DOCSLIB.ORG

Phosphorylation Mutants of MAP4 2881

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phosphorylation Mutants of MAP4 2881 RESEARCH ARTICLE 2879 Phosphorylation of MAP4 affects microtubule properties and cell cycle progression Winston Chang1,2, Dorota Gruber1, Sripriya Chari2, Hidefumi Kitazawa3, Yuko Hamazumi3, Shin-ichi Hisanaga3 and J. Chloë Bulinski1,2,* 1Departments of Biological Sciences, Anatomy & Cell Biology, and Pathology, Colleges of Arts & Sciences and Physicians & Surgeons, Columbia University, 1212 Amsterdam Avenue, New York, NY 10027-2450, USA 2Integrated Program in Cell, Molecular & Biophysical Studies, College of Physicians & Surgeons, Columbia University, 1212 Amsterdam Avenue, New York, NY 10027-2450, USA 3Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, 1-1 Minami-ohsawa, Hachiohji, Tokyo 192-0397, Japan *Author for correspondence (e-mail: [email protected]) Accepted 02 May 2001 Journal of Cell Science 114, 2879-2887 (2001) © The Company of Biologists Ltd SUMMARY phosphorylatable mutants of MAP4 did not affect cell doubling time; however, expression of some mutants In human cells, MAP4, a microtubule-associated protein altered progression into or through cell division. ubiquitously expressed in proliferating cells, has been Interactions of mutant MAP4 with MTs were examined in shown to undergo in vivo phosphorylation. Two vitro. KK mutant MAP4 bound MTs more avidly than its phosphorylation sites, serines 696 and 787, lie within the wild-type counterpart, WT-MAP4. In vivo MT polymer proline-rich region of its microtubule-binding domain. To also differed among the mutants: MTs in cells expressing test the hypothesis that phosphorylation at these sites the KK- and AA-MAP4 forms were more resistant to influences microtubule properties or cell cycle progression, nocodazole depolymerization than those in cells expressing we prepared stable cell lines that inducibly express versions EE- or WT-MAP4 forms. Our results demonstrate that of MAP4 in which phosphorylation of these two serines was phosphorylation alters MAP4 properties and suggest a prevented by their replacement with alanine, lysine, or raison d’être for phosphorylation of the MAP4 glutamate residues (AA-, KK-, or EE-MAP4). All non- microtubule-binding domain during cell cycle progression. phosphorylatable mutant forms of MAP4 expressed in mouse Ltk- cells were localized to MT arrays that were Key words: Phosphorylation, Microtubule binding, Microtubule unremarkable in appearance. Expression of non- dynamics, Stable microtubules, Mitosis INTRODUCTION directly with cyclin B-cdc2, the major kinase responsible for mitosis-specific phosphorylation of structural proteins (Ookata Microtubules (MTs) are dynamic polymers of tubulin that are et al., 1995). In addition, in vivo phosphorylation of MAP4 by involved in many diverse functions, including spindle cyclin B-cdc2 has been shown to occur at numerous sites formation, vesicle and organelle transport, and cell motility. throughout the molecule (Ookata et al., 1997). Phosphorylation The fact that MTs polymerized in vivo are more dynamic than of MAP4 by cyclin B-cdc2 kinase renders MTs more dynamic those polymerized in vitro (Desai and Mitchison, 1997; Verdé in vitro, apparently by decreasing the frequency of rescue et al., 1990) has been attributed to the actions of cellular factors (Ookata et al., 1995). This mechanism is consistent with the that destabilize MTs, such as Op18 (Belmont et al., 1996; observed in vivo behavior of MTs during mitosis in Larsson et al., 1999), and the opposing action of factors that mammalian cells. stabilize MTs, such as microtubule-associated proteins (MAPs) Mitotic behavior of MAP4 homologs has been studied both (Mandelkow and Mandelkow, 1995; Andersen, 2000). MTs in mammalian cells and in Xenopus. However, the Xenopus undergo a dramatic increase in dynamics during mitosis, MAP4 homolog (XMAP4; XMAP230) (Cha et al., 1999; relative to interphase (Saxton et al., 1984; Hamaguchi et al., Andersen et al., 1994; Shiina