Identification of Signaling Pathways in Macrophage Exposed to Porphyromonas gingivalis or to Its Purified Cell Wall Components This information is current as of September 27, 2021. Qingde Zhou and Salomon Amar J Immunol 2007; 179:7777-7790; ; doi: 10.4049/jimmunol.179.11.7777 http://www.jimmunol.org/content/179/11/7777 Downloaded from
Supplementary http://www.jimmunol.org/content/suppl/2007/11/19/179.11.7777.DC1 Material
References This article cites 54 articles, 28 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/179/11/7777.full#ref-list-1
Why The JI? Submit online.
• Rapid Reviews! 30 days* from submission to initial decision
• No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021
• Fast Publication! 4 weeks from acceptance to publication
*average
Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology
Identification of Signaling Pathways in Macrophage Exposed to Porphyromonas gingivalis or to Its Purified Cell Wall Components1
Qingde Zhou and Salomon Amar2
Porphyromonas gingivalis (P. gingivalis) can trigger an inflammatory condition leading to the destruction of periodontal tissues. However P. gingivalis LPS and its fimbriae (FimA) play different roles compared with the live bacteria in the context of intra- cellular molecule induction and cytokine secretion. To elucidate whether this difference results from different signaling pathways in host immune response to P. gingivalis, its LPS, or its FimA, we examined gene expression profile of human macrophages exposed to P. gingivalis, its LPS, or its FimA. A comparison of gene expression resulted in the identification of three distinct groups of expressed genes. Furthermore, computer-assisted promoter analysis of a subset of each group of differentially regulated genes Downloaded from revealed four putative transcriptional regulation models that associate with transcription factors NFB, IRF7, and KLF4. Using gene knockout mice and siRNA to silence mouse genes, we showed that both TLR2 and TLR7 are essential for the induction of NFB-containing genes and NFB-IFN-sensitive response element (ISRE) cocontaining genes by either P. gingivalis or its purified components. The gene induction via either TLR2 or TLR7 is dependent on both MyD88 and p38 MAPK. However, the unique induction of IFN- by P. gingivalis LPS requires TLR7 and IFN␣R cosignaling, and the induction of ISRE-containing gene is  dependent on the activation of IFN- autocrine loop. Taken together, these data demonstrate that P. gingivalis and its components http://www.jimmunol.org/ induce NFB-containing genes through either TLR2- or TLR7-MyD88-p38 MAPK pathway, while P. gingivalis LPS uniquely induces ISRE-containing genes, which requires IFN␣R signaling involving IRF7, KLF4, and pY701 STAT1. The Journal of Immunology, 2007, 179: 7777–7790.
orphyromonas gingivalis (P. gingivalis) is a predominant sues, several investigators have suggested that fimbriae of this periodontal pathogen that colonizes periodontal pockets pathogen can trigger the production of proinflammatory mediators P and then spreads into deeper tissues. Inflammation fol- in human endothelial and epithelial cells and macrophages (5–7). lowing P. gingivalis infection leads to the destruction of periodon- Therefore, these bacterial factors are likely to contribute differen- tal tissues, resorption of alveolar bone, and exfoliation of teeth (1). tially in the progression of the overall inflammatory destruction of by guest on September 27, 2021 Various cellular components of P. gingivalis are thought to func- infected periodontal tissues. tion as virulence factors, including LPS and fimbriae. LPS from P. The innate immune system is the body’s first line of defense gingivalis induces multiple biological and immunological activi- against infection. The outcome of infection is the net conse- ties through TLRs (2). It has also been shown to antagonize Esch- quence of the immune defenses of the host and a pathogen’s erichia coli LPS-dependent induction of E-selectin expression, p38 capacity to subvert them. Macrophages play a central role in MAPK activation, and NF-␣B activation in human endothelial regulating innate and acquired immune responses against patho- cells and monocytes (2, 3). The ability of P. gingivalis LPS to gens: they identify foreign invaders using pattern-recognition down-regulate innate immune responses to other LPS (E. coli) may receptors, such as TLRs, which detect highly conserved micro- play a role in allowing this oral pathogen to evade the normal bial-specific structures. Macrophages, once activated via TLRs, surveillance system so essential in maintaining periodontal health unfold a tightly controlled pathogen-specific immune response (4). Fimbriae are reported to mediate the bacterial adherence to and (8). The mechanisms by which macrophages interact with P. invasion of epithelial cells and gingival fibroblasts (5). Although gingivalis are complex and involve the coregulation of specific the LPS of P. gingivalis is reported to play the most critical role in signaling and transcriptional machinery in response to this bac- inducing proinflammatory responses in infected periodontal tis- terium and to its cell surface components (2, 5). Achieving a better understanding of the molecular basis of host response to
Department of Periodontology and Oral Biology, School of Dental Medicine, Boston P. gingivalis will be critical for preventing periodontal infection University, Boston, MA 02118 and also for minimizing the tissue damage resulting from an Received for publication November 7, 2006. Accepted for publication September overly aggressive host response. 26, 2007. Our previous study demonstrated qualitative and quantitative The costs of publication of this article were defrayed in part by the payment of page differences in the response of macrophages to P. gingivalis com- charges. This article must therefore be hereby marked advertisement in accordance pared with its fimbriae or LPS (7, 9, 10), supporting our hypothesis with 18 U.S.C. Section 1734 solely to indicate this fact. that unique signaling mechanisms are induced by P. gingivalis vs 1 This work was supported by grants from the National Institute of Dental and Cranio- facial Research DE15989 (to S.A.). its components, and these differential signaling may play important 2 Address correspondence and reprint requests to Dr. Salomon Amar, Department of roles in P. gingivalis acute vs chronic infection. Indeed, in acute Periodontology and Oral Biology, School of Dental Medicine, Boston University infection, the host is sensing mostly live bacteria, whereas in Medical Center, 700 Albany Street, W-201E, Boston, MA 02118. E-mail address: chronic infection, a combination of live bacteria and subsequent [email protected] breakdown of its cell wall (i.e., LPS, fimbriae) by host immune Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 cells. To improve our understanding of the mechanisms by which www.jimmunol.org 7778 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis macrophages interact with P. gingivalis, we attempted in the plates at a concentration of 1 ϫ 106 cells/ml in RPMI 1640 medium sup- present study to identify transcriptional profiles that are modulated plemented with 10% FBS and standard penicillin/streptomycin. After a 2 h-incubation at 37°C in an atmosphere containing 5% CO , nonadherent after treatment with P. gingivalis relative to its purified LPS or its 2 3 cells were washed out with warm PBS. Adherent macrophages were cul- major fimbrial protein (FimA). We used the cDNA microarray tured for 2 days before experiments. Media was changed 1 h before ex- technique to define more precisely the individual effects of LPS, periments began. FimA, and their parental bacterium, P. gingivalis, on the transcrip- tional reprogramming of human macrophages. Our study demon- Infection of macrophages with P. gingivalis and treatment of strates that there is an overlapping pattern of regulated genes in macrophages with P. gingivalis components human macrophages representing a general inflammatory response Adherent macrophages were infected with live P. gingivalis at indicated to P. gingivalis and to its cell surface components. Additionally, P. multiplicities of infection (MOI). Live P. gingivalis 381 frozen stocks were gingivalis and its purified components preferentially induce regu- thawed and cultured for 24 h, and then the cultures were collected and diluted in medium to a concentration of 5 ϫ 108 bacteria per 50 l, to give lation of private sets of genes that may specifically perturb the MOIs as indicated, and added to cultures of macrophages. Dilutions were macrophage response to infection. Pathway analysis further dem- also plated on brain-heart infusion agar plates for anaerobic culture, and onstrates that P. gingivalis and its components commonly activate colonies were counted to confirm the accuracy of dilution and viability of NFB-containing genes through either TLR2- or TLR7-MyD88- bacteria. In additional cultures, purified LPS or FimA