University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange
Supervised Undergraduate Student Research Chancellor’s Honors Program Projects and Creative Work
Spring 5-1998
Characterization of Bacterial Isolates from an Acidic Soil Environment Using 16S rRNA Phylogeny Techniques
Jerrie Caroline Haney-Weaver University of Tennessee - Knoxville
Follow this and additional works at: https://trace.tennessee.edu/utk_chanhonoproj
Recommended Citation Haney-Weaver, Jerrie Caroline, "Characterization of Bacterial Isolates from an Acidic Soil Environment Using 16S rRNA Phylogeny Techniques" (1998). Chancellor’s Honors Program Projects. https://trace.tennessee.edu/utk_chanhonoproj/256
This is brought to you for free and open access by the Supervised Undergraduate Student Research and Creative Work at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Chancellor’s Honors Program Projects by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. ------Characterization of Bacterial Isolates from an Acidic Soil Environment Using 16S rRNA Phylogeny - Techniques - - - - - Jerrie Caroline Haney - University Honors 458 Senior Thesis - May 13, 1998 ------Table of Contents Section of Thesis Page Number
- Title Page 1 Table of Contents 2 Figures and Tables 3 - Prospectus Form 4 Updated Prospectus 6 Abstract 8 - Key Words 8 Introduction 9 Review of Literature 9 - Purpose Statement 15 Hypothesis 16 - Matelials and Methods 17 Results 19 Tables 20 - Phylogenetic Trees 22 Discussion 25 Conclusions 26 - Acknowledgments 27 References 28 Appendix 30 - Appendix Contents 31 Lab Notebook Al- A29 Style Guide Bl - B25 - SRSI C1- C6 SRS2 D1-D7 - SRS4 E1 - E12 - Approval Form 32 ------2 - .. Figures and Tables Figyre/ Table Description Page Number - Figure 1 Adapted Five-Kingdom Classification of Life 11 Figure 2 Adapted Two-Dimensional Structure of 16S - rRNA 12 - Figure 3 Adapted Three-Domain Tree of Life 13 Figure 4 Adapted Bacterial Phyla Showing New - Holophaga/ Acidobacterium Branch 14 - Figure 5 Materials and Methods Flow Chart 18 Table 1 Isolates Used in the Study 20 - Table 2 16S rRNA Partial Gene Sequence Analysis Using a Computer Assisted Methodology and - Database 21 Figure 6 Phylogenetic Comparison of SRS 1 with - Closely Related Microorganisms 22 Figure 7 Phylogenetic Comparison of SRS2 with - Closely Related Microorganisms 23 Figure 8 Phylogenetic Comparison of SRS4 with - Closely Related Microorganisms 24 ------3 - - UNIVERSITY HONORS PROGRAM SENIOR PROJECT - PROSPECTUS - Name: __~C(~ __ ~~iOL-1L~ ______- College: ~.J&J±Ltr~______Department: Alic..w.b.i.a.Lqg.y. ______Faculty Mentor: J){~~SftK~__ ~--Dr.LR~Si.apjedtJ.YJ------PRO IE C T TIT LE: \' Tb.f..J!1KlmdCYJ1{t6p.tLo.f_..l1ill,1'J.)1~U1LJ)i!t&rs/) - ~~) __Cl~i!lL~_SolJ_~x~~~_Jlsl(~_J~QJ:~fl ______-fuLfhCj-QJ0~~------PROJECT DESCRIPTION (Attach not more than one additional page, if necessary): - Ple.qse See_ a'rtac~)c...d .sheef. ------:.:.;~e:;~.~ .. :~;;~~;?~~~~~~~~~~;~~~~~~~_-::~. I have discussed this research proposal with this student and agree to serve in an advisory role as faculty me9tor, and to the acceptabilit~ of the completed - l tif project. ~ 4,~ ~ c.> . Of (/~ 7 tY ~ , ______, Faculty Mentor - Signed: --t..4~ ...<~~7';::'JfI~~ - Date: Return this completed form to The University Honors Program, FIOl Melrose Hall, - 974-7875, not later than the beginning of your last year in residence. - 4 Jerrie Caroline Haney - Prospectus - There are several steps that one must follow to analyze microorganisms from a molecular standpoint. The purpose of this thesis will be to analyze an acidic soil sample for two sets of data. The - first goal is to analyze the portion of the sample that is made up of culturable organisms. These are the - microbes that can be grown on laboratory media. The second goal is to examine the portion of the soil sample that camot be cultured on laboratory media. - To characterize the organisms that can be grown, one must first enrich for them on solid media. The isolated colonies are restreaked several times to make sure that the colony is pure. Once
- there are well isolated colonies visible, they can be plated again to produce higher numbers of - organisms. Next, the DNA is extracted from these isolates. Using polymerase chain reaction (PCR), the gene encoding the 16s rRNA is amplified. These peR products are run on an agarose gel to confirm - that the appropriate DNA product was amplified. After this is verified, the peR product is ligated into a - cloning vector, a plasmid, and then this plasmid is used to transfonn competent Escherichia coli cells. These transformed cells are then plated on selective media. They are allowed to grow overnight and - then colonies are selected based on a color screening assay for further culturing and analysis. If a - colony is blue after incubation, it has not been transformed. If a colony is white, then it has been transfonned. The plasmid is then extracted from the white colonies using a mini-plasmid-preparation - technique. The extracted plasmids are restriction digested and then fWl on a gel. The gel is used to make sure the desired 16s rRNA gene insert fragment is present. After this is verified, the fragment is - sequenced using an automated technique. The sequence is then analyzed on the computer for its - phylogenie relation to other known and/or sequenced microorganisms. To characterize organisms that cannot be cultured, DNA is extracted directly from the soil - sample. This DNA is then amplified, verified, and analyzed using the same techniques already - described. This portion of the work win allow examination and identification of microbes that cannot be grown or studied in the laboratory, but that may be contributing to the ecology of the soil sampling - site. - - 5 - - UPDATED PROSPECTUS There are several steps that one must follow to analyze microorganisIflS from a - molecular standpoint. The purpose of this research will be to analyze acidic soil sample - bacterial isolates for their phylogenetic relationships. These microorganisms are readily grown on laboratory media. - To characterize these bacteria, one must ftrst enrich for them on solid media. The - isolated colonies are restreaked several times to make sure that the colony is pure. Once there are well isolated visible colonies, they can be plated again to produce higher numbers
- of organisms. Next the DNA is extracted from the isolates. The gene encoding the 16S - ribosomal RNA (rRNA) portion of the ribosome is amplifted using polymerase chain - reaction (peR) following the DNA extraction. These peR products are electrophoresed on an agarose gel to confrrm that the appropriate size DNA product was amplifted. After - this is verified, the peR product is ligated into a plasmid cloning vector and this plasmid is - used to transform competent Escherichia coli cells which are then plated on selective media. After growth overnight, colonies are selected based on a color screening assay for
- further culturing and analysis. If a colony is blue after incubation, it has not been - transformed. If a colony is white, then it has been successfully transformed. The plasmid is extracted from the white colonies using a mini-plasmid-preparation technique. The
- extracted plasmids are restriction digested and the resulting DNA fragments are separated - by gel electrophoresis. The gel is used to make sure the desired 16S rRNA gene insert - fragment is present. After this is verified, the fragment is sequenced using an automated technique. The sequence is then analyzed on the computer for its phylogenetic relation to - other known and/or sequenced microorganisms. - - 6 - This thesis will utilize major headings consistent with a graduate student thesis in
- the area of Microbiology at the University of Tennessee, Knoxville. ------7 - - ABSTRACT Many soil environments have been altered by industrial processes such as mining - and chemical waste dumping. There are many changes in the soils at these sites such as a - depressed pH and increased contamination. Many times, the main contaminant present will be polyaromatic hydrocarbons or P AHs. These P AHs can be the harmful byproducts of
- coal refming or petroleum dumping. Because this problem is becoming more and more - widespread, bioremediation methods are becoming very important. For bioremediation to - be an option in the acidic soil environn1ent, the bacterial microorganisms present must be better understood. I studied a site at the Westinghouse Savannah River Laboratory in - Aiken, South Carolina. There are seven coal-frred plants, the soil pH is 3.0, and there are - many different P AHs present. A 16S rRNA gene library was constructed by polymerase chain reaction (PCR) amplification and cloning of isolated cultures obtained from this site. - Sequence analysis of this library was used to construct a series of phylogenetic trees. - These trees graphically show the relationship of the isolates to known organisms and - potentially to each other. - - - KEYWORDS - 16S rRNA; acidic pH; acidophile; coal byproducts; contamination; P AHs; phylogenetic - tree - - 8 - - INTRODUCTION Many natural environments have become contaminated by pollution from human - alteration of the Earth's surface. It has been observed that these sites have an altered pH - and sometimes hydrocarbon pollutants are present. It is important for researchers to examine these sites and to understand the natural processes occurring which may lead to - eventual return of the site to its former neutral pH and non-contaminated state. The site - studied for this thesis was in Aiken, South Carolina. The low pH and contamination with P AHs was a result of coal byproduct run-off into the nearby land areas.
- Review of Literature - There have been several studies examining the effects of pollution on the natural - state of land. For example, in studies conducted at sites impacted by long-term coal storage, it was determined that the major microorganisms populating these sites were iron - and sulfur-oxidizing bacteria (Radway 1988). Another study from the 1990's looked at the - bacterial diversity present at these sites and found many unique attributes of the microorganisms existing under these extreme growth conditions (Pizzaro 1996). - After it was established that life can exist at different polluted sites, scientists - wanted to examine the possible biochemical potentials of the microbial communities. Because many of these sites are contaminated with hydrocarbons as well as having
- extreme growth conditions such as low pH, it is important to note findings from other - sites such as the Savannah River Laboratory Site. One study of pyrene degradation, proposed that two microorganisms, a bacterium and a fungus, were symbiotically working
- to degrade the hydrocarbon present at the site examined (Wiesche 1996). This is - important because current research from the Savannah River Laboratory Site suggests that - - 9 - - no single microbial isolate is capable of degrading the P AH contaminant present (Stapleton, April 1998). - Into the early 1980's, there was a consensus among scientists that the organisms - present on the Earth could be divided into five kingdoms, Monera, Protista, Fungi, Plantae, and Animalia (Whittaker 1969). The early classification scheme is shown in
- Figure 1. This view began to change as the power of molecular techniques became more - widely recognized. Scientists began to use the 16S rRNA gene to analyze microbial classification taxonomy and classification. A two-dimensional representation of the
- structure of 16S rRNA can be seen in Figure 2 (NCBI). This new research led scientists to - change their ideas about the kingdoms of life. Figure 3 shows how the molecular techniques separated the living organisms on
- Earth. It became evident that there were three domains of life -- Eukarya, Bacteria, - Archaea -- into which all organisms fit (Pace 1996). These three domains are further - subdivided into kingdoms and then further into phyla. There have already been several phyla studied and characterized. Now, there seems to be a new proposed phylum that - describes many of the microorganisms found in extreme acidic environments. These - organisms are grouped into a phylum called Holophagal Acidobacterium (Ludwig 1997). The new phylum can be seen in Figure 4. It is characterized by the varied habitats
- that are occupied by its members. The ability of these microorganisms to exist at low pH - and the greatly uncharacterized biochemical potential of representatives are other characteristics. The samples that fall into this new phylum were obtained from many
- different habitats such as snow drifts, marine sediment, and also soils (Ludwig 1997). - - - 10 I I I I I I I I I I I I I I I I I I I
Kingdom Characteristics Number of Phyla Representative Organisms I. Monera Prokaryotic; no nuclear membrane; 14 Bacteria; myxobacteria; actinomycetes; no mitochondria; single circular cyanobacteria (blue-green algae) chromosome; binary fission; photoheterotrophic or photoautotrophic; unicellular; filamentous; mycelial
II. Protista Eukaryotic; nuclear membrane; 3 Protozoans; mycetozoans (slime molds); more than one chromosome; hetero- brown algae; red algae; green algae; or photoautotrophic; mitotic hypochytrids; oomycetes; chytrids division; uni- or multi-cellular; plastids; mitochondria
III. Fungi Absorptive nutrition; unicellular or 2 Zygomycota; Dikaryomycota (Ascomycota); --' mycelial; haploid or dikaryotic; cell Basidiomycota; lichens walls contain chitin; have lysine pathway
IV. Plantae Photoautotrophic; highly differentiated; 9 Liverworts; mosses; ferns; conifers; seed diploid phase; DAP lysine pathway; plants; etc. develop from nonblastular embryo
V. Animalia Heterotrophic; multicellular; diploid 32 Coelenterates; flatworms; mollusks; insects; blastula reptiles; birds; mammals
Figure 1: Adapted Five-Kingdom Classification of Life - - lloor - 1114f ------
- Figure 2: Adapted Two-Dimensional Structure of 16S rRNA - - - - 12 -
- BACfERIA - ARCHAE A HalolaFaX Ailtia
Su/f()/Ob(JS - Thermoproteus Thetmofilum pSlSO pSl4 . pSl22 ----.:~ - pSt.. 12
Marine' - group 1 - 0.1 changes per n( - EUCARYA ------Figure 3: Adapted Three-Domain Tree of Life - - - - 13 - - - Cyanobacteria
- H%phaga IAcidobaclerium - Cytophagal Fusobacterium Flavobacte ri umlBac Ie ro ide s