et al., 1992) shows only limited 1985), possibly due to activation of MT-destabilizing factors, sequence identity with mammalian MAP4 (~30% sequence deactivation of MT-stabilizing MAPs, or a combination of identity between Xenopus and human MAP4) (Shiina et al., both. MAP4, a 210 kDa MAP present in all proliferating cells, 1999; Andersen, 2000). Other data suggest that there may also binds to and stabilizes MTs both in vitro (e.g. Bulinski and be mechanistic differences between the cellular actions of these Borisy, 1980) and in vivo (e.g. Nguyen et al., 1997). Thus, homologs. For example, XMAP4 was reported to dissociate altered MAP4 activity is a mechanism that might contribute to from MTs during mitotic prophase (Andersen et al., 1994), in increased MT turnover at the mitotic stage (Ookata et al., contrast to mammalian MAP4, which remains associated with 1995). MTs throughout the cell cycle (Bulinski and Borisy, 1980; Consistent with this hypothesis, MAP4’s level of Olson et al., 1995). However, it should be noted that other phosphorylation has been shown to increase at the G2/M investigators (Cha et al., 1999; Shiina et al., 1999) transition (Vandré et al., 1991). In vitro, MAP4 interacts demonstrated continuous association of XMAP4 with MTs 2880 JOURNAL OF CELL SCIENCE 114 (15) during mitosis. Because human MAP4 is a MT-stabilizing and Bulinski, 1991), stained with anti-β-tubulin antibody (3F3, protein that is continuously localized on MTs throughout the courtesy of James Lessard, University of Cincinnati, OH), were cell cycle, we and others have hypothesized that mitosis- scanned with an HP ScanJet 6200C scanner and intensities of each specific phosphorylation of MAP4 toggles its MT stabilizing immunostained band determined with MetaMorph software function during portions of the cell cycle. (Universal Imaging Corp., West Chester, PA). The percentage of Accordingly, we focused on phosphorylation events within tubulin in polymer was defined as the ratio (tubulin in MT polymer sample):(tubulin in total protein extract). MAP4’s MT-binding domain. We previously showed that cyclin B-cdc2 kinase phosphorylates serine-787 in vivo during Analysis of cell growth and phenotype mitosis (Ookata et al., 1997), and that in vitro phosphorylation Cells in 100 mm tissue culture plates, induced with dex, were released by cyclin B-cdc2 is sufficient to reduce MAP4’s capacity to from the substratum with Viokase solution, and counted in a stimulate in vitro polymerization of MTs (Kitazawa et al., haemocytometer before and after an additional 36 hours of growth. 2000). By contrast, we showed that serine-696 is continually Cell cycle stages of each cell line were determined following 36 hours phosphorylated throughout the cell cycle in proliferating cells of dex-induction on coverslips. The coverslips were fixed in ice-cold (Ookata et al., 1997), whereas phosphorylation at this site is methanol for 15 minutes, mounted in the presence of 1 µg/ml DAPI, not detectable in quiescent, serum-starved cells (Srsen et al., and cell cycle stages were determined by scoring GFP-MAP4-labeled 1999). Because we predicted that phosphorylation at sites spindles and DAPI-labeled condensed chromosomes. Fluorescence- activated cell sorting (FACS) was performed as previously described within the MT-binding domain would manifest effects on MT (Nguyen et al., 1999). dynamics, we focused on the function of MAP4 phosphorylation at the serine-696 and -787 sites. Assay of MT stability Following dex induction, cells on coverslips were incubated in medium containing the MT-depolymerizing drug nocodazole (10 µM) MATERIALS AND METHODS for 0-30 minutes at 37°C, washed once with Hanks’ Balanced Salt Solution (HBSS) containing 10 µM nocodazole, and immediately Materials fixed in ice-cold methanol for 15 minutes. GFP-expressing cells were Except as noted, all chemicals were purchased from Sigma (St Louis, scored for the presence of a MT array at each time of nocodazole MO) or from Fisher Scientific (Tustin, CA). All tissue