from P. gingivalis p38 MAPK pathway, while purified P. gingivalis LPS uniquely were added to cell culture medium at indicated concentrations. Cells were incubated at 37°C in an atmosphere containing 5% CO2. Cells and super- induces IFN-sensitive response element (ISRE)-containing genes natants were harvested at indicated times after incubation with live P. requiring IFN␣R signaling. gingivalis or its components. Downloaded from Materials and Methods RNA preparation and Affymetrix GeneChip microarray analysis Bacterial strain and reagents Two hours after infection with P. gingivalis, or treatment with P. gin- givalis LPS, FimA, or saline (control), human macrophages were P. gingivalis 381 (American Type Culture Collection) was cultured washed three times with ice cold PBS, and total RNA was extracted anaerobically, as described previously (9). Protein-free LPS from P. using an RNeasy Mini Kit according to the manufacturer’s instructions. gingivalis 381 was extracted with phenol-water and purified by cesium For each condition, three independent experiments were performed. For chloride isopyknic density gradient ultracentrifugation followed by re- each experimental sample, RNA quality was assessed by RNA Nano http://www.jimmunol.org/ purification, and FimA was purified by size exclusion chromatography, LabChip analysis on an Agilent Bioanalyzer 2100. Concentrations were as previously described (9). Abs against IRF3, IRF7, KLF4, p65 NFB, also determined using a NanoDrop 1000 spectrophotometer. Under STAT1 (including pY701 and pS727), and -actin, along with HRP- standard conditions, processing of RNAs for GeneChip Analysis was conjugated anti-rabbit or anti-goat Ig G, were obtained from Santa Cruz conducted in accordance with methods described in the Affymetrix Ge- Biotechnology. Ficoll-Hypaque (1.0771) was purchased from Sigma- neChip Expression Analysis Technical Manual, revision 4, as subse- Aldrich; Monocyte Isolation Kit II, FITC-conjugated anti-CD14, and quently detailed. Synthesis of cDNA first and second strand were per- PE-conjugated anti-biotin were purchased from Miltenyi Biotec; RPMI formed using the GeneChip Expression 3Ј-Amplification Reagents One- 1640, DMEM, FBS, Gentamicin, penicillin/streptomycin, and Lipo- Cycle cDNA Synthesis Kit (P/N 900431). In vitro transcription was fectamine 2000 reagents were purchased from Invitrogen Life Technol- performed using the GeneChip Expression Amplification Reagents ogies; human serum type AB was purchased from Cambrex; and kit-30 reactions (P/N 900449), and was conducted according to the RNeasy Mini Kit was obtained from Qiagen. by guest on September 27, 2021 standard Affymetrix protocols. Hybridization was conducted according Animals to the Affymetrix GeneChip Manual. Twenty micrograms of in vitro transcription material were used on each GeneChip Human Genome C57BL/6 mice were purchased from The Jackson Laboratories. TLR2 U133 Plus 2.0 array, which contains ϳ54674 gene probe sets. Af- Ϫ Ϫ Ϫ Ϫ knockout (TLR2 / ), MyD88 knockout (MyD88 / ), and TLR7 knockout fymetrix hybridization ovens were used to incubate the arrays overnight Ϫ Ϫ (TLR7 / ) mice on a C57BL/6 background were a gift from Dr. S. Akira at a constant temperature of 45°C. Preparation of microarrays for scan- (Department of Host Defense, Research Institute for Microbial Diseases, ning was conducted with Affymetrix wash protocols appropriately Osaka University, Osaka, Japan). All procedures involving animals were matched to the specific chip type on a Model 450 Fluidics station. approved by the Institutional Animal Care and Use Committee at Boston Affymetrix GeneChip Operating Software operating system controls the University Medical Center. Fluidics station process. Scanning was conducted on a GeneChip Scan- Macrophage cultures ner 3000 7G scanner with autoloader. The Affymetrix GeneChip Op- erating Software v1.3 operating system controlled the Model 3000 7G Human PBMC were derived by Ficoll-Hypaque density gradient cen- scanner and data acquisition functions and maintained the mediated trifugation from buffy coats of different healthy blood donors obtained first-level data analysis and desktop data management for the entire from the Interstate Blood Bank (Memphis, TN). All blood donors are GeneChip System. male, 25 to 45 years old, and were evaluated by FDA-licensed testing procedures to eliminate donors whose specimens indicated the presence Data processing of HIV, hepatitis B virus, hepatitis C virus, or syphilis infections. Ͼ Primary data from the microarray experiments were analyzed algorithmi- CD14-positive monocytes were enriched from PBMC to 95% purity cally using ArrayAssist software (Version 4.1.0; Stratagene). Fluorescence by immunomagnetic elimination of T cells, NK cells, B cells, dendritic intensities were first normalized to median array intensities for all condi- cells, and basophils using the Monocyte Isolation Kit II. Purity of tions tested, and then each intensity value was converted to its log base 2 monocytes was determined by flow-cytometric analysis of FITC-con- value. The fold changes were calculated relative to unstimulated baseline jugated anti-CD14 and PE-conjugated anti-biotin. Purified human controls. Data from three independent replicate experiments were used to monocytes were plated at a density of 2 ϫ 106 cells/ml in DMEM with perform a paired two-sample t test for each gene. Data from a total of 12 20% FBS, 10% human serum AB, and 50 g/ml gentamicin in 6-well arrays (three treated conditions and one untreated condition with three or 10-cm diameter tissue culture plates for 5 days at 37°C, in a humid- replicates for each condition) were included in the analysis. A filter for ified atmosphere containing 5% CO2. On days 5 and 7, half of the regulated genes used the following stringent criteria to define genes as medium were removed and replaced with medium lacking FBS. Media significantly differentially expressed: 1) fold change of Ն2orՅ–2, which on the cultured macrophages were replaced with fresh DMEM contain- signifies changes in the expression level between control conditions (base- ing 1% human serum on day 9, 1 hour before experiments were begun. line) and stimulated cells; 2) a change in the p value of Ͻ0.05, which Mouse peritoneal macrophages were isolated by peritoneal lavage, as describes the likelihood of change of expression for each transcript, where described previously (9). Isolated macrophages were plated into 6-well p values indicated the level of significance of the difference between the baseline and experimental conditions based on the paired two-sample t test; Ն 3 Abbreviations used in this paper: FimA, fimbrial protein; ISRE, IFN-sensitive re- and 3) absolute difference in signal intensity between group means of 50. sponse element; MOI, multiplicity of infection; TF, transcription factor; qRT-PCR, Hierarchical clustering algorithms were used to group together genes with quantitative real-time PCR; RT, reverse transcription; CT, cycle threshold; KLF, similar expression patterns. Pathway Architect Software (Stratagene) was Kruppel-like factor. used for gene ontology assessment and pathway visualization. The Journal of Immunology 7779
Computer-assisted promoter analysis in a Bio-Rad iCycler according to the manufacturer’s protocol. The mRNA expression of all samples was normalized to that of -actin. The Promoter sequences 1000 bases upstream from the transcriptional start site cycle threshold (CT) value indicates the number of PCR cycles that are of selected genes were obtained from Advanced Biomedical Computing necessary for the detection of a fluorescence signal exceeding a fixed Center (ABCC) (http://grid.abcc.ncifcrf.gov/promoters.php). Gene pro- threshold. The fold change (FC) was calculated by using the following moters were assessed for potential transcription factor (TF) binding sites ⌬ ϭ  ϭ formulas: CT CT ( -actin) – CT (target gene) and FC using the Transcription Regulatory Element Search program (http:// (⌬C Ϫ⌬C ) ⌬ 2 T2 T1 , in which CT1 represents the mean for P. gingivalis-, bioportal.bic.nus.edu.sg/tres). The input sequences can be searched for ⌬ FimA- or P. gingivalis LPS-treated cells, and CT2 represents the mean conserved TF binding sites using nucleotide frequency distribution for control cells. matrices described in the TRANSFAC database (11). The position weights and matrix similarity scores are essentially calculated according to Quandt et al. (12). A TF binding site is considered conserved only when the matrix MAPK phosphorylation array similarity score is Ն90. The output matrix positions correspond to sense For analysis of MAPK phosphorylation, human macrophages were stim- strand numbering, and all sequences are provided in the 5Ј-3Ј direction. ulated with live P. gingivalis, its LPS, or its FimA for 30 min and then The National Center for Biotechnology Information gene accession num- solubilized at 1 ϫ 107 cells/ml in Lysis Buffer 6 (R&D Systems), according bers of selected genes that were analyzed are as follows: TSLP to the manufacturer’s instructions. Cell lysates were centrifuged at (NM_033035), CXCL3 (NM_002090), PTGS2 (NM_000963), PTX3 14,000 ϫ g for 5 min, supernatants were transferred into clean tubes, and (NM_002852), IL12B (NM_002187), CXCL1 (NM_001511), CXCL10 protein concentrations were determined using a Bio-Rad Bradford protein (NM_001565), CCL20 (NM_004591), IL1B (NM_000576), TNF assay. Phosphorylation of 21 MAPK was assayed simultaneously using (NM_000594), IFN- (NM_002176), SOCS1 (NM_003745), IRF7 Human Phospho-MAPK Array Kit (R&D Systems), according to the man- (NM_004031), CXCL11 (NM_005409), IFIT1 (NM_001001887), IFIT2 ufacturer’s instructions. (NM_001547), OASL (NM_003733), USP18 (NM_017414), ACSL4
