The Mating System, Genetic Variability and Genetic Relationships Between Centrosema Species

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/257567338

Molecular diversity, genetic structure and mating system of Calopogonium mucunoides Desv

Article in Genetic Resources and Crop Evolution · February 2012 DOI: 10.1007/s10722-011-9773-7

CITATIONS READS 5 272

7 authors, including:

Adna Sousa Tatiana Campos Universidade Federal da Paraíba University of Campinas

50 PUBLICATIONS 454 CITATIONS 51 PUBLICATIONS 549 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Genomic studies in Urochloa humidicola, a tropical perennial grass View project

GENETIC DIVERSITY AS A STRATEGY FOR THE MANAGEMENT AND USE OF GERMPLASM OF Vitis sp. OF THE AGRONOMIC INSTITUTE - IAC View project

All content following this page was uploaded by Marcelo Ayres Carvalho on 29 May 2014.

The user has requested enhancement of the downloaded file. Euphytica DOI 10.1007/s10681-011-0415-0

Genetic studies in Centrosema pubescens benth, a tropical forage legume: the mating system, genetic variability and genetic relationships between Centrosema species

A. C. B. Sousa • M. A. Carvalho • A. K. B. Ramos • T. Campos • D. A. Sforc¸a • M. I. Zucchi • L. Jank • A. P. Souza

Received: 11 December 2010 / Accepted: 16 March 2011 Springer Science+Business Media B.V. 2011