culture treatment. Since all expressing cells showed an extensive MT array materials were from Gibco Life Sciences (Gaithersburg, MD). initially (T=0) and no MTs at T=30, the proportion of expressing lines Immunochemicals were obtained from Organon Teknika (Durham, with a MT array at the 10-minute time point (t=10), when a disparity NC). All restriction enzymes were purchased from Promega Biotech was noted, was quantified. (Madison, WI). Affinity of mutant and wild-type GFP-MAP4 forms for MTs Preparation of stable cell lines overexpressing wild-type Suspension cultures of each stably transfected cell line, induced with and mutant MAP4 1 µM dex for 20-28 hours, were used to prepare Taxol-stabilized MAP4 cDNA was mutated at amino acids serine-696 and serine-787 MTs, as described previously (Chapin et al., 1991). After washing and inserted into pEGFP-C1 vector, modified to be dexamethasone- MT pellets four times in buffer containing 0.1 M PIPES, pH 6.9, 1 inducible. Full-length MAP4 cDNA encoding the five-repeat isoform mM dithiothreitol, 1 mM EGTA and 1 mM MgCl2 (PDEM), the MTs of human MAP4 (isoform IV; Chapin et al., 1995) was mutagenized were resuspended in fresh PDEM plus the applicable concentration using the Muta-Gene in vitro Mutagenesis Kit (Biorad, CA) and the of NaCl (0-0.6 M), incubated for 10 minutes at 37°C, and centrifuged following primers for the S696A/S787A (AA-MAP4) construct: (40,000 g, 15 minutes). Supernatant fractions containing unbound AACAAGGAGCTCCCACCAGCCCCAGAG and TGGCTTGGAT- MAP were assayed by western blotting with guinea pig antibodies GGTGCGGCCCGCTT. Corresponding primers for S696K/S787K prepared against the MT-binding domain of human MAP4 (MTB and S696E/S787E were substituted, respectively, with AAA/TTT and antibody; Nguyen et al., 1997) or to the bacterially expressed proline- GAG/CTC at the positions underlined in the AA-MAP4 primers. All rich domain of murine MAP4 (MuPro antibody; used at 1:1000 mutant and wild-type MAP4 cDNAs were then cut with SmaI and dilution). MAP4 released at each salt concentration was quantified partially digested with BglII, which deleted the N-terminal 669 amino and normalized to that eluted with 0.6 M NaCl, which was set at acids corresponding to the projection domain.
Load more

Recommended publications
  • Specialized Cilia in Mammalian Sensory Systems
    Cells 2015, 4, 500-519; doi:10.3390/cells4030500 OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Review Specialized Cilia in Mammalian Sensory Systems Nathalie Falk, Marlene Lösl, Nadja Schröder and Andreas Gießl * Department of Biology, Animal Physiology, University of Erlangen-Nuremberg, 91058 Erlangen, Germany; E-Mails: [email protected] (N.F.); [email protected] (M.L.); [email protected] (A.G.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +49-9131-85-28055; Fax: +49-9131-85-28060. Academic Editors: Gang Dong and William Tsang Received: 18 May 2015 / Accepted: 9 September 2015 / Published: 11 September 2015 Abstract: Cilia and flagella are highly conserved and important microtubule-based organelles that project from the surface of eukaryotic cells and act as antennae to sense extracellular signals. Moreover, cilia have emerged as key players in numerous physiological, developmental, and sensory processes such as hearing, olfaction, and photoreception. Genetic defects in ciliary proteins responsible for cilia formation, maintenance, or function underlie a wide array of human diseases like deafness, anosmia, and retinal degeneration in sensory systems. Impairment of more than one sensory organ results in numerous syndromic ciliary disorders like the autosomal recessive genetic diseases Bardet-Biedl and Usher syndrome. Here we describe the structure and distinct functional roles of cilia in sensory organs like the inner ear, the olfactory epithelium, and the retina of the mouse. The spectrum of ciliary function in fundamental cellular processes highlights the importance of elucidating ciliopathy-related proteins in order to find novel potential therapies.