(NM_022977), PBEF1 (NM_005746), and MAML2 (NM_032427). These siRNA transfection Downloaded from genes were selected as representative of three groups of genes that are either commonly induced by P. gingivalis and by its cell surface compo- siRNAs for IFN␣R, IFN-, and TLR7 were synthesized by Ambion (Aus- nents or uniquely induced by LPS and by P. gingivalis. tin, TX) and targeted exons 6 and 7 of the human IFN␣R gene (NM_000874, NM_207584, and NM_207585), exon 2 of the mouse Quantitative real-time PCR (qRT-PCR) IFN␣R gene (NM_010508), exon 1 of the mouse IFN- gene (NM_010510), and exon 3 of the mouse TLR7 gene (NM-133211), respec- Reverse transcription (RT) of total RNA (1 g) in each 20 l reaction was tively. Ambion’s Silencer Negative Control siRNA was used to demon- conducted using iScript cDNA Synthesis kit (Bio-Rad) according to the strate that the transfection does not induce nonspecific effects on gene http://www.jimmunol.org/ manufacturer’s instructions. RT reactions without iScript Reverse Tran- expression. For transient transfections of siRNA, each pair of oligoribo- scriptase were used as negative controls. The reaction mixtures were di- nucleotides was annealed at a concentration of 40 M and introduced into luted to 200 l (10ϫ dilutions) after RT, and 5.0 l of each cDNA mixture macrophages derived from human peripheral monocytes or mouse perito- was used for quantitative PCR. Primers for target genes were generated neal macrophages in 6-well plates by transfection with Lipofectamine 2000 using Beacon Designer software (Bio-Rad). Human gene primers were as reagents, according to the manufacturer’s protocol. Forty-eight hours after listed in Table I, and mouse gene primers were as follows: TLR2 (sense transfection, cells were treated with P. gingivalis, its LPS, or its FimA for 5-ACTGTCCTGTGATACTGTTCTG, antisense 5-TGTGCCTGGTCT the indicated time, and total RNA, or protein, was extracted as described GTGTCC); TLR7 (sense 5-AGCCCTTTACCTGGATGGAAAC, antisense above. 5-CGTGATGGAGAAGATGTTGTTAGC); MyD88 (sense 5-AG
CAGCAGAACCAGGAGTC, antisense 5-GGGCAGTAGCAGATA Western analysis by guest on September 27, 2021 AAGGC); IFN␣R (sense 5-AGGTGTTGTGTTCTTCTCTGTC, anti- sense 5-CCGTGTCTGTATTCTCAATGATG); PTX3 (sense 5Ј-AA Cell lysates were prepared with cold lysis buffer (25 mM HEPES (pH 7.7),
GAATGGTTGCTGTGTAGGTG, antisense 5-CGCCTGAATCTCTGT 400 mM NaCl, 1.5 mM MgCl2, 2 mM EDTA, 0.5% Triton X-100, 3 mM GACTCC); CXCL10 (sense 5-TTCTGCCTCATCCTGCTG, antisense DTT, 20 mM -glycerophosphate, 1 mM sodium orthovanadate, and 25 5-AGACATCTCTGCTCATCATTC); IFN- (sense 5Ј-GCTTCCTGCT mM para-nitrophenylphosphate and protease inhibitor mixture; Roche). GTGCTTCTC, antisense 5-CATCTTCTCCGTCATCTCCATAG); IFIT2 Protein concentrations were determined using a Bio-Rad Bradford protein (sense 5Ј-GCCATTCAACTGTCTCCTG, antisense 5-GCTCTGTCTGT assay. Proteins (50 g) were electrophoresed through an SDS-polyacryl- GTCATATACC); and -actin (sense 5Ј-TTGACCAGAGCAGGCA amide gel and transferred to a polyvinylidene difluoride membrane (Bio- GATG, antisense 5Ј-CTACCAGAAGGGCAGGATACAG). Quantita- Rad) by electroblotting. The membranes were incubated in blocking buffer tive PCR was conducted using the iQSYBR Green Supermix (Bio-Rad) (5% nonfat dried milk, 10 mM Tris (pH 7.5), 100 mM NaCl, and 0.1%
Table I. Primers used for SYBR Green real-time RT-PCR
Genes Forward Sequence (5Ј-3Ј) Reverse Sequence (5Ј-3Ј) Amplicon Size (bp)
PTX3 ATCCTTGTGGGTAAATGGTGAAC GATATTGAAGCCTGTGAGTCTCC 172 PTGS2 TTGACCAGAGCAGGCAGATG CTACCAGAAGGGCAGGATACAG 174 TRAF1 CCTGAATGGAGATGGCACTG GCTCACGGTTGTTCTGGTC 140 TLR2 CACTCAGGAGCAGCAAGC GCAGGAACAGAGCACAGC 170 TLR6 ACCCAGAAAGTTATAGAGGAAGCC TCACAGTCACAGCCAACACC 120 TLR7 AAACTCTGCCCTGTGATGTC GTCTGGTATGTGGTTAATGGTG 143 IRAK2 TGAGGATGAACAGGAAGAG AATGGAGGTGCTGAAGTC 178 TSLP TGCCCAGGCTATTCGGAAAC TGAAGCGACGCCACAATCC 127 IRF7 CCCACGCTATACCATCTACC CTGAGGCTGCTGCTATCC 162 TRIF GGAGGAAGGAACAGGACAC TGGAGGTAGGCTGAGTAGG 106 IRF8 CGACACCAGCCAGTTCTTC GCCTCTTCTGCCAGTTGC 177 IER3 GTGAGTATCGCCGAAGTG AGCAGCAGAAAGAGAAGC 172 CXCL3 CTGCTGCTCCTGCTCCTG GTGGCTATGACTTCGGTTTGG 173 LITAF TCCGCACCTCCATCCTATG CGCTGGCTGGGTATAATACG 147 REL TTGACGACTGCTCTTCCTCCTG CATCTCCTCCTCTGACACTTCCAC 121 NFKB2 CGCTTCTCTGCCTTCCTTAG CCTGCTGTCTTGTCCATTCG 137 SPRY2 TTAAGCCACTGAGCAAGG ACACAGCATACACAAGTCC 178 IFNB1 GGAGGACGCCGCATTGAC TGATAGACATTAGCCAGGAGGTTC 123 IFIT2 TTCACCTCTGGACTGGCAATAGC CTCTCCTTCACCTTCCTCTTCACC 180 Actin- GCGTGACATTAAGGAGAAG GAAGGAAGGCTGGAAGAG 172 7780 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis
Tween 20) before immunoblotting was performed with primary Abs. HRP- scripts in response to P. gingivalis infection and to its LPS or conjugated Abs were used as secondary Ab. The blots were developed with FimA treatment is available in the Supplemental Data. Table II an ECL system (Amersham Biosciences). Western blotting was repeated lists the 60 transcripts showing the greatest increases in re- three times. sponse to P. gingivalis infection or to its purified cell surface Results components. These data also indicate that their fold change was Ͼ Differential gene induction in primary macrophages exposed to 5-fold between treated and untreated macrophages. Among P. gingivalis, its LPS, or its FimA these most strongly up-regulated genes, the gene expression patterns in response to P. gingivalis and to its components Our previous studies have demonstrated that the response of were found to overlap. However, purified LPS from P. gingi- macrophages to live P. gingivalis differs from their response to valis uniquely and potently induced a set of IFN-inducible an- this bacterium’s cell surface components, LPS and FimA (9, tiviral genes, including IFN-, IFIT1, IFIT2, IFIT4, CXCL11, 10). To further uncover the cellular signaling events responsible OASL, ZC3HAV1, USP18, and IRF7, as well as a gene involved for these differences, we conducted a whole genome-based tran- in cholesterol metabolism (CH25H). In contrast, P. gingivalis scriptional analysis. This analysis examined the early response uniquely induced genes related to fatty acid or glucose of human macrophages to P. gingivalis infection and to its LPS metabolic cellular pathways (ACSL4, PBEF1) and the MAML2 or its FimA treatment. First, we purified human monocytes from (mastermind-like 2) gene whose protein product functions buffy coats of healthy blood donors, and the purity of mono- as a coactivator of the Notch signaling pathway. Therefore, cytes was found to be over 95%, as determined by FACS anal- we classified these 60 genes into three groups: Group 1, ␣ ysis (Fig. 1, A and B). Because TNF- release is an important genes commonly induced by P. gingivalis, its LPS and its Downloaded from response of monocytes/macrophages to infections and because FimA; Group 2, genes uniquely induced by P. gingi- the extent of such release is correlated to bacterial virulence, we valis LPS;and Group 3, genes uniquely induced by live ␣ then monitored the TNF- levels to determine the optimal P. gingivalis. quantities of P. gingivalis, its LPS and its FimA for the in vitro To independently confirm the microarray results, seventeen experiments. The MOI of 25:1 was selected for P. gingivalis genes from different categories with various expression levels, infection in vitro, because this ratio is equivalent to the potency which were identified by microarray analysis, were analyzed http://www.jimmunol.org/ of 10 g/ml of either LPS or FimA, which is sufficient to induce by qRT-PCR using the same RNA samples with which the mi- ␣ TNF- in macrophages (Fig. 1, C and D). croarrays had been hybridized. Our results showed that Of the 54674 genes (probe sets) assayed by the genome- a strong positive correlation exists between microarray based cDNA microarray, P. gingivalis, its LPS, and its FimA data and qRT-PCR results in terms of the magnitude and direc- commonly regulated 266 genes, while 501, 286, and 291 genes tion of gene expression patterns (Table III). The linear corre- were uniquely regulated by P. gingivalis, its LPS, or its FimA, lation coefficients (r2 values) for gene expression levels regu- respectively. The complete list of changes in macrophage tran- lated by P. gingivalis LPS, FimA, and P. gingivalis itself were 0.9927, 0.9311, and 0.9499, respectively. by guest on September 27, 2021
