO, CN, COR, COOH or CONHR; [0021] X is a bond, O, CH2, NH, Se, PR, or NR; [0014] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or [0022] Z is NO2, CN, COR, COOH or CONHR; Sn(R)s; [0023] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or [0015] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. Sn(R)s; NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR [0024] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, NHCOCF, NHCOR, NHCONHR, NHCOOR, SO,R or SR; OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, or Q together with the benzene ring to which it is attached SO,R or SR; is a fused ring system represented by structure A, B or C: or Q together with the benzene ring to which it is attached is a fused ring system represented by structure A, B or C: 2. NH O 2. NH O –CIO -CO? 2. NH O 2. NH O 2. NH –CIO -CO? s | / 2. NH s | / [0016] R is CHs, CFs, CH2CHA, or CF.CFs; and [0017] T is OH, OR, NHCOCHA, or NHCOR; [0025] R is CHA, CFs, CH2CHA, or CF2CFs; and [0018] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0026] T is OH, OR, NHCOCHA, or NHCOR; [0019] In another embodiment the compound is charac [0027] wherein R is a C-C, alkyl, aryl, phenyl, alkenyl, terized by the structure of formula III: hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0028] In another embodiment the compound is charac III terized by the structure of formula III: NC CN III

NC CN

Hó" on or its isomer, pharmaceutically acceptable salt, pharmaceu Hò' ori tical product, hydrate, N-oxide, or any combination thereof. [0020] In one embodiment, this invention provides a or its isomer, pharmaceutically acceptable salt, pharmaceu method of treating, reducing the severity of reducing the tical product, hydrate, N-oxide, or any combination thereof. US 2007/028 1906 A1 Dec. 6, 2007

[0029] In one embodiment, this invention provides a [0038] In one embodiment, this invention provides a method of treating, reducing the severity of reducing the method of treating, reducing the severity of reducing the incidence of delaying the onset of, or reducing pathogenesis incidence of delaying the onset of, or reducing pathogenesis of hyperinsulinemia in a human subject, comprising the step of insulin resistance in a human subject, comprising the step of administering to said subject a compound of formula (I): of administering to said subject a compound of formula (I):

(I) (I) Z Z 2% O S 2% O S C ——Q C) ——Q yS/S NH X 2 yS/S NH X 2 R. T R. T wherein wherein [0030] X is a bond, O, CH, NH, Se, PR, or NR; [0039] X is a bond, O, CH2, NH, Se, PR, or NR; [0031] Z is NO, CN, COR, COOH or CONHR; [0040] Z is NO, CN, COR, COOH or CONHR; [0041] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or [0032] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; Sn(R)s; [0042] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. [0033] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. NHCOCFs, NHCOR, NHCONHR, NHCOOR, NHCOCF, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR; SO,R or SR; or Q together with the benzene ring to which it is attached or Q together with the benzene ring to which it is attached is a fused ring system represented by structure A, B or is a fused ring system represented by structure A, B or C: C:

2. NH 2.0 2. NH 2.0 2. NH O 2. NH O –CIO -CO? –CIO -CO? 2. NH 2. NH s | / [0043] R is CHA, CFs, CH2CHA, or CF2CFs; and [0034] R is CHs, CFs, CH2CHA, or CF.CFs; and [0044] T is OH, OR, -NHCOCH, or NHCOR; [0035] T is OH, OR, NHCOCHA, or NHCOR; [0045] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, [0036] wherein R is a C-C, alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0046] In another embodiment the compound is charac [0037] In another embodiment the compound is charac terized by the structure of formula III: terized by the structure of formula III: III NC CN

III

NC CN

Hó" on

Hò' ori or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. or its isomer, pharmaceutically acceptable salt, pharmaceu [0047] In one embodiment, this invention provides a tical product, hydrate, N-oxide, or any combination thereof. method of treating, reducing the severity of reducing the US 2007/028 1906 A1 Dec. 6, 2007 incidence of delaying the onset of, or reducing pathogenesis [0057] In one embodiment, this invention provides a of diseases associated with diabetes comprising the step of method of treating, reducing the severity of reducing the administering to said subject a compound of formula (I) incidence of delaying the onset of, or reducing pathogenesis of fatty liver conditions in a human subject, comprising the step of administering to said subject a compound of formula (I) Z (I) 2% O S (I) C)S/S 2—HQ Z y NH X 2% O S R. T yS.C NH X J’ wherein R. T [0048] X is a bond, O, CH2, NH, Se, PR, or NR; [0049] Z is NO, CN, COR, COOH or CONHR; wherein [0050] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or [0058] X is a bond, O, CH2, NH, Se, PR, or NR; Sn(R)s; [0051] Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCH, [0059] Z is NO, CN, COR, COOH or CONHR: NHCOCFs, NHCOR, NHCONHR, NHCOOR, [0060] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR Sn(R)s; NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR; [0061] Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHs. NHCOCFs, NHCOR, NHCONHR, NHCOOR, or Q together with the benzene ring to which it is attached OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR is a fused ring system represented by structure A, B or NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, C: SO,R or SR; or Q together with the benzene ring to which it is attached 2. NH 2.0 2. NH 2.0 is a fused ring system represented by structure A, B or –CIO -CO? C: 2. NH –CIO2. NH O -CO?2. NH O 2. NH [0052] Ri is CHs, CFs, CH2CHA, or CF.CFs; and s | / [0053] T is OH, OR, -NHCOCH, or NHCOR; [0054] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0062] R, is CHA, CFA, CH2CHA, or CF.CFA; and [0055] In another embodiment the compound is charac [0063] T is OH, OR, NHCOCHA, or NHCOR; terized by the structure of formula III: [0064] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. III NC CN [0065] In another embodiment the compound is charac terized by the structure of formula III:

III Hò' ori NC CN

or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. Hò' ori [0056] In another embodiment, the diseases associated with diabetes comprise neuropathy, retinopathy, nephro pothy, chronic kidney disease, metabolic syndrome or a or its isomer, pharmaceutically acceptable salt, pharmaceu combination thereof. tical product, hydrate, N-oxide, or any combination thereof. US 2007/028 1906 A1 Dec. 6, 2007

[0066] In one embodiment, this invention provides a [0075] In one embodiment, this invention provides a method of treating, reducing the severity of reducing the method of treating reducing the severity of reducing the incidence of delaying the onset of, or reducing pathogenesis incidence of delaying the onset of, or reducing pathogenesis of cardiovascular disease in a human subject, comprising the of cachexia in a subject, comprising the step of administer step of administering to said subject compound of formula ing to said subject compound of formula (I): (I). (I) (I) Z Z 2% O S 2% O S C) ——Q C J’ yS/S NH X 2 yS. NH X R. T R. T wherein wherein [0076] X is a bond, O, CH2, NH, Se, PR, or NR; [0067] X is a bond, O, CH2, NH, Se, PR, or NR; [0077] Z is NO, CN, COR, COOH or CONHR: [0068] Z is NO, CN, COR, COOH or CONHR; [0078] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or [0069] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; Sn(R)s; [0079] Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHs. NHCOCFs, NHCOR, NHCONHR, NHCOOR, [0070] Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCH, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHCOCF3, NHCOR, NHCONHR, NHCOOR, NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR SO,R or SR; NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, or Q together with the benzene ring to which it is attached SO,R or SR; is a fused ring system represented by structure A, B or or Q together with the benzene ring to which it is attached C: is a fused ring system represented by structure A, B or C: 2. NH 2.0 2. NH 2.0 2. NH O 2. NH O –CIO -CO? –CIO -CO? 2. NH 2. NH

[0080] R is CHA, CFs, CH2CHA, or CF2CFs; and [0071] R, is CHA, CFs, CH2CHA, or CF.CFA; and [0081] T is OH, OR, -NHCOCH, or NHCOR; [0082] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, [0072] T is OH, OR, NHCOCHA, or NHCOR; hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0073] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, [0083] In another embodiment the compound is charac hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. terized by the structure of formula III: [0074] In another embodiment the compound is charac terized by the structure of formula III: III NC CN

III

NC CN

Hó" on

In another embodiment the subject has cystic fibrosis. In [0094] In one embodiment, the compound is characterized another embodiment, the subject has anorexia. by the structure of formula III: [0085] In another embodiment, this invention provides a III composition comprising a compound of formula (I): NC CN

(I) Z 2% O S Hò' ori C) —HQ [0095] or its isomer, pharmaceutically acceptable salt, yS/S NH X 2 pharmaceutical product, hydrate, N-oxide, or any combi R. T nation thereof. [0096] In another embodiment, the agent is an anti-andro gen, an antiestrogen, a monoclonal antibody, a chemothera wherein peutic agent, an immunosuppressive or anti-inflammatory agent, an immunostimulatory agent, a sulfonylurea, meglit [0086] X is a bond, O, CH2, NH, Se, PR, or NR; nide, insulin, biguanide, thiazolidinedione, or alpha-glucosi dase inhibitor, an adrenomimetic agent, adrenoceptor [0087] Z is NO, CN, COR, COOH or CONHR; antagonist, cholinomimetic agent, a muscarinic blocker, a [0088] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or ganglionic blocker, an anesthetic agent, an analgesic agent, an agent treating neuromuscular transmission, a nervous Sn(R)s; system stimulant, a sedative agent, neurodegenerative dis [0089] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. order medication, antiepileptic agent, antipsychotic agent, NHCOCFs, NHCOR, NHCONHR, NHCOOR, anti-addiction agent, an anti-arrhythmic agent, an anti-angi OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR nal agent, a vasocative agent, a calcium channel blocker, an NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, antihypertensive agent, a diuretic agent, an anticoagulant or SO,R or SR; fibrinolytic agent, a hypocholesterolemic agent, an opioid, 5-HT, receptor antagonist, adsorbent agent, bulking agent, a or Q together with the benzene ring to which it is attached stool softening or laxative agent, cathartic agent, an anti is a fused ring system represented by structure A, B or emetic agent, an emetic agent, an antacid agent, an H3-re C: ceptor antagonist, a proton pump inhibitor, a 5-aminosali cylate agent, a prostaglandin, a glucocorticosteroid, a retinoid, photochemotherapeutic agent, a photodynamic 2. NH 2.0 2. NH 2.0 agent, aminolevulinic acid, dapsone, pyrethrin, pyrethroid, thalidomide, an antimalarial agent, an antimicrobial agent, an antifungal agent, an antiviral agent, a sulfonamide, a –CIO -CO? trimethoprim agent, a quinolone agent, an oxazolidinone 2. NH agent, an antiseptic agent, a beta-lactam agent, an aminogly coside agent, a tetracycline agent, a chloramphenicol agent, a macrolide agent, a lincosamide agent, a bacitracin agent, a glycopeptide agent, a polymyxin agent, an antiprotozoal agent, an antithelmintic agent, a cortisone, a colchicine, a [0090] R is CHs, CFs, CH2CHA, or CF.CFs; and methotrexate, a ursodeoxycholic acid, a penicillamine, a vitamin, glucosidase alpha, sodium bicarbonate, bisphos [0091] T is OH, OR, NHCOCHA, or NHCOR; phonate, biotin, allopurinol, levodopa, diazepam, phenobar bital, haloperidol, folic acid, haptoglobin, camitine, a a wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, steroid, cannabinoid metoclopramid, cisapride, medrox hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl; yprogesterone acetate, megestrol acetate, cyproheptadine, [0092] and a therapeutic agent which is: hydrazine sulfate, pentoxifylline, thalidomide, anticytokine antibodies, cytokine inhibitors, eicosapentaenoic acid, [0093] an anti-cancer agent, an immunomodulating agent, indomethacin, ibuprofen, melatonin, insulin, growth hor an agent treating diabetes, an agent treating the nervous mone, clenbuterol, pancreas extract, cabergoline, bro system, an agent treating the cardiovascular system, an mocriptine, thyroxime, gonadotropin, glucocorticoid, gluco agent treating the gastrointestinal system, an agent treat corticoid analogue, corticotrophin, metyrapone, ing a dermatological disease, or condition, an anti-infec aminoglutethimide, mitotane, ketoconazole, mifepristone, tive agent, an agent treating the liver, an agent treating the dexamethasone somatostatin analogue, gonadotropin-re kidney, an agent treating a metabolic disease, an agent leasing hormone analogue, leuprolide, goserelin, antidi treating a wasting disease, a gene therapy agent, an agent uretic hormone, antidiuretic hormone analogue, oxytocin, treating the endocrine system, a vitamin, a stomatognathic estrogen, progestin, specific estrogen receptor modulator agent, a urogenital agent, behavior-modulating agent, an (SERM), uterine, stimulant, uterine relaxant, androgen, anti agent treating the respiratory system, an agent treating the androgen, prostaglandin, dopamine receptor agonist, alpha hemic system, an agent treating an ophthalmic disease, or adrenoreceptor blocker, anabolic steroid, an antianxiety any combination thereof. agent, an antipsychotic agent, an antidepressant, beta-2 US 2007/028 1906 A1 Dec. 6, 2007 agonist, anticholinergic bronchodilator, theophylline, ami [0108] FIG. 11: Improvement of soleus strength by Com nophylline, nedocromil sodium, sodium cromoglycate, leu pound III in rats. kotriene receptor antagonist, corticosteroid, expectorant, mucolytic agent, antihistamine, pseudoephedrine, or a [0109] FIG. 12: Trabecular bone mineral density deter neuraminidase inhibitor, betagan, betimol, timoptic, betop mined by p(JCT analysis of the distal femur 12A. Rat distal tic, betoptic, ocupress, optipranolol, xalatan, alphagan, femur representative reconstructions 12B. BV/TV analysis azopt, trusopt, cospot, pilocar, pilagan, propine, opticrom, of the distal femur 12C. Trabecular number of the distal acular, livostin, alomide, emadine, patanol, alrex, dexacidin, femur 12D. maxitrol, tobradex, blephamide, ocufen, voltaren, profenal, [0110] FIG. 13: plots circulating levels of Compound III in pred forte, econpred plus, eflone, flarex, inflamase forte, plasma in male and female dogs. inflamase mild, lotemax, Vexol, polytrim, illotycin, ciloxan, [0111] FIG. 14: depicts recruitment of AR in response to ocuflox, tobrex, or garamycin, or any combination thereof. DHT or SARM. FIG. 14A is a Ven diagram showing the [0097] In another embodiment, this invention provides a number of promoters significantly recruiting AR over method of treating reducing the severity of reducing the vehicle in response to DHT, SARM or DHT and SARM. incidence of delaying the onset of, or reducing pathogenesis FIG. 14B illustrates classification of genes assayed with of diabetes, glucose intolerance, hyperinsulinemia, insulin known function (1023) whose promoters were occupied by resistance, fatty liver conditions, cardiovascular disease, AR in response to DHT (open bars), SARM (filled bars) or atherosclerosis, cachexia, neoplasia, musculoskeletal dis promoters common to DHT or SARM (hatched bars). FIG. ease or disorder, inflammation, ophthalmic disease, urologic 14C depicts computational identification of androgen disease, hemic disease, connective tissue disease or renal responsive AR direct target gene promoters in response to disease, in a subject, comprising the step of administering to DHT, SARM or DHT and SARM. Human and orthologous the subject a composition as herein described. mouse sequences determined from the AR promoter array experiment were searched for the presence of ARE. BRIEF DESCRIPTION OF THE DRAWINGS [0112] FIG. 15: depicts recruitment of SRC-1 in response [0098] FIG. 1: Organ weights from rats treated with a to DHT or SARM. FIG. 15A illustratres recruitment to PSA compound of formula III presented as a percentage of intact enhancer as measured by realtime quantitative PCR. Values control. * P-value:0.05 versus intact controls. are reported as the ratio of target detected in the IP DNA pool to target detected in the total input DNA pool. Open bars are [0099] FIG. 2: Organ weights from castrated, compound vehicle treated, filled bars are DHT treated and hatched bars of formula III-treated rats presented as a percentage of intact are SARM treated. FIG. 15B depicts is a Ven diagram control. * P-value:0.05 versus intact controls. showing the number of promoters significantly recruiting SRC-1 over vehicle in response to DHT or SARM or DHT [0100] FIG. 3: Organ weight maintenance dose-response and SARM. FIG. 15C depicts classification of genes assayed curves for compound of formula III in castrated rats com with known function (1015) whose promoters were occu pared to Oxandrolone. pied by SRC-1 in response to DHT (open bars), SARM [0101] FIG. 4: Organ weight maintenance dose-response (filled bars) or promoters common to DHT and SARM curves for compound of formula III in castrated rats. Ema, (hatched bars). FIG. 15D illustratres computational identi and EDso values for the levator ani (closed triangles), fication of androgen responsive elements in SRC-1 target prostate (open circles), and seminal vesicles (closed squares) gene promoters in response to DHT, SARM or DHT and were obtained by nonlinear regression analysis using the SARM. Human and orthologous mouse sequences deter sigmoid Ema, model in WinNonlin R. mined from the SRC-1 promoter array experiment were searched for the presence of ARE. [0102] FIG. 5: Organ weights from castrated, compound [0113] FIG. 16. FIG. 16A depicts recruitment of SRC-1 to of formula III-treated rats presented as a percentage of intact various promoters. LNCaP cells were maintained in 1% control. * P-value:0.05 versus intact controls. csFBS for 6 days to reduce the basal transcription factor [0103] FIG. 6: Organ weight regrowth dose-response recruitment and treated with vehicle (open bars), 100 nM curves for compound of formula III in castrated rats. Ema, DHT (filled bars) or SARM (hatched bars) for the indicated and EDso values for the levator ani (closed triangles), time periods. ChIP assay was performed with SRC-1 anti prostate (open circles), and seminal vesicles (closed squares) body and the recruitment to various promoters showing were obtained by nonlinear regression analysis using the significance from the array was measured using quantitative sigmoid Ema, model in WinNonlin R. rtPCR (primers and probes given in table 1). Values are indicated as the ratio of target detected in the IP DNA pool [0104] FIG. 7: Cholesterol reduction by compound of to target detected in the total input DNA pool. FIG. 16B formula III in rats. depicts the interaction between SRC-1 and SHC-1 in INCAP cells that were treated with 100 nM DHT or SARM for 1 [0105] FIG. 8: Total lean mass increase of all subjects with hour. Protein extracts were immunoprecipitated with IgG or 0.1 mg, 0.3 mg, 1 mg, and 3 mg dose of Compound III. SHC-1 antibody. FIG. 16C depicts measurement of gene [0106] FIG. 9: Total fat mass change of all subjects with transcription of promoters recruiting SRC-1 of LNCaP cells 0.1 mg, 0.3 mg, 1 mg, and 3 mg dose of Compound III. maintained in 1% csFBS with vehicle (open bars), DHT (filled bars) or SARM (hatched bars). Gene transcription [0107] FIG. 10: Insulin resistance results (including insu was measured by realtime RT-PCR. FIG. 16D depicts a Ven lin, glucose and HOMA-IR levels) of Avandia, Glipizide and diagram comparing the complete list of promoters occupied Compound III. in response to DHT or SARM by AR and SRC-1.

US 2007/028 1906 A1 Dec. 6, 2007

(I)

º S

wherein [0133] wherein X is O, [012.4] X is a bond, O, CH2, NH, Se, PR, or NR; [0134] Z is NO, CN, COR, or CONHR; [0125] Z is NO, CN, COR, COOH or CONHR; [0135] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, F or Sn(R)s; [0126] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; [0136] Q is CN: [0127] Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCH, [0137] T is OH, OR, NHCOCHA, NHCOR or NHCOCFs, NHCOR, NHCONHR, NHCOOR, OC(O)K; OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR [0138] R is alkyl, haloalkyl, dihaloalkyl, trihaloalkyl, NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, CH2F, CHF, CFs, CF2CFs, aryl, phenyl, halogen, SO,R or SR; alkenyl, haloalkenyl or OH; and or Q together with the benzene ring to which it is attached is a fused ring system represented by structure A, B or [0139] R is CHA, CH2F, CHF, CFs, CH2CHA, or C: CF2CFs. [0140] In one embodiment, Q is in the para position. In another embodiment, X is O, or in another embodiment, T 2. NH O 2. NH O is OH, or in another embodiment, R, is CHA, or in another embodiment, Z is NO2, or in another embodiment, Z is CN, or in another embodiment, Z is in the para position, or in –CO -CO? another embodiment, Y is CFs, or in another embodiment, Y 2. NH is in the meta position, or in another embodiment, Q is in the para position, or in another embodiment, Q is para alkyl, halogen, N(R), NHCOCHA, NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO.CHA, NHSO,R, OR, COR, [0128] R, is CHA, CFs, CH2CHA, or CF.CFA; and OCOR, OSOAR, SO,R or SR, or in another embodiment, any combination thereof. [0129] T is OH, OR, NHCOCHA, or NHCOR; [0141] In one embodiment, this invention provides for the [0130] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, use of a racemate SARM compound represented by the hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. structure of formula (Ia): [0131] In one embodiment, Q is in the para position. In another embodiment, X is O, or in another embodiment, T (Ia) is OH, or in another embodiment, R, is CHA, or in another embodiment, Z is NO2, or in another embodiment, Z is CN, º O S or in another embodiment, Z is in the para position, or in another embodiment, Y is CFs, or in another embodiment, Y is in the meta position, or in another embodiment, Q is in the para position, or in another embodiment, Q is para alkyl, Q__C. halogen, N(R), NHCOCHA, NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO.CHA, NHSO,R, OR, COR, wherein OCOR, OSO,R, SO,R or SR, or in another embodiment, any combination thereof. [0142] X is a bond, O, CH2, NH, Se, PR, or NR; [0132] In one embodiment the present invention provides [0143] Z is NO2, CN, COR, COOH or CONHR; for the use of a SARM compound or its prodrug, analog, [0144] Y is CFs, CH5, formyl, alkoxy, H, I, Br, C1, or isomer, metabolite, derivative, pharmaceutically acceptable salt, pharmaceutical product, polymorph, crystal, impurity, Sn(R)s; N-oxide, hydrate or any combination thereof, represented by [0145] Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. a structure of formula (I): NHCOCF, NHCOR, NHCONHR, NHCOOR, US 2007/028 1906 A1 Dec. 6, 2007

OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR [0158] In one embodiment, this invention provides for the NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, use of a SARM compound or its prodrug, analog, isomer, SO,R or SR; metabolite, derivative, pharmaceutically acceptable salt, pharmaceutical product, polymorph, crystal, impurity, N-ox or Q together with the benzene ring to which it is attached ide, hydrate or any combination thereof, represented by the is a fused ring system represented by structure A, B or C: structure of formula (III):

II 2. NH O 2. NH O Z Q

–CIO -CO? Y DC. N O X C? 2. NH H 2. H3C O

[0159] wherein [0146] R is CHA, CFs, CH2CHA, or CF.CFs; and [0160] X is O, CH2, NH, Se, PR, or NR; [0147] T is OH, OR, NHCOCHA, or NHCOR; [0161] Z is a hydrogen bond acceptor, NO2, CN, COR, CONHR: [0148] wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. [0162] Y is a lipid soluble group, CFs, CH5, formyl, alkoxy, H, I, Br, C1, Sn(R)s; [0149] In one embodiment, Q is in the para position. In another embodiment, X is O. In another embodiment, Q is [0163] R is an alkyl, aryl, phenyl, alkenyl, haloalkyl, in the para position and X is O. In another embodiment, Q haloalkenyl, halogen or OH: is para alkyl, halogen, N(R)2, NHCOCHA, NHCOCFs, [0164] and Q is alkyl, halogen, N(R)2, CN, NHCOCHs. NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCOCF, NHCOR, NHCONHR, NHCOOR, NHCSCH, NHCSCFs, NHCSR NHSO.CHA, NHSO.R. OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR OR, COR, OCOR, OSO,R, SO,R or SR NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, [0150] wherein R is an aryl, phenyl, hydroxyl, C1-Ca SO,R or SR, CN, halogen, acetamido-, trifluroaceta alkyl, C1-C4 haloalkyl, halogen, alkenyl or haloalkenyl. mido-, alkylamines, ether, alkyl, N-sulfonyl, O-sulfo nyl, alkylsulfonyl, carbonyl, or a ketone. [0151] In one embodiment the present invention provides for the use of a SARM compound or its prodrug, analog, [0165] In one embodiment, X is O, or in another embodi isomer, metabolite, derivative, pharmaceutically acceptable ment, T is OH, or in another embodiment, R, is CHA, or in salt, pharmaceutical product, polymorph, crystal, impurity, another embodiment, Z is NO2, or in another embodiment, N-oxide, hydrate or any combination thereof, represented by Z is CN, or in another embodiment, Y is CFs, or in another the structure of formula (II): embodiment, Q is alkyl, F, Cl, Br, I, N(R), NHCOCHA, NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCFs, NHCSR NHSO.CH, (II) NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR, CN, halogen, acetamido-, trifluroacetamido-, alkylamines, ether, alkyl, N-sulfonyl, O-sulfonyl, alkylsulfonyl, carbonyl, or a

ketone or in another embodiment, any combination thereof. [0166] In another embodiment, the present invention pro vides for the use of a SARM represented by a structure of formula (II): [0152] wherein (II)

[0153] X is O, CH2, NH, Se, PR, or NR; [0154] Z is a hydrogen bond acceptor, NO2, CN, COR, CONHR: [0155] Y is a lipid soluble group, I, CFs, alkyl, formyl, alkoxy, Br, C1, Sn(R)s; [0156] R is an alkyl, aryl, phenyl, alkenyl, haloalkyl, haloalkenyl, halogen or OH: [0167] wherein X is O, [0157] and Q is CN, halogen, acetamido-, trifluroaceta [0168] Z is NO, CN, COR, or CONHR; mido-, alkylamines, ether, alkyl, N-sulfonyl, O-sulfo [0169] Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, F or nyl, alkylsulfonyl, carbonyl, or a ketone. Sn(R)s; US 2007/028 1906 A1 Dec. 6, 2007

[0170] R is an alkyl, aryl, phenyl, alkenyl, haloalkyl, [0181] wherein haloalkenyl, halogen or OH; and [0182] R2, Rs. Ra, Rs. Ra are independently is H, halogen, [0171] Q is CN. NO2, CN, NHCORs, N(COR)2, CORio, OR11, OSO2R12, SO2R1s. NHSO2R12, SR14, an imide ring, alkyl [0172] In one embodiment, the invention provides for the or substituted alkyl with at least one substituent of halo use of a compound or its prodrug, analog, isomer, metabo gen, CN, NH2, OH, alkoxy; or R2 and Rs. Rs and Ra, Ra lite, derivative, pharmaceutically acceptable salt, pharma and Rs, or Rs and Ra form, together with any of the ring ceutical product, polymorph, crystal, impurity, N-oxide, atom(s) to which they are attached, a condensed 5 to 7 hydrate or any combination thereof, represented by a struc membered aliphatic or aromatic carbocyclic ring or a ture of formula (III): condensed 5 to 7 membered heterocyclic ring containing 1 to 3 heteroatom(s) selected from N, O, S, or represented by structures A, B or C: (III) NC CN

2. NH .O A. 2. | O }s [0173] In another embodiment, this invention provides for 2. NH 2.0 B the use of a SARM compound or its prodrug, analog, isomer, metabolite, derivative, pharmaceutically acceptable salt, pharmaceutical product, polymorph, crystal, impurity, N-ox }s | 2 ide, hydrate or any combination thereof, represented by a structure of formula (IV): 2. NH C

(IV) %2%-4

[0183] R, and Rs are independently H, halogen, alkyl or alkenyl [0184] R., and Rio are independently alkyl, alkenyl, haloalkyl, aminoalkyl, mono- or di alkylaminoalkyl, aryl, N(Ris), or –OR1a; [0174] wherein X is O or NH; [0185] R11 and Ria independently H, alkyl, alkenyl, haloalkyl, aminoalkyl, mono- or di alkylaminoalkyl, [0175] T is OH, OR, NHCOCH, NHCOR or OC(O)R; aryl, -COR17; [0176] Z is hydrogen, alkyl, NO2, CN, COOH, COR, [0186] R12 and R1s are independently alkyl or alkenyl, NHCOR or CONHR: haloalkyl or aryl; [0177] Y is hydrogen, alkyl, CFs, formyl, alkoxy, halo [0187] R1s and Rig are independently H, alkyl, alkenyl, gen, hydroxyalkyl or alkyl aldehyde; haloalkyl, aminoalkyl or aryl; [0178] R is alkyl, haloalkyl, dihaloalkyl, trihaloalkyl, [0188] Riz is alkyl, alkenyl, haloalkyl or aryl. CH2F, CHF, CFs, CF2CFs, aryl, phenyl, halogen, [0189] In one embodiment, according to this aspect of the haloalkenyl, alkenyl or OH; and invention, X is O, or in another embodiment, T is OH, or in [0179] R is CHA, CH,F, CHF, CFs, CH2CHA, or another embodiment, RI is CH3, or in another embodiment, CF2CFs. Z is NO2, or in another embodiment, Z is CN, or in another embodiment, R2, Rs. Rs, Ra are hydrogens and R4 is [0180] A is a group selected from: NHCOCFs, or in another embodiment, R2, Rs. Rs. Ra are hydrogens and R4 is CN, or in another embodiment, R2, Rs. Rs, Ra are hydrogens and Ra is F, or in another embodiment, R2 R2, Rs. Rs, Ra are hydrogens, or in another embodiment, Z is in the para position, or in another embodiment, Y is in the meta position, or in another embodiment, any combination thereof. [0190] In one embodiment, the compound of formula II, wherein X is a bond or CH2 is an agonist with minimal or no antagonist activity. In another embodiment, compound XVIII and XIX are agonists with minimal or no antagonist activity. US 2007/028 1906 A1 Dec. 6, 2007

[0191] The present invention relates to use of a compound any position of the five or 6 membered ring carrying this represented by the structure of formula (XX): substitutent (hereinafter “B ring”). It is understood that when any of the ring members Al-Ali or B1-B11 are O or S, then these ring members are unsubstituted. It is further (XX) understood that when any of the ring members Al-Ali or B-B, are O or S, then the dotted line between O or Satoms and adjacent ring members represents a single bond. [0204] In one embodiment, the A ring includes any type of saturated or unsaturated carbocyclic ring. In one embodi ment, the A ring is a 6 membered saturated carbocyclic ring, which may be unsubstituted, monosubstituted or polysub wherein stituted by any of the substitutents described hereinabove. In one embodiment, the A ring is a 5 membered saturated [0192] X is O, CH, NH, Se, PR, or NR; carbocyclic ring, which may be unsubstituted, monosubsti [0193] R is CHA, CFs, CH2CH3, or CF, CFs; tuted or polysubstituted by any of the substitutents described hereinabove. In another embodiment, the A ring is a 6 [0194] T is OH, OR, NHCOCHA, or NHCOR; membered carbocyclic ring containing one or more double [0195] wherein R is a C1-C4 alkyl, a C1-C4 haloalkyl, aryl, bonds, which ring may be unsubstituted, monosubstituted or phenyl, halogen, alkenyl, haloalkenyl, or hydroxyl; polysubstituted by any of the substitutents described here inabove. In another embodiment, the Aring is a 5 membered [0196] A is a 5 or 6 membered saturated, unsaturated or carbocyclic ring containing one or more double bonds, aromatic carbocyclic or heterocyclic ring represented by which ring may be unsubstituted, monosubstituted or the structure: polysubstituted by any of the substitutents described here inabove. Z [0205] In another embodiment, the A ring includes any Zsº - - As *N*.- A type of saturated, unsaturated or aromatic heterocyclic ring. A, A- or ; Ai In another embodiment, the Aring is a 6 membered saturated 2× A. A10/..' heterocyclic ring, which may be unsubstituted, monosubsti Y As-- A. Y All tuted or polysubstituted by any of the substituents described hereinabove. In another embodiment, the A ring is a 5 membered saturated heterocyclic ring, which may be unsub [0197] B is a 5 or 6 membered saturated, unsaturated or stituted, monosubstituted or polysubstituted by any of the aromatic carbocyclic or heterocyclic ring represented by substituents described hereinabove. In another embodiment, the structure: the A ring is a 6 membered heterocyclic ring containing one or more double bonds, which ring may be unsubstituted, monosubstituted or polysubstituted by any of the substi tutents described hereinabove. In another embodiment, the A ring is a 5 membered heterocyclic ring containing one or more double bonds, which ring may be unsubstituted, mono substituted or polysubstituted by any of the substitutents described hereinabove. In another embodiment, the Aring is a 6 membered heteroaromatic ring which may be unsubsti tuted, monosubstituted or polysubstituted by any of the [0198] wherein Al-Ali are each C, CH, CH, O, S, N, or substitutents described hereinabove. In another embodi NH; ment, the A ring is a 5 membered heteroaromatic ring which [0199] B1-B, are each C, CH, CH, O, S, N, or NH; may be unsubstituted, monosubstituted or polysubstituted by any of the substitutents described hereinabove. [0200] Z is a hydrogen bond acceptor, alkyl, H, NO2, CN, COOH, COR, NHCOR or CONHR; Y is a lipid soluble [0206] Similarly, the Bring includes any type of saturated group, hydrogen, alkyl, formyl, alkoxy, hydroxylalkyl, or unsaturated carbocyclic ring. In one embodiment, the B alkylaldehyde, CFs, F, I, Br, C1, CN, C(R)s or Sn(R)s; and ring is a 6 membered saturated carbocyclic ring, which may be unsubstituted, monosubstituted or polysubstituted by any [0201] Q, and Q, are independently of each other H, alkyl, of the substitutents described hereinabove. In one embodi halogen, CN, N(R), NHCOCHA, NHCOCFs, NHCOR, ment, the B ring is a 5 membered saturated carbocyclic ring, NHCONHR, NHCOOR, OCONHR, CONHR, NHC which may be unsubstituted, monosubstituted or polysub SCHA, NHCSCFs, NHCSR, NHSO2CH2, NHSO,R, OR, stituted by any of the substitutents described hereinabove. In COR, OCOR, OSO,R, SO,R or SR; another embodiment, the Bring is a 6 membered carbocyclic 0202] wherein R is a C1-C41-C4 alkyl,alky a C1-C41 TS-4 haloalkyl,y1, aryaryl, ring containing one or more double bonds, which ring may phenyl, halogen, alkenyl, haloalkenyl, or hydroxyl. In one be unsubstituted, monosubstituted or polysubstituted by any of the substitutents described hereinabove. In another embodiment, the alkyl group is CHs. embodiment, the B ring is a 5 membered carbocyclic ring [0203] The substitutents Z and Y can be in any position of containing one or more double bonds, which ring may be the five or 6 membered ring carrying these substitutents unsubstituted, monosubstituted or polysubstituted by any of (hereinafter “A ring”). Similarly, the substituent Q can be in the substitutents described hereinabove. US 2007/028 1906 A1 Dec. 6, 2007

[0207] In another embodiment, the B ring includes any [0212] An “aryl” group refers to an aromatic group having type of saturated, unsaturated or aromatic heterocyclic ring. at least one carbocyclic aromatic group or heterocyclic In another embodiment, the B ring is a 6 membered satu aromatic group, which may be unsubstituted or substituted rated heterocyclic ring, which may be unsubstituted, mono by one or more groups selected from halogen, haloalkyl, substituted or polysubstituted by any of the substitutents hydroxy, alkoxy carbonyl, amido, alkylamido, dialkyla described hereinabove. In another embodiment, the Bring is mido, nitro, amino, alkylamino, dialkylamino, carboxy or a 5 membered saturated heterocyclic ring, which may be thio or thioalkyl. Nonlimiting examples of aryl rings are unsubstituted, monosubstituted or polysubstituted by any of phenyl, naphthyl, pyranyl, pyrrolyl, pyrazinyl, pyrimidinyl, the substituents described hereinabove. In another embodi pyrazolyl, pyridinyl, furanyl, thiophenyl, thiazolyl, imida ment, the B ring is a 6 membered heterocyclic ring contain zolyl, isoxazolyl, and the like. In one embodiment, the aryl ing one or more double bonds, which ring may be unsub group is a 1-12 membered ring. In another embodiment, the stituted, monosubstituted or polysubstituted by any of the aryl group is a 1-8 membered ring. In another embodiment, substitutents described hereinabove. In another embodi the aryl group comprises of 1-4 fused rings. ment, the B ring is a 5 membered heterocyclic ring contain ing one or more double bonds, which ring may be unsub [0213] A “hydroxyl” group refers to an OH group. It is stituted, monosubstituted or polysubstituted by any of the understood by a person skilled in the art that when T is OR, substitutents described hereinabove. In another embodi R is not OH. ment, the B ring is a 6 membered heteroaromatic ring which [0214] In one embodiment, the term “halogen refers to in may be unsubstituted, monosubstituted or polysubstituted by one embodiment to F, in another embodiment to C1, in any of the substituents described hereinabove. In another another embodiment to Br, in another embodiment to I. embodiment, the Bring is a 5 membered heteroaromatic ring which may be unsubstituted, monosubstituted or polysub [0215] An “arylalkyl” group refers, in another embodi ment, to an alkyl bound to an aryl, wherein alkyl and aryl are stituted by any of the substitutents described hereinabove. as defined above. An example of an arylalkyl group is a [0208] Nonlimiting examples of suitable A rings and/or B benzyl group. rings are carbocyclic rings such as cyclopentane, cyclopen tene, cyclohexane, and cyclohexene rings, and heterocyclic [0216] In one embodiment, this invention provides for the rings such as pyran, dihydropyran, tetrahydropyran, pyrrole, use of a compound as herein described and/or, its analog, dihydropyrrole, tetrahydropyrrole, pyrazine, dihydropyra derivative, isomer, metabolite, pharmaceutically acceptable zine, tetrahydropyrazine, pyrimidine, dihydropyrimidine, salt, pharmaceutical product, hydrate, N-oxide, prodrug, tetrahydropyrimidone, pyrazol, dihydropyrazol, tetrahydro polymorph, impurity or crystal or combinations thereof. pyrazol, piperidine, piperazine, pyridine, dihydropyridine, [0217] In one embodiment, the term “isomer” includes, tetrahydropyridine, morpholine, thiomorpholine, furan, but is not limited to, optical isomers and analogs, structural dihydrofuran, tetrahydrofuran, thiophene, dihy isomers and analogs, conformational isomers and analogs, drothiophene, tetrahydrothiophene, thiazole, imidazole, and the like. isoxazole, and the like. [0218] In one embodiment, the term “isomer” is meant to [0209] An “alkyl” group refers, in one embodiment, to a encompass optical isomers of the SARM compound. It will saturated aliphatic hydrocarbon, including straight-chain, be appreciated by those skilled in the art that the SARMs of branched-chain and cyclic alkyl groups. In one embodiment, the present invention contain at least one chiral center. the alkyl group has 1-12 carbons. In another embodiment, Accordingly, the SARMs used in the methods of the present the alkyl group has 1-7 carbons. In another embodiment, the invention may existin, and be isolated in, optically-active or alkyl group has 1-6 carbons. In another embodiment, the racemic forms. Some compounds may also exhibit polymor alkyl group has 1-4 carbons. The alkyl group may be phism. It is to be understood that the present invention unsubstituted or substituted by one or more groups selected encompasses any racemic, optically-active, polymorphic, or from halogen, hydroxy, alkoxy carbonyl, amido, alkyla stereroisomeric form, or mixtures thereof, which form pos mido, dialkylamido, nitro, amino, alkylamino, dialkylamino, sesses properties useful in the treatment of androgen-related carboxyl, thio and thioalkyl. In one embodiment, the alkyl conditions described herein. In one embodiment, the group is CHs. SARMs are the pure (R)-isomers. In another embodiment, the SARMs are the pure (S)-isomers. In another embodi [0210] An “alkenyl” group refers, in another embodiment, ment, the SARMs are a mixture of the (R) and the (S) to an unsaturated hydrocarbon, including straight chain, isomers. In another embodiment, the SARMs are a racemic branched chain and cyclic groups having one or more double mixture comprising an equal amount of the (R) and the (S) bond. The alkenyl group may have one double bond, two isomers. It is well known in the art how to prepare optically double bonds, three double bonds etc. Examples of alkenyl active forms (for example, by resolution of the racemic form groups are ethenyl, propenyl, butenyl, cyclohexenyl etc. The by recrystallization techniques, by synthesis from optically alkenyl group may be unsubstituted or substituted by one or more groups selected from halogen, hydroxy, alkoxy carbo active starting materials, by chiral synthesis, or by chro nyl, amido, alkylamido, dialkylamido, nitro, amino, alky matographic separation using a chiral stationary phase). lamino, dialkylamino, carboxyl, thio and thioalkyl. [0219] The invention includes “pharmaceutically accept able salts” of the compounds of this invention, which may [0211] A “haloalkyl” group refers to an alkyl group as be produced, by reaction of a compound of this invention defined above, which is substituted by one or more halogen with an acid or base. atoms, in one embodiment by F, in another embodiment by Cl, in another embodiment by Br, in another embodiment by [0220] Suitable pharmaceutically-acceptable salts of I. amines of Formula I-XX may be prepared from an inorganic US 2007/028 1906 A1 Dec. 6, 2007 acid or from an organic acid. In one embodiment, examples [0224] In one embodiment, the salts may be formed by of inorganic salts of amines are bisulfates, borates, bro conventional means, such as by reacting the free base or free mides, chlorides, hemisulfates, hydrobromates, hydrochlor acid form of the product with one or more equivalents of the ates, 2-hydroxyethylsulfonates (hydroxyethanesulfonates), approptriate acid or base in a solvent or medium in which the iodates, iodides, isothionates, nitrate, persulfates, phosphate, salt is insoluble or in a solvent such as water, which is sulfates, sulfamates, sulfanilates, sulfonic acids (alkylsul removed in vacuo or by freeze drying or by exchanging the fonates, arylsulfonates, halogen substituted alkylsulfonates, ions of a existing salt for another ion or suitable ion halogen substituted arylsulfonates), sulfonates and thiocy exchange resin. anates. [0225] The invention also includes use of N-oxides of the [0221] In one embodiment, examples of organic salts of amino substituents of the compounds described herein. amines may be selected from aliphatic, cycloaliphatic, aro matic, araliphatic, heterocyclic, carboxylic and sulfonic [0226] This invention provides for the use of derivatives classes of organic acids, examples of which are acetates, of the compounds as herein described. In one embodiment, arginines, aspartates, ascorbates, adipates, anthranilate, “derivatives” includes but is not limited to ether derivatives, algenate, alkane carboxylates, substituted alkane carboxy acid derivatives, amide derivatives, ester derivatives and the lates, alginates, benzenesulfonates, benzoates, bisulfates, like. In another embodiment, this invention further includes butyrates, bicarbonates, bitartrates, carboxilate, citrates, use of hydrates of the compounds as described herein. In one camphorates, camphorsulfonates, cyclohexylsulfamates, embodiment, “hydrate” includes but is not limited to hemi cyclopentanepropionates, calcium edetates, camsylates, car hydrate, monohydrate, dihydrate, trihydrate and the like. bonates, clavulanates, cinnamates, dicarboxylates, diglucon [0227] This invention provides, in other embodiments, use ates, dodecylsulfonates, dihydrochlorides, decanoates, enan of metabolites of the compounds as herein described. In one thuates, ethanesulfonates, edetates, edisylates, estolates, embodiment, “metabolite” means any substance produced esylates, fumarates, formates, fluorides, galacturonate glu conates, glutamates, glycolates, glucorate, glucohep from another substance by metabolism or a metabolic pro tanoates, glycerophosphates, gluceptates, glycollylarsa CèSS. nilates, glutarates, glutamate, heptanoates, hexanoates, [0228] This invention provides, in other embodiments, use hydroxymaleates, hydroxycarboxlic acids, hexylresorci of pharmaceutical products of the compounds as herein nates, hydroxybenzoates, hydroxynaphthoate, hydrofluo described. The term “pharmaceutical product” refers, in rate, lactates, lactobionates, laurates, malates, maleates, other embodiments, to a composition suitable for pharma methylenebis(beta-oxynaphthoate), malonates, mandelates, ceutical use (pharmaceutical composition), for example, as mesylates, methane sulfonates, methylbromides, methylni described herein. trates, methylsulfonates, monopotassium maleates, mucates, monocarboxylates, mitrates, naphthalenesulfonates, 2-naph [0229] Compounds as herein described may be prepared thalenesulfonates, nicotinates, napsylates, N-methylglucam by any means known in the art, including inter alia, those ines, oxalates, octanoates, oleates, pamoates, phenylac described in U.S. patent application Ser. No. 11/505,363 and etates, picrates, phenylbenzoates, pivalates, propionates, U.S. patent application Ser. No. 11/505,499; fully incorpo phthalates, phenylacetate, pectinates, phenylpropionates, rated by reference herein in their entirety. palmitates, pantothenates, polygalacturates, pyruvates, [0230] In some embodiments, the compounds for use in quinates, salicylates, succinates, stearates, sulfanilate, sub the methods of this invention are nonsteroidal ligands for the acetates, tartarates, theophyllineacetates, p-toluene androgen receptor and may demonstrate tissue-selective sulfonates (tosylates), trifluoroacetates, terephthalates, tan androgenic and/or anabolic activity. These novel agents are nates, teoclates, trihaloacetates, triethiodide, tricarboxylates, useful in males for the treatment of a variety of hormone undecanoates and valerates. related conditions such as sexual dysfunction, decreased [0222] In one embodiment, examples of inorganic salts of sexual libido, erectile dysfunction, hypogonadism, sarcope carboxylic acids or phenols may be selected from ammo nia, osteopenia, osteoporosis, alterations in cognition and nium, alkali metals to include lithium, sodium, potassium, mood, depression, anemia, hair loss, obesity, benign prostate cesium; alkaline earch metals to include calcium, magne hyperplasia and/or prostate cancer. Further, the compounds sium, aluminium; zinc, barium, cholines, quaternary ammo are useful for oral testosterone replacement therapy, and niums. treating prostate cancer. In other embodiments, the com pounds are useful for the treatment of a variety of hormone [0223] In another embodiment, examples of organic salts related conditions in females including, sexual dysfunction, of carboxylic acids or phenols may be selected from argin decreased sexual libido, hypogonadism, sarcopenia, ine, organic amines to include aliphatic organic amines, osteopenia, osteoporosis, alterations in cognition and mood, alicyclic organic amines, aromatic organic amines, benza depression, anemia, hair loss, obesity, endometriosis, infer thines, t-butylamines, benethamines (N-benzylphenethy tility, breast cancer, uterine cancer and ovarian cancer. In lamine), dicyclohexylamines, dimethylamines, diethanola other embodiments, the SARMs are useful for treating, mines, ethanolamines, ethylenediamines, hydrabamines, suppressing, inhibiting or reducing the incidence of diabetes imidazoles, lysines, methylamines, meglamines, N-methyl type II, diabetes type I, glucose intolerance, hyperinsuline D-glucamines, N,N'-dibenzylethylenediamines, nicotina mia, insulin resistance, dyslipidemia, hypercholesterolemia, mides, organic amines, omithines, pyridines, picolies, pip high blood pressure, obesity, fatty liver conditions, diabetic erazines, procain, tris(hydroxymethyl)methylamines, nephropathy, diabetic neuropathy, diabetic retinopathy, car triethylamines, triethanolamines, trimethylamines, diovascular disease, atherosclerosis, cerebrovascular condi tromethamines and ureas. tions and stroke. US 2007/028 1906 A1 Dec. 6, 2007