    [Show full text]
  • Microtubule Organization and Microtubule- Associated Proteins (Maps)
    Chapter 3 Microtubule Organization and Microtubule- Associated Proteins (MAPs) Elena Tortosa, Lukas C. Kapitein, and Casper C. Hoogenraad Abstract Dendrites have a unique microtubule organization. In vertebrates, den- dritic microtubules are organized in antiparallel bundles, oriented with their plus ends either pointing away or toward the soma. The mixed microtubule arrays control intracellular trafficking and local signaling pathways, and are essential for dendrite development and function. The organization of microtubule arrays largely depends on the combined function of different microtubule regulatory factors or generally named microtubule-associated proteins (MAPs). Classical MAPs, also called structural MAPs, were identified more than 20 years ago based on their ability to bind to and copurify with microtubules. Most classical MAPs bind along the microtubule lattice and regulate microtubule polymerization, bundling, and stabilization. Recent evidences suggest that classical MAPs also guide motor protein transport, interact with the actin cytoskeleton, and act in various neuronal signaling networks. Here, we give an overview of microtubule organization in dendrites and the role of classical MAPs in dendrite development, dendritic spine formation, and synaptic plasticity. Keywords Neuron • Dendrite • Cytoskeleton • Microtubule • Microtubule- associated protein • MAP1 • MAP2 • MAP4 • MAP6 • MAP7 • MAP9 • Tau 3.1 Introduction Microtubules (MTs) are cytoskeletal structures that play essential roles in all eukaryotic cells. MTs are important not only during cell division but also in non-dividing cells, where they are critical structures in numerous cellular processes such as cell motility, migration, differentiation, intracellular transport and organelle positioning. MTs are composed of two proteins, α- and β-tubulin, that form heterodimers and organize themselves in a head-to-tail manner.
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]
  • Genetic Dissection of Intermated Recombinant Inbred Lines Using a New Genetic Map of Maize
    Copyright Ó 2006 by the Genetics Society of America DOI: 10.1534/genetics.106.060376 Genetic Dissection of Intermated Recombinant Inbred Lines Using a New Genetic Map of Maize Yan Fu,*,1 Tsui-Jung Wen,† Yefim I. Ronin,‡ Hsin D. Chen,† Ling Guo,§ David I. Mester,‡ Yongjie Yang,* Michael Lee,† Abraham B. Korol,‡ Daniel A. Ashlock** and Patrick S. Schnable*,†,§,††,2 *Interdepartmental Genetics Graduate Program, Iowa State University, Ames, Iowa 50011, †Department of Agronomy, Iowa State University, Ames, Iowa 50011, ‡Institute of Evolution, University of Haifa, Haifa 31905, Israel, §Bioinformatics and Computational Biology Graduate Program, Iowa State University, Ames, Iowa 50011, **Department of Mathematics and Statistics, University of Guelph, Guelph, Ontario N1G 2W1, Canada and ††Center for Plant Genomics, Iowa State University, Ames, Iowa 50011-3467 Manuscript received July 6, 2006 Accepted for publication August 21, 2006 ABSTRACT A new genetic map of maize, ISU–IBM Map4, that integrates 2029 existing markers with 1329 new indel polymorphism (IDP) markers has been developed using intermated recombinant inbred lines (IRILs) from the intermated B73 3 Mo17 (IBM) population. The website http://magi.plantgenomics.iastate.edu pro- vides access to IDP primer sequences, sequences from which IDP primers were designed, optimized marker- specific PCR conditions, and polymorphism data for all IDP markers. This new gene-based genetic map will facilitate a wide variety of genetic and genomic research projects, including map-based genome sequencing and gene cloning. The mosaic structures of the genomes of 91 IRILs, an important resource for identifying and mapping QTL and eQTL, were defined. Analyses of segregation data associated with markers genotyped in three B73/Mo17-derived mapping populations (F2, Syn5, and IBM) demonstrate that allele frequencies were significantly altered during the development of the IBM IRILs.