Computer-assisted promoter analysis of common and unique genes induced by P. gingivalis, its LPS, or its FimA Gene expression is regulated by nuclear transcription factors. The identification of three groups of genes among P. gingivalis and its components-simulated macrophages indicates that dif- ferent transcriptional regulation patterns may exist in macro- phages in response to P. gingivalis infection and to its purified components treatment. To determine whether unique transcrip- tional regulation patterns exist in different groups of genes, se- quences of 1000 bases upstream from the transcriptional start site of selected genes from each of the groups were analyzed using the Transcription Regulatory Element Search program to identify common TF sites for each group. Four different TF site patterns were identified from the three groups of genes (Fig. 2A). All genes in Group 1 possess the NFB binding site in their promoters, but have no ISRE element (except CXCL10); there- fore, they are defined as NFB-containing genes. Among these NFB-containing genes, some possess an NFB, but no Krup- pel-like factor (KLF) site (Pattern I), while others possess both NFB and KLF binding sites (Pattern II) in their promoters. All genes in Group 2 have the ISRE element. Among these, some FIGURE 1. TNF-␣ levels in human monocyte-derived macrophages in possess NFB site with or without KLF sites (Pattern III), response to P. gingivalis, its LPS, or its FimA. A, Peripheral blood PBMC which are defined as NFB and ISRE cocontaining genes; oth- were isolated by Ficoll-Hypaque density gradient centrifugation and sub- ers possess KLF site, but no NFB site (Pattern IV), and these jected to FACS analysis using anti-biotin Ab and anti-CD14 Ab. B, Mono- cytes were purified from PBMC and subjected to FACS analysis using are defined as ISRE-containing genes. Genes in Group 3, such anti-Biotin Ab and anti-CD-14 Ab. C, Dose-dependent TNF-␣ levels of as ACSL4, PBEF1, and MAML2, have no common TF pattern macrophages were measured by ELISA in response to LPS and FimA. D, and are unclassified (data not shown). Dose-dependent TNF-␣ levels of macrophages were measured by ELISA Accordingly, by hierarchical clustering of transcription fac- in response to live P. gingivalis. tors from cDNA array data, we observed that NFB family The Journal of Immunology 7781
Table II. The 60 genes of human macrophages showing the greatest increases in response to P. gingivalis, its LPS, and its FimA
Fold Changea
Unigene Gene Symbol Gene Title P. gingivalis FimA LPS
Hs.514913 SERPINB2 Serine (or cysteine) proteinase inhibitor, clade B, member 2 162.0 86.9 62.9 Hs.512234 IL6 Interleukin 6 (interferon,  2) 123.9 60.6 135.7 Hs.196384 PTGS2 Prostaglandin-endoperoxide synthase 2 118.7 67.8 131.6 Hs.160789 LOC341720 Similar to immune-responsive gene 1 84.8 75.0 198.9 Hs.546280 PTX3 Pentaxin-related gene, rapidly induced by IL-1 84.3 66.9 94.2 Hs.389874 TSLP Thymic stromal lymphopoietin 76.1 32.8 32.6 Hs.75498 CCL20 Chemokine (CC motif) ligand 20 68.2 55.5 53.3 Hs.98309 IL23A Interleukin 23, ␣ subunit p19 66.3 27.6 25.0 Hs.75765 CXCL2 Chemokine (CXC motif) ligand 2 66.3 50.0 43.4 Hs.530443 LOC387763 Hypothetical LOC387763 56.6 31.2 46.8 Hs.89690 CXCL3 Chemokine (CXC motif) ligand 3 52.8 46.1 43.1 Hs.371976 DMRTA1 DMRT-like family A1 50.3 28.8 11.7 Hs.1722 IL1A Interleukin 1, ␣ 49.2 22.8 19.5 Hs.99141 COBL Cordon-bleu homolog (mouse) 48.6 52.5 40.7 Hs.241570 TNF Tumor necrosis factor (TNF superfamily, member 2) 37.3 24.3 26.7 Hs.519909 MARCKS Myristoylated alanine-rich protein kinase C substrate 35.2 36.0 37.4 Hs.369785 MGC2749 Hypothetical protein MGC2749 29.9 22.3 18.9 Downloaded from Hs.532316 DBC1 Deleted in bladder cancer 1 26.6 20.4 18.0 Hs.674 IL12B Interleukin 12B 26.5 9.3 13.7 Hs.445818 SPON1 Spondin 1, extracellular matrix protein 23.6 17.8 16.0 Hs.126256 IL1B Interleukin 1,  23.4 21.2 20.2 Hs.164073 SLC26A9 Solute carrier family 26, member 9 22.9 18.7 23.7 Hs.789 CXCL1 Chemokine (CXC motif) ligand 1 21.6 18.6 17.2
Hs.272493 CCL14 Chemokine (CC motif) ligand 14 18.3 8.8 13.7 http://www.jimmunol.org/ Hs.506423 EDN1 Endothelin 1 17.9 10.7 11.2 Hs.335891 ABCC11 ATP-binding cassette, subfamily C, member 11 17.8 15.3 13.0 Hs.508234 KLF5 Kruppel-like factor 5 (intestinal) 17.4 15.6 14.4 Hs.248189 KRTHA6 Keratin, hair, acidic, 6 15.6 11.1 14.6 Hs.487046 SOD2 Superoxide dismutase 2, mitochondrial 15.3 12.7 11.1 Hs.466919 GEMIN7 Gem (nuclear organelle) associated protein 7 15.2 11.9 14.5 Hs.210043 SGPP2 Sphingosine-1-phosphate phosphatase 2 14.6 11.3 10.7 Hs.50550 KBTBD10 Kelch repeat and BTB (POZ) domain containing 10 14.5 12.6 14.7 Hs.274256 ELOVL7 ELOVL family member 7, elongation of long-chain fatty acids 14.3 12.4 11.4 Hs.502328 CD44 CD44 antigen (homing function and Indian blood group system) 14.2 5.4 7.5
Hs.23582 TACSTD2 Tumor-associated calcium signal transducer 2 13.1 11.9 15.0 by guest on September 27, 2021 Hs.235768 NKIR CD300 antigen-like family member F 12.8 7.9 11.2
Hs.432132 G0S2 Putative lymphocyte G0/G1 switch gene 12.4 8.5 6.3 Hs.105448 WNK4 WNK lysine-deficient protein kinase 4 12.3 9.5 12.1 Hs.76095 IER3 Immediate early response 3 11.8 9.5 6.9 Hs.55999 NKX3–1 NK3 transcription factor-related locus 1 11.6 7.1 7.4 Hs.413924 CXCL10 Chemokine (CXC motif) ligand 10 10.8 14.2 34.8 Hs.155396 NFE2L2 Nuclear factor (erythroid-derived 2)-like 2 9.4 11.3 10.3 Hs.525607 TNFAIP2 Tumor necrosis factor, ␣ -induced protein 2 9.4 8.2 8.7 Hs.112148 TGIF2LY TGFB-induced factor 2-like, Y-linked 8.5 7.4 10.6 Hs.113912 RAPGEF2 Rap guanine nucleotide exchange factor (GEF) 2 5.8 8.3 12.0 Hs.157818 KCNAB1 Potassium voltage-gated channel, shaker-related subfamily,  member 1 16.4 10.9 NC Hs.506415 PCTK2 PCTAIRE protein kinase 2 13.9 8.4 NC Hs.268785 ACSL4 Acyl-CoA synthetase long-chain family member 4 14.6 NC NC Hs.489615 PBEF1 Pre-B cell colony enhancing factor 1 13.1 NC NC Hs.428214 MAML2 Mastermind-like 2 (Drosophila) 11.4 NC NC Hs.93177 IFNB1 Interferon,  1, fibroblast NC NC 132.4 Hs.518814 CXCL11 Chemokine (CXC motif) ligand 11 NC NC 98.6 Hs.437609 IFIT2 Interferon-induced protein with tetratricopeptide repeats 2 NC NC 68.1 Hs.118633 OASL 2Ј-5Ј-oligoadenylate synthetase like NC NC 26.3 Hs.20315 IFIT1 Interferon-induced protein with tetratricopeptide repeats 1 NC NC 18.8 Hs.47357 CH25H Cholesterol 25-hydroxylase NC NC 12.8 Hs.38260 USP18 Ubiquitin-specific protease 18 NC NC 11.0 Hs.376206 KLF4 Kruppel-like factor 4 (gut) NC NC 9.4 Hs.166120 IRF7 Interferon regulatory factor 7 NC NC 7.6 Hs.50640 SOCS1 Suppressor of cytokine signaling 1 NC NC 5.9
aData are presented as average fold increases compared to levels in control cells (n ϭ 3 independent experiments). NC, no change (do not meet the criteria for significant filter described in Materials and Methods).
members, such as RELA (p65 NFB), REL, RELB, and Kruppel- with the different TF binding patterns identified from the three like factor (KLF5), were commonly up-regulated by P. gingi- groups of genes differently induced by P. gingivalis, its LPS valis, its LPS, and its FimA, while KLF4 and IRF7 were and its FimA, indicating that these transcription factors may uniquely up-regulated by P. gingivalis LPS (Fig. 2B). The dif- play an important role in the regulation of gene expression in ferential regulation of NFB, KLF4, and IRF7 is coordinated macrophages in response to P. gingivalis, its LPS, or its FimA. 7782 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis
Table III. Validation by qRT-PCR of selected genes that were regulated by P. gingivalis, its LPS, and its FimA according to cDNA microarraya
Fold Change by LPS Fold Change by FimA Fold Change by PG
Gene Product qPCR Microarray qPCR Microarray qPCR Microarray
Pentaxin-related gene, rapidly induced by IL-1 (PTX3) 337.8 94.2 137.2 66.9 247.3 84.3 Prostaglandin-endoperoxide synthase 2 (PTGS2) 430.5 131.6 123.6 67.8 337.8 118.7 TNF receptor-associated factor 1 (TRAF1) 35.5 6.5 27.9 6.3 28.8 8.1 Toll-like receptor 2 (TLR2) 4.8 2.9 5.3 2.3 10.2 6.8 Toll-like receptor 6 (TLR6) Ϫ2.9 Ϫ4.9 Ϫ3.3 Ϫ5.3 Ϫ3.8 Ϫ5.6 Interferon regulatory factor 8 (IRF8) 16 5.4 13.5 3.6 12.1 3.1 Lipopolysaccharide-induced TNF factor (LITAF) 3 2.4 3.2 2.5 4.6 3.1 Toll-like receptor 7 (TLR7) 17.2 2.7 13.0 2.5 21.9 4.1 TIR domain-containing adaptor-inducing interferon  2.6 2.1 2.6 2.2 2.4 1.6 (TRIF) Interleukin-1 receptor-associated kinase 2 (IRAK2) 24.3 4.8 24.3 5.1 32 5.7 Immediate early response 3 (IER3) 2.5 6.9 3.7 9.5 12.6 11.8 Interferon regulatory factor 7 (IRF7) 28.8 7.6 4.8 1.3 4.8 1.1 Sprouty homolog 2 (SPRY2) Ϫ7.7 Ϫ6.3 Ϫ3.6 Ϫ3.7 Ϫ5.9 Ϫ7.7 Thymic stromal lymphopoietin (TSLP) 142 32.6 132.5 32.8 512.1 76.1 Chemokine (CXC motif) ligand 3 (CXCL3) 115.4 43.1 163.1 46.1 265 52.8 v-rel reticuloendotheliosis viral oncogene homolog (REL) 5.5 4.3 6.7 5.3 12.1 7.2 Downloaded from Nuclear factor of light polypeptide gene enhancer in B 5.8 4.3 6.8 4.6 7.6 6.1 cells 2 (NFkB2)
aData are presented as average fold changes compared to levels in control cells (n ϭ 3 independent experiments). Ϫ, Decrease. PG, P. gingivalis.