Abstract In this study, we used microsatellite loci to occurs in related individuals. A paternity correlation of estimate the outcrossing rate of Centrosema pubescens 14% suggests that there is a low probability of finding in open-pollinated populations of 10 progenies that full sibs in the progeny. Cross-amplification of the 26 each contained 20 genotypes. The multilocus outcross- microsatellite loci available for C. pubescens was ing rate was 27%, which suggested a mixed mating evaluated across 11 different Centrosema species. system with a predominance of autogamy. The single Nineteen of the 26 tested microsatellites were success- locus outcrossing rate was 13%. The difference was fully transferable across the Centrosema species. The 0.040, which indicated that only 4% of outcrossing polymorphism information content and discriminating power evaluated had averages of 0.64 and 0.77, respectively. A total of three clusters were assembled A. C. B. Sousa T. Campos D. A. Sforça to demonstrate the genetic relationships between A. P. Souza (&) Centrosema species. The transferable microsatellite Genetic Engineering and Molecular Biology Center loci should be useful for exploiting the genetic (CBMEG), University of Campinas (UNICAMP), CP 6010, Campinas, SP CEP 13083-970, Brazil resources of the Centrosema species and determining e-mail: [email protected] the outcrossing rate, which are essential for proposing effective approaches for conservation and for estab- M. A. Carvalho A. K. B. Ramos lishing strategies for the selection and improvement of Brazilian Agricultural Research Corporation, EMBRAPA Cerrados, BR 020, Km 18, Planaltina, Centrosema spp. DF CEP 73310-970, Brazil Keywords Tropical legume Cross-amplification M. I. Zucchi Mating system Autogamy Agronomic Institute of Campinas, Po´lo Apta Centro Sul, Rod. SP 127 Km 30, CP 28, Piracicaba, SP CEP 13400-970, Brazil Introduction L. Jank Forage Breeding Department, Brazilian Agricultural Research Corporation, EMBRAPA Beef Cattle, The genus Centrosema (DC.) Benth belongs to the CP 154, Campo Grande, MS CEP 79002-970, Brazil family Fabaceae (alt. Leguminosae), the subfamily Faboideae and the tribe Phaseoleae. The genus is A. P. Souza composed of 34 species that are native to Central and Plant Biology Department (DBV), Biology Institute, University of Campinas (UNICAMP), CP 6109, South America (Williams and Clements 1990). Campinas, SP CEP 13083-970, Brazil Several Centrosema species occur naturally in Brazil 123 Euphytica where wide genetic diversity is found (Schultze-Kraft that microsatellites can be transferred from one genera/ and Clements 1990). Centrosema includes species species to another (Eujayl et al. 2004; Gutierrez et al. that can adapt to diverse habitats such as the dry 2005). In addition to being applicable to genetic tropics, high-altitude tropics, subtropics, poorly diversity, genetic mapping, and marker-assisted selec- drained and seasonally flooded areas and acidic, tion, microsatellites are useful for estimating the low-fertility soils (Keller-Grein et al. 2000). Because mating systems in plants (Varshney et al. 2005). of this adaptability, Centrosema has been agronom- Centrosema is assumed to be a predominantly self- ically evaluated in Brazil (Borges 2006), Nigeria pollinating genus, although insect cross-pollination has (Odeyinka et al. 2008), Columbia (Keller-Grein et al. been reported in C. brasilianum with outcrossing rates 2000) Australia (Schultze-Kraft et al. 1997), Asia ranging from 31.2 to 53.5% (Maass and Torres 1992). (Humphreys et al. 1990) and Peru (Rea`tegui et al. However, the reproductive system of other Centrosema 1985). Of the promising fodder crop species of species has not been clearly elucidated. This informa- Centrosema, three are of interest in the tropical and tion is essential for proposing effective approaches for subtropical areas of America: C. pubescens (Centro- conservation and for establishing strategies for selec- sema molle Mart. Ex Benth), C. acutifolium and tion and improvement. In this study, we used C. C. brasilianum. The chromosome number for these pubescens-specific microsatellite markers to assess three species is 2n = 2x = 22 (Novaes and Penteado cross-transferability in 11 different Centrosema species 1993), whereas numbers of 2n = 2x = 18 and 20 and to estimate the outcrossing rate in C. pubescens. have been reported in other species of this genus (Battistin and Vargas 1989; Miles et al. 1990). In addition to the currently cultivated species, the Material and methods genus Centrosema includes other promising species that may be used as pasture crops. However, genetic Plant material knowledge in Centrosema is still limited and has restricted their domestication and exploitation in Twelve Centrosema species: C. pubescens, C. pascuo- breeding programs. Advancing the knowledge in this rum, C. brachypodum, C. brasilianum, C. rotundifoli- area will require the application of genomic tools such um, C. acutifolium, C. terezae, C. arenarium, as molecular markers. In C. pubescens, 26 polymorphic C. tetragonolobum, C. macrocarpum, C. plumieri, microsatellite loci have been reported (Sousa et al. and C. sagittatum were used in this study (Table 1). 2009). These accessions were obtained from the Cerrados Microsatellite loci are short (1–6 bp) tandem repeat Research Center Germplasm Bank of the Brazilian DNA sequences that are dispersed randomly through- Agricultural Research Corporation—EMBRAPA, out the genome. Replication slippage or unequal Distrito Federal—Brası´lia, Brazil and the Instituto de crossing over events produce variation in the number Zootecnia, Saõ Paulo—Nova Odessa, Brazil. of repeat motifs, and these loci thus represent hyper- variable regions of the genome. These regions are Microsatellite loci highly polymorphic, codominant and can result in high rates of transferability across species (Gaitań-Solı´s Twenty-six microsatellite loci were selected for this et al. 2002). study based on the primer sequences used previously in The cross-amplification of microsatellite loci C. pubescens (Sousa et al. 2009). The lengths of these among closely related species depends on the extent microsatellites varied from 18 to 22 nucleotides, and of homology and sequence conservation in regions the product lengths varied from 165 to 298 bp. Primers flanking the simple sequence repeats. A high rate of were synthesized by Invitrogen, CA, USA. transferability has already been documented in plant species. Cross-amplification of microsatellites in DNA extraction, polymerase chain reaction closely related Oryza species has been reported (Wu (PCR) amplification and genotyping and Tanksley 1993). Choumane et al. (2000) reported the conservation of microsatellite loci in different taxa Genomic DNA was extracted from freeze-dried leaf of Fabaceae. In legumes, several reports have shown samples using the cetyltrimethylammonium bromide 123 Euphytica