    [Show full text]
  • T611384 Anti-MAP4 Rabbit Pab
    T611384 Anti-MAP4 Rabbit pAb Order 021-34695924 [email protected] Support 400-6123-828 50ul [email protected] 100 uL √ √ Web www.ab-mart.com.cn Product Information Description MAP4 rabbit polyclonal Protein full name Microtubule-associated protein 4 Synonyms MAP-4, Map4, Mtap4, DKFZp779A1753, MGC8617 Immunogen Recombinant protein corresponding to Mouse MAP4 Isotype IgG Purity Affinity purification Subcellular location Cytoplasm Uniprot ID P27816, P27546 Applications Applications IHC Species Human, Mouse Dilution 1: 1000-1: 2000 Positive Tissue lung cancer, colon cancer, ovary cancer, spleen, kidney Background The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule- associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Images Immunohistochemistry analysis of paraffin-embedded human lung cancer using MAP4 (T611384M) at dilution of 1: 1900 Immunohistochemistry analysis of paraffin-embedded human colon cancer using MAP4 (T611384M) at dilution of 1: 1900 Immunohistochemistry analysis of paraffin-embedded human ovary cancer using MAP4 (T611384M) at dilution of 1: 1900 Immunohistochemistry analysis of paraffin-embedded human ovary cancer using MAP4 (T611384M) at dilution of 1: 1900 Immunohistochemistry analysis of paraffin-embedded mouse spleen using MAP4 (T611384M) at dilution of 1: 1900 Immunohistochemistry analysis of paraffin-embedded mouse kidney using MAP4 (T611384M) at dilution of 1: 1900 Storage Storage Store at -20 ℃ for one year.
    [Show full text]
  • The MAP2/Tau Family of Microtubule-Associated Proteins Comment Leif Dehmelt and Shelley Halpain
    Protein family review The MAP2/Tau family of microtubule-associated proteins comment Leif Dehmelt and Shelley Halpain Address: Department of Cell Biology, The Scripps Research Institute and Institute for Childhood and Neglected Diseases, 10550 North Torrey Pines Rd, La Jolla, CA 92037, USA. Correspondence: Shelley Halpain. E-mail: [email protected] reviews Published: 23 December 2004 Genome Biology 2004, 6:204 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2004/6/1/204 © 2004 BioMed Central Ltd reports Summary Microtubule-associated proteins (MAPs) of the MAP2/Tau family include the vertebrate proteins MAP2, MAP4, and Tau and homologs in other animals. All three vertebrate members of the family have alternative splice forms; all isoforms share a conserved carboxy-terminal domain containing microtubule-binding repeats, and an amino-terminal projection domain of varying size. deposited research MAP2 and Tau are found in neurons, whereas MAP4 is present in many other tissues but is generally absent from neurons. Members of the family are best known for their microtubule- stabilizing activity and for proposed roles regulating microtubule networks in the axons and dendrites of neurons. Contrary to this simple, traditional view, accumulating evidence suggests a much broader range of functions, such as binding to filamentous (F) actin, recruitment of signaling proteins, and regulation of microtubule-mediated transport. Tau is also implicated in Alzheimer’s disease and other dementias. The ability of MAP2 to interact with both microtubules and F-actin might be critical for neuromorphogenic processes, such as neurite initiation, during which refereed research networks of microtubules and F-actin are reorganized in a coordinated manner.
    [Show full text]
  • Transposon Mutagenesis Identifies Genetic Drivers of Brafv600e Melanoma
    ARTICLES Transposon mutagenesis identifies genetic drivers of BrafV600E melanoma Michael B Mann1,2, Michael A Black3, Devin J Jones1, Jerrold M Ward2,12, Christopher Chin Kuan Yew2,12, Justin Y Newberg1, Adam J Dupuy4, Alistair G Rust5,12, Marcus W Bosenberg6,7, Martin McMahon8,9, Cristin G Print10,11, Neal G Copeland1,2,13 & Nancy A Jenkins1,2,13 Although nearly half of human melanomas harbor oncogenic BRAFV600E mutations, the genetic events that cooperate with these mutations to drive melanogenesis are still largely unknown. Here we show that Sleeping Beauty (SB) transposon-mediated mutagenesis drives melanoma progression in BrafV600E mutant mice and identify 1,232 recurrently mutated candidate cancer genes (CCGs) from 70 SB-driven melanomas. CCGs are enriched in Wnt, PI3K, MAPK and netrin signaling pathway components and are more highly connected to one another than predicted by chance, indicating that SB targets cooperative genetic networks in melanoma. Human orthologs of >500 CCGs are enriched for mutations in human melanoma or showed statistically significant clinical associations between RNA abundance and survival of patients with