Role of TLR2 and TLR7 in macrophage gene induction by P. gen-specific immune response (15). Our cDNA microarray data http://www.jimmunol.org/ gingivalis, its LPS, or its FimA showed that TLR2 and TLR7 were up-regulated by P. gingivalis, its Previous studies have demonstrated that P. gingivalis, its LPS, and LPS, or its FimA, while TLR1, TLR6, and TLR10, which are its FimA activate macrophages via TLR2 (9, 13) or TLR4 (14). thought to associate with TLR2 to form heterodimers (16–19), Macrophages then use TLRs to initiate a tightly controlled patho- were down-regulated (Fig. 3A). To clarify the roles of TLR2 and by guest on September 27, 2021
FIGURE 2. NFB, KLF4, and IRF7 were identified as potential transcription factors that regulate gene expression in response to P. gingivalis and its components. A, Promoter analysis reveals ISRE elements and NFB or KLF binding site in the upstream no-coding regions of selected genes differentially expressed in macrophages treated by P. gingivalis and its components. Elements 1000 bases 5Ј upstream from the transcriptional start site were analyzed by Transcription Regulatory Element Search to identify the presence of transcription factor binding sites. The nucleotide sequences and specific locations of DNA binding elements within these promoter regions are provided with positions relative to the transcriptional start site, which is defined as ϩ 1. Symbols indicating distinct DNA binding elements (e.g., ISRE, NFB, KLF, STAT, AP-1, GC box, and TATA box) are shown. B, Depicted here as a heat map are transcription factors that were identified as being regulated by P. gingivalis, its LPS, and its FimA. Color intensity correlates with average log base 2 values of fluorescence intensities (n ϭ 3; red corresponds to up-regulation and green corresponds to down-regulation). Transcription factors were grouped and then extracted with hierarchical clustering algorithms. Numbers under fold change are mean values of three independent experiments: Ϫ, down- regulated; NC, no change. The Journal of Immunology 7783 Downloaded from http://www.jimmunol.org/
FIGURE 3. Roles of TLR2 and TLR7 in macrophage gene induction by P. gingivalis, its LPS, and its FimA. A, A heat map shows a group of cell surface receptors that were regulated in macrophages by P. gingivalis, its LPS, and its FimA. Color intensity and map keys are described as in Fig. 2B. B, An agarose gel electrophoresis shows an RT-PCR analysis of TLR2 and TLR7 mRNA expression in wild-type (WT), TLR2Ϫ/Ϫ, and TLR7 siRNA-treated macrophages. C, WT, TLR2Ϫ/Ϫ, and TLR7 siRNA-treated macrophages were exposed to P. gingivalis, its LPS, or its FimA for 2 h, and the mRNA expression of PTX3, CXCL10, IFNB1, and IFIT2 in macrophages was measured by qRT-PCR using total RNA. The data shown are the average fold changes of three independent experiments. Asterisks indicate statistically significant (p Ͻ 0.05) differences in change of mRNA expression compared with wild-type control. by guest on September 27, 2021
TLR7 in gene induction by P. gingivalis, its LPS, and its FimA, we well as in TLR7 siRNA knockdown macrophages. The gene ex- further used qRT-PCR to analyze gene expression for PTX3 pression of TLR2 and TLR7 was confirmed by RT-PCR using total (NFB-containing), CXCL10, IFN- (NFB/ISRE con-contain- RNA from TLR2Ϫ/Ϫ macrophages and TLR7 siRNA knockdown ing), and IFIT2 (ISRE-containing) in TLR2Ϫ/Ϫ macrophages as macrophages (Fig. 3B). The results of qRT-PCR, which
FIGURE 4. Gene induction by P. gingivalis, its LPS, or its FimA in TLR7Ϫ/Ϫ macrophages. Peritoneal macrophages from TLT7Ϫ/Ϫ and WT mice were exposed to P. gingivalis, its LPS, or its FimA for 2 h, and the mRNA expression of PTX3, CXCL10, IFNB1, and IFIT2 was measured by qRT-PCR using total RNA. The data shown is the average fold changes of three independent experiments. Asterisks indicate statistically significant (p Ͻ 0.05) differences in change of mRNA expression compared with WT control. 7784 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis corresponded to the cDNA microarray results, demonstrated that gingivalis, its LPS, or its FimA are essential for the induction of PTX3 and CXCL10 were induced by P. gingivalis, its LPS, or its both NFB-containing gene (PTX3) and NFB-ISRE cocontaining FimA, while IFN- and IFIT2 were induced by LPS alone (Fig. genes (IFN- and CXCL10), but the induction of ISRE- containing 3C). TLR2Ϫ/Ϫ or TLR7 knockdown caused remarkable suppres- gene (IFIT2) is largely independent of either TLR2 or TLR7. sion of PTX3 and CXCL10 mRNA induction by all three stimuli, ␣ but little effect of TLR2 or TLR7 on the induction of IFN- and Role of IFN R and MyD88 in macrophage gene induction by IFIT2 by LPS was observed. Codeficiency of TLR2 and TLR7 P. gingivalis, its LPS or its FimA severely impaired PTX3, CXCL10, and IFN- mRNA induction, IFN␣R has been demonstrated to play an important role in IFN- but exhibited a significantly lesser effect on IFIT2 mRNA induc- inducible gene induction (20). In addition, MyD88 is an adopter tion (Fig. 3C). Because the activation of TLR7 by P. gingivalis, its activated by both TLR2 and TLR7 and is essential for the induc- LPS, or its FimA was an intriguing finding, we further used tion of both inflammatory cytokine (21, 22) and type-I IFN pro- TLR7Ϫ/Ϫ mice to confirm these results. As anticipated, TLR7 duction (23). Therefore, we compared the role of IFN␣R and mRNA in TLR7Ϫ/Ϫ macrophages was undetectable, but it was eas- MyD88 in the induction of cytokine genes and IFN-inducible ily detected in wild type macrophages (data not shown). The in- genes. The gene expression of IFN␣R in siRNA knockdown duction of PTX3 and CXCL10 mRNA by live P. gingivalis, its macrophages and MyD88 expression in MyD88Ϫ/Ϫ macrophages LPS, or its FimA was dramatically attenuated in TLR7Ϫ/Ϫ mac- were either significantly suppressed or completely disappeared, re- rophages as compared with their wild type counterpart (Fig. 4, A spectively (Fig. 5A). Knockdown of IFN␣R by siRNA had no and B), similar to the results as observed with TLR7 knockdown. effect on the suppression of PTX3 expression, but had remarkable
In addition, the induction of IFN- mRNA by LPS was also sig- effect on the suppression of CXCL10, IFN-, and IFIT2 expression Downloaded from nificantly reduced in TLR7Ϫ/Ϫ macrophages (Fig. 4C), but the (Fig. 5B). However, stimulation of MyD88Ϫ/Ϫ macrophages with mRNA expression of IFIT2 was unimpaired (Fig. 4D). Together, P. gingivalis, its LPS, or its FimA was unable to activate PTX3 and these results indicate that activation of either TLR2 or TLR7 by P. CXCL10 gene expression, and the induction of IFN-, but not http://www.jimmunol.org/ by guest on September 27, 2021
FIGURE 5. Roles of IFN␣/R and MyD88 in macrophage gene induction by P. gingivalis, its LPS, or its FimA. A, An agarose gel electrophoresis shows an RT-PCR analysis of MyD88 and IFN␣/R mRNA expression in wild-type (WT), MyD88Ϫ/Ϫ, and IFN␣/R siRNA-treated macrophages. B, WT, MyD88Ϫ/Ϫ, and IFN␣/R siRNA-treated macrophages were exposed to P. gingivalis, its LPS, or its FimA for 2 h, and the mRNA expression of PTX3, CXCL10, IFNB1, and IFIT2 was measured by qRT-PCR using total RNA. C, Human macrophages transfected with IFN␣/R siRNA were stimulated with P. gingivalis LPS for 2 or 4 h, and the mRNA expression of PTX3, CXCL10, IFNB1, IRF7, and IFIT2 was measured by qRT-PCR using total RNA. The data shown is the average fold changes of three independent experiments. Asterisks indicate statistically significant (p Ͻ 0.05) differences in change of mRNA expression compared with control siRNA. The Journal of Immunology 7785
IFIT2 by LPS, was severely impaired in MyD88Ϫ/Ϫ macrophages tokine and IFN-inducible gene expression in mammalian cells (Fig. 5B). Codeficiency of IFN␣R and MyD88 resulted in com- (23–25). Based on our cDNA microarray and the computer- plete suppression of PTX3, CXCL10, IFN-, and IFIT2 induction assisted promoter analysis of TF sites, the data presented (Fig. 5B). Thus, these data indicate that the induction of PTX3 is clearly suggest that the transcription factors NFB, KLF4, and dependent on MyD88, but not on IFN␣R; the robust induction of IRF7 do play an important role in gene induction by P. gingi- CXCL10 and IFN- is dependent on both MyD88 and IFN␣R, valis, its LPS, or its FimA. Thus, we first assessed the role of while the induction of IFIT2 is dependent on IFN␣R. To deter- TLR2 and TLR7 in the regulation of NFB p65, KLF4, IRF3, mine whether IFN␣R plays the same role in human macrophages and IRF7 at the protein level. Neither P. gingivalis nor its com- ␣ as in mouse macrophages, we analyzed the effect of IFN R gene ponents induced total p65 expression (data not shown), but all  knockdown by siRNA on PTX3, CXCL10, IFN- , IRF7, and IFIT2 of them induced the phosphorylation of p65 NFB. Further- gene induction in human macrophages. Our results showed that more, the phosphorylation of p65 NFB was significantly sup- ␣ gene knockdown of IFN R dramatically suppressed CXCL10, pressed by TLR2 knockout, but not by TLR7 siRNA (Fig. 7A).  IFN- , IRF7, and IFIT2 gene induction, but not PTX3 gene in- Expression of KLF4 and IRF7 was only induced by P. gingi- C ␣ duction by LPS (Fig. 5 ), confirming the role of IFN R on IFN- valis LPS, and their induction was not affected by either TLR2 inducible gene expression in human macrophages. knockout or by TLR7 siRNA (Fig. 7A). IRF3 was constitutively To determine whether P. gingivalis LPS induces IFN-inducible expressed and not modulated either by TLR2 or by TLR7 ac- gene via IFN- autocrine loop (20), we further analyzed the PTX3, tivation (Fig. 7A). These results suggest that the phosphoryla- IFN-, CXCL10, and IFIT2 gene induction by P. gingivalis LPS in tion of p65 NFB is largely dependent on TLR2, but the in- IFN- gene knockdown macrophages. As expected, the expression Downloaded from duction of KLF4 and IRF7 is independent of either TLR2 or of IFN- mRNA was dramatically diminished by IFN- siRNA TLR7. Because both MyD88 and IFN␣R played important (Fig. 6B). We stimulated the cells with P. gingivalis LPS for 4 h rather than 2 h this time, so that IFN- was produced to trigger roles in gene induction by P. gingivalis, its LPS or its FimA ␣ autocrine induction. The induction of IFN- and IFIT2 by P. gin- (Fig. 5), we further analyzed the role of MyD88 and IFN Rin givalis LPS was much stronger after 4 h stimulation (Fig. 6, B and the regulation of p65 NF B, KLF4, IRF3, and IRF7 activation. As expected, the phosphorylation of p65 NFB via TLR2 was D) than that after 2 h stimulation (Fig. 5B) in control cells. How- http://www.jimmunol.org/ ever, the knockdown of IFN- gene by siRNA, which blocked the completely suppressed by MyD88 knockout, but was not af- ␣ IFN- autocrine induction, dramatically suppressed IFIT2 mRNA fected by IFN R siRNA. Both KLF4 and IRF7 induced by induction (Fig. 6D) and partially inhibited CXCL10 mRNA induc- LPS were suppressed by IFN␣R siRNA, but not by MyD88 tion (Fig. 6C), but the induction of PTX3 mRNA by P. gingivalis knockout. The constitutively expressed IRF3 was also not af- LPS remained unimpaired (Fig. 6A). These results suggest that the fected by either MyD88 knockout or by IFN␣R siRNA (Fig. robust induction of IFN-inducible gene by P. gingivalis LPS is 7B). Furthermore, in human macrophages, p65 NFB phosphor- dependent on IFN- autocrine loop. ylation was also unimpaired by IFN␣R siRNA; however, the induction of both KLF4 and IRF7 by P. gingivalis LPS was
by guest on September 27, 2021 MyD88 is essential for p65 NF B phosphorylation, while significantly diminished by IFN␣R siRNA (Fig. 7C). There- ␣ IFN R is required for the induction of KLF4 and IRF7 in fore, we can conclude that activation of p65 NFBbyP. gin- macrophage response to P. gingivalis, its LPS, or its FimA givalis, its LPS, or its FimA via TLR2 is dependent on MyD88, Transcription factors, such as NFB, KLF4, IRF3, and IRF7, while activation of KLF4 and IRF7 by P. gingivalis LPS is have been reported to play an important role in regulating cy- dependent on IFN␣R.