Table 1 Centrosema species and their respective accession Taq DNA Polymerase (Invitrogen, CA, USA). All numbers PCR amplifications were performed in a PTC-200 Name species Accession no. thermal cycler (MJ Research, Waltham, MA/USA) using the touchdown PCR parameters: 94C for a 1 Centrosema pubescens CPAC 4205 2 min; 2x [15 cycles of 94C for 1 min, 60C(-1C/ a 2 Centrosema pubescens CPAC 4247 cycle) for 1 min and 72C for 2 min]; 30 cycles of a 3 Centrosema pubescens CPAC 4250 94C for 1 min, 48C for 1 min and 72C for 2 min; a Centrosema pubescens CPAC 4251 and 72C for 5 min (Don et al. 1991). Amplification a Centrosema pubescens CPAC 4252 products were genotyped by electrophoresis on 6% a Centrosema pubescens CPAC 4253 denaturing polyacrylamide gels in 19 TBE buffer Centrosema pubescensa CPAC 4254 using a 10 bp ladder (Invitrogen, CA, USA) as a size Centrosema pubescensa CPAC 4255 standard. The DNA fragments were visualized by Centrosema pubescensa CPAC 4256 silver staining according to Creste et al. (2001). Centrosema pubescensa CPAC 4257 4 Centrosema pascuorum CPAC 2945 5 Centrosema pascuorum CPAC 2955 Allele scoring and data analysis 6 Centrosema. brachypodum CIAT 5833 7 Centrosema. brachypodum CIAT 5850 Polymorphism information content (PIC) values were 8 Centrosema brasilianum CIAT 5234 calculated for estimates of marker informativeness 9 Centrosema brasilianum CIAT 5178 according to the equation of Botstein et al. (1980), 10 Centrosema rotundifolium CIAT 2560 Xn Xn¼1 Xn 2 2 2 11 Centrosema rotundifolium CPAC 2661 PIC ¼ 1 fi 2fi fj 12 Centrosema acutifolium CIAT 15086 i¼1 i¼1 j¼jþ1 13 Centrosema acutifolium CIAT 15448 where fi is the frequency of the ith allele, fj is the b 14 Centrosema terezae CPAC 4526 frequency of the jth allele and the summation extends 15 Centrosema arenarium CIAT 5236 over n alleles. In order to compare marker efficiencies 16 Centrosema arenarium CIAT 5599 in varietal identification, the discriminating power 17 Centrosema tetragonolobum CIAT 15087 (D) was estimated for each primer based on the 18 Centrosema tetragonolobum CIAT 15440 formula, 19 Centrosema macrocarpum CIAT 5593 X1 Np 1 20 Centrosema macrocarpum CIAT 5447 D ¼ 1 p j k j N 21 Centrosema plumieri NO 2418 j¼1 1 22 Centrosema sagittatum BRA 7595 N p 23 Centrosema sagittatum BRA7864 where is the number of individuals and j is the frequency of the jth pattern (Tessier et al. 1999). a Maternal plants selected for the progeny array The observed heterozygosity (HO) and the expected b Nomen nudum (not a described species) heterozygosity (HE) were analyzed using GDA soft- CPAC Brazilian agricultural research corporation— ware (Lewis and Zaykin 2002). Genetic distance was EMBRAPA Cerrados, NO nova odessa, BRA accession calculated from microsatellite loci data using modified number of the Brazilian agricultural research corporation, CIAT international center for tropical agriculture Roger’s genetic distances. A genetic distance matrix was estimated using tools for genetic population (CTAB) method of Doyle and Doyle (1990). DNA analysis (TFPGA v 1.3) (Miller 1997). Cluster analysis samples were quantified by comparison with known was performed using the neighbor-joining (NJ) method quantities of k phage DNA on a 1% agarose gel. with the DARwin v. 5.0.157 software (Perrier and PCR was carried out in a total reaction volume of Jacquemound-Collet 2006). The reliability of the 25 lL, which contained 0.5 ng of DNA template, generated dendrogram was also tested by bootstrap 0.8 lM of each forward and reverse primers, 100 lM analysis using the BooD program with 1000 iterations of each dNTP (MBI Fermentas, MD, USA), 1.5 mM (Coelho 2002). STRUCTURE version 2.2 software