- Gram-positive bacteria Green sulfur bacteria high DNA G+C Proteobacten'a - Nitrospira
- Deinococci
- bacteria - -
- Figure 4: Adapted Bacterial Phyla Showing New Holophaga! - Acidobacterium Branch ------14 - - Other characteristics of this new phylum are likely to be discovered through ongoing - research efforts. - Purpose Statement The work completed for this thesis is one part of a larger study. To understand - how the results of this work are useful, it is necessary to provide a greater context for - evaluation. Dr. Raymond Stapleton conducted a study of the Savannah River Laboratory Site that examined P AH degradation in extremely acidic environments while working for - the Center for Environmental Biotechnology at the University of Tennessee, Knoxville. - His research determined the following things: 1) P AH degradation does occur in extremely acidic environments, 2) no microbial isolate alone could not degrade any PAH,
- and 3) these findings suggest that a consortia of microorganisms are responsible for the - P AH degradation. This work is reported in an unpublished paper that has been submitted - (Stapleton, April 1998). To further examine and characterize the diversity of the microorganisms at the - Savannah River Laboratory Site, the researcher completed a 16S rRNA phylogenetic - study. This thesis focuses on characterization of the bacterial isolates recovered in the previous study completed by Dr. Stapleton. This study will hopefully provide insight into - the microorganisms in the P AH degrading consortia and will also show which phyla are - capable of existence at other sites like the one examined in this thesis. The purpose of this thesis shall be threefold. First, the researcher will acquire a
- suite of isolated microorganisms from a natural sample obtained from the Aiken, South - Carolina Savannah River Laboratory Site that are acidophillic and, when in a consortia, - - 15 - - may be capable of degrading contaminant hydrocarbons, PARs. Secondly, the researcher will phylogenetically describe the isolates using computer analysis of partial sequence data - obtained from the 16S rRNA gene recovered from DNA extraction of pure cultures, peR - amplification, vector cloning, and automated sequencing. Thirdly, a determination of the - phylogenetic diversity of the microorganisms found at the site will be made. - Hypothesis This thesis will attempt to support the following three part hypothesis:
- 1. Isolates from the sample site will be acidophiles and will grow best on acidic media in - the laboratory; - 2. DNA (i.e. 16S rRNA gene) recovery will describe different microorganisms having similar physiological characteristics and capabilities; - 3. There will be some diversity in the isolates, but a majority of them will group into the - Holophagal Acidobacterium phylum. ------16 - - MATERIALS AND METHODS Organisms were isolated fronl the Savannah River Site in Aiken, South Carolina
- soil samples by enrichment plate methods. This work was part of a larger study and was - completed by Dr. Raymond Stapleton. DNA was extracted from pure cultures and the 16S - rRNA gene was PCR amplified (Lane 1991). The gene fragment was ligated into a pCR II vector (Invitrogen, San Diego, CA) and transformed into Escherichia coli. Colonies were - selected for further analysis by a color screen assay on selective media. The cloned vector - was removed, digested, and electrophoresed on a one percent agarose gel to verify the 16S rRNA gene insert was present (Holmes, et aI1981). Positive microorganisms were - subcultured. Large scale plasmid preparation was performed and the plasmid digested to - verify the insert was still present after subculture (Promega 1992). Positive preparations were sequenced in the University of Tennessee Biological Resource Facility using an ABI
- sequencer. All sequence data was computer analyzed. It was searched against the National - Center for Biotechnology Information (NCB I) database using a basic local alignment - search tool (BLAST) program to determine and identify relatedness to other sequenced microorganisms (Altschul 1990). Partial sequences were then used to construct - phylogenetic tress in the ribosomal database project (RDP). Figure 5 graphically - represents this process. - - - - - 17 I I I I I I I I I I I I I I I I I I I
Sample (pure curtLre or soli)
(Many purification steps in soli) • DNA Extraction •
peR for 1 6s rRNA gene
I Run 1 % agarose, gel I (check for 1.5 kb fTagment)
Ligation
Transformation (transform E. coIl) (I' • •
I Min i-P lasm id Prep. I (reco\Jer plasmid trom E. coli and cut to verify gene Insert)
I Run 1 % agarose gel I (check for 1.5 kb or doublet of I ...... ,~ ...... 700 and 800 b)
Subculture
(reco\Jer entire plasmid fTom Maxi-Plasmid Prep. positive subcultures)
Automated Sequencing, of 16s rRNA gene
(NCBI or ReP to produce a tree 'IIIIIth 1 6S rRNA gene sequences)
Figure 5: Materials and Methods Flow Chart - - RESULTS The laboratory work conducted for this thesis was successful in most regards and - resulted in the accumulation of useful data. Microorganisms were isolated from the acidic - Savannah River Laboratory Site in Aiken, South Carolina. DNA was extracted from the pure cultures and the 16S rRNA gene was PCR amplified. The gene was cloned into
- Escherichia coli using a pCR II vector (Invitrogen, San Diego, CA). The vector was - recovered and sequenced in an ABI sequencer. Partial sequence data for three isolates was obtained. A computer analysis of these sequences was conducted using the NCBIs
- BLAST program. Identity to known organisms was determined. Table 1 and Table 2 show - the data obtained. The partial sequence data for the three organisms was also used to - construct phylogenetic trees using the suggest tree program available through the RDP computer database. Figures 6, 7, and 8 show the results of this program for each partial - sequence. ------19 - ISOLATE PHYSIOLOGICAL - CHARACTERISTIC SRS1 Acidoehile
- SRS2 Acidoehile - SRS4 Neutrophile - - - Table 1: Isolates Used in the Study ------20 - ISOLATE SEQUENCING CLOSEST DATABASE % SIMILARITY - PRIMER MATCH SRS1 27f Acidiphilium facilis 96 - Acidiphilium aminolytica 95 SRS2 27f Acidiphilium aminolytica 97 - Acidiphilium facilis 95 SRS4 27f Xylel/a fastidiosa 89 - Xylel/a albilineans 88 - - ** 27fPrimer sequence is the following: 5' AGAGTTTGATCMTGGCTCAG ... ** - Table 2: 16S rRNA Partial Gene Sequence Analysis Using a Computer - Assisted Methodology and Database ------21 I I I I I I I I I I I I I I I I I I I
Figure 6: Phylogenetic Comparison of SRSI with Closely Related Microorganisms
2.0E·02
Acc.tacl12 Gb.cerinus I G .frateur Gb.oxydans rl Aba.paster 1 Aba. ceti2 1 Aba.ace Adm.meth. AdlT methan Aba. uropa Aba.diaztr Aba.liqfac sym.Hthsvi Rpl.globif Acdp.organ I ., Acdp.cryp3 1 Acdp.spC1 1 I Acdp.rubr2 1 Acdp.angu2 f-- Acc.amnlyt sr$1-271 I I I I I I I I I I I I I I I I I I I
Figure 7: Phylogenetic Comparison of SRS2 with Closely Related Microorganisms
1.0E-01
f:'-,..} W
Ac:c.faciI2 Acc.amnly1 ....----1 Acdp.rubr2 I Acdp.angu2 1..------Acdp.spC1
r------___-{======~c.xylanOly Eub.fissic '------sym.Hthsvi L------r------Rpl.globit
Gb.cerinus '------srs2·271 I I I I I I I I I I I I I I I I I I I
Figure 8: Phylogenetic Comparison of SRS4 with Closely Related Microorganisms
5.0E-02
N ~
_---- RaLeutrop ------L___ _===== Alc.spM913 Tlr.mixta
------Bur.gladi2 Bur.androp
Mbc.whtbur Mbc.luteu2 Mmb.album ______...._ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -_ -..:-- Mmb.pelagi ... Mlc.JB140 ______...:..=== Car.homini Aba.hansen env.PVB3_5 env.PVB25 Jr------1I env.PVB47 lL. ------f------:~_:_=_:_:_--- Xytlastid I Xan.campes "'------1 _ Xan.fragar Xan.ory:zae - Xan.phased L-______SRS4-271 - - DISCUSSION The results obtained from the molecular study of acidophilic bacteria conducted - for this thesis, support partially all three parts of the hypothesis. The researcher was able - to show that two of the three bacterial isolates acquired from the larger study grow best on acidic media in the laboratory. Thus all were not acidophiles. One organism, SRS4,
- grew best at neutral pH of 7.0 and grouped with the neutrophiles (Wells 1987). The - second part of the hypothesis was also supported. All of the isolates could grow on acidic media, even if the isolate was not an acidophilic microorganism. The isolates also shared
- other common physiological characteristics like a very slow growth rate. The DNA - recovery and analysis showed that these microorganisms were, however, different. The - last part of the hypothesis stated that a majority of the isolates would group into the new phyla described by Ludwig, et al in 1997. This was supported because two of the three - isolates studied were identified by computer analysis to belong to this branch of bacteria. - SRS1 and SRS2 were identified by the BLAST search as members of the Acidophilium genus. They are also a part of the phylum H olophagal Acidobacterium
- (Ludwig 1997). This was an expected result because the microorganisms in this phylum - are widespread, live in acidic pH environments, and have much uncharacterized biochemical potential. The microorganisms recovered and studied in this thesis may be
- determined to be novel members of the genus and phylum after the complete 16S rRNA - sequence is determined. - SRS4 was identified to be a member of the Xylella genus. This genus was described in a 1987 paper by Wells, et al as having the following characteristics: gram - negative; Eubacteria; Proteobacteria; gamma subdivision; Lysobactera Xanthomonas - 25 - - group. This was a surprise because this microorganism is a neutrophile and grows best at .. neutral pH. After further consideration of this surprise, the researcher determined that the presence of this microorganism fit the known data. The Xylella representative may be part - of the P AH degradation consortia and may exist because the pH of its microenvironment is kept at a neutral pH rather than the macroenvironmental acidic pH of 3.0. Not a lot is
- known about Xylella as a genus other than the characteristics already reported. In future - work, it will be useful to obtain the entire 16S rRNA sequence and to further examine its biochemical potential to determine if it is part of the consortia.
- Conclusions .. This study has conclusively shown that microorganisms can live and flourish at .. very acidic pHs of 3.0 and below. Further, it has helped to elucidate and characterize a specific group of these microorganisms. The representative members of the microbial - community that this work studied were determined to be related to genera that are already - known and characterized using computer analysis. This thesis has only begun to characterize the true diversity of the extremely acidic
- site. It has proven the robustness of the 16S rRNA molecular phylogeny techniques to - identify members of complex microbial communities existing under these conditions. Future research should be targeted at fmding ways to use the members of the acidophilic
- phyla to return the site to its former condition of neutral pH and no P AH contamination. - - .. - - 26 - - ACKNOWLEDGMENTS I would especially like to thank Dr. Gary Stacey and Dr. Raymond Stapleton, my faculty
- mentors. I would also like to thank everyone else in the Center for Environmental - Biotechnology at the University of Tennessee. They have been a constant resource of help, - support, and guidance on this project. ------27 - - REFERENCES 1. Altschul, S. F., et al. "Basic Local Alignment Search Tool." Journal of Molecular - Biology. Vol. 215.403-410. 1990. 2. Hiraishi, A. "Phylogeny of Acidophilic Thiobaccili and other Acidophilic Bacteria that - Share Their Habitat. Annual Review of Microbiology. Vol. 38. 265-292. 1996. 3. Holmes, D. S. and C. M. Quigley. "A Rapid Boiling Method For Preparation of - Bacterial Plasmids." Analytical Biochemistry. Vol. 114. 193-197. 1981. 4. Johnston, W. H., et al. "Direct Extraction of Microbial DNA from Soils and Sediments." In Akkermans, A.D.L., lD. van Elsas, and F.J. de Bruijn (eds.) Molecular - Microbial Manual. Kluwer, The Netherlands. 1.3.2. 1-9. 1996.
5. Lane, D. 1 "16S/23S rRNA Sequencing". In E. Stackebrandt and M. Goodfellow - (eds.) Nucleic Acid Techniques in Bacterial Systematics. John Wiley and Sons, - Chichester. 115-148. 1991. 6. Ludwig, Wolfgang, et al. "Detection and in situ identification of representatives of a widely distributed new bacterial phylum." FEMS: Microbiology Letters. Vol. 153. - 181-190.1997. 7. National Center for Biotechnology Information (NCBI) - Http://ncbi.nlm.nih.gov 8. Pace, Norman R. "New Perspective on the Natural Microbial World: Molecular - Microbial Ecology." ASM News. Vol. 62. No.9. 463-470. 1996. 9. Pizzaro, Jose', et aI. "Bacterial Populations in Sample of Bioleached Copper Ore as - Revealed by Analysis of DNA Obtained Before and After Cultivation." Applied and Environmental Microbiology. Vol. 62. No.4. 1323-1328. April, 1996.
- 10. Promega. Promega Technical Bulletin 009. Promega, Madison, WI. 1992. - 11. Radway, JoAnn C., et al. "Influence of Coal Source and Treatment upon Indigenous Microbial Communities." Journal of Industrial Microbiology. VolA. 195-208. 1989. - 12. Ribosomal Database Project (RDP) Http://cme.msu.eduIRDP - 13. Stapleton, Raymond, et al. "Biodegradation of Aromatic Hydrocarbons in an - Extremely Acidic Environment." April 1998. Unpublished. - - 28 - 14. Wells, J. M., et al. "Xylellafastidiosa New-Genus New-Species Gram-Negative - Xylem-Limited Fastidious Plant Bacteria Related to Xanthum." International Journal of Systematic Bacteriology. Vo1.37. 136-143. 1987. - 15. Wiesche, C in der, et al. "Two-Step Degradation of pyrene by white-rot Fungi and - Soil Microorganisms." Applied Microbiology Biotechnology. Vol. 46.653-659. 1996. ------29 ------APPENDIX ------10 - - - Appendix Contents - Material Page Number Copy of Lab Notebook AJ - A29 Style Guide B1 - B25 - Raw Data SRS1 C1 - C6 SRS2 DI-D7 - SRS4 E1 - E12 ------31 Table 0+ ConfWiS
3 l/ ·5 to 7 JY 7) JO, J\ /t9v 13 )lJ- IS IG J7 )0