FIGURE 6. LPS-induced IFN-inducible gene expression requires IFN-. Peritoneal macrophages from C57BL/6 mice were transfected with siRNA for IFN- gene and stimulated with P. gingivalis LPS for 4 h. Gene expression of PTX3 (A), IFN- (B), CXCL10 (C), and IFIT2 (D) was analyzed by qRT-PCR using total RNA isolated from macrophages. The data shown is the average fold changes of three independent experiments. Asterisks indicate statistically significant (p Ͻ 0.05) differences in change of mRNA expression. 7786 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis Downloaded from
FIGURE 7. Roles of TLR2, TLR7, MyD88, and IFN␣/R in the activation of NFB, KLF4 and IRF7. A, Macrophages from WT and TLR2Ϫ/Ϫ mice
were transfected with siRNA for TLR7, and treated with P. gingivalis, its LPS, or its FimA for 4 h. The cell lysates were analyzed by Western blotting. http://www.jimmunol.org/ The data shown represent one of the three independent experiments. B, WT, MyD88Ϫ/Ϫ, and IFN␣/R siRNA-treated macrophages were stimulated with P. gingivalis, its LPS, or its FimA for 4 h, and the cell lysates were analyzed by Western blotting. The data shown represent one of the three independent experiments. C, Human macrophages were transfected with IFN␣/R siRNA and treated with P. gingivalis LPS for 2 and 4 h. The cell lysates were analyzed by Western blotting, and the data shown represent one of the three independent experiments.
Induction of pS727 STAT1 by P. gingivalis or its components is p38 MAPK is identified as the most predominant phosphor- dependent on MyD88, while induction of pY701 STAT1 by LPS kinase (including p38␣,␥,␦) and because it has previously been ␣ is dependent on IFN R shown to be necessary for TLR-induced phosphorylation of by guest on September 27, 2021 Previous reports have demonstrated that both TLR-signaling STAT1 (27), we further analyzed the role of p38 MAPK on  and IFN␣R-signaling lead to the phosphorylation of STAT1 gene induction of PTX3, CXCL10, IFN- , IRF7, and IFIT2.To (20, 26, 27). Subsequent studies sought to determine whether accomplish this, human macrophages were stimulated with P. engagement of MyD88 and IFN␣R also leads to the activation gingivalis, its LPS, or its FimA, in the presence or absence of STAT1 in response to the stimulation of P. gingivalis, its (DMSO only) of the specific p38 inhibitor SB203580. Total LPS, or its FimA. STAT1 activation was assessed by measuring RNA was analyzed by qRT-PCR for gene expression of PTX3,  its phosphorylation status. Our results demonstrated that P. gin- CXCL10, IFN- , IRF7, and IFIT2. The results showed that givalis, its LPS, and its FimA all induced the serine phosphor- SB203580 treatment inhibited PTX3 and CXCL10 induction by  ylation of STAT1 (pS727) and that this induction was sup- each agonist, but had little effect on IFN- , IRF7, and IFIT2 pressed by MyD88 knockout, but not by IFN␣R siRNA. induction by P. gingivalis LPS (Fig. 9, D–F). These findings However, the STAT1 tyrosine phosphorylation (pY701) was demonstrated that the phosphorylation of p38 MAPK was nec- induced only by P. gingivalis LPS, and this phosphorylation essary for P. gingivalis-, its LPS-, and its FimA-induced NF B- was not affected by MyD88 knockout, but was severely im- dependent gene expression, but not for P. gingivalis LPS-in- paired by IFN␣R siRNA. Total levels of STAT1 did not duced IFN-inducible gene expression. change in response to each agonist, and no effect of MyD88 and IFN␣R on total STAT1 was observed (Fig. 8). Thus, the serine Discussion phosphorylation of STAT1 induced by P. gingivalis, its LPS, or P. gingivalis causes an inflammatory condition that leads to a its FimA was dependent on MyD88, while the unique induction progressive destruction of the tooth attachment apparatus and of the tyrosine phosphorylation of STAT1 by P. gingivalis LPS was dependent on IFN␣R.
Role of p38 MAP kinase in macrophage gene induction by P. gingivalis, its LPS, or its FimA Because phosphorylation of kinases play important roles in sig- nal transduction, we analyzed the phosphorylation status of all three major families of MAPKs, the ERK1/2, and cJNK1–3 by FIGURE 8. Effects of MyD88 and IFN␣/R on STAT1 phosphoryla- human MAPKs phosphorylation array. The results indicated tion are shown. WT, MyD88Ϫ/Ϫ, and IFN␣/R siRNA-treated macro- that p38 MAPK, ERK1/ERK2, JNK2, and HSP27 were phos- phages were stimulated with P. gingivalis, its LPS, or its FimA for 4 h, and phorylated in human macrophages after treatment with P. gin- the phosphorylation of STAT1 was analyzed by Western blotting. The data givalis or its cell surface components (Fig. 9, A–C). Because shown represent one of the three independent experiments. The Journal of Immunology 7787 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021
FIGURE 9. p38 MAPK is essential for NFB-dependent gene induction by P. gingivalis, its LPS, and its FimA. Human macrophages were exposed to P. gingivalis, its LPS, or its FimA for 30 min, and cell lysates were subjected to phospho-MAPK array. The locations of each phospho-MAPK Ab in the array membrane are shown in A. B, The phospho-MAPK array images which represent one of three independent experiments obtained by exposure of membranes to x-ray film. Phosphorylated MAPK, whose average changes in net optical intensity (mean Ϯ SD; n ϭ 3) were greater than 2-fold in P. gingivalis-, LPS-, or FimA-treated cells relative to control cells, are shown in C. D–F, Human macrophages treated with DMSO or 20 M SB203580 for 1 h before exposure to P. gingivalis, its LPS, or its FimA for 2 h. Gene expression of PTX3, CXCL10, IFNB1, IRF7, and IFIT2 were quantified by qRT-PCR using total cellular RNA. The data shown is the average fold changes of three independent experiments. Asterisks indicate statistically significant (p Ͻ 0.05) differences in change of mRNA expression.
the supporting bones, and has been implicated as a contributory teria, whereas in chronic infection the host responds to a com- factor in the development of atherosclerosis (28–32). The fim- bination of live bacteria and subsequent breakdown of its cell briae produced by this pathogen constitute a major virulence wall (i.e., LPS, fimbria) by host immune cells. The present factor on the basis of studies in animal models of periodontitis study offers new insight into our understanding of acute vs or atherosclerosis (33). Another widely studied surface struc- chronic infections and unveils mechanisms by which live P. ture of P. gingivalis is its LPS, which displays significant struc- gingivalis, its LPS, and its fimA interact with innate immune tural and biological differences from the LPS of E. coli (34). cells. This may not only contribute to elucidating periodontal Both P. gingivalis and its purified cell surface components (LPS inflammation and disease pathogenesis, but also offers excellent and FimA) are detected predominantly by TLR2 of the innate molecular tolls for the study of pattern-recognition mechanisms immune system resulting in host cell activation (9, 28, 35), of innate immunity. although activation of TLR4 by P. gingivalis LPS has also been In the present study, we demonstrated that P. gingivalis, its reported (14). Our previous studies demonstrated that macro- LPS, and its FimA commonly activate NFB through either phages respond differently to live P. gingivalis, when compared TLR2- or TLR7-MyD88-p38 MAPK pathway to induce NFB- with its LPS or its FimA, in the context of cytokine secretion and intracellular molecule induction (7, 9, 10). The differential containing and NF B/IRSE cocontaining gene expression, cytokine response to live P. gingivalis and to its components while P. gingivalis LPS uniquely induces ISRE-containing gene  LPS or FimA suggests that live P. gingivalis and its components by the activation of IFN- autocrine loop. Although endowed play different roles in P. gingivalis acute vs chronic infection. with critical antiviral activities, type I IFN signaling plays un- Indeed, in acute infection the host responds mostly to live bac- certain roles in antibacterial defenses. It had only minor effects 7788 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis on the outcome of experimental lung tuberculosis (36), but det- mediates an inhibitory signal that interferes with IRF7 phos- rimental in listeriosis (37–39); whereas it was a crucial host phorylation. We also found that the induction of IRF7 requires defense against extracellular patho-gens, including group B an IFN␣R signaling. This may explain why the initial induc- Streptococci pneumonia, E. coli, and Sal-monella typhimurium tion of IFN- requires signal from both TLR7 and IFN␣R. (40). IFN-␣ signaling was required for optimal macrophage Our results show that the early weak induction of IFN-inducible responses to low dose of purified LPS, which may mimic the genes (IFN- and IFIT2)byP. gingivalis LPS was significantly actual amount of LPS in the infection tissue, to increase the suppressed by siRNA for IFN␣/R. Therefore, P. gingivalis TNF-␣ and IFN-␥ production in macrophages (40). Therefore, LPS may be a weak activator for IFN␣/R and induces a min- P. gingivalis LPS possibly could boost the antibacterial re- imal initial IFN- expression because it induces the tyrosine sponses of macrophages by promoting IFN- expression, and phosphorylation of STAT1 (Fig. 8) and