MgCl2, 10 mM Tris–HCl, 50 mM KCl, and 0.5 U of was used to generate a Bayesian inference of 123 Euphytica population structure (Pritchard et al. 2000). With this standard errors of the reported estimates were calcu- method, a model of K populations is assumed, and lated based on 10,000 bootstrap resamplings of the samples are grouped in order to minimize linkage progenies. disequilibrium and to maximize conformity to Hardy– Weinberg equilibrium across all analyzed loci. As a preliminary step, an analysis was performed once for Results and discussion each K value ranging from 2 to 20. Each run was performed using the admixture model and 1,000 Cross-amplification and polymorphism replicates for burn-in and 10,000 replicates during of microsatellite markers in Centrosema species analysis. The most probable value of K was calculated based on Evanno et al. (2005) using an ad hoc statistic To evaluate cross-species amplification, we screened DK, which represents the rate of change in the log 20 accessions of 11 different Centrosema species. Of probability of the data between successive K values the 26 C. pubescens-specific microsatellite loci that rather than the log probability of the data. were assessed, 19 were amplified in at least 1 Centrosema species, whereas 7 were not amplified in Mating system determination any of the 11 Centrosema species. Table 2 displays the name of the locus, GenBank accession number, repeat Fifteen accessions of C. pubescens from the Germ- motif, primer sequences (forward and reverse), anneal- plasm Bank of Embrapa Cerrados were grown in the ing temperature, allele number, product length and the field under natural conditions to obtain maternal source for these microsatellite loci. We observed that progenies (Table 1). From these 15 accessions, 10 the transferability of these microsatellites across were randomly chosen for the progeny array. Polli- species varied. Two microsatellite loci (CS45 and nated seeds from the 10 maternal plants were grown in CS71) were amplified in all Centrosema species the year of 2009, and 20 plants per progeny were (Table 3). Transferability among Centrosema species evaluated for a total of 200 accessions for each species. was determined to be 55% for two microsatellites The mating system was analyzed according to the (CS70 and CS128), 33.3% for four microsatellites mixed mating model of Ritland and Jain (1981) using (CS35, CS36, CS37 and CS156), 25% for another MLTR software (Ritland 2002) with the following seven microsatellites (CS10, CS20, CS39, CS61, assumptions: (a) each mating event is due to random CS62, CS86 and CS120), 16% for three microsatellites outcrossing (t) or self-fertilization (with probability (CS21, CS81 and CS89) and 8.3% for one microsat- s = 1 - t); (b) the probability of outcrossing is ellite (CS102). Seven microsatellites (CS53, CS68, independent of the maternal genotypes; (c) the pollen CS98, CS99, CS125, CS127 and CS154) did not show pool is homogeneous over all maternal plants; positive amplification in any Centrosema species. (d) there is no selection between fertilization and However, these results show a considerable level of the time of assay for progeny genotypes; (e) alleles at conserved sequences in the flanking regions of micro- different loci segregate independently (Ritland and satellite loci. All of the transferable loci that were Jain 1981). The following parameters were estimated: amplified are simple dinucleotide and compound multilocus outcrossing rate (tm), single-locus out- repeat motifs with (GT)n and (AG)n being the most crossing rate (ts), outcrossing rate between related abundant repeats. A total of 149 alleles were identified individuals (tm - ts), correlation of paternity (rp)or for the 19 transferable microsatellites in the different proportion of full sibs among outcrossed progeny, Centrosema species. correlation between outcrossing rates of different loci Extensive polymorphism in the accessions of the

(rta) and normalized variation of outcrossing rates Centrosema species is apparent in the wide variation among progenies (rt). All parameters were estimated of both the size and number of ampliﬁcation prod- using maximum likelihood procedures. The number ucts. The number of alleles per locus ranged from 2 to of contributing pollen donors for each progeny was 20 with an average of 7.52. The PIC values ranged estimated to be 1/rp (Ritland 1989). The inbreeding from 0.22 (CS102) to 0.89 (CS71) with an average of coefﬁcient of maternal parents (Fm) was also calcu- 0.64, and the D values ranged from 0.47 (CS102) to lated using MLTR software (Ritland 2002). The 0.99 (CS71 and CS45) with an average of 0.77. 123 Euphytica

Table 2 Microsatellite loci used in the cross-ampliﬁcation of Centrosema species and in the estimation of the outcrossing rate in C. pubescens Locus/Accession no. Repeat motif TD (8C) Primer sequences (50–30)b A Product length