Al - -- PftrQdUft- : J. ~USIfLru1froW1 pwu ~ ~ ~ IOrnL TE ~ - 1r {~.af wI }rnL L:;soz,'1(11.{! .soluTion {fa(}78/fnLTE)o}{dJ~#ri J odd I rnL- 610 'SDS' +0 terse CQQQJ:J -fr5(YJ'(\ Cf!)7 QG ./' e, t ~, cec\oI IOCy,L ofpm-ki0.GseJC 5'o/uf---iOt'l ( 1003/ n1L.. /6 I l?~fteAr ) aJ- 376"C ~ /<5 -20 n:ill 1), add J.~rnL of ,5JA sodllA01 f CVGh Iora-IG ~ jha.b., t I ,L!i~O~V(51iS.0 - t, (klrJ "'7mL- CD pkt(1ol o()d"'lm~ uP Chiorofov(71. shctk*,{)')IX V cenffi&~ at- IOOOOrprn -{Oy 1 (¥lin f -.. r ~{ fa.~ of+( o.~t.{tOU-~ /O!!~ and -fa{nJftr 10 C{ ~uJ t I -fv. b0 -top 1{,(~ v Ivrfflu CR JeJ ~. Qd d f'-' 13 m L L h I ()yof()rm l/1 ('X /0. Cenfr i fl{~ a+ ICOCO 'rpm ~y ~ 7m;''r\- " II. t~~ns-Kf Ctf)tP-, lVlL L~d wi 4 cUfi€rent 1U~ cuJf-ctre S:'Amplts: 1 ~t'rArK)troph } } n-t)yY) ~'I \ Sl-f~ ) 2 O~(s A2 I -i - ., ! .,j. { H -':. J \ - - -EtA\') ft~ 9fZ>ciuci s on gel (J to &y1vv~ I. jQJ '-"-r ~ Is UJ/ )~ -r~ bA{fey - &, rnCAh, I Kb I G\d~{y h fOYYl pa.("fSDno ~ i ~Oyl (l f I a.dd,e r !»S/),(L) (POy Lot I oudif\.,g d~Q, , qOyL of-. Ui1iJe.r5Q r b.ct+~I ( lax) .; $5pL o-P (1 Hz-o I 4CXJ)t L -ro-tu \ • YhiX 2.5)-lL l'l f loo.dili£J d-ye.- L0j;;(O jJ l o-P PC t: p,-ociud- .1 for e.Ctth Setmple. ~() rn:film . If. ,~ cyJ 1 !GoA lKb IMdJLVI()lq~ I j~ $)el .I :z loO-.c~ / kh I q ofoia,r ill la~1.JL 2 ~ ~1Jt ffs'Ie I J ! +~(Y\ 0 c'-pet r+ k5. I 0 Sox>lfl-L • &1 U\1~ r I ~kJ fQdckr I 2. A\ -,! 3 Al 1 ~ SRSt -I l & I z ~ La t1.(0 SCU'Yl PJ-t. I )b- S .I d- ) Kb let ddRA~ I 3 /o-~ .l 1 /0- 3 5 /O-~ (0 )0- J • I -* Conm)j r:: '(u \I ~\s ,at 80 vtJ Its f .! I - - -, A4 - - ~t, if feE Reacf?ons/foJ.x ):4, ~j {u Ie JR5 L( DN It Jo- I J 10- 2/ Iv- 3 /0- 'I jD' 5 I", di 1 J f 'flrt petre Sir' c Ie ' t'c e ("-.a cho), (Y) i Xill r{ (- re-k r f0 f a ~ d) - I ~Y' (P eC(l rea (fionS 1)1 add q(1 III L- 6(:, ,51v clc ~ rn/.rtitH'-e_ t[:) -e c( (h pc r -71, '( ~- - ~. c\C:{0 ifl--L st.,; +unplcr-k rfc Q.C\ ch tube. p. bv II ~ !5 fl) j n LA +es - !w. o.ctol · 5)-( L ~ 1a3 pO(lJ~v~,Q- r. {2-d- I (1. Put I11CcCh ffl~ 0 vCYnl :jMt ( (.€-Ity tt>pccc;)Q ,;l,.J - i I C-r-e\ £\1XQctll~ ~I. \Y\Q. Q& lA. ~ • ~j cS A:J't ~s-c_ - I 01. C\J.C\ t-u ,'.:::,0 m L d6 i lo T6E bvJ!-tv 3 I ~cr\- tv (Y)tj - f/-L Qclc\ :)/-tl 6b E:t tSv- - .5 ( ~l r- gQJ C.-t vld / et- ~+ l~ ------AS - I ~ R\,\\\ \'CR. pmdv..c-\-s 01') :9~1 - il. St ."'f ~ IAJ/ \ t rEf ,Pt( fky ~, 1')11 K ,:)' 'V-{ L. - I I - ! - - A6 - - - f, Se ~ rQ~ . 1b-<- procecill K# . 3d Jo~ Ii~.f, il6Wl~ WCL(j : - ~ If! I'lL. --,5a vnp IL I J Kb (({del cr - 2, /0° roA-\()Sktt{m 1 :J /0- \1 ~ /0- ~ II - 5 JO~~ I( o JO~<-i (f 5 - 7 10- II 0 8 /0- II - ~ ~ LDnhv I ), R1M9 ~f ~ I ,,5 hG1{ rs C{ +- db vo Irs -I " Vis uq (ic~_ wi U v a net ?ha(l'(~mph I /vof11i~ wcy&cA Lr f 'en r I T ,.T ,I 1 \ -I ., ., I A7 - - - - - ,. \ I ... j T ... ,.I I T T .,. I T ..T 1 .,. \ I 1 - A8 ------ -\ r 1 -j ,. ( 1 -j , l ~1( AI A it~ :;J 1 1St rnr \e.., ladJ~\4 Jd 3 10 J I , -- o~l~ p/ -1 ., I 1. .. 1 1 l., I l .., 1 ~ I \ 1 - AlO \ - 10 - . (I) B: ::; 9 - ,~::;:::f-1L"~ (ai~;-'1 : -hi·--:;;~:;-----f.--"""--L------t-~-j-t::;--l) - oo\~ plasmid ur5,blc I - I I - cD l\.1 f14 )n, 1< c~ :l - ~~ '10 ·1 I -I -11 .1 - 1 -1 .1 - 1 - \ - 1 I\ \ \ - i - 1 - All - j 1 -! ,GeIC: . I Lanc~ e-:) :5 Y- Cl \¥-b I C \ C;J.. 1 g i -cn~ f1Q501! ci visible. 'J(~A'1 Ot' c~{ ;} ''J s- 98 1 Q) I C)-E5 ., CJ ~ 7tcl V; 1 1 -I ., I I l ~ -I -, J 1 -I 1 -1 -1 J I I Al2 -I - - -, - - -! I -i - ,. , .. 1 -I -I . , -, - I AI3 - J3 - I ~. A{'lf( - prep r Al l)z)t+ -I 13 J,d,3 j g ... .A;] _3, jOt i1 ! Cd. 1)dJ9 - ! SQ~ ~YD C ~d. UJ't fO <¥- g ... ~.Di~ ~ 15 'R,Xt\)s I ~Q. '~ l·x \ I 0( -, ', ~d?C)Ajlju~ C 0 samF-e- ~ ~ -CW( r~ ~+hocJ \ f I -i " 'f~fXZu i- Ilv Tf3E+If:;a'1~ +FI& ~ - 1 l ., J 1 .1 1 \ -I 1 I - - AJ4 ------A15 .3-3-~lo - }.5 - ,U2:W1 Pet p)Dcwd s on qcJ I- &\ \: (] - Lct\\~ I () 5 (S:t \l'\ ~ (e \ ~b \C{dc\.Of /ooA i lOot> loot 1nob JOOS IO°!\J • te~()~ LQr\G 5 Co -, 0 - lo-'e Jo-'D lo-IF )0- JO-{ N - ISC1Ynp\~ 10-'/\ /VOTH (fu6 Ct)OfZl){;D • ~~ RIC 0", c\.'[\G(f\QrSoil S(A(I~ Cc~pl.e..,) C·3::v{cesam(J0 • • - - - I \ -, - • ., AI6 - s.:frcwSftr mo,tjQrL of ,)-2·Q g (. i¢on~ jPcrz_ I " -. , ll I p rD C~~~ll/~'rr ~ /9. , .'I , ~(1tr.. vn ~l ell if'L( O)/t),l1 Bft+' .i ~ ~1.l-. w J to/(!. n:sw\'l\Q()f:s II, ~ L(Oj--l L. 66 x, ,gdl 1) %J.~ q ~~ - {, ~ 3))JL) )Ci~Lj Res+- f' ~ ~ (1·1\c..~ "'37°C) _I I I j , I -- - I" 4-Z~ e~ :;2. - - - I -\ ! _i - - ' \ i AI7 - - - - } I d-- 7 g - - - - \- - - -, -t .. j \ -• \ -i rI -I j i -I - A18 - - - - ... - -I - - -\ I - -: \ I -' - \ - - A19 ...... -' J IV - - - - - -( - - - - -I - - -J - - A2a - -, Run n1ini - PV'tfS - -( - - ~\ J.: ~ LClh( , ~ 3<% ~sr 5 C, 7 g <5trnfltL ~ t~d(.( 5R~ SR\O 6K1\ SRt~ ,3K/S SR/Y - . - - - -:t I I \ -I \ ! i \ -i J 1 I -1 - - A21 I - I I I I • - &13~. i LG\Yl~ \ ~ ! (y\(Il?\~ CE I C[~ CE ,5 (E f.o CE 7 - i -I ------(E r;) ([ /3 ([/~ ~ - _l - - - - 1 I I - ~c(dwK- 3-1-18 Jra.r:sfwmC{~ons - I ~ ~ II -h-r p(l)c-u~GLK- - - c5U£1(;tLUtttLt- -{?Q211i{~, rYUAl j '- C!lQ{J:b- - I, KcatllilL fOiici-Lc~ CeU1LU1.M (Jfl L~-/I-mr -12&ctL.J..., I r(~ ,SB r ce 1- (( Cltf\ - /1 So. mples )0°; /0 - I I' If) - 2 I /0 3 CbrJ'hoJ (+) JoUXc.c- 1 /5cC\("Le.d - . 'f\"D c('(LlV.-t ~ J ------ - - - - A23 .. 3-JJ-98 - J_3 - i~. .edt.- pc e (3~ II -qr) /.AO lli - &(2 Rut.. Sit b cu /:h-tr-es Ii Gc-j : NofhifJJ ll\/ovkco( ------A24 3- /3-76 - ;{ - ---&A IJ 1l7i'ni - Pre,P5 clI1JRl -furv .3 - J Z3% /willi - r:>rff5 (0JJfd. /' (;e) I: ~ lanL I ;2 - SQ0)pk- iodd}} . cr/Iv ft - ,.J.-;( I !J ~ LW1 t I I 1f! :2 I) J k J t '1ct" - Jqrnplc SR ~ I 71ft dfr I S~ q ] 5;~) 0 - "* ~J&~1.tc( ~ -ptqsrnl C\ i- 6t~ \/,~tblz, A\ '-- ere - I . ~ JU roCLd U'~' ~ !f - AI Sa f'n f I (5 : £4 {- d ~ ------A25 3-JL~-9Y - 95 - f f)a!sh ,MiDi -PrfJZ5 //lurC<>ef's IRIAn ('}(2fu ~. R~i5h p:ccedLrt-L ~:~ ~ - p, Cr ~.QJ-;81\ f3J"11JQ~ · I 0 ~ L ~"CJ 1<.-\ X;}S ~ }dl ,5)-lL Cod 15),,{ L - I :] I ,5JA L DfA-++er- 1+ x 'J, S - 6>q,))l d H~() x /)5 (.i50"ul - },~~d - ·fhwte· ~ //0 ~ Q/( C9>lQ + (1-i3r LGe.eJ 1 '; , - ( j L_ ~ if 5 f.o 7 I - J~/ &L{S f~' Lf ------A26 - - 5 ------'. - - - - 3-JY'-9S - _'Pkvund '!lutz. It Jgueau1f~ /Jdioi JPrffiJw~, ;{7 J.~ Lb '- fMcet-/c 101 ~ - 1 add armh;ott'c )afnp,ci//fn ) dSO JAL to ~Q cJ1 - {i ------.:<3~ 19-93 ., -I - - - - - A28 ...... ------ .., - -7 - - - -) - A29 - - 2 3 4 - 5 6 Biodegradation of Aromatic Hydrocarbons in an Extremely Acidic Environment 7 - 8 9 Rayn10nd D. Stapletonl,4, Dwayne C. Savage3, Gary S. Saylerl,3,4 and Gary Staceyl,2,3,4*, - 10 2 11 Center for Environmental Biotechnologyl, Center for Legume Research , Department of 12 Microbiology3, and Department of Ecology and Evolutionary Biology4 13 The University of Tennessee-Knoxville - 14 Knoxville, TN 37996 15 - 16 17 18 - 19 Submitted To: Applied and Environmental Microbiology 20 21 - 22 Running Title: Biodegradation in Acidic Environments 23 _ 24 25 26 - 27 *Correspondent Footnote: Gary Stacey, PhD 28 Center for Environmental Biotechnology 29 676 Dabney Hall - 30 The University of Tennessee-Knoxville 31 Knoxville, TN 37996 32 ph:(423) 974-4041; fax:(423) 974-4007; email:[email protected] - 33 34 Key Words: extremophiles, bioremediation, naphthalene, coal 35 microbiology - 36 - 37 .. - .. - Bl - - Abstract 2 The potential for biodegradation of aromatic hydrocarbons was evaluated in soil - 3 samples recovered along both contaminant and pH gradients existing downstrealn of a - 4 long-term coal pile storage basin. pH values for areas greatly impacted by runoff from 5 the storage basin were 2.02. Even at such a reduced pH, the indigenous Inicrobial - 6 community showed signs of remaining metabolically active, showing the ability to - 7 oxidize more than 40 percent of the parent hydrocarbons naphthalene and toluene to 8 carbon dioxide and water. Treatment of the soil samples with cylcohexamide inhibited - 9 mineralization of the aromatic substrates. DNA hybridization analysis indicated whole - 10 community nucleic acids recovered from these samples did not hybridize with common - 11 enzymes from neutrophilic bacteria, including nahA, nahG, nahH, todC1C2 and tomA. 12 Since these data suggested the degradation of aromatic compounds may involve a - 13 microbial consortia instead of individual acidiphilic bacteria, experiments using - 14 microorganisms isolated from these samples were initiated. While no self-constructed 15 mixed cultures were able to evolve 14C02 from labeled substrates in these mineralization - 16 experiments, an undefined mixed culture including a fungus, a yeast, and several bacteria - 17 successfully metabolized approximately 27 percent of naphthalene after one week. This - 18 study shows that biodegradation of aromatic hydrocarbons can occur in environments - 19 suffering from reduced pH values. - - - B2 - - - Introduction 2 Polycyclic aromatic hydrocarbons (PAHs) occur as common constituents of - 3 petroleum, coal tar, and shale oil, but are most frequently formed by incomplete - 4 cOlnbustion of fossil fuels (21). These contaminants represent a class of con1pounds that 5 are widely distributed in nature (31) and generally considered to have genotoxic or - 6 carcinogenic potential (21; 31). Several species of algae, bacteria, and fungi are known to - 7 degrade P AHs (31). Lower molecular weight P AH compounds, including naphthalene, - 8 phenanthrene, and anthracene, have been previously shown to be mineralized by bacteria 9 (Cerniglia, 1992). The capacity of microorganisms to degrade specific P AHs in nature - 10 depends on the physical and chemical properties of the contaminants, the environment, - 11 and activity of indigenous organisms. 12 In spite of the wide ranges of environments suffering from P AH contamination, - 13 most investigations have largely focused on species of microorganisms that grow on _ 14 common laboratory media at room temperature (mesophiles) at neutral pH (neutrophiles). 15 Many environments in which P AH contamination occur, such as mine drainage basins, - 16 are acidic (acidiphilic) and occasionally at temperatures well above room temperature - 17 (thermophilic). Significant numbers of acidiphilic bacteria have been found in these - 18 environments (10, 20,32). Many of these isolates are autotrophic or mixotrophic 19 acidiphiles. However, heterotrophic acidiphiles belonging to the genus Acidiphilium - 20 have been isolated from coal mine drainage (10). These bacteria are mesophilic, gram- - 21 negative, aerobic rods that utilize citrate and other simple organic compounds as energy - 22 sources. Ivfost Inelnbers of this genus grow at pH 2-3, but none grow above pH 6.0. - - B3 - - This paper describes initial investigations into the biodegradation of arolnatic 2 compounds under acidiphilic conditions. Surface water and soil samples were - 3 strategically recovered from a coal pile storage area, the downstream drainage basin, and - 4 a nearby creek. These areas provide samples with different degrees of P AH 5 concentrations and pH values. - 6 - 7 Materials and Methods - 8 Site and Sample Description: Soil and surface water samples were recovered from a coal 9 runoff basin on the Westinghouse Savannah River Laboratory site in Aiken, SC. Surface - 10 runoff from the coal storage piles was discharged to surface streams until 1977, when - 11 new regulatory requirements were initiated. At that time, unlined earthen containment 12 basins were constructed to intercept, stabilize, and treat surface runoff from the coal - 13 storage area. Water leaking from these basins has contaminated nearby soil and surface - 14 water with heavy metals and PAH compounds, as well as threatened local groundwater - 15 supplies. Microbiological analyses were performed on samples representing three 16 distinct levels ofPAH concentration and pH values. The samples were taken from a - 17 source coal pile (identified as source), downstream from the pile in the catch basin 18 (identified as downstream), and from an outfall creek located near the catch basin but 19 unaffected by drainage from the coal pile (identified as creek). Each sedilnent smnple - 20 was collected and individually sealed in sterile, plastic sample bags, placed on ice, and - 21 imnlediately shipped to our laboratory. Corresponding water samples were collected in - 22 sterile lL Nalgene bottles, placed on ice, and imnlediately shipped to our laboratory. - B4 - - - Upon receipt of the soil and water samples in the laboratory, lnicrobial 2 enumerations, enrichments with aromatic hydrocarbons, mineralization assays utilizing - 3 '4C-labeled cOlnpounds, and DNA extractions were immediately initiated. The pH _ 4 values of each soil and water sample was determined. Soil fron1 the source area had a pH - 5 of 6.09, with the pH of the corresponding water sample 2.0. Soil froln the downstream 6 sample had a pH of 3.35, with the pH of the corresponding water sample 2.02. Soil from - 7 the creek sample had a pH of6.59, with the pH of the corresponding water sample 5.42. - 8 Additional sediment and water samples were stored at 4°C. 9 - 10 Microbial Enumerations: Neutrophilic and acidiphilic heterotrophic bacteria were - 11 enumerated using traditional spread plate analysis on solid agar media. Total viable 12 counts (TVC) for neutrophilic, heterotrophic microorganisms were determined in - 13 triplicate by adding 1.0 gm of sediment to 9.0 ml of sterile 0.1 % (w/v) sodiuln - 14 pyrophosphate dilution buffer (pH 7.0) (4), then vortexing vigorously for 30 s 011, 30 s - 15 off, and 30 s on. Appropriate dilutions were plated from each series on 1I4th strength 16 YEPG (YEPG giL dH20: yeast extract, 0.2; polypeptone, 2.0; D-glucose, 1.0; - 17 ammonium nitrate, 0.2; agar, 17.0; pH 7.0) and incubated at 25°C for one week before - 18 determining colony forming units (cfu) (25). Acidiphi1ic bacteria were enumerated using 19 the lnethod of Harrison (1981). Again, serial dilutions were performed on triplicate - 20 samples and appropriate dilutions were plated from each dilution series on acidiphile - 21 lnediuln as described by Harrison (9). Acidiphile plates were incubated for 2 weeks at - 22 25 DC before detennining colony fonning units. - - B5 - - 2 Biodegradation Analysis: All radio chemicals were purchased from Siglna (St. Louis, 14 - 3 MO). The specific activities (mCi I mmol) were as follows: toluene-ring-UL- C, 60.0; 14 14 - 4 naphthalene-UL- '4C, 49.8; phenanthrene-9- C, 13.3; anthracene-UL- C, 15.0; and 5 salicylic-acid-ring-UL- '4, 10.0. Mineralization assays, using the method of Sanseverino - 6 et al. (24), were set up on the soil samples in order to determine the biodegradation - 7 potential of toluene, naphthalene, phenanthrene and anthracene in each soil san1ple. 8 Biodegradation was defined as the evolution of 14C02, which was detennined by liquid - 9 scintillation counting. Briefly, 2 gm samples were slurried with 1 mL of the - 10 corresponding filter-sterilized (0.45 J.!m filter apparatus; Corning Costar Corporation, - 11 Cambridge, MA) water sample in 40 mL EPA certified vials (Eagle-Picher, Miami, OK). 12 Sterility of the water samples used for mineralization experiments was detennined by the - 13 lack of colony forming units appearing on either 1I4th strength YEPG (pH 7.0) or - 14 acidiphile plate medium (pH 3.0) after 1 week incubation. Carbon dioxide traps were 15 created by inserting an 8 mL glass vial containing 0.5 mL of a 0.5 M sodium hydroxide - 16 solution into the 40 mL mineralization vial. Approximately 100,000 dpm of the - 17 appropriate '4C-Iabeled substrate was added and the vials sealed with screw caps and - 18 teflon lined septa. In experiments with cyloc1ohexamide treatment, a solution of 10 19 mg/mL of the appropriate filter sterilized water sample was freshly prepared and 2 mL of - 20 the solution was added. - 21 For mineralization experiments with pure cultures, isolates were grown for 48 hrs - 22 in 1 L liquid acidiphile medium (9). Individual organisn1s were concentrated by - B6 - - - centrifugation at 5500 x the resulting cell pellet washed 2X in minilnal salts tnedium 2 (pH 3.0), and the final cell pellet suspended in 50 mL fresh Ininimal salts mediuln - 3 (resulting optical density of 1.8 to 2.0 at 543 nm). Each mineralization vial received 1 - 4 mL culture and 4 mL either acidiphile medium, minimal salts medium, or filter-sterilized 5 water salnple from the downstream area. Radiolabeled salicylic acid, toluene~ - 6 naphthalene, and phenanthrene were used. In all 111ineralization experilnents~ active - 7 assays and controls were killed by the addition of 11nL 37% formaldehyde (Fisher 8 Chemicals~ Fair Lawn, NJ). - 9 - 10 Molecular Diagnostics: Duplicate 50 gm samples were used for DNA extraction studies - 11 using the method ofOgram et al. (14,19,28). Cell lysis was initiated by a heat-SDS 12 treatment and completed by ballistic disintegration using bead-mill homogenization. - 13 After concentrating nucleic acids from the aqueous phase by isopropanol precipitation, _ 14 the samples were dialyzed against TE buffer (10 mM Tris-HCI, 1 mM EDTA; pH 7.5) 15 overnight. The samples were then extracted IX with Tris-saturated phenol (pH 7.5), - 16 followed by extraction IX with Chloroforrn:Isoamyl alcohol (24:1). The final aqueous - 17 phase was recovered and ethanol precipitated overnight at -20o e. DNA was collected by 18 centrifugation and dried under vacuum. The final pellet was suspended in 1 mL sterile 19 TE buffer (pH 7.5) and stored at -20°C until used for hybridization studies. - 20 DNA recovered from each soil sample was vacuum blotted onto 0.22 J.lln Biotrans - 21 nylon nlelnbranes (lCN Bionledical, Inc., Costa Mesa, CA) and fixed by baking at 80°C 22 for I hour, then rinsing in 2X SSC buffer (g I L dH 0: sodium chloride, 17.53; sodiu111 - 2 - B7 - - - citrate, 8.82; pH 7.0), followed by baking at 80°C for another hour. Menlbranes were 2 pre-hybridized 12-18 hrs, then hybridized an additional 12-18 hrs with the appropriate - 3 probe as previously described (28). The membranes were washed 3X with high - 4 stringency wash buffer (g / L: sodium chloride, 0.59; Tris-base, 2.42; EDTA, 0.37, SDS, 5 5.00; pH 7.5) and positive hybridization signals determined by autoradiography. DNA - 6 was recovered from the isolate organisms using the lnethod of Marmur (1962). - 7 8 PCR, Cloning, and Sequencing of16S rDNA from Isolates: PCR amplification of 16S - 9 rDNA from soil isolates was performed using primers 27f and 1492r (Eschericia coli - 10 numbering system) as previously described (16, 26). The l.5 kb PCR products were - 11 cloned using the T A cloning kit (Invitrogen, San Diego, CA) following the 12 manufacturer's instructions. Bacterial colonies were screened for plasmids containing the - 13 correct insert using the rapid-boiling plasmid mini-preparation technique of Holmes and - 14 Quigley (12), followed by restriction digestion with EcoR1. Plasmid DNA containing the - ] 5 correct insert for DNA sequence analysis was prepared (22) and the amount of plasmid 16 DNA recovered was determined using a Hoefer DyNA Quant 2 fluorometer (San - 17 Francisco, CA). DNA sequencing was conducted using an Applied BiosystelTIS Division - 18 of Perkin Elmer (Foster City, CA) automated DNA sequencer in the Molecular Biology 19 Resource Facility at The University of Tennessee-Knoxville using the sequencing primer - 20 27f (16). Tentative phylogenetic identification of microorganisms using DNA sequence - 21 analysis of cloned small subunit ribosomal RNA was performed with existing GenBank - 22 databases using the FASTA fonnat in the BLAST progranl (2). - B8 - - - Results 2 Enuilleration of Inicroorganislns from acidic soil saIllples was perfonned by - 3 traditional agar spread plate analysis. Neutrophilic heterotrophs were present at values of 4 3 3 2 - 4 1.1 x 10 4.1 x 10 ) cfu / gm source soil, 1.0 x 10 (± 4.7 x 10 ) cfu / gn1 downstrealn 6 5 5 soil, and 2.2 x 10 8.2 x 10 ) cfu / gm creek soil. Estimates of acidiphilic bacteria 2 3 - 6 ranged fonn 10 - 10 cfu / gm of each sample, but statistical analysis was confounded - 7 because the plates yielded few colonies and were contaminated with fungi. - 8 Results from the 14C-Iabeled substrate mineralization experiments indicate that 9 natural samples of acidic pH maintain the capacity for significant biodegradation of - 10 aron1atic hydrocarbons (Figure 1). Each of the three soil samples tested possessed the - 11 ability to n1ineralize one or more of the aromatic hydrocarbons tested. Figure 1A shows 12 mineralization of aromatic hydrocarbons by the source soil sample. The potential for - 13 biodegradation on a per gram of soil basis is probably underestimated because this - 14 sample was collected directly from the storage pile and contained significant aInounts of 15 solid coal. Nevertheless, mineralization of toluene and naphthalene reached - 16 approximately at 28 days. The downstream soil sample showed mineralization of 10% - 17 each compound tested (Figure 1B). Toluene and naphthalene mineralization approached - 18 500/0 degradation, while phenanthrene and anthracene showed 10-200/0 n1ineralization. 19 Soil saInples from the creek area showed significant toluene mineralization (400/0) at 14 - 20 days (Figure I C). Naphthalene mineralization reached 200/0 mineralization at 2 weeks, - 21 while the other PAH cOlnpounds, phenanthrene and anthracene, showed little - 22 degradation. - B9 - 50 - A 40 • anthracene • naphthalene - A phenanthrene 30 • toluene - 20 - 10 - a - a 5 10 15 20 25 30 100 c B - 0 .-.... 80 CU - .-N 60 -...CU - (1) 40 .-C - :! 20 0~ - a a 5 10 15 20 25 30 - 100 C - 80 - 60 - 40 - 20 a - a 3 6 9 12 15 - Days - B10 - - Microbial enumeration studies revealed representation of both fungi and yeast in 2 the soil nlicrobial communities in each sample. A mineralization experinlent was - 3 designed to test the impact of these micro-eukaryotes on biodegradation of the test - 4 arOlllatic hydrocarbons. Cyclohexamide was used to repress micro-eukaryotic 5 Inetabolisln during a 14 day Inineralization experiment. Cyclohexamide treahnent of the - 6 downstremn smnples eliminated aromatic hydrocarbon nletabolism, but did not elilninate - 7 mineralization in the creek samples (Table 1). This indicates the mineralization of 8 arOlnatic hydrocarbons in the highly acidic downstream sample involves eukaryotic - 9 organisms, probably either yeast, fungi, or both. - 10 Whole community DNA was extracted from each soil sample and hybridized with - 11 molecular probes targeting genes commonly associated with aromatic hydrocarbon 12 degradation under neutrophilic conditions (data not shown). Hybridization analyses with - 13 the gene probes nahA (naphthalene dioxygenase), nahH (catechol-2,3-dioxygenase), _ 14 nahG (salicylate hydroxylase), {odClC2 (toluene dioxygenase), and lornA (toluene - 15 Inonooxygenase) did not produce positive signals above the calculated detection lilnit of 16 0.003 ng of target sequence. The extracted DNA did hybridize positively with a - 17 Universal 16S rDNA oligonucleotide (27, 28), indicating that DNA of sufficient quality - 18 for analysis was successfully recovered from the saInples. The strongest hybridization 19 signal with the Universal 16S rDNA oligonucleotide was seen with DNA recovered from - 20 the creek saInple. - 21 In order to explore the possibility of isolating a pure culture of an obligately 22 acidiphilic Inicroorganisln capable of growth on PAHs, enrichments were prepared using - lOgIn dowl1streaIn soil smnple and 40 mL filter-sterilized corresponding water sanlple - - BI1 I I I I I I I I I I I I I I I I I I I Tab1c 1. Effects of cyclohexamide (10 mg/ml) on mineralization of naphthalene and toluene after 14 days. sample 0/0 naphthalene mineralization 0/0 toluene mineralization downstream 31.74 ± 6.47 5.19 ± 1.62 downstream with cyclohexamide 0.00 ± 0.00 0.00 ± 0.00 creek 74.77 ± 1.16 45.54 ± 15.25 creek with cyclohexamide 56.57 ± 4.35 30.58 ± 19.14 co,...... t-.J ------PubMed nucleotide query http://www.ncbi.nlm.nih.gov/htbin-... ry?form=6&dopt=g&db=n&uid=OO 176357 - 1321 caactcgact ccatgaagtc ggaatcgcta gtaatcgcag atcagattgc tgcgg 1381 acgttcccgg gnnttgtaca caccgcncgt cacaccatgg gagtttgttg caeca 1441 aggtagctga accgcgagga gggcgctnnc agcggtgtgg cngatgactg ggg - II - - I Save the above report in Macintosh R ...... T_e_xt_-..Lo R_· format ------E12 4/23/98 9:21 Prv; - UNIVERSITY HONORS PROGRAM - SENIOR PROJECT .. APPROVAL - N a me: -Je.rIj~--Ca.(oLlr.l~-_H - 3 plated on acidiphile medium agar plates (9). The acidiphile plates were incubated at - 425°C for I week before individual colonies were re-streaked. After 2 consecutive re- 5 streaks, the cultures appeared to be of a single colony type. Each isolate was re-streaked - 6 twice Inore to ensure the culture was axenic. At this point, three distinct isolates were - 7 identified based on colony morphology and growth characteristics. Two isolates were - 8 Inicroscopically identified as bacteria, designated SRS 1 and SRS 2, and the third isolate 9 identified as a yeast, designated SRS 3. Furthermore, the two bacterial isolates were - 10 defined as obligate acidiphiles by their ability to grow on acidiphile mediuln plates (pH - 11 3.0), but not on 1I4th strength YEPG medium plates (pH 7.0). The yeast was able to ] 2 grow on both types of medium. - 13 Partial sequence analysis of slnall subunit ribosomal DNA provided tentative - 14 identification of the bacterial isolates (Table 2). SRS 1 showed 96% sequence similarity - 15 with both Acidocella sp. (11) and A c idiph ilium facilis (14). SRS 2 showed 89% sequence 16 homology with both Acidocella sp. (11) and Acidiphilium facilis (14) . The heterotrophic - 17 yeast was microscopically designated as Pichia sp. SRS 4 showed 880/0 sequence - 18 homology with a neutrphilic, nitrate-reducing iron-oxidizing bacteria isolated froin a 19 German sediment sample and 87% sequence homology with a neutrohilic, iron-oxidizing - 20 bacteria isolated from groundwater in Michigan. - 21 Growth assays on siInple carbon substrates and mineralization studies were - 22 perfonned on the isolates SRS 1, SRS 2, and SRS 3. Growth assays were scored as - B13 - I I I I I I I I I I I I I I I I I I I Table 2. Identification of soil isolates Isolate Closest Sequence Match 0/0 Sequence Similarity Reference SRSI Acidocella sp. 96 11 A cidiph ilium jacilis 96 14 SRS2 Acidocella sp. 89 11 Acidiphilium jacilis 89 14 SRS33 Pichia sp. n/a n/a SRS4 Denitrifying Iron-Oxidizing Bacteria 88 28 co Lithotrophic Iron-Oxidizing Bacteria 87 8 ...j.::;.. a Isolate SRS3 was identified as a yeast microscopically, not using DNA sequence analysis. - - positive if they showed signs of turbidity (Table 3). The isolate designated SRS 1 grew 2 to turbidity in minimal salts medium plus each of the substrates tested except lactose, - 3 arginine, and phenylalanine. The isolate designated SRS 2 showed turbidity on only - 4 citrate, catechol, and yeast extract. The isolate designated SRS 3 grew on every carbon 5 source except lactose. Biodegradation of toluene, naphthalene, or phenanthrene was at - 6 background levels, with no more than 3% mineralization under any of the conditions - 7 tested by any of the isolates (Table 4). However, salicylic acid was Inineralized to 8 varying degrees by all three isolates. SRS 1 showed a marked increase in Inineralization - 9 of salicylic acid when incubated with filter-sterilized water from the downstreanl area. - 10 SRS 2 also showed an increase in salicylic acid mineralization when incubated with the - 11 natural water sanlple. SRS 3 mineralized salicylic acid under all conditions tested, with 12 the highest amount of 14C-labeled carbon dioxide occurring in minimal salts medium (pH - 13 3.0). - 14 The ability of model mixed microbial cultures to biodegrade aromatic 15 hydrocarbons at pH 2.0 was evaluated using the previously mentioned isolates, along - 16 with 5 fungal isolates, slurried in filter-sterilized water fronl the downstreanl drainage - 17 basin area (Table 5). Microorganisms isolated from the downstream sample were used - 18 for the mixed community mineralizations included two obligate acidiphilic bacteria (SRS 19 1 and SRS 2), a heterotrophic yeast (SRS 3), and a fungus (Fungus 3). Initial work with - 20 SRS 1, SRS 2, SRS 3, and Fungus 3 revealed the ability of this mixed culture to - 21 Inineralize naphthalene. However, microscopic analysis of the Fungus3 enrichnlent 22 culture revealed it was contanlinated with bacteria. A bacteriu111 designated as SRS 4 - 23 was recovered from the contanlinated fungal culture, but proved Uni111portant in the - BlS - - - Table 3. Carbon source utilization spectrum for soil isolates. carbon source SRS1 SRS2 SRS3 - maltose + + galactose + + glucose + + - lactose citrate + + + acetate + + - succinate + + salicylate + + + - catechol + + + yeast extract + + + arginine + - phenylalanine + acidophile + + + - media - 1/4 YEPG + ------B16 I I I I I I I I I I I I I I I I I I I Table 4. Mineralization of aromatic hydrocarbons by soil isolates. isolate compound acidophile medium minimal salts medium natural water SRSI salicylic acid 