[0231] In some embodiments, the compounds as described or ocular application. Another method of administration is herein are useful in preventing and treating muscle wasting via aspiration or aerosol formulation. disorders, bone related disorders, and diabetes related dis [0238] In one embodiment, the pharmaceutical composi orders. tions are administered orally, and are thus formulated in a [0232] In some embodiments, the compounds as described form suitable for oral administration, i.e. as a solid or a herein are useful, either alone or as a composition, in males liquid preparation. Suitable solid oral formulations include and females for the treatment of a variety of hormone tablets, capsules, pills, granules, pellets, powders, and the related conditions, such as hypogonadism, sarcopenia, erec like. Suitable liquid oral formulations include solutions, tile dysfunction, lack of libido, osteoporosis and fertility. In suspensions, dispersions, emulsions, oils and the like. In one some embodiments, the compounds as described herein are embodiment of the present invention, the SARM com useful in stimulating or promoting or restoring function to pounds are formulated in a capsule. In accordance with this various processes, which in turn result in the treatment of the embodiment, the compositions of the present invention conditions as herein described, including, inter aila, promot comprise in addition to the SARM active compound and the ing erythropoiesis, osteogenesis, muscle growth, glucose inert carrier or diluent, a hard gelatin capsule. uptake, insulin secretion, and/or preventing lipidogenesis, [0239] In one embodiment, the micronized capsules com clotting, insulin resistance, atherosclerosis, osteoclast activ prise particles containing a SARM of this invention, wherein ity, and others. the term “micronized” used herein refers to particles having [0233] In one embodiment, the methods of this invention a particle size is of less than 100 microns, or in another make use of the described compound contacting or binding embodiment, less than 50 microns, or in another embodi a receptor, and thereby mediating the described effects. In ment, less than 35 microns, or in another embodiment, less some embodiments, the receptor is a nuclear receptor, which than 15 microns, or in another embodiment, less than 10 in one embodiment, is an androgen receptor, or in another microns, or in another embodiment, less than 5 microns. embodiment, is an estrogen receptor, or in another embodi [0240] Further, in another embodiment, the pharmaceuti ment, is a progesterone receptor, or in another embodiment, cal compositions are administered by intravenous, intraar is a glucocorticoid receptor. In some embodiments, the terial, or intramuscular injection of a liquid preparation. multitude of effects may occur simultaneously, as a function Suitable liquid formulations include solutions, suspensions, of binding to multiple receptors in the subject. In some dispersions, emulsions, oils and the like. In one embodi embodiments, the tissue selective effects of the compounds ment, the pharmaceutical compositions are administered as described herein provide for simulataneous action on intravenously, and are thus formulated in a form suitable for different target organs. intravenous administration. In another embodiment, the [0234] In some embodiments, tissue selectivity may be a pharmaceutical compositions are administered intraarteri function of specific promoter interaction, as exemplified ally, and are thus formulated in a form suitable for intraar herein in Example 8. terial administration. In another embodiment, the pharma ceutical compositions are administered intramuscularly, and Pharmaceutical Compositions are thus formulated in a form suitable for intramuscular [0235] In some embodiments, this invention provides administration. methods of use which comprise administering a composition [0241] Further, in another embodiment, the pharmaceuti comprising the described compounds. As used herein, “phar cal compositions are administered topically to body sur maceutical composition” means a “therapeutically effective faces, and are thus formulated in a form suitable for topical amount” of the active ingredient, i.e. the SARM compound, administration. Suitable topical formulations include gels, together with a pharmaceutically acceptable carrier or dilu ointments, creams, lotions, drops and the like. For topical ent. A “therapeutically effective amount” as used herein administration, the SARM agents or their physiologically refers to that amount which provides a therapeutic effect for tolerated derivatives such as salts, esters, N-oxides, and the a given condition and administration regimen. like are prepared and applied as solutions, suspensions, or [0236] As used herein, the term “administering” refers to emulsions in a physiologically acceptable diluent with or bringing a subject in contact with a SARM compound of the without a pharmaceutical carrier. present invention. As used herein, administration can be [0242] Further, in another embodiment, the pharmaceuti accomplished in vitro, i.e. in a test tube, or in vivo, i.e. in cal compositions are administered as a suppository, for cells or tissues of living organisms, for example humans. In example a rectal suppository or a urethral suppository. one embodiment, the present invention encompasses admin Further, in another embodiment, the pharmaceutical com istering the compounds of the present invention to a subject. positions are administered by subcutaneous implantation of [0237] The pharmaceutical compositions containing the a pellet. In a further embodiment, the pellet provides for SARM agent can be administered to a subject by any method controlled release of SARM agent over a period of time. In known to a person skilled in the art, such as orally, parenter a further embodiment, the pharmaceutical compositions are ally, intravascularly, paracancerally, transmucosally, trans administered intravaginally. dermally, intramuscularly, intranasally, intravenously, intra [0243] In another embodiment, the active compound can dermally, subcutaneously, sublingually, intraperitonealy, be delivered in a vesicle, in particular a liposome (see intraventricularly, intracranially, intravaginally, by inhala Langer, Science 249:1527-1533 (1990); Treat et al., in tion, rectally, intratumorally, or by any means in which the Liposomes in the Therapy of Infectious Disease and Cancer, recombinant virus/composition can be delivered to tissue Lopez-Berestein and Fidler (eds.), Liss, New York, pp. (e.g., needle or catheter). Alternatively, topical administra 353–365 (1989); Lopez-Berestein, ibid., pp. 317-327; see tion may be desired for application to mucosal cells, for skin generally ibid). US 2007/028 1906 A1 Dec. 6, 2007

[0244] As used herein “pharmaceutically acceptable car carmelose sodium, crospovidone, guar gum, sodium starch riers or diluents” are well known to those skilled in the art. glycolate), buffers (e.g., Tris-HCI, acetate, phosphate) of The carrier or diluent may be a solid carrier or diluent for various pH and ionic strength, additives such as albumin or solid formuations, a liquid carrier or diluent for liquid gelatin to prevent absorption to surfaces, detergents (e.g., formulations, or mixtures thereof. Tween 20, Tween 80, Pluronic F68, bile acid salts), protease inhibitors, surfactants (e.g. sodium lauryl sulfate), perme [0245] Solid carriers/diluents include, but are not limited ation enhancers, solubilizing agents (e.g., cremophor, glyc to, a gum, a starch (e.g. corn starch, pregeletanized starch), erol, polyethylene glycerol, benzlkonium chloride, benzyl a sugar (e.g., lactose, mannitol, sucrose, dextrose), a cellu benzoate, cyclodextrins, sobitan esters, stearic acids), anti losic material (e.g. microcrystalline cellulose), an acrylate oxidants (e.g., ascorbic acid, sodium metabisulfite, butylated (e.g. polymethylacrylate), calcium carbonate, magnesium hydroxyanisole), stabilizers (e.g. hydroxypropyl cellulose, oxide, talc, or mixtures thereof. hyroxypropylmethyl cellulose), viscosity increasing agents [0246] In one embodiment, the compositions of this inven (e.g. carbomer, colloidal silicon dioxide, ethyl cellulose, tion may include, a SARM of this invention or any combi guar gum), sweetners (e.g. aspartame, citric acid), preser nation thereof, together with one or more pharmaceutically vatives (e.g., Thimerosal, benzyl alcohol, parabens), color acceptable excipients. ing agents, lubricants (e.g. Stearic acid, magnesium Stearate, polyethylene glycol, sodium lauryl sulfate), flow-aids (e.g. [0247] Suitable excipients and carriers may be, according colloidal silicon dioxide), plasticizers (e.g. diethyl phthalate, to embodiments of the invention, solid or liquid and the type triethyl citrate), emulsifiers (e.g. carbomer, hydroxypropyl is generally chosen based on the type of administration cellulose, sodium lauryl sulfate), polymer coatings (e.g., being used. Liposomes may also be used to deliver the poloxamers or poloxamines), coating and film forming composition. Examples of suitable solid carriers include agents (e.g. ethyl cellulose, acrylates, polymethacrylates), lactose, sucrose, gelatin and agar. Oral dosage forms may and/or adjuvants. contain suitable binders, lubricants, diluents, disintegrating agents, coloring agents, flavoring agents, flow-inducing [0251] In one embodiment, the pharmaceutical composi agents, and melting agents. Liquid dosage forms may con tions provided herein are controlled release compositions, tain, for example, suitable solvents, preservatives, emulsi i.e. compositions in which the SARM compound is released fying agents, suspending agents, diluents, sweeteners, thick over a period of time after administration. Controlled or eners, and melting agents. Parenteral and intravenous forms sustained release compositions include formulation in lipo should also include minerals and other materials to make philic depots (e.g. fatty acids, waxes, oils). In another embodiment, the composition is an immediate release com them compatible with the type of injection or delivery position, i.e. a composition in which all of the SARM system chosen. Of course, other excipients may also be used. compound is released immediately after administration. [0248] For liquid formulations, pharmaceutically accept [0252] In another embodiment, the pharmaceutical com able carriers may be aqueous or non-aqueous solutions, position can be delivered in a controlled release system. For suspensions, emulsions or oils. Examples of non-aqueous example, the agent may be administered using intravenous solvents are propylene glycol, polyethylene glycol, and infusion, an implantable osmotic pump, a transdermal patch, injectable organic esters such as ethyl oleate. Aqueous liposomes, or other modes of administration. In one embodi carriers include water, alcoholic/aqueous solutions, cyclo ment, a pump may be used (see Langer, supra; Sefton, CRC dextrins, emulsions or suspensions, including saline and Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., buffered media. Examples of oils are those of petroleum, Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. animal, vegetable, or synthetic origin, for example, peanut 321:574 (1989). In another embodiment, polymeric materi oil, soybean oil, mineral oil, olive oil, sunflower oil, and als can be used. In yet another embodiment, a controlled fish-liver oil. release system can be placed in proximity to the therapeutic [0249] Parenteral vehicles (for subcutaneous, intravenous, target, i.e., the brain, thus requiring only a fraction of the intraarterial, or intramuscular injection) include sodium systemic dose (see, e.g., Goodson, in Medical Applications chloride solution, Ringer’s dextrose, dextrose and sodium of Controlled Release, supra, vol. 2, pp. 115-138 (1984). chloride, lactated Ringer’s and fixed oils. Intravenous Other controlled release systems are discussed in the review vehicles include fluid and nutrient replenishers, electrolyte by Langer (Science 249:1527-1533 (1990). replenishers such as those based on Ringer’s dextrose, and [0253] The compositions may also include incorporation the like. Examples are sterile liquids such as water and oils, of the active material into or onto particulate preparations of with or without the addition of a surfactant and other polymeric compounds such as polylactic acid, polglycolic pharmaceutically acceptable adjuvants. In general, water, acid, hydrogels, etc, or onto liposomes, microemulsions, saline, aqueous dextrose and related sugar solutions, and micelles, unilamellar or multilamellar vesicles, erythrocyte glycols such as propylene glycols or polyethylene glycol are ghosts, or spheroplasts.) Such compositions will influence preferred liquid carriers, particularly for injectable solutions. the physical state, solubility, stability, rate of in vivo release, Examples of oils are those of petroleum, animal, vegetable, and rate of in vivo clearance. or synthetic origin, for example, peanut oil, soybean oil, [0254] Also comprehended by the invention are particu mineral oil, olive oil, sunflower oil, and fish-liver oil. late compositions coated with polymers (e.g. poloxamers or [0250] In addition, the compositions may further comprise poloxamines) and the compound coupled to antibodies binders (e.g. acacia, cornstarch, gelatin, carbomer, ethyl directed against tissue-specific receptors, ligands or antigens cellulose, guar gum, hydroxypropyl cellulose, hydroxypro or coupled to ligands of tissue-specific receptors. pyl methyl cellulose, povidone), disintegrating agents (e.g. [0255] Also comprehended by the invention are com cornstarch, potato starch, alginic acid, silicon dioxide, cros pounds modified by the covalent attachment of water US 2007/028 1906 A1 Dec. 6, 2007

soluble polymers such as polyethylene glycol, copolymers invention. In one embodiment, such compositions are useful of polyethylene glycol and polypropylene glycol, carboxym for oral testosterone replacement therapy. ethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrroli [0260] In one embodiment, this invention also provides a done or polyproline. The modified compounds are known to composition comprising two or more compounds of I-XX of exhibit substantially longer half-lives in blood following this invention, or polymorphs, isomers, hydrates, salts, intravenous injection than do the corresponding unmodified N-oxides, etc., thereof. The present invention also relates to compounds (Abuchowski et al., 1981; Newmarket al., 1982; compositions and a pharmaceutical compositions which and Katre et al., 1987). Such modifications may also increase the compound’s solubility in aqueous solution, comprises a SARM alone or in combination with a progestin eliminate aggregation, enhance the physical and chemical or estrogen, or in another embodiment, chemotherapeutic stability of the compound, and greatly reduce the immuno compound, osteogenic or myogenic compound, or other genicity and reactivity of the compound. As a result, the agents suitable for the applications as herein described. In desired in vivo biological activity may be achieved by the one embodiment, the compositions of this invention will administration of such polymer-compound abducts less fre comprise a suitable carrier, diluent or salt. quently or in lower doses than with the unmodified com [0261] In one embodiment, the methods of this invention pound. may comprise administration of a compound of formula I-XX of this invention at various dosages. In one embodi [0256] The preparation of pharmaceutical compositions, ment, the compound of formula I-XX is administered at a which contain an active component is well understood in the dosage of 0.01-1 mg per day. In one embodiment, compound art, for example by mixing, granulating, or tablet-forming of formula I-XX is administered at a dosage of 0.1-200 mg processes. The active therapeutic ingredient is often mixed per day. In one embodiment, compound of formula I-XX is with excipients which are pharmaceutically acceptable and administered at a dose of 0.1-10 mg per day, or in another compatible with the active ingredient. For oral administra embodiment, 0.1-25 mg per day, or in another embodiment, tion, the SARM agents or their physiologically tolerated 0.1-50 mg per day, or in another embodiment, 0.3-15 mg per derivatives such as salts, esters, N-oxides, and the like are day, or in another embodiment, 0.3–30 mg per day, or in mixed with additives customary for this purpose, such as another embodiment, 0.5-25 mg per day, or in another vehicles, stabilizers, or inert diluents, and converted by embodiment, 0.5-50 mg per day, or in another embodiment, customary methods into suitable forms for administration, 0.75-15 mg per day, or in another embodiment, 0.75-60 mg such as tablets, coated tablets, hard or soft gelatin capsules, per day, or in another embodiment, 1-5 mg per day, or in aqueous, alcoholic or oily solutions. For parenteral admin another embodiment, 1-20 mg per day, or in another embodi istration, the SARM agents or their physiologically tolerated ment, 3-15 mg per day, or in another embodiment, 30-50 mg, derivatives such as salts, esters, N-oxides, and the like are or in another embodiment, 30-75 mg per day, or in another converted into a solution, suspension, or emulsion, if desired embodiment, 100-2000 mg per day. with the substances customary and suitable for this purpose, for example, solubilizers or other. [0262] In one embodiment, the methods of this invention may comprise administration of a compound of formula III [0257] An active component can be formulated into the at various dosages. In one embodiment, compound of for composition as neutralized pharmaceutically acceptable salt mula III is administered at a dosage of 1 mg. In another forms. Pharmaceutically acceptable salts include the acid embodiment the compound of formula III is administered at addition salts (formed with the free amino groups of the a dosage of 0.01 mg, 0.03 mg, 0.1 mg, 0.3 mg, 0.75 mg, 5 polypeptide or antibody molecule), which are formed with mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 inorganic acids such as, for example, hydrochloric or phos mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 phoric acids, or such organic acids as acetic, oxalic, tartaric, mg, 90 mg, 95 mg or 100 mg. mandelic, and the like. Salts formed from the free carboxyl groups can also be derived from inorganic bases such as, for [0263] In one embodiment, the compound of formula III example, sodium, potassium, ammonium, calcium, or ferric of this invention may be administered at various dosages. In hydroxides, and such organic bases as isopropylamine, one embodiment, compound of formula III is administered trimethylamine, 2-ethylamino ethanol, histidine, procaine, at a dosage of 0.01-1 mg per day. In one embodiment, and the like. compound of formula III is administered at a dosage of 0.1-200 mg per day. In one embodiment, compound of [0258] For use in medicine, the salts of the compounds of formula III is administered at a dose of 0.1-10 mg per day, formula I-XX will be pharmaceutically acceptable salts. or in another embodiment, 0.1-25 mg per day, or in another Other salts may, however, be useful in the preparation of the embodiment, 0.1-50 mg per day, or in another embodiment, compounds according to the invention or of their pharma 0.3-15 mg per day, or in another embodiment, 0.3–30 mg per ceutically acceptable salts. Suitable pharmaceutically day, or in another embodiment, 0.5-25 mg per day, or in acceptable salts of the compounds of this invention include another embodiment, 0.5-50 mg per day, or in another acid addition salts which may, for example, be formed by embodiment, 0.75-15 mg per day, or in another embodiment, mixing a solution of the compound according to the inven 0.75-60 mg per day, or in another embodiment, 1-5 mg per tion with a solution of a pharmaceutically acceptable acid day, or in another embodiment, 1-20 mg per day, or in such as hydrochloric acid, sulphuric acid, methanesulphonic another embodiment, 3-15 mg per day, or in another embodi acid, fumaric acid, maleic acid, succinic acid, acetic acid, ment, 30-50 mg, or in another embodiment, 30-75 mg per benzoic; acid, oxalic acid, citric acid, tartaric acid, carbonic day, or in another embodiment, 100-2000 mg per day. acid or phosphoric acid. [0264] In one embodiment, the methods of this invention [0259] In one embodiment, this invention provides phar may comprise administration of a compound of formula III maceutical compositions comprising compound I-XX of this at various dosages. In one embodiment, the compound of US 2007/028 1906 A1 Dec. 6, 2007

formula III is administered at a dosage of 1 mg. In another suppressing, enhancing or stimulating a desired response in embodiment the compound of formula III is administered at a subject, as will be understood by one skilled in the art. In a dosage of 0.01 mg, 0.03 mg, 0.1 mg, 0.3 mg, 0.75 mg, 5 another embodiment, the compositions may further com mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 prise additional active ingredients, whose activity is useful mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 for the particular application for which the SARM com mg, 90 mg, 95 mg or 100 mg. pound is being administered. [0265] In one embodiment, the present invention provides [0272] In some embodiments, the compositions will fur methods of use comprising the administration of a pharma ther comprise a 5a-Reductase Inhibitors, another SARM, a ceutical composition comprising a) any embodiment of a SERM, an aromatase inhibitor, such as but not limited to compound as described herein; and b) a pharmaceutically anastrazole, exemestane, or letrozole; a GnRH agonist or acceptable carrier or diluent; which is to be understood to antagonist, a steroidal or nonsteroidal GR ligand, a steroidal include an analog, isomer, metabolite, derivative, pharma or nonsterodial PR ligand, a steroidal or nonsteroidal AR ceutically acceptable salt, N-oxide, hydrate or any combi antagonist, a 17-aldoketoreductase inhibitor or 17b-hydrox nation thereof of a compound as herein described, and may ysteroid dehydrogenase inhibitor. Such compositions may comprise compounds of formulas I-XX. be used, in some embodiments, for treating a hormone dependent condition, such as, for example, infertility, neo [0266] In some embodiments, the present invention pro plasia of a hormone-responsive cancer, for example, a vides methods of use of a pharmaceutical composition gonadal cancer, or a urogenital cancer. comprising a) any embodiment of the compounds as described herein, including an analog, isomer, metabolite, [0273] In some embodiments, the composition will com derivative, pharmaceutically acceptable salt, pharmaceutical prise the SARMs as described herein, as well as another product, N-oxide, hydrate thereof or any combination therapeutic compound, including inter alia, a 5ARI such as thereof; b) a pharmaceutically acceptable carrier or diluent; finasteride, dutasteride, izonsteride; other SARMs, such as, RU-58642, RU-56279, WS9761 A and B, RU-59063, c) a flow-aid; and d) a lubricant. RU-58841, bexlosteride, LG-2293, L-245976, LG-121071, [0267] In another embodiment, the present invention pro LG-121091, LG-121104, LGD-2226, LGD-2941, vides methods of use of a pharmaceutical composition YM-92088, YM-175735, LGD-1331, BMS-357597, BMS comprising a) any embodiment of the compounds as 391197, S-40503, BMS-482404, EM-4283, EM-4977, described herein, including an analog, isomer, metabolite, BMS-564929, BMS-391197, BMS-434588, BMS-487745, derivative, pharmaceutically acceptable salt, pharmaceutical BMS-501949, SA-766, YM-92088, YM-580, LG-123303, product, N-oxide, hydrate thereof or any combination LG-123129, PMCol, YM-175735, BMS-591305, BMS thereof; b) lactose monohydrate; c) microcrystalline cellu 591309, BMS-665139, BMS-665539, CE-590, 116BG33, lose; d) magnesium stearate; and e) colloidal silicon dioxide. 154BG31, arcarine, ACP-105: SERMs, such as tamoxifene, [0268] In some embodiments, the methods of this inven 4-hydroxytamoxifene, idoxifene, toremifene, ospenifene, tion make use of compositions comprising SARM com droloxifene, raloxifene, arzoxifene, bazedoxifene, PPT (1,3, pounds, which offer the advantage that the compounds are 5-Tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole), DPN, nonsteroidal ligands for the androgen receptor, and exhibit lasofoxifene, pipendoxifene, EM-800, EM-652, nafoxidine, anabolic activity in vivo. According to this aspect, such zindoxifene, tesmilifene, miproxifene phosphate, RU compounds are unaccompanied by serious side effects, pro 58,688, EM 139, ICI 164,384, ICI 182,780, clomiphene, vide convenient modes of administration, and lower pro MER-25, diethylstibestrol, coumestrol, genistein, GW5638, duction costs and are orally bioavailable, lack significant LY353581, zuclomiphene, enclomiphene, delmadinone cross-reactivity with other undesired steroid receptors, and acetate, DPPE, (N,N-diethyl-2-[4-(phenylmethyl) may possess long biological half-lives. phenoxy}ethanamine), TSE-424, WAY-070, WAY-292, WAY-818, cyclocommunol, prinaberel, ERB-041, WAY [0269] For administration to mammals, and particularly 397, WAY-244, ERB-196, WAY-169122, MF-101, ERb-002, humans, it is expected that the physician will determine the ERB-037, ERB-017, BE-1060, BE-380, BE-381, WAY-358, actual dosage and duration of treatment, which will be most [18FIFEDNP. LSN-500307, AA-102, Ban Zhilian, CT-101, suitable for an individual and can vary with the age, weight CT-102, VG-101; GnRH agonists or antagonists, such as, and response of the particular individual. leuprolide, goserelin, triptorelin, alfaprostol, histrelin, [0270] In one embodiment, the compositions for admin detirelix, ganirelix, antide iturelix, cetrorelix, ramorelix, istration may be sterile solutions, or in other embodiments, ganirelix, antarelix,teverelix, abarelix, ozarelix, Sufugolix, aqueous or non-aqueous, suspensions or emulsions. In one prazarelix, degarelix, NBI-56418, TAK-810, acyline; FSH embodiment, the compositions may comprise propylene agonist/antagonist, LH agonist/antagonists, aromatase glycol, polyethylene glycol, injectable organic esters, for inhibitors, such as, letrozole, anastrazole, atamestane, fadro example ethyl oleate, or cyclodextrins. In another embodi zole, minamestane, exemestane, plomestane, liarozole, ment, compositions may also comprise wetting, emulsifying NKS-01, vorozole, YM-511, finrozole, 4-hydroxyandros and/or dispersing agents. In another embodiment, the com tenedione, aminogluethimide, rogletimide; Steroidal or non positions may also comprise sterile water or any other sterile steroidal glucocorticoid receptor ligands, such as, injectable medium. ZK-216348, ZK-243149, ZK-243185, LGD-5552, mifepris tone, RPR-106541, ORG-34517, GW-215864X, Sesquicil [0271] In one embodiment, the invention provides com lin, CP-472555, CP-394531, A-222977, AL-438, A-216054, pounds and compositions, including any embodiment A-276575, CP-394531, CP-409069, UGR-07: Steroidal or described herein, for use in any of the methods of this nonsterodial progesterone receptor ligands; Steroidal or invention. In one embodiment, use of a SARM or a com nonsteroidal AR antagonists such as flutamide, hydroxy position comprising the same, will have utility in inhibiting, flutamide, bicalutamide, nilutamide, hydroxysteroid dehy US 2007/028 1906 A1 Dec. 6, 2007 drogenase inhibitors, PPARD ligand such as bezafibrate, drugs, radioisotopes, other biologic response modifiers, fenofibrate, gemfibrozil; PPARY ligands such as darglita other toxins, or a combination thereof. In one embodiment, zone, pioglitazone, rosiglitazone, isaglitazone, rivoglita anti-cancer monoclonal antibodies are conjugated or linked zone, netoglitazone; Dual acting PPAR ligands, such as to a SARM compound as described hereinabove. naveglitazar, farglitazar, tesaglitazar, ragaglitazar, Oxegli tazar, PN-2034, PPAR 6: a 17-ketoreductase inhibitors, [0279] In another embodiment, the present invention 33-DHA4,6-isomerase inhibitors, 33-DHA4,5-isomerase includes SARM compounds and compositions in which a inhibitors, 17.20 desmolase inhibitors, p450c17 inhibitors, compound of the invention is either combined with, or p450ssc inhibitors, 17,20-lyase inhibitors, or combinations covalently bound to, an agent bound to a targeting agent, thereof. such as a monoclonal antibody (e.g., a murine or humanized monoclonal antibody). In one embodiment, the agent bound [0274] In some embodiments, the compositions will fur to a targeting agent is a cytotoxic agent. It will be appreci ther comprise Ghrelin receptor ligand or growth hormone ated that the latter combination may allow the introduction analogues and secretagogues, IGF-1, IGF-1 analogues and of cytotoxic agents into for example cancer cells with secretagogues, Myostatin Analogues, Proteasome Inhibitors, greater specificity. Thus, the active form of the cytotoxic Androgenic/Anabolic Steroid, EmbrelNMelanocortin 4 Recep agent (i.e., the free form) will be present only in cells tor Agonist, Insulins, or combinations thereof. Such com targeted by the antibody. Of course, the compounds of the positions may be used, in some embodiments, for treating invention may also be combined with monoclonal antibod sarcopenia or a musculoskeletal condition. ies that have therapeutic activity against cancer. [0275] In some embodiments, the composition will com [0280] In one embodiment, the SARM compound is prise the SARMs as described herein, as well as another administered in combination with a selective tyrosine kinase therapeutic compound, including inter alia, Ghrelin receptor inhibitor. In some embodiments, the selective tyrosine ligand or growth hormone analogues and secretagogues, kinase inhibitor inhibits catalytic sites of cancer promoting such as, pralmorelin, examorelin, tabimorelin, capimorelin, receptors thereby inhibiting tumor growth. In one embodi capromorelin, ipamorelin, EP-01572, EP-1572, JMV-1843, ment, a selective tyrosine kinase inhibitor modulates growth an androgenic/Anabolic Steroid such as Testosterone/Oxan factor signaling. In some embodiments, the selective drolone; a melanocortin 4 receptor agonist, such as Bremel tyrosine kinase inhibitor targets EGFR (ERBB/HER) family anotide, a Ghrelin or analogue thereof, such as human members. In one embodiment, the selective tyrosine kinase ghrelin, CYT-009-Ghr0b, L-692429, GHRP-6, SK&F inhibitor is a BCR-ABL tyrosine kinase inhibitor. In one 110679, U-75799E), leptin (metreleptin, pegylated leptin; a embodiment, the selective tyrosine kinase inhibitor is an leptin receptor agonist, such as LEP(116-130), OB3, epidermal growth factor receptor tyrosine kinase inhibitor. [D-Leu-4]-OB3, ra AV-leptin, AAV-hCB, ra AVhCB; an In one embodiment, the selective tyrosine kinase inhibitor is insulin (short-, intermediate-, and long acting formulations; a vascular endothelial growth factor tyrosine kinase inhibi a cortisol or corticosteroid, or a combination thereof. tor. In one embodiment, the selective tyrosine kinase inhibi [0276] The invention contemplates, in some embodi tor is a Platelet Derived Growth Factor (PDGF) inhibitor. ments, administration of compositions comprising the indi [0281] In one embodiment, the SARM compound is vidual agents, administered separately and by similar or administered in combination with a cancer vaccine. In one alternative routes, formulated as appropriately for the route embodiment, the cancer vaccine is a therapeutic vaccine of administration. The invention contemplates, in some thus, treating an existing cancer. In some embodiments, the embodiments, administration of compositions comprising cancer vaccine is a prophylactic vaccine thus, preventing the the individual agents, administered in the same formulation. development of cancer. In one embodiment, both types of The invention contemplates, in some embodiments, stag vaccines have the potential to reduce the burden of cancer. gered administration, concurrent administration, of admin In one embodiment, treatment or therapeutic vaccines are istration of the various agents over a course of time, how administered to cancer patients and are designed to ever, their effects are synergistic in the subject. strengthen the body’s natural defenses against cancers that [0277] It is to be understood that any of the above means, have already developed. In one embodiment, therapeutic timings, routes, or combinations thereof, of administration vaccines may prevent additional growth of existing cancers, of two or more agents is to be considered as being encom prevent the recurrence of treated cancers, or eliminate cancer passed by the phrase “administered in combination”, as cells not killed by prior treatments. In some embodiments, described herein. prevention or prophylactic vaccines are administered to healthy individuals and are designed to target cancer in [0278] In one embodiment, the SARM compound is individuals who present high risk for the disease. In one administered in combination with an anti-cancer agent. In embodiment, the cancer vaccine is an antigen/adjuvant vac one embodiment, the anti-cancer agent is a monoclonal cine. In one embodiment, the cancer vaccine is a whole cell antibody. In some embodiments, the monoclonal antibodies tumor vaccine. In one embodiment, the cancer vaccine is a are used for diagnosis, monitoring, or treatment of cancer. In dendritic cell vaccine. In one embodiment, the cancer vac one embodiment, monoclonal antibodies react against spe cine comprises viral vectors and/or DNA vaccines. In one cific antigens on cancer cells. In one embodiment, the monoclonal antibody acts as a cancer cell receptor antago embodiment, the cancer vaccine is an idiotype vaccine. nist. In one embodiment, monoclonal antibodies enhance the [0282] In one embodiment, the SARM compound is patient’s immune response. In one embodiment, monoclonal administered in combination with an anti-cancer chemo antibodies act against cell growth factors, thus blocking therapeutic agent. In one embodiment, the anti-cancer che cancer cell growth. In one embodiment, anti-cancer mono motherapeutic agent is an alkylating agent, such as but not clonal antibodies are conjugated or linked to anti-cancer limited to cyclophosphamide. In one embodiment, the anti US 2007/028 1906 A1 Dec. 6, 2007 20 cancer chemotherapeutic agent is a cytotoxic antibiotic such tidine, 5-fluorodeoxyuridine, 5-fluorouracil, hydroxyurea as but not limited to doxorubicin. In one embodiment, the and 6-mercaptopurine also can be used in combination anti-cancer chemotherapeutic agent is an antimetabolite, therapies with the compounds of the invention. Topoi such as but not limited to methotrexate. In one embodiment, somerase inhibitors, such as coumermycin, nalidixic acid, the anti-cancer chemotherapeutic agent is a vinca alkaloid, novobiocin and oxolinic acid, inhibitors of cell division, such as but not limited to vindesine. In some embodiments, including colcemide, colchicine, vinblastine and vincristine; the anti-cancer chemotherapeutic agents include platinum and RNA synthesis inhibitors including actinomycin D, compounds such as but not limited to carboplatin, and Cº-amanitine and other fungal amatoxins, cordycepin (3' taxanes such as docetaxel. In one embodiment, the anti deoxyadenosine), dichlororibofuranosyl benzimidazole, cancer chemotherapeutic agent is an aromatase inhibitor rifampicine, streptovaricin and streptolydigin also can be such as but not limited to anastrazole, exemestane, or combined with the compounds of the invention to provide letrozole. pharmaceutical compositions. [0283] In one embodiment, the SARM compound is [0286] In one embodiment, the SARM compound is administered in combination with a Bax activity modulator administered in combination with a vaccine for prostate such as alisol B acetate. In one embodiment, the SARM cancer, Alisol B acetate, angiotensin II receptor blocker, or compound is administered in combination with an angio others known in the art. In one embodiment, the SARM tensin II receptor blocker such as losartan. In one embodi compound is administered in combination with an agent to ment, the SARM compound is administered in combination decrease prostate (benign or malignant) hypertrophy, such with selenium, green tea cachecins, saw palmetto, lycopene, as, for example, Selenium, green tea cachecins, saw pal vitamin D, dietary soy, genistein or isoflavone. metto, lycopene, vitamin D, dietary soy, genistein and [0284] In one embodiment, the SARM compound is isoflavone food product and others. administered in combination with antineoplastic agents, [0287] In one embodiment, the SARM compound is such as alkylating agents, antibiotics, hormonal antineoplas administered in combination with an immunomodulating tics and antimetabolites. Examples of useful alkylating agent. In one embodiment, the immunomodulating agent is agents include alkyl sulfonates such as busulfan, improsul an immunosuppressive agent. In one embodiment, immu fan and piposulfan; aziridines, such as a benzodizepa, car nosuppressive agents comprise corticosteroids, cyclospo boguone, meturedepa and uredepa; ethylenimines and meth rine, azathioprine, methotrexate, cyclophosphamide, tacroli ylmelamines such as altretamine, triethylenemelamine, mus–FK-506, anti-thymocyte globulin, mycophenylate triethylenephosphoramide, triethylenethiophos-phoramide moeftil, or a combination thereof. In one embodiment, the and trimethylolmelamine; nitrogen mustards such as corticosteroid is a glucocorticoid. chlorambucil, chlomaphazine, cyclophosphamide, estra [0288] In one embodiment, the immunomodulating agent mustine, iphosphamide, mechlorethamine, mechlore is an immunostimulatory agent. In one embodiment, the thamine oxide hydrochloride, melphalan, movembichine, immunostimulatory agent is a specific immunostimulator phenesterine, prednimustine, trofosfamide, and uracil mus thus, provides antigenic specificity during an immune tard; nitroso ureas, such as carmustine, chlorozotocin, fote response, such as a vaccine or any antigen. In one embodi mustine, lomustine, nimustine, ranimustine, dacarbazine, ment, the immunostimulatory agent is a non-specific immu mannomustine, mitobronitol, mitolactol and pipobroman. nostimulator thus, acting irrespective of antigenic specificity More such agents will be known to those having skill in the to augment immune response of other antigen or stimulate medicinal chemistry and oncology arts. components of the immune system without antigenic speci [0285] In some embodiments, other agents suitable for ficity. In one embodiment, the non-specific immunostimu combination with SARMs include protein synthesis inhibi lator is Freund's complete adjuvant. In one embodiment, the tors such as abrin, aurintricarboxylic acid, chloramphenicol, non-specific immunostimulator is Freund's incomplete adju colicin E3, cycloheximide, diphtheria toxin, edeine A, emet vant. In one embodiment, the non-specific immunostimula ine, erythromycin, ethionine, fluoride, 5-fluorotryptophan, tor is a montanide ISA adjuvant. In one embodiment, the fusidic acid, guanylyl methylene diphosphonate and guany non-specific immunostimulator is a Ribi’s adjuvant. In one lyl imidodiphosphate, kanamycin, kasugamycin, kirromy embodiment, the non-specific immunostimulator is a Hunt cin, and O-methyl threonine, modeccin, neomycin, norval er’s TiterMax. In one embodiment, the non-specific immu ine, pactamycin, paromomycine, puromycin, ricin, Cº-sarcin, nostimulator is an aluminum salt adjuvant. In one embodi shiga toxin, showdomycin, sparsomycin, spectinomycin, ment, the non-specific immunostimulator is a nitrocellulose streptomycin, tetracycline, thiostrepton and trimethoprim. adsorbed protein. In one embodiment, the non-specific Inhibitors of DNA synthesis, including alkylating agents immunostimulator is a Gerbu Adjuvant. such as dimethyl sulfate, mitomycin C, nitrogen and sulfur mustards, MNNG and NMS; intercalating agents such as [0289] In one embodiment, the SARM compound is acridine dyes, actinomycins, adriamycin, anthracenes, ben administered in combination with an agent, which treates zopyrene, ethidium bromide, propidium diiodide-intertwin bone diseases, disorders or conditions, such as osteoporosis, ing, and agents such as distamycin and metropsin, can also be bone fractures, etc., and this invention comprises methods of combined with compounds of the present invention in treating the same, by administering the SARMs as herein pharmaceutical compositions. DNA base analogs such as described, alone or in combination with other agents. acyclovir, adenine, fl-1-D-arabinoside, amethopterin, ami [0290] In one embodiment, this invention provides for the nopterin, 2-aminopurine, aphidicolin, 8-azaguanine, azaser treatment, prevention, suppression or inhibition of, or the ine, 6-azauracil, 2’-azido-2'-deoxynucliosides, 5-bromode reduction of the risk of developing a skeletal-related event oxycytidine, cytosine, fl-1-D-arabinoside, (SRE), such as bone fractures, surgery of the bone, radiation diazooxymorleucine, dideoxynucleosides, 5-fluorodeoxycy of the bone, spinal cord compression, new bone metastasis, US 2007/028 1906 A1 Dec. 6, 2007