IRF7 expression (Fig. simultaneously cause detrimental lesion in infected tissues due 5C). After a certain amount of IFN- has been produced, the to enhanced local inflammatory reactions, such as overexpres- robust expression of IFN-inducible genes is then induced by sion of TNF-␣. IFN- autocrine loop. Nevertheless, the initial activator of P. gingivalis is also strongly associated with the development of IFN␣R requires further investigation. Further studies will ex- atherosclerosis (28–33); this may be attributed to its ability to amine whether P. gingivalis LPS can directly activate and bind activate TLR2 given that TLR2 plays a critical role in the progres- to the IFN␣/R. sion of atherosclerosis (41–44). During P. gingivalis chronic in- Based on our present data, we postulated a signaling pathway fection, the bacteria themselves and their LPS and fimbriae re- model induced by P.gingivalis, its LPS and its FimA (Fig. 10). leased via bacterial breakdown might penetrate the gingival tissues P. gingivalis, its LPS and its FimA activate either TLR2 or Downloaded from and move into blood circulation, from which they might contribute TLR7 and induce NFB-containing or NFB/IFN␣R cocon- to systemic inflammatory responses, such as those believed to be taining genes through MyD88-p38 MAPK pathway in connec- involved in atherosclerosis. P. gingivalis LPS and FimA have been tion with the use of STAT1 (pS727)/p65 complexes or KLF/p65 demonstrated to have the ability to induce the production of IL-8 complexes. P. gingivalis LPS additionally induces expression and MCP-1 in human vascular endothelial cells (45) and macro- of ISRE-containing genes requiring the activation of IFN␣R-
phages (9), which is closely related to atherosclerosis (46, 47). STAT1 (pY701) pathway in connection with the use of p65/ http://www.jimmunol.org/ TLR2 activation by P. gingivalis LPS and fimbriae in the blood IRF7 or KLF4/IRF7 complexes. Because IRF7 is absolutely circulation system may also impart macrophage-activating ability required for robust IFN␣/ induction (23, 55), the maximum to apolipoprotein A-1 (44), therefore, reverse the protective role of induction of IFN- by P. gingivalis LPS may require the acti- apoA-1 and contribute to the genesis of atherosclerosis. Finally vation of both IRF7 and p65 NFB. Because the induction of DPG3, a fimbriae-deficient strain of P. gingivalis was not able to KLF4 and IRF7 by P. gingivalis LPS was dependent on stimulate atherosclerosis as did the wild-type strain advocating for IFN␣R, and the promoters of ISRE-containing genes possess a role of fimbriae in P. gingivalis-associated atherosclerosis (45, both ISRE and KLF-binding sites; therefore, KLF4 together 48–50). with IRF7 may play an important role in the induction of ISRE- In addition, our studies demonstrated that TLR7 was acti- containing genes, such as IFIT2. In summary, we have identi- by guest on September 27, 2021 vated by P. gingivalis, its LPS, or its FimA, and it played an fied these signaling pathways based on a broad range of infor- important role in the induction of NFB-containing gene as mation obtained in this study. Although the TLR-MyD88-p38 well as NFB-ISRE cocontaining gene expression. The study MAPK pathway is well-known for macrophage reaction to by Triantafilou et al. (28) showed that the silencing of TLR7 did not affect the production of TNF-␣ in human vascular endothe- lial cells in response to P. gingivalis LPS. However, in our study we used macrophages, a cell type that is different from endothelial cells, which can explain the discrepancy. In coop- eration with TLR4 signaling, TLR7/8 was shown recently to induce IL-12p70 synthesis in human monocytes, triggering a potent Th1 response before T cell help is established (51). How- ever, consistent with our results that TLR2 had little effect on the early induction of IFN-, a potential IL-12p70 inducer (20), the combination of TLR2 and TLR7/8 signaling was found un- able to induce IL-12p70 in human monocytes (51). Interest- ingly, we observed that TLR7 was essential for the early in- duction of IFN- (Fig. 4) by P. gingivalis LPS, and this induction required an intact IFN␣R signaling. This double re- quirement for IFN- induction may represent a safeguard mech- anism preventing inappropriate secretion of potentially harmful Th1 cytokines induced by type I IFN in the early phase of an infection. The mechanism involved in the initial IFN- induc- tion by TLR7 may require the formation of a complex consist- ing of MyD88, IRF7, and TRAF6 (52, 53). Although both TLR2 FIGURE 10. Model of signaling pathways of macrophage initiated by and TLR7 activate MyD88 pathway, TLR7 uses only MyD88 as P. gingivalis (PG), its LPS, and its FimA. Both P. gingivalis and its purified an adaptor to transmit a signal. In contrast, TLR2 uses both components activate TLR2 and TLR7 to induce NFB-dependent gene MyD88 and TIRAP (54). Thus, it is possible that the newly expression through MyD88-p38 MAPK pathway. In addition, P. gingivalis induced IRF7 by P. gingivalis LPS or its associated protein LPS induces ISRE-containing gene expression requiring IFN␣/R signal kinase cannot be recruited to the TLR-MyD88 complex when from IFN-, which leads to the tyrosine phosphorylation of STAT1 and the TIRAP is associated with the receptor complex or that TIRAP activation of IRF7 and KLF4. The Journal of Immunology 7789 pathogens, the IFN␣R signaling pathway could also be of ma- 22. Hemmi, H., T. Kaisho, O. Takeuchi, S. Sato, H. Sanjo, K. Hoshino, T. Horiuchi, jor importance in determining the nature of the course of in- H. Tomizawa, K. Takeda, and S. Akira. 2002. Small anti-viral compounds acti- vate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Im- fection and pathology (i.e., acute vs chronic) in P. gingivalis munol. 3: 196–200. infection because P. gingivalis LPS is a potent inductor of 23. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada,  Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master IFN- . Determining the physiological role of type I IFNs during regulator of type-I interferon-dependent immune responses. Nature 434: P. gingivalis infection will be the next critical step in under- 772–777. standing the chronic inflammatory reaction of periodontitis 24. Jiang, Z., T. W. Mak, G. Sen, and X. Li. 2004. Toll-like receptor 3-mediated activation of NF-B and IRF3 diverges at Toll-IL-1 receptor domain-containing caused by P. gingivalis. adapter inducing IFN-. Proc. Natl. Acad. Sci. USA 101: 3533–3538. 25. Feinberg, M. W., Z. Cao, A. K. Wara, M. A. Lebedeva, S. Senbanerjee, and Disclosures M. K. Jain. 2005. Kruppel-like factor 4 is a mediator of proinflammatory signal- ing in macrophages. J. Biol. Chem. 280: 38247–38258. The authors have no financial conflict of interest. 26. Toshchakov, V., B. W. Jones, P. Y. Perera, K. Thomas, M. J. Cody, S. Zhang, B. R. Williams, J. Major, T. A. Hamilton, M. J. Fenton, and S. N. Vogel. 2002. References TLR4, but not TLR2, mediates IFN--induced STAT1␣/-dependent gene ex- pression in macrophages. Nat. Immunol. 3: 392–398. 1. Darveau, R. P., A. Tanner, and R. C. Page. 1997. The microbial challenge in periodontitis. Periodontol. 2000 14: 12–32. 27. Rhee, S. H., B. W. Jones, V. Toshchakov, S. N. Vogel, and M. J. Fenton. 2003. 2. Bainbridge, B. W., and R. P. Darveau. 2001. Porphyromonas gingivalis lipopoly- Toll-like receptors 2 and 4 activate STAT1 serine phosphorylation by distinct saccharide: an unusual pattern recognition receptor ligand for the innate host mechanisms in macrophages. J. Biol. Chem. 278: 22506–22512. defense system. Acta Odontol. Scand. 59: 131–138. 28. Triantafilou, M., F. G. Gamper, P. M. Lepper, M. A. Mouratis, C. Schumann, 3. Darveau, R. P., S. Arbabi, I. Garcia, B. Bainbridge, and R. V. Maier. 2002. E. Harokopakis, R. E. Schifferle, G. Hajishengallis, and K. Triantafilou. 2007. Porphyromonas gingivalis lipopolysaccharide is both agonist and antagonist Lipopolysaccharides from atherosclerosis-associated bacteria antagonize TLR4,