2.29 5.12 51.02 toluene 0.00 0.01 0.50 naphthalene 0.01 1.76 1.73 phenanthrene 1.64 0.51 0.83 SRS2 salicylic acid 4.67 13.0 35.10 toluene 0.03 1.30 0.73 naphthalene 0.02 1.45 2.36 CO phenanthrene 2.27 0.95 0.68 ~ -.) SRS3 salicylic acid 26.40 67.30 36.87 toluene 0.00 0.88 0.00 naphthalene 1.40 1.50 0.88 phenanthrene 1.50 1.20 0.98 - - lnineralization of naphthalene either individually, or in Inixed culture. SRS 4, showing 2 similar sequence homology to several neutrophilic, iron-oxidizing bacteria, grew rapidly - 3 on 1I4th YEPG at pH 7.0, but very slowly on acidiphile medium at pH 3.0. No other - 4 organislns have been isolated from the contaminated fungal culture. Only the n1icrobial 5 consortia including the contaminated Fungus 3 and unidentified, uncultured organisms - 6 were able to mineralize naphthalene to carbon dioxide. Fungus 3 was isolated in pure - 7 culture by successive transfers in liquid acidiphile lnedium containing the antibiotics - 8 streptomycin, kanomycin, and rifampicin. The fungal culture was detern1ined to be 9 axenic by microscopic analysis. When SRS 1, SRS 2, SRS 3, SRS 4, and - 10 uncontaminated Fungus 3 were mixed together, naphthalene mineralization did not occur. - 11 This supports the hypothesis that other uncultured organisms exist in the undefined 12 microbial consortium capable of evolving mineralizing naphthalene. While the model - 13 lnicrobialluixed cultures constructed using pure cultures were unsuccessful in - 14 mineralization of naphthalene, salicylic acid was mineralized to a greater extent (Table 15 5). Mineralization approached 100% after 1 week in mixed cultures, but remained under - 16 52% by any individual isolate. - 17 Discussion - 18 The data presented conclusively shows that biodegradation of aromatic 19 hydrocarbons can occur in extremely acidic environments. While involvement of - 20 individual heterotrophic, prokaryotic acidiphiles has not been eliminated, biodegradation - 21 in the downstremn area of this particular drainage basin likely requires luicro-eukaryotic - 22 organisms, such as fungi and yeast. Since 14C02 evolution from fungi has been shown to - B18 - - a Table 5. Mineralization of aromatic hydrocarbons by soil microorganisms • - microorganism (s) salicylate naphthalene - SRS1 51.02 ± 25.99 1.73 ± 1.22 SRS2 35.10 ± 6.84 2.36 ± 0.90 - SRS3 36.87 ± 4.82 0.88 ± 0.33 - SRS4 41.31 ± 6.02 0.00 ± 0.00 - Fungus3 38.67 ± 0.37 0.00 ± 0.00 SRS1 / SRS2 82.60 ± 4.49 0.00 ± 0.00 - SRS1 / SRS3 79.78 ± 1.48 0.84 ± 0.02 - SRS2 / SRS3 64.89 ± 3.40 0.19 ± 0.10 SRS1 / SRS2 / SRS3 97.55 ± 3.87 0.43 ± 0.01 - SRS1 / SRS2 / SRS3 / 93.88 ± 11.33 1.45 ± 0.66 fungus1 - SRS 1 / SRS2 / SRS3 / 90.04 ± 0.89 0.35 ± 0.07 - fungus2 SRS1 / SRS2 / SRS3 / 32.08 ± 1.72 0.00 ± 0.00 - fungus3 SRS 1 / SRS2 / SRS3 / 73.57 ± 4.21 0.47 ± 0.52 - fungus4 SRS 1 / SRS2 / SRS3 / 86.59 ± 6.75 0.45 ± 0.44 - fungus5 - undefined mixed cultureb 93.34 ± 4.44 27.13 ± 15.73 a Microorganisms suspended in filter sterilized water sample from the downstream drainage basin area (pH2.0). - b The undefined mixed culture consisted of SRS 1, SRS2, SRS3, fungus 3 and unidentified bacterial - contaminants of the original fungus3 culture. - B19 - - - be rare (6), conlplete lnineralization ofthe arolnatic contaminants may involve a cOlnplex 2 interaction between several distinct groups of microorganislns. - 3 It is well understood that the biotransformation of P AH compounds by fungi - 4 primarily exists as a detoxification mechanism, with the secondary metabolites fonned 5 having lower toxicity than the parent compound (30). Moreover, In der Wiesch et al. (13) - 6 showed that the addition of soil microorganislns increased nlineralization of the P AH 7 pyrene. This study suggested that initial fungal, extracellular enzymatic attacks on the - 8 PAH produced intermediates that were available for further degradation by soil 9 Inicroorganisms. We hypothesize that a similar situation may explain the arolnatic - 10 hydrocarbon mineralization activity detected under extremely acidic conditions. This - 11 hypothesis is supported by the demonstration that cyclohexamide treatment eliminates 12 mineralization of both naphthalene and toluene in the sediment sample recovered fonn - 13 the downstream drainage basin area. The ability of organisms present in the soil smnples - 14 to degrade these compounds but not hybridize to gene probes targeting biochemical - ] 5 pathways commonly associated with prokaryotic aromatic hydrocarbon degradation 16 further supports the involvement of micro-eukaryotic organisms. Attelnpts to isolate pure - 17 cultures of aromatic hydrocarbon degrading acidiphilic microorganisms are ongoing. - 18 However, 16S rRNA sequence analysis clearly indicate the presence of known groups of 19 acidiphilic bacteria in these samples. - 20 Metabolism of salicylic acid was shown to be greatly affected by addition of the - 21 water smnple from the downstremn area. These data suggest that an unknown co-factor - 22 or nutrient Inay enhance levels of salicylic acid metabolism by acidiphilic bacteria. - B20 - - - Increased l11ineralization of salicylic acid was seen by consortia of Inicroorganims when 2 cOlnpared with single organisms. all 3 Additional support on the potential for biodegradation of arOlnatic contaminants all 4 by acidiphilic bacteria comes from the work of Quentmeier and Freidrich (23). These - 5 experilnents showed that plasmids encoding either phenol degradation or antibiotic 6 resistance froln neutrophilic bacteria could be acquired by Acidiphilium cryptum by - 7 conjugation. Once the genes were successfully transferred into the acidiphile, the - 8 encoded proteins were shown to be functional. This directly supports the hypothesis that 9 genes encoding enzymes involved in degrading aromatic compounds can be acquired and - 10 expressed in heterotrophic acidiphiles. - 11 To date, the great majority of studies focusing on aromatic hydrocarbon 12 biodegradation have been performed using organisms isolated from non-extrelne - 13 environments. Considering that aromatic hydrocarbon contamination has been - 14 documented within extreme environments, clearly research is needed to ascertain the - 15 ability of these environments to biodegrade such compounds. This study lends credence 16 to the hypothesis that microbially-based degradation mechanisms are at work in extreme - 17 acidic ecosystems. Furthermore, this study suggests that instead of a single organism - 18 being responsible for complete mineralization of aromatic contaminants to carbon dioxide 19 and water, biodegradation in these environments may be the result of cOlnplex - 20 interactions within the microbial community. Such consortium-based systenls have - 21 recently been reported for compounds generally considered to be recalcitrant in nature (1, - 22 3,7,17). - B21 - - - Acknowledgements 2 Funding for this project was provided by The Center for Environlnental - 3 Biotechnology and The Waste Management Research and Education Institute at The - 4 University of Tennessee-Knoxville. 5 _ 6 7 8 - 9 10 11 - 12 Figure Legends 13 14 Figure 1. Mineralization of aromatic hydrocarbons by acidic soil samples. Panel A - 15 shows biodegradation by the source coal pile sample, panel B shows biodegradation by 16 the downstream drainage basin sample, and panel C shows biodegradation by the control 17 creek sample. Each soil sample was slurried with its corresponding water sample. - 18 19 20 - 21 - 22 ------ - B22 - - References - 2 3 1. Alvey, S., and D.E. Crowley. 1996. Survival and activity of an atrazine-nlineralizing 4 bacterial consortium in rhizosphere soil. Environ. Sci. Technol. 30: 1595-1603. - 5 6 2. Altschul, S.F., W. Gish, W. Miller, E.W. Meyers, and D.l Lipman. 1990. Basic local 7 alignment search tool. l Mol. BioI. 215: 403-410. - 8 9 3. Assaf: N.A., and R.F. Turco. Accelerated biodegradation of atrazine by a 111icrobial 10 consortiul11 is possible in culture and soil. Biodegradation. 5: 29-35. - 11 12 4. Balkwill, D.L., T.E. Rucinsky, and L.E. Casida. 1977. Release ofmicroorganisl11s 13 frol11 soil with respect to transmission electron microscopy viewing and plate counts. - 14 Antonie van Leewenhoek. 43: 73-87. 15 - 16 5. Cerniglia, C.E. 1992. Biodegradation of polycyclic aromatic hydrocarbons. 17 Biodegradation. 3: 351-368. 18 - 19 6. Cerniglia, C.E., J.B. Sutherland, and S.A.Crow. Fungal metabolisnl of aromatic 20 hydrocarbons, In G. Winkelmann (ed.) Microbial degradation of natural products. 21 VCHPress, Weinheim,Germany. P.193-217. - 22 23 7. De Souza, M.L., D. Newcombe, S. Alvey, D.E. Crowley, A. Hay, M.J. Sadowski, and 24 L.P. Wackett. 1998. Molecular basis of a bacterial consortium: interspecies - 25 catabolisl11 of atrazine. Appl. Environ. Microbiol. 64: 178-184. 26 27 8. Emerson, D., and C. Moyer. 1997. Isolation and characterization of novel iron- - 28 oxidizing bacteria that grows at circumneutral pH. Appl. Environ. Microbiol. 63: 29 4784-4792. - 30 31 9. Harrison, A.P. 1981. Acidiphiliunl cryptum gen. nov., sp nov., a heterotrophic 32 bacterium from acidic mineral environments. Intemat. l Syst. Bacteriol. 31: 327- - 33 332. 34 35 10. Harrison, A.P. 1984. The acidiphilic thiobacilli and other acidiphilic bacteria that - 36 share their habitat. Annu. Rev. Microbiol. 38: 265-292. 37 38 11. Hiraishi, A. 1996. Phylogeny of acidiphilic chemoorganotrophic bacteria. Direct - 39 sequence to GenBank, Accession number D8651 O. 40 41 12. Holnles, D.S., and C.M. Quigley. 1981. A rapid boiling l11ethod for preparation of - 42 bacterial plasl11ids. Anal. Biochenl. 114: 193-197. - 43 - - B23 - 1 13. In der Wiesch, C., R. Martens, and F. Zadrazil. 1996. Two-step degradation of pyrene - 2 by white-rot fungi and soil microorganisn1s. Appl. Microbiol. Biotechnol. 46: 653- 3 659. 4 - 5 14. Johnston, W.H., R.D. Stapleton, and G.S. Sayler. 1996. Direct extraction of 111icrobial 6 DNA froln soils and sediments. In Akkermans, A.D.L., J.D. van Elsas, and FJ. de 7 Bruijn (eds) Molecular microbiallnanual. Kluwer, The Netherlands. 1.3.2: 1-9. - 8 9 15. Kishimoto, N., Y. Kosako, N. Wakao, T. Tano, and A. Hiraishi. 1995. Transfer of 10 AcidiphiliUln facilis and Acidiphilium aminolytica to the genus Acidocella gen. Nov., - 11 and elnendation of the genus Acidiphilium. Syst. Appl. Microbiol. 18: 85-91. 12 - 13 16. Lane, DJ. 1991. 16S/23S rRNA sequencing. In Stackebrandt and M. Goodfellow 14 (eds.) Nucleic acid techniques in bacterial systematics. John Wiley and Sons, 15 Chichester, p. 115-148. - 16 17 17. Mandelbaum, R.T., L.P. Wackett, and D.L. Allan. 1993. Mineralization of the s- 18 triazine ring of atrazine by stable bacterial mixed cultures. App!. Environ. Microbiol. - 19 59: 1695-1701. 20 21 18. Mannur, 1 1961. A procedure for the isolation of deoxyribonucleic acid froln - 22 microorganislns. J. Mol. BioI. 3: 208-218. 23 24 19. OgraI11, A., G.S. Sayler, and T. Barkay. 1987. The extraction and purification of - 25 lnicrobial DNA from sediments. J. Microbiol. Methods. 7: 57-66. 26 - 27 20. Pizarro, l, E. Jedlicki, O. Orellano, and R.T. Espejo. 1996. Bacterial populations in 28 samples ofbioleached copper ore as revealed by analysis of DNA obtained before and 29 after cultivation. App!. Environ. Microbiol. 62: 1323-1328. - 30 31 21. Pothuluri, lV., and C.E. Cerniglia. 1994. Microbial n1etabolism of polycyclic 32 aromatic hydrocarbons. In: G.R. Chaundry (ed.), Biological degradation and - 33 bioremediation of toxic chemicals. Dioscorides Press, Portland, Oregon. p.92-124. 34 35 22. Pron1ega. 1992. Prolnega Technical Bulletin 009. Promega, Madison, WI. - 36 37 23. Quentmeier, A., and C.G. Friedrich. 1994. Transfer and expression of degradative _ 38 and antibiotic resistance plasmids in acidiphilic bacteria. Appl. Environ. Microbiol. 39 60: 973-978. 40 - 41 24. Sanseverino, J., C. Werner, 1 Flemn1ing, B. Applegate, lM.H. King, and G.S. Sayler. 42 1993. Molecular diagnostics of polycyclic aron1atic hydrocarbon biodegradation in 43 ll1anufactured gas plant soils. Biodegradation. 4: 303-321. - 44 - B24 - - 25. Sayler, G.S., M.S. Shields, E. Tedford, A. Breen, S. Hooper, K. Sirotkin, and 1. - 2 Davis. 1985. Application of DNA-DNA colony hybridization to the detection of 3 catabolic genotypes in environmental samples. Appl. Environ. Microbiol. 49: 1295- 4 1303. - 5 6 26. Stahl, D.A. and R. Amann. 1991. Development and application of nucleic acid 7 probes, In Stackebrandt and M. Goodfellow (eds.) Nucleic acid techniques in - 8 bacterial systen1atics. Jolm Wiley and Sons, Chichester, p. 205-248. 9 - 10 27. Stahl, D.A., B. Flescher, H.R. Mansfield, L. Montgomery. 1988. Use of 11 phyllogenetically based hybridization probes for studies of ruminal microbial 12 ecology. Appl. Environ. Microbiol. 54: 1079-1084. 13 - 14 28. Stapleton, R.D. and G.S. Sayler. 1998. Assessing the microbial potential for natural 15 attenuation of petroleum hydrocarbons. Microb. Ecol. In review. - 16 17 29. Straub, K.L., M. Benz, B. Schink, and F. Widdel. 1996. Anaerobic, nitrate-dependent 18 microbial oxidation of ferrous iron. Appl. Environ. Microbiol. 62: 1458-1460. - 19 20 30. Sutherland, J.B. 1992. Detoxification of polycyclic aromatic hydrocarbons by fungi. 21 J. Ind. Microbiol. 9: 53-62. - 22 23 31. Sutherland, J.B., F. Rafii, A.A. Kahn, and C.E. Cerniglia. 1995. Mechanisms of 24 polycyclic aromatic hydrocarbon degradation. In: L. Y. Young and C.E. Cerniglia - 25 (eds.) Microbial transformation and degradation of toxic organic chemicals. Wiley- 26 Liss, New York. p. 269-306. - 27 28 32. Wichalacz, P.L. and R.F. Unz. 1981. Acidiphilic, heterotrophic bacteria of acid mine - 29 waters. Appl. Environ. Microbiol. 41: 1254-1261. - - - - - - B25 - - - SRSI Sequence Data - TCTTACCTTGGCCNCATGNTTAACACATGCAAGTCGCACGGTCAGCAATGGCA - GTGGCGGACGGGTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAAC AGCGGGAAACTGCTGCTAATACCGCATGATACCTGAGGGTCAAAGGCGCAAG - TCGCCTTGGGAGGAGCCTGCGTCTGATTAGCTTGTTGGTGGGGTAAAGGCCTA - CCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATTGGGAC TGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAA - TGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGTAGAAGGTCTTCGGATT - GTAAAGCACTTTTGGCAGGGACGATGATGACGGTACCTGCAGAATAACCCCG - GCTAACTTCCTGCCAGCAGCCGCGGTAATACGAANGGGGCTACCTTTGCTCGG AATGACTGGGCGTAAAAGGCGCCTTAAGCCGCTTACACATCAAAATTAAATTC - CTGGGCTCAACCTGGGACTGCTTTTGATACTTTTTTCTAAATTAGAAAAAGTTT - GTTGAATTTCCATTTTAAAGTTNAAATCCGTAATATTGAAAGAACCCGGTTGC - AAAGGCGCACCTTGTCCCTTTACTGACCCT ------('1 NCBJ BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-b\as - ""r',-i - ,('n sublnitted, please 'wait for fe-suits ... - BLASTN 1.4.11 [24-Nov-97] [Build 24-Nov-97] Reference: Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J. Lipman (1990) 0 Basic local alignment search tool. ~ ""11 L Bi 0 1. 