bone loss, or a combination thereof in a subject with cancer, methods provided herein, utilizing the compositions pro comprising administering to the a selective androgen recep vided herein may be conducted as a function of, or adjusted tor modulator (SARM) as herein described and/or its analog, or varied as a function of inter-alia, the severity of the derivative, isomer, metabolite, pharmaceutically acceptable underlying disease, the source of the underlying disease, the salt, pharmaceutical product, hydrate, N-oxide, or any com extent of the patients’ pain and source of the patients’ pain, bination thereof. The invention relates, inter alia to treatment as well as the stage of the disease. The therapeutic changes of an SRE with the compound of formula III in a subject may include in certain embodiments, changes in the route of with prostate cancer undergoing or having undergone andro administration (e.g. intracavitarily, intraartiarly, intratu gen deprivation therapy (ADT). moraly etc.), forms of the compositions administered (e.g. [0291] In one embodiment, the skeletal-related events tablets, elixirs, suspensions etc.), changes in dosage and the treated using the methods provided herein and/or utilizing like. Each of these changes are well recognized in the art and the compositions provided herein, are fractures, which in are encompassed by the embodiments provided herein. one embodiment, are pathological fractures, non-traumatic [0296] In one embodiment, the skeletal-related events are fractures, vertebral fracture, non-vertebral fractures, mor a result of cancer therapy. In one embodiment, the skeletal phometric fractures, or a combination thereof. In some related events are a result of hormone deprivation therapy, embodiments, fractures may be simple, compound, trans while in another embodiment, they are a product of andro verse, greenstick, or comminuted fractures. In one embodi gen deprivation therapy (ADT). ment, fractures may be to any bone in the body, which in one embodiment, is a fracture in any one or more bones of the [0297] In males, while the natural decline in sex-hormones arm, wrist, hand, finger, leg, ankle, foot, toe, hip, collar at maturity (direct decline in androgens as well as lower bone, or a combination thereof. levels of estrogens derived from peripheral aromatization of [0292] In another embodiment, the methods and/or com androgens) is associated with the frailty of bones, this effect positions provided herein, are effective in treatment, pre is more pronounced in males who have undergone androgen vention, suppression, inhibition or reduction of the risk of deprivation therapy. skeletal-related events such as pathologic fractures, spinal [0298] Such agents for combined use may comprise a cord compression, hypercalcemia, bone-related pain, or their SERM, as herein described, a bisphosphonate, for example, combination. alendronate, tiludroate, clodroniate, pamidronate, etidr [0293] In another embodiment, the skeletal-related events onate, alendronate, zolendronate, cimadronate, neridronate, sought to be treated using the methods provided herein minodronic acid, ibandronate, risedronate, homoresidronate, and/or utilizing the compositions provided herein, comprise a calcitonin, for example, salmon, Elcatonin, SUN-8577, the necessity for bone surgery and/or bone radiation, which TJN-135; a Vitamin D or derivative (ZK-156979); a Vitamin in some embodiments, is for the treatment of pain resulting D receptor ligand or analogues thereof, such as calcitriol, in one embodiment from bone damage, or nerve compres topitriol, ZK-1501.23, TEI-9647, BXL-628, Ro-26-9228, sion. In another embodiment, the skeletal-related events BAL-2299, Ro-65-2299, DP-035, an estrogen, estrogen sought to be treated using the methods provided herein derivative, or conjugated estrogen; an antiestrogen, proges and/or utilizing the compositions provided herein, comprise tin, synthetic estrogen/progestin; a RANK ligand mAb, for spinal cord compression, or the necessity for changes in example, denosumab or AMG162 (Amgen); an ov[3 inte antineoplastic therapy, including changes in hormonal grin receptor antagonist; an osteoclast vacuolar ATPase therapy, in a subject. In some embodiments, skeletal-related inhibitor; an antagonist of VEGF binding to osteoclast events sought to be treated using the methods provided receptors; a calcium receptor antagonist; PTh (parathyroid herein and/or utilizing the compositions provided herein, hormone) or analogues thereof, PTHrP analogues (parathy comprise treating, suppressing, preventing, reducing the roid hormone-related peptide), Cathepsin K inhibitors incidence of, or delaying progression or severity of bone (AAE581); Strontium ranelate; Tibolone; HCT-1026, metastases, or bone loss. In one embodiment, bone loss may PSK3471; Gallium maltolate:Nutropin AQ: Prostaglandins, comprise osteoporosis, osteopenia, or a combination thereof. p38 protein kinase inhibitor; a bone morphogenetic protein; In one embodiment, skeletal-related events may comprise an inhibitor of BMP antagonism, an HMG-CoA reductase any combination of the embodiments listed herein. inhibitor, a Vitamin K or derivative, an antiresorptive, an [0294] In one embodiment, the methods provided herein Ipriflavone, a fluoride salt, dietary calcium supplement, and/or utilizing the compositions provided herein, are effec Osteoprotegerin, or any combination thereof. In one tive in reducing metastases to the bone, such as in terms of embodiment, the combined administration of a SARM as number of foci, the size of foci, or a combination thereof. herein described, Osteoprotegerin and parathyroid hormone According to this aspect of the invention and in one embodi is contemplated for treating any disease, disorder or condi ment, provided herein is a method of preventing or inhib tion of the bone. iting cancer metastasis to bone in a subject, comprising the [0299] In one embodiment, the immunomodulating agent step of administering to the subject a composition compris is an anti-inflammatory agent. In one embodiment, the ing toremifene, raloxifene, tamoxifen or an analogue, func anti-inflammatory agent is a non-steroidal anti-inflammatory tional derivative, metabolite or a combination thereof, or a agent. In one embodiment, the non-steroidal anti-inflamma pharmaceutically acceptable salt thereof. In one embodi tory agent is a cox-1 inhibitor. In one embodiment, the ment, such metabolites may comprise ospenifene, non-steroidal anti-inflammatory agent is a cox-2 inhibitor. In fispenifene or their combination. In one embodiment, the one embodiment, the non-steroidal anti-inflammatory agent cancer is is prostate cancer. is a cox-1 and cox-2 inhibitor. In some embodiments, [0295] A person skilled in the art would readily recognize non-steroidal anti-inflammatory agents include but are not that changes in the antineoplastic therapy according to the limited to aspirin, salsalate, diflunisal, ibuprofen, fenopro US 2007/028 1906 A1 Dec. 6, 2007 22 fen, flubiprofen, fenamate, ketoprofen, nabumetone, piroxi system. In one embodiment, the agent treating the auto cam, naproxen, diclofenac, indomethacin, sulindac, tol nomic nervous system is an adrenomimetic drug. In one metin, etodolac, ketorolac, oxaprozin, or celecoxib. In one embodiment, the adrenomimetic drug is a beta-adrenoceptor embodiment, the anti-inflammatory agent is a steroidal agonist, alpha-adrenoceptor agonist, or a combination anti-inflammatory agent. In one embodiment, the steroidal thereof. In one embodiment, the adrenomimetic drug is a anti-inflammatory agent is a corticosteroid. catecholamine. In one embodiment, adrenomimetic drugs include but are not limited to isoproterenol, norepinephrine, [0300] In one embodiment, the immunomodulating agent epinephrine, amphetamine, ephedrine, or dopamine. In one is an anti-rheumatic agent. In one embodiment, the anti rheumatic agent is a non-steroidal anti-inflammatory agent. embodiment, the adrenomimetic drug is a directly acting In one embodiment, the anti-rheumatic agent is a corticos adrenomimetic drug. In some embodiments, directly acting teroid. In one embodiment, the corticosteroid is prednisone adrenomimetic drugs include but are not limited to phenyle or dexamethasone. In one embodiment, the anti-rheumatic phrine, metaraminol, or methoxamine. agent is a disease modifying anti-rheumatic drug. In one [0303] In one embodiment, the agent treating the auto embodiment, the disease modifying anti-rheumatic drug is a nomic nervous system is an adrenoceptor antagonist. In one slow-acting anti-rheumatic drug. In one embodiment, the embodiment, the adrenoceptor antagonist is a haloalky disease modifying anti-rheumatic drug is an antimalarial lamine, imidazoline, or quinazoline. In one embodiment, agent. In one embodiment, disease modifying anti-rheu haloalkylamines include but are not limited to phenoxyben matic drugs include but are not limited to chloroquine, zamine. In one embodiment, imidazolines include but are hydroxychloroquine, methotrexate, sulfasalazine, cyclospo not limited to phentolamine or tolazoline. In one embodi rine, azathioprine, cyclophosphamide, azathioprine, sul ment, quinazolines include but are not limited to prazosine, fasalazine, penicillamine, aurothioglucose, gold sodium thi terazosin, doxazosin, or trimazosin. In one embodiment, the omalate, or auranofin. In one embodiment, the anti adrenoceptor antagonist has a combined alpha and beta rheumatic agent is an immunosuppressive cytotoxic drug. In blocking activity. In one embodiment, the combined alpha one embodiment, immunosuppressive cytotoxic drugs and beta blocking agent is labetalol, bucindolol, carvedilol, include but are not limited to methotrexate, mechlore or medroxalol thamine, cyclophosphamide, chlorambucil, or azathioprine. [0304] In one embodiment, the agent treating the auto [0301] In one embodiment, the SARM compound is nomic nervous system is a cholinomimetic agent. In one administered in combination with an antidiabetic agent. In embodiment, the cholinomimetic agent is a direct-acting one embodiment, the antidiabetic agent is a sulfonylurea. In parasympathomimetic drug. In one embodiment, direct one embodiment, sulfonylureas include but are not limited acting parasympathomimetic drugs include but are not lim to tolbutamide, acetohexamide, tolazamide, chlorpropam ited to methacholine, pilocarpine, carbachol, or bethanechol. ide, glipizide, glyburide, glimepiride, or gliclazide. In one embodiment, the antidiabetic agent is a meglitimide. In one [0305] In one embodiment, the agent treating the auto embodiment, meglitimides include but are not limited to nomic nervous system is a cholinesterase inhibitor. In one prandin or nateglinide. In one embodiment, the antidiabetic embodiment, the cholinesterase inhibitor is a quaternary agent is a biguanide. In one embodiment, biguanides include ammonium agent. In one embodiment, quaternary ammo but are not limited to metformin. In one embodiment, the nium agents include but are not limited to edrophonium or antidiabetic agent is a thiazolidinedione. In one embodi ambenonium. In one embodiment, the cholinesterase inhibi ment, thiazolidinediones include but are not limited to tor is a carbamate such as physostigmine, pyridostigmine, rosiglitazone, pioglitazone, or troglitazone. In one embodi neostigmine, or rivastigmine. In one embodiment, the cho ment, the antidiabetic agent is an alpha glucosidase inhibitor. linesterase inhibitor is an organophosphate agent. In one In one embodiment, alpha glucosidase inhibitors include but embodiment, the inhibitor targets acetylcholine in the cen are not limited to miglitol or acarbose. In one embodiment, tral nervous system such as tacrine, donepezil, or galan the antidiabetic agent is PPARo?y ligand, dipeptidylpepti thamine. dase 4 (DPP-4) inhibitor, SGLT (sodium-dependent glucose [0306] In one embodiment, the agent treating the auto transporter 1) inhibitor, or FBPase (fructose 1,6-bisphos nomic nervous system is a muscarinic blocking agent. In one phatase) inhibitor. In one embodiment, the antidiabetic agent embodiment, the muscarinic blocking agent is a belladonna is insulin. In one embodiment, the insulin is rapid-acting alkaloid such as atropine or scopolamine. insulin. In one embodiment, the insulin is short-acting insulin. In one embodiment, the insulin is intermediate [0307] In one embodiment, the agent treating the auto acting insulin. In one embodiment, the insulin is interme nomic nervous system is a gangilionic blocking agent. In diate- and short-acting insulin mixtures. In one embodiment, one embodiment, gangilionic blocking agents include but the insulin is long-acting insulin. In one embodiment, the are not limited to nicotine, trimethaphan, or mecamylamine. antidiabetic agents are inhibitors of fatty acid binding pro [0308] In one embodiment, the agent treating the nervous tein (ap2) such as those disclosed in U.S. Ser. No. 09/519, system is an agent treating the central nervous system. In 079 filed Mar. 6, 2000, glucagon-like peptide-1 (GLP-1), one embodiment, the agent treating the central nervous and dipeptidyl peptidase IV (DPP4) inhibitors such as those system is a local anesthetic agent. In one embodiment, local disclosed in WO 0168603, which are incorporated by ref anesthetic agents include but are not limited to benzocaine, erence. chloroprocaine, cocaine, procaine, bupivacaine, levobupiv [0302] In one embodiment, the SARM compound is acaine, lidocaine, mepivacaine, prilocaine, or ropivacaine. administered in combination with an agent treating the In one embodiment, the agent treating the central nervous nervous system. In one embodiment, the agent treating the system is a general anaesthetic agent. In one embodiment, nervous system is an agent treating the autonomic nervous general anesthetic agents include but are not limited to US 2007/028 1906 A1 Dec. 6, 2007

esflurane, sevoflurane, isoflurane, halothane, enflurane, ment, the neurodegenerative disorder medication is an methoxyflurane, xenon, propofol, etomidate, methohexital, N-methyl-D-aspartate (NMDA) antagonist such as meman midazolam, diazepamor, ketamine, thiopentone/thiopental, time. In one embodiment, the neurodegenerative disorder or lidocaine/prilocaine. medication reduces damage to motor neurons such as rilu zole. In one embodiment, the neurodegenerative disorder [0309] In one embodiment, the agent treating the central medication silences the gene that causes the progression of nervous system is an analgesic agent. In some embodiments, the disease. In one embodiment, the agent treating the analgesic agents include but are not limited to paracetamol central nervous system is an antiepileptic drug (AED). In or non-steroidal anti-inflammatory agent. In some embodi some embodiments, antiepileptic agents include sodium ments, analgesic agents include opiates or morphinomimet channel blockers, GABA receptor agonists, GABA reuptake ics such as morphine, pethidine, oxycodone, hydrocodone, inhibitors, GABA transaminase inhibitor, AEDs with a diamorphine, tramadol, or buprenorphine. In some embodi potential GABA mechanism of action, glutamate blockers, ments, a combination of two or more analgesics is desired. or AEDs with other mechanisms of action. In some embodi [0310] In one embodiment, the agent treating the central ments, antiepileptic agents include but are not limited to nervous system is a muscle relaxant or vasoconstrictor carbamazepine, fosphenytoin, oxcarbazepine, lamotrigine, agent. In one embodiment, muscle relaxants include but are zonisamide, clobazam, clonazepam, phenobarbital, primi not limited to methocarbamol, baclofen, carisoprodol, chlo done, tiagabine, vigabatrin, gabapentin, valproate, felbam rzoxazone, cyclobenzaprine, dantrolene, metaxalone, ate, topiramate, levetiracetam, or pregabalin. orphenadrine, amyl nitrite, pancuronium, tizanidine, cloni dine, or gabapentin. In one embodiment, vasoconstrictor [0314] In one embodiment, the agent treating the central agents include but are not limited to antihistamines, adrena nervous system is an anti-addiction drug. In one embodi lin dimethylarginine, caffeine, cannabis, catecholamines, ment, the anti-addiction is an anti-alcoholism drug such as decongestants, pseudoephedrinse, norepinephrines, tetrahy disulfiram. In one embodiment, the anti-addiction drug is a serotonin uptake inhibitor, dopaminergic agonist, or opioid drozoline, or thromboxane. antagonist. [0311] In one embodiment, the agent treating the central nervous system is an antiemetic drug. In one embodiment, [0315] In one embodiment, the agent treating the central the antiemetic drug is a 5-HT3 receptor antagonist such as nervous system is an agent treating Alzheimer disease. In dolasetron, granisetron, ondansetron, or tropisetron. In one some embodiments, agents treating Alzheimer’s disease embodiment, the antiemetic drug is a dopamine antagonist include but are not limited to a cholinesterase inhibitor, such as domperidone droperidol, haloperidol, chlorprom gamma secreatse inhibitor, or a beta lowering drug. azine, promethazine, or metoclopramide. In one embodi [0316] In one embodiment, the agent treating the central ment, the antiemetic drug is an antihistamine such as cycliz nervous system is an agent treating mild cognitive impair ine, diphenhydramine, dimenhydrinate, or meclizine. In one ment. In some embodiments, agents treating mild cognitive embodiment, the antiemetic drug is a cannabinoid such as impairment include but are not limited to an AMPA regu cannabis or marinol. lator. [0312] In one embodiment, the agent treating the central [0317] In one embodiment, the agent treating the central nervous system is a sedative agent. In one embodiment, the nervous system is an agent treating Parkinson’s disease. In sedative agent is an antidepressant agent such as mirtazapine some embodiments, agents treating Parkinson’s disease or trazodone. In one embodiment, the sedative agent is a include but are not limited to a dopaminergic drugs, aman barbiturate such as secobarbital, pentobarbital, or amobar tadine, benztropine, biperiden, bromocriptine, entacapone, bital. In one embodiment, the sedative agent is a benzodi carbidopa/levodopa, selegiline/deprenyl, iphenhydramine, azepine such as diazepam, clonazepam, alprazolam, pergolide, procyclidine, selegiline, or trihexyphenidyl. temazepam, chlordiazepoxide, flunitrazepam, lorazepam, or clorazepate. In one embodiment, the sedative agent is an [0318] In one embodiment, the SARM compound is imidazopyridines such as zolpidem or alpidem. In one administered with an agent, which treats Alzheimer’s dis embodiment, the sedative agent is a Pyrazolopyrimidine ease, such as cholinesterase inhibitors, gamma secreatse such as zaleplon. In one embodiment, the sedative agent is inhibitors, A-beta lowering drugs; or an agent, which treats an antihistamine such as diphenhydramine, dimenhydrinate, mild cognitive impairment (MCI)—such as AMPA regula or doxylamine. In one embodiment, the sedative agent is an tors, or an agent, which treats Parkinson’s Disease, such as antipsychotic agent such as ziprasidone, risperidone, que dopaminergic drugs, or an agent, which treats Major Depres tiapine, clozapine, prochlorperazine, perphenazine, loxap sion, such as SSRI’s, SNRI’s, for example, duloxetine, or an ine, trifluoperazine, thiothixene, haloperidol, or fluphena agent, which treats sexual dysfunction, such as PDE5 inhibi zine. In one embodiment, the sedative agent is an herbal torS. sedative such as valerian plant mandrake, or kava. In some embodiments, the sedative agent is eszopiclone, ramelteon, [0319] In one embodiment, the SARM compound is methaqualone, ethchlorvynol, chloral hydrate, meprobam administered in combination with an agent treating the ate, glutethimide, methyprylon, gamma-hydroxybutyrate, cardiovascular system. In one embodiment, the agent treat ing the cardiovascular system is treating a congestive heart ethyl alcohol, methyl trichloride, zopiclone, or diethyl ether. failure. In one embodiment, the agent treating congestive [0313] In one embodiment, the agent treating the central heart failure is an angiotensin converting enzyme (ACE) nervous system is a neurodegenerative disorder medication. inhibitor such as benazepril, captopril, cilazapril, enalapril, In one embodiment, the neurodegenerative disorder medi fosinopril, lisinopril, moexipril, perindopril, quinapril, rami cation is an acetylcholinesterase inhibitor such as tacrine, pril, trandolapril, or enalaprilat. In one embodiment, the donepezil, galanthamine, or rivastigmine. In one embodi agent treating congestive heart failure is a beta-blocker such US 2007/028 1906 A1 Dec. 6, 2007 24 as acebutolol, atenolol, betaxolol hydrochloride, bisoprolol [0322] In one embodiment, the agent treating the cardio fumarate, carteolol hydrochloride, carvedilol, celiprolol vascular system is a vasocative agent or an inotrope. In one hydrochloride, esmolol hydrochloride, labetalol hydrochlo embodiment, vasocative agents or inotropes include but are ride, levobunolol, metoprolol tartrate, metipranolol, nadolol, not limited to digoxin, dopamine, dobutamine, hydralazine, nebivolol, oxprenolol hydrochloride, pindolol, propranolol prazosin, carvedilol, nitroprusside, nitroglycerin, captopril, hydrochloride, sotalol hydrochloride, or timolol maleate. In lisinopril, nifedipine, diltiazem, hydrochlorothiazide, furo one embodiment, the agent treating congestive heart failure semide, spironolactone, AT-1 receptor antagonists (e.g., is digoxin. In one embodiment, the agent treating congestive losartan, irbesartan, Valsartan), ET receptor antagonists (e.g., heart failure is a diuretic such as thiazide diuretic, loop sitaxsentan, atrsentan and compounds disclosed in U.S. Pat. diuretic, potassium-sparing diuretic, or a combination Nos. 5,612,359 and 6,043,265), Dual ET/AII antagonist thereof. In some embodiments, thiazide diuretics include but (e.g., compounds disclosed in WO 00/01389), neutral are not limited to bendrofluazide, bendroflumethiazide, ben endopeptidase (NEP) inhibitors, vasopepsidase inhibitors zthiazide, chlorothiazide, chlorthalidone, cyclopenthiazide, (dual NEP-ACE inhibitors) (e.g., omapatrilat and gemopat Diucardinº, Diuril?k), Enduron(R), Esidrix R, Exna(R), HCTZ, rilat), or nitrates. [Should we incorporate by refernce?] Hydrochlorothiazide, HydroIDIURILR, HYDROFLUME [0323] In one embodiment, the agent treating the cardio THIAZIDE, Hydromox R, Hygroton R, indapamide, vascular system is an anticoagulant agent. In one embodi Lozolº, methyclothiazide, metolazone, MykroxR), Naqua R, ment, the anticoagulant agent is a coumarin derivative or an Naturetin R, Oretic R, polythiazide, quinethazone, ReneseR, unfractionated heparin. In one embodiment, coumarin trichlormethiazide, xipamide, or Zaroxolyn R. In some derivatives include but are not limited to warfarin. embodiments, loop diuretics include but are not limited to furosemide/frusemide, bumetanide, or torasemide. In some [0324] In one embodiment, the agent treating the cardio embodiments, potassium-sparing diuretics include but are vascular system is a fibrinolytic agent such as streptokinase, not limited to amiloride, triamterene, aldosterone antago urokinase, alteplase, anistreplase, prourokinase, reteplase, nists, or spironolactone. tenecteplase, lanoteplase, staphylokinase, vampire, or alfimeprase. [0320] In one embodiment, the agent treating the cardio vascular system is an anti-arrhythmic agent. In one embodi [0325] In one embodiment, the agent treating the cardio ment, the anti-arrhythmic agent is a sodium channel blocker, vascular system is a hypercholesterolemic agent such as beta-adrenergic blocker, calcium channel blocker, or an niacin-lovastatin, colestipol HCl, fluvastatin sodium, atorv agent that prolong repolarization. In one embodiment, astatin calcium, simvastatin, gemfibrozil, lovastatin, prav sodium channel blockers include but are not limited to astatin sodium, cholestyramine, cholestyramine light, quinidine, procainamide, disopyramide, lidocaine, tocain fenofibrate, colesevelam HCl, or ezetimibe. ide, mexiletine, encainide, or flecainide. In one embodiment, beta-adrenergic blockers include but are not limited to [0326] In one embodiment, the SARM compound is propranolol, acebutolol, esmolol, or sotalol. In one embodi administered in combination with an agent treating the ment, agents that prolong repolarization include but are not gastrointestinal system. In one embodiment, the agent treat limited to sotalol or amiodarone. In one embodiment, cal ing the gastrointestinal (GI) system is enhancing GI motility. cium channel blockers include but are not limited to vera In one embodiment, the agent enhancing GI motility is a pamil, diltiazem, nifedipine, or mebefradil. In one embodi prokinetic agent such as metoclopramide, cisapride, tegas ment, the anti-arrhythmic agent is adenosine or digoxin. erod, or erythromycin. In one embodiment, the agent treat ing the GI system is decreasing GI motility. In one embodi [0321] In one embodiment, the agent treating the cardio ment, the agent decreasing GI motility is an opioid such as vascular system is an anti-anginal agent. In one embodi morphine, diphenoxylate, loperamide hydrochloride, or ment, the anti-anginal agent is an antiplatelet agent, adreno opium. ceptor antagonist, calcium channel blocker, or a vasodilator. In some embodiments, the adrenoceptor antagonists and [0327] In one embodiment, the agent treating the GI calcium channel blockers comprise agents as described system is an adsorbent or a bulking agent. In one embodi hereinabove. In one embodiment, the antiplatelet agent is a ment, the adsorbent is kaolin or other hydrated aluminum cyclooxygenase inhibitor, ADP inhibitor, phosphodiesterase silicate clays. In one embodiment, the hydrated aluminum III inhibitor, glycoprotein IIb/IIIa inhibitor, or an adenosine silicate clay is further combined with pectin. In one embodi reuptake inhibitor. In one embodiment, cyclooxygenase ment, adsorbents or a bulking agents comprise bismuth inhibitors include but are not limited to acetylsalicylic acid subsalicylate, methylcellulose, psyllium derivative, or cal or an acetylsalicylic acid in combination with dipyridimole. cium polycarbophil. In one embodiment, ADP inhibitors include but are not [0328] In one embodiment, the agent treating the GI limited to clopidogrel, CS-747, or ticlopdipine. In one system is a stool softener. In one embodiment, stool soft embodiment, phosphodiesterase III inhibitors include but eners include but are not limited to mineral oil, docusate are not limited to cilostazol. In one embodiment, glycopro dioctyl sodium sulfosuccinate, dioctyl calcium sulfosucci tein IIb/IIIa inhibitors include but are not limited to abciz nate, or dioctyl potassium sulfosuccinate. imab, rheopro, eptifibatide, integrilin, tirofiban, or aggrastat. In one embodiment, adenosine reuptake inhibitors include [0329] In one embodiment, the agent treating the GI but are not limited to dipyridimole. In one embodiment, system is a laxative. In one embodiment, the agent treating vasodilator agents include but are not limited to isosorbide the GI system is a bulk forming laxative as described dinitrate, isosorbide mononitrate, or nitroglycerine. In one hereinabove. In one embodiment, the laxative is an osmotic embodiment, cardiac glycosides such as digitalis or ouabain laxative such as lactulose, sorbitol, or polyethylene glycol. may be used in combination with a SARM compound. In one embodiment, the laxative is a saline laxative such as US 2007/028 1906 A1 Dec. 6, 2007 milk of magnesia, magnesium citrate, sodium phosphate, [0337] In one embodiment, the SARM compound is docusate potassium, sorbitol, sodium phosphate-biphos administered in combination with an agent treating a der phate, or visicol. matological disorder. In one embodiment, the agent treating [0330] In one embodiment, the agent treating the GI a dermatological disorder is a corticosteroid or glucocorti system is a cathartic stimulant. In one embodiment, the costeroid such as betamethasone dipropionate, clobetasol, cathartic stimulant is an anthraquinone dervative such as diflorasone, amcinonide, desoximetasone, fluocinonide, cascara, aloe, senna, or rhubarb. In one embodiment, the aclometasone, desonide triamcinolone, fluticasone, halobe cathartic stimulant is phenolphthalein, castor oil, or bisa tasol, mometasone, or hydrocortisone. In one embodiment, codyl. the agent treating a dermatological disorder is a retinoid such as isotretinoin, acitretin, tretinoin, adapalene, tazaro [0331] In one embodiment, the agent treating the GI tene, bexarotene, alitretinoin, or beta-carotene. system is an emetic agent. In one embodiment, the emetic agent is ipecac or apomorphine. In one embodiment, the [0338] In one embodiment, the agent treating a dermato agent treating the GI system is an anti-emetic agent such as logical disorder is photochemotherapy agent. In one antihistamine, anti-cholinergic agent, benzodiazepine, can embodiment, the photochemotherapy agent is PUVA or psoralen such as oxsoralen. In one embodiment, the agent nabinoid, dopamine antagonist, phenothiazine derivative, or treating a dermatological disorder is a photodynamic agent 5-HT3 antagonist such as ondansetron or granisetron. such as porphyrin. [0332] In one embodiment, the agent treating the GI system is an antacid. In one embodiment the antacid phar [0339] In one embodiment, the agent treating a dermato maceutical preparation comprises buffering agents such as logical disorder is daspone, thalidomide, anti-malarial agent, sodium bicarbonate, calcium carbonate, magnesium hydrox antimicrobial agent, or antifungal agent. In one embodiment, ide, or aluminum hydroxide. the anti-malarial agent is chloroquine or hydroxychloro quine. [0333] In one embodiment, the agent treating the GI system is an H2-receptor antagonist. In some embodiments, [0340] In one embodiment, the agent treating a dermato the H2-receptor antagonist is cimetidine, ranitidine, famo logical disorder is an antibiotic. In one embodiment, the tidine, or nizatidine. antibiotic is a systemic antibiotic such as griseofulvin, ketoconazole, fluconazole, itraconazole, terbinafine, or [0334] In one embodiment, the agent treating the GI potassium iodide. In one embodiment, the antibiotic is a system is a proton pump inhibitor. In some embodiments, topical antifungal agent. In some embodiment, topical anti the proton pump inhibitor is omeprazole, lansoprazole, fungal agents include but are not limited to ciclopirox, pantoprazole, rebeprazole, or esomeprazole clotrimazole, econazole, ketoconazole, miconazole, nafti [0335] In one embodiment, the agent treating the GI fine, oxiconazole, terbinafine, or tolnaftate. system is an agent treating inflammation. In one embodi [0341] In one embodiment, the agent treating a dermato ment, the agent treating inflammation is 5-amino-salicylate, logical disorder is an antiviral agent such as interferon alpha. corticosteroid, metronidazole, ciprofloxacin, infiximab, In one embodiment, the agent treating a dermatological budesonide, or anti-TNF alpha antibody. disorder is an antiscabies agent such as pyrethrin or pyre [0336] In one embodiment, the SARM compound is throid. In one embodiment, the agent treating a dermato administered in combination with an agent treating a meta logical disorder is an immunosuppressive agent such as bolic disease, disorder or condition, which in some embodi mycophenolate motefil or 6-thioguanine. In one embodi ments refers to metabolic syndrome. In some embodiments, ment, the agent treating a dermatological disorder is a such agents comprise, inter alia, pancreatic lipase inhibitors, topical immunosuppressive agent such as tacrolimus, pime such as for example, orlistat, cetilistat, serotonin and more crolimus, imiquimod, 5-fluorouracil, or mechlorethamine. In pinephrine reuptake inhibitors, such as sibutramine, insulin one embodiment, the agent treating a dermatological disor sensitizers such as biguanides (metformin) or PPAR ago der is an antihistamine such as doxepin. In one embodiment, nists, dual-acting PPAR agonists (muraglitazar, tesaglitazar, the agent treating a dermatological disorder is treating naveglitazar), PPAR-delta agonists (GW-501516), DPP-IV pigmentation such as hydroquinone or monobenzone. In one Inhibitors (vildagliptin, sitagliptin), alpha glucosidase embodiment, the agent treating a dermatological disorder is inhibitors (acarbose), anti-diabetic combinations (ActoPlus a protein or a recombinant protein such as becaplermin, Met, AvandaMet, metformin/pioglitazone, metformin/ etanercept, denileukin diftitox, or botulinum toxin. In one rosiglitazone, Glucovance, etc.), glucagon-like peptide-1 embodiment, the agent treating a dermatological disorder is analogues (exematide, liraglutide), amylin analogues (pram capsaicin, anthralin, benzoyl peroxide, or calcipotriene. lintide), statins (atorvastatin, simvastatin, rosuvastatin, prav [0342] In one embodiment, the agent treating a dermato astatin, fluvastatin, lovastatin, pitavastatin), cholesterol logical disorder is a keratolytic agent. In one embodiment, absorption inhibitors (ezetimibe), nicotinic acid derivatives the agent treating a dermatological disorder is selenium (immediate release and controlled release niacins, niaslo, sulfide. In one embodiment, the agent treating or preventing etc.), antidyslipidemic fixed combinations (simvastatin/ a dermatological disorder is a sunscreen. In one embodi ezetimibe, lovastatin/nicotinic acid, atorvastatin/amlo dipine, atorvastatin/torcetrapib, simvastatin/nicotinic acid ment, the sunscreen absorbs UVB, UVA, or a combination (ER)), ACE inhibitors (ramipril, captopril, lisinopril), AT-H thereof. receptor antagonists (valsartan, telmisartan), cannabinoid [0343] In one embodiment, the agent treating a dermato receptor antagonists (rimonabant), cholesteryl ester transfer logical disorder may be a growth factor such as epidermal protein or CETP Inhibitors (JTT-705, CETi-1), beta3 adr growth factor (EGF), transforming growth factor-O (TGF energic agonists, PPARa ligands, or combinations thereof. O), platelet derived growth factor (PDGF), fibroblast growth US 2007/028 1906 A1 Dec. 6, 2007 26 factors (FGFs) including acidic fibroblast growth factor rophene, iodophors, chloroxylenol (PCMX), quaternary (o-FGF) and basic fibroblast growth factor (?3-FGF), trans ammonium compounds, or triclosan. forming growth factor-fi (TGF-5) and insulin like growth [0354] In one embodiment, the antibiotic is an anti-tuber factors (IGF-1 and IGF-2), or any combination thereof. culosis agent. In one embodiment an anti-tuberculosis [0344] In one embodiment, the SARM compound is agents include but are not limited to ethambutol, rifabutin, administered in combination with an anti-infective agent. In isoniazid, rifampicin, pyrazinamide, or rifampin one embodiment, the anti-infective agent is an antibiotic [0355] In one embodiment, the antibiotic is an antifungal agent. In one embodiment the antibiotic is a beta-lactam agent. In one embodiment, antifungal agents include but are antibiotic. In one embodiment beta-lactam antibiotics not limited to terbinafine, flucytosine, fluconazole, itracona include but are not limited to penicillin, benzathine penicil zole, ketoconazole, ravuconazole, posaconazole, Voricona lin, benzylpenicillin, amoxicillin, procaine penicillin, zole, caspofungin, micafungin, V-echinocandin, amphoteri dicloxacillin, amoxicillin, flucloxacillin, ampicillin, methi cin B, amphotericin B lipid complex (ABLC), amphotericin cillin, azlocillin, carbenicillin, ticarcillin, mezlocillin, pip B colloidal dispersion (ABCD), liposomal amphotericin b eracillin, phenoxymethylpenicillin, co-amoxiclav, cepha (1-Amb), liposomal nystatin, or griseofulvin. losporin, cefalexin, cephalothin, cefazolin, cefaclor, cefuroxime, cefamandole, cefotetan, cefoxitin, ceftriaxone, [0356] In one embodiment, the antibiotic is an antiproto cefotaxime, ceftazidime, cefepime, cefpirome, imipenem, zoal agent. In one embodiment the antiprotozoal agent is an meropenem, ertapenem, faropenem, monobactam, aztre antimalarial agent. In one embodiment, antimalarial agents include but are not limited to chloroquine, mefloquine, onam, or carbapenem. proguanil, pyrimethamine with dapsone, pyrimethamine [0345] In one embodiment the antibiotic is a tetracycline with sulfadoxine, quinine, or primaquine. In one embodi antibiotic. In one embodiment tetracycline antibiotics ment, the antiprotozoal agent is an amoebicide. In one include but are not limited to tetracycline, chlortetracycline, embodiment, amoebicides include but are not limited to demeclocycline, doxycycline, lymecycline, minocycline, or metronidazole, tinidazole, or diloxanide furoate. In one oxytetracycline. embodiment, the antiprotozoal agent is an antigiadial agent. [0346] In one embodiment the antibiotic is a macrolide In one embodiment, antigiadial agents include but are not antibiotic. In one embodiment macrolide antibiotics include limited to metronidazole, tinidazole, or mepacrine. In one but are not limited to erythromycin, azithromycin, oxithro embodiment, the antiprotozoal agent is a leishmanicide. In mycin, dirithromycin, clarithromycin, josamycin, oleando one embodiment, leishmanicides include but are not limited mycin, kitasamycin, spiramycin, tylosin/tylocine, troleando to sodium stibogluconate. In one embodiment, the antibiotic mycin, carbomycin, cethromycin, or telithromycin. is an antithelmintic agent. [0357] In one embodiment, the antibiotic is an antiviral [0347] In one embodiment the antibiotic is an aminogly agent. In one embodiment, antiviral agents include but are coside antibiotic. In one embodiment, aminoglycoside anti not limited to abacavir, acyclovir, amantadine, didanosine, biotics include but are not limited to gentamicin, tobramy emtricitabine, enfuvirtide, entecavir, lamivudine, nevirap cin, faropenem, imipenem, kanamycin, neomycin, ine, oseltamivir, ribavirin, rimantadine, stavudine, valaciclo ertapenem, apramycin, paromomycin sulfate, streptomycin, vir, vidarabine, zalcitabine, or zidovudine. In one embodi or amikacin. ment, the antiviral agent is a nucleotide analog reverse [0348] In one embodiment the antibiotic is a quinolone transcriptase inhibitor. In one embodiment, nucleotide ana antibiotic. In one embodiment quinolone antibiotics include log reverse transcriptase inhibitors include but are not lim but are not limited to ciprofloxacin, norfloxacin, lomefloxa ited totenofovir or adefovir. In one embodiment, the antiviral cin, enoxacin, ofioxacin, ciprofloxacin, levofloxacin, spar agent is a protease inhibitor. In one embodiment, protease floxacin, gatifloxacin, moxifloxacin, trovafloxacin, or ala inhibitors include but are not limited to saquinavir, ritonavir, trofloxacin. indinavir, nelfinavir, amprenavir, lopinavir, fosamprenavir, or tipranavir. In one embodiment, the antiviral agent is a [0349] In one embodiment the antibiotic is a cyclic peptide fusion inhibitor such as enfuvirtide. In one embodiment, a antibiotic. In one embodiment cyclic peptide antibiotics combination of antiviral or antiretroviral agents is desired. include but are not limited to Vancomycin, streptogramins, In one embodiment, antiviral or antiretroviral agents or a Microcin J25, Bacteriocin AS-48, RTD-1, or polymyxins. combination thereof, further comprise hydroxyurea, resvera [0350] In one embodiment the antibiotic is a lincosamide trol, grapefruit, ritonavir, leflunomide, or a combination antibiotic. In one embodiment lincosamide antibiotics thereof. include but are not limited to clindamycin. [0358] In one embodiment, the SARM compound is administered in combination with an agent treating the liver. [0351] In one embodiment, the antibiotic is an oxazolidi In one embodiment, the SARM compound is administered none antibiotic. In one embodiment oxazolidinone antibiot in combination with a statin. In some embodiment, statins ics include but are not limited to linezolid, U-100592, include but are not limited to atorvastatin, fluvastatin, lov DA-7867, AZD2563, or U-100766. astatin, pravastatin, simvastatin, or rosuvastatin. [0352] In one embodiment, the antibiotic is a sulfa anti [0359] In one embodiment, the SARM compound is biotic. In one embodiment, sulfa antibiotics include but are administered in combination with a bile acid sequestrant. In not limited to sulfisoxazole. some embodiment, bile acid sequestrants include but are not [0353] In one embodiment, the antibiotic is an antiseptic limited to cholestyramine, colestipol, or colesevelam. agent. In one embodiment, antiseptic agents include but are [0360] In one embodiment, the SARM compound is not limited to alcohols, chlorhexidine, chlorine, hexachlo administered in combination with a cholesterol absorption US 2007/028 1906 A1 Dec. 6, 2007 27 inhibitor. In some embodiment, cholesterol absorption anti-diabetic combination such as Actoplus Met, AvandaMet, inhibitors include but are not limited to ezetimibe. metformin/pioglitazone, metformin/rosiglitazone, or Gluco vance, Glucagon-like peptide-1 analogue such as exematide [0361] In one embodiment, the SARM compound is or liraglutide, Amylin analogue such as pramlintide, statin administered in combination with a nicotinic acid agent. In such as atorvastatin, simvastatin, rosuvastatin, pravastatin, some embodiments, nicotinic acid agents include but are not fluvastatin, lovastatin, or pitavastatin, Cholesterol absorp limited to niacin, niacor, or slo-niacin. tion inhibitor such as ezetimibe, Nicotinic acid derivative [0362] In one embodiment, the SARM compound is such as niacin or miaslo, antidyslipidemic fixed combination administered in combination with a fibrate. In some embodi such as simvastatin/ezetimibe, lovastatin/nicotinic acid, ments, fibrates include but are not limited to gemfibrozil, or atorvastatin/amlodipine, or atorvastatin/torcetrapib, simvas fenofibrate. tatin/nicotinic acid, ACE inhibitor such as ramipril, capto pril, or lisinopril, AT-II receptor antagonist such as Valsartan [0363] In one embodiment, the agent treating the liver is or telmisartan, cannabinoid receptor antagonist such as cortisone, cortisol or corticosterone. In some embodiments, rimonabant, cholesteryl ester transfer protein or CETP the agent treating the liver is colchicine, methotrexate, Inhibitor such as JTT-705, CETi-1, or beta-3 adrenergic ursodeoxycholic acid, or penicillamine. agonist. [0364] In one embodiment, the SARM compound is administered in with an agent treating the kidney. In one [0368] In one embodiment, the SARM compound is embodiment, the agent treating the kidney is a diuretic. In administered with an agent treating a wasting disease. In some embodiments, diuretics include but are not limited to some embodiments, agents treating a wasting disease organomercurial, ethacrynic acid, frusemide, humetamide, include but are not limited to corticosteroids, anabolic piretanide, muzolimine, chlorothiazide and thiazide, phthali steroids, cannabinoids, metoclopramid, cisapride, medrox midine, chlorthalidone, clorexolone, quinazolinone, quinet yprogesterone acetate, megestrol acetate, cyproheptadine, hazone, metolazone ilenzenesulphonamide, mefruside, chlo hydrazine sulfate, pentoxifylline, thalidomide, anticytokine robenzamide, clopamidesalicylamide, xipamide, xanthine, antibodies, cytokine inhibitors, eicosapentaenoic acid, aminophylline, carbonic anhydrase inhibitor, acetazolamide indomethacin, ibuprofen, melatonin, insulin, growth hor mannitol, potassium-sparing compound, aldosterone mone, clenbuterol, porcine pancreas extract, IGF-1, IGF-1 antagonist, spironolactone and canrenoate, pteridines, pyra analogue and secretagogue, myostatin analogue, proteasome zine, carboxamide-triamterene, oramiloride. In one embodi inhibitor, testosterone, oxandrolone, enbrel, melanocortin 4 ment, the agent treating the kidney is a steroid. receptor agonist, or a combination thereof. [0365] In one embodiment, the agent treating the kidney is [0369] In one embodiment, the agent treating a wasting erythropoietin. In one embodiment, erythropoietin is disease is a ghrelin receptor ligand, growth hormone ana obtained by natural sources (e.g., urinary erythropoietin: See logue, or a secretagogue. In some embodiments, ghrelin U.S. Pat. No. 3,865,801), or is a recombinantly produced receptor ligands, growth hormone analogues, or secreta protein and analogs thereof, for example, as described in gogues include but are not limited to pralmorelin, examo U.S. Pat. Nos. 5,441,868, 5,547,933, 5,618,698 and 5,621, relin, tabimorelin, capimorelin, capromorelin, ipamorelin, 080 as well as human erythropoietin analogs with increased EP-01572, EP-1572, or JMV-1843. glycosylation and/or changes in the amino acid sequence as those described in European Patent Publication No. EP [0370] In one embodiment, growth promoting agents such 668351 and the hyperglycosylated analogs having 1-14 as but not limited to TRH, diethylstilbesterol, theophylline, sialic acid groups and changes in the amino acid sequence enkephalins, E series prostaglandins, compounds disclosed described in PCT Publication No. WO 91/05867. In one in U.S. Pat. No. 3,239,345, e.g., zeranol, and compounds embodiment, erythropoietin-like polypeptides are adminis disclosed in U.S. Pat. No. 4,036,979, e.g., sulbenox or tered in combination with SARM compounds. In some peptides disclosed in U.S. Pat. No. 4,411,890 are utilized as embodiments, erythropoietin-like polypeptides comprise agents treating a wasting disease. darbepoietin (from Amgen; also known as Aranesp and [0371] In other embodiments, agents treating a wasting novel erthyropoiesis stimulating protein (NESP)). disease may comprise growth hormone secretagogues such as GHRP-6, GHRP-1 (as described in U.S. Pat. No. 4,411, [0366] In one embodiment, the SARM compound is 890 and publications WO 89/07110 and WO 89/07111), administered in with an agent treating a metabolic disease. GHRP-2 (as described in WO 93/04081), NN703 (Novo In some embodiments, agents treating a metabolic disease Nordisk), LY444711 (Lilly), MK-677 (Merck), CP424391 include but are not limited to a vitamin, Coenzyme Q10, (Pfizer) and B-HT920, or, in other embodiments, with glucosidase alfa, sodium bicarbonate, bisphosphonate, growth hormone releasing factor and its analogs or growth biotin, allopurinol, levodopa, diazepam, phenobarbital, hormone and its analogs, or with alpha-adrenergic agonists, haloperidol, folic acid, antioxidants, activators of cation such as clonidine or serotinin 5-HTD agonists, such as channels haptoglobin, or carnitine. Sumatriptan, or agents which inhibit somatostatin or its [0367] In one embodiment, the agent treating a metabolic release, such as physostigmine and pyridostigmine. In some disease is a pancreatic lipase inhibitor such as orlistat or embodiments, agents treating a wasting disease may com cetilistat, Serotonin or norepinephrine reuptake inhibitor prise parathyroid hormone, PTH(1-34) or bisphosphonates, such as sibutramine, insulin-sensitizers such as biguanide, such as MK-217 (alendronate). In other embodiments, PPAR agonist, Dual-acting PPAR agonist such as muragli agents treating wasting disease may further comprise estro tazar, tesaglitazar, or naveglitazar, PPAR-delta agonist such gen, a selective estrogen receptor modulator, such as tamox as GW-501516, DPP-IV Inhibitor such as vildagliptin or ifene or raloxifene, or other androgen receptor modulators, sitagliptin, alpha glucosidase inhibitor such as acarbose, such as those disclosed in Edwards, J. P. et al., Bio. Med. US 2007/028 1906 A1 Dec. 6, 2007 28