for p38 mitogen-activated protein kinase activation. Infect. Immun. 70: induce formation of TLR2/1/CD36 complexes in lipid rafts and trigger TLR2- Downloaded from 1867–1873. induced inflammatory responses in human vascular endothelial cells. Cell Mi- 4. Yoshimura, A., T. Kaneko, Y. Kato, D. T. Golenbock, and Y. Hara. 2002. Li- crobiol. 9: 2030–2039. popolysaccharides from periodontopathic bacteria Porphyromonas gingivalis and 29. Yamazaki, K., T. Honda, H. Domon, T. Okui, K. Kajita, R. Amanuma, C. Kudoh, Capnocytophaga ochracea are antagonists for human toll-like receptor 4. Infect. S. Takashiba, S. Kokeguchi, F. Nishimura, M. Kodama, Y. Aizawa, and H. Oda. Immun. 70: 218–225. 2007. Relationship of periodontal infection to serum antibody levels to periodon- 5. Amano, A. 2003. Molecular interaction of Porphyromonas gingivalis with host topathic bacteria and inflammatory markers in periodontitis patients with coro- cells: implication for the microbial pathogenesis of periodontal disease. nary heart disease. Clin. Exp. Immunol 149: 445–452. J. Periodontol. 74: 90–96. 30. Li, L., E. Messas, E. L. Batista, Jr., R. A. Levine, and S. Amar. 2002. Porphy- http://www.jimmunol.org/ 6. Nakagawa, I., A. Amano, M. Kuboniwa, T. Nakamura, S. Kawabata, and romonas gingivalis infection accelerates the progression of atherosclerosis in a S. Hamada. 2002. Functional differences among FimA variants of Porphyromo- heterozygous apolipoprotein E-deficient murine model. Circulation 105: nas gingivalis and their effects on adhesion to and invasion of human epithelial 861–867. cells. Infect. Immun. 70: 277–285. 31. Beck, J. D., S. Offenbacher, R. Williams, P. Gibbs, and R. Garcia. 1998. Peri- 7. Saba, J. A., M. E. McComb, D. L. Potts, C. E. Costello, and S. Amar. 2007. odontitis: a risk factor for coronary heart disease? Ann. Periodontol. 3: 127–141. Proteomic mapping of stimulus-specific signaling pathways involved in THP-1 32. Gibson, F. C., III, H. Yumoto, Y. Takahashi, H. H. Chou, and C. A. Genco. 2006. cells exposed to Porphyromonas gingivalis or its purified components. Innate immune signaling and Porphyromonas gingivalis-accelerated atheroscle- J. Proteome Res. 6: 2211–2221. rosis. J. Dent. Res. 85: 106–121. 8. Lien, E., and R. R. Ingalls. 2002. Toll-like receptors. Crit. Care Med. 30: S1–S11. 33. Gibson, F. C., III, C. Hong, H. H. Chou, H. Yumoto, J. Chen, E. Lien, J. Wong, 9. Zhou, Q., T. Desta, M. Fenton, D. T. Graves, and S. Amar. 2005. Cytokine and C. A. Genco. 2004. Innate immune recognition of invasive bacteria accel- profiling of macrophages exposed to Porphyromonas gingivalis, its lipopolysac- erates atherosclerosis in apolipoprotein E-deficient mice. Circulation 109:
charide, or its FimA protein. Infect. Immun. 73: 935–943. 2801–2806. by guest on September 27, 2021 10. Zhou, Q., and S. Amar. 2006. Identification of proteins differentially ex- 34. Dixon, D. R., and R. P. Darveau. 2005. Lipopolysaccharide heterogeneity: innate pressed in human monocytes exposed to Porphyromonas gingivalis and its host responses to bacterial modification of lipid a structure. J. Dent. Res. 84: purified components by high-throughput immunoblotting. Infect. Immun. 74: 584–595. 1204–1214. 35. Hajishengallis, G., and E. Harokopakis. 2007. Porphyromonas gingivalis inter- 11. Heinemeyer, T., X. Chen, H. Karas, A. E. Kel, O. V. Kel, I. Liebich, actions with complement receptor 3 (CR3): innate immunity or immune evasion? T. Meinhardt, I. Reuter, F. Schacherer, and E. Wingender. 1999. Expanding the Front. Biosci. 12: 4547–4557. TRANSFAC database towards an expert system of regulatory molecular mech- 36. Cooper, A. M., J. E. Pearl, J. V. Brooks, S. Ehlers, and I. M. Orme. 2000. anisms. Nucleic Acids Res. 27: 318–322. Expression of the nitric oxide synthase 2 gene is not essential for early control 12. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and of Mycobacterium tuberculosis in the murine lung. Infect. Immun. 68: MatInspector: new fast and versatile tools for detection of consensus matches in 6879–6882. nucleotide sequence data. Nucleic Acids Res. 23: 4878–4884. 37. Auerbuch, V., D. G. Brockstedt, N. Meyer-Morse, M. O’Riordan, and 13. Hajishengallis, G., R. I. Tapping, E. Harokopakis, S. Nishiyama, P. Ratti, D. A. Portnoy. 2004. Mice lacking the type I interferon receptor are resistant to R. E. Schifferle, E. A. Lyle, M. Triantafilou, K. Triantafilou, and F. Yoshimura. Listeria monocytogenes. J. Exp. Med. 200: 527–533. 2006. Differential interactions of fimbriae and lipopolysaccharide from Porphy- 38. Carrero, J. A., B. Calderon, and E. R. Unanue. 2004. Type I interferon sensitizes romonas gingivalis with the Toll-like receptor 2-centred pattern recognition ap- lymphocytes to apoptosis and reduces resistance to Listeria infection. J. Exp. paratus. Cell Microbiol. 8: 1557–1570. Med. 200: 535–540. 14. Darveau, R. P., T. T. Pham, K. Lemley, R. A. Reife, B. W. Bainbridge, 39. O’Connell, R. M., S. K. Saha, S. A. Vaidya, K. W. Bruhn, G. A. Miranda, S. R. Coats, W. N. Howald, S. S. Way, and A. M. Hajjar. 2004. Porphyromo- B. Zarnegar, A. K. Perry, B. O. Nguyen, T. F. Lane, T. Taniguchi, J. F. Miller, nas gingivalis lipopolysaccharide contains multiple lipid A species that func- and G. Cheng. 2004. Type I interferon production enhances susceptibility to tionally interact with both toll-like receptors 2 and 4. Infect. Immun. 72: Listeria monocytogenes infection. J. Exp. Med. 200: 437–445. 5041–5051. 15. Staros, E. B. 2005. Innate immunity: new approaches to understanding its clinical 40. Mancuso, G., A. Midiri, C. Biondo, C. Beninati, S. Zummo, R. Galbo, significance. Am. J. Clin. Pathol. 123: 305–312. F. Tomasello, M. Gambuzza, G. Macri, A. Ruggeri, et al. 2007. Type I IFN 16. Wyllie, D. H., E. Kiss-Toth, A. Visintin, S. C. Smith, S. Boussouf, D. M. Segal, signaling is crucial for host resistance against different species of pathogenic G. W. Duff, and S. K. Dower. 2000. Evidence for an accessory protein function bacteria. J. Immunol. 178: 3126–3133. for Toll-like receptor 1 in anti-bacterial responses. J. Immunol. 165: 7125–7132. 41. Mullaly, S. C., and P. Kubes. 2004. Toll gates and traffic arteries: from endo- 17. Massari, P., A. Visintin, J. Gunawardana, K. A. Halmen, C. A. King, thelial TLR2 to atherosclerosis. Circ. Res. 95: 657–659. D. T. Golenbock, and L. M. Wetzler. 2006. Meningococcal porin PorB binds to 42. Liu, X., T. Ukai, H. Yumoto, M. Davey, S. Goswami, F. C. Gibson, III, and TLR2 and requires TLR1 for signaling. J. Immunol. 176: 2373–2380. C. A. Genco. 2007. Toll-like receptor 2 plays a critical role in the progression of 18. Hasan, U., C. Chaffois, C. Gaillard, V. Saulnier, E. Merck, S. Tancredi, C. Guiet, atherosclerosis that is independent of dietary lipids. Atherosclerosis In press. F. Briere, J. Vlach, S. Lebecque, et al. 2005. Human TLR10 is a functional 43. Harokopakis, E., M. H. Albzreh, M. H. Martin, and G. Hajishengallis. 2006. receptor, expressed by B cells and plasmacytoid dendritic cells, which activates TLR2 transmodulates monocyte adhesion and transmigration via Rac1- and gene transcription through MyD88. J. Immunol. 174: 2942–2950. PI3K-mediated inside-out signaling in response to Porphyromonas gingivalis 19. Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, fimbriae. J. Immunol. 176: 7645–7656. R. L. Modlin, and S. Akira. 2002. Cutting edge: role of Toll-like receptor 1 in 44. Hasebe, A., N. D. Pennock, H. H. Mu, F. V. Chan, M. L. Taylor, and B. C. Cole. mediating immune response to microbial lipoproteins. J. Immunol. 169: 10–14. 2006. A microbial TLR2 agonist imparts macrophage-activating ability to apo- 20. Gautier, G., M. Humbert, F. Deauvieau, M. Scuiller, J. Hiscott, E. E. Bates, lipoprotein A-1. J. Immunol. 177: 4826–4832. G. Trinchieri, C. Caux, and P. Garrone. 2005. A type I interferon autocrine- 45. Nassar, H., H. H. Chou, M. Khlgatian, F. C. Gibson, III, T. E. Van Dyke, and paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secre- C. A. Genco. 2002. Role for fimbriae and lysine-specific cysteine proteinase tion by dendritic cells. J. Exp. Med. 201: 1435–1446. gingipain K in expression of interleukin-8 and monocyte chemoattractant protein 21. Yamamoto, M., and S. Akira. 2004. TIR domain–containing adaptors regulate in Porphyromonas gingivalis-infected endothelial cells. Infect. Immun. 70: TLR-mediated signaling pathways. Nippon Rinsho. 62: 2197–2203. 268–276. 7790 TLR2, TLR7, AND IFN␣R IN MACROPHAGE RESPONSE TO P. gingivalis
46. Gerszten, R. E., E. A. Garcia-Zepeda, Y. C. Lim, M. Yoshida, H. A. Ding, 51. Bekeredjian-Ding, I., S. I. Roth, S. Gilles, T. Giese, A. Ablasser, V. Hornung, M. A. Gimbrone, Jr., A. D. Luster, F. W. Luscinskas, and A. Rosenzweig. 1999. S. Endres, and G. Hartmann. 2006. T cell-independent, TLR-induced IL-12p70 MCP-1 and IL-8 trigger firm adhesion of monocytes to vascular endothelium production in primary human monocytes. J. Immunol. 176: 7438–7446. under flow conditions. Nature 398: 718–723. 52. Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, 47. Boring, L., J. Gosling, M. Cleary, and I. F. Charo. 1998. Decreased lesion for- M. Matsuda, J. Inoue, S. Uematsu, et al. 2004. Interferon-␣ induction through mation in CCR2Ϫ/Ϫ mice reveals a role for chemokines in the initiation of ath- Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. erosclerosis. Nature 394: 894–897. Nat. Immunol. 5: 1061–1068. 48. Giacona, M. B., P. N. Papapanou, I. B. Lamster, L. L. Rong, V. D. D’Agati, 53. Honda, K., H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, A. M. Schmidt, and E. Lalla. 2004. Porphyromonas gingivalis induces its uptake Y. Ohba, A. Takaoka, W. C. Yeh, and T. Taniguchi. 2004. Role of a by human macrophages and promotes foam cell formation in vitro. FEMS Mi- transductional-transcriptional processor complex involving MyD88 and crobiol. Lett. 241: 95–101. IRF-7 in Toll-like receptor signaling. Proc. Natl. Acad. Sci. USA 101: 49. Kang, I. C., and H. K. Kuramitsu. 2002. Induction of monocyte chemoattractant 15416–15421. protein-1 by Porphyromonas gingivalis in human endothelial cells. FEMS Im- 54. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat. Rev. Immunol. munol. Med. Microbiol. 34: 311–317. 4: 499–511. 50. Khlgatian, M., H. Nassar, H. H. Chou, F. C. Gibson, III, and C. A. Genco. 2002. 55. Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya, and Fimbria-dependent activation of cell adhesion molecule expression in Porphy- T. Taniguchi. 2005. Spatiotemporal regulation of MyD88-IRF-7 signalling for romonas gingivalis-infected endothelial cells. Infect. Immun. 70: 257–267. robust type-I interferon induction. Nature 434: 1035–1040. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021