215: 4 03 -1 0 . ).----- Notice: this program and its default parameter settings are optimized to find nearly identical sequences rapidly. To identi weak similari - encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX. Query= tmpseq_1 - (742 letters) Database: Non-redundant GenBank+EMBL+DDBJ+PDB sequences - 333,892 sequences; 664,089,867 total letters. Searching ... 0 •••••• 0 •••• 0 0 0 • 0 0 0 0 • 0 0 •• 0 ••• 0 •• 0 0 •••• 0 0 •• 0 • 0 0 0 done - S High Pr - Sequences producing High-scoring Segment Pairs: Score P( 'Acidocella spo 16S ribosomal RNA gene 1942 4 . - , Acidocella spo DNA for 16S rRNA 8 . ~Acidiphilium aminolytica gene for . 9:~ 1 . dbj ID30774 I ACD16SRNAG ,Acidiphilium facilis gene for 16S .~ 7 . - AF047643 Uncultured eubacterium TRB25 16S r .. 0 2 . Acidiphilium angustum gene for 16SKJ 1584 3 0 fAcetobacter aceti gene for 16S rib. 0 • 1624 1 0 Acidiphilium spo DNA for 16S rRNA 1584 1 . - ,Acidiphilium organovorum gene for 1572 3 . ~t!? I Acidiphilium cryptum gene for 16S .~$ 1 3. Acidiphilium sp. 16S ribosomal RNA ... 1 4 0 - A.aceti gene for 16S rRNA 9 0 Acidosphaera rubrifaciens DNA for ... 1 . Bacterial species 16S rRNA gene, c ... 1 . - fAcidiphilium multivorum gene for 1 . 0 • 2 0 Acidiphilium multivorum gene for 1 .. 0 2 0 A.cryptum (B-Het4 ) gene for 16S ri ... 4 . - A.pasteurianus gene for 16S riboso ... 1 . Acetobacter pomorum 16S ribosomal 1 . G.cerinus 16S rRNA gene - G.frateurii 16S rRNA gene 3 . Gluconobacter oxydans gene for 16S ... 8 . A.methanolicus 16S rRNA gene 4. - A.diazotrophicus gene for 16S ibo ... 7 . Acidomonas methanolica gene for 16. . . 2. - Acetobacter europaeus 16S rRNA gene 2 4 . C2 3/30/98 I: I:) pf\ - NeBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-bla~ A.europaeus 168 rRNA gene 1525 4. A.liquefaciens gene for 168 riboso .. . 151 4. - Thiobacillus acidophilus DNA for 1 .. . 157 3. A.xylinum gene for 168 ribosomal RNA 151 5. Acetobacter intermedius 168 rRNA gene 15 4 8. Heliothis virescens testis endosym ... 1097 9. - R.thiosulatophilus gene for 168 rRNA 1581 1. Acetobacter oboediens 68 ribosoma .. . 1 4. Unknown Proteobacterium, alpha-1 s .. . 1560 5. - G.asaii 168 rRNA gene 1530 1. Bacterial species 168 rRNA gene (c .. . 1570 4. Uncultured eubacterium TRB3 168 ri .. . 11 9 5. - A.hansenii gene for 168 ribosomal RNA 1498 8. Rhodopila globiformis DNA for 168 .. . 1153 2. Acidiphilium Spa gene for 168 ribo .. . 11 1 3. - Rhodopseudomonas globiformis 168 r .. . 1144 4. Unknown Proteobacterium, alpha-1 S .. . 1464 2. Unknown Proteobacterium, alpha-1 S .. . 1076 2. Uncultured eubacterium WCHBl-87 16 .. . 1 . - Alpha-proteobacterium species 168 .. . 3 . Rhizobium Spa 168 rRNA gene, parti .. . 1 8 4 . Rhodospirillum salinarum (strain N .. . 1076 7. - Unidentified eubacterium 168 rRNA .. . 1076 7. Rasbo bacterium 168 ribosomal RNA .. . 1018 7. Rhizobium galegae 168 rRNA gene, p .. . 1014 2. - Rhizobium galegae 168 rRNA gene, p .. . 1014 2. Rhizobium galegae 168 rRNA gene, p .. . 1014 2. 'Rhizobium galegae 168 rRNA gene, p .. . 1014 2. - R.vannielii 168 ribosomal RNA. 1024 3. Rhodospirillum fulvum (strain NCIM .. . 1009 7. Magnetic coccus small subunit rRNA .. . 1282 8. - Rhizobium galegae strain 59A2 168 .. . 1014 9. Rhodospirillum salinarum 168 ribos .. . 1055 9. A.sp. (D8M 4835) 168 ribosomal RNA 1009 9. - Methylobacterium Spa 168 rRNA gene 1053 2. Magnetic coccus 168 rRNA gene (C8408) 991 4. Eubacteria DNA for 168 rRNA 1018 5. - R.palustris DNA for 16S ribosomal RNA 1018 7. Rhizobium galegae 168 rRNA gene, p .. . 1014 8. Rhizobium galegae 168 rRNA gene, p .. . 1014 8. Rhizobium galegae 16S rRNA gene, p .. . 1014 8. - Rhizobium Spa 16S rRNA gene, parti .. . 996 8. Unidentified eubacterium MHP17 16S .. . 1045 9. Uncultured eubacterium WCHBl-55 16 .. . 1018 1. - 1009 1. Rhodoplanes elegans 168 rRNA gene Methylobacterium zatmanii gene for .. . 1044 1. Rhodospirillum sodomense 16S ribos .. . 1046 1. - Agrobacterium rubi gene for 16S ri .. . 996 1. Rhodopseudomonas palustris 16S rRN .. . 1027 2. Alpha-proteobacterium species 16S .. . 1469 2. - Afipia genosp. 5 16S ribosomal RNA .. . 1018 2. R.palustris 16S rRNA gene 1027 2. - Rhodopseudomonas palustr s 6S r b ... 1027 2. CJ 3130198 1: 15 Pi NCBI BLAST Search Results http://www.ncbi.nlm.l1ih .gov/cgi-bin/BLAST/nph-bla: - Rhizobium galegae 16S rRNA gene 1014 2. A.rubi (LMG 156) gene for 16S rRNA 996 2. Agrobacterium rubi 16S rRNA gene 996 2. - Rhizobium huautlense 16S ribosomal .. . 996 2. Rhizobium Spa gene for 16S ribosom .. . 996 2. Methylobacterium Spa 16S rRNA gene 1053 3. - Rhodospirillum mqlischianum 16S ri .. . 994 3. Bradyrhizobium japonicum 16S rRNA, .. . 1036 3. Bradyrhizobium japonicum 16S rRNA, .. . 1036 3. - Rhodopseudomonas palustris 16S rRN .. . 1021 5. Solemya reidi gill symbiont riboso .. . 1273 6. Metylobacterium Spa 16S rRNA gene 1044 8. - Rhizobium galegae gene for 16S rib .. . 1014 8. Methylobacterium sp. (strain F37) .. . 1044 9. Magnetic coccus 16S rRNA gene (CS105) 991 1. - Rhizobium leguminosarum bv. viciae .. . 987 1. Rhizobium leguminosarum bv. viciae .. . 987 1. Rhizobium leguminosarum 16S riboso .. . 987 1. - Rhizobium leguminosarum 16S riboso .. . 987 1. R.galegae (LMG 6214) gene for 16S .. . 1005 1. - R.leguminosarum (LMG 8820) gene fo .. . 987 1. emblX917971ASPGS19H Acidocella Spa 16S ribosomal RNA gene - Length = 1442 - Plus Strand HSPs: Score 1942 (536.6 bits), Expect = 4.6e 179, Sum P(5) 4. -179 - Identities 400/416 (96%), Positives = 400/416 (96%), Strand = Plus Query: 5 ACCTTGGCCNCATGNTTAACACATGCAAGTCGCACGGTCAGCAATGGCAGTGGCGGA II 11/1 1111111111111111111111111111111111111111111111 - Sbjct: 8 ACGCTGGCGGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGGCAGTGGCGGA Query: 65 GTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAACAGCGGGAAACTGCTGC - I I ! I I I I I I I I I I I I I I I I I I I I ! I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 Sbjct: 68 GTGAGTAACACGTAGGAATCTATCCAGAGGTGGGGGACAACAGCGGGAAACTGCTGC - Query: 125 TACCGCATGATACCTGAGGGTCAAAGGCGCAAGTCGCCTTGGGAGGAGCCTGCGTCT I I I I I I I 1 1 I I I I I I I I I I I I I I I 1 I I I I I I 1 I I I 1 I I I I I I I I I I I 1 I I I I I I 1 I Sbjct: 128 TACCGCATGATACCTGAGGGTCAAAGGCGCAAGTCGCCTTTGGAGGAGCCTGCGTCT - Query: 185 TAGCTTGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAG I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I 1 1 1 1 I I 1 1 I I I 1 I I I I I I I I I 1 I I - Sbjct: 188 TAGCTTGTTGGTGGGGTAAAGGCTTACCAAGGCGACGATCAGTAGCTGGTCTGAGAG Query: 245 GATCAGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGG 1 I I I I I 1 I 1 I 1 1 1 1 I I I I I I I 1 I 1 1 1 1 1 I 1 I I I 1 1 I 1 1 I I 1 I I I I I I I I I I I I I I I I - Sbjct: 248 GATCAGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGG - Query: 305 TATTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGTAGAAGGTCTT _ 301'61 C4 3!30/9X I: 1) P -NCBI BLAST Search Results http://www.l1cbi.l1lm .n i h.gov /cgi-b in/B LAST/nph-blas 1111111111111/ I 1111111111111111111111111111 1111111111 Sbjct: 308 TATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTT - Query: 365 ATTGTAAAGCACTTTTGGCAGGGACGATGATGACGGTACCTGCAGAATAACCCCGG IlIlllllll!11111I1I1111111111111111111111111111111 III I - Sbjct: 368 ATTGTAAAGCACTTTTGGCAGGGACGATGATGACGGTACCTGCAGAATAAGCCCCG Score 354 (97.8 bits), Expect = 4.6e-179, Sum P(5) 4.6e-179 - Identities = 75/81 (92%), Positives = 75/81 (92%), Strand Plus / PI Query: 413 AACCCCGGCTAACTTCCTGCCAGCAGCCGCGGTAATACGAANGGGGCTACCTTTGCT 11/111111111111 111111111111111111111111 1111111 I 11111 - Sbjct: 417 AGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGCT Query: 473 AATGACTGGGCGTAAAAGGCG 493 - 1111111111111111 1111 Sbjct: 477 AATGACTGGGCGTAAAGGGCG 497 Score 117 (32.3 bits), Expect = 4.6e-179, Sum P(5) 4.6e-179 - Identities = 25/27 (92%), Positives = 25/27 (92%), Strand = Plus / PI Query: 515 AAATTAAATTCCTGGGCTCAACCTGGG 541 - II I 1111111111111111111111 Sbjct: 520 AAGTGAAATTCCTGGGCTCAACCTGGG 546 - Score 86 (23.8 bits), Expect = 4.6e-179, Sum P(5) = 4.6e-179 Identities = 18/19 (94%), Positives = 18/19 (94%), Strand = Plus / PI - Query: 539 GGGACTGCTTTTGATACTT 557 1 I 1 I 1 1 1 1 1 II I I " I I I - Sbjct: 545 GGGACTGCTTTTGATACGT 563 Score 105 (29.0 bits), Expect = 4.6e-179, Sum P(5) = 4.6e-179 - Identities = 35/54 (64%), Positives 35/54 (64%), Strand = Plus / PI Query: 633 AAAGGCGCACCTTGTCCCTTTACTGACCCTNAGCCCAAAANCTTTGGGAACCAA 68 I I I I 1 1 I 1 I II 1 II I 1 I 1 I I I I I I I I I 1 I I I I I I I - Sbjct: 646 AAGGCGGCAACCTGGTCCTTTACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAA 69 - dbjlD86510lD86510 Acidocella sp. DNA for 16S rRNA - Length 1407 Plus Strand HSPs: Score = 1969 (544.1 bits), Expect = 8.5e-179, Sum P(4) = 8.5e-179 - Identities 403/416 (96%), Positives 403/416 (96%), Strand = Plus Query: 5 ACCTTGGCCNCATGNTTAACACATGCAAGTCGCACGGTCAGCAATGGCAGTGGCGGA - 11 1111 1111111111111111111111 1111111111111111 1I1111 - Sbjct: 6 ACGCTGGCGGCATGCTTAACACATGCAAGTCGCGCGGTCAGCAATGGCAGCGGCGGA C5 _-40f61 3130/98 I: 15 p~ NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast - 65 GTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAACAGCGGGAAACTGCTGC Query: I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ! ! I I I I I I I I I I I I - Sbjct: 66 GTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAACAGCGGGAAACTGCTGC Query: 125 TACCGCATGATACCTGAGGGTCAAAGGCGCAAGTCGCCTTGGGAGGAGCCTGCGTCT I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I I - Sbjct: 126 TACCGCATGATACCTGAGGGTCAAAGGCGCAAGTCGCCTTGGGAGGAGCCTGCGTCT Query: 185 TAGCTTGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAG - I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 186 TAGCTTGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAG - Query: 245 GATCAGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGG I I I I I I I I I I I I I I J I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I - Sbjct: 246 GATCAGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGG Query: 305 TATTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGTGTGTAGAAGGTCTT 111111/1111111 I II 11111111111111111111111111 1111111111 - Sbjct: 306 TATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTT Query: 365 ATTGTAAAGCACTTTTGGCAGGGACGATGATGACGGTACCTGCAGAATAACCCCGG 11111111111111111111111111111111111111111111111111 III I - 366 ATTGTAAAGCACTTTTGGCAGGGACGATGATGACGGTACCTGCAGAATAAGCCCCG - Score 360 (99.5 bits), Expect = 8.5e-179, Sum P(4) = 8.5e-179 Identities = 77/84 (91%), Positives = 77/84 (91%), Strand Plus / PI Query: 413 AACCCCGGCTAACTTCCTGCCAGCAGCCGCGGTAATACGAANGGGGCTACCTTTGCT - I 11111/11111111 111111111111111111111111 1111111 I I1111 Sbjct: 415 AGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGCT - Query: 473 AATGACTGGGCGTAAAAGGCGCCT 496 111111111111111111111 I - Sbjct: 475 AATGACTGGGCGTAAAGGGCGCGT 498 Score 111 (30.7 bits), Expect 8.5e-179, Sum P(4) = 8.5e-179 - Identities = 24/27 (88%), Positives = 24/27 (88%), Strand Plus / PI Query: 515 AAATTAAATTCCTGGGCTCAACCTGGG 541 II I 1111 11111111111111111 - Sbjct: 518 AAGTGAAATNCCTGGGCTCAACCTGGG 544 Score 86 (23.8 bits), Expect 8.5e 179, Sum P(4) = 8.5e-179 - Identities 18/19 (94%), Positives 18/19 (94%), Strand Plus / Pl Query: 539 GGGACTGCTTTTGATACTT 557 ""1111111111111 I - Sbjct: 543 GGGACTGCTTTTGATACGT 561 - dbjlD307711ACD16SRNAD Acidiphilium aminolytica gene for 16S ribosomal _ Length = 1406 .50f61 C6 3!30/9X 1: 15 Prv - - SRS2 Sequence Data - TACGACCTGGCCGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGGGC - AGTGNGCGGACGGGTGAGTAACACGTNGGAATCTATCCCAGGGTGGGGGGAC ACAGCNGGGAAAACTGCTGCTAATNCCGCATGATACCTGAAGGGTCAAAGGC - GCCAGTCCCCTTNGGANGAACCTGCCTCTGATTAACNTGTTGGTGGGGTTNAN - GCCNACCCAAGCGACCATCANTTTCTGGTCNGANAAGATNATCNNCCNCCTTG GGACTGANACACNGCCCCAACTCCNNCCGGANGCAACNGTGGGGAATATTGG - ACCATGGGGGAAACCNGATTCAGCAATNCCNCNTGTNTNAANAAAGTCTTCC GATTGTNAANCACTTTTGGCANGGACGATNATNACNGTACCTGCAATANNCC CCCCCGGCTTACTTCCTNCCANCAACCNCNGTTAATNCCAAAGGGGCNAGCCT - TTGCTCCCGAAATGACTGGGCCTTTAAAGGGCCCTTNTGGCGGCGTTTCACCN - TTCCGAAATTTAAAATTCCCTGGGGCTCCACCCTGGGGGACTGCCTTTTTGAA - AACCTTTTTTTTTCTAAAATAGAAAAGGGTTTTTTNN~TTCCCCCCC - CTTTTNTAAAGGTT ------Dl -NCBI BLAST Search Results http://www .ncbi.nlm. nih.goy Icgi-bin/BLASTIn ph-b last - 'n S tlfH n t itcd, pit as e ,va it 1'0 r r l'S HitS ••. - BLASTN 1.4.11 [24-Nov-97] [Build 24-Nov-97] Reference: Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J. Lipman (1990). Basic local alignment search tool. - BioI. 215:403-10. Notice: this program and its default parameter settings are optimized - to find nearly identical sequences rapidly. To identify weak similari encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX. - Query= tmpseq_1 (904 letters) - Database: Non-redundant GenBank+EMBL+ODBJ+PDB sequences 333,892 sequences; 664,089,867 total letters. searC;i~g "&"/ ~ ("cit"O ~"d-;';-" "" " " " " " " " " " " " " " " " " " " " " " " " " " " " " "done - S U" High Pr - Sequences producing High-scoring Segment Pairs: Score P( dbj 10865101086510 Acidocella sp. DNA for 16S rRNA ~ 631 8 . - dbj 10307741ACD16SRNAG Acidiphilium facilis gene for 16S~. 631 8 . emb X91797 ASPGS19H Acidocella sp. 16S ribosomal RNA ge~ 622 1 . ACD16SRNAD Acidiphilium aminolytica gene for . . 1.' ~ 616 4 . - ABC16SRNAA Acetobacter aceti gene for 16S rib ... 7/604 8 . A.aceti gene for 16S rRNA 5 5 . Bacterial species 16S rRNA gene (p... __5_ 7 . - G. frateurii 16S rRNA gene 7tt 568 1 . G.cerinus 16S rRNA gene I~ 568 1 . Gluconobacter oxydans gene for 16S... 568 4 . Bacterial species 16S rRNA gene (c... 5 1 . - G.asaii 16S rRNA gene 550 1 . Rhizobium galegae 16S rRNA gene, p .. . 2 . Alpha-proteobacterium species 16S .. . 3 . - Unknown alpha proteobacterium cIon .. . 5 . A.pasteurianus gene for 16S riboso .. . 1 . Acetobacter intermedius 16S rRNA gene 1 . - Acetobacter oboediens 16S ribosoma .. . 1 . A.diazotrophicus gene for 16S ribo .. . 1 . Acetobacter pomorum 16S ribosomal 1 . - A.methanolicus 16S rRNA gene 6. A.hansenii gene for 16S ribosomal RNA 6. Acetobacter europaeus 16S rRNA gene 6. - A.europaeus 16S rRNA gene 6. Alpha-proteobacterium species 1 S 586 1 . - Acidosphaera rubrifaciens DNA for 581 2 . 