metastatic melanoma. We also functionally validate CEP350 as a new tumor-suppressor gene in human melanoma. SB mutagenesis has thus helped to catalog the cooperative molecular mechanisms driving BRAFV600E melanoma and discover new genes with potential clinical importance in human melanoma. Substantial sun exposure and numerous genetic factors, including including BrafV600E, recapitulate the genetic and histological hallmarks skin type and family history, are the most important melanoma risk of human melanoma. In these models, increased MEK-ERK signaling factors. Familial melanoma, which accounts for <10% of cases, is asso- initiates clonal expansion of melanocytes, which is limited by oncogene- ciated with mutations in CDKN2A1, MITF2 and POT1 (refs.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Genomic Variants Within Chromosome 14Q32.32 Regulate Bone Mass Through MARK3 Signaling in Osteoblasts
    Genomic variants within chromosome 14q32.32 regulate bone mass through MARK3 signaling in osteoblasts Qian Zhang, … , Charles R. Farber, Thomas L. Clemens J Clin Invest. 2021;131(7):e142580. https://doi.org/10.1172/JCI142580. Research Article Bone Biology Bone mineral density (BMD) is a highly heritable predictor of osteoporotic fracture. GWAS have identified hundreds of loci influencing BMD, but few have been functionally analyzed. In this study, we show that SNPs within a BMD locus on chromosome 14q32.32 alter splicing and expression of PAR-1a/microtubule affinity regulating kinase 3 (MARK3), a conserved serine/threonine kinase known to regulate bioenergetics, cell division, and polarity. Mice lacking Mark3 either globally or selectively in osteoblasts have increased bone mass at maturity. RNA profiling from Mark3-deficient osteoblasts suggested changes in the expression of components of the Notch signaling pathway. Mark3-deficient osteoblasts exhibited greater matrix mineralization compared with controls that was accompanied by reduced Jag1/Hes1 expression and diminished downstream JNK signaling. Overexpression of Jag1 in Mark3-deficient osteoblasts both in vitro and in vivo normalized mineralization capacity and bone mass, respectively. Together, these findings reveal a mechanism whereby genetically regulated alterations in Mark3 expression perturb cell signaling in osteoblasts to influence bone mass. Find the latest version: https://jci.me/142580/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Genomic variants within chromosome 14q32.32 regulate bone mass through MARK3 signaling in osteoblasts Qian Zhang,1,2 Larry D. Mesner,3 Gina M. Calabrese,3 Naomi Dirckx,1 Zhu Li,1,2 Angela Verardo,1 Qian Yang,1 Robert J.
    [Show full text]
  • The Microtubule Skeleton and the Evolution of Neuronal Complexity in Vertebrates
    Biol. Chem. 2019; 400(9): 1163–1179 Nataliya I. Trushina, Armen Y. Mulkidjanian and Roland Brandt* The microtubule skeleton and the evolution of neuronal complexity in vertebrates https://doi.org/10.1515/hsz-2019-0149 Received February 4, 2019; accepted April 17, 2019; previously Introduction published online May 22, 2019 The complexity of the nervous system permits the devel- Abstract: The evolution of a highly developed nervous opment of sophisticated behavioral repertoires, such as system is mirrored by the ability of individual neurons to language, tool use, self-awareness, symbolic thought, develop increased morphological complexity. As microtu- cultural learning and consciousness. The basis for the bules (MTs) are crucially involved in neuronal development, development of such a complexity is a high neuronal het- we tested the hypothesis that the evolution of complexity is erogeneity caused by neuronal diversification on the one driven by an increasing capacity of the MT system for regu- hand and a large interconnectivity between the individual lated molecular interactions as it may be implemented by neurons on the other hand (Muotri and Gage, 2006). In a higher number of molecular players and a greater ability addition, the brain constantly needs to adapt to func- of the individual molecules to interact. We performed bio- tional challenges of various kinds during development informatics analysis on different classes of components of and adulthood by a process called neural plasticity (Zilles, the vertebrate neuronal MT cytoskeleton. We show that the 1992). At a single cell level, neural plasticity involves number of orthologs of tubulin structure proteins, MT-bind- changes in the number or the strength of synaptic con- ing proteins and tubulin-sequestering proteins expanded tacts between individual neurons thereby changing the during vertebrate evolution.
