RESEARCH ARTICLE 2879 Phosphorylation of MAP4 affects microtubule properties and cell cycle progression Winston Chang1,2, Dorota Gruber1, Sripriya Chari2, Hidefumi Kitazawa3, Yuko Hamazumi3, Shin-ichi Hisanaga3 and J. Chloë Bulinski1,2,* 1Departments of Biological Sciences, Anatomy & Cell Biology, and Pathology, Colleges of Arts & Sciences and Physicians & Surgeons, Columbia University, 1212 Amsterdam Avenue, New York, NY 10027-2450, USA 2Integrated Program in Cell, Molecular & Biophysical Studies, College of Physicians & Surgeons, Columbia University, 1212 Amsterdam Avenue, New York, NY 10027-2450, USA 3Department of Biological Sciences, Graduate School of Science, Tokyo Metropolitan University, 1-1 Minami-ohsawa, Hachiohji, Tokyo 192-0397, Japan *Author for correspondence (e-mail: [email protected]) Accepted 02 May 2001 Journal of Cell Science 114, 2879-2887 (2001) © The Company of Biologists Ltd SUMMARY phosphorylatable mutants of MAP4 did not affect cell doubling time; however, expression of some mutants In human cells, MAP4, a microtubule-associated protein altered progression into or through cell division. ubiquitously expressed in proliferating cells, has been Interactions of mutant MAP4 with MTs were examined in shown to undergo in vivo phosphorylation. Two vitro. KK mutant MAP4 bound MTs more avidly than its phosphorylation sites, serines 696 and 787, lie within the wild-type counterpart, WT-MAP4. In vivo MT polymer proline-rich region of its microtubule-binding domain. To also differed among the mutants: MTs in cells expressing test the hypothesis that phosphorylation at these sites the KK- and AA-MAP4 forms were more resistant to influences microtubule properties or cell cycle progression, nocodazole depolymerization than those in cells expressing we prepared stable cell lines that inducibly express versions EE- or WT-MAP4 forms. Our results demonstrate that of MAP4 in which phosphorylation of these two serines was phosphorylation alters MAP4 properties and suggest a prevented by their replacement with alanine, lysine, or raison d’être for phosphorylation of the MAP4 glutamate residues (AA-, KK-, or EE-MAP4). All non- microtubule-binding domain during cell cycle progression. phosphorylatable mutant forms of MAP4 expressed in mouse Ltk- cells were localized to MT arrays that were Key words: Phosphorylation, Microtubule binding, Microtubule unremarkable in appearance. Expression of non- dynamics, Stable microtubules, Mitosis INTRODUCTION directly with cyclin B-cdc2, the major kinase responsible for mitosis-specific phosphorylation of structural proteins (Ookata Microtubules (MTs) are dynamic polymers of tubulin that are et al., 1995). In addition, in vivo phosphorylation of MAP4 by involved in many diverse functions, including spindle cyclin B-cdc2 has been shown to occur at numerous sites formation, vesicle and organelle transport, and cell motility. throughout the molecule (Ookata et al., 1997). Phosphorylation The fact that MTs polymerized in vivo are more dynamic than of MAP4 by cyclin B-cdc2 kinase renders MTs more dynamic those polymerized in vitro (Desai and Mitchison, 1997; Verdé in vitro, apparently by decreasing the frequency of rescue et al., 1990) has been attributed to the actions of cellular factors (Ookata et al., 1995). This mechanism is consistent with the that destabilize MTs, such as Op18 (Belmont et al., 1996; observed in vivo behavior of MTs during mitosis in Larsson et al., 1999), and the opposing action of factors that mammalian cells. stabilize MTs, such as microtubule-associated proteins (MAPs) Mitotic behavior of MAP4 homologs has been studied both (Mandelkow and Mandelkow, 1995; Andersen, 2000). MTs in mammalian cells and in Xenopus. However, the Xenopus undergo a dramatic increase in dynamics during mitosis, MAP4 homolog (XMAP4; XMAP230) (Cha et al., 1999; relative to interphase (Saxton et al., 1984; Hamaguchi et al., Andersen et al., 1994; Shiina et al., 1992) shows only limited 1985), possibly due to activation of MT-destabilizing factors, sequence identity with mammalian MAP4 (~30% sequence deactivation of MT-stabilizing MAPs, or a combination of identity between Xenopus and human MAP4) (Shiina et al., both. MAP4, a 210 kDa MAP present in all proliferating cells, 1999; Andersen, 2000). Other data suggest that there may also binds to and stabilizes MTs both in vitro (e.g. Bulinski and be mechanistic differences between the cellular actions of these Borisy, 1980) and in vivo (e.g. Nguyen et al., 1997). Thus, homologs. For example, XMAP4 was reported to dissociate altered MAP4 activity is a mechanism that might contribute to from MTs during mitotic prophase (Andersen et al., 1994), in increased MT turnover at the mitotic stage (Ookata et al., contrast to mammalian MAP4, which remains associated with 1995). MTs throughout the cell cycle (Bulinski and Borisy, 1980; Consistent with this hypothesis, MAP4’s level of Olson et al., 1995). However, it should be noted that other phosphorylation has been shown to increase at the G2/M investigators (Cha et al., 1999; Shiina et al., 1999) transition (Vandré et al., 