CS10 (GT)8 60–45 F: ATACTGTTTTCCTCATTG 9 298 bp GQ293042 R:AACTCTGTCTCTTCACTG

CS20 (CA)3CG(CA)5 60–45 F:ACACCATACATGCGAAAGAT 6 267 bp GQ293043 R:CCATATGAAAATTGTTGTGA a CS21 (AG)15 60–45 F:TTCACATAAAATCAAACCAA 3 229 bp GQ293044 R:AACCACATTCTTCTATCCTT

CS35 (CA)6 60–45 F:GCATATAGTAAATCTGTTGTGG 8 253 bp GQ293045 R:AGAGTGAAAGAAAGAAGAAAAG

CS36 (CA)5 60–45 F:TTGGTTATTAAATTGGTGAAG 9 176 bp GQ293046 R:0TTAAAAATCTAGCAGGAAAGTT 0 CS37 (GA)2GT(GA)12 60–45 F: TCAAAACTATCTACATCCA 9 165 bp GQ293047 R:0TCTAATAACAACGCAATAA

CS39 (GT)7AT(GA)9AA(GA)4 60–45 F:ACACAACAACATAAAAGTA 4 268 bp GQ293048 R:0TATGGAGTAAGACAAACAA

CS45 (CA)5 60–45 F:CAGAAATGCAAATGCTACAAAA 16 216 bp GQ293049 R:GTGGGCCAGAATCAGGAA

CS53 (GT)7 60–45 F:TGCAAAAAGAGAAATAAAATGA – 232 bp GQ293050 R:ATGACCAAAAGTGAGTGAGAAT

CS61 (CA)7 60–45 F:TTTTTATGCTTCCTGTTCA 5 241 bp GQ293051 R:TTAAATTTCAAAAGACCACTG

CS62 (CT)2(GT)6 60–45 F:CTGATGTGGATGATGAGG 6 227 bp GQ293052 R:TTCTGACACTTATAAAAACAAC

CS68 (GT)5 60–45 F:TGGGTTAATTCAATGTAGCAG – 189 bp GQ293053 R:AAGGTCGAATCTCAGCAAAAT a CS70 (CA)10 60–45 F:CCATACCCTCACCAATCC 8 253 bp GQ293054 R:CCATCACAAGTTATACCATCAG

CS71 (CT)9 60–45 F:ATACCTGATGAAATGTGGAT 20 226 bp GQ293055 R:AATAATTTCTGCAGTGTTTTG

CS81 (AG)6GG(AG)7 60–45 F:CATGGGTCTTGGGTTTTG 4 243 bp GQ293056 R:AATAGGGTCTGCATCTGTTCA

CS86 (AC)5 60–45 F:ACTTGCTGCACTTGTCACC 6 184 bp GQ293057 R:GTCCCTTTCTTTTCGTTATCAC

CS89 (GT)4…(GT)5 60–45 F:AATTTCCTTCACTTTTGTTCC 5 242 bp GQ293058 R:AATTTCTTTCTTTTTCACTTCA a CS98 (CA)7 60–45 F:ACAAAGCAGGTGATGGACTCT – 204 bp GQ293059 R:0TCTCTGTTGCTCTGGACTTACTC

CS99 (GA)9 60–45 F:TTCATACTAATACCCTTTTTCT – 273 bp GQ293060 R:CTCCACTTCAACCACTCA a CS120 (GT)11 60–45 F:TTTGAAGTGACCAGGAGGATTT 6 286 bp GQ293061 R:AAGACCATGTGGAAGAGGATTG

CS125 (GT)6 60–45 F:GATTACAGAGTTGGGATTTT – 254 bp GQ293062 R:CCATTCTCTTCATACTTACC

CS127 (AC)7 60–45 F:GGAAAGGGACTCAAGAAAGAAA – 204 bp GQ293063 R:GTGATTATAGGGGGAACAGGAG

123 Euphytica

Table 2 continued Locus/Accession no. Repeat motif TD (8C) Primer sequences (50–30)b A Product length

CS128 (GT)8 60–45 F:CACTTGCCCTTCTTGTTATC 8 247 bp GQ293064 R:GCTGTGCGTATGTTTGTGT a CS154 (GA)13 60–45 F:CCCAGTCAGTTGAGTTGTAG – 226 bp GQ293065 R:AAGGTATCCATGGTTTATCT