    [Show full text]
  • An Evolutionary Roadmap to the Microtubule-Associated Protein MAP Tau Frederik Sündermann1, Maria-Pilar Fernandez2 and Reginald O
    Sündermann et al. BMC Genomics (2016) 17:264 DOI 10.1186/s12864-016-2590-9 RESEARCH ARTICLE Open Access An evolutionary roadmap to the microtubule-associated protein MAP Tau Frederik Sündermann1, Maria-Pilar Fernandez2 and Reginald O. Morgan2* Abstract Background: The microtubule associated protein Tau (MAPT) promotes assembly and interaction of microtubules with the cytoskeleton, impinging on axonal transport and synaptic plasticity. Its neuronal expression and intrinsic disorder implicate it in some 30 tauopathies such as Alzheimer’s disease and frontotemporal dementia. These pathophysiological studies have yet to be complemented by computational analyses of its molecular evolution and structural models of all its functional domains to explain the molecular basis for its conservation profile, its site-specific interactions and the propensity to conformational disorder and aggregate formation. Results: We systematically annotated public sequence data to reconstruct unspliced MAPT, MAP2 and MAP4 transcripts spanning all represented genomes. Bayesian and maximum likelihood phylogenetic analyses, genetic linkage maps and domain architectures distinguished a nonvertebrate outgroup from the emergence of MAP4 and its subsequent ancestral duplication to MAP2 and MAPT. These events were coupled to other linked genes such as KANSL1L and KANSL and may thus be consequent to large-scale chromosomal duplications originating in the extant vertebrate genomes of hagfish and lamprey. Profile hidden Markov models (pHMMs), clustered subalignments and 3D structural predictions defined potential interaction motifs and specificity determining sites to reveal distinct signatures between the four homologous microtubule binding domains and independent divergence of the amino terminus. Conclusion: These analyses clarified ambiguities of MAPT nomenclature, defined the order, timing and pattern of its molecular evolution and identified key residues and motifs relevant to its protein interaction properties and pathogenic role.
    [Show full text]
  • 1 Genetic Dissection of Intermated Recombinant Inbred Lines Using A
    Genetics: Published Articles Ahead of Print, published on September 1, 2006 as 10.1534/genetics.106.060376 1 Genetic dissection of intermated recombinant inbred lines using a new genetic map of maize that includes 1,329 novel PCR-based genic markers Yan Fu*2, Tsui-Jung Wen†, Yefim I. Ronin‡, Hsin D. Chen†, Ling Guo§, David I. Mester‡, Yongjie Yang*, Michael Lee†, Abraham B. Korol‡, Daniel A. Ashlock¶, Patrick S. Schnable*†§||,1 *Interdepartmental Genetics Graduate Program, Iowa State University, Ames, IA 50011, USA †Department of Agronomy, Iowa State University, Ames, IA 50011, USA ‡Institute of Evolution, University of Haifa, Haifa 31905, Israel §Bioinformatics and Computational Biology Graduate Program, Iowa State University, Ames, IA 50011, USA ¶Department of Mathematics and Statistics, University of Guelph, ON Canada N1G 2W1 ||Center for Plant Genomics, Iowa State University, Ames, IA 50011-3467, USA 1Corresponding author 2Present address: Donald Danforth Plant Science Center, St. Louis, MO 63132 Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under accession nos. DQ207642~DQ207725. 2 Running Head Title: Maize genetic map and IRILs Key words: genetic map, recombinant inbred lines, gametic disequilibrium, QTL mapping, segregation distortion To whom correspondence should be addressed: Patrick S. Schnable, 2035B Roy J. Carver Co-Laboratory, Iowa State University, Ames, IA 50011-3650, USA Voice: 515-294-0975 Fax: 515-294-5256 E-mail: [email protected] 3 ABSTRACT A new genetic map of maize, ISU-IBM Map4, that integrates 2,029 existing markers with 1,329 new InDel Polymorphism (IDP) markers has been developed using Intermated Recombinant Inbred Lines (IRILs) from the Intermated B73xMo17 (IBM) population.
    [Show full text]