02 3/30/98 1:20 rl\ -NCB I BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-bla~ ADM168RNAC Acidomonas methanolica gene for 16 ... 568 3. --~------A.xylinum gene for 168 ribosomal RNA 3 . - A.liquefaciens gene for 168 riboso .. . 3. Phototrophic bacterium 168 rRNA ge .. . 4 . Agrobacterium sp. gene for 168 rRNA 623 5. Heliothis virescens testis endosym .. . 1 . - Uncultured eubacterium TRB25 168 r .. . 559 1. Acidiphilium angustum gene for 168 .. . 5 2. Bacterial species 168 rRNA gene, c .. . 550 2. - Acidiphilium multivorum gene for 1 .. . 5 0 2. Acidiphilium organovorum gene for .. . 5 2. Acidiphilium cryptum gene for 168 .. . 550 2. - Acidiphilium sp. 168 ribosomal RNA .. . 550 2. Acidiphilium multivorum gene for 1 .. . 55 3. Acidiphilium sp. DNA for 168 rRNA .. . 55 1. - A.cryptum (B-Het4) gene for 168 ri .. . 550 9. Brucella sp. A4/I 168 ribosomal RN .. . 2. Phototrophic bacterium 168 rRNA ge .. . 2 . - C.paradoxa gene for 168 small subu .. . 6. Unknown Proteobacterium, alpha-1 s .. . 1 . Ralstonia eutropha 168 rRNA gene, 2. Porphyrobacter tepidarius gene for .. . 4 . - Unidentified eubacterium 168 rRNA .. . 1 . 8hewanella sp. ANG.309 168 ribosom .. . 600 3. Gamma Proteobacterial sp. (clone 8 .. . 3 . - Rhodopila globiformis DNA for 168 .. . 492 6. Thiobacillus acidophilus DNA for 1 .. . 508 1. 8pirulina sp. genes for 168 rRNA, .. . 566 1. - Cowdria ruminantium 168 rRNA gene. 593 1. Pseudomonas azotoformans 168 rRNA .. . 604 2. Rhodopseudomonas globiformis 168 r .. . 483 3. - Uncultured eubacterium TRB3 168 ri .. . 499 5. Unknown Proteobacterium, alpha-1 s .. . 547 6. Rhizobium gallicum strain R602sp 1 .. . 619 7. - Rhizobium gallicum strain F127 168 .. . 619 7. Rhizobium gallicum strain Cb8-18 1 .. . 619 7. Rhizobium gallicum strain Cb8-17 1 .. . 619 7. Rhizobium gallicum strain Cb8 1 16 .. . 619 7. - 593 1. Ehrlichia sp. strain Germishuys 16 .. . Unknown organism, partial 168 rRNA .. . 510 2. Prionitis lanceolata gall symbiont .. . 555 5. - Bradyrhizobium japonicum 168 rRNA, .. . 591 5. Proteobacterium species 168 rRNA g .. . 477 1. 8hewanella oneidensis strain 8P-22 .. . 604 1. - Proteobacterium species 168 rRNA g .. . 535 1. 80lemya occidental is gill symbiont .. . 485 2. R.marina ribosomal RNA small subunit. 501 3. - R.thiosulatophilus gene for 168 rRNA 487 5. Acidiphilium sp. gene for 168 ribo .. . 481 6. Unidentified rumen bacterium RCP6 .. . 617 8. - Ralstonia eutropha DNA 168 ribosom .. . 565 1. Rhodobium marinum 168 rRNA gene, c .. . 495 1. - Unidentified rumen bacterium 12 74 .. . 565 2. _:2 01'43 03 -NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blm Sphingomonas sp. small subunit rib .. . 483 2. Unidentified gamma proteobacterium .. . 601 4. - Uncultured eubacte urn WCHBl-87 16 .. . 451 8. Unidentified rumen bacterium RC21 .. . 595 1. Synechococcus sp. gene for 16S rRN .. . 562 1. Unidentified eubacterium SCB45 16S .. . 498 1. - Purple bacteria, gamma subdivision .. . 537 1. Cyanobacterium sp. 16S ribosomal RNA. 571 1. Unknown Proteobacterium, alpha 1 s .. . 460 1. - Sphingomonas sp. 16S ribosomal RNA .. . 483 1. S.flava 16S rRNA gene, strain IPse .. . 483 1. Proteobacterium species 16S rRNA g .. . 450 2. - L.mucor 16S rRNA gene 480 2. Unidentified eubacterium 16S ribos .. . 508 2. Sphingomonas sp. 16S ribosomal RNA .. . 483 2. - L.adelaidensis gene for ribosomal .. . 500 4. Unknown organism, partial 16S rRNA .. . 489 4. Moraxella catarrhalis ATCC 25238 1 .. . 532 4. - S.flava 16S rRNA gene, strain 'Fla .. . 483 4. Microcystis aeruginosa PCC7005 16S .. . 508 5. - Sphingomonas sp. 16S rRNA gene 483 5. dbjlD86510lD86510 Acidocella sp. DNA for 16S rRNA - Length = 1407 - Plus Strand HSPs: Score = 202 (55.8 bits), Expect 8.6e-72, Sum P(4) 8.6e-72 - Identities = 42/44 (95%), Positives 42/44 (95%), Strand = Plus / PI Query: 32 CTGGCCGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 75 11111111111111111111111111111 1111111111111 - Sbjct: 9 CTGGCGGCATGCTTAACACATGCAAGTCGCGCGGTCAGCAATGG 52 Score 242 (66.9 bits), Expect = 8.6e-72, Sum P(4) 8.6e-72 - Identities = 52/58 (89%), Positives 52/58 (89%), Strand Plus / PI Query: 83 GCGGACGGGTGAGTAACACGTNGGAATCTATCCCAGGGTGGGGGGACACAGCNGGGA - 1IIIIIIIIIIIIIIIIIIIIIIIIIIlIIIIIIIIIIIIIII 11111 II I Sbjct: 58 GCGGACGGGTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAACAGCGGGAA Score 156 (43.1 bits), Expect 8.6e-72, Sum P(4) 8.6e 72 - Identities = 33/36 (91%), Positives 33/36 (91%), Strand Plus / PI = - Query: 137 GGAAAACTGCTGCTAATNCCGCATGATACCTGAAGG 172 1111111111111111111111111111111 II Sbjct: 110 GGGAAACTGCTGCTAATACCGCATGATACCTGAGGG 145 - Score 631 (174.4 bits), Expect = 8.6e-72, Sum P(4) 8.6e-72 - Identities = 146/185 (78 ) , Positives 146/185 (78%), Strand Plus D4 _ .J of 3/30/98 1:20 PI -NCBI BLAST Search Results http://www.ncbi.nIITI.nih.gov/cgi-bin/BLAST/nph-b\as Query: 170 AGGGTCAAAGGCGCCAGTCCCCTTNGGANGAACCTGCCTCTGATTAACNTGTTGGTG 111111111111111111 II11 III II I111I 1111111/ I ""1111 - Sbjct: 142 AGGGTCAAAGGCGCAAGTCGCCTTGGGAGGAGCCTGCGTCTGATTAGCTTGTTGGTG Query: 230 TTNANGCCNACCCAAGCGACCATCANTTTCTGGTCNGANAAGATNATCNNCCNCCTT I I III III I 11111 1111 I 111111 II I III III II I II - Sbjct: 202 TAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATT Query: 290 ACTGANACACNGCCCCAACTCCNNCCGGANGCAACNGTGGGGAATATTGGACCATGG - 11111 1111 1II1 111111 I III III I 1111111111111111 1111 Sbjct: 262 ACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGG - Query: 350 AAACC 354 I I I - Sbjct: 322 CAAGC 326 Score 328 (90.6 bits), Expect = 9.7e-17, P 9.7e-17 - Identities 73/92 (79%), Positives = 73/92 (79%), Strand Plus / PI Query: 345 GGGGGAAACCNGATTCAGCAATNCCNCNTGTNTNAANAAAGTCTTCCGATTGTNAAN II I II II III 1111111 II I III I II II 111111 111111 II - Sbjct: 318 GGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAG Query: 405 TTTTGGCANGGACGATNATNACNGTACCTGCA 436 11111111 1111111 II II 111111111 - Sbjct: 378 TTTTGGCAGGGACGATGATGACGGTACCTGCA 409 - dbjlD30774lACD16SRNAG Acidiphilium facilis gene for 16S ribosomal RNA - Length 1407 Plus Strand HSPs: - Score = 202 (55.8 bits), Expect = 8.6e-72, Sum P(4) 8.6e-72 Identities 42/44 (95%), Positives 42/44 (95%), Strand = Plus / PI - Query: 32 CTGGCCGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 75 11111 111111/11111111111111111 1111111111111 - Sbjct: 9 CTGGCGGCATGCTTAACACATGCAAGTCGCGCGGTCAGCAATGG 52 Score 242 (66.9 bits), Expect 8.6e-72, Sum P(4) = 8.6e-72 - Identities = 52/58 (89%), Posit s 52/58 (89%), Strand = Plus / PI Query: 83 GCGGACGGGTGAGTAACACGTNGGAATCTATCCCAGGGTGGGGGGACACAGCNGGGA 1111111111111111111111111111111111111111111 11111 II I - Sbjct: 58 GCGGACGGGTGAGTAACACGTAGGAATCTATCCCAGGGTGGGGGACAACAGCGGGAA Score 156 (43.1 bits), Expect = 8.6e 72, Sum P(4) 8.6e-72 - Identities 33/36 (91%), Positives = 33/36 (91%), trand Plus / PI Query: 137 GGAAAACTGCTGCTAATNCCGCATGATACCTGAAGG 172 - II 11111111111111 111111111111111 II 05 _4of43 ]/]O/9R 1:20 P\ "'leBt BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast - Sbjct: 110 GGGAAACTGCTGCTAATACCGCATGATACCTGAGGG 145 Score 631 (174.4 bits), Expect 8.6e-72, Sum P(4) 8.6e-72 - Identities = 146/185 (78%), Positives = 146/185 (78%), Strand Plus Query: 170 AGGGTCAAAGGCGCCAGTCCCCTTNGGANGAACCTGCCTCTGATTAACNTGTTGGTG - 11111111111111 1111 II1I III II 11111 11111111 I 11111111 Sbjct: 142 AGGGTCAAAGGCGCGAGTCGCCTTGGGAGGAGCCTGCGTCTGATTAGCTTGTTGGTG - Query: 230 TTNANGCCNACCCAAGCGACCATCANTTTCTGGTCNGANAAGATNATCNNCCNCCTT I I III III I 11111 1111 I 111111" I III III II I II - Sbjct: 202 TAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATT Query: 290 ACTGANACACNGCCCCAACTCCNNCCGGANGCAACNGTGGGGAATATTGGACCATGG 1111111111111 ""11 I III III I 1111111111111111 1111 - Sbjct: 262 ACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGG Query: 350 AAACC 354 I I I - Sbjct: 322 CAAGC 326 Score 328 (90.6 bits), Expect = 9.7e-17, P 9.7e-17 - Identities 73/92 (79%), Positives 73/92 (79%), Strand = Plus / PI Query: 345 GGGGGAAACCNGATTCAGCAATNCCNCNTGTNTNAANAAAGTCTTCCGATTGTNAAN - II I II II III 1111111 II I III I II 1/ 111111 II/III 11 Sbjct: 318 GGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAG - Query: 405 TTTTGGCANGGACGATNATNACNGTACCTGCA 436 111111111111111 II II 111111111 - Sbjct: 378 TTTTGGCAGGGACGATGATGACGGTACCTGCA 409 - emblX917971ASPGS19H Acidocella sp. 16S ribosomal RNA gene Length = 1442 - Plus Strand HSPs: Score = 211 (58.3 bits), Expect = 1.5e-69, Sum P(4) = 1.5e-69 - Identities = 43/44 (97%), Positives 43/44 (97%), Strand = Plus / PI Query: 32 CTGGCCGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 75 I I I I I I I I I I I I I I I I I I I I j I I I I I I I I I I I I I I I I I I I I I I - 11 CTGGCGGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 54 Sbjct: Score 215 (59.4 bits), Expect 1.5e-69, Sum P(4) 1.5e-69 - Identities = 49/58 (84%), Positives = 49/58 (84%), Strand = Plus / PI Query: 8 GCGGACGGGTGAGTAACACGTNGGAATCTATCCCAGGGTGGGGGGACACAGCNGGGA - 11111111111111111111111111111111 11111111 I1I1I II I - Sbjct: 60 GCGGACGGGTGAGTAACACGTAGGAATCTATCCAGAGGTGGGGGACAACAGCGGGAA 06 _" nf43 3/30/98 1:20 PfY -l\JCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/llph-blast Score 156 (43.1 bits), Expect 1.5e-69, Sum P(4) 1.5e-69 Identities 33/36 (91%), Positives = 33/36 (91%), Strand = Plus / PI - Query: 137 GGAAAACTGCTGCTAATNCCGCATGATACCTGAAGG 172 1111111111111111111111111111111 II - Sbjct: 112 GGGAAACTGCTGCTAATACCGCATGATACCTGAGGG 147 Score 622 (171.9 bits), Expect = 1.5e-69, Sum P(4) 1.5e-69 _ Identities 145/185 (78%), Positives = 145/185 (78%), Strand Plus Query: 170 AGGGTCAAAGGCGCCAGTCCCCTTNGGANGAACCTGCCTCTGATTAACNTGTTGGTG 11111111111111 1111 1111 III II 11111 111111/1 I 11111111 - Sbjct: 144 AGGGTCAAAGGCGCAAGTCGCCTTTGGAGGAGCCTGCGTCTGATTAGCTTGTTGGTG Query: 230 TTNANGCCNACCCAAGCGACCATCANTTTCTGGTCNGANAAGATNATCNNCCNCCTT - I I II III I 11111 1111 I 111111" I III III "I II Sbjct: 204 TAAAGGCTTACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGATGATCAGCCACATT - Query: 290 ACTGANACACNGCCCCAACTCCNNCCGGANGCAACNGTGGGGAATATTGGACCATGG 11111 1111 1111 111111 I III III I 111111/111111111 1111 Sbjct: 264 ACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGG - Query: 350 AAACC 354 I I I - Sbjct: 324 CAAGC 328 Score 328 (90.6 bits), Expect 9.7e-17, P 9.7e-17 - Identities = 73/92 (79%), Positives = 73/92 (79%), Strand = Plus / PI Query: 345 GGGGGAAACCNGATTCAGCAATNCCNCNTGTNTNAANAAAGTCTTCCGATTGTNAAN II I II II III 1111111 II I III I II II 111111 111/11 II - Sbjct: 320 GGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAG Query: 405 TTTTGGCANGGACGATNATNACNGTACCTGCA 436 - 111111111111111 II 1/ 111111111 - Sbjct: 380 TTTTGGCAGGGACGATGATGACGGTACCTGCA 411 dbjlD307711ACD16SRNAD Acidiphilium aminolytica gene for 16S ribosomal - Length 1406 - Plus Strand HSPs: Score = 211 (58.3 bits), Expect 4.3e-69, Sum P(4) 4.3e-69 Identities = 43/44 (97%), Positives = 43/44 (97%), Strand = Plus / PI - Query: 32 CTGGCCGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 75 I I I I I I I 1 I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I \ I I I - Sbjct: CTGGCGGCATGCTTAACACATGCAAGTCGCACGGTCAGCAATGG 52 Score 215 (59.4 bits), Expect = 4.3e-69, Sum P(4) .3e-69 _ Ident t es = 49/58 (84%), Positives = 49/58 (84%), Strand = Plus / PI 07 3/30/98 I :20 PM - - SRS4 Sequence Data .. TGACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCA - GTAGCAATACTGTGGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGG .. ACCTGCCCAGACGTGGGGGATAACGTAGGGAAACTTACGCTAATACCGCATA CGTCCTACGGGAGAAAGCGGGGGATCGCAAGACCTCGCGCGGTTGGATGGAC - CGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCGA - TAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGA CTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGAT - CCAGCAATGCCGCGTTGTTGTTGAAGAAAGGCCTTCGGGTTGTTAAAGCACTT - TTATCCAGGAGCCGAAACGCTGTCGGCTAATACCCCGGCGGAACTTGACGGTA CCTTGAAGAAATAAGCACCNGCTAACTTCCGTGCCCACCACCGCGGTAATACA - AAGGTTGCAACCGTTTAATCCGAATTACTGGCCGTTANCCTTGCGTTTAGCGG - TTGAATTTANTTCTGCTNGTGAAATCCCCCNGGCTCCACCCTTGGAAATGGCA - GTTGAAAACTGGATTCCCTAAATT ------E1 I I I I I I I I • I I I I I I I I I I • Model Sample 20 Signal G:189 A:418 T:176 C:1 05 Page 1 of 3 ABI~ Version 2.1.1 610 ng/ul- 0.74 ullrxn DT 4%Ac{A Set-AnyPrimer} Apr, 7, 1998 6:36 AM PRI~M' 6ata ~llEction File: '..I CT1 tJ Data Base Call Start: 975 Base Call End: 8350 Primer Peak loc. :975 G (189), A (418), T (176), C (105) MatrJx Name: 94112221S.MatrixFile Cl1aI1T1els Ave. : 3 Verso : Version 2.1.1 Ba.se Spacing: 11.51 - SemiAdaptive 1 NlX}ACGCTGG CC'.:GCA'IGCIT MCACArr::£A AGICGAACGG CAC!£.ACAGCA GrAGl:.MTAC m:rGGGIGGC GAGIGGCGGA CGGGI'l::;AGGA ATACATCGG:; ACCTGC:CCAG 110 111 AC~ TMCGrACf.X3 AAACITAcc:J:. TMTACCC!£.A TACGrCCTAC CJ:X'lAGAAAGC GGGGGATCGC MGACCICGC GCGGrIGGAT GGACCGATGr TCGATTAGCT 220 221 Aarn;GIGAG GrM'IGGCIC ACCMGCr.GA. CGATCGATAG CI'GGICIGAG AGGA'IGATCA GCCACAcr<::J:!, GlCIGAGACA Cr:lf.:CCCAGAC TCcrACGGGA ro.:.:AGCAGrG 330 331 GGGAATATIG GACM~ Gl:.Ma.:rrGA TCCAGl:.MTG CCGCGITGIT GrIGAA.GAAA GGCcrTCCf.X3 TIGITAAAGC AcrTTTATCC AGGAGCCGAA ACGCIGTCGG 440 441 crMTACCCC G3C:GGMCIT GACGGrACCT rrsJAAGAAATA AC!£.ACCN:rr McrTCCGrG CCCACCACCG CG:JrMTACA Mrorrrr:..M CCGrTTMTC CGAATTACIG 550 551 GCCGrTAN:C TIGCGITrAG CGGrIGAATT TANI'ICTGCT NnGAAATCC CCCN3G(;ICC ACccrroGAA A'IGGCAGrro MMCJ.'(]fJAT TCCcrAAATT NITANAAAGA 660 661 I\GGI~ MTTCCCCGG 'I'l'I'l'I'rACCG TrNM'I\3CCr TTMAAAA.TT CGGGt\lMGNA Mc:rccc.NIT ~GG CNJCCN.IN::T. GGN1N 770 I I I I I I I I I I I I I I I I I I I Model Sample 20 Signal G:189 A:418 T:176 C:105 Page 2 of 3 Version 2.1.1 610 ng/ul- 0.74 ul/rxn DT4%Ac{A Set-Any Primer} Apr, 7,1998 6:36 AM ABI~ SRS-4/27f 94112221S.MatrixFile Apr, 6,1998 4:13 PM PRISM" Lane 20 Points 975 to 8350 Base 1: 975 Spacing: 11.50 SemiAdaptive NTGA CGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCAGT AGCAAT ACTGTGGGTGGCG AGTGGCGG ACGGGTG AGG AAT ACATCGGG ACCTGCCCAG ACGTGGGGG ATAA 10 20 30 40 50 60 70 80 90 100 110 1 ~o ACGCTAATACCGCATACGTCCTACGGGAGAAAGCGGGGGATCGCAAGACCTCGCGCGGTTGGATGGACCGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTCACCA 140 150 160 170 180 190 200 210 220 230 240 T GTT A A AGC ACT T T TAT CCAG G A GCCGA A ACGC T GT C G G C T A AT A C C CCG GC GG A A CT TG A CG G T A C CTTG A A G AAA T A AG C A C C N G C T AAC T 410 420 430 440 450 460 470 480 490 C G T GC CC A CCA C C GC G G T A A T A C A A A G G T T G C A A CCG T T T AA T C C G A AT T ACT G G CC G T TAN CC n GC OTT TAG C GG TTG A AT T TAN T T C T GC TN G T G AAA T C C C C C N G GC T C C A CCC T T G 500 510 520 530 540 550 560 570 580 590 600 610 I • I I I I I I I I I I I I I I I I I I I ~ Model Sample 20 Signal G:189 A:418 T:176 C:105 Page 3 of 3 ABI~ Version 2.1.1 610 nglul - 0.74 ullrxn DT4%Ac{A Set-Any Primer} Apr, 7. 