CS156 (GA)9 60–45 F:ATAGAAAAGAAAAGAAGAAA 9 206 bp GQ293066 R:ACAAGCATAAATGATAAGTG a CS102 (CA)6 60–45 F:TTCATGCATGCACTTCAAAT 2 236 bp GQ293067 R:CCCTTCCCATACGTTACTTACT Locus/accession number, name locus and GenBank accession number a Microsatellite used for estimation of the outcrossing rate b Sequences of primer pairs developed by Sousa et al. (2009) F forward sequence, R reverse sequence, TD touchdown PCR with temperatures ranging from 60 to 45C, A allele number in Centrosema

Several microsatellite loci displayed complex the Evanno DK statistics suggests a primary partition allele patterns with minor alleles that amplified of Centrosema species into three clusters (K = 3) poorly; these loci were not considered for further (Fig. 1a, b). STRUCTURE can help to identify analysis. The size of the alleles produced by the clusters of genetically similar accessions. Subpopu- transferable microsatellites was highly variable in lations from the STRUCTURE analysis were thus Centrosema species indicating that there could be grouped into three clusters (C): C1, C2 and C3 additional unpredicted amplification products of (Fig. 2). Cluster C1 (red) includes the species C. rot- C. pubescens-specific microsatellites. The occurrence undifolium (10 and 11), C. acutifolium (12 and 13), of multiple alleles as a result of the amplification of C. terezae (14) and C. macrocarpum (19 and 20). more than one locus for each microsatellite has been Cluster C2 (green) includes the species C. tetrago- previously reported (Holton et al. 2002). The gener- nolobum (17 and 18), C. brasilianum (8 and 9), ation of amplification products from a defined locus C. brachypodum (6 and 7), C. arenarium (15 and 16) requires that the 30 terminal nucleotides of the target and C. plumieri (21). Cluster C3 (blue) includes the sequence be perfectly complementary to the primers. three C. pubescens accessions (1, 2 and 3), as well as If amplification across the species boundary is the species C. pascuorum (4 and 5) and C. sagittatum possible, the respective loci should be conserved (22 and 23). between the two species. The amplification of a The phylogenetic NJ tree was constructed based on microsatellite locus in one species with primers the modified Roger’s genetic distance matrix and was recognizing the microsatellite from another species colored according to the STRUCTURE results does not necessarily confirm the conservation and (Fig. 3). We observed a strong tendency for corre- identity of the locus (Choumane et al. 2004). We spondence between the Bayesian clusters in the NJ observed here that some C. pubescens microsatellite tree. Cluster C1 (red) is comprised of the species loci cannot be amplified in either all or one particular C. rotundifolium, C. acutifolium, C. terezae and species of Centrosema. This result could be due to a C. macrocarpum. Cluster C2 (green) includes C. mutation in the microsatellite binding site or to the tetragonolobum, C. brasilianum, C. brachypodum, absence of the locus in certain species. C. arenarium and C. plumieri. Cluster C3 (blue) includes the three C. pubescens accessions, C. pascuo- Genetic relationships among Centrosema species rum and C. sagittatum. In these two analyses, the species that were used as male parents in the crosses Using the 149 alleles obtained, we assessed the with C. pubescens (C. acutifolium and C. macrocar- genetic relationships among Centrosema species. pum) were grouped together in cluster C1. The genetic STRUCTURE analysis coupled with computation of distance among Centrosema species ranges from 42 to 123 Euphytica Table 3 Transferability of 26 C. pubescens-specific microsatellite loci in 11 different Centrosema species Centrosema species Microsatellite locib CS10 CS20 CS21 CS35 CS36 CS37 CS39 CS45 CS53 CS61 CS62 CS68 CS70