1991). In vitro, MAP4 interacts demonstrated continuous association of XMAP4 with MTs 2880 JOURNAL OF CELL SCIENCE 114 (15) during mitosis. Because human MAP4 is a MT-stabilizing and Bulinski, 1991), stained with anti-β-tubulin antibody (3F3, protein that is continuously localized on MTs throughout the courtesy of James Lessard, University of Cincinnati, OH), were cell cycle, we and others have hypothesized that mitosis- scanned with an HP ScanJet 6200C scanner and intensities of each specific phosphorylation of MAP4 toggles its MT stabilizing immunostained band determined with MetaMorph software function during portions of the cell cycle. (Universal Imaging Corp., West Chester, PA). The percentage of Accordingly, we focused on phosphorylation events within tubulin in polymer was defined as the ratio (tubulin in MT polymer sample):(tubulin in total protein extract). MAP4’s MT-binding domain. We previously showed that cyclin B-cdc2 kinase phosphorylates serine-787 in vivo during Analysis of cell growth and phenotype mitosis (Ookata et al., 1997), and that in vitro phosphorylation Cells in 100 mm tissue culture plates, induced with dex, were released by cyclin B-cdc2 is sufficient to reduce MAP4’s capacity to from the substratum with Viokase solution, and counted in a stimulate in vitro polymerization of MTs (Kitazawa et al., haemocytometer before and after an additional 36 hours of growth. 2000). By contrast, we showed that serine-696 is continually Cell cycle stages of each cell line were determined following 36 hours phosphorylated throughout the cell cycle in proliferating cells of dex-induction on coverslips. The coverslips were fixed in ice-cold (Ookata et al., 1997), whereas phosphorylation at this site is methanol for 15 minutes, mounted in the presence of 1 µg/ml DAPI, not detectable in quiescent, serum-starved cells (Srsen et al., and cell cycle stages were determined by scoring GFP-MAP4-labeled 1999). Because we predicted that phosphorylation at sites spindles and DAPI-labeled condensed chromosomes. Fluorescence- activated cell sorting (FACS) was performed as previously described within the MT-binding domain would manifest effects on MT (Nguyen et al., 1999). dynamics, we focused on the function of MAP4 phosphorylation at the serine-696 and -787 sites. Assay of MT stability Following dex induction, cells on coverslips were incubated in medium containing the MT-depolymerizing drug nocodazole (10 µM) MATERIALS AND METHODS for 0-30 minutes at 37°C, washed once with Hanks’ Balanced Salt Solution (HBSS) containing 10 µM nocodazole, and immediately Materials fixed in ice-cold methanol for 15 minutes. GFP-expressing cells were Except as noted, all chemicals were purchased from Sigma (St Louis, scored for the presence of a MT array at each time of nocodazole MO) or from Fisher Scientific (Tustin, CA). All tissue culture treatment. Since all expressing cells showed an extensive MT array materials were from Gibco Life Sciences (Gaithersburg, MD). initially (T=0) and no MTs at T=30, the proportion of expressing lines Immunochemicals were obtained from Organon Teknika (Durham, with a MT array at the 10-minute time point (t=10), when a disparity NC). All restriction enzymes were purchased from Promega Biotech was noted, was quantified. (Madison, WI). Affinity of mutant and wild-type GFP-MAP4 forms for MTs Preparation of stable cell lines overexpressing wild-type Suspension cultures of each stably transfected cell line, induced with and mutant MAP4 1 µM dex for 20-28 hours, were used to prepare Taxol-stabilized MAP4 cDNA was mutated at amino acids serine-696 and serine-787 MTs, as described previously (Chapin et al., 1991). After washing and inserted into pEGFP-C1 vector, modified to be dexamethasone- MT pellets four times in buffer containing 0.1 M PIPES, pH 6.9, 1 inducible. Full-length MAP4 cDNA encoding the five-repeat isoform mM dithiothreitol, 1 mM EGTA and 1 mM MgCl2 (PDEM), the MTs of human MAP4 (isoform IV; Chapin et al., 1995) was mutagenized were resuspended in fresh PDEM plus the applicable concentration using the Muta-Gene in vitro Mutagenesis Kit (Biorad, CA) and the of NaCl (0-0.6 M), incubated for 10 minutes at 37°C, and centrifuged following primers for the S696A/S787A (AA-MAP4) construct: (40,000 g, 15 minutes). Supernatant fractions containing unbound AACAAGGAGCTCCCACCAGCCCCAGAG and TGGCTTGGAT- MAP were assayed by western blotting with guinea pig antibodies GGTGCGGCCCGCTT. Corresponding primers for S696K/S787K prepared against the MT-binding domain of human MAP4 (MTB and S696E/S787E were substituted, respectively, with AAA/TTT and antibody; Nguyen et al., 1997) or to the bacterially expressed proline- GAG/CTC at the positions underlined in the AA-MAP4 primers. All rich domain of murine MAP4 (MuPro antibody; used at 1:1000 mutant and wild-type MAP4 cDNAs were then cut with SmaI and dilution). MAP4 released at each salt concentration was quantified partially digested with BglII, which deleted the N-terminal 669 amino and normalized to that eluted with 0.6 M NaCl, which was set at acids corresponding to the projection domain.