1998 6:36 AM SRS-4/27f 94112221S.MatrixFile Apr, 6,1998 4:13 PM PRISM" Lane 20 Points 975 to 8350 Base 1: 975 Spacing: 11.50 SemiAdaptive r p A to. A T GG C A G T T G A A A ACT G GAT T C C C T A A A T TNT TAN A A A G A N G G T T N G G N A A A T T C C C eGG T T T T T T Ace G T T N A A TG CC T T T II A A A A A T T C G G G N A A GN A A ACT C C C N T T N G C N A A A A I 620 630 640 650 660 670 680 690 700 710 720 no I I : i I GGCNGCCNTNCT GGNTN 740 t"I1 +:;.. NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-b\as - - .. BLAST Search Results IlDlIDIIJ - BLASTN 1.4.11 [24-Nov-97] [Build 24-Nov-97] Reference: Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers, and David J. Lipman (1990). Basic local alignment search tool. - BioI. 215:403-10. Notice: this program and its default parameter settings are optimized - to find nearly identical sequences rapidly. To identify weak similari encoded in nucleic acid, use BLASTX, TBLASTN or TBLASTX. - Query= tmpseq_l (755 letters) Database: Non-redundant GenBank+EMBL+DDBJ+PDB sequences - 338,156 sequences; 680,895,594 total letters. Searching ...... done - S High Pr - Sequences producing High-scoring Segment Pairs: Score P( X.fastidiosa small subunit ribosome .. 1552 5. - X.albilineans 16S rRNA gene 2. X.melonis 16SrRNA gene 1524 1 . X.campestris 16S rRNA gene, strain ... 1515 6. - X.hyacinthi 6S rRNA gene 1 . 21 Proteobacterium sp. partial 16S rR ... 125 2 . Denitrifying Fe/II/-oxidizing bact ... 1 1 4 . - Stenotrophomonas sp. 16S rRNA gene ... 1456 4 . S.maltophilia 16S rRNA gene, strai ... 1479 5. Iron-oxidizing lithotroph ES-1 16S ... 1 . - X.sacchari 16S rRNA gene 8 . 06 Stenotrophomonas sp. 16S rRNA gene ... 5 . X.vasicola 16S rRNA gene 1 . X.axonopodis 16S rRNA gene 1 . - Unknown organism, partial 16S rRNA ... 2 . X.vesicatoria 16S rRNA gene 7 . X.theicola 16S rRNA gene 7 . - X.hortorum 16S rRNA gene /embIYI07 ... 7 . X.oryzae 16S rRNA gene 7 . X.campestris 16S rRNA gene 7 . - Xanthomonas campestris pv. campest ... 8 . Uncultured proteobacterium clone M... 1 . X.pisi 16S rRNA gene 2 . - X.cucurbitae 6S rRNA gene 2. X.codiaei 16S rRNA gene 4 . - X.cassavae 16S rRNA gene 92 5 . E5 _ lor)4 4/23/98 9:20 Pl\ -NCB I BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blasl 3tenotrophomonas maltophilia 163 r ... 1 . X.bromi 163 rRNA gene 1 . ______~ ______1_4 3tenotrophomonas sp. 163 rRNA gene ... 1 . - X.populi 163 rRNA gene 2 . X.fragariae 163 rRNA gene 2 . Xanthomonas sp. 163 ribosomal RNA .. . 1 . - 3.maltophilia 163 rRNA gene, strai .. . 1 . Uncultured eubacterium TRA5-3 163 .. . 2 . Unidentified bacterium DNA for 163 .. . 2 . - Xanthomonas sp. 163 ribosomal RNA 7 • Hydrothermal vent eubacterium PVB .. . 4 . hydrothermal vent eubacterium PVB= .. . 4 . - Uncultured proteobacterium clone M.. . 8 . 3.maltophilia 163 rRNA gene, strai .. . 1 . Hydrothermal vent eubacterium PVB .. . 2 . - Haererehalobacter ostenderis 163 r .. . 2 . R.fermentans gene for 163 ribosoma .. . 3 . R.fermentans gene for 163 ribosoma .. . 1 4 3. Gamma proteobacterium N4-7 163 rib .. . 801 3. - C.marismortui 163 rRNA gene, ATCC .. . 1273 5. P.lemoignei 163 ribosomal RNA (str .. . 259 1. Unknown organism, partial 163 rRNA .. . 1300 4. - denitrifying bacterium 72Chol 163 .. . 1380 4. Unknown organism, partial 163 rRNA .. . 13 7. Thiobacillus thermosulfatus 163 ri .. . 1201 1. - Unknown organism, partial 163 rRNA .. . 1312 2. Chromohalobacter marismortui 163 r .. . 1273 2. C.marismortui 163 rRNA gene, A-65 .. . 1273 3. - C.marismortui 163 rRNA gene, A-492 .. . 1273 3. Unknown organism, partial 163 rRNA .. . 1300 4. P.lemoignei 163 ribosomal RNA (str .. . 1255 4. - Unknown organism, partial 163 rRNA .. . 1309 4. Zymobacter palmae 163 rRNA gene 1273 4. Unknown organism, partial 163 rRNA .. . 1294 7. - Unknown organism, partial 163 rRNA .. . 1300 9. Methylocaldum tepidum 163 ribosoma .. . 1217 1. C.marismortui 163 rRNA gene, A-100 .. . 1273 1. - Environmental sample; bacterial 16 .. . 1237 2. Unknown organism, partial 163 rRNA .. . 1291 2. Unknown organism, partial 163 rRNA .. . 1282 2. Chromohalobacter sp. 163 ribosomal .. . 1273 2. - Bacteria species 16S rRNA gene, st .. . 1219 3. T.mixta 163 rRNA 1240 3. 30lemya terraeregina gill symbiont .. . 1344 4. - Unidentified beta proteobacterium .. . 1224 4. Unknown organism, partial 163 rRNA .. . 1294 7. Azoarcus indigens 163 ribosomal RN .. . 1231 1. - Unknown organism, partial 16S rRNA .. . 1291 1. H.desiderata 163 ribosomal RNA 1237 1. 3hewanella sp. MR-4 163 ribosomal .. . 1344 2. - Gamma proteobacterium MED20 163 ri .. . 1259 3. Pseudomonas sp. strain B1*8 163 ri .. . 1185 3. - Methylocaldum szegediense 16S ribo .. . 1190 4. E6 ..;'. or 54 4/23/C;R 9:20 Piv -NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blas1 Variovorax paradoxus DNA for 16S r .. . 1213 5. Bacterial sp. 16S rRNA gene (Lake .. . 1249 5. Azoarcus sp. BH72 16S ribosomal RN .. . 1222 5. - Unknown organism, partial 16S rRNA .. . 1312 8. 16S rRNA [Burkholderia pickettii, .. , 1335 9. Hydrogenophaga palleronii 16S ribo .. . 1223 9. - Alcaligenes sp. 16S rRNA gene, iso .. . 1320 1. Unidentified beta proteobacterium .. . 1192 1. Ralstonia eutropha 16S ribosomal R .. . 1210 3. - Lucina floridana gill symbiont rib .. . 1215 5. R.tenuis gene for 16S ribosomal RNA 1201 5. Ralstonia sp. DNA for 16S ribosoma .. . 1201 5. - Azoarcus indigens (strain VB32) 16 .. . 1210 5. Aeromonas sp. RC50 16S ribosomal R .. . 1191 5. Codakia costata gill symbiont ribo .. . 1215 6. - L.feeleii sgp2 (ATCC 35849) gene f .. . 1317 6. Ralstonia basilensis 16S rRNA gene 1219 7. Alcaligenes faecalis DNA for 16S r .. . 1320 7. Pseudomonas sp. strain BI*7 16S ri .. . 1183 8. - Unidentified bacterium DNA for 16S .. . 1234 8. - Variovorax paradoxus gene for 16S .. . 1198 9. gblM26601lXYLSSRNA X.fastidiosa small subunit ribosomal RNA. - Length 1493 - Plus Strand HSPs: Score 1552 (428.8 bits), Expect = 5.1e-122, Sum P(3) 5.1e-122 - Identities 3 2/383 (89%), Positives = 342/383 (89%), Strand = Plus Query: 4 ACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCAGTAGCAATAC 111111111111 II 1111111111111111 11111111II1 1111 11111 - Sbjct: 35 ACGCTGGCGGCAGGCCTAACACATGCAAGTCGGACGGCAGCACATTGGTAGTAATAC Query: 64 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGGACCTGCCCAGACGTGGGGGA - 111111111111111111111111111111111111 I "" 111111111 Sbjct: 95 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGAATCTACCTTATCGTGGGGGA - Query: 124 CGTAGGGAAACTTACGCTAATACCGCATACGTCCTACGGGAGAAAGCGGGGGATCGC 111111111111111111111111111111111111111 11//11 1111/ I Sbjct: 155 CGTAGGGAAACTTACGCTAATACCGCATACGACCTACGGGTGAAAGCAGGGGACCTT - Query: 184 ACCTCGCGCGGTTGGATGGACCGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTC III I III 1111111 1111111 11111111111111111111111 11111 - Sbjct: 215 GCCTTGTGCGATTGGATGAGCCGATGTCCGATTAGCTAGTTGGTGAGGTAAAGGCTC ry: 244 AAGGCGACGATCGATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACA 111111111111 111111111111111/11111111111111111111111111 - Sbjct: 275 NAGGCGACGATCGGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACA - ry: 304 CCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA F7 4123/98 9:20 PM -NCBt BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast ! I I J J J I J I J I I I I I I J I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct: 335 TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA - Query: 364 AGCAATGCCGCGTTGTTGTTGAA 386 I" I 1 I I I I I 1 I I I I 1 II - Sbjct: 395 AGCTATGCCGCGTGGGTGAAGAA 417 Score 84 (23.2 bits), Expect = 5.1e-122, Sum P(3) 5.1e-122 - Identities 21/27 (77%), Positives = 21/27 (77%), Strand = Plus / PI Query: 389 AAGGCCTTCGGGTTGTTAAAGCACTTT 415 II 1111111111111 II I III - Sbjct: 416 AATGCCTTCGGGTTGTAAAGCCCNTTT 442 Score 127 (35.1 bits), Expect 5.1e-122, Sum P(3) = 5.1e-122 - Identities 32/41 (78%), Positives = 32/41 (78%), Strand = Plus / PI Query: 495 TCCGTGCCCACCACCGCGGTAATACAAAGGTTGCAACCGTT 535 1111111 I 111111111111 "" III I 1111 - Sbjct: 514 TTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCNAGCGTT 554 - emblX959181XARR494 X.albilineans 16S rRNA gene - Length 1500 Plus Strand HSPs: - Score 1533 (423.6 bits), Expect 2.0e-121, Sum P(3) = 2.0e-121 Identities 341/384 (88%), Positives = 341/384 (88%), Strand = Plus - Query: 4 ACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCAGTAGCAATAC 111111111111 II 11111111111111111111111111111 1111111111 - Sbjct: 6 ACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGCAGCACAGTGGTAGCAATAC Query: 64 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGGACCTGCCCAGACGTGGGGGA 111111111111111111111111111111111111 I II II 111111111 - Sbjct: 66 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGAATCTACCTTTTCGTGGGGGA Query: 124 CGTAGGGAAACTTACGCTAATACCGCATACGTCCTACGGGAGAAAGCGGGGGATCGC 1111111111111111111111111111111 III III 11111111 III I - Sbjct: 126 CGTAGGGAAACTTACGCTAATACCGCATACGACCTTAGGGTGAAAGCGGAGGACCTT Query: 184 ACCTCGCGCGGTTGGATGGACCGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTC - 111111111 I 1111 1111111 1111111111111111 IIlII III I Sbjct: 186 GCTTCGCGCGGATAGATGAGCCGATGTCGGATTAGCTAGTTGGTGGGGTAAAGGCCC - Query: 244 AAGGCGACGATCGATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACA 111111111111 111111111111111111111111111111111 111111111 - Sbjct: 246 AAGGCGACGATCCGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACA Query: 304 CCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA - I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I I I I , I I 1 I I I 1 E8 -+ of 54 4/23198 9:20 PM NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast - Sbjct: 306 TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA Query: 364 AGCAATGCCGCGTTGTTGTTGAAG 387 - 111111111111 I II 1111 Sbjct: 366 AGCCATGCCGCGTGGGTGAAGAAG 389 - Score 90 (24.9 bits), Expect = 2.0e-121, Sum P(3) 2.0e-121 Identities = 22/27 (81%), Positives = 22/27 (81%), Strand = Plus / PI - Query: 389 AAGGCCTTCGGGTTGTTAAAGCACTTT 415 1111111111111111 II I III - Sbjct: 387 AAGGCCTTCGGGTTGTAAAGCCCTTTT 413 Score 133 (36.8 bits), Expect = 2.0e-121, Sum P(3) = 2.0e-121 - Identities = 33/41 (80%), Positives = 33/41 (80%), Strand = Plus / PI Query: 495 TCCGTGCCCACCACCGCGGTAATACAAAGGTTGCAACCGTT 535 1111111 1 1111111111111111 11111 1111 - Sbjct: 485 TTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTT 525 - emblY107561XMY10756 X.melonis 16SrRNA gene Length = 1500 - Plus Strand HSPs: Score = 1524 (421.1 bits), Expect = 1.le-120, Sum P(3) 1.le-120 - Identities = 340/384 (88%), Positives = 340/384 (88%), Strand Plus Query: 4 ACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCAGTAGCAATAC - 111111111111 II 11111111111111111111111111111 1111111111 Sbjct: 6 ACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGCAGCACAGTGGTAGCAATAC - Query: 64 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGGACCTGCCCAGACGTGGGGGA 111111111/11111111111111111111111111 I II II 111111111 - Sbjct: 66 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGAATCTACCTTTTCGTGGGGGA Query: 124 CGTAGGGAAACTTACGCTAATACCGCATACGTCCTACGGGAGAAAGCGGGGGATCGC 1111111111111111111111111111111 III 11111111111 III I - Sbjct: 126 CGTAGGGAAACTTACGCTAATACCGCATACGACCTTAGGGTGAAAGCGGAGGACCTT Query: 184 ACCTCGCGCGGTTGGATGGACCGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTC 111111111 I 111I 1111111 11111111111111 I 11111 III I - Sbjct: 186 GCTTCGCGCGGATAGATGAGCCGATGTCGGATTAGCTAGTTGGCGGGGTAAAGGCCC Query: 244 AAGGCGACGATCGATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACA - 111111111111 111111111111111111111111111111111 111111111 Sbjct: 246 AAGGCGACGATCCGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACA - ry: 304 CCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA I I 1 I I I I I I I I I I I I I ! 1 I I I I I 1 I 1 I I I I I J I I I I 1 I I I 1 I I 1 I ) I I I I I I I I I I - Sbjct: 306 TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA E9 4/23/98 9:20 PM NCBI BLAST Search Results http://www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-blast - Query: 364 AGCAATGCCGCGTTGTTGTTGAAG 387 1 1 1 1 1 I I I 1 1 1 1 1 I I II I I - Sbjct: 366 AGCCATGCCGCGTGGGTGAAGAAG 389 Score 90 (24.9 bits), Expect = 1.le 120, Sum P(3) 1.1e-120 - Identities = 22/27 (81%), Positives 22/27 (81%), Strand Plus / PI Query: 389 AAGGCCTTCGGGTTGTTAAAGCACTTT 415 - 1111111111111111" I III Sbjct: 387 AAGGCCTTCGGGTTGTAAAGCCCTTTT 413 - Score 133 (36.8 bits), Expect 1 . 1 e - 12 0 , Sum P ( 3) = 1. 1 e 12 0 Identities:::: 33/41 (80%), Posit s :::: 33/41 (80%), Strand Plus / PI - Query: 495 TCCGTGCCCACCACCGCGGTAATACAAAGGTTGCAACCGTT 535 I 111111 I 111111111111 1111 11111 1111 - Sbjct: 485 TTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTT 525 - emblX992981XC16S726 X.campestris 16S rRNA gene, strain LMG 726 Length = 1500 - Plus Strand HSPs: Score = 1515 (418.6 bits), Expect = 6.0e-120, Sum P(3) 6.0e-120 - Identities = 339/384 (88%), Positives = 339/384 (88%), Strand Plus Query: 4 ACGCTGGCGGCATGCTTAACACATGCAAGTCGAACGGCAGCACAGCAGTAGCAATAC 111111111111 II 11111111111111111111111111111 1111111111 - Sbjct: 6 ACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGCAGCACAGTGGTAGCAATAC Query: 64 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGGACCTGCCCAGACGTGGGGGA - 111111111111111111111111111111111111 I II II 111111111 Sbjct: 66 GGGTGGCGAGTGGCGGACGGGTGAGGAATACATCGGAATCTACCTTTTCGTGGGGGA - Query: 124 CGTAGGGAAACTTACGCTAATACCGCATACGTCCTACGGGAGAAAGCGGGGGATCGC 1111111111111111111111111111111 III III 11111111 III I - Sbjct: 126 CGTAGGGAAACTTACGCTAATACCGCATACGACCTTAGGGTGAAAGCGGAGGACCTT Query: 184 ACCTCGCGCGGTTGGATGGACCGATGTTCGATTAGCTAGTTGGTGAGGTAATGGCTC 111111111 I 1111 1111111 11111111111111 I 11111 III I - Sbjct: 186 GCTTCGCGCGGATAGATGAGCCGATGTCGGATTAGCTAGTTGGCGGGGTAAAGGCCC Query: 244 AAGGCGACGATCGATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACA 11111 111111 111111111111111111111111111111111 111111111 - Sbjct: 246 AAGGCAACGATCCGTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACA Query: 304 CCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA - I I ! I I I I I I I I I I I I I I 1 I I I I I I I I I I I I I I I I I 1 I 1 I I I I I I 1 1 I 1 I I I I 1 I I I - Sbjct: 306 TCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGA El0 4123/98 () PM