Chem. Let., 9, 1003-1008 (1999) and Hamann, L. G. et al., (phenylmethyl)-phenoxy}ethanamine), TSE-424, WAY-070, J. Med. Chem., 42, 210-212 (1999). In some embodiments, WAY-292, WAY-818, cyclocommunol, prinaberel, ERB agents treating a wasting disease may further comprise a 041, WAY-397, WAY-244, ERB-196, WAY-169122, progesterone receptor agonists (“PRA”), such as levonorg MF-101, ERb-002, ERB-037, ERB-017, BE-1060, BE-380, estrel, medroxyprogesterone acetate (MPA). In some BE-381, WAY-358, [18FIFEDNP. LSN-500307, AA-102, embodiments, agents treating a wasting disease may include Ban Zhilian, CT-101, CT-102, or VG-101. nutritional supplements, such as those described in U.S. Pat. No. 5,179,080, which, in other embodiments are in combi [0376] In one embodiment, the agent treating the endo nation with whey protein or casein, amino acids (such as crine system is a gonadotropin-releasing hormone agonist or leucine, branched amino acids and hydroxymethylbutyrate), antagonist. In some embodiments, gonadotropin-releasing triglycerides, vitamins (e.g., A, B6, B 12, folate, C, D and E), hormone agonists or antagonists include but are not limited minerals (e.g., selenium, magnesium, zinc, chromium, cal to leuprolide, goserelin, triptorelin, alfaprostol, histrelin, cium and potassium), camitine, lipoic acid, creatinine, B-hy detirelix, ganirelix, antide iturelix, cetrorelix, ramorelix, roxy-B-methylbutyriate (Juven) and coenzyme Q. In one ganirelix, antarelix, teverelix, abarelix, ozarelix, Sufugolix, embodiment, agents treating a wasting disease may further prazarelix, degarelix, NBI-56418, TAK-810, or acyline. comprise antiresorptive agents, vitamin D analogues, [0377] In one embodiment, the agent treating the endo elemental calcium and calcium supplements, cathepsin K crine system is a luteinizing hormone agonist or antagonist. inhibitors, MMP inhibitors, vitronectin receptor antagonists, In some embodiments, luteinizing hormone agonists or Src SH2 antagonists, vacular-H+-ATPase inhibitors, iprifla antagonists include but are not limited to letrozole, anastra vone, fluoride, tibolone, prostanoids, 17-beta hydroxysteroid zole, atamestane, fadrozole, minamestane, exemestane, dehydrogenase inhibitors and Src kinase inhibitors. plomestane, liarozole, NKS-01, vorozole, YM-511, finro zole, 4-hydroxyandrostenedione, aminogluethimide, or [0372] In one embodiment, the SARM compound is administered in with an agent treating the endocrine system. rogletimide. In one embodiment, the agent treating the In some embodiments, agents treating the endocrine system endocrine system is a follicle stimulating hormone agonist include but are not limited to radioactive iodine, antithyroid or antagonist. In one embodiment, the agent treating the agent, thyroid hormone supplement, growth hormone, cab endocrine system is a luteinizing hormone releasing hor ergoline, bromocriptine, thyroxime, gonadotropin, glucocor mone (LHRH) or a LHRH analog. ticoid, glucocorticoid analogue, corticotrophin, metyrapone, [0378] In one embodiment, the agent treating the endo aminoglutethimide, mitotane, ketoconazole, mifepristone, crine system is a steroidal or nonsteroidal glucocorticoid dexamethasone somatostatin analogue, gonadotropin-re receptor ligand. In some embodiments, nonsteroidal gluco leasing hormone analogue, leuprolide, goserelin, antidi corticoid receptor ligands include but are not limited to uretic hormone, antidiuretic hormone analogue, oxytocin, ZK-216348, ZK-243149, ZK-243185, LGD-5552, mifepris calcium supplement, vitamin D, or a combination thereof. tone, RPR-106541, ORG-34517, GW-215864X, Sesquicil [0373] In one embodiment, the agent treating the endo lin, CP-472555, CP-394531, A-222977, AL-438, A-216054, crine system is a 5-alpha-reductase inhibitor. In some A-276575, CP-394531, CP-409069, or UGR-07. embodiments, 5-alpha-reductase inhibitors include but are [0379] In one embodiment, the agent treating the endo not limited to finasteride, dutasteride, or izonsteride. crine system is a steroidal or non-steroidal progesterone receptor ligand. In one embodiment, the agent treating the [0374] In one embodiment, the agent treating the endo endocrine system is a steroidal or nonsteroidal androgen crine system is a SARM compound. In some embodiments, receptor antagonist. In some embodiments, steroidal or SARMs include but are not limited to RU-58642, nonsteroidal androgen receptor antagonists include but are RU-56279, WS9761 A and B, RU-59063, RU-58841, bex not limited to flutamide, hydroxyflutamide, bicalutamide, losteride, LG-2293, L-245976, LG-121071, LG-121091, nilutamide, or hydroxysteroid dehydrogenase inhibitor. LG-121104, LGD-2226, LGD-2941, YM-92088, YM-175735, LGD-1331, BMS-357597, BMS-391197, [0380] In one embodiment, the agent treating the endo S-40503, BMS-482404, EM-4283, EM-4977, BMS-564929, crine system is a peroxisome proliferator-activated receptor BMS-391197, BMS-434588, BMS-487745, BMS-501949, ligand. In some embodiments, peroxisome proliferator-ac SA-766, YM-92088, YM-580, LG-123303, LG-123129, tivated receptor ligands include but are not limited to PMCol, YM-175735, BMS-591305, BMS-591309, BMS bezafibrate, fenofibrate, gemfibrozil, darglitazone, pioglita 665139, BMS-665539, CE-590, 116BG33, 154BG31, arcar zone, rosiglitazone, isaglitazone, rivoglitazone, netoglita ine, or ACP-105. Zone, naveglitazar, farglitazar, tesaglitazar, ragaglitazar, oxeglitazar, or PN-2034. [0375] In one embodiment, the additional agent treating the endocrine system is a SERM compound. In some [0381] In one embodiment, an agent treating the endocrine embodiments, SERMs include but are not limited to tamox system is a human growth hormone. In some embodiments, ifene, 4-hydroxytamoxifene, idoxifene, toremifene, human growth hormones include but are not limited to ospenifene, droloxifene, raloxifene, arzoxifene, bazedox somatotropin or analogues. ifene, PPT (1,3,5-Tris(4-hydroxyphenyl)-4-propyl-1H-pyra zole), DPN, lasofoxifene, pipendoxifene, EM-800, EM-652, [0382] In one embodiment, the agent treating the endo nafoxidine, zindoxifene, tesmilifene, miproxifene phos crine system is a ghrelin. In some embodiments, ghrelins phate, RU 58,688, EM 139, ICI 164,384, ICI 182,780, include but are not limited to human ghrelin, CYT-009 clomiphene, MER-25, diethylstibestrol, coumestrol, Ghrob, L-692429, GHRP-6, SK&F-110679, or U-75799E. genistein, GW5638, LY353581, zuclomiphene, enclomi [0383] In one embodiment, the agent treating the endo phene, delmadinone acetate, DPPE, (N,N-diethyl-2-[4 crine system is a leptin. In some embodiments, leptins US 2007/028 1906 A1 Dec. 6, 2007 29 include but are not limited to metreleptin or pegylated leptin. pamil, antidopaminergic agent, anti-emetic agent, metoclo In one embodiment, an agent treating the endocrine system pramide, H2 receptor antagonist, cimetidine, ranitidine, is a leptin receptor agonist. In some embodiments, leptin estrogen, or amphetamine. receptor agonists include but are not limited to LEP(116 [0389] In one embodiment, the SARM compound is 130), OB3, [D-Leu-4]-OB3, ra AV-leptin, AAV-hCB, or administered with a vitamin. In some embodiments, vita rAAVHOB. mins include but are not limited to vitamin D, vitamin E, [0384] In one embodiment, the SARM compound is vitamin K, vitamin B. vitamin C, or a combination thereof. administered with an inhibitor of an enzyme involved in the [0390] In one embodiment, the SARM compound is androgen biosynthetic pathway. In some embodiments, administered with a behavior-modulating agent. In some inhibitors of enzymes involved in the androgen biosynthetic embodiments, behavior-modulating agents include but are pathway include but are not limited to 17-ketoreductase not limited to an anti-anxiety agent, anti-psychotic agent, inhibitor, 3-DH.4.6-isomerase inhibitor, 3-DH4.5-isomerase anti-depressant, beta-blocker, beta-2 agonist, anticholinergic inhibitor, 17.20 desmolase inhibitor, p450c17 inhibitor, bronchodilator, theophylline, aminophylline, nedocromil p450ssc inhibitor, or 17,20-lyase inhibitor. sodium, sodium cromoglycate, leukotriene receptor antago nist, corticosteroid, expectorant, mucolytic agent, antihista [0385] In one embodiment, the SARM compound is mine, pseudoephedrine, methylphenidate, amphetamine, administered with an agent treating osteoporosis. In some buspirone, benzodiazepine, dextroamphetamine, tricyclic embodiments, osteoporosis is induced by alcohol and/or smoking. In some embodiments, agents treating osteoporo antidepressant, serotonin reuptake inhibitor, phenothiazines, sis include but are not limited to SERMs, calcitonin, vitamin benztropine, bupropion, propranolol, lithium, venlafaxine, D, vitamin D derivatives, vitamin D receptor ligand, vitamin haloperidol, buspirone, or a neuraminidase inhibitor. D receptor ligand analogue, estrogen, estrogen derivative, [0391] In one embodiment, the behavior-modulating agent conjugated estrogen, antiestrogen, progestin, synthetic is a benzodiazepine. In one embodiment, benzodiazepines estrogen, synthetic progestin, RANK ligand monoclonal comprise alprazolam, chlordiazepoxide, diazepam, flu antibody, integrin receptor antagonist, osteoclast vacuolar razepam, lorazepam, oxazepam, temazepam, or triazolam. ATPase inhibitor, antagonist of VEGF binding to osteoclast [0392] In one embodiment, the behavior-modulating agent receptors, calcium receptor antagonist, parathyroid hor is a phenothiazine. In one embodiment, phenothiazines mone, parathyroid hormone analogue, parathyroid hormone comprise fluphenazine, perphenazine, thioridazine, or trif related peptide, cathepsin K inhibitor, strontium ranelate, luoperazine. tibolone, HCT-1026, PSK3471, gallium maltolate, nutropin AQ, prostaglandin, p38 protein kinase inhibitor, bone mor [0393] In one embodiment, the behavior-modulating agent phogenetic protein (BMP), inhibitor of BMP antagonism, is a tricyclic antidepressant or a serotonin reuptake inhibitor. HMG-CoA reductase inhibitor, vitamin K, vitamin K deriva In one embodiment, tricyclic antidepressants or serotonin tive, ipriflavone, fluoride salts, dietary calcium supplement, reuptake inhibitors comprise phenothiazine, protriptyline, or osteoprotegerin. fluoxetine, paroxetine, or sertraline. [0386] In one embodiment, the agent treating osteoporosis [0394] In one embodiment, the SARM compound is is a calcitonin. In some embodiments, calcitonins include administered with an agent treating a connective tissue. In but are not limited to salmon, elcatonin, SUN-8577, or some embodiments, agents treating a connective tissue TJN-135. include but are not limited to an anti-malaria agent, a cytotoxic agent, a steroid, corticosteroid, lupus medication, [0387] In one embodiment, the agent treating osteoporosis imuran, cytoxan, anti-rheumatic agent, corticosteroid, nife is a vitamin D receptor ligand or analogue. In some embodi dipine, aspirin, colchicine, captopril, penicillamine, azathio ments, vitamin D receptor ligands or analogues include but prine, methotrexate, cyclophosphamide, prednisone, nicar are not limited to calcitriol, topitriol, ZK-1501.23, TEI-9647, dipine, or a non-steroidal anti-inflammatory agent. BXL-628, Ro-26-9228, BAL-2299, Ro-65-2299, or DP-035. [0395] In one embodiment, the SARM compound is administered with an agent treating an ophthalmic disease. [0388] In one embodiment, the SARM compound is In some embodiments, agents treating an ophthalmic disease administered with an agent treating pharmacotherapy include but are not limited to betagan, betimol, timoptic, induced hypogonadal and/or osteopenic and/or sarcopenic betoptic, betoptic, ocupress, optipranolol, xalatan, alphagan, state. In some embodiments, agents treating pharmaco azopt, trusopt, cospot, pilocar, pilagan, propine, opticrom, therapy induced hypogonadal and/or osteopenic and/or sar acular, livostin, alomide, emadine, patanol, alrex, poly-pred, copenic states include but are not limited to opioids, nar pred-g, dexacidin, erythromycin, maxitrol, tobradex, ble cotics, opiates, opioids, methadone, kadian, D2 dopamine phamide, FML, ocufen, voltaren, profenal, pred forte, econ receptor antagonist, zotepine, haloperidol, amisulpride, ris pred plus, eflone, flarex, inflamase forte, betadine, gramici peridone, anti-epileptic agent, valproic acid, carbamazepine, din, prednisolone, betaxolol, humorsol, proparacaine, oxcarbamazepine, chemotherapeutic agent, methotrexate, betoptic, hylartin, inflamase mild, lotemax, flurbiprofen, cyclophosphamide, ifosfamide, adriamycin, doxorubicin, chloramphenicol, methazolamide, timolol, ciloxan, terramy glucocorticoids, cyclosporine, L-thyroxine, SERMs, AI, ful cin, ciprofloxacin, miostat, triamcinolone, miconazole, vestrant, gonadotropin-releasing hormone agent, androgen tobramycin, physostimine, gentamicin, pilocarpine, bacitra depravation agent, prolactinemia-inducing agent, serotoner cin, goniosol, polymyxin, oxytetracycline, viroptic, vexol, gic antidepressant, selective serotonin reuptake inhibitor, suprofen, celluvisc, polytrim, illotycin, ciloxan, ocuflox, monoamine oxidase inhibitor, tricyclic antidepressant, anti brinzolamide, cefazolin, tobrex, latanoprost, indocycanine, hypertensive agents, methyldopa, reserpine, clonidine, Vera trifluridine, phenylephrine, demecarium, neomycin, tropica US 2007/028 1906 A1 Dec. 6, 2007 30 mide, dexamethasone, neptazane, dipivefrin, ocuflox, alone or as part of the combined therapy or using the vidarabine, dorzolamide, ofioxacin, epinephrine, acyclovir, compositions of this invention represent additional embodi carbonic anhydrase inhibitor, antihistamine vitamin A, vita ments of this invention. min C, vitamin E, zinc, copper, atropine, or garamycin. Biological Activity of Selective Androgen Modulator Com pounds [0396] In one embodiment, the SARM compound is administered in with a gene therapy agent. In some embodi [0400] The SARMs of this invention may be useful, in ments, gene therapy agents include but are not limited to an some embodiments, for oral testosterone replacement antisense agent, or a replacement gene. therapy. In other embodiments, appropriately substituted compounds are useful for a) male contraception; b) treat [0397] In some embodiments, any of the compositions of ment of a variety of hormone-related conditions, for this invention will comprise a compound of formula I-XX, example conditions associated with ADAM, such as fatigue, in any form or embodiment as described herein. In some depression, decreased libido, sexual dysfunction, erectile embodiments, any of the compositions of this invention will dysfunction, hypogonadism, osteoporosis, hair loss, obesity, consist of a a compound of formula I-XX, in any form or sarcopenia, osteopenia, benign prostate hyperplasia, and embodiment as described herein. In some embodiments, of alterations in mood and cognition; c) treatment of conditions the compositions of this invention will consist essentially of associated with ADIF, such as sexual dysfunction, decreased a compound of -XX, in any form or embodiment as sexual libido, hypogonadism, sarcopenia, osteopenia, described herein. In some embodiments, the term “com osteoporosis, alterations in cognition and mood, depression, prise” refers to the inclusion of the indicated active agent, anemia, hair loss, obesity, endometriosis, breast cancer, such as the compound of formula I-XX, as well as inclusion uterine cancer and ovarian cancer; d) treatment and/or of other active agents, and pharmaceutically acceptable prevention of chronic muscular wasting; e) treatment of carriers, excipients, emollients, stabilizers, etc., as are prostate cancer, imaging of prostate cancer; decreasing the known in the pharmaceutical industry. In some embodi incidence of halting or causing a regression of prostate ments, the term “consisting essentially of refers to a com cancer, f) treatment of diabetes type I, g) treatment of position, whose only active ingredient is the indicated active diabetes type II; h) suppressing or inhibiting or reducing the ingredient, however, other compounds may be included incidence of diabetes i) treatment of glucose intolerance; j) which are for stabilizing, preserving, etc. the formulation, treatment of hyperinsulinemia; k) treatment of insulin resis but are not involved directly in the therapeutic effect of the tance 1) treatment of diabetic nephropathy; m) treatment of indicated active ingredient. In some embodiments, the term diabetic neuropathy, n) treatment of diabetic retinopathy; oy “consisting essentially of may refer to components which treatment of fatty liver condition; p) treatment of cachexia; facilitate the release of the active ingredient. In some q) oral androgen replacement and/or other clinical therapeu embodiments, the term “consisting” refers to a composition, tic and/or diagnostic areas, including any embodiment of which contains the active ingredient and a pharmaceutically what is encompassed by the term “treating” as described acceptable carrier or excipient. herein. [0401] In some embodiments, the SARM compounds pos [0398] In one embodiment, the present invention provides sess in vivo tissue selective androgenic and anabolic activity, combined preparations. In one embodiment, the term “a which is accordingly utilized for particular applications, as combined preparation” defines especially a “kit of parts” in will be appreciated by one skilled in the art. the sense that the combination partners as defined above can [0402] In one embodiment, this invention provides: a) a be dosed independently or by use of different fixed combi method of treating a subject having a muscle wasting nations with distinguished amounts of the combination disorder; b) a method of treating a subject suffering from partners i.e., simultaneously, concurrently, separately or malnutrition; c) a method of treating a bone-related disorder sequentially. In some embodiments, the parts of the kit of in a subject; d) a method of increasing a bone mass in a parts can then, e.g., be administered simultaneously or subject; e) a method of improving the lipid profile in a chronologically staggered, that is at different time points and subject; f) a method of treating atherosclerosis and its with equal or different time intervals for any part of the kit associated diseases; g) a method of improving dexterity and of parts. The ratio of the total amounts of the combination movement in a subject; a method of improving dexterity and partners, in some embodiments, can be administered in the movement in a subject; h) a method of treating a subject combined preparation. In one embodiment, the combined suffering from dwarfism; i) a method of treating a subject preparation can be varied, e.g., in order to cope with the having dysmenorrhea, j) a method of treating a subject needs of a patient subpopulation to be treated or the needs having dysparunia; k) a method of treating a subject having of the single patient which different needs can be due to a dysspermtogenic sterility; comprising the step of adminis particular disease, severity of a disease, age, sex, or body tering to said subject a selective androgen receptor modu weight as can be readily made by a person skilled in the art. lator (SARM) compound of formula I-XX and/or an analog, [0399] It is to be understood that this invention is directed derivative, isomer, metabolite, pharmaceutically acceptable to compositions and combined therapies as described herein, salt, pharmaceutical product, hydrate, N-oxide, prodrug, for any disease, disorder or condition, as appropriate, as will polymorph, impurity or crystal of said SARM compound, or be appreciated by one skilled in the art. Certain applications any combination thereof. of such compositions and combined therapies have been [0403] In some embodiments, the SARMs as described described hereinabove, for specific diseases, disorders and herein and/or compositions comprising the same may be conditions, representing embodiments of this invention, and used for applications and treating diseases in which the methods of treating such diseases, disorders and conditions improvement of cognition, reduction or treatment of depres in a subject by administering a SARM as herein described, sion, or other neuroportective effects are desired.

US 2007/028 1906 A1 Dec. 6, 2007 32 incidence or severity or pathogenesis of a cancer in a derivative, isomer, metabolite, pharmaceutically acceptable subject, delaying progression, prolonging remission or salt, pharmaceutical product, polymorph, crystal, impurity, delaying onset of cancer in a subject, comprising the step of hydrate, N-oxide or any combination thereof, in an amount administering to the subject a SARM compound as herein effective to treat prostatitis in the subject. described and/or its analog, derivative, isomer, metabolite, pharmaceutically acceptable salt, pharmaceutical product, [0422] In some embodiments, this invention provides for the use of a SARM compound as herein described, or its polymorph, crystal, impurity, hydrate, N-oxide or any com prodrug, analog, isomer, metabolite, derivative, pharmaceu bination thereof. In some embodiments, such cancers are tically acceptable salt, pharmaceutical product, polymorph, hormone-dependent or associated with reproductive tissue crystal, impurity, N-oxide, hydrate or any combination in males or females, such as cancer of the prostate, ovary, thereof, for treating reducing the severity of reducing the breast, uterus, testicle, or others. incidence of, or reducing pathogenesis of cachexia and/or [0418] In some embodiments, this invention provides cachexia associated with cancer in a subject. In another methods for the treatment of a precancerous precursor or embodiment, the cancer comprise adrenocortical carcinoma, lesion in a subject, reduction of incidence of precancerous anal cancer, bladder cancer, brain tumor, brain stem glioma, precursors or lesions in a subject, comprising the step of brain tumor, cerebellar astrocytoma, cerebral astrocytoma, administering to the subject a SARM compound as herein ependymoma, medulloblastoma, supratentorial primitive described and/or its analog, derivative, isomer, metabolite, neuroectodermal, pineal tumors, hypothalamic glioma, pharmaceutically acceptable salt, pharmaceutical product, breast cancer, carcinoid tumor, carcinoma, cervical cancer, polymorph, crystal, impurity, hydrate, N-oxide or any com colon cancer, endometrial cancer, esophageal cancer, extra bination thereof. In some embodiments, such precancerous hepatic bile duct cancer, ewings family of tumors (Pnet), precursors are found in hormone-responsive tissue or are extracranial germ cell tumor, eye cancer, intraocular mela associated with reproductive tissue in males or females, such noma, gallbladder cancer, gastric cancer, germ cell tumor, as in the prostate, ovary, breast, uterus, testicle, or others. In extragonadal, gestational trophoblastic tumor, head and neck some embodiments, such precancerous precursors comprise cancer, hypopharyngeal cancer, islet cell carcinoma, laryn any local intraepithelial neoplasia, for example, of the geal cancer, leukemia, acute lymphoblastic, leukemia, oral prostate, the cervix, etc. In some embodiments, such meth cavity cancer, liver cancer, lung cancer, small cell lung ods are useful in treating neoplasia or pre-neoplasia, dys cancer, non small cell lung cancer, lymphoma, AIDS-related plasia or hyperplasia in a tissue, such as in reproductive lymphoma, central nervous system (primary), lymphoma, tissue in males or females. cutaneous T-cell, lymphoma, Hodgkin’s disease, non Hodgkin’s disease, malignant mesothelioma, melanoma, [0419] In one embodiment, this invention provides com Merkel cell carcinoma, metasatic squamous carcinoma, pounds, compositions and/or methods of use thereof in multiple myeloma, plasma cell neoplasms, mycosis fun treating benign prostate hyperplasia (BPH). “BPH (benign goides, myelodysplastic syndrome, myeloproliferative dis prostate hyperplasia)” is a nonmalignant enlargement of the orders, nasopharyngeal cancer, neuroblastoma, oropharyn prostate gland, and is the most common non-malignant geal cancer, osteosarcoma, ovarian epithelial cancer, ovarian proliferative abnormality found in any internal organ and the germ cell tumor, ovarian low malignant potential tumor, major cause of morbidity in the adult male. BPH occurs in pancreatic cancer, exocrine, pancreatic cancer, islet cell over 75% of men over 50 years of age, reaching 88% carcinoma, paranasal sinus and nasal cavity cancer, parathy prevalence by the ninth decade. BPH frequently results in a roid cancer, penile cancer, pheochromocytoma cancer, pitu gradual squeezing of the portion of the urethra which itary cancer, plasma cell neoplasm, prostate cancer, rhab traverses the prostate (prostatic urethra). This causes domyosarcoma, rectal cancer, renal cell cancer, salivary patients to experience a frequent urge to urinate because of gland cancer, Sezary syndrome, skin cancer, cutaneous incomplete emptying of the bladder and urgency of urina T-cell lymphoma, skin cancer, Kaposi’s sarcoma, skin can tion. The obstruction of urinary flow can also lead to a cer, melanoma, small intestine cancer, soft tissue sarcoma, general lack of control over urination, including difficulty soft tissue sarcoma, testicular cancer, thymoma, malignant, initiating urination when desired, as well as difficulty in thyroid cancer, urethral cancer, uterine cancer, sarcoma, preventing urinary flow because of the inability to empty unusual cancer of childhood, vaginal cancer, vulvar cancer, urine from the bladder, a condition known as overflow Wilms’ tumor, or any combination thereof. urinary incontinence, which can lead to urinary obstruction and to urinary failure. [0423] In another embodiment, this invention provides the use of a SARM compound as herein described including [0420] In another embodiment of the present invention, comprising an analog, derivative, isomer, metabolite, phar the method for treating benign prostate hyperplasia (BPH) in maceutically acceptable salt, pharmaceutical product, poly a subject, comprises the step of administering to the subject morph, crystal, impurity, hydrate, N-oxide or any combina a SARM compound as herein described and/or its analog, tion thereof, of a compound of formula III for treating derivative, isomer, metabolite, pharmaceutically acceptable reducing the severity of reducing the incidence of delaying salt, pharmaceutical product, polymorph, crystal, impurity, the onset of lung cancer, which in one embodiment is hydrate, N-oxide or any combination thereof, in an amount non-small cell lung cancer. effective to treat BPH in the subject. [0424] In another embodiment, this invention provides the [0421] In another embodiment of the present invention, use of a SARM compound as herein described including this invention provides a method for treating, including all comprising an analog, derivative, isomer, metabolite, phar embodiments encompassed by such term, prostatitis in a maceutically acceptable salt, pharmaceutical product, poly subject, comprises the step of administering to the subject a morph, crystal, impurity, hydrate, N-oxide or any combina SARM compound as herein described and/or its analog, tion thereof, of a compound of formula III for treating US 2007/028 1906 A1 Dec. 6, 2007 reducing the severity of reducing the incidence of delaying [0430] In another embodiment, the bone-related disorder the onset of cachexia or other conditions arising as a result is a loss of bone mineral density (BMD). In another embodi of lung cancer in the subject, which in one embodiment is ment, the bone-related disorder is any combination of non-small cell lung cancer. osteoporosis, osteopenia, increased bone resorption, bone [0425] In some embodiments, this invention provides the fracture, bone frailty and loss of BMD. Each disorder use of a SARM compound as herein described including represents a separate embodiment of the present invention. comprising an analog, derivative, isomer, metabolite, phar [0431] “Osteoporosis” refers, in one embodiment, to a maceutically acceptable salt, pharmaceutical product, poly thinning of the bones with reduction in bone mass due to morph, crystal, impurity, hydrate, N-oxide or any combina depletion of calcium and bone protein. In another embodi tion thereof, of a compound of formula III for treating ment, osteoporosis is a systemic skeletal disease, character reducing the severity of reducing the incidence of, or ized by low bone mass and deterioration of bone tissue, with reducing pathogenesis of cancer. In another embodiment, the a consequent increase in bone fragility and susceptibility to cancer comprise androgen AR dependent tumors (malignant fracture. In osteoporotic patients, bone strength is abnormal, or benign) such as prostate cancer, breast cancer (male or in one embodiment, with a resulting increase in the risk of female, operable or inoperable). In another embodiment the fracture. In another embodiment, osteoporosis depletes both SARM compounds adjunct to ADT for treating prostate the calcium and the protein collagen normally found in the cancer; bladder cancers; brain cancers; bone tumors, colon bone, in one embodiment, resulting in either abnormal bone cancer, endometrial cancer, liver cancer, lung cancer, lym quality or decreased bone density. In another embodiment, phatic cancer, kidney cancer, osteosarcoma cancer, ovarian bones that are affected by osteoporosis can fracture with cancer, pancreas cancer, penis cancer, skin cancer, thyroid only a minor fall or injury that normally would not cause a cancer; and/or hormone-dependent cancers. bone fracture. The fracture can be, in one embodiment, [0426] In one embodiment, this invention provides for the either in the form of cracking (as in a hip fracture) or use of a SARM compound as herein described, or its collapsing (as in a compression fracture of the spine). The prodrug, analog, isomer, metabolite, derivative, pharmaceu spine, hips, and wrists are common areas of osteoporosis tically acceptable salt, pharmaceutical product, polymorph, induced bone fractures, although fractures can also occur in crystal, impurity, N-oxide, hydrate or any combination other skeletal areas. Unchecked osteoporosis can lead, in thereof, for a) treating a bone related disorder; b) preventing another embodiment, to changes in posture, physical abnor a bone related disorder; c) suppressing a bone related mality, and decreased mobility. disorder; d) inhibiting a bone related disorder; e) increasing [0432] In one embodiment, the osteoporosis results from a strength of a bone of a subject: f) increasing a bone mass androgen deprivation. In another embodiment, the in a subject; g) use for osteoclastogenesis inhibition. osteoporosis follows androgen deprivation. In another [0427] In one embodiment, this invention provides for the embodiment, the osteoporosis is primary osteoporosis. In use of a SARM compound as herein described including another embodiment, the osteoporosis is secondary comprising an analog, derivative, isomer, metabolite, phar osteoporosis. In another embodiment, the osteoporosis is maceutically acceptable salt, pharmaceutical product, poly postmenopausal osteoporosis. In another embodiment, the morph, crystal, impurity, hydrate, N-oxide or any combina osteoporosis is juvenile osteoporosis. In another embodi tion thereof, of a compound of formula I for a) Accelerate ment, the osteoporosis is idiopathic osteoporosis. In another bone repair; b) treating bone disorders; c) treating bone embodiment, the osteoporosis is senile osteoporosis. density loss; d) treating low bone mineral density (BMD); e) [0433] In another embodiment, the primary osteoporosis is treating reduced bone mass; f) treating metabolic bone Type I primary osteoporosis. In another embodiment, the disease; g) promoting bone growth or regrowth; h) promot primary osteoporosis is Type H primary osteoporosis. Each ing bone restoration: i) promoting bone fracture repair, j) type of osteoporosis represents a separate embodiment of the promoting bone remodeling, k) treating bone damage fol present invention. lowing reconstructive surgery including of the face, hip, or joints; 1) enhancing of bone strength and function; m) [0434] According to this aspect of the invention and in one increasing cortical bone mass; n) increasing trabecular con embodiment, the bone-related disorder is treated with a nectivity. SARM compound as herein described, or a combination thereof. In another embodiment, other bone-stimulating [0428] In one embodiment, the bone related disorder is a compounds can be provided to the subject, prior to, concur genetic disorder, or in another embodiment, is induced as a rent with or following administration of a SARM or SARMs result of a treatment regimen for a given disease. For as herein described. In one embodiment, such a bone stimu example, and in one embodiment, the SARMs as herein lating compound may comprise natural or synthetic mate described are useful in treating a bone-related disorder that rials. arises as a result of cancer metastasis to bone, or in another embodiment, as a result of androgen-deprivation therapy, for [0435] In one embodiment, the bone stimulating com example, given in response to prostate carcinogenesis in the pound may comprise a bone morphogenetic protein (BMP), subject. a growth factor, such as epidermal growth factor (EGF), a fibroblast growth factor (FGF), a transforming growth factor [0429] In one embodiment, the bone-related disorder is (TGF, an insulin growth factor (IGF), a platelet-derived osteoporosis. In another embodiment, the bone-related dis growth factor (PDGF) hedgehog proteins such as sonic, order is osteopenia. In another embodiment, the bone-related Indian and desert hedgehog, a hormone such as follicle disorder is increased bone resorption. In another embodi stimulating hormone, parathyroid hormone, parathyroid hor ment, the bone-related disorder is bone fracture. In another mone related peptide, activins, inhibins, follistatin, frizzled, embodiment, the bone-related disorder is bone frailty. frzb or frazzled proteins, BMP binding proteins such as US 2007/028 1906 A1 Dec. 6, 2007 34 chordin and fetuin, a cytokine such as IL-3, IL-7, GM-CSF, 1) strontium ranelate; m) tibolone; n.) HCT-1026, PSK3471; a chemokine, such as eotaxin, a collagen, osteocalcin, o) gallium maltolate; p.) nutropin AQ: q) prostaglandins (for osteonectin and others, as will be appreciated by one skilled osteo); r) p38 protein kinase inhibitor, s) bone morphoge in the art. netic protein; t) inhibitor of BMP antagonism; u) HMG-CoA reductase inhibitor; v)vitamin K or derivative: w) iprifla [0436] In another embodiment, the compositions for use in vone; x) fluoride salts; y) dietary calcium supplement, and z) treating a bone disorder of this invention may comprise a osteoprotegerin. SARM or SARMs as herein described, an additional bone stimulating compound, or compounds, and osteogenic cells. [0441] In one embodiment, the methods of this invention In one embodiment, an osteogenic cell may be a stem cell or are useful in treating diseases or disorders caused by, or progenitor cell, which may be induced to differentiate into associated with a hormonal disorder, disruption or imbal an osteoblast. In another embodiment, the cell may be an all Cè. osteoblast. In another embodiment, nucleic acids which [0442] In one embodiment, the hormonal disorder, disrup encode bone-stimulating compounds may be administered tion or imbalance comprises an excess of a hormone. In to the subject, which is to be considered as part of this another embodiment, the hormonal disorder, disruption or invention. imbalance comprises a deficiency of a hormone. In one [0437] In one embodiment, the methods of the present embodiment, the hormone is a steroid hormone. In another invention comprise administering the SARM compound for embodiment, the hormone is an estrogen. In another treating osteoporosis. In another embodiment, the methods embodiment, the hormone is an androgen. In another of this invention comprise administering a SARM com embodiment, the hormone is a glucocorticoid. In another pound in combination with SERMs for treating osteoporo embodiment, the hormone is a cortico-steroid. In another sis. In another embodiment, the SERMs are tamoxifene, embodiment, the hormone is Luteinizing Hormone (LH). In 4-hydroxytamoxifene, idoxifene, toremifene, ospenifene, another embodiment, the hormone is Follicle Stimulating droloxifene, raloxifene, arzoxifene, bazedoxifene, PPT (1,3, Hormone (FSH). In another embodiment, the hormone is 5-Tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole), DPN, any other hormone known in the art. In another embodiment, lasofoxifene, pipendoxifene, EM-800, EM-652, nafoxidine, the hormonal disorder, disruption or imbalance is associated zindoxifene, tesmilifene, miproxifene phosphate, RU with menopause. In another embodiment, the hormonal 58,688, EM 139, ICI 164,384, ICI 182,780, clomiphene, disorder, disruption or imbalance is associated with andro MER-25, diethylstibestrol, coumestrol, genistein, GW5638, pause, andropausal vasomotor symptoms, andropausal LY353581, zuclomiphene, enclomiphene, delmadinone gynecomastia, muscle strength and/or function, bone acetate, DPPE, (N,N-diethyl-2-[4-(phenylmethyl) strength and/or function and anger. In another embodiment, phenoxy}ethanamine), TSE-424, WAY-070, WAY-292, hormone deficiency is a result of specific manipulation, as a WAY-818, cyclocommunol, prinaberel, ERB-041, WAY byproduct of treating a disease or disorder in the subject. For 397, WAY-244, ERB-196, WAY-169122, MF-101, ERb-002, example, the hormone deficiency may be a result of andro ERB-037, ERB-017, BE-1060, BE-380, BE-381, WAY-358, gen depletion in a subject, as a therapy for prostate cancer [18FIFEDNP. LSN-500307, AA-102, Ban Zhilian, CT-101, in the subject. Each possibility represents a separate embodi CT-102, or VG-101. ment of the present invention. [0438] In another embodiment, the methods of the present [0443] In another embodiment the invention is directed to invention comprise administering the SARM compound, in treating sarcopenia or cachexia, and associated conditions combination with bisphosphonates such as alendronate, related thereto, for example diseases or disorders of the tiludroate, clodroniate, pamidronate, etidronate, alendr bone. onate, zolendronate, cimadronate, neridronate, minodronic acid, ibandronate, risedronate, or homoresidronate for treat [0444] In one embodiment, this invention provides for the ing osteoporosis. use of a SARM compound as herein described, or its prodrug, analog, isomer, metabolite, derivative, pharmaceu [0439] In another embodiment, the methods of the present tically acceptable salt, pharmaceutical product, polymorph, invention comprise administering the SARM compound, in crystal, impurity, N-oxide, hydrate or any combination combination with Calcitonin such as salmon, Elcatonin, thereof, for 1) treating a muscle wasting disorder; 2) pre SUN-8577 or TJN-135 for treating osteoporosis. venting a muscle wasting disorder; 3) treating, preventing, suppressing, inhibiting or reducing muscle loss due to a [0440] In another embodiment, the methods of treating muscle wasting disorder; 4) treating, preventing, inhibiting, osteoporosis of the present invention comprise administer reducing or suppressing muscle wasting due to a muscle ing the SARM compound, in combination with a) vitamin D wasting disorder; and/or 5) treating, preventing, inhibiting, or derivative such as ZK-156979; b) vitamin D receptor reducing or suppressing muscle protein catabolism due to a ligand and analogues such as calcitriol, topitriol, muscle wasting disorder; and/or treating, preventing, inhib ZK-1501.23, TEI-9647, BXL-628, Ro-26-9228, BAL-2299, iting, reducing or suppressing end stage renal disease; and/or Ro-65-2299 or DP-035; c) estrogen, estrogen derivative, or 6) treating, preventing, inhibiting, reducing or suppressing conjugated estrogens; d) antiestrogen, progestins, or syn fraility. thetic estrogen/progestins; e) RANK ligand mab such as denosumab formerly AMG162 (Amgen); f) ov?ø3 Integrin [0445] In another embodiment, the use of a SARM com receptor antagonist; g) osteoclast vacuolar ATPase inhibitor; pound for treating a subject having a muscle wasting dis h) antagonist of VEGF binding to osteoclast receptors; i.) order, or any of the disorders described herein, includes calcium receptor antagonist; j) PTh (parathyroid hormone) administering a pharmaceutical composition including a and analogues, PTHrP analogues (parathyroid hormone SARM compound as herein described. In another embodi related peptide), k) Cathepsin K inhibitors (AAE581, etc.); ment, the administering step includes intravenously, intraar US 2007/028 1906 A1 Dec. 6, 2007 terially, or intramuscularly injecting to said subject said [0451] In one embodiment, muscle wasting in a subject is pharmaceutical composition in liquid form; subcutaneously a result of the subject having a muscular dystrophie; muscle implanting in said subject a pellet containing said pharma atrophy: X-linked spinal-bulbar muscular atrophy (SBMA). ceutical composition; orally administering to said subject [0452] In some embodiments, muscle loss or muscle wast said pharmaceutical composition in a liquid or solid form; or ing or cachexia in a subject results in reduced protein topically applying to the skin surface of said subject said reserves, decreased strength and functional capacity, frailty, pharmaceutical composition. falls, reduced aerobic capacity, reduced energy requirements [0446] A muscle is a tissue of the body that primarily or increased mortality in patients and the methods of this functions as a source of power. There are three types of invention serve to treat these conditions, as well, in the muscles in the body: a) skeletal muscle—the muscle respon subject, via the administration of any embodiment of a sible for moving extremities and external areas of the SARM and/or composition as described herein. bodies; b) cardiac muscle—the heart muscle; and c) smooth [0453] In some embodiments, muscle loss or muscle wast muscle—the muscle that is in the walls of arteries and ing or cachexia in a subject results in increased dietary bowel. protein needs, inflammation (accelerated muscle protein [0447] A wasting condition or disorder is defined herein as breakdown), loss of motor units (aging CNS), reduced rate a condition or disorder that is characterized, at least in part, of muscle protein synthesis (post-prandial), and/or changing by an abnormal, progressive loss of body, organ or tissue endocrine function (testosterone, estrogen, growth hormone, mass. A wasting condition can occur as a result of a insulin resistance) and the methods of this invention serve to pathology such as, for example, cancer, or an infection, or it treat these conditions, as well, in the subject, via the admin can be due to a physiologic or metabolic state, such as disuse istration of any embodiment of a SARM and/or composition deconditioning that can occur, for example, due to prolonged as described herein. bed rest or when a limb is immobilized, such as in a cast. A wasting condition can also be age associated. The loss of [0454] In some embodiments, this invention provides body mass that occurs during a wasting condition can be methods for the treating of sarcopenia and/or cachexia, via characterized by a loss of total body weight, or a loss of the administration of any embodiment of a compound and/or organ weight such as a loss of bone or muscle mass due to composition as described herein. a decrease in tissue protein. [0455] In some embodiments, treatment with a compound and/or composition as described herein may provide for the [0448] In one embodiment, “muscle wasting” or “muscu increased rate of muscle protein synthesis, increased muscle lar wasting”, used herein interchangeably, refer to the pro size and strength, improved functional status in elderly gressive loss of muscle mass and/or to the progressive people, increased independence for older, frail people, weakening and degeneration of muscles, including the skel increased insulin sensitivity, which in some embodiments is etal or voluntary muscles which control movement, cardiac whereby such administration results in the treatment of muscles which control the heart, and smooth muscles. In one cachexia and/or sarcopenia or other disorders as described embodiment, the muscle wasting condition or disorder is a herein. Muscle is the primary site for glucose metabolism, chronic muscle wasting condition or disorder. “Chronic insulin resistance is largely a problem of resistance of muscle wasting” is defined herein as the chronic (i.e. per muscle to insulin, resulting from increased lipid in muscle sisting over a long period of time) progressive loss of muscle cells, increased total fat, increased visceral fat, with the mass and/or to the chronic progressive weakening and compounds and/or compositions of this invention being degeneration of muscle. useful to reduce total fat, thereby increasing insulin sensi [0449] The loss of muscle mass that occurs during muscle tivity and/or reducing the risk of, or treating, etc., diabetes, wasting can be characterized by a muscle protein breakdown as described herein. or degradation, by muscle protein catabolism. Protein [0456] The muscular dystrophies are genetic diseases catabolism occurs because of an unusually high rate of characterized by progressive weakness and degeneration of protein degradation, an unusually low rate of protein syn the skeletal or voluntary muscles that control movement. thesis, or a combination of both. Protein catabolism or The muscles of the heart and some other involuntary depletion, whether caused by a high degree of protein muscles are also affected in some forms of muscular dys degradation or a low degree of protein synthesis, leads to a trophy. The major forms of muscular dystrophy (MD) are: decrease in muscle mass and to muscle wasting. The term duchenne muscular dystrophy, myotonic dystrophy, duch “catabolism” has its commonly known meaning in the art, enne muscular dystrophy, becker muscular dystrophy, limb specifically an energy burning form of metabolism. girdle muscular dystrophy, facioscapulhumeral muscular [0450] Muscle wasting can occur as a result of a pathol dystrophy, congenital muscular dystrophy, oculopharyngeal ogy, disease, condition or disorder. In one embodiment, the muscular dystrophy, distal muscular dystrophy and emery pathology, illness, disease or condition is chronic. In another dreifuss muscular dystrophy. embodiment, the pathology, illness, disease or condition is genetic. In another embodiment, the pathology, illness, [0457] Muscular dystrophy can affect people of all ages. disease or condition is neurological. In another embodiment, Although some forms first become apparent in infancy or the pathology, illness, disease or condition is infectious. As childhood, others may not appear until middle age or later. described herein, the pathologies, diseases, conditions or Duchenne MD is the most common form, typically affecting disorders for which the compounds and compositions of the children. Myotonic dystrophy is the most common of these present invention are administered are those that directly or diseases in adults. indirectly produce a wasting (i.e. loss) of muscle mass, that [0458] Muscle atrophy (MA) is characterized by wasting is a muscle wasting disorder. away or diminution of muscle and a decrease in muscle US 2007/028 1906 A1 Dec. 6, 2007 36 mass. For example, Post-Polio MA is a muscle wasting that [0467] This invention is directed to treating, in some occurs as part of the post-polio syndrome (PPS). The atro embodiments, any wasting disorder, which may be reflected phy includes weakness, muscle fatigue, and pain. in muscle wasting, weight loss, malnutrition, starvation, or [0459] Another type of MA is X-linked spinal-bulbar any wasting or loss of functioning due to a loss of tissue muscular atrophy (SBMA-also known as Kennedy’s Dis IIläSS. ease). This disease arises from a defect in the androgen [0468] In some embodiments, wasting diseases or disor receptor gene on the X chromosome, affects only males, and ders, such as cachexia; malnutrition, tuberculosis, leprosy, its onset is in adulthood. Because the primary disease cause diabetes, renal disease, chronic obstructive pulmonary dis is an androgen receptor mutation, androgen replacement is ease (COPD), cancer, end stage renal failure, sarcopenia, not a current therapeutic strategy. There are some investi emphysema, osteomalacia, or cardiomyopathy, may be gational studies where exogenous testosterone propionate is treated by the methods of this invention, via the adminis being given to boost the levels of androgen with hopes of tration of a SARM compound as herein described, compo overcoming androgen insensitivity and perhaps provide an sitions comprising the same, with or without additional anabolic effect. Still, use of supraphysiological levels of drugs, compounds, or agents, which provide a therapeutic testosterone for supplementation will have limitations and effect for the condition being treated. other potentially serious complications. [0469] In some embodiments, wasting is due to infection [0460] Sarcopenia is a debilitating disease that afflicts the with enterovirus, Epstein-Barr virus, herpes zoster, HIV, elderly and chronically ill patients and is characterized by trypanosomes, influenze, coxsackie, rickettsia, trichinella, loss of muscle mass and function. Further, increased lean schistosoma or mycobacteria, and this invention, in some body mass is associated with decreased morbidity and embodiments, provides methods of treatment thereof. mortality for certain muscle-wasting disorders. In addition, other circumstances and conditions are linked to, and can [0470] Cachexia is weakness and a loss of weight caused cause muscle wasting disorders. For example, studies have by a disease or as a side effect of illness. Cardiac cachexia, shown that in severe cases of chronic lower back pain, there i.e. a muscle protein wasting of both the cardiac and skeletal is paraspinal muscle wasting. muscle, is a characteristic of congestive heart failure. Cancer cachexia is a syndrome that occurs in patients with solid [0461] Muscle wasting and other tissue wasting is also tumors and hematological malignancies and is manifested associated with advanced age. It is believed that general by weight loss with massive depletion of both adipose tissue weakness in old age is due to muscle wasting. As the body and lean muscle mass. ages, an increasing proportion of skeletal muscle is replaced by fibrous tissue. The result is a significant reduction in [0471] Cachexia is also seen in acquired immunodefi muscle power, performance and endurance. ciency syndrome (AIDS), human immunodeficiency virus (HIV)-associated myopathy and/or muscle weakness/wast [0462] Long term hospitalization due to illness or injury, ing is a relatively common clinical manifestation of AIDS. or disuse deconditioning that occurs, for example, when a Individuals with HIV-associated myopathy or muscle weak limb is immobilized, can also lead to muscle wasting, or ness or wasting typically experience significant weight loss, wasting of other tissue. Studies have shown that in patients generalized or proximal muscle weakness, tenderness, and suffering injuries, chronic illnesses, burns, trauma or cancer, muscle atrophy. who are hospitalized for long periods of time, there is a long-lasting unilateral muscle wasting, and a decrease in [0472] In some embodiments, the present invention pro body mass. vides a method for treating, reducing the incidence, delaying the onset or progression, or reducing and/or abrogating the [0463] Injuries or damage to the central nervous system symptoms associated with an infection in a subject. In one (CNS) are also associated with muscle wasting and other embodiment, the method comprises administering to a sub wasting disorders. Injuries or damage to the CNS can be, for ject a composition comprising a SARM compound and an example, caused by diseases, trauma or chemicals. immunomodulating agent, an anti-infective agent, a gene Examples are central nerve injury or damage, peripheral therapy agent, or a combination thereof. In some embodi nerve injury or damage and spinal cord injury or damage. In ments, infections comprise actinomycosis, anaplasmosis, one embodiment CNS damage or injury comprise Alzhe anthrax, aspergillosis, bacteremia, bacterial mycoses, bar imer’s diseases (AD); anger (mood); anorexia, anorexia tonella infections, botulism, brucellosis, burkholderia infec nervosa, anorexia associated with aging and/or assertiveness tions, campylobacter infections, candidiasis, cat-scratch dis (mood). ease, chlamydia infections, cholera, clostridium infections, [0464] In another embodiment, muscle wasting or other coccidioidomycosis, cross infection, cryptococcosis, der tissue wasting may be a result of alcoholism, and may be matomycoses, diphtheria, ehrlichiosis, Escherichia coli treated with the compounds and compositions of the inven infections, fasciitis, necrotizing, Fusobacterium infections, tion, representing embodiments thereof. gas gangrene, gram-negative bacterial infections, gram positive bacterial infections, histoplasmosis, impetigo, Kleb [0465] In one embodiment, the invention provides a use of siella infections, legionellosis, leprosy, leptospirosis, List SARM compound as described herein or its prodrug, analog, eria infections, lyme disease, maduromycosis, melioidosis, isomer, metabolite, derivative, pharmaceutically acceptable mycobacterium infections, mycoplasma infections, salt, pharmaceutical product, polymorph, crystal, impurity, mycoses, nocardia infections, onychomycosis, plague, pneu N-oxide, hydrate or any combination thereoffor the treat mococcal infections, pseudomonas infections, psittacosis, q ment of a wasting disease, disorder or condition in a subject. fever, rat-bite fever, relapsing fever, rheumatic fever, Rick [0466] In one embodiment, the wasting disease, disorder ettsia infections, rocky mountain spotted fever, salmonella or condition being treated is associated with chronic illness infections, scarlet fever, scrub typhus, sepsis, sexually trans US 2007/028 1906 A1 Dec. 6, 2007 37 mitted diseases, Staphylococcal infections, Streptococcal poland syndrome, polychondritis, relapsing, polymyalgia infections, tetanus, tick-bome diseases, tuberculosis, tulare rheumatica, polymyositis, rhabdomyolysis, rheumatic dis mia, typhoid fever, typhus, louse-bome, vibrio infections, eases, Russell silver syndrome, Scheuermann’s disease, yaws, yersinia infections, zoonoses, zygomycosis, acquired scoliosis, Sever’s disease/calceneal apophysitis, spinal dis immunodeficiency syndrome, adenoviridae infections, eases, spinal osteophytosis, spinal stenosis, spondylitis, alphavirus infections, arbovirus infections, boma disease, ankylosing, spondylolisthesis, sprengel’s deformity, synovi bunyaviridae infections, caliciviridae infections, chicken tis, tendinopathy, tennis elbow, tenosynovitis, thanatophoric pox, coronaviridae infections, coxsackievirus infections, dysplasia, or Tietze’s syndrome. cytomegalovirus infections, dengue, DNA virus infections, [0474] In some embodiments, the present invention pro ecthyma, contagious, encephalitis, arbovirus, Epstein-barr vides a method for treating, reducing the incidence, delaying virus infections, erythema infectiosum, hantavirus infec the onset or progression, or reducing and/or abrogating the tions, hemorrhagic fevers, viral hepatitis, viral human herpes symptoms associated with a digestive system disease in a simplex, herpes zoster, herpes zoster oticus, herpesviridae subject. In one embodiment, the method comprises admin infections, infectious mononucleosis, human-lassa fever, istering to a subject a composition comprising a SARM measles, molluscum, contagiosum, mumps, paramyxoviri compound and an anti-cancer agent, an immunomodulating dae infections, phlebotomus fever, polyomavirus infections, agent, an antidiabetic agent, an agent treating the central rabies, respiratory syncytial virus infections, rift valley nervous system, an agent treating the gastrointestinal sys fever, RNA virus infections, rubella, slow virus diseases, tem, an anti-infective agent, an agent treating a metabolic smallpox, subacute sclerosing panencephalitis, tumor virus disease, a gene therapy agent, an agent treating the endo infections, warts, west mile fever, virus diseases, yellow crine system, vitamins, or a combination thereof. In some fever, amebiasis, anisakiasis, ascariasis, babesiosis, blasto embodiments, gastrointestinal diseases comprise adenoma cystis hominis infections, bug bite, cestode infections, cha tous polyposis coli, Alagille syndrome, anus diseases, gas disease, cryptosporidiosis, cyclosporiasis, cysticercosis, appendicitis, barrett esophagus, biliary atresia, biliary tract dientamoebiasis, diphyllobothriasis, dracunculiasis, echino diseases, Caroli disease, celiac disease, cholangitis, chole coccosis, ectoparasitic infestations, filariasis, giardiasis, hel cystitis, cholelithiasis, colitis, ulcerative, Crohn’s disease, minthiasis, hookworm infections, larva migrans, leishma deglutition disorders, duodenal ulcer, dysentery, enterocoli niasis, lice infestations, loiasis, malaria, mite infestations, tis, pseudomembranous, esophageal achalasia, esophageal myiasis, onchocerciasis, protozoan infections, scabies, atresia, esophagitis, exocrine pancreatic insufficiency, fatty schistosomiasis, skin diseases, parasitic, strongyloidiasis, liver, fecal incontinence, gastritis, gastritis, hypertrophic, taeniasis, toxocariasis, toxoplasmosis, trichinosis, trichomo gastroenteritis, gastroesophageal reflux, gastroparesis, hem nas infections, trypanosomiasis, trypanosomiasis, african, or orrhoids, hepatic vein thrombosis, hepatitis, hepatitis, whipworm infections. chronic, hernia, diaphragmatic, hernia, hiatal, Hirschsprung [0473] In some embodiments, the present invention pro disease, hypertension, portal, inflammatory bowel diseases, vides a method for treating, reducing the incidence, delaying intestinal diseases, intestinal neoplasms, intestinal neuronal the onset or progression, or reducing and/or abrogating the dysplasia, intestinal obstruction, irritable bowel syndrome, symptoms associated with a musculoskeletal disease in a lactose intolerance, liver cirrhosis, liver diseases, meckel subject. In one embodiment, the method comprises admin diverticulum, pancreatic diseases, pancreatic neoplasms, istering to a subject a composition comprising a SARM pancreatitis, peptic ulcer, Peutz-Jeghers syndrome, proctitis, compound and an anti-cancer agent, an immunomodulating rectal diseases, rectal prolapse, short bowel syndrome, tra agent, an antidiabetic agent, an agent treating the central cheoesophageal fistula, whipple disease, or Zollinger-Elli nervous system, an agent treating a metabolic disease, an son syndrome. agent treating a wasting disease, a gene therapy agent, an [0475] In some embodiments, the present invention pro agent treating the endocrine system, vitamins, or a combi vides a method for treating, reducing the incidence, delaying nation thereof. In some embodiments, musculoskeletal dis the onset or progression, or reducing and/or abrogating the eases comprise achondroplasia, acquired hyperostosis syn symptoms associated with a stomatognathic disease in a drome, acrocephalosyndactylia, arthritis, arthrogryposis, subject. In one embodiment, the method comprises admin arthropathy, neurogenic bursitis, cartilage diseases, cleidoc istering to a subject a composition comprising a SARM ranial dysplasia, clubfoot, compartment syndromes, cranio compound and an anti-cancer agent, an immunomodulating facial dysostosis, craniosynostoses, dermatomyositis, agent, an anti-infective agent, an agent treating a wasting Dupuytren’s contracture, dwarfism, Ellis Van Creveld syn disease, a gene therapy agent, an agent treating the endo drome, enchondromatosis, eosinophilia-myalgia syndrome, crine system, vitamins, or a combination thereof. In some exostoses, fasciitis, fatigue syndrome, fibromyalgia, fibrous embodiments, stomatognathic diseases comprise ankyloglo dysplasia of bone, fibrous dysplasia, polyostotic, flatfoot, ssia, bruxism, burning mouth syndrome, cheilitis, foot deformities, Freiberg’s disease, funnel chest, Goldenhar cherubism, cleft lip, dentigerous cyst, gingivitis, glossitis, syndrome, gout, hallux valgus, hip dislocation, hyperostosis, benign migratory, herpes labialis, Ludwig’s angina, macro intervertebral disk displacement, kabuki make-up syndrome, glossia, Melkersson-Rosenthal syndrome, periodontal dis Klippel-Feil syndrome, Langer-Giedion syndrome, Legg eases, Pierre Robin syndrome, prognathism, salivary gland Perthes disease, lordosis, mandibulofacial dysostosis, melorheostosis, mitochondrial myopathies, muscle cramp, diseases, sialorrhea, stomatitis, aphthous, temporomandibu muscle spasticity, muscular dystrophies, musculoskeletal lar joint disorders, temporomandibular joint dysfunction abnormalities, musculoskeletal diseases, myositis, myositis syndrome, or xerostomia. ossificans, myotubular myopathy, osteitis deformans, [0476] In some embodiments, the present invention pro osteoarthritis, osteochondritis, osteogenesis imperfecta, vides a method for treating, reducing the incidence, delaying osteomyelitis, osteonecrosis, osteopetrosis, osteoporosis, the onset or progression, or reducing and/or abrogating the US 2007/028 1906 A1 Dec. 6, 2007 symptoms associated with a respiratory tract disease in a [0480] In some embodiments, central nervous system dis subject. In one embodiment, the method comprises admin eases comprise Alzheimer’s disease, arachnoiditis, brain istering to a subject a composition comprising a SARM abscess, brain ischemia, central nervous system infections, compound and an anti-cancer agent, an immunomodulating cerebral palsy, cerebrovascular disorders, corticobasal gan agent, an agent treating the central nervous system, an agent glionic degeneration (CBGD), Creutzfeldt-Jakob syndrome, treating the cardiovascular system, an anti-infective agent, Dandy-Walker syndrome, dementia, encephalitis, encepha an agent treating a wasting disease, a gene therapy agent, an lomyelitis, epilepsy, epilepsy induced hypogonadal and/or agent treating the endocrine system, vitamins, or a combi hypermetabolic state, essential tremor, Friedreich ataxia, nation thereof. In some embodiments, respiratory tract dis Gerstmann-Straussler-Scheinker disease, Hallervorden eases comprise airway obstruction, apnea, asbestosis, Spatz syndrome, Huntington disease, hydrocephalus, asthma, atelectasis, berylliosis, bronchial diseases, bron hypoxia, insomnia, ischemic attack, kuru, Landau-Kleffner chiectasis, bronchiolitis, bronchiolitis obliterans organizing syndrome, Lewy Body disease, Machado-Joseph disease, pneumonia, bronchitis, bronchopulmonary dysplasia, com meige syndrome, meningitis, bacterial meningitis, viral, mon cold, cough, empyema, pleural, epiglottitis, hemopty migraine disorders, movement disorders, multiple system sis, hypertension, pulmonary, hyperventilation, Kartagener atrophy, myelitis, olivopontocerebellar atrophies, Parkin syndrome, lung abscess, lung diseases, meconium aspiration son’s disease, parkinsonian disorders, poliomyelitis, post syndrome, pleural effusion, pleurisy, pneumonia, pneu poliomyelitis syndrome, prion diseases, pseudotumor cere mothorax, pulmonary alveolar proteinosis, pulmonary dis bri, Shy-Drager syndrome, spasms, infantile, spinal cord ease, chronic obstructive, pulmonary edema, pulmonary diseases, supranuclear palsy, syringomyelia, thalamic dis embolism, pulmonary emphysema, pulmonary fibrosis, res eases, tic disorders, tourette syndrome, or uveomeningoen piratory distress syndrome, newborn-espiratory hypersensi cephalitic syndrome. In some embodiments, the central tivity, respiratory tract infections, rhinoscleroma, scimitar nervous system disease is cystic fibrosis induced hypogo syndrome, severe acute respiratory syndrome, silicosis, nadal state. sleep apnea, central stridor, tracheal stenosis, Wegener’s granulomatosis, or whooping cough. [0481] In some embodiments, cranial nerve diseases com prise bell palsy, cranial nerve diseases, facial hemiatrophy, [0477] In some embodiments, the present invention pro facial neuralgia, glossopharyngeal nerve diseases, Moebius vides a method for treating, reducing the incidence, delaying syndrome, or trigeminal neuralgia. the onset or progression, or reducing and/or abrogating the symptoms associated with an otorhinolaryngologic disease [0482] In some embodiments, central nervous system dis in a subject. In one embodiment, the method comprises eases comprise injuries or damage to the central nervous administering to a subject a composition comprising a system (CNS). In some embodiments, injuries or damage to SARM compound and an anti-cancer agent, an immuno the CNS may be associated with muscle wasting disorders. modulating agent, an anti-infective agent, an agent treating Injuries or damage to the CNS can be, for example, caused a wasting disease, a gene therapy agent, an agent treating the by diseases, trauma or chemicals. Examples are central endocrine system, vitamins, or a combination thereof. In nerve injury or damage, peripheral nerve injury or damage some embodiments, otorhinolaryngologic diseases comprise and spinal cord injury or damage. cholesteatoma, middle ear, croup, deafness, epistaxis, hear [0483] Studies involving patients with spinal cord injuries ing loss, hyperacusis, labyrinthitis, laryngitis, laryngomala (SCI) have shown that central neurotransmitters may be cia, laryngostenosis, mastoiditis, Meniere’s disease, nasal altered after SCI causing hypothalamus-pituitary-adrenal obstruction, nasal polyps, otitis, otorhinolaryngologic dis axis dysfunction, whose disruption led to a significant eases, otosclerosis, pharyngitis, presbycusis, retropharyn decrease in testosterone and other hormone levels. SCI or geal abscess, rhinitis, sinusitis, tinnitus, tonsillitis, tympanic other acute illness or trauma characteristically includes membrane perforation, vestibular neuronitis, vocal cord heightened catabolism in conjunction with the lowered paralysis, or voice disorders. anabolic activity resulting in a condition that is prone to loss [0478] In some embodiments, the present invention pro of lean body tissue, which is often accompanied by disturbed vides a method for treating, reducing the incidence, delaying nutrient utilization. The effects of the loss of lean body mass the onset or progression, or reducing and/or abrogating the include the development of wounds and impaired healing symptoms associated with a nervous system disease in a mechanisms, further compounding the problem. Because of subject. In one embodiment, the method comprises admin poor nutrition and protein combined with immobilization, istering to a subject a composition comprising a SARM patients with spinal cord injury are at high risk for bed sores. compound and an anti-cancer agent, an immunomodulating agent, an agent treating the central nervous system, an [0484] In one embodiment, a wide variety of injuries of anti-infective agent, an agent treating a metabolic disease, an the CNS may be treated by the methods of the present agent treating a wasting disease, a gene therapy agent, an invention. CNS injury may refer, in one embodiment, to a breakdown of the membrane of a nerve cell, or, in another agent treating the endocrine system, vitamins, or a combi embodiment, to the inability of the nerve to produce and nation thereof. In some embodiments, nervous system dis propagate nerve impulses, or in another embodiment, to the eases comprise autonomic nervous system diseases, central death of the cell. An injury includes damage that directly or nervous system diseases, cranial nerve diseases, demyeli indirectly affects the normal functioning of the CNS. The nating diseases, nervous system malformations, neurologic injury may be a structural, physical, or mechanical impair manifestations, or neuromuscular diseases. ment and may be caused by physical impact, as in the case [0479] In some embodiments, autonomic nervous system of a crushing, compression, or stretching of nerve fibers. diseases comprise causalgia, or reflex sympathetic dystro Alternatively, the cell membrane may be destroyed by or phy. degraded by an illness, a chemical imbalance, or a physi US 2007/028 1906 A1 Dec. 6, 2007 39 ological malfunction such as anoxia (e.g., stroke), aneurysm, secondary conditions in the subject, which arise due to the or reperfusion. A CNS injury includes, for example and subject having a nervous system disease, some of which are without limitation, damage to retinal ganglion cells, a trau described herein. matic brain injury, a stroke-related injury, a cerebral aneur [0492] In some embodiments, the present invention pro ism-related injury, a spinal cord injury, including monople vides a method for treating, reducing the incidence, delaying gia, diplegia, paraplegia, hemiplegia and quadriplegia, a the onset or progression, or reducing and/or abrogating the neuroproliferative disorder, or neuropathic pain syndrome. symptoms associated with an ophthalmic disease in a sub [0485] With injury to the spinal cord of a mammal, con ject. In one embodiment, the method comprises administer nections between nerves in the spinal cord are broken. Such ing to a subject a composition comprising a SARM com injuries block the flow of nerve impulses for the nerve tracts pound and an anti-cancer agent, an immunomodulating affected by the injury, with a resulting impairment to both agent, an agent treating the cardiovascular system, an anti sensory and motor function. Injuries to the spinal cord may infective agent, an agent treating a wasting disease, a gene arise from compression or other contusion of the spinal cord, therapy agent, an agent treating the endocrine system, vita or a crushing or severing of the spinal cord. A severing of the mins, or a combination thereof. In some embodiments spinal cord, also referred to herein as a “transection,” may be ophthalmic disease comprise acute zonal occult outer retin a complete severing or, may be an incomplete severing of opathy, Adie syndrome, albinism, ocular-amaurosis, fugax, the spinal cord. amblyopia, aniridia, anisocoria, anophthalmos, aphakia, astigmatism, blepharitis, blepharoptosis, blepharospasm, [0486] In some embodiments, the methods of treating a blindness, cataract, chalazion, chorioretinitis, choroider subject suffering form a CNS injury or, in other embodi emia, coloboma, color vision defects, conjunctivitis, comeal ments, spinal cord injury, may be accompanied by treatment diseases, comeal dystrophies, comeal edema, comeal ulcer, of the subject with electrical stimulation of the injured site diabetic retinopathy, diplopia, distichiasis, dry eye syn and the administration of a purine nucleoside, or analog dromes, Duane retraction syndrome, ectropion, entropion, thereof, for example as described in United States Patent esotropia, exfoliation syndrome, exotropia, eye hemorrhage, Application Publication Number 20040214790A1. eye neoplasms, eyelid diseases, floaters, general fibrosis [0487] In some embodiments, demyelinating diseases syndrome, glaucoma, gyrate atrophy, hemianopsia, Herman comprise adrenoleukodystrophy, alexander disease, canavan ski-Pudlak syndrome, hordeolum, Homer syndrome, disease, demyelinating disease, diffuse cerebral sclerosis of hyperopia, hyphema, iritis, Kearns-Sayer syndrome, kerati schilder, leukodystrophy-globoid cell, leukodystrophy tis, keratoconus, lacrimal apparatus diseases, lacrimal duct metachromatic, multiple sclerosis, or neuromyelitis optica. obstruction, lens diseases, macular degeneration, microphthalmos, myopia, nystagmus, pathologic, ocular [0488] In some embodiments, nervous system malforma motility disorders, oculomotor nerve diseases, ophthal tions comprise Arnold-Chiari malformation, Charcot-Marie moplegia, optic atrophies, optic nerve diseases, optic neu Tooth disease, encephalocele, hereditary motor and sensory ritis, optic neuropathy, orbital cellulitis, papilledema, peter’s neuropathies, septo-optic dysplasia, spina bifida occulta, or anomaly, presbyopia, pterygium, pupil disorders, refractive spinal dysraphism. errors, retinal detachment, retinal diseases, retinal vein [0489] In some embodiments, neurologic manifestations occlusion, retinitis pigmentosa, retinopathy of prematurity, comprise agnosia, amnesia, anomia, aphasia, apraxias, back retinoschisis, scleritis, scotoma, strabismus, Thygeson’s pain, Brown-Sequard syndrome, cerebellar ataxia, chorea, superficial punctate keratitis, trachoma, uveitis, white dot communication disorders, confusion, dizziness, dyslexia, syndrome, vision disorders, or vitreous disorders dystonia, facial paralysis, fasciculation, gait disorders, neu [0493] In some embodiments, the present invention pro rologic-headache, hemiplegia, memory disorders, mental vides a method for treating, reducing the incidence, delaying retardation, mutism, myoclonus, neck pain, nonverbal leam the onset or progression, or reducing and/or abrogating the ing disorder, olfaction disorders, pain, paralysis, phantom symptoms associated with an urologic and/or male genital limb, prosopagnosia, quadriplegia, seizures, spasm, speech disease in a subject. In one embodiment, the method com disorders, synesthesia tardive dyskinesia, taste disorders, prises administering to a subject a composition comprising torticollis, tremor, trismus, unconsciousness, or vertigo. a SARM compound and an anti-cancer agent, an immuno [0490] In some embodiments, neuromuscular diseases modulating agent, an antidiabetic agent, an agent treating the comprise amyotrophic lateral sclerosis, brachial plexus neu gastrointestinal system, an anti-infective agent, an agent ritis, brachial plexus neuropathies, bulbar palsy, carpal tun treating the kidney, an agent treating a metabolic disease, an nel syndrome, cubital tunnel syndrome, diabetic neuropa agent treating a wasting disease, a gene therapy agent, an thies, dysautonomia, guillain,barre syndrome, hereditary agent treating the endocrine system, vitamins, or a combi nation thereof. In some embodiments, an urologic and/or sensory and autonomic neuropathies, miller fisher syn male genital diseases comprise anti-glomerular basement drome, motor neuron disease, muscular atrophy, spinal, membrane disease, balanitis, bladder exstrophy, bladder myasthenia gravis, myopathies, structural, congenital, nerve neoplasms, cryptorchidism, cystitis, interstitial, diabetes compression syndromes, neuralgia, neuromuscular diseases, insipidus, nephrogenic, epididymitis, fournier gangrene, paralyses, familial periodic, peripheral nervous system dis glomerulonephritis, Goodpasture syndrome, hematosper eases, poems syndrome, polyneuropathies, polyradiculopa mia, hematuria, hemolytic-uremic syndrome, hydronephro thy, refsum disease, sciatica, spinal muscular atrophies of sis, hypospadias, impotence, infertility, kidney calculi, kid childhood, stiff-person syndrome, thoracic outlet syndrome, ney failure, acute, kidney failure, chronic, kidney tubular or ulnar nerve compression syndromes. necrosis, acute, medullary sponge kidney, multicystic dys [0491] In one embodiment, methods of treating a subject plastic kidney, nephritis, hereditary, nephrosis, nephrotic with a nervous system disease encompass treating any syndrome, nocturia, oliguria, penile diseases, penile indu US 2007/028 1906 A1 Dec. 6, 2007 40 ration, penile neoplasms, phimosis, priapism, prostatic dis any healing has initiated or even before a specific wound like eases, benign prostate hyperplasia, prostatic neoplasms, a surgical incision is made (prophylactic treatment). proteinuria, pyelonephritis, Reiter disease, renal artery [0496] Examples of wounds which can be prevented and/ obstruction, spermatic cord torsion, testicular diseases, ure or treated in accordance with the present invention are, e.g., thral stricture, urethritis, urinary retention, urinary tract aseptic wounds, contused wounds, incised wounds, lacer infections, urination disorders, urologic and male genital ated wounds, non-penetrating wounds (i.e. wounds in which diseases, urologic diseases, varicocele, vesico, or urethral there is no disruption of the skin but there is injury to reflux. underlying structures), open wounds, penetrating wounds, [0494] In some embodiments, the present invention pro perforating wounds, puncture wounds, septic wounds, sub vides a method for treating, reducing the incidence, delaying cutaneous wounds, etc. Examples of sores are bed sores, the onset or progression, or reducing and/or abrogating the canker sores, chrome sores, cold sores, pressure sores etc. symptoms associated with a dermatological disorder in a Examples of ulcers are, e.g., peptic ulcer, duodenal ulcer, subject. In one embodiment, the method comprises admin gastric ulcer, gouty ulcer, diabetic ulcer, hypertensive istering to a subject a composition comprising a SARM ischemic ulcer, stasis ulcer, ulcus cruris (venous ulcer), compound and anti-cancer agent, an immunomodulating sublingual ulcer, submucous ulcer, symptomatic ulcer, agent, an agent treating a dermatological disorder, an anti trophic ulcer, tropical ulcer, veneral ulcer, e.g. caused by infective agent, a gene therapy agent, an agent treating the gonorrhoea (including urethritis, endocervicitis and procti endocrine system, vitamins, or a combination thereof. In tis). Conditions related to wounds or sores which may be some embodiments, dermatological disorders comprise successfully treated according to the invention are burns, acne, actinic keratosis, alopecia, androgenic alopecia, alope anthrax, tetanus, gas gangrene, scalatina, erysipelas, sycosis cia areata, alopecia secondary to chemotherapy, alopecia barbae, folliculitis, impetigo contagiosa, or impetigo secondary to radiation therapy, alopecia induced by scarring, bullosa, etc. There is often a certain overlap between the use alopecia induced by stress, angioma, athlete’s foot, of the terms “wound” and “ulcer” and “wound” and “sore” aquagenic pruritus, atopic dermatitis, baldness, basal cell and, furthermore, the terms are often used at random. carcinoma, bed sore, Behcet’s disease, blepharitis, boil, Therefore as mentioned above, in the present context the Bowen’s disease, bullous pemphigoid, canker sore, car term “wounds” encompasses the term “ulcer”, “lesion”, buncles, cellulitis, chloracne, chronic dermatitis of the hands “sore” and “infarction”, and the terms are indiscriminately and feet, dyshidrosis, cold sores, contact dermatitis, creeping used unless otherwise indicated. eruption, dandruff, dermatitis, dermatitis herpetiformis, der [0497] The kinds of wounds to be treated according to the matofibroma, diaper rash, eczema, epidermolysis bullosa, invention include also i) general wounds such as, e.g., erysipelas, erythroderma, friction blister, genital wart, surgical, traumatic, infectious, ischemic, thermal, chemical hidradenitis, suppurativa, hives, hyperhidrosis, ichthyosis, and bullous wounds; ii) wounds specific for the oral cavity impetigo, jock itch, Kaposi’s sarcoma, keloid, keratoacan such as, e.g., post-extraction wounds, endodontic wounds thoma, keratosis pilaris, lice infection, lichen planus, lichen especially in connection with treatment of cysts and simplex chronicus, lipoma, lymphadenitis, malignant mela abscesses, ulcers and lesions of bacterial, viral or autoim noma, melasma, miliaria, molluscum contagiosum, nummu munological origin, mechanical, chemical, thermal, infec lar dermatitis, paget’s disease of the nipple, pediculosis, tious and lichenoid wounds; herpes ulcers, stomatitis aph pemphigus, perioral dermatitis, photoallergy, photosensitiv thosa, acute necrotising ulcerative gingivitis and burning ity, pityriasis rosea, pityriasis rubra pilaris, psoriasis, mouth syndrome are specific examples; and iii) wounds on raynaud’s disease, ring worm, rosacea, scabies, scleroderma, the skin such as, e.g., neoplasm, burns (e.g. chemical, sebaceous cyst, seborrheic keratosis, seborrhoeic dermatitis, thermal), lesions (bacterial, viral, autoimmunological), bites shingles, skin cancer, skin tags, spider veins, squamous cell and surgical incisions. Another way of classifying wounds is carcinoma, stasis dermatitis, tick bite, tinea barbae, tinea as i) small tissue loss due to surgical incisions, minor capitis, tinea corporis, tinea cruris, tinea pedis, tinea abrasions and minor bites, or as ii) significant tissue loss. unguium, tinea versicolor, tinea, tungiasis, vitiligo, or warts. The latter group includes ischemic ulcers, pressure sores, [0495] In one embodiment, the dermatological disorder is fistulae, lacerations, severe bites, thermal burns and donor a wound or a burn. In some embodiments, wounds and/or site wounds (in soft and hard tissues) and infarctions. ulcers are found protruding from the skin or on a mucosal [0498] In other aspects of the invention, the wound to be surface or as a result of an infarction in an organ. A wound prevented and/or treated is selected from the group consist may be a result of a soft tissue defect or a lesion or of an ing of aseptic wounds, infarctions, contused wounds, incised underlying condition. In one embodiment, the term “wound” wounds, lacerated wounds, non-penetrating wounds, open denotes a bodily injury with disruption of the normal integ wounds, penetrating wounds, perforating wounds, puncture rity of tissue structures. The term is also intended to encom wounds, septic wounds and subcutaneous wounds. pass the terms “sore”, “lesion”, “necrosis” and “ulcer”. In one embodiment, the term “sore” refers to any lesion of the [0499] Other wounds which are of importance in connec skin or mucous membranes and the term “ulcer” refers to a tion with the present invention are wounds like ischemic local defect, or excavation, of the surface of an organ or ulcers, pressure sores, fistulae, severe bites, thermal burns tissue, which is produced by the sloughing of necrotic tissue. and donor site wounds. Lesion generally relates to any tissue defect. Necrosis is [0500] In one embodiment, the use of the SARM com related to dead tissue resulting from infection, injury, pounds as described herein and/or compositions are useful in inflammation or infarctions. All of these are encompassed by wound healing as an adjunct to physical therapy/rehabilita the term “wound”, which denotes any wound at any par tion, as an anabolic agent. In another embodiment, the ticular stage in the healing process including the stage before compositions as described herein are useful in promoting US 2007/028 1906 A1 Dec. 6, 2007

healing of anterior cruciate ligament (ACL) or medial cru symptoms associated with an endocrine disorder in a sub ciate ligament (MCL) injuries, or accelerating recovery after ject. In one embodiment, the method comprises administer ACL or MCL surgery. In another embodiment, the conipo ing to a subject a composition comprising a SARM com sitions as described herein are useful in enhancing athletic pound and anti-cancer agent, an immunomodulating agent, performance. In another embodiment, the compositions as an antidiabetic agent, an agent treating the cardiovascular described herein are useful in treating burns. In another system, an agent treating the gastrointestinal system, an embodiment, the compositions as described herein are use agent treating a dermatological disorder, an agent treating ful in stimulating cartilage regrowth. In another embodi the central nervous system, an anti-infective agent, an agent ment, the compositions as described herein are useful in treating the liver, an agent treating the kidney, an agent preventing, treating, or reversing of catabolism associated treating a metabolic disease, an agent treating a wasting with prolonged critical illness, pulmonary dysfunction, ven disease, a gene therapy agent, an agent treating the endo tilator dependency, aging, AIDS, trauma, surgery, conges crine system, vitamins, or a combination thereof. In some tive heart failure, cardiac myopathy, burns, cancer, COPD. embodiments, endocrine disorders comprise acromegaly, In another embodiment, the compositions as described Addison disease, adrenal gland diseases, adrenal hyperpla herein are useful in preventing or reversing protein catabo sia, congenital, androgen-insensitivity syndrome, congenital lism due to trauma. In another embodiment, the composi hypothyroidism, Cushing syndrome, diabetes insipidus, dia tions as described herein are useful as a) adjunct to cauter betes mellitus, diabetes mellitus-type 1, diabetes mellitus ization therapy (laser or radio) as is used in surgery to type 2, diabetic, ketoacidosis, empty Sella syndrome, endo promote wound healing, b) adjunct to cryotherapy to pro crine gland neoplasms, endocrine system diseases, mote wound healing, c) adjunct to chemotherapy to prevent gigantism, gonadal disorders, graves disease, hermaphrodit side effects such as alopecia, hypogonadism, muscle wast ism, hyperaldosteronism, hyperglycemic hyperosmolar non ing, osteopenia, osteoporosis, sarcopenia, increased IDL, ketotic coma, hyperpituitarism, hyperprolactinemia, hyper TG or total cholesterol, decreased HDL. In another embodi thyroidism, hypogonadism, hypopituitarism, ment, the compositions as described herein are useful in hypothyroidism, Kallmann syndrome, Nelson syndrome, chronic catabolic state (coma, wasting conditions, starva parathyroid diseases, pituitary diseases, polyendocrinopa tion, eating disorders); concomitant bone fracture and thies, autoimmune, puberty, delayed, puberty, precocious, muscle damage; critical illness in which muscle or bone renal osteodystrophy, thyroid diseases, thyroid hormone wasting are apparent; and/or connective tissue diseases and resistance syndrome, thyroid neoplasms, thyroid nodule, disorders thyroiditis, thyroiditis, autoimmune, thyroiditis, subacute, or Wolfram syndrome. [0501] Ischemic ulcers and pressure sores are wounds, which normally only heal very slowly and especially in such [0507] In one embodiment, “Hypogonadism” is a condi cases an improved and more rapid healing is of course of tion resulting from or characterised by abnormally decreased great importance for the patient. Furthermore, the costs functional activity of the gonads, with retardation of growth involved in the treatment of patients suffering from such and sexual development. wounds are markedly reduced when the healing is improved [0508] In some embodiments, the present invention pro and takes place more rapidly. vides a method for treating, reducing the incidence, delaying [0502.] Donor site wounds are wounds which e.g. occur in the onset or progression, or reducing and/or abrogating the connection with removal of hard tissue from one part of the symptoms associated with urogenital disease and/or fertility body to another part of the body e.g. in connection with in a subject. In one embodiment, the method comprises transplantation. The wounds resulting from such operations administering to a subject a composition comprising a are very painful and an improved healing is therefore most SARM compound and anti-cancer agent, an immunomodu valuable. lating agent, an anti-infective agent, an agent treating the kidney, gene therapy agent, an agent treating the endocrine [0503] The term “skin” is used in a very broad sense system, vitamins, or a combination thereof. In some embodi embracing the epidermal layer of the skin and in those cases ments, urogenital diseases and/or fertility diseases comprise where the skin surface is more or less injured also the dermal abortion, spontaneous-adhesions-pelvic, candidiasis, vul layer of the skin. Apart from the stratum comeum, the vovaginal, depression-postpartum, diabetes, gestational, epidermal layer of the skin is the outer (epithelial) layer and dyspareunia, dystocia, eclampsia, endometriosis, fetal death, the deeper connective tissue layer of the skin is called the fetal growth retardation, fetal membranes, premature rup dermis. ture, genital diseases, female, genital neoplasms, female, hydatidiform mole, hyperemesis gravidarum, infertility, [0504] In some embodiments, the present invention pro ovarian cysts, ovarian torsion, pelvic inflammatory disease, vides a method for promoting healing of anterior cruciate placenta diseases, placental insufficiency, polycystic ovary ligament (ACL) or medial cruciate ligament (MCL) injuries, syndrome, polyhydramnios, postpartum hemorrhage, preg or accelerating recovery after ACL or MCL surgery. nancy complications, pregnancy, ectopic, pruritus vulvae, [0505] In some embodiments, burns are associated with puerperal disorders, puerperal infection, salpingitis, tropho reduced testosterone levels, and hypgonadism is associated blastic neoplasms, uterine cervix incompetence, uterine with delayed wound healing. In one embodiment, the meth inversion, uterine prolapse, vaginal diseases, vulvar dis ods of this invention, provide for treating a subject suffering eases, vulvar lichen sclerosis. from a wound or a burn. [0509] In some embodiments, the present invention pro [0506] In some embodiments, the present invention pro vides a method for treating, reducing the incidence, delaying vides a method for treating, reducing the incidence, delaying the onset or progression, or reducing and/or abrogating the the onset or progression, or reducing and/or abrogating the symptoms associated with hemic and/or lymphatic disease US 2007/028 1906 A1 Dec. 6, 2007 42 in a subject. In one embodiment, the method comprises genetic diseases, inborn, hernia, umbilical, holoprosenceph administering to a subject a composition comprising a aly, incontinentia pigmenti, Ivemark syndrome, Jacobsen SARM compound and an anti-cancer agent, an immuno syndrome, jaundice, Klinefelter syndrome, Larsen syn modulating agent, an antidiabetic agent, an agent treating the drome, Laurence-moon syndrome, lissencephaly, micro cardiovascular system, an anti-infective agent, an agent cephaly, monosomy 9p, nail-patella syndrome, neurofibro treating the liver, an agent treating the kidney, an agent matoses, neuronal ceroid-lipofuscinosis, Noonan syndrome, treating a metabolic disease, a gene therapy agent, an agent ochoa syndrome (urofacial syndrome, hydronephrosis with treating the endocrine system, vitamins, or a combination peculiar facial expression), oculocerebrorenal syndrome, thereof. In some embodiments, hemic and/or lymphatic Pallister-Killian syndrome, Prader-Willi syndrome, proteus diseases comprise afibrinogenenmia, anemia, aplastic ane syndrome, prune belly syndrome, Rett syndrome, Robinow mia, hemolytic anemia, congenital nonspherocytic anemia, syndrome, Rubinstein-Taybi syndrome, schizencephaly, megaloblastic anemia, pernicious anemia, sickle cell ane situs inversus, Smith-Lemli-Opitz syndrome, Smith-Mage mia, angiolymphoid hyperplasia with eosinophilia, anti nis syndrome, Sturge-Weber syndrome, syphilis, congenital, thrombin III deficiency, Bernard-Soulier syndrome, blood trichothiodystrophy, triple-x females, trisomy 13 (Patau syn coagulation disorders, blood platelet disorders, blue rubber drome), trisomy 9, turner syndrome, twins, conjoined, Usher bleb nevus syndrome, Chediak-Higashi syndrome, cryoglo syndrome, Waardenburg’s syndrome, Werner syndrome, or bulinemia, disseminated intravascular coagulation, eosino Wolf-Hirschhom syndrome. philia, Erdheim-Chester disease, erythroblastosis, fetal, [0511] In some embodiments, the present invention pro evans syndrome, factor V deficiency, factor VII deficiency, vides a method for treating, reducing the incidence, delaying factor X deficiency, factor XI deficiency, factor XII defi the onset or progression, or reducing and/or abrogating the ciency, fanconi anemia, giant lymph node hyperplasia, symptoms associated with a connective tissue disease in a hematologic diseases, hemoglobinopathies, hemoglobin subject. In one embodiment, the method comprises admin uria, paroxysmal, hemophilia a, hemophilia b, hemorrhagic istering to a subject a composition comprising a SARM disease of newborn, histiocytosis, histiocytosis, langerhans compound and anti-cancer agent, an immunomodulating cell, histiocytosis, non-langerhans-cell, job’s syndrome, leu agent, an agent treating a dermatological disorder, an anti kopenia, lymphadenitis, lymphangioleiomyomatosis, infective agent, an agent treating a metabolic disease, an lymphedema, methemoglobinemia, myelodysplastic syn agent treating a wasting disease, a gene therapy agent, an dromes, myelofibrosis, myeloid metaplasia, myeloprolifera agent treating the endocrine system, vitamins, or a combi tive disorders, neutropenia, paraproteinemias, platelet stor nation thereof. In some embodiments, connective tissue age pool deficiency, polycythemia vera, protein c deficiency, diseases comprise ankylosing spondylitis, Ehlers-Danlos protein s deficiency, purpura, thrombocytopenic, purpura, syndrome, Henoch-Schonlein purpura, Kawasaki disease, thrombotic thrombocytopenic, RH-isoimmunization, sarcoi Marfan syndrome, polyarteritis nodosa, polymyositis, pso dosis, sarcoidosis, spherocytosis, splenic rupture, thalas riatic arthritis, reactive arthritis, rheumatoid arthritis, scle semia, thrombasthenia, thrombocytopenia, Waldenstrom roderma, Sjogren’s syndrome, Still’s disease, systemic lupus macroglobulinemia, or Von Willebrand disease. erythematosus, Takayasu disease, or Wegener’s granuloma [0510] In some embodiments, the present invention pro tosis. vides a method for treating, reducing the incidence, delaying [0512] In some embodiments, the present invention pro the onset or progression, or reducing and/or abrogating the vides a method for treating, reducing the incidence, delaying symptoms associated with a congenital, hereditary, or neo the onset or progression, or reducing and/or abrogating the natal disease in a subject. In one embodiment, the method symptoms associated with a metabolic disease in a subject. comprises administering to a subject a composition com In one embodiment, the method comprises administering to prising a SARM compound and anti-cancer agent, an immu a subject a composition comprising a SARM compound and nomodulating agent, an antidiabetic agent, an agent treating antidiabetic agent, an agent treating the gastrointestinal the cardiovascular system, an agent treating the gastrointes system, an agent treating a dermatological disorder, an agent tinal system, an agent treating a dermatological disorder, an treating the central nervous system, an anti-infective agent, agent treating the central nervous system, an anti-infective an agent treating the liver, an agent treating the kidney, an agent, an agent treating the liver, an agent treating the agent treating a metabolic disease, an agent treating a kidney, an agent treating a metabolic disease, an agent wasting disease, a gene therapy agent, an agent treating the treating a wasting disease, a gene therapy agent, an agent endocrine system, vitamins, or a combination thereof. In treating the endocrine system, vitamins, or a combination some embodiments, metabolic diseases comprise acid-base thereof. In some embodiments, congenital, hereditary, and imbalance, acidosis, alkalosis, alkaptonuria, alpha-mannosi neonatal diseases comprise Aicardi syndrome, amniotic dosis, amino acid metabolism inbom errors, amyloidosis, band syndrome, anencephaly, Angelman syndrome, ataxia iron-deficiency anemia, ascorbic acid deficiency, avitamino telangiectasia, Bannayan-Zonana syndrome, Barth syn sis, beriberi, biotinidase deficiency, carbohydrate-deficient drome, basal cell nevus syndrome, Beckwith-Wiedemann glycoprotein syndrome, camitine disorders, cystinosis, syndrome, bloom syndrome, branchio-oto-renal syndrome, cystinuria, dehydration, fabry disease, fatty acid oxidation cat eye syndrome, cerebral gigantism-charge syndrome, disorders, fucosidosis, galactosemias, Gaucher disease, Gil chromosome 16 abnormalities, chromosome 18 abnormali bert disease, glucosephosphate dehydrogenase deficiency, ties, chromosome 20 abnormalities, chromosome 22 abnor glutaric acidemia, glycogen storage disease, Hartnup dis malities, Costello syndrome, cri-du-chat syndrome, Cur ease, hemochromatosis, hemosiderosis, hepatolenticular rarino syndrome, cystic fibrosis, de-Lange syndrome, distal degeneration, histidinemia, homocystinuria, hyperbiliru trisomy 10q, down syndrome, ectodermal dysplasia, fetal binemia, hypercalcemia, hyperinsulinism, hyperkalemia, alcohol syndrome, fetal diseases, fetofetal transfusion, frag hyperlipidemia, hyperoxaluria, hypervitaminosis A, hypoc ile x syndrome, Freeman-Sheldon syndrome, gastroschisis, alcemia, hypoglycemia, hypokalemia, hyponatremia, hypo US 2007/028 1906 A1 Dec. 6, 2007 phosphatasia, insulin resistance, iodine deficiency, iron ders comprise Asperger syndrome, attention deficit disorder overload, jaundice, chronic idiopathic, leigh disease, lesch with hyperactivity, autistic disorder, bipolar disorder, bor nyhan syndrome, leucine metabolism disorders, lysosomal derline personality disorder, capgras syndrome, child behav storage diseases, magnesium deficiency, maple syrup urine ior disorders, combat disorders, cyclothymic disorder, disease, Melas syndrome, Menkes kinky hair syndrome, dependent personality disorder, depressive disorder, disso metabolic diseases, metabolic syndrome x, metabolism, ciative disorders, dysthymic disorder, eating disorders, fire inbom errors, mitochondrial diseases, mucolipidoses, muco setting behavior, hypochondriasis, impulse control disor polysaccharidoses, Niemann-Pick diseases, obesity, orni ders, Kleine-Levin syndrome, mental disorders, mental thine carbamoyltransferase deficiency disease, osteomala disorders diagnosed in childhood, multiple personality dis cia, pellagra, peroxisomal disorders, phenylketonurias, order, Munchausen syndrome, Munchhausen syndrome, porphyria, erythropoietic, porphyrias, progeria, pseudo,gau narcissistic personality disorder, narcolepsy, obsessive-com cher disease, refsum disease, Reye syndrome, rickets, Sand pulsive disorder, paraphilias, phobic disorders, psychotic hoff disease, starvation, tangier disease, Tay-Sachs disease, disorders, restless legs syndrome, schizophrenia, seasonal tetrahydrobiopterin deficiency, trimethylaminuria, tyrosine affective disorder, sexual and gender disorders, sexual dys mias, urea cycle disorders, water-electrolyte imbalance, functions, psychological, sleep disorders, somatoform dis Wernicke encephalopathy, vitamin A deficiency, vitamin orders, stress disorders, post-traumatic, substance-related B12 deficiency, vitamin B deficiency, Wolman disease, or disorders, suicidal behavior, or trichotillomania. Zellweger syndrome. [0516] In one embodiment, “depression” refers to an ill [0513] In some embodiments, the present invention pro ness that involves the body, mood and thoughts that affects vides a method for treating, reducing the incidence, delaying the way a person eats, sleeps and the way one feels about the onset or progression, or reducing and/or abrogating the oneself, and thinks about things. The signs and symptoms of symptoms associated with a disorder of environmental ori depression include loss of interest in activities, loss of gin in a subject. In one embodiment, the method comprises appetite or overeating, loss of emotional expression, an administering to a subject a composition comprising a empty mood, feelings of hopelessness, pessimism, guilt or SARM compound and anti-cancer agent, an immunomodu helplessness, social withdrawal, fatigue, sleep disturbances, lating agent, an antidiabetic agent, an agent treating the trouble concentrating, remembering, or making decisions, cardiovascular system, an agent treating the gastrointestinal restlessness, irritability, headaches, digestive disorders or system, an agent treating a dermatological disorder, an agent chronic pain. treating the central nervous system, an anti-infective agent, an agent treating the liver, an agent treating the kidney, an [0517] In one embodiment, “cognition” refers to the pro agent treating a metabolic disease, an agent treating a cess of knowing, specifically the process of being aware, wasting disease, a gene therapy agent, an agent treating the knowing, thinking, learning and judging. Cognition is endocrine system, vitamins, or a combination thereof. In related to the fields of psychology, linguistics, computer some embodiments, disorders of environmental origin com science, neuroscience, mathematics, ethology and philoso prise barotrauma, bites and stings, brain concussion, burns, phy. In one embodiment, “mood” refers to a temper or state central cord syndrome, craniocerebral trauma, electric inju of the mind. As contemplated herein, alterations mean any ries, fractures, bone, frostbite, heat stress disorders, motion change for the positive or negative, in cognition and/or sickness, occupational diseases, poisoning, shaken baby mood. syndrome, shoulder injuries, space motion sickness, spinal [0518] In some embodiments, the present invention pro cord injuries, tick paralysis, or wounds (penetrating and vides a method for treating, reducing the incidence, delaying non-penetrating). the onset or progression, or reducing and/or abrogating the [0514] In some embodiments, the present invention pro symptoms associated with a liver disease in a subject. In one vides a method for treating, reducing the incidence, delaying embodiment, the method comprises administering to a sub the onset or progression, or reducing and/or abrogating the ject a composition comprising a SARM compound and symptoms associated with a behavior mechanism in a sub anti-cancer agent, an immunomodulating agent, an agent ject. In one embodiment, the method comprises administer treating the gastrointestinal system, an anti-infective agent, ing to a subject a composition comprising a SARM com an agent treating the liver, an agent treating a metabolic pound and an agent treating the cardiovascular system, an disease, an agent treating a wasting disease, a gene therapy agent treating the central nervous system, a gene therapy agent, an agent treating the endocrine system, vitamins, or a agent, an agent treating the endocrine system, vitamins, or a combination thereof. In some embodiments, liver diseases combination thereof. In some embodiments, behavior comprise liver cancer, primary biliary cirrhosis, autoimmune mechanisms comprise aggression, attitude to death, code hepatitis, chronic liver disease, cirrhosis of the liver, hepa pendency, self-injurious behavior, sexual behavior, or social titis, viral hepatitis (hepatitis a, hepatitis b, chronic hepatitis behavior. b, hepatitis c, chronic hepatitis c, hepatitis d, hepatitis e, hepatitis x), liver failure, jaundice, neonatal jaundice, [0515] In some embodiments, the present invention pro hepatoma, liver cancer, liver abscess, alcoholic liver disease, vides a method for treating, reducing the incidence, delaying hemochromatosis, Wilson’s disease, portal hypertension, the onset or progression, or reducing and/or abrogating the primary scierosing cholangitis, sarcoidosis, tapeworms, symptoms associated with a mental disorder in a subject. In alveolar hydatid disease, fascioliasis, schistosomiasis, gau one embodiment, the method comprises administering to a cher disease, Zellweger syndrome, alcoholism, food poison subject a composition comprising a SARM compound and ing, pneumococcal pneumonia or vibrio vulnificus. an agent treating the central nervous system, a gene therapy agent, an agent treating the endocrine system, vitamins, or a [0519] In some embodiments, the present invention pro combination thereof. In some embodiments, mental disor vides a method for treating, reducing the incidence, delaying US 2007/028 1906 A1 Dec. 6, 2007 44 the onset or progression, or reducing and/or abrogating the ever, the compounds/compositions of this invention may in symptoms associated with a kidney disease in a subject. In some embodiments be effective in such a scenario. one embodiment, the method comprises administering to a [0523] In one embodiment, Compound III of this inven subject a composition comprising a SARM compound and tion and compositions comprising the same is useful in anti-cancer agent, an immunomodulating agent, an antidia improving Stage 3 and 4 CKD, by, inter alia, and in some betic agent, an agent treating the gastrointestinal system, an embodiments, increasing lean body mass (LBM), improving anti-infective agent, an agent treating the kidney, an agent physical performance, increasing quality of life, decreasing treating a metabolic disease, a gene therapy agent, an agent adiposity, improving physical performance, decreasing treating the endocrine system, vitamins, or a combination muscle catabolism, improving or treating renal metabolic thereof. In some embodiments, kidney diseases comprise syndrome, decreasing risk for development of insulin resis acromegaly, acute renal failure (ARF) amyloidosis, autoso tance and/or decreasing the risk for heart disease. mal dominant polycystic kidney disease, kidney stones, kidney cysts, autosomal recessive polycystic kidney disease, [0524] In one embodiment, the SARM compounds of this chronic renal failure (CRF), chronic renal disease, chronic invention improve muscle wasting and physical perfor kidney disease (CKD), coffin-Lowry syndrome, cor pulmo mance in end-stage renal disease (dialysis) patients. In some male, cryoglobulinemia, diabetic nephropathy, dyslipidemia, embodiments, the treatment methods of this invention are Gaucher disease, glomerulonephritis, goodpasture syn useful in treating uremic cachexia and/or complications, drome, hemolytic uremic syndrome, hepatitis, kidney can diseases and/or conditions associated thereto. cer, kidney stones, leukemia, lipoproteinemia, lupus, mul [0525] In some embodiments, administration of the tiple myeloma, nephritis, polyartekidney cysts, post SARM compound for the above indications is at a dose of streptococcal glomerulonephritis, glomerulonephritis, kid 1 or 3 mg daily. ney pain, preeclampsia, renal tuberculosis, pyelonephritis, [0526] In one embodiment, the methods of this invention renal tubular acidosis kidney disease, streptococcal toxic are useful in subjects predisposed to kidney diseases or shock syndrome, thromboembolism, toxoplasmosis, urinary disorders. In one embodiment, the phrase “predisposed to a tract infections, uremia, vesicoureteral reflux, or williams kidney disease or disorder” with respect to a subject is syndrome. In some embodiments, the kidney disease being synonymous with the phrase “subject at risk”, and includes treatment comprises kidney metabolic syndrome. a subject at risk of acute or chronic renal failure, or at risk [0520] In one embodiment, the kidney disease or disorder of the need for renal replacement therapy, if the subject is is acute, or in another embodiment, chronic. In one embodi reasonably expected to suffer a progressive loss of renal ment, clinical indications of a kidney disease or disorder, function associated with progressive loss of functioning wherein the methods of treatment may be useful include nephron units. Whether a particular subject is at risk is a urinary casts, measured GFR, or other markers of renal determination which may routinely be made by one of function. ordinary skill in the relevant medical or veterinary art. [0527] In one embodiment, subjects with kidney disease, [0521] In one embodiment, the kidney disease or disorder in particular male subjects with end-stage renal disease is a chronic kidney disease (CKD). In some embodiments (ESRD) suffer from hypogonadism, with some having con treating CKD patients includes treating those with advanced comitant moderate to severe protein-energy malnutrition disease (uremia), and may comprise treating muscle wast (PEM), which leads to higher required doses of EPO, lower ing, repetitive catabolic stimuli (chronic infections, dialy QOL scores, and higher mortality. Many have other symp sis), anorexia, or other associated conditions, which will toms associated with hypogonadism, including fatigue, lack comprise what is meant by treating the disease. In one of apetite, muscle weakness, etc. In some embodiments, the embodiment, the SARM compounds of this invention are treatment methods of this invention are useful in treating useful in increasing muscle and physical performance in a symptoms associated with hypogonadism, brought about in subject, in some embodiemtns, improving the patients’ the subject by the kidney disease or disorder. In another quality of life, diminishing morbidity and/or mortality, embodiment, brought about in the subject by androgen improving insulin resistance, and other associated condi deficiency in a female (ADIF); androgen deficiency in aging tions, thereby treating the subject afflicted with a disorder as male (ADAM) to include fatigue, depression, decreased described herein. In some embodiments, use of the com libido, erectile dysfunction, decreased cognition, decreased pounds/compositions of this invention treats or improves a mood; androgen insufficiency (male or female), androgen functional impairment in the subject, including, inter alia, deficiency (male or female). one that results in a decrease in physical performance, [0528] In one embodiment, diabetic nephropathy is a inability to perform daily activity, decrease in muscle complication of diabetes that evolves early, typically before strength, decrease in exercise capacity, increase in frailty clinical diagnosis of diabetes is made. The earliest clinical and/or decrease in quality of life. evidence of nephropathy is the appearance of low but [0522] In one embodiment, CKD predisposes the subject abnormal levels (>30 mg/day or 20 pg/min) of albumin in to functional impairment, which in turn may result in the the urine (microalbuminuria), followed by albuminuria presence of a chronic inflammatory state, local and systemic (>300 mg/24 h or 200 pg/min) that develops over a period inflammatory effects, increased adiposity (e.g. visceral adi of 10-15 years. In patients with type 1 diabetes, diabetic pose tissue), decreased LBM and/or any adverse effects of hypertension typically becomes manifest early on, by the adipose tissue. In some embodiments, conventional thera time that patients develop microalbuminuria. Once overt pies such as the administration of anabolic hormones lose nephropathy occurs, the glomerular filtration rate (GFR) efficacy in such subjects, as a result of resistance to the falls over a course of times, which may be several years, anabolic hormones resulting in decreased levels and resis resulting in End Stage Renal Disease (ESRD) in diabetic tance to actions (for example due to uremic toxins), how individuals. US 2007/028 1906 A1 Dec. 6, 2007

[0529] Hypertension is another comorbid factor for renal or degradation, by muscle protein catabolism. Protein disease. In some embodiments, treatment of renal disease catabolism occurs because of an unusually high rate of according to the present invention may comprise concomi protein degradation, an unusually low rate of protein syn tant treatment with a SARM and an agent which treats thesis, or a combination of both. Protein catabolism or hypertension. depletion, whether caused by a high degree of protein degradation or a low degree of protein synthesis, leads to a [0530] In some embodiments, the present invention pro decrease in muscle mass and to muscle wasting. The term vides a method for treating, reducing the incidence, delaying “catabolism” has its commonly known meaning in the art, the onset or progression, or reducing and/or abrogating the specifically an energy burning form of metabolism. symptoms associated with a wasting disease in a subject. In one embodiment, the method comprises administering to a [0534] Muscle wasting can occur as a result of pathology, subject a composition comprising a SARM compound and disease, condition or disorders, including disorders for treat anti-cancer agent, an immunomodulating agent, an antidia ment via the methods of this invention, such as, for example, betic agent, an agent treating the cardiovascular system, an end stage renal failure. agent treating the gastrointestinal system, an agent treating the central nervous system, an agent treating a metabolic [0535] In some embodiments, the present invention pro disease, an agent treating a wasting disease, a gene therapy vides a method for prevention of statin induced rhabdomy agent, an agent treating the endocrine system, vitamins, or a olysis. In some embodiments, the present invention provides combination thereof. In some embodiments, wasting dis a method for prevention of statin induced rhabdomyolysis, eases comprise muscle injury, bed rest, immobility, nerve organ failure or insufficiency. In some embodiments, the injury, neuropathy, diabetic neuropathy, alcoholic neuropa present invention provides a method for prevention of statin thy, anorexia, anorexia nervosa, anorexia associated with induced kidney or liver failure or insufficiency. In one cachexia, anorexia associated with aging, subacute com embodiment, the method comprises administering to a sub bined degeneration of the spinal cord, diabetes, rheumatoid ject a composition comprising a SARM compound and a arthritis, motor neurone diseases, Duchenne muscular dys statin. trophy, carpal tunnel syndrome, chronic infection, tubercu [0536] In one embodiment, the wasting disease is cachexia losis, Addison’s disease, adult sma, limb muscle atrophy, or involuntary weight loss in a subject. In another embodi back tumour, dermatomyositis, hip cancer, inclusion body ment, the present invention provides a method of treating, myositis, incontinentia pigmenti, intercostal neuralgia, juve preventing, inhibiting, reducing or suppressing muscle wast mile rheumatoid arthritis, Legg–Calve-Perthes disease, ing in a subject suffering from a kidney disease. In one muscle atrophy, multifocal motor neuropathy, nephrotic embodiment, the present invention provides a method of syndrome, osteogenesis imperfecta, post-polio syndrome, treating, preventing, inhibiting, reducing or suppressing rib tumor, spinal muscular atrophy, reflex sympathetic dys protein catabolism in a subject suffering from a kidney trophy syndrome, or Tay-Sachs. disease or disorder, [0531] A wasting condition or disorder is defined herein as [0537] Cachexia is weakness and a loss of weight caused a condition or disorder that is characterized, at least in part, by a disease or as a side effect of illness. Long term by an abnormal, progressive loss of body, organ or tissue hospitalization due to illness or injury, or disuse decondi mass. A wasting condition can occur as a result of a tioning that occurs, for example, when a limb is immobi pathology such as, for example, cancer, or it can be due to lized, can also lead to muscle wasting. Studies have shown a physiologic or metabolic state, such as disuse decondi that in patients suffering injuries, chronic illnesses, burns, tioning that can occur, for example, due to prolonged bed trauma or cancer, who are hospitalized for long periods of rest or when a limb is immobilized, such as in a cast, or with time, there is a long-lasting unilateral muscle wasting, with the occurrence of multiple wounds, including, for example, a consequent decrease in body mass. Nervous system injury, amputation, as occurs in diabetics, and other conditions, as for example, spinal cord injury, as described further herein, will be appreciated by one skilled in the art. A wasting may be a contributory factor, as well. condition can also be age associated. The loss of body mass that occurs during a wasting condition can be characterized [0538] In some embodiments, the present invention pro by a loss of total body weight, or a loss of organ weight such vides a method for treating, reducing the incidence, delaying as a loss of bone or muscle mass due to a decrease in tissue the onset or progression, or reducing and/or abrogating the protein. symptoms associated with a wasting diseases or disorders in a subject. In another embodiment, the wasting diseases and [0532] In one embodiment, the terms “muscle wasting” or disorders include inter-alia: a) acquired immunodeficiency “muscular wasting”, refer to the progressive loss of muscle syndrome (AIDS) wasting; b) wasting associated with bed mass and/or to the progressive weakening and degeneration rest; c) bulimia, and/or wasting associated with bulimia; c) of muscles, including the skeletal or voluntary muscles cachexia; d) cancer cachexia; e) HIV wasting: f) reduce which control movement, cardiac muscles which control the cachexia and protein loss due to prolonged critical illness, heart, and smooth muscles. In one embodiment, the muscle pulmonary dysfunction, ventilator dependency, aging, wasting condition or disorder is a chronic muscle wasting AIDS, trauma, surgery, congestive heart failure, cardiac condition or disorder. “Chronic muscle wasting” is defined myopathy, burns, cancer, chronic obstructive pulmonary herein as the chronic (i.e. persisting over a long period of disease (COPD), eating disorders such bulimia, anorexia time) progressive loss of muscle mass and/or to the chronic nervosa, loss of appetite, starvation, and/or depression. progressive weakening and degeneration of muscle. [0539] In some embodiments, the present invention pro [0533] The loss of muscle mass that occurs during muscle vides a method for treating, reducing the incidence, delaying wasting can be characterized by a muscle protein breakdown the onset or progression, or reducing and/or abrogating the US 2007/028 1906 A1 Dec. 6, 2007 46 symptoms associated with invalid states in a subject. In one der, an anti-infective agent, an agent treating the liver, an embodiment, the invalid state is post-polio syndrome. In one agent treating the kidney, vitamins, or a combination thereof. embodiment, the method comprises administering to a sub ject a composition comprising a SARM compound and an [0542] In some embodiments, the present invention pro immunomodulating agent, an antidiabetic agent, an agent vides a method for treating, reducing the incidence, delaying treating the cardiovascular system, an agent treating the the onset or progression, or reducing and/or abrogating the gastrointestinal system, an agent treating the central nervous symptoms associated with a sarcopenic state in a subject. In system, an agent treating a metabolic disease, an agent one embodiment, the present invention provides a method treating a wasting disease, a gene therapy agent, an agent for treating, reducing the incidence, delaying the onset or treating the endocrine system, vitamins, or a combination progression, or reducing and/or abrogating the symptoms thereof. associated with a pharmacotherapy induced sarcopenic state [0540] In some embodiments, the present invention pro in a subject. In some embodiments, sarcopenia is a signifi vides a method for treating, reducing the incidence, delaying cant loss of muscle mass. In one embodiment, sarcopenia the onset or progression, or reducing and/or abrogating the definition is having a lean body mass less than two standard symptoms associated with a hypogonadal state in a subject. deviation below the mean for normal young adults. In some In one embodiment, the present invention provides a method embodiments, sarcopenia is caused by genetic factors, for treating, reducing the incidence, delaying the onset or altered circulation, decrease in the capillary:muscle fiber progression, or reducing and/or abrogating the symptoms ratio, altered motor neurons, denervation, deterioration of associated with a pharmacotherapy induced hypogonadal motor end plates, selective reinnervation of Type I fibers, state in a subject. In some embodiments, hypogonadism is inflammatory responses causing muscle damage, reduced caused by treatments which alter the secretion of hormones exercise, malnutrition, low dietary protein intake, vitamin D from the sex glands in both women and men. In some deficiency, age-related decline in vitamin D, oxidative embodiments, hypogonadism may be “primary” or “cen stress, muscle mitochondrial mutations, changes in specific tral.” In primary hypogonadism, the ovaries or testes them types of muscle fibers, decline in muscle protein, disabling selves do not function properly. In some embodiments, disease, strokes, Alzheimer’s disease, Parkinson’s disease, hypogonadism may be induced by surgery, radiation, genetic osteoporsis, atherosclerosis, diabetes mellitus, hyperin and developmental disorders, liver and kidney disease, Sulimemia, renal failure, or hypogonadism. In one embodi infection, or certain autoimmune disorders. In some embodi ment, the method comprises administering to a subject a ments, menopause is a form of hypogonadism. Menopause composition comprising a SARM compound and an anti may cause, in some embodiments, amenorrhea, hot flashes, cancer agent, an immunomodulating agent, an antidiabetic vaginal dryness, or irritability due to woman’s estrogen agent, an agent treating the cardiovascular system, an agent levels fall. In one embodiment, the method comprises treating the gastrointestinal system, an agent treating the administering to a subject a composition comprising a central nervous system, an agent treating a metabolic dis SARM compound and an anti-cancer agent, an immuno ease, an agent treating a wasting disease, a gene therapy modulating agent, an antidiabetic agent, an agent treating the agent, an agent treating the endocrine system, an agent cardiovascular system, an agent treating the gastrointestinal treating a dermatological disorder, an anti-infective agent, system, an agent treating the central nervous system, an an agent treating the liver, an agent treating the kidney, agent treating a metabolic disease, an agent treating a vitamins, or a combination thereof. wasting disease, a gene therapy agent, an agent treating the endocrine system, an agent treating a dermatological disor [0543] In some embodiments, the present invention pro der, an anti-infective agent, an agent treating the liver, an vides a method for treating, reducing the incidence, delaying agent treating the kidney, vitamins, or a combination thereof. the onset or progression, or reducing and/or abrogating the symptoms associated with a combination of diseases and/or [0541] In some embodiments, the present invention pro disorders in a subject as described hereinabove. In one vides a method for treating, reducing the incidence, delaying embodiment, the method comprises administering to a sub the onset or progression, or reducing and/or abrogating the ject a composition comprising a SARM compound and an symptoms associated with osteopenic state in a subject. In anti-cancer agent, an immunomodulating agent, an antidia one embodiment, the present invention provides a method betic agent, an agent treating the cardiovascular system, an for treating, reducing the incidence, delaying the onset or agent treating the gastrointestinal system, an agent treating progression, or reducing and/or abrogating the symptoms the central nervous system, an agent treating a metabolic associated with a pharmacotherapy induced osteopenic state disease, an agent treating a wasting disease, a gene therapy in a subject. In some embodiments, osteopenia is a mild agent, an agent treating the endocrine system, an agent thinning of the bone mass. In some embodiments, osteope treating a dermatological disorder, an anti-infective agent, nia is a precursor to osteoporosis. In some embodiments an agent treating the liver, an agent treating the kidney, osteopenia is defined as a bone density between one standard vitamins, or a combination thereof. deviation (SD) and 2.5 SD below the bone density of a normal young adult. In one embodiment, the method com [0544] It is to be understood that any method of this prises administering to a subject a composition comprising invention, as herein described, encompasses the administra a SARM compound and an anti-cancer agent, an immuno tion of a SARM compound as herein described, or a com modulating agent, an antidiabetic agent, an agent treating the position comprising the same, to the subject, in order to treat cardiovascular system, an agent treating the gastrointestinal the indicated disease, disorder or condition. The methods as system, an agent treating the central nervous system, an herein described each and/or all may further comprise agent treating a metabolic disease, an agent treating a administration of an additional therapeutic agent as herein wasting disease, a gene therapy agent, an agent treating the described, and as will be appreciated by one skilled in the endocrine system, an agent treating a dermatological disor art. US 2007/028 1906 A1 Dec. 6, 2007 47

[0545] In some embodiments, the present invention pro condition, the method comprising administering to the sub vides a method for enhanced production such as milk, ject a SARM as herein described, and optionally chemo sperm, or egg. In some embodiments, the present invention therapeutics agents and therapies (methotrexate, cyclophos provides a method for enhanced production of lean meats or phamide, ifosfamide, adriamycin, doxorubicin, eggs. In some embodiments, the present invention provides glucocorticoids, cyclosporine, L-thyroxine, SERMs, AI, ful a method for increased productivity of feeds or stud live vestrant, GnRH agents, ADT, discontinuation of hormone stock, for example, increased sperm count, improved mor replacement therapy, cranial irradiation, peripheral irradia phology of sperm, etc. In some embodiments, the present tion, etc.; prolactinemia-inducing pharmacotherapeutics invention provides a method for expanding the productive (serotonergic antidepressants acting through 5HT2 recep life of farm animals, for example, egg-laying hens, milk tors, selective serotonin reuptake inhibitors, monoamine producing cows, etc, and/or enhanced herd health, for oxidase inhibitors, tricyclic antidepressants, antihyperten example, improved immune clearance, stronger animals. sives such as methyldopa, reserpine, clonidine, and vera [0546] In one embodiment, the method comprises admin pamil; antidopaminergic anti-emetics such as metoclopra istering to a subject a composition comprising a SARM mide, H2 receptor antagonists such as cimetidine and compound and an anti-cancer agent, an immunomodulating ranitidine, estrogens, amphetamines, AR partial antagonists agent, an antidiabetic agent, an agent treating the cardio (ketoconazole, spironolactone, eplerenone) vascular system, an agent treating the gastrointestinal sys [0552] In another embodiment, the SARMs and compo tem, an agent treating the central nervous system, an agent sitions as described herein are useful in promoting or treating a metabolic disease, an agent treating a wasting speeding recovery following a surgical procedure. disease, a gene therapy agent, an agent treating the endo crine system, an agent treating a dermatological disorder, an [0553] In one embodiment, the present invention provides anti-infective agent, an agent treating the liver, an agent a use of a SARM compound as described herein for reducing treating the kidney, vitamins, nutritional additives, hor a fat mass in a subject. In another embodiment the invention mones, each and/or all as herein described, or any other provides such methods for use of the SARM compound as therapeutic agent as herein described, or a combination described herein or its prodrug, analog, isomer, metabolite, thereof. derivative, pharmaceutically acceptable salt, pharmaceutical product, polymorph, crystal, impurity, N-oxide, hydrate or [0547] In another embodiment, this invention provides any combination thereof, or a composition comprising the methods of treatment of cystic fibrosis and induced hypogo madal states as a result of the same, epilepsy and induced SãIIlê. hypogonadal and/or hypermetabolic states as a result of the [0554] In another embodiment, this invention provides for same, hereditary angioedema, lupus erythematosus and the use of the SARM compounds as described herein or its decreased BMD as a result of the same, alcohol and smoking analog, derivative, isomer, metabolite, pharmaceutically induced osteoporosis, in a subject the methods comprising acceptable salt, pharmaceutical product, polymorph, crystal, administering a SARM as herein described to the subject. impurity, hydrate, N-oxide or any combination thereof, for [0548] In another embodiment, this invention provides treating adominal fat accumulation; improving body com methods of treatment of polio and post-polio syndrome and position; lowering body fat content; lowering fat mass; other invalid states, statin induced rhabdomyolysis, statin improving blood lipid profile, increasing muscle mass/ induced muscle weakness, statin-induced organ failure or strength/function; increasing bone mass/BMD/strength/ insufficiency, in a subject, the methods comprising the function; lowering body fat; congenital hyperinsulinemia; administration of a SARM as herein described, optionally cushing’s disease (hypercortisolemia); obesity or diabetes with a statin, as appropriate, as will be appreciated by one associated with a metabolic syndrome in a subject. skilled in the art, and/or with any therapeutic agent. [0555] In another embodiment, the subject has a hormonal [0549] In another embodiment, this invention provides a imbalance, disorder, or disease. In another embodiment the method of treating Opioid Induced Androgen Deficiency subject has menopause. (OPIAD), the method comprising administering to the sub [0556] In one embodiment, the present invention provides ject a SARM as herein described, and optionally opiates, a use of a SARM compound as described herein for increas opioids, narcotics, etc. methadone, long-acting opiates/opio ing a lean mass in a subject. In another embodiment such use ids such as Kadian, extended release morphines, all opiates/ comprises administration of a SARM compound as opioids/narcotics agents approved by FDA, opiates/opioids described herein or its prodrug, analog, isomer, metabolite, used in treatment of heroin addiction, opiates/opioids used derivative, pharmaceutically acceptable salt, pharmaceutical in the treatment of chronic pain of malignancy, opiates/ product, polymorph, crystal, impurity, N-oxide, hydrate or opioids used in the treatment non-malignant of chronic pain syndromes. any combination thereof. [0550] In another embodiment, this invention provides a [0557] In one embodiment the subject has a hormonal method of treating a nervous system disease, disorder or imbalance, disorder, or disease. In another embodiment the condition, the method comprising administering to the sub subject has menopause. ject a SARM as herein described, and optionally anti [0558] Example 1 demonstrate that a compound of for psychotics, such as, for example, zotepine, haloperidol, mula III is anabolic yet minimally androgenic, thus such amisulpride, risperidone, other D2 dopamine receptor compounds may be useful in treating patient groups in antagonists; anti-epileptics, such as valproic acid, carbam which androgens were contraindicated in the past. Com azepine, oxcarbamazepine, etc. or combinations thereof. pound of formula III was shown to stimulate muscle growth, [0551] In another embodiment, this invention provides a whether in the presence or absence of testosterone while method of treating a hormone dependent disease, disorder or exerting anti-proliferative effects on the prostate, thus, in US 2007/028 1906 A1 Dec. 6, 2007 48 one embodiment, the methods of this invention provide for [0567] The correlation between atherosclerosis and LDL restoring lost muscle mass in patients with sarcopenia or cholesterol levels, however, is much higher than a similar cachexia. correlation between atherosclerosis and total serum choles [0559] In one embodiment, the SARM compounds as terol levels. herein described alter the levels of leptin in a subject. In [0568] In one embodiment, this invention provides meth another embodiment, the SARM compounds as herein ods of use of the SARM compounds as herein described for described decrease the levels of leptin. In another embodi improving the lipid profile and/or reducing the circulating ment, the SARM compounds as herein described increase lipid levels in a subject. In some embodiments, according to the levels of leptin in a subject. Leptin is known to have an this aspect of the invention, the subject suffers from one or effect on appetite on weight loss in obese mice, and thus has more conditions comprising atherosclerosis and its associ been implicated in obesity. ated diseases, premature aging, Alzheimer’s disease, stroke, [0560] The SARM compounds as herein described, in one toxic hepatitis, viral hepatitis, peripheral vascular insuffi embodiment, affect circulating, or in another embodiment, ciency, renal disease, and/or hyperglycemia, and the inven tissue levels of leptin. In one embodiment, the term “level/s tion provides for the administration of a SARM compound of leptin’ refers to the serum level of leptin. As contemplated or composition comprising the same, as herein described, herein, the SARM compounds of the present invention have which in some embodiments positively affects a lipid profile an effect on leptin in-vitro and in-vivo. Leptin levels can be in the subject, which is one means by which the method is measured by methods known to one skilled in the art, for useful in treating the indicated diseases, disorders and con example by commercially available ELISA kits. In addition, ditions. Leptin levels may be determined in in-vitro assays, or in [0569] In one embodiment the invention provides for the in-vivo assays, by any method known to a person skilled in treatment of atherosclerosis and its associated diseases, such the art. as for example, cardiovascular disorders, cerebrovascular [0561] Since leptin is implicated in controlling appetite, disorders, peripheral vascular disorders, intestinal vascular weight loss, food intake, and energy expenditure, modulat disorders, or combinations thereof. ing and/or controlling the levels of leptin is a useful thera [0570] In one embodiment cardiovascular disorders com peutic approach in treating preventing, inhibiting or reduc prise of hypertention (HTN), coronary artery disease (CAD) ing the incidence of obesity in subjects suffering from or myocardial perfusion. In another embodiment this inven obesity. Modulating the level of leptin can result in a loss of tion provides methods of use of the compositions as herein appetite, a reduction of food intake, and an increase in described for promoting aortic smooth muscle cell prolif energy expenditure in the subject, and thus may contribute eration. In another embodiment this invention provides to the control and treatment of obesity. methods of use of the compositions as herein described for treating arteriosclerosis. In another embodiment this inven [0562] The term “obesity” is defined, in one embodiment, tion provides methods of use of the compositions as herein as an increase in body weight beyond the limitation of described for lowering blood pressure. In another embodi skeletal and physical requirement, as the result of excessive ment this invention provides methods of use of the compo accumulation of fat in the body. sitions as herein described for treating cardiac diseases and [0563] The term “obesity-associated metabolic disorder” disorders comprising cardiomyopathy, cardiac dysfunctions refers, in one embodiment, to a disorder which results from, such as, myocardial infarction, cardiac hypertrophy and is a consequence of, is exacerbated by or is secondary to cognitive heart failure. In another embodiment this inven obesity. Non-limiting examples of such a disorder are tion provides methods of use of the compositions as herein osteoarthritis, Type II diabetes mellitus, increased blood described for cardioprotection comprising cardioprotection pressure, stroke, and heart disease. in insulin resistance; treating diabetes type I ans II, meta bolic syndrome, syndrome X and/or high blood pressure. [0564] Cholesterol, triacylglycerol and other lipids are transported in body fluids by lipoproteins which may be [0571] In one embodiment, the invention provides a classified according to their density, for example, the very method of treating, preventing, reducing the risk of mortality low density lipoproteins (VLDL), intermediate density lipo from cardiovascular and/or cerebrovascular disease in a proteins (IDL), low density lipoproteins (LDL) and high subject, comprising administering a compound of formula density lipoproteins (HDL). (I-XX) or its prodrug, ester, analog, isomer, metabolite, derivative, pharmaceutically acceptable salt, pharmaceutical [0565] It has been shown that high levels of LDL-Cho product, polymorph, crystal, impurity, N-oxide, hydrate or lesterol in the blood correlate with atherosclerosis which is any combination thereof, or a pharmaceutical composition a progressive disease characterized in part by sedimentation comprising the same. In one embodiment, the SARM com of lipids in inner walls of arteries, particularly of coronary pound is characterized by the structure of formula III. arteries. It has also been shown that a high blood level of LDL-Cholesterol correlates with coronary heart disease. [0572] In one embodiment, compounds of formulae I-XX Also, a negative correlation exists between blood levels of reduce LDL and total cholesterol levels, and in one embodi HDL cholesterol and coronary heart disease. ment the SARM compound of formula III reduces IDL and [0566] The level of total cholesterol in blood, which is the total cholesterol levels in a subject. sum of HDL-Cholesterol, LDL-Cholesterol, VLDL-Choles [0573] In another embodiment, compounds of formulae terol and chylomicron-Cholesterol, is not necessarily pre I-XX are co-administered with HDL-elevating agents. In dictive of the risk of coronary heart disease and atheroscle another embodiment, a compound of formula III is co I’OS1S. administered with an HDL-elevating agents. In another US 2007/028 1906 A1 Dec. 6, 2007 49 embodiment, HDL-elevating agents include niacin; In [0581] In addition, androgens have recently been shown to another embodiment the HDL-elevating agents include be involved in commitment of mesenchymal pluripotent fibrates including gemfibrozil (Lopid), thiourea based gem cells into myogenic lineage and to block differentiation into fibrozil analogues, and fenofibrate (TriCor). In another adipogenic lineage (Singh et al., Endocrinology, 2003, Jul. embodiment, HDL-elevating agents include statins. In 24). Accordingly, SARM compounds can be useful in meth another embodiment, HDL-elevating agents include 1-hy ods of blocking adipogenesis, and/or altering stem cell droxyalkyl-3-phenylthiourea, and analogs thereof. differentiation, as described herein. [0574] In one embodiment, this invention provides a [0582] In another embodiment, this invention relates to a method of reducing circulating lipid levels in a subject, said method of promoting, increasing or facilitating weight loss method comprising administering a selective androgen in a subject, comprising the step of administering to the receptor modulator (SARM) compound of formula I-XX or subject a SARM as herein described and/or its analog, its pharmaceutically acceptable salt, hydrate, N-oxide, or derivative, isomer, metabolite, pharmaceutically acceptable any combination thereof, or a composition comprising the salt, pharmaceutical product, hydrate, N-oxide, prodrug, same. In one embodiment, the subject suffers from athero polymorph, crystal, or any combination thereof, in an sclerosis and its associated diseases, premature aging, amount effective to promote, increase or facilitate weight Alzheimer’s disease, stroke, toxic hepatitis, viral hepatitis, loss in the subject. peripheral vascular insufficiency, renal disease, hyperglyce [0583] In another embodiment, this invention relates to a mia, or any combination thereof. method of decreasing, suppressing, inhibiting or reducing [0575] In one embodiment, this invention provides a appetite of a subject, comprising the step of administering to method of treating atherosclerosis and its associated dis the subject a SARM as herein described and/or its analog, eases, such as, for example, cardiovascular disorders, cere derivative, isomer, metabolite, pharmaceutically acceptable brovascular disorders, peripheral vascular disorders, or salt, pharmaceutical product, hydrate, N-oxide, prodrug, intestinal vascular disorders in a subject, the method com polymorph, crystal, or any combination thereof, in an prising the step of administering to the subject a selective amount effective to decrease, suppress, inhibit or reduce the androgen receptor modulator (SARM) compound of for appetite of the subject. mula I-XX or its pharmaceutically acceptable salt, hydrate, [0584] In another embodiment, this invention relates to a N-oxide, or any combination thereof, or a composition method of altering the body composition of a subject, comprising the same. The method may further comprise comprising the step of administering to the subject a SARM co-administration, subsequent or prior administration with as herein described and/or its analog, derivative, isomer, an agent or agents, which are known to be useful in treating metabolite, pharmaceutically acceptable salt, pharmaceuti cardiovascular disorders, cerebrovascular disorders, periph cal product, hydrate, N-oxide, prodrug, polymorph, crystal, eral vascular disorders, or intestinal vascular disorders. or any combination thereof, in an amount effective to alter the body composition of the subject. In one embodiment, [0576] In one embodiment, this invention provides a altering the body composition comprises altering the lean method of improving the dexterity and movement in a body mass, the fat free body mass of the subject, or a subject, for example, by treating arthritis in the subject. combination thereof. [0577] The term “arthritis” refers, in another embodiment, [0585] In another embodiment, this invention relates to a to a non-inflammatory degenerative joint disease occurring method of altering lean body mass or fat free body mass of chiefly in older people, characterized by degeneration of the a subject, comprising the step of administering to the subject articular cartilage, hypertrophy of bones and the margins, a SARM as herein described and/or its analog, derivative, changes in the synovial membrane, etc. It is accompanied, in isomer, metabolite, pharmaceutically acceptable salt, phar other embodiments, by pain and stiffness, particularly after maceutical product, hydrate, N-oxide, prodrug, polymorph, prolonged activity. crystal, or any combination thereof, in an amount effective [0578] The term “diabetes”, in one embodiment, refers to to alter the lean body mass or fat free body mass of the a relative or absolute lack of insulin leading to uncontrolled subject. carbohydrate metabolism. Most patients can be clinically [0586] In another embodiment, this invention relates to a classified as having either insulin-dependent diabetes mel method of converting fat to lean muscle in a subject, litus (IDDM or Type-I diabetes) or non-insulin-dependent comprising the step of administering to the subject a SARM diabetes mellitus (NIDDM or Type-II diabetes). as herein described and/or its analog, derivative, isomer, metabolite, pharmaceutically acceptable salt, pharmaceuti [0579] The term “increased blood pressure” or “hyperten cal product, hydrate, N-oxide, prodrug, polymorph, crystal, sion” refers, in other embodiments, to a repeatedly high or any combination thereof, in an amount effective to blood pressure above 140 over 90 mmHg. Chronically convert fat to lean muscle in the subject. elevated blood pressure can cause blood vessel changes in the back of the eye, thickening of the heart muscle, kidney [0587] In another embodiment, this invention relates to a failure, and brain damage. method of treating an obesity-associated metabolic disorder in a subject, comprising the step of administering to the [0580] The term “stroke” refers, in other embodiments, to subject a SARM as herein described and/or its analog, damage to nerve cells in the brain due to insufficient blood derivative, isomer, metabolite, pharmaceutically acceptable supply often caused by a bursting blood vessel or a blood salt, pharmaceutical product, hydrate, N-oxide, prodrug, clot. The term “heart disease”, in other embodiments, refers polymorph, crystal, or any combination thereof, in an to a malfunction in the heart normal function and activity, amount effective to treat the obesity-associated metabolic including heart failure. disorder in the subject. US 2007/028 1906 A1 Dec. 6, 2007 50

[0588] In another embodiment, this invention relates to a skin diseases such as Necrobiosis Lipoidica Diabeticorum method of preventing, suppressing, inhibiting or reducing an (NLD), Blisters of diabetes (Bullosis Diabeticorum), Erup obesity-associated metabolic disorder in a subject, compris tive Xanthomatosis, Digital Sclerosis, Disseminated Granu ing the step of administering to the subject a SARM as loma Annulare, and Acanthosis Nigricans. herein described and/or its analog, derivative, isomer, metabolite, pharmaceutically acceptable salt, pharmaceuti [0594] In one embodiment this invention provides a cal product, hydrate, N-oxide, prodrug, polymorph, crystal, method of treating, suppressing, inhibiting or reducing the or any combination thereof, in an amount effective to incidence of (a) diabetes type I; (b) diabetes type II; (c) prevent, suppress, inhibit or reduce the obesity-associated glucose intolerance; (d) hyperinsulinemia; (e) insulin resis metabolic disorder in the subject. tance (f) nephropathy; (g) diabetic neuropathy: (h) diabetic retinopathy (i) fatty liver conditions (j) MODY and (k) [0589] In one embodiment, the obesity-associated meta cardiovascular disease in a human subject, comprising the bolic disorder is hypertension. In another embodiment, the step of administering to said subject a selective androgen disorder is osteoarthritis. In another embodiment, the disor receptor modulator compound of formula I-XX. der is Type II diabetes mellitus. In another embodiment, the disorder is increased blood pressure. In another embodi [0595] In some embodiments, the SARMs as herein ment, the disorder is stroke. In another embodiment, the described and/or compositions comprising the same may be disorder is heart disease. used for applications in, or treating diseases or conditions associated with a subject having diabetes. In one embodi [0590] In another embodiment, this invention relates to a ment, the subject for whom treatment is sought via the method of decreasing, suppressing, inhibiting or reducing methods of this invention is one with diabetic I. Type I adipogenesis in a subject, comprising the step of adminis diabetes is characterized by autoimmune destruction of tering to the subject a SARM as herein described and/or its pancreatic beta-cells. Markers of immune destruction of the analog, derivative, isomer, metabolite, pharmaceutically beta-cell are present at the time of diagnosis in 90% of acceptable salt, pharmaceutical product, hydrate, N-oxide, individuals and include antibodies to the islet cell (ICAs), to prodrug, polymorph, crystal, or any combination thereof. glutamic acid decarboxylase (GAD), and to insulin (1AAs). [0591] In another embodiment, this invention relates to a While this form of diabetes usually occurs in children and method of altering stem cell differentiation in a subject, adolescents, it can occur at any age. Younger individuals comprising the step of administering to the subject a SARM typically have a rapid rate of beta-cell destruction and as herein described and/or its analog, derivative, isomer, present with ketoacidosis, while adults often maintain suf metabolite, pharmaceutically acceptable salt, pharmaceuti ficient insulin secretion to prevent ketoacidosis for many cal product, hydrate, N-oxide, prodrug, polymorph, crystal, years. Eventually, all type I diabetic patients require insulin or any combination thereof, in an amount effective to alter therapy to maintain nornglycemia. stem cell differentiation in the subject. [0596] In one embodiment, this invention provides a [0592] In one embodiment, the SARM that’s as herein method of treating diabetes type II. Type II diabetes is described are useful in a) treating, preventing, suppressing, characterized by insulin resistance and at some stage in inhibiting, or reducing obesity; b) promoting, increasing or pathogenesis of the disease, a relative deficiency of insulin facilitating weight loss; c) decreasing, suppressing, inhibit secretion. In absolute terms, the plasma insulin concentra ing or reducing appetite; d) altering the body composition; tion (both fasting and meal-stimulated) usually is increased, e) altering lean body mass or fat free body mass; f) con although “relative” to the severity of insulin resistance, the verting fat to lean muscle; g) treating, preventing, suppress plasma insulin concentration is insufficient to maintain nor ing, inhibiting, or reducing an obesity-associated metabolic mal glucose homeostasis. With time, however, there is disorder, for example hypertension, osteoarthritis, diabetes progressive beta cell failure and absolute insulin deficiency mellitus, MODY, increased blood pressure, stroke, or heart ensues. Most individuals with type II diabetes exhibit intra disease; h) decreasing, suppressing, inhibiting or reducing abdominal (visceral) obesity, fatty liver, which is closely adipogenesis: i) altering stem cell differentiation; and/or j) related to the presence of insulin resistance. The patient’s altering the level of leptin. liver becomes insulin resistant and glycogen breakdown is uncontrolled and the result is increased and unphysiological [0593] In one embodiment, the SARMs as herein glucose delivery to the bloodstream. The liver generated described find utility in treating or halting the progression of cholesterol and VLDL particles is also uncontrolled. In or treating symptoms of diabetes. In another embodiment, addition, hypertension, dyslipidemia (high triglyceride and the SARMs as herein described are useful in treating co low HDL-cholesterol levels; postprandial hyperlipemia), morbidities related to diabetes. These conditions include: and elevated PAI-1 levels often are present in these indi hypertension, cerebrovascular disease, atherosclerotic coro viduals. This clustering of abnormalities is referred to as the nary artery disease, macular degeneration, diabetic retinopa “insulin resistance syndrome”, or the “metabolic syndrome” thy (eye disease) and blindness, cataracts—systemic inflam or obesity related disorders. Because of these abnormalities, mation (characterized by elevation of inflammatory markers patients with type II diabetes are at increased risk of devel such as erythrocyte sedimentation rate or C-reactive pro oping macrovascular complications such as myocardial inf tein), birth defects, pregnancy related diabetes, pre-ecclamp arction and stroke. sia and hypertension in pregnancy, kidney disease (renal insufficiency, renal failure etc.), nerve disease (diabetic [0597] In one embodiment, this invention provides a neuropathy), superficial and systemic fungal infections, con method of treating diabetic nephropathy. Diabetic nephropa gestive heart failure, gout/hyperuricemia, obesity, hypertrig thy is a complication of diabetes that evolves early, typically lyceridemia, hypercholesterolemia, fatty liver disease (non before clinical diagnosis of diabetes is made. The earliest alcoholic steatohepatitis, or NASH), and diabetes-related clinical evidence of nephropathy is the appearance of low US 2007/028 1906 A1 Dec. 6, 2007

but abnormal levels (>30 mg/day or 20 pg/min) of albumin [0603] Diabetes and the liver obesity is typically associ in the urine (microalbuminuria), followed by albuminuria ated with elevated levels of free fatty acid (FFAs) that (>300 mg/24 h or 200 pg/min) that develops over a period promote lipid accumulation and insulin resistance in target of 10-15 years. In patients with type 1 diabetes, diabetic tissues, i.e. reduced action of insulin primarily in skeletal hypertension typically becomes manifest early on, by the muscle and liver. A prominent role of insulin is to reduce time that patients develop microalbuminuria. Once overt glucose output from the liver. FFAs stimulate hepatic glu nephropathy occurs, the glomerular filtration rate (GFR) coneogenesis which perse does not lead to increased hepatic falls over a course of times, which may be several years, glucose output as long as it is paralleled by a decrease in resulting in End Stage Renal Disease (ESRD) in diabetic hepatic glycogenolysis, a compensatory process referred to individuals. as “hepatic autoregulation”. FFAs stimulate insulin secretion [0598] In one embodiment, this invention provides a and insulin blocks glycogenolysis in part by inhibiting method of treating diabetic neuropathy. Diabetic neuropathy secretion of glucagon, an inducer of glycogenolysis. How is a family of nerve disorders caused by diabetes. Diabetic ever, long-term elevated levels of FFAs leads to hepatic neuropathies cause numbness and sometimes pain and insulin resistance and thus breakdown of hepatic autoregu weakness in the hands, arms, feet, and legs. Neurologic lation, resulting in increased hepatic glucose production and problems in diabetes may occur in every organ system, development of type II diabetes. Fatty liver and hepatic including the digestive tract, heart, and genitalia. Diabetic insulin resistance is a major driving force behind hypergly neuropathies are classified as peripheral, autonomic, proxi cemia and type II diabetes. mal, and focal. Peripheral neuropathy causes pain or loss of [0604] In one embodiment, this invention provides meth feeling in the toes, feet, legs, hands, and arms. Autonomic ods that inhibit (improve) the fatty liver, resulting in that the neuropathy causes changes in digestion, bowel and bladder insulin resistance in the liver is inhibited (improved) and function, sexual response, and perspiration and can also thereby solving the basic problem in type II diabetes. affect the nerves that serve the heart and control blood pressure. Proximal neuropathy causes pain in the thighs, [0605] In one embodiment, this invention provides a hips, or buttocks and leads to weakness in the legs. Focal method of treating a human subject having a diabetes, neuropathy results in the sudden weakness of one nerve, or comprising the step of administering to said subject a a group of nerves, causing muscle weakness or pain. Any selective androgen receptor modulator (SARM) compound nerve in the body may be affected. of formula III: [0599] In one embodiment, this invention provides a method of treating diabetic retinopathy. The effect of dia III betes on the eye is called diabetic retinopathy. Patients with NC CN diabetes are more likely to develop eye problems such as

cataracts and glaucoma. The affect of diabetic retinopathy on vision varies widely, depending on the stage of the disease. Some common symptoms of diabetic retinopathy are blurred vision (this is often linked to blood sugar levels), floaters and Hó" or flashes and sudden loss of vision. [0600] In one embodiment, the subject for whom treat or its isomer, pharmaceutically acceptable salt, pharmaceu ment is sought via the methods of this invention is one with tical product, hydrate, N-oxide, or any combination thereof. glucose intolerance. Glucose intolerance is a pre-diabetic [0606] In another embodiment, the diabetes is a type I state in which the blood glucose is higher than normal but diabetes. In another embodiment, the diabetes is a type II not high enough to warrant the diagnosis of diabetes. diabetes. [0601] In one embodiment, the subject for whom treat ment is sought via the methods of this invention is one with [0607] In one embodiment, this invention provides a hyperinsulinemia. Hyperinsulinemia is a sign of an under method of treating suppressing, inhibiting or reducing the lying problem that is causing the pancreas to secrete exces incidence of diabetes is a human subject, comprising the step sive amounts of insulin. The most common cause of hyper of administering to said subject a selective androgen recep insulinemia is insulin resistance, a condition in which your tor modulator (SARM) compound of formula III: body is resistant to the effects of insulin and the pancreas tries to compensate by making more insulin. hyperinsuline III mia is associated with type II diabetes NC CN

[0602] In one embodiment, the subject for whom treat

ment is sought via the methods of this invention is one with insulin resistance. Insulin resistance is a condition in which normal amounts of insulin are inadequate to produce a normal insulin response from fat, muscle and liver cells. Insulin resistance in fat cells results in hydrolysis of stored triglycerides, which elevates free fatty acids in the blood plasma. Insulin resistance in muscle reduces glucose uptake or its isomer, pharmaceutically acceptable salt, pharmaceu whereas insulin resistance in liver reduces glucose storage, tical product, hydrate, N-oxide, or any combination thereof. with both effects serving to elevate blood glucose. High [0608] In another embodiment, the diabetes is a Type I plasma levels of insulin and glucose due to insulin resistance diabetes. In another embodiment, the diabetes is a type II often leads to the metabolic syndrome and type II diabetes. diabetes. US 2007/028 1906 A1 Dec. 6, 2007 52

[0609] In one embodiment, this invention provides a method of treating a human subject having glucose intoler III ance, comprising the step of administering to said subject a NC CN selective androgen receptor modulator (SARM) compound of formula III:

III NC CN or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. [0613] In one embodiment, this invention provides a Hó" or method of treating diabetic neuropathy in a human subject, comprising the step of administering to said subject a selective androgen receptor modulator compound of for or its isomer, pharmaceutically acceptable salt, pharmaceu mula III: tical product, hydrate, N-oxide, or any combination thereof.

[0610] In one embodiment, this invention provides a III method of treating a hyperinsulinemia in a human subject, NC CN comprising the step of administering to said subject a selective androgen receptor modulator compound of for mula III: Hó" or

III NC CN or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof.

F3C N O [0614] In one embodiment, this invention provides a H method of treating diabetic retinopathy in a human subject, Hó" on comprising the step of administering to said subject a selective androgen receptor modulator compound of for mula III: or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. III NC CN

[0611] In one embodiment, this invention provides a method of treating insulin resistance in a human subject, comprising the step of administering to said subject the selective androgen receptor modulator compound of for mula III: Hó" or

III or its isomer, pharmaceutically acceptable salt, pharmaceu NC CN tical product, hydrate, N-oxide, or any combination thereof. [0615] In one embodiment, this invention provides a method of treating fatty liver conditions in a human subject, F3C N O H comprising the step of administering to said subject a Hó" on selective androgen receptor modulator compound of for mula III: or its isomer, pharmaceutically acceptable salt, pharmaceu III tical product, hydrate, N-oxide, or any combination thereof. NC CN In another embodiment, treatment of insulin resistance is exemplified in Example 5. [0612] In one embodiment, this invention provides a method of treating diabetic nephropathy in a human subject, Hó" or comprising the step of administering to said subject a selective androgen receptor modulator compound of for or its isomer, pharmaceutically acceptable salt, pharmaceu mula III: tical product, hydrate, N-oxide, or any combination thereof. US 2007/028 1906 A1 Dec. 6, 2007 53

[0616] In one embodiment, this invention provides a [0622] In one embodiment, subjects with kidney disease, method of treating cardiovascular disease in a human sub in particular male subjects with end-stage renal disease ject, comprising the step of administering to said subject a (ESRD) suffer from hypogonadism, with some having con selective androgen receptor modulator compound of for comitant moderate to severe protein-energy malnutrition mula III: (PEM), which leads to higher required doses of EPO, lower QOL scores, and higher mortality. Many have other symp toms associated with hypogonadism, including fatigue, lack III of apetite, muscle weakness, etc. In some embodiments, the NC CN treatment methods of this invention are useful in treating symptoms associated with hypogonadism, brought about in

the subject by the kidney disease or disorder. h [0623] In one embodiment, diabetic nephropathy is a Hó" or complication of diabetes that evolves early, typically before clinical diagnosis of diabetes is made. The earliest clinical evidence of nephropathy is the appearance of low but or its isomer, pharmaceutically acceptable salt, pharmaceu abnormal levels (>30 mg/day or 20 pg/min) of albumin in tical product, hydrate, N-oxide, or any combination thereof. the urine (microalbuminuria), followed by albuminuria [0617] In one embodiment this invention provides a (>300 mg/24 h or 200 pg/min) that develops over a period method for a) treating, preventing, suppressing inhibiting of 10-15 years. In patients with type 1 diabetes, diabetic atherosclerosis b) treating, preventing, suppressing inhibit hypertension typically becomes manifest early on, by the ing liver damage due to fat deposits comprising the step of time that patients develop microalbuminuria. Once overt administering to the subject a SARM as described herein nephropathy occurs, the glomerular filtration rate (GFR) and/or its analog, derivative, isomer, metabolite, pharma falls over a course of times, which may be several years, ceutically acceptable salt, pharmaceutical product, hydrate, resulting in End Stage Renal Disease (ESRD) in diabetic N-oxide, prodrug, polymorph, crystal, or any combination individuals. thereof, or a composition comprising the same, in an amount [0624] Hypertension is another comorbid factor for renal effective to treat, prevent or inhibit atherosclerosis and liver disease. In some embodiments, treatment of renal disease damage due to fat deposit. according to the present invention may comprise concomi tant treatment with a SARM and an agent which treats [0618] In one embodiment, the SARM as described herein hypertension. is useful in a) treating, preventing, suppressing, inhibiting, or reducing atherosclerosis; b) treating, preventing, sup [0625] In one embodiment, the compounds and/or com pressing inhibiting liver damage due to fat deposits. positions and/or methods of use thereof are for the treatment of human subjects, wherein, in one embodiment, the subject [0619] In one embodiment atherosclerosis refers to a slow, is male, or in another embodiment, the subject is female. complex disease that may begin with damage to the inner most layer of the artery. In another embodiment the causes [0626] Androgen-dependent conditions which may be of damage to the arterial wall may include a) elevated levels treated with the compounds and/or compositions as herein of cholesterol and in the blood; b) high blood pressure; c) described, comprising the methods of the present invention tobacco smoke d) diabetes. In another embodiment, the include those conditions which are associated with aging. In condition is treatable in a smoker, despite the fact that one embodiment, the SARM as described herein is useful in tobacco smoke may greatly worsen atherosclerosis and a) Age-related functional decline (ARFD); b) reversal or speed its growth in the coronary arteries, the aorta and prevention of ARFD; c) reversal or prevention of ARFD in arteries in the legs. Similarly, in another embodiment, the elderly d) reversal or prevention of ARFD-induced sarcope methods of this invention may be useful in treating subjects nia or osteopenia; e) Andropause, andropausal vasomotor with a family history of premature cardiovascular disease symptoms, f) andropausal gynecomastia, muscle strength/ who have an increased risk of atherosclerosis. function; g) bone strength/function; h) Anger: i) Asthenia; j) Chronic fatigue syndrome; k) Cognitive impairment; and/or [0620] In one embodiment, liver damage due to fat depos 1) improving cognitive function. its refer to the build-up of fat in the liver cells forming a Fatty Liver which may be associated with or may lead to [0627] In one embodiment, the SARM compounds as inflammation of the liver. This can cause scarring and described herein are useful in treating inflammation and hardening of the liver. When scarring becomes extensive, it related disorders such as: a) prevention, treatment, or rever is called cirrhosis. sal of arthritis; b) prevention, treatment, or reveral of an arthritic condition such as Behcet’s disease (autoimmune [0621] In another embodiment the fat accumulates in the vasculitis), bursitis, calcium pyrophosphate dihydrate crys liver as obesity. In another embodiment fatty liver is also tal (CPPD), deposition disease (or pseudogout), carpal tun associated with diabetes mellitus, high blood triglycerides, nel syndrome, connective tissue disorders, Crohn’s dieases, and the heavy use of alcohol. In another embodiment fatty Ehlers-Danlos syndrome (EDS), fibromyalgia, gout, infec Liver may occur with certain illnesses such as tuberculosis tious arthritis, inflammatory bowel disease (IBD), juvenile and malnutrition, intestinal bypass surgery for obesity, arthritis, systemic lupus erythematosus (SLE), Lyme’s dis excess vitamin A in the body, or the use of certain drugs such ease, Marfan syndrome, myositis, osteoarthritis, polyarteri as valproic acid (trade names: Depakene/Depakote) and tis nodosa, polymyalgia rheumatica, psoriasis, psoriatic corticosteroids (cortisone, prednisone). Sometimes fatty arthritis, Raynaud’s phenomenon, reflex sympathetic dys liver occurs as a complication of pregnancy. trophy syndrome, Reiter’s syndrome, rheumatoid arthritis, US 2007/028 1906 A1 Dec. 6, 2007 54 scleroderma, Sjögrens’ syndrome, tendonitis or ulcerative invention comprise administering a SARM compound, in colitis; c) preventing, treatment, or reversing an autoimmune combination with a PDE5 inhibitor. In another embodiment, disease. the methods of the present invention comprise administering a SARM compound, in combination with apomorphine. In [0628] In one embodiment, the compositions as described another embodiment, the methods of the present invention herein are useful in prevention of iatrogenic effects com comprise administering a SARM compound, in combination prising acute fatigue syndrome (post-surgical) or androgen with a bisphosphonate. In another embodiment, the methods deprivation therapy (ADT) induced side effects such as of the present invention comprise administering a SARM reduced muscle mass, reduced muscle strength, frailty, compound, in combination with one or more additional hypogonadism, osteoporosis, osteopenia, decreased BMD SARMS. In some embodiments, the methods of the present and/or decreased bone mass. invention comprise combined preparations comprising a [0629] In one embodiment, the methods of the present SARM compound and an agent as described hereinabove. In invention comprise administering a SARM compound as the some embodiments, the combined preparations can be var sole active ingredient. However, also encompassed within ied, e.g., in order to cope with the needs of a patient the scope of the present invention are methods for diabetes subpopulation to be treated or the needs of the single patient and related disorders, hormone therapy, dry eye, obesity, which different needs can be due to the particular disease, treating prostate cancer, delaying the progression of prostate severity of the disease, age, sex, or body weight as can be cancer, and for preventing and/or treating the recurrence of readily determined by a person skilled in the art. In some prostate cancer, male contraception; treatment of osteoporo embodiments, the methods of the present invention com sis, treatment of conditions associated with ADIF and for prise personalized medicine methods which treat the needs treatment and/or prevention of chronic muscular wasting of a single patient. In one embodiment, different needs can which comprise administering the SARM compounds in be due to the particular disease, severity of the disease, the combination with one or more therapeutic agents. These overall medical state of a patient, or the age of the patient. agents include, but are not limited to: LHRH analogs, In some embodiments, personalized medicine is the appli reversible antiandrogens, antiestrogens, anticancer drugs, cation of genomic data to better target the delivery of 5-alpha reductase inhibitors, aromatase inhibitors, medical interventions. Methods of personalized medicine, in progestins, agents acting through other nuclear hormone some embodiments, serve as a tool in the discovery and receptors, selective estrogen receptor modulators (SERM), clinical testing of new products of the present invention. In progesterone, estrogen, PDE5 inhibitors, apomorphine, bis one embodiment, personalized medicine involves the appli phosphonate, and one or more additional SARMS. cation of clinically useful diagnostic tools that may help determine a patient’s predisposition to a particular disease or [0630] Thus, in one embodiment, the methods of the condition. In some embodiments, personalized medicine is a present invention comprise administering the SARM com comprehensive approach utilizing molecular analysis of pound, comprise administering a SARM compound in com both patients and healthy individuals to guide decisions bination with diabetes drug such as Troglitazone, Rosigli throughout all stages of the discovery and development of tazone, and Pioglitazone. In another embodiment, the pharmaceuticals and diagnostics; and applying this knowl methods of the present invention comprise administering a edge in clinical practice for a more efficient delivery of SARM compound in combination with an LHRH analog. In accurate and quality healthcare through improved preven another embodiment, the methods of the present invention comprise administering a SARM compound, in combination tion, diagnosis, treatment, and monitoring methods. with a reversible antiandrogen. In another embodiment, the [0631] It is to be understood that any use of any of the methods of the present invention comprise administering a SARMs as herein described amy be used in the treatment of SARM compound, in combination with an antiestrogen. In any disease, disorder or condition as described herein, and another embodiment, the methods of the present invention represents an embodiment of this invention. comprise administering a SARM compound, in combination [0632] The following examples are presented in order to with an anticancer drug. In another embodiment, the meth more fully illustrate the preferred embodiments of the inven ods of the present invention comprise administering a tion. They should in no way, however, be construed as SARM compound, in combination with a 5-alpha reductase limiting the broad scope of the invention. inhibitor. In another embodiment, the methods of the present invention comprise administering a SARM compound, in EXAMPLES combination with an aromatase inhibitor. In another embodi ment, the methods of the present invention comprise admin Example 1 istering a SARM compound, in combination with a proges tin. In another embodiment, the methods of the present invention comprise administering a SARM compound, in Androgenic & Anabolic Activity of Compound III combination with an agent acting through other nuclear in Intact and ORX Subjects hormone receptors. In another embodiment, the methods of the present invention comprise administering a SARM com Materials and Methods pound, in combination with a selective estrogen receptor [0633] Male Sprague-Dawley rats weighing approxi modulators (SERM). In another embodiment, the methods mately 200 g were purchased from Harlan Bioproducts for of the present invention comprise administering a SARM Science (Indianapolis, Ind.). The animals were maintained compound, in combination with a progesterone. In another on a 12-hlight/dark cycle with food (7012C LM485 Mouse/ embodiment, the methods of the present invention comprise Rat Sterilizable Diet, Harlan Teklad, Madison, Wis.) and administering a SARM compound, in combination with an water available ad libitum. The animal protocol was estrogen. In another embodiment, the methods of the present reviewed and approved by the Institutional Animal Care and US 2007/028 1906 A1 Dec. 6, 2007

Use Committee of the University of Tennessee. Anabolic pound III maintained prostate weights at 8%+2%, 20%+5%, and androgenic activity of Compound III in intact animals 51%+19%, 56%–9%. 80%+28%, and 74+12.5% of intact was evaluated and also compared to Oxandrolone, and the controls, respectively. (FIG. 2). dose response in acutely orchidectomized (ORX) animals [0639] Compound III partially maintained seminal vesicle was evaluated as well. Regenerative effects of Compound III weights in ORX animals, as well. While in castrated con in chronically (9 days) ORX rats were also assessed. trols, seminal vesicle weight decreased to 13%+2% of intact [0634] The compound was weighed and dissolved in 10% controls, Compound III treated animal weights were DMSO (Fisher) diluted with PEG 300 (Acros Organics, NJ) 12%-4%, 17%+5%, 35%+10%. 61%+15%, 70%+14%, and for preparation of the appropriate dosage concentrations. 80%:6% of intact controls, following doses of 0.01, 0.03, The animals were housed in groups of 2 to 3 animals per 0.1, 0.3, 0.75, and 1.0 mg/day, respectively (FIG. 2). cage. Intact and ORX animals were randomly assigned to [0640] In ORX controls the levator ani muscle weight one of seven groups consisting of 4 to 5 animals per group. decreased to 55%:7% of intact controls, while Compound Control groups (intact and ORX) were administered vehicle III treated animals fully maintained and increased levaor ani daily. Compound III was administered via oral gavage at muscle weights at doses >0.1 mg/day, with muscle weights doses of 0.01, 0.03, 0.1, 0.3, 0.75, and 1 mg/day to both of 59%+6%. 85%+9%, 11.2%+10%, 122%+16%, 127+12%, intact and ORX groups. and 130+2% of intact control weights for the 0.01, 0.03, 0.1, [0635] Castrated animals (on day one of the study) were 0.3, 0.75, and 1.0 mg/day dose groups, respectively, randomly assigned to dose groups (4-5 animals/group) of observed. (FIG. 2). 0.01, 0.03, 0.1, 0.3, 0.75, and 1 mg/day, for dose-response evaluation. Dosing began nine days post ORX and was [0641] Levator ani muscle weight in intact rats following administered daily via oral gavage for fourteen days. The Compound III treatment were 120%+10%, 118%+5%, animals were sacrificed under anesthesia (ketamine/xy 130%+5%. 135%+5%, 122%+10%, and 1.45%+20% of alzine, 87:13 mg/kg) after a 14-day dosing regimen, and intact controls for the 0.01, 0.03, 0.1, 0.3, 0.75, and 1.0 body weights were recorded. In addition, ventral prostate, mg/day doses, respectively. seminal vesicles, and levator ani muscle were removed, [0642] Prostate weight in intact rats following Compound individually weighed, normalized to body weight, and III treatment were 110+10%, 90%+15%, 80%–15%, expressed as a percentage of intact control. Student’s T-test 70%+15%, 70%-15%, and 90%+15% of intact controls for was used to compare individual dose groups to the intact the 0.01, 0.03, 0.1, 0.3, 0.75, and 1.0 mg/day doses, respec control group. Significance was defined a priori as a tively. P-value-0.05. As a measure of androgenic activity, ventral [0643] Pharmacology results following 1 mg/day of com prostate and seminal vesicle weights were evaluated, pound III exhibited that prostate weight was 87%+13% of whereas levator ani muscle weight was evaluated as a intact control and levator ani muscle weight was 146%+17% measure of anabolic activity. Blood was collected from the of intact control. Compound III maintained prostate weight abdominal aorta, centrifuged, and sera were frozen at —80° following orchidectomy at 74+12.5% of intact controls and C. prior to determination of serum hormone levels. Serum levator ani muscle weight at 130+2% of intact controls. 0.1 lutenizing hormone (LH) and follicle stimulating hormone mg/day of Compound III restored 100% of levator ani (FSH) concentrations were determined. muscle weight, while 51+20% prostate weight was restored. [0644] Oxandrolone treatment of ORX animals, was less Results anabolic than Compound III, with levator ani weights being [0636] Prostate weights following Compound III treat 50% of intact controls, and not dosage dependant when ment were 111%+21%, 88%+15%, 77%+17%, 71%+1.6%, administered at 0.1-1 mg/day (FIG. 3). 71%+10%, and 87%+13% of intact controls following doses [0645] Ema, and EDso, were determined in each tissue by of 0.01, 0.03, 0.1, 0.3, 0.75, and 1 mg/day, respectively FIG. nonlinear regression analysis in WinNonlin R and presented 1). Similarly, seminal vesicle weights decreased to in FIG. 4. ED50 indicates the dose of Compound III result 94%+9%, 77%+11%, 80%+9%, 73%+12%. 77%+10%, and ing in 50% of the maximal response, which is the E E 88%+14% of intact controls following doses of 0.01, 0.03, values were 83%+25%, 85%+11%, and 13.1%+2% for pros 0.1, 0.3, 0.75, and 1 mg/day, respectively (FIG. 1). Signifi tate, seminal vesicles, and levator ani, respectively. The cant increases were seen in levator ani muscle weights of ED. in prostate, seminal vesicles, and levator ani was sham animals, however, in all dose groups, when compared 0.05:007, 0.17+0.05, and 0.02+0.01 mg/day, respectively. to intact controls. The levator ani muscle weights were 120%+12%, 116%+7%, 128%+7%. 134%+7%, 125%+9%, Serum Hormone Analysis and 146%+17% of intact controls corresponding to 0.01, [0646] Serum LH and FSH concentrations for the animals 0.03, 0.1, 0.3, 0.75, and 1.0 mg/day dose groups, respec are presented in Table 2. LH decreased in a dose-dependent tively (FIG. 1). manner in both intact and castrated animals, as a function of [0637] Compound III exhibited anabolic muscle/prostate treatment with the compound. Following doses >0.1 mg/day, ratio in castrated rats of 7.56, 4.28, 2.21, 2.19, 1.57 and 1.75 LH levels were below the limit of quantitation (0.07 ng/mL). following doses of 0.01, 0.03, 0.1, 0.3, 0.75 and 1 mg/day, The 0.1 mg/day dose in ORX animals returned LH levels respectively. back to those seen in intact controls. Similar effects were observed with FSH. In intact animals, a significant decrease [0638] Compound III partially maintained prostate weight in FSH levels was observed with the 0.75 and 1 mg/day following orchidectomy. Prostate weight in vehicle treated doses. In ORX animals, a dose-dependent decrease in FSH ORX controls decreased to 5% +1% of intact controls. At levels was observed. Doses of Compound III -0.1 mg/day in doses of 0.01, 0.03, 0.1, 0.3, 0.75, and 1.0 mg/day, Com ORX animals returned FSH levels to those of intact controls. US 2007/028 1906 A1 Dec. 6, 2007 56

TABLE 2

Serum LH and FSH levels from animals in Arm 1 and Arm2. Lulenizing Hormone Follicle Stimulating Hormone Compound III Intact ORX Intact ORX (mg/day) (ng/ml) (ng/ml) (ng/ml) (ng/ml) Vehicle 0.281 + 0.126° 9.66 + 1.13° 6.40 + 1.58" 43.45 + 4.97° 0.01 0.195 + 0.106° 8.45 + 2.44" 5.81 + 0.31° 36.23 + 7.75° 0.03 0.176 + 0.092% 4.71 + 1.72* 5.74 + 0.78% 40.15 + 3.33° 0.1 0.177 ± 0.058° 0.778 + 0.479° 6.60 + 1.06% 20.69 + 3.52* 0.3

*P × 0.05 vs. Intact Controls. *P º 0.05 vs. ORX Controls.

Androgenic & Anabolic Activity Following 102+13 mg/dL respectively. These values are considered Delayed Dosing within the normal historical range for the testing laboratory. [0647] Compound III partially restored both prostate and Daily oral doses of Compound III at or above 3 mg/kg seminal vesicle weight in ORX animals. Prostate weights caused a significant reduction in total cholesterol levels in were restored to 9%+3%, 11%+3%, 23%-5%, 50%+13%, both male and female rats. At 3 mg/kg, compared to vehicle 62%+12%, and 71%+5%, while seminal vesicle weights control animals, an approximate 30% reduction in total were restored 7%+1%, 9%+1%, 23%+8%, 49%+5%, cholesterol was noted where males and females had 63+17.4 67%–12%, and 67%:11% of intact controls for 0.01, 0.03, and 74+14.2 mg/dL respectively. Although a slightly greater 0.1, 0.3, 0.75, and 1.0 mg/day dose groups, respectively. effect was noted at the highest dose group (100 mg/kg per Compound III fully restored levator ani muscle weight at day), in general, a dose-response relationship was not doses >0.1 mg/day. Levator ani muscle weights were observed in the reduction of total cholesterol levels in the restored to 56%-7%. 82%+9%, 103%+11%, 1.13%+11%. Sprague Dawley rat. Results are presented graphically in 121%+7%, and 120%+7% corresponding to doses of 0.01, FIG. 7. 0.03, 0.1, 0.3, 0.75, and 1.0 mg/day, respectively. Results are presented graphically in FIG. 5. Ema, and EDso values were determined in each tissue by nonlinear regression analysis in Example 3 WinNonlin(R) and presented in FIG. 6. Enº, values were 75%+8%, 73%+3%, and 126%+4% for prostate, seminal SARM Promotion of Lean Mass and Reduction of vesicles, and levator ani, respectively. The EDso in prostate, Fat Mass in Human Clinical Trials seminal vesicles, and levator ani was 0.22+0.05, 0.21+0.02, and 0.013+0.01 mg/day, respectively. [0650] Five groups of 24 human subjects per group (12 males and 12 females) of 60 elderly men (age -60) and 60 Example 2 postmenopausal women (not hypogonadal, not osteoporotic, no exercise program, no controlled diet) were dosed each in SARM Reduction of Cholesterol Levels a randomized, double-blind study design. Each subject received 0.1 mg, 0.3 mg, 1 mg, and 3 mg Compound III (or Materials and Methods placebo of equal volume) in solution or in experimental capsules for 90 days treatment. Total lean body mass [0648] One hundred Sprague Dawley rats (50 male and 50 (DEXA=dual energy x-ray absorptiometry), fat mass and female) were divided into five groups (n=10 per gender per group), representing vehicle only (PEG300:40% Cavasolº performance were analyzed. [75/25 (v/v)]), and four dose groups of Compound III. Animals were administered Compound III once daily by oral Results gavage according to their most recent body weight with doses of either 0, 3, 10, 30 or 100 mg/kg. During the study Total Lean Mass (DEXA) Effects period, rats had access to water and a standard laboratory diet of Harlan Taklad Rodent Chow ad libitum. After 28 [0651] All subjects (average age=64 years)(n=114) exhib consecutive days of dosing, animals were fasted overnight, ited a dose-dependent increase in Lean Body Mass (LBM) blood samples were collected and serum was obtained. following treatment with 0.1 mg, 0.3 mg, 1 mg and 3 mg of Serum levels of total cholesterol were determined using an Compound III (FIG. 8). automated laboratory assay method. [0652] Treatment with 3 mg Compound III exhibited LBM increase of about 3.1+3.4% compared to baseline with Results a p<0.0001 (ANOVA). The 1 mg dose of Compound III [0649] The male and female rats in the vehicle only group exhibited an increase of 1.3+2.7% compared to baseline (0 mg/kg) had serum total cholesterol values of 92+13.5 and with a p=0.020 (ANOVA). US 2007/028 1906 A1 Dec. 6, 2007 57

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline 44615 + 96.7 46400 + 9350 452.58 + 10.103 481.54 + 10590 45031 + 10255 Mean + SD (g) Mean –73.2 + 1126.8 164.0 + 868.2 78.0 + 1150.3 588.7 + 1257.5 1246.3 + 1288.0 absolute change from baseline + SD (g) p-value 0.474 0.651 0.055 <0.001 (compared to placebo) p-value 0.754 0.838 0.741 0.020 <0.0001 (compared to baseline) Mean 9% 0.1 + 2.7 0.3 + 2.0 0.4 + 2.7 1.3 + 2.7 3.1 + 3.4 change from baseline + SD

[0653] Females (average age 63 years) (n=56) exhibited a [0656] The site of fat loss was different among males and dose-dependent increase in LBM when administered a 3 mg females. Males tended to lose from the trunk/abdomen about dose of Compound III, with an increase of 1.7 kg compared 1.4 kg compared to the placebo (and 0.5 kg from baseline) to baseline and an increase of 1.4 kg compared to placebo with 3 mg (p=0.237) and 1.7 kg compared to the placebo with a p–0.02 (ANOVA). Females administered the 1 mg (and 0.8 kg from baseline) with 1 mg (p=0.810) doses. dose of Compound III exhibited an increase of 0.4 kg Females tended to lose from the thigh and legs about 1 kg compared to baseline and no changes compared to placebo compared to the placebo (and 0.5 kg from baseline) with 1 with a p=0.884 (ANOVA) mg (p=0.038) and 3 mg (p=0.212) doses. [0654] Males (Average age 66 years) (n=58) exhibited a dose-dependent increase in LBM when administered a 1 mg dose of Compound III, with an increase of 0.7 kg compared to baseline and an increase of 1.2 kg compared to placebo Placebo 1 mg 3 mg with a p-0.03 (ANOVA). Males administered the 3 mg dose Females 529 + 1210 –514 + 941 —50.2 + 909 0.038 0.212 of Compound III exhibited an increase of 1 kg compared to Males 91.8 + 1013 –8.26 + 949 –540 + 1486 baseline and an increase of 1.4 kg compared to placebo with 0.810 0.237 a p-0.005 (ANOVA). Fat Mass (DEXA) Effects [0657] Total tissue percent fat, relative to lean muscle [0655] All subjects exhibited a dose-dependent decrease mass decreased in a dose-dependent fashion, at the 1 mg in total fat for the 0.3 mg, 1 mg and 3 mg doses of dose achieving p-0.02 (ANOVA) and at 3 mg, achieving Compound III with p=0.242, 0.085 and 0.049 respectively. p=0.006 (ANOVA) for all subjects. The decrease in tissue All subjects exhibited an increase in fat mass for the 0.1 mg percent fat in women administering 3 mg was highest, (FIG. 9). At 3 mg, the loss was 0.6 kg compared to placebo compared to administering 1 mg of Compound III, and and 0.3 kg (0.4%) from baseline with a p=0.049. compared to men administered the same doses.

Placebo 0.1 mg 0.3 mg 1 mg 3 mg (gr) (gr) (gr) (gr) (gr) Baseline 20807 it 8689 23355 + 6019 21555 + 6694 22561 + 5659 20493 + 6932 Mean + SD(g) Mean 304.7 -i- 1105.2 222.47 + 958.0 –65.4 + 1055.0 –255.1 + 948.0 –321.9 + 1282.0 absolute change from baseline + SD(g) p-value 0.793 0.242 0.085 0.049 (compared to placebo) Mean 9% 1.3 + 7.1 1.3 + 5.1 0.2 + 5.1 —1.3 + 4.4 –0.4 + 6.9 change from baseline + SD US 2007/028 1906 A1 Dec. 6, 2007

Performance Effects Hepatic Effects [0658] In order to analyze the physical performance [0665] It is well known that natural anabolic steroids and (which reflects the gain of quality LBM), a stair climb (time synthetic anabolic steroids induce elevations in liver tran and power) study was conducted. Subjects climbed 12 stairs saminases, in particular ALT and AST. Compound III, in and data was collected as a function of time (speed) and contrast, appeared to minimally affect ALT and AST levels. power. Of the 120 patients evaluated, 1 female patient exhibited an isolated ALT elevation with no other clinically meaningful [0659] Speed: A dose-dependent decrease in the time changes including no changes in alkaline phosphatase, GTT, needed to climb 12 stairs was observed with the 3 mg dose and total bilirubin levels. Of the 114 patients that completed of Compound III showing a 15.5% decrease in time the trial, there were no clinically meaningful changes in (p=0.006, ANOVA). ALT, AST, alkaline phosphatase, GGT, or bilirubin levels at [0660] Power Exerted: A dose-dependent increase in 3 months post-initiation. power was observed. In subjects with the 3 mg dose of Compound III, there was 25.5% more power observed than Lipid Profile Effects in the placebo group (p=0.005, ANOVA). An increase of 62 [0666] Circulating cholesterol, LDL, VLDL, triglyceride watts is approximately 8 times what is considered clinically and HDL levels were analyzed: High dose testosterone and significant in a middle-aged to elderly non-athlete. other anabolic steroids have the ability to reduce cholesterol [0661] Thus, Compound III built lean body mass in both and profoundly reduce HDL (60-80%). Compound III men and women and lowered the percent body fat. This lean reduced total cholesterol, LDL, VLDL, and triglycerides in body mass improvement translated to improved perfor a dose-dependent manner. A dose-dependent reduction in mance and power on a stair climb, which indicates, inter HDL was seen, as well, however not of the magnitude of alia, that Compound III improves strength and provides a other orally administered anabolic agents. LDL/HDL ratios, clinical benefit in the elderly and in persons where a con which are a well established way to identify cardiovascular dition such as cancer or chronic kidney disease has caused risk, revealed that Compound III treated subjects and pla muscle wasting. cebo groups were in the low or below cardiovascular risk category at all doses. Bone Mass Effects Body Weight Effects [0662] Bone Mineral Density (BMD) (DEXA). BMD measurements in treated patients were not different from [0667] All subjects total body weight was measured post baseline or from placebo. This was not unexpected since 90 administration of Compound III. A dose-dependent change days of dosing and measurement is insufficient time to in total body weight of all subjects given a 0.1 mg, 0.3 mg, observe meaningful changes in BMD. 1 mg and 3 mg dose of Compound III was observed. Treatment with 0.3 mg or 3 mg Compound III exhibited an [0663] Bone resorption and turnover markers: In preclini increase of 1 kg compared to placebo (and 0.9 kg, from cal in vitro and in vivo models of osteoporosis tested, baseline), with a p=0.196 and 0.178 respectively, (ANOVA).

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline 68.0 + 72.0 72.5 + 10.6 68.6 + 15.9 72.9 + 13.7 62.5 + 13.5 Mean + SD Mean absolute —0.1 + 2.3 0.4 + 1.3 0.9 + 4.9 0.3 + 1.7 0.9 + 1.7 change from baseline + SD p-value 0.510 0.196 0.550 0.178 (compared to placebo) p-value 0.791 0.504 0.121 0.568 0.105 (compared to baseline) Mean 9% —0.1 + 3.5 0.5 + 1.8 3.1 + 15.0 0.4 + 2.3 1.7 ± 2.7 change from baseline + SD

Compound III demonstrated both anabolic and antiresorp [0668] A dose-dependent change in total body weight of tive activity affecting both the osteoblasts and osteoclasts. women given a 3 mg dose of Compound III was observed, with an increase of 0.8 kg compared to placebo (and 1.63 kg Safety from baseline) with a p–0.279 (ANOVA) and with the 1 mg dose a decrease of 0.9 kg compared to the placebo with a [0664] Adverse Events (AEs) and Severe Adverse Events p=0.215 (ANOVA). (SAEs)—Compound III was shown to be safe and well tolerated. There were no trends in AEs and there were no [0669] A dose-dependent change in total body weight of SAEs reported during 90 day study period. men with the 3 mg dose of Compound III was observed, with US 2007/028 1906 A1 Dec. 6, 2007 59 an increase of 0.7 kg compared to placebo with a p=0.277 Less LH leads to lower endogenously produced testosterone. (ANOVA) and with the 1 mg dose an increase of 1 kg LH levels (U/L) changed relative to placebo groups, as a compared to the placebo with a p=0.193 (ANOVA). function of treatment with Compound III. [0671] Administration of 0.1 mg to women led to a 12+1.14 U/L increase (p=0.01) in LH, to a 0.841.14 U/L Placebo 1 mg 3 mg decrease (p=0.466) in men. Females 0.850 + 2.09 –0.080 + 1.02 1.63 + 1.10 [0672] Administration of 0.3 mg to women led to a 0.215 0.279 1.8+1.09 U/L decrease (p=0.403) in LH, to a 0.1+1.19 U/L Males –0.375 + 1.45 0.655 + 2.18 0.383 + 1.85 increase (p=0.834) in men. 0.193 0.277 [0673] Administration of 1 mg to women led to a 2.6+1.19 U/L decrease (p=0.780) in LH, to a 0.7+1.14 U/L decrease (p=0.476) in men. Hormonal Effects [0674] Administration of 3 mg to women led to a 6.4+1.14 [0670] Testosterone and other anabolic steroid agents sup U/L reduction (p=0.039) in LH, to a 0.5+1.09 U/L decrease press LH secretion by feedback inhibition on the pituitary. (p=0.543) in men.

Placebo 0.1 mg 0.3 mg 1 mg 3 mg

FEMALES Change in -3.1 + 1.14 1.2 + 1.14 -1.8 + 1.09 –2.6 + 1.19 —6.4 + 1.14 LS mean from baseline + SE (U/L) p-value 0.010 0.403 0.780 0.039 (compared to from placebo) MALES Change in 0.4 + 1.09 –0.8 + 1.14 0.1 + 1.19 —0.7 + 1.14 –0.5 + 1.09 LS mean from baseline + SE (U/L) p-value 0.466 0.834 0.476 0.543 (compared to from placebo)

[0675] SHBG is a sensitive marker of anabolic activity. Anabolic agents lower SHBG levels. In this study, consistent with its anabolic activity, Compound III exhibited a dose dependent, profound reduction of SHBG levels. Adminis tration of 0.1 mg, 0.3 mg, 1 mg or 3 mg Compound III resulted in reduction of SHBG levels in men and women.

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Females Change in –16.5 + 5.82 —1.1 + 5.82 – 21.2 + 5.57 –55.8 + 6.11 –52.9 + 5.82 LS mean from baseline + SE (nmol/L) p-value 0.064 0.564 <0.001 <0.001 (compared to from placebo) US 2007/028 1906 A1 Dec. 6, 2007 60

-continued Placebo 0.1 mg 0.3 mg 1 mg 3 mg Males Change in -10.0 + 5.57 –6.1 + 5.82 – 12.4 + 6.11 —19.1 + 5.82 – 25.8 + 5.57 LS mean from baseline + SE (nmol/L) p-value 0.627 0.775 0.265 0.048 (compared to from placebo)

[0676] Endogenous free testosterone levels decreased currently associated with non-specific androgenic agents, relative to placebo groups post-administration of 0.1 mg, 0.3 and d) was well tolerated with no serious adverse events mg or 1 mg to women, and had no change relative to placebo reported. post administration of 3 mg Compound III. [0681] In addition, there were reductions in total choles [0677] Free testosterone levels in men increased relative to terol, LDL and HDL levels. There were no AEs or detri placebo groups post administration of 0.1 mg, 0.3 or 3 mg mental changes in other cardiovascular risk factors as mea of Compound III and had almost no change relative to sured in the study (such as blood pressure, insulin placebo groups post administration of 1 mg Compound III. sensitivity). The data shows that there is a 20% decline in

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Females Change in LS –0.5 + 2.80 –2.0 + 2.99 — 1.0 + 2.50 –0.9 + 2.64 –0.5 + 3.23 mean from baseline + SE (pmol/L) p-value 0.718 0.887 0.922 0.995 (compared to from placebo) Males Change in LS —11.2 + 2.64 0.5 + 2.80 2.7 ± 2.80 – 11.0 + 2.54 – 8.2 + 2.50 mean from baseline + SE (pmol/L) p-value 0.003 <0.001 0.966 0.413 (compared to from placebo)

[0678] A potential side effect of testosterone and other HDL while LDL, triglycerides and total cholesterol are androgenic anabolic steroids is stimulation of the prostate. lowered in the presence of increased muscle and decreased Measurement of serum PSA is a sensitive measure of body fat. stimulation of the prostate gland. Compound III had no [0682] A 1.5 kg (3.3 lb) improvement in lean body mass effect on serum PSA levels at any dose tested. is clinically meaningful and consistent with what is seen with other anabolic agents. As men lose a V2 lb. per year this [0679] Androgenic steroids stimulate sebaceous glands, would represent reversing 7 years of muscle loss in 3 which play a role in producing sebum and hair. Compound months. The lean body mass improvement translates to an III did not show any significant changes in hair growth in improvement in function and muscle power. The improve women. Increased sebum production can lead to acne and ment was seen in both men and women at the same dose that oily skin, an unwanted side effect. Sebum production was improved muscle mass. This indicates that if the SARM measured in both men and women. Compound III did not compound of formula III delivers the same lean body mass affect sebum production in men or women compared to improvement in the elderly population or those people placebo, had no virilization effect and did not cause Acne in suffering from conditions which accelerate muscle wasting men and women. then it would also provide a functional benefit and improved quality of life. [0680] Compound III: a) built lean body mass in both men and women and lowered the percent body fat, b) improved Example 4 performance and power on a stair climb, thus improving strength and providing a clinical benefit in the elderly and in Compound III-Mediated Reduction of Glucose and people where a condition such as cancer or chronic kidney Insulin Levels disease has caused muscle wasting, c) was minimally andro [0683] Five groups of 24 human subjects per group (12 genic thus diminishing risks of hirsitism and prostate cancer males and 12 females) of 60 elderly men (age -60) and 60 US 2007/028 1906 A1 Dec. 6, 2007 61 postmenopausal women (not hypogonadal, not osteoporotic, no exercise program, no controlled diet) were dosed each in a randomized, double-blind study design. Each subject received 0.1 mg, 0.3 mg, 1 mg, and 3 mg Compound III (or Placebo 1 mg 3 mg placebo of equal volume) in solution or in experimental All subjects —1.4 + 5.2 –2.5 + 6.2 –8.6 + 9.1 capsules for 90 days treatment. Glucose and insulin levels Absolute change from (mg/dL) (mg/dL) (mg/dL) were analyzed. baseline 0.470 0.004 Females —1.2 + 5.6 –4.5 + 7.5 —11.4 + 10.0 Results Absolute change from (mg/dL) (mg/dL) (mg/dL) baseline 0.343 0.012 [0684] The subjects exhibited dose-dependent decreases Males —1.5 + 5.0 —1.6 + 5.6 —4.9 + 6.7 in total circulating insulin levels post-administration of 0.3 Absolute change from (mg/dL) (mg/dL) (mg/dL) mg, 1 mg or 3 mg of Compound III for all subjects (all baseline 0.998 0.247 fasting subjects). Treatment with 3 mg Compound III exhib ited decrease in insulin levels of about 17.6+43.5 pmol/L compared to baseline with a p=0.043 (ANOVA). The 1 mg The decrease in the concentration of glucose in women, dose of Compound III exhibited decrease of 5.43+16.7 post-administration of Compound III was twice as high as pmol/L compared to baseline with a p-0.143 (ANOVA). that in men.

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline 43.3 + 21.3 44.1 + 26.1 38.1 + 26.6 56.6 + 37.1 52.9 + 48.5 Mean + SD (pmol/L) Mean absolute —0.32 + 14.5 4.96 + 21.0 — 1.30 + 19.0 —5.43 + 1 6.7 – 17.6 + 43.5 change from baseline + SD (pmol/L) p-value 0.169 0.423 0.143 0.043 Mean 9% 0.5 + 31.9 19.2 + 49.7 5.9 + 44.2 –6.9 + 24.9 —17.6 + 37.0 change from baseline + SD

[0685] All subjects (all fasting) exhibited dose-dependent Example 5 decreases in total glucose levels post-administration of 0.3 mg, 1 mg or 3 mg of Compound III. Treatment with 3 mg Compound III-Mediated Reduction of Insulin Compound III exhibited decrease in glucose levels of Resistance (HOMA-IR) 11.1+7.4% compared to baseline. The 1 mg dose of Com pound III exhibited decrease of 3.5+6.3% compared to [0687] Five groups of 24 human subjects per group (12 baseline with a p=0.764 (ANOVA). males and 12 females) of 60 elderly men (age -60) and 60

Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline 5.09 + 0.44 5.17 + 0.50 4.85 + 0.41 5.29 + 0.39 5.22 + 0.51 Mean + SD mmol/L Mean absolute —0.19 + 0.35 0.2 + 0.42 –0.01 + 0.42 –0. 19 + 0.33 –0.60 + 0.44 change from baseline + SD Mmol/L p-value 0.039 0.064 0.481 <0.001 Mean 9% –3.5 + 6.5 0.7 + 8.2 0.3 + 9.9 –3.5 + 6.3 —11.1 + 7.4 change from baseline + SD

[0686] Females exhibited a dose-dependent decrease in postmenopausal women (not hypogonadal, not osteoporotic, total glucose levels post-administration of 1 mg or 3 mg of no exercise program, no controlled diet) were dosed each in Compound III, with the 1 mg dose achieving p=0.343 a randomized, double-blind study design. Each subject (ANOVA) and the 3 mg achieving p=0.012 (ANOVA). received 0.1 mg, 0.3 mg, 1 mg, and 3 mg Compound III (or Males exhibited a dose-dependent decrease in total glucose placebo of equal volume) in solution or in experimental levels post-adminstration of 1 mg or 3 mg doses of Com capsules for 90 days treatment. Insulin resistance was ana pound III, with the 1 mg dose achieving p=0.998 (ANOVA) lyzed, calculated from the mean fasting glucose and insulin and the 3 mg dose achieving p-0.247 (ANOVA). levels.

US 2007/028 1906 A1 Dec. 6, 2007 osteal perimeter (circumference) and endosteal perimeter bone density over the OVX vehicle control group to 360 were determined at the mid-shaft of the femur. At the distal mg/mm and estradiol (E2) increased trabecular bone density femur, total bone mineral content, total bone area, total bone to 415 mg/mm’, Alendronate increased trabecular bone mineral density, trabecular bone mineral content, trabecular density to 480 mg/mmº. The combination therapy of Alen bone area and trabecular bone mineral density were deter dronate and Compound III showed additive effects increas mined. Following p(JCT analysis, the femoral strength was ing trabecular bone density to 552 mg/mm2. determined by a three-point bending test. The anterior to [0698] Rat distal femur representative reconstructions posterior diameter (APD) (unit:mm) at the midpoint of the were prepared by standard methodology. As seen in FIG. femoral shaft was measured with an electronic caliper. The 12B, while OVX animals show pronounced loss of normal femur was placed on the lower supports of a three-point architecture (panel B), OVX Compound III-treated animals bending fixture with the anterior side of the femur facing provided a structure comparable to intact controls (panel D). downward in an Instron Mechanical Testing Machine (Instron 4465 retrofitted to 5500)(Canton, Mass.). The [0699] Ovariectomized animals may serve as a model for length (L) between the lower supports was set to 14 mm. The females suffering from ADIF, and as such, one embodiment upper loading device was aligned to the center of the femoral of this invention is treatment thereof, for example, via shaft. The load was applied at a constant displacement rate administration of Compound III as exemplified herein. of 6 mm/min until the femur broke. The mechanical testing [0700] As evident from FIGS. 12C (BV/TV) and 12D machine directly measured the maximum load (Fº) (unit:N), (trabecular number), Compound III prevented gonadec stiffness (S) (units:N/mm), and energy absorbed (W) (unit:m?). The axial area moment of inertia (1) (unit:mm”) tomy-induced losses in trabecular bone in males, as well. was calculated by the software during the pGACT analysis of Example 8 the femoral mid-shaft. Stress (a) (units:N/mm3), elastic modulus (E) (unit:Mpa), and toughness (T) (units:m.J/mº.) Pharmacokinetics of Compound III were calculated by the following formulas: stress: O-(F,”L*(a/2))/(4*I); elastic modulus: E=S*L*/(48*I); and [0701] In order to determine the pharmacokinetics of toughness: T=3*W*(APD/2)/(L*I). Compound III, the compound was administered to beagle dogs perorally, and circulating plasma levels, Cmax, trnax, [0695] Statistical analysis was performed by Student’s t1/2, AUC and F 9% (FIG. 13 and the Table below, respec T-test. P-values of less than 0.05 were considered as statis tively) were determined. Comound III was rapidly and tically significant differences. completely absorbed.

Male 1 mg/kg Soln. Female 1 mg/kg Soln. Male 1 mg/kg Cap. Female 1 mg/kg Cap. Cmax 0.91 + 0.1 0.56 + 0.26 0.59 + 0.16 0.58 + 0.06 mg/mL) triläx 250 + 1 61 165 + 211 120 + 37 250 + 313 (min) t1/2 (hr) 24.3 35.5 21.0 35.5 AUC 1.96 + 0.72 1.66 + 0.70 1.22 + 0.34 1.71 + 0.43 minºmg/mL F 9% 104.9% 73.5% 64.8% 75.6%

[0696] Male rats were subjected to Orchiectomy (ORX), Example 9 and on days 1-119 were administered perorally by gavage a vehicle, different doses of Compound III (0.1, 1, and 3 Mapping of AR Binding Sites mg/d), with or without alendronate (1 mg/d), and alendr onate alone. After sacrifice at the indicated times, mice were Materials and Methods sacrificed, fermus removed and subjected to pCOCT analysis and a 3-point bending assay. Vertebra were harvested as Reagents well, and crush assay of L5 was conducted. Tibias were [0702] AR and SHC-1 antibodies were obtained from subjected to static and dynamic histomorphometry (calcein). Upstate Biotechnology (Lake Placid, N.Y.), SRC-1 antibody Results was obtained from Santacruz Biotechnology (Santa Cruz, Calif.). Protein A Sepharose was obtained from Amersham [0697] Trabecular bone mineral density was analyzed by Pharmacia (Piscataway, N.J.). WTS reagent was purchased pOCT at the distal femur. Results are shown in FIG. 12A. Significant trabecular bone loss was observed following from Roche (Nutley, N.J.). All cell culture medium was OVX. Trabecular bone density decreased from 379 to 215 obtained from Invitrogen (Carlsbad, Calif.) and the serum mg/mm in the intact and OVX vehicle control groups, for cell culture obtained from Atlanta Biologicals (Atlanta, respectively. In intact animals treated with Compound III, a Ga.). All other reagents used were analytical grade. slight increase in trabecular bone density to 398 mg/mm’ Cell Culture was observed. In OVX animals treated with Compound III, a significant increase was observed over the OVX vehicle [0703] LNCaP prostate cancer cells, were obtained from control group to 406 mg/mm2. DHT increased trabecular ATCC (Manassas, Va.). The cells were grown in RPMI 1640 US 2007/028 1906 A1 Dec. 6, 2007 64

(containing 2 mM L-glutamine, 10 mM HEPES, 1 mM Realtime PCR Primers for ChIP Assay Sodium Pyruvate, penicillin and streptomycin) supple mented with 10% fetal bovine serum (FBS). For the ChIP [0706] assays, cells were plated in 150 mm dishes at 10 million cells per dish in RPMI 1640 supplemented with 1% charcoal stripped FBS. The cells were maintained in 1% csFBS for 6 Primer Name Sequence days to reduce basal occupancy of promoters with medium MSX Forward AACCCAGCCACAGACTAAAGA changed on days 1 and 3 and before treatment on day 6. Primer

MSX Reverse TCCCTTGTTCTCGTTCCTTC Chromatin Immunoprecipitation Assay (ChIP) Primer

[0704] ChIP assays were performed as described earlier MSX TaqMan AAAGAGGAGCGGAAAAGAGGGCTG (Narayanan, R. et al., 2005). The proteins were cross-linked Probe by incubation with 1% formaldehyde (final concentration) at APIG Forward GGGTCCGAGTTCTTGGATAA 37°C. for 10 min. The cells were washed with 1xPBS twice, Primer scraped in 1 ml of PBS containing protease inhibitors ([1 mg APIG reverse ATCCTGAGGAAGGAGGGAGT each of aprotinin, leupeptin, antipain, benzamidine HCl, and Primer pepstatin/ml], 0.2 mM phenylmethylsulfonyl fluoride, and 1 APIG TaqMan GGACAGGGAGCGAAGTTTCCTCAA mM sodium vanadate), pelleted, and resuspended in SDS Probe lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HC1 [pH AXIN-1 Forward ATTCCAAGGACCTGCAACG 8.1]). After lysis on ice for 10 min, the cell extract was Primer sonicated (Branson sonifier 250) in a cold room eight times AXIN-1 Reverse GAGAGGGCGTGGTCAGTG for 10 s each at constant duty cycle, with an output of 3 and Primer with incubation on ice after every sonication. The debris was AXIN–1 TaqMan CGCCTCTCCCACTCCGCTCT pelleted at 13,000 rpm for 10 min at 4° C., and the Probe supernatant was diluted 10-fold with ChIP dilution buffer BATF-1 Forward CTGGACTTAAGGGGTGAGGA (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Primer Tris HC1 [pH 8.1], 167 mM NaCl). The proteins were BATF-1 Reverse GGAGAGGACAACCAGGAAAA precleared with 50 pil of 1:1 protein A-Sepharose beads in Primer TE, 300 pul was reserved as input, and the remaining was BATF-1 TaqMan TGAGCAGCTGCTTTCGGCTGAA incubated with 5 pig of AR or SRC-1 antibody or IgG Probe (negative control) and 2 pig of sheared salmon sperm DNA (Stratagene, La Jolla, Calif.) rotating overnight at 4°C. The SHC-1 Forward TAACTCGGGAAAGTGGGAAG protein-DNA-antibody complex was precipitated by incu Primer SHC-1 Reverse AGCTTAGGTTACCGCTCCAA bating with 100 pil of 1:1 protein A-Sepharose beads and 2 Primer pig of salmon sperm DNA at 4°C. for 2 h. The beads were pelleted and washed three times with low-salt wash buffer SHC-1 TaqMan AATAAAGTTTCTCCAGGGAGGCAGGG (0.1% sodium dodecyl sulfate [SDS), 1% Triton X-100, 2 Probe mM EDTA, 20 mM Tris HC1 [pH 8.1], 0.15 M NaCl), and NFkB 1. Forward CTCGAGAGAGTATGGACCGCATGACTCTATCA twice with 1xTE (10 mM Tris HCl, 1 mM EDTA; pH 8.0). Primer The DNA-protein complex was obtained by extracting the NFkB1 Reverse ACGCGTAGAGAGAGCATACAGACAGACGGACA beads with 50 pil of freshly prepared extraction buffer (1% Primer

SDS, 0.1 M NaHCOs) three times. The cross-linking of the PCBP2 Forward AGATGATGGGAGGTTTGGAG DNA protein complex was reversed by incubating at 65° C. Primer for 6 h. The DNA was extracted with a QIAquick PCR PCBP2 Reverse GCCTAAACCAGAAACCAAGG purification kit (QIAGEN, Valencia, Calif.) in 25 pil final Primer volume of TE. PCBP2 TaqMan ATTTGGGGTAAGGGAGGTGAAGGAGG Real-Time PCR Probe [0705] The realtime PCR was performed on an ABI 7300 PSA Forward GCCTGGATCTGAGAGAGATATCATC (Applied Biosystems) using TaqMan PCR master mix at Primer universal condition. The numbers on the y axis of the ChIP PSA Reverse ACACCTTTTTTTTTCTGGATTGTTG assay results were obtained by dividing the arbitrary quan Primer titative PCR numbers obtained for each sample by the PSA TaqMan TGCAAGGATGCCTGCTTTACAAACATCC respective input. All promoter array results were validated Probe using primers and taqman probes (Biocource, Colo.) given in the following table. US 2007/028 1906 A1 Dec. 6, 2007

Promoter Array and commercial rat chow (Harlan Teklad 22/5 rodent diet– [0707] H2OK promoter array from AVIVA systems biol 8640). During the course of the study, the animals were ogy (San Diego, Calif.) was used for these experiments. The maintained on a 12 hr light:dark cycle. This study was array consists of 20,000 probe pairs mapped to about 19,600 reviewed and approved by the Institutional Laboratory Care unique proximal promoter regions. Proximal promoter and Use Committee of The University of Tennessee. The regions between -1.0 KB to +300 bp were spotted on this animals were dosed daily for 15 days with 3 mg/day of array. Before hybridization, the efficiency of the ChIP assay SARM or DHT or vehicle (Polyethylene Glycol). Dosing was tested on PSA enhancer using quantitative PCR. Manu solutions were prepared daily by dissolving drug in dimethyl facturer’s protocol was followed for the hybridization using sulfoxide (DMSO) and diluting in polyethylene glycol 300 Cy5 label for the immunoprecipitated samples and Cy3 label (PEG 300). At the end of 15 days, the animals were for total input DNA. The hybridized slides were scanned sacrificed and the weights of prostate and levator ani mea using a Gene Pix 4 scanner. Resulting background sub sured. tracted median intensities for both the Cy3 and the Cy5 Bone Marrow Culture channels were used to calculate normalized logº (Cy5/Cy3) or M values in the limmaCUI” package developed for the [0711] Cell culture materials were obtained from Invitro R statistical language. In limmaCUI, background subtrac gen (Carlsbad, Calif.). The femurs were first rinsed in 70% tion was set to minimum replacing confounding negative or ethanol and were then washed three times with 5 ml each of zero intensities with very small positive numbers. Default penicillin and streptomycin. Both ends of the femurs were settings were used for spot quality weighting and all arrays snapped and the bone marrow cells were flushed with 15 ml were within-array normalized using the global-loess func of MEM with penicillin, streptomycin and fungizone into a tion and between-array normalized using the aquantile 50 ml conical tube and stored on ice. The bone marrow cells method as needed. A one-tailed students t-test was used to were pooled and were centrifuged at 1000 rpm for 5 min in determine significance (P<0.05) of treatment hybridization a clinical centrifuge. The cells were resuspended in phenol versus vehicle control where the mean of replicate normal red-free MEM supplemented with 10% charcoal-stripped ized M-values was greater in treatment than in control. serum, penicillin, streptomycin and fungizone. The cells were triturated through a 22g needle, counted under micro Gene Ontology Functional Analyses scope, and were plated at 1.5 million cells per well of a 6 well plate in phenol red-free MEM supplemented with 15% [0708] The software package Ermine?” was used to mine charcoal-stripped serum, penicillin, streptomycin, 300 ng/ml statistically overrepresented GO terms from each experi fungizone, 0.28 mM ascorbic acid, and 10 mM fl-glycero mental group and successfully mapped 80% of array targets phosphate to differentiate towards the fibroblast/osteoblast to their GO annotation. An implementation of the receiver lineage. In separate wells, 2.5 million cells per well were operator characteristic (ROC) method was used in ranking– plated in 24 well plates in phenol red-free MEM supple log(p-values) (NLP) of all genes showing recruitment and mented with 10% charcoal stripped serum, penicillin, strep performing the wilcoxon rank sum test to examine signifi tomycin, and 300 ng/ml fungizone to differentiate towards cance of gene sets (minimum size 20) associated with GO the osteoclast lineage. The medium was changed on day 2 terms containing a greater number of high ranking genes and the cells were treated with the compound of interest. than would be expected if rankings were randomly distrib Osteoclast cultures were performed in the presence of uted amongst all gene sets. Only the most significant NLP of RANK Ligand (50 ng) and GM-CSF (10 ng) to induce replicates within each array were considered. p-0.05 (uncor osteoclastogenesis. Medium was completely changed every rected for multiple comparisons) were reported. Gene pro third day for osteoclast cultures. For fibroblast cultures, half duct:Go term associations used were retrived using SOUCE the culture medium was changed every third day to leave the and the GO database (Ashbumer, M. et al. 2000) growth factors secreted by the cells” Orthlogous Promoter Determination and Retrieval Staining of Cells [0709] All human-mouse orthologs were determined using [0712] At the end of 12 days, the cells were fixed in 10% NCBI's Homologene”. Using only orthologous Reference buffered formalin for fibroblast cultures and in 4% formal Sequences (RefSeq), 5000 base pairs upstream of the tran dehyde in PBS for osteoclast cultures. The fibroblasts were scription start site (TSS) and 2000 base pairs down stream stained for alkaline phosphatase activity and the O.D. at 405 were retrieved using UCSC's Genome Browser (H. Sapiens nm was measured using a spectrophotometer as described and M. musculus NCBI Build 35). 50-60% (712 genes) of earlier. The osteoclasts were stained for Tartarate Resistant the genes of interest contained the complete annotation Acid Phosphatase Activity (TRAP) and cells having 2 or described and were searched. more nuclei were counted under the microscope. Animal Experiments RNA Analysis and Reverse Transcriptase [0710] Five male Sprague Dawley rats per group (300 g) Polymerase Chain Reaction from Harlan (Indianapolis, Ind.) were housed with three [0713] LNCaP cells were plated at 700,000 cells per well animals per cage and were allowed free access to tap water of a 6 well plate in RPMI supplemented with 1% csFBS or US 2007/028 1906 A1 Dec. 6, 2007 66 in full serum. The cells were maintained for 3 days and were of the genes associated with an external stimulus (eg. treated with vehicle, DHT or SARM. RNA was isolated intracellular signaling pathways). Genes associated with using Trizol (Invitrogen) and the expression of various genes cytoskeleton, reproduction, development, transcription and measured using Taq Man primer probe mix from Applied metabolism were associated about equally with DHT and SARM treatment. A comparative genomics search was used Biosystems using one step rtPCR master mix on an ABI to identify the presence of AREs in the 1303 gene promoters. 7300 realtime PCR machine. The expression of individual Totally 712 of the 1303 gene promoters were sufficiently gene is normalized to 18S rRNA levels. annotated in the human and mouse database for this search. 78 of 350 searched promoters recruiting AR in response to Growth Assay DHT contained AREs, whereas 69 of 277 SARM-responsive [0714] LNCaP cells were plated at 10,000 cells per well of promoters were classified as ARE positive (FIG. 14C). a 96 well plate in RPMI supplemented with 1% csFBS. The cells were treated for 72 hrs with the indicated concentra Mapping of SRC-1 Binding Sites in Response to tions of DHT or SARM. The cell viability at the end of 72 DHT and SARM hrs measured using WTS assay reagent. [0717] SRC-1 was efficiently recruited in the presence of DHT and SARM (FIG. 15A). Using promoter array and Co-Immunoprecipitation identical conditions to that used for AR, we mapped SRC-1 [0715] LNCaP cells were plated at 4 million cells per 10 binding to 285 promoters (FIG. 15B). DHT recruited SRC-1 cm dish in RPMI supplemented with 1% csFBS. The cells to 498 promoters, SARM recruited SRC-1 to 640 promoters were maintained in 1% csFBS containing medium for 2 and DHT or SARM commonly recruited SRC-1 to 147 days. The medium was changed and were treated with promoters. Functional analysis of the genes revealed some vehicle, 100 nM DHT or SARM for 1 hr. Protein was significant differences in the functional activity of these extracted in Homogenization buffer ((0.05 M potassium genes (FIG. 15C). DHT promoted recruitment of SRC-1 to phosphate, 10 mM sodium molybdate, 50 mM sodium 67% and 28% of the genes associated with reproduction and fluoride, 2 mM EDTA, 2 mM EGTA, and 0.05% mono cytoskeleton, respectively, while 33% and 55%, respectively thioglycerol [pH 7.4] containing 0.4 M NaCl and the pro of the promoters were occupied by SRC-1 in response to tease inhibitors mentioned above) by three freeze thaw SARM. Genes associated with other classes were associated cycles in dry ice ethanol bath. Equal amounts of protein (100 equally with DHT and SARM. A comparative genomics pig) were immunoprecipitated with SHC-1 antibody or IgG search similar to that performed with AR was performed over night rotating at 4°C. The protein antibody complex with the list of promoters occupied by SRC-1 to identify the was precipitated by the addition of protein A sepharose for presence of AREs. FIG. 15D shows that 77 of the 269 2 hrs. The beads were pelleted and washed three times with searched promoters recruiting SRC-1 in response to DHT low salt wash buffer and twice with TE. The proteins were contained AREs, whereas 66 of 317 SARM-responsive extracted from the beads by boiling for 10 min with 2× promoters were classified as ARE positive. Array results Laemmli buffer. The protein extracts were fractionated on a were validated by performing realtime PCR on the DNA 6.5% SDS-PAGE, transferred to a nitrocellulose and western pool obtained from ChIP experiments in LNCaP cells using blotted with SRC-1 antibody. SRC-1 antibody. [0718] The tissue selective responses of the compounds of Results this invention may be a result of their interaction with a particular androgen receptor subtype, as a function of tissue Mapping of AR Binding Sites in Response to DHT expression, or in some embodiments, as a function of tissue and SARM distribution of the particular compound, or tissue distribu [0716] A chromatin immunoprecipitation assay (ChIP) tion of a metabolite thereof, or a function of the interaction assay was coupled with DNA microarray to determine the of the compound with a 540-reductase, or by any other genome wide-binding of AR to various proximal promoter mechanism. regions. LNCaP cells were treated with DHT or SARM, and equal amounts of DNA were hybridized to the transcription [0719] In some embodiment, tissue selectivity is a func factor promoter array. AR significantly associated with 1303 tion of the ligand affinity, or in some embodiments, intrinsic of the promoter regions for known protein-coding genes in activity of the compound, for example, in terms of the the presence of DHT or SARM (FIG. 14A). AR bound to ligand-induced receptor conformational change. In some nearly 6.5% of the promoters spotted on the array. Although embodiments, the tissue selectivity is a function of the DHT and SARM stimulated the recruitment of AR to a efficacy of the compound in provoking a response in terms similar number of gene promoters, only 118 of the 1303 of effects on gene expression, regulator recruitment, inter promoters were shared. In response to DHT, 626 promoters actions with components of the transcriptional machinery, or were uniquely occupied, while in response to SARM, 559 others. promoters were uniquely occupied by AR. Functional analy [0720] In this context, Compound III has been shown sis of the genes revealed profound differences in the func herein to bind the Androgen receptor (Ki-10.5 nM), as well tional activity of these genes (FIG. 14B). DHT promoted as the Serotonin Transporter (Ki-2.55 puM). recruitment of the AR to 71% and 63% of the genes associated with cell growth and extracellular matrix, respec [0721] It will be appreciated by a person skilled in the art tively, while only 29% and 31%, respectively of these that the present invention is not limited by what has been promoters were occupied by the AR in response to SARM. particularly shown and described hereinabove. Rather, the In contrast, SARM stimulated recruitment of the AR to 63% scope of the invention is defined by the claims that follow: US 2007/028 1906 A1 Dec. 6, 2007 67

SEQUENCE LISTING

NUMBER OF SEQ ID NOS: SEQ ID NO 1 LENGTH - 21 TYPE : DNA ORGANISM: Homo sapiens <400: SEQUENCE: 1 aacco agc.ca cagactaaag a 21

EQ ID NO 2 ENGTH = 20 YPE : DNA : RGANISM: Homo sapiens S EQUENCE: 2 tocctg ttc. tcgttcct tc 20

EQ ID NO 3 ENGTH = 24 YPE : DNA : RGANISM: Homo sapiens S EQUENCE: 3 aaagaggage gqaaaagagg gctg 24

SEQ ID NO 4 LENGTH = 20 TYPE : DNA ORGANISM: Homo sapiens SEQUENCE: 4 gggtocgagt tottggataa 20

EQ ID NO 5 ENGTH = 20 YPE : DNA : RGANISM: Homo sapiens S EQUENCE: 5 atcc to a gga aggagggagt 20

EQ ID NO 6 ENGTH = 24 YPE : DNA : RGANISM: Homo sapiens S EQUENCE: 6 ggacagggag cqaagtttcc to aa 24

<210: SEQ ID NO 7 <2 11: LENGTH - 19 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 7 atto caagga ccto caacg 19

<210: SEQ ID NO 8 US 2007/028 1906 A1 Dec. 6, 2007 68

—continued

<2 11: LENGTH = 18 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 8 gagaggg.cgt gotcagtg 18

<210: SEQ ID NO 9 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 9 cgc.ctetc.cc actocqctot 20

<210: SEQ ID NO 10 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 10

Ctggactitaa goggtgagga 20

<210: SEQ ID NO 11 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 11 ggagaggaca accaggaaaa 20

<210: SEQ ID NO 12 <211: LENGTH : 22 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 12 tgagoagetg citttcggctg aa 22

<210: SEQ ID NO 13 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 13 taactcggga aagtgggaag 20

<210: SEQ ID NO 14 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 14 agcttaggtt accqctccaa 20

<210: SEQ ID NO 15 <2 11: LENGTH - 26 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 15 US 2007/028 1906 A1 Dec. 6, 2007 69

—continued aataaagttt citc.cagggag goaggg 26

<210: SEQ ID NO 16 <2 11: LENGTH = 32 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 16 citc.gagagag tatggaccgc atgacitctat ca 32

<210: SEQ ID NO 17 <2 11: LENGTH = 32 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 17 acgc.gtagag agagcataca gacagacgga ca 32

<210: SEQ ID NO 18 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 18 agatgatggg aggtttggag 20

<210: SEQ ID NO 19 <2 11: LENGTH = 20 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 19 gcctaaacca gaaaccaagg 20

<210: SEQ ID NO 20 <2 11: LENGTH - 26 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 20 atttggggta agg gaggtga aggagg 26

<210: SEQ ID NO 21 <2 11: LENGTH - 25 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 21 gcctggat.ct gaga.gagata to atc 25

<210: SEQ ID NO 22 <2 11: LENGTH - 25 <2 12: TYPE : DNA <213> ORGANISM: Homo sapiens <400: SEQUENCE: 22 acacct tttt ttttctggat tottg 25

<210: SEQ ID NO 23 <2 11: LENGTH - 28 <2 12: TYPE : DNA US 2007/028 1906 A1 Dec. 6, 2007 70

—continued <213> ORGANISM: Homo sapiens <400: SEQUENCE: 23 tgcaaggatg cctoctittac aaa.catcc 28

What is claimed is: 2. The method of claim 1, wherein said compound is 1. A method of treating, reducing the severity of reducing characterized by the structure of formula III: the incidence of delaying the onset of, or reducing patho genesis of diabetes in a human subject, comprising the step III of administering to said subject a selective androgen recep NC CN tor modulator (SARM) compound of formula I:

(I) Z 2% O S or its isomer, pharmaceutically acceptable salt, pharmaceu yS.C NH X JTº tical product, hydrate, N-oxide, or any combination thereof. R! T 3. The method of claim 1, wherein said diabetes is a type II diabetes or MODY. 4. The method of claim 1, wherein said administering wherein comprises administering a pharmaceutical composition comprising said compound and/or its isomer, pharmaceuti X is a bond, O, CH2, NH, Se, PR, or NR; cally acceptable salt, pharmaceutical product, hydrate, Z is NO, CN, COR, COOH or CONHR; N-oxide, or any combination thereof; and a pharmaceuti cally acceptable carrier. Y is CFs, CH5, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; 5. A method of treating, reducing the severity of reducing the incidence of delaying the onset of, or reducing patho Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs, genesis of glucose intolerance in a human subject having, NHCOCFs, NHCOR, NHCONHR, NHCOOR, comprising the step of administering to said subject a OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR selective androgen receptor modulator (SARM) compound NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, of formula I: SO,R or SR;

or Q together with the benzene ring to which it is attached (I) is a fused ring system represented by structure A, B or Z C: 2% O S yS.C ) NH X J’ R! T 2. NH 2.0 ºr O S S 2 wherein X is a bond, O, CH2, NH, Se, PR, or NR; 2. NH Z is NO, CN, COR, COOH or CONHR; Y is CFA, CH5, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHs. NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR R1 is CH5, CFs, CH2CH3, or CF2CFs; and NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR; T is OH, OR, -NHCOCHA, or NHCOR; or Q together with the benzene ring to which it is attached wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, is a fused ring system represented by structure A, B or hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. C: US 2007/028 1906 A1 Dec. 6, 2007 71

2. NH 2.0 2. | NH 2.0 2. NH 2.0 2. | NH 2 O

S S 2 S S 2 2. NH 2. NH SJ's/

R? is CHA, CFs, CH2CHA, or CF.CFs; and R1 is CHA, CFs, CH2CHA, or CF2CFs; and T is OH, OR, -NHCOCHA, or NHCOR; T is OH, OR, NHCOCHA, or NHCOR; wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. 6. The method of claim 5, wherein said compound is 9. The method of claim 8, wherein said compound is characterized by the structure of formula III: characterized by the structure of formula III:

III III NC CN NC CN

or its isomer, pharmaceutically acceptable salt, pharmaceu or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. tical product, hydrate, N-oxide, or any combination thereof. 7. The method of claim 5, wherein said administering 10. The method of claim 8, wherein said administering comprises administering a pharmaceutical composition comprises administering a pharmaceutical composition comprising said compound and/or its isomer, pharmaceuti comprising said compound and/or its isomer, pharmaceuti cally acceptable salt, pharmaceutical product, hydrate, cally acceptable salt, pharmaceutical product, hydrate, N-oxide, or any combination thereof; and a pharmaceuti N-oxide, or any combination thereof; and a pharmaceuti cally acceptable carrier. cally acceptable carrier. 8. A method of treating, reducing the severity of reducing 11. A method of treating, reducing the severity of reduc the incidence of delaying the onset of, or reducing patho ing the incidence of delaying the onset of, or reducing genesis of hyperinsulinemia in a human subject, comprising pathogenesis of insulin resistance in a human subject, com the step of administering to said subject a compound of prising the step of administering to said subject a compound formula (I) of formula (I):

(I) (I) Z Z 2% O S 2% O S C) ——Q C) ——Q yS/S NH X 2 ySAS NH X 2 R1 T R1 T wherein wherein X is a bond, O, CH2, NH, Se, PR, or NR; X is a bond, O, CH2, NH, Se, PR, or NR; Z is NO, CN, COR, COOH or CONHR; Z is NO, CN, COR, COOH or CONHR; Y is CFA, CHA, formyl, alkoxy, H, I, Br, C1, or Sn(R)s; Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHA, Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHs. NHCOCFs, NHCOR, NHCONHR, NHCOOR, NHCOCFs, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR; SO,R or SR; or Q together with the benzene ring to which it is attached or Q together with the benzene ring to which it is attached is a fused ring system represented by structure A, B or is a fused ring system represented by structure A, B or C: C: US 2007/028 1906 A1 Dec. 6, 2007 72

–CIO2. NH 2.0 -CO?2. NH 2.0 –CIO2. NH 2.0 -CO?2. NH 2 O 2. NH 2. NH

R? is CHA, CFs, CH2CHA, or CF.CFs; and R1 is CH5, CFs, CH2CH3, or CF2CFs; and T is OH, OR, -NHCOCHA, or NHCOR; T is OH, OR, NHCOCHA, or NHCOR; wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. 12. The method of claim 11, wherein said compound is 15. The method of claim 14, wherein said compound is characterized by the structure of formula III: characterized by the structure of formula III:

III III NC CN NC CN

h Hó" or or its isomer, pharmaceutically acceptable salt, pharmaceu or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. tical product, hydrate, N-oxide, or any combination thereof. 13. The method of claim 11, wherein said administering 16. The method of claim 14, wherein said administering comprises administering a pharmaceutical composition comprises administering a pharmaceutical composition comprising said compound and/or its isomer, pharmaceuti comprising said SARM and/or its isomer, pharmaceutically cally acceptable salt, pharmaceutical product, hydrate, acceptable salt, pharmaceutical product, hydrate, N-oxide, N-oxide, or any combination thereof; and a pharmaceuti or any combination thereof; and a pharmaceutically accept cally acceptable carrier. able carrier. 14. A method of treating, reducing the severity of reduc 17. The method of claim 14, wherein said diseases asso ing the incidence of delaying the onset of, or reducing ciated with diabetes comprise neuropathy, retinopathy, pathogenesis of diseases associated with diabetes compris nephropothy, or a combination thereof. ing the step of administering to said subject a compound of 18. A method of treating, reducing the severity of, reduc formula (I) ing the incidence of delaying the onset of, or reducing pathogenesis of fatty liver conditions in a human subject, comprising the step of administering to said subject a (I) Z compound of formula (I) 2% O S C) ——Q (I) yS/S NH X 2 Z 2% O S R. T C) ——Q yS/S NH X 2 wherein R. T X is a bond, O, CH2, NH, Se, PR, or NR; Z is NO, CN, COR, COOH or CONHR; wherein Y is CFA, CHA, formyl, alkoxy, H, I, Br, C1, or Sn(R)s; X is a bond, O, CH2, NH, Se, PR, or NR; Q is alkyl, F, Cl, Br, I, N(R), CN, NHCOCHA, NHCOCFs, NHCOR, NHCONHR, NHCOOR, Z is NO, CN, COR, COOH or CONHR; OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR Y is CFA, CHA, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; NHSO2CHA, NHSO,R, OR, COR, OCOR, OSO,R, Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. SO,R or SR; NHCOCF, NHCOR, NHCONHR, NHCOOR, or Q together with the benzene ring to which it is attached OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR is a fused ring system represented by structure A, B or NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, C: SO,R or SR; US 2007/028 1906 A1 Dec. 6, 2007 73

or Q together with the benzene ring to which it is attached or Q together with the benzene ring to which it is attached is a fused ring system represented by structure A, B or is a fused ring system represented by structure A, B or C: C: –CIO2. NH O -CO?2. NH O –CIO2. NH - O -CO?2. NH - O 2. NH 2. NH

R? is CHA, CFs, CH2CHA, or CF.CFs; and R1 is CHA, CFs, CH2CHA, or CF2CFs; and T is OH, OR, -NHCOCHA, or NHCOR; T is OH, OR, NHCOCHA, or NHCOR; wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, wherein R is a C1-C4 alkyl, aryl, phenyl, alkenyl, hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. hydroxyl, a C1-C4 haloalkyl, halogen, or haloalkenyl. 19. The method of claim 18, wherein said compound is 22. The method of claim 21, wherein said compound is characterized by the structure of formula III: characterized by the structure of formula III:

III III NC CN NC CN

Hò' ori or its isomer, pharmaceutically acceptable salt, pharmaceu or its isomer, pharmaceutically acceptable salt, pharmaceu tical product, hydrate, N-oxide, or any combination thereof. tical product, hydrate, N-oxide, or any combination thereof. 20. The method of claim 18, wherein said administering 23. The method of claim 21, wherein said administering comprises administering a pharmaceutical composition comprises administering a pharmaceutical composition comprising said compound and/or its isomer, pharmaceuti comprising said SARM and/or its isomer, pharmaceutically cally acceptable salt, pharmaceutical product, hydrate, acceptable salt, pharmaceutical product, hydrate, N-oxide, N-oxide, or any combination thereof; and a pharmaceuti cally acceptable carrier. or any combination thereof; and a pharmaceutically accept 21. A method of treating, reducing the severity of reduc able carrier. ing the incidence of delaying the onset of, or reducing 24. A method of treating reducing the severity of reduc pathogenesis of cardiovascular disease in a human subject, ing the incidence of delaying the onset of, or reducing comprising the step of administering to said subject com pathogenesis of cachexia in a subject, comprising the step of pound of formula (I): administering to said subject compound of formula (I):

(I) (I) Z Z 2% O S 2% O S C) ——Q C)S/S 2——Q yS/S NH X 2 y NH X R! T R. T wherein wherein X is a bond, O, CH2, NH, Se, PR, or NR; X is a bond, O, CH2, NH, Se, PR, or NR; Z is NO, CN, COR, COOH or CONHR; Z is NO, CN, COR, COOH or CONHR; Y is CFA, CHA, formyl, alkoxy, H, I, Br, C1, or Sn(R)s; Y is CFA, CH5, formyl, alkoxy, H, I, Br, Cl, or Sn(R)s; Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs, Q is alkyl, F, Cl, Br, I, N(R)2, CN, NHCOCHs. NHCOCF, NHCOR, NHCONHR, NHCOOR, NHCOCF, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR OCONHR, CONHR, NHCSCH, NHCSCF, NHCSR NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, NHSO.CHA, NHSO,R, OR, COR, OCOR, OSO,R, SO,R or SR; SO,R or SR;