4 C. pascuorum 200 – – 250 176 165 – 192 – – – – – 5 C. pascuorum 200 – – 250/256 172/186 160/170 – 192 – – – – – 6 C. brachypodum 220/236 – – – 200 – – 200 – 240 – – 198 7 C. brachypodum 228/240 – – – 202/216 – – 200 – 230/240 – – 198 8 C. brasilianum – – 180 – 190/200 – – 192/202 – – – – 198/206 9 C. brasilianum – – 180 – 190 – – 196 – – – – 206 10 C. rotundifolium – – 220/228 – 208/216 – – 210/222 – – – – 200 11 C. rotundifolium – – 228 – 210/216 – – 210 – – – – 200/210 12 C. acutifolium – 192/204 – – – – – 215 – – – – – 13 C. acutifolium – 204 – – – – – 215 – – – – – 14 C. terezaea – 210 – – – – 220 192/206 – 208/216 192 – – 15 C. arenarium 204//210 250/262 – 190 – 190/202 212/222 216 – 216 192/212 – – 16 C. arenarium 204/216 250/256 – 190 – 200 – 216 – 210/216 192/210 – – 17 C. tetragonolobum – – – 200/212 – – – 210/218 – – 220 – 206/212 18 C. tetragonolobum – – – 212/216 – – – 218/228 – – 220/230 – 214/226 19 C. macrocarpum – – – 220 – – – 215 – – – – 232 20 C. macrocarpum – – – 220/226 – – – 198/215 – – – – 232 21 C. plumieri – – – – – 202 – 202 – – – – – 22 C. sagitatum – – – – – 172/186 220/228 190 – – – – – 23 C. sagitatum – – – – – 170/180 228 188/192 – – – – – Transferability (%) 25.0 25.0 16.0 33.3 33.3 33.3 25.0 100 – 25.0 25.0 – 55.0 PIC 0.86 0.71 0.47 0.76 0.51 0.68 0.39 0.87 – 0.76 0.67 – 0.79 D 0.98 0.87 0.68 0.82 0.69 0.83 0.47 0.99 – 0.81 0.86 – 0.86 123 123 Table 3 continued Centrosema species Microsatellite locib CS71 CS81 CS86 CS89 CS98 CS99 CS120 CS125 CS127 CS128 CS154 CS156 CS102

4 C. pascuorum 180 240 – 230 – – 206/214 – – 240 – 200 – 5 C. pascuorum 178/188 240 – 232/242 – – 214 – – 242/248 – 200 – 6 C. brachypodum 200/212 – – – – – 240 – – – – 186/200 – 7 C. brachypodum 206/218 – – – – – 242/252 – – – – 186 – 8 C. brasilianum 180/186 – – – – – 240/256 – – 232 – 190/206 – 9 C. brasilianum 180/190 – – – – – 256 – – 230/240 – 194/208 – 10 C. rotundifolium 212 – – – – – – – – – – 196/216 – 11 C. rotundifolium 212 – – – – – – – – – – 214 – 12 C. acutifolium 200 232/242 180 – – – – – – – – – 222/236 13 C. acutifolium 200 2 238 182/196 – – – – – – – – – 222 14 C. terezaea 206/212 – 200/206 – – – – – – 240/252 – – – 15 C. arenarium 200/220 – 180/190 – – – – – – 252 – – – 16 C. arenarium 220 – 190 – – – – – – 252 – – – 17 C. tetragonolobum 202/214 – – – – – – – – 246/258 – – – 18 C. tetragonolobum 210/218 – – – – – – – – 258 – – – 19 C. macrocarpum 216– – – ––– ––– –– – 20 C. macrocarpum 216– – – ––– ––– –– – 21 C. plumieri 214– – – ––– ––– –– – 22 C. sagitatum 220/228 – – 200/210 – – – – – – – – – 23 C. sagitatum 218/230 – – 210 – – – – – – – – – Transferability (%) 100 16.0 25.0 16.0 – – 25.0 – – 55.0 – 33.3 8.3 PIC 0.89 0.41 0.52 0.58 – – 0.71 – – 0.62 – 0.78 0.22 D 0.99 0.56 0.68 0.69 – – 0.86 – – 0.79 – 0.89 0.49 a Nomen nudum (not a described species) b Alleles observed for each locus are displayed in bp – indicates no ampliﬁcation. PIC polymorphism information content; D discriminating power Euphytica Euphytica

Fig. 1 Determination of K, the most probable number of a function of K averaged over 20 replicates, and b ad hoc DK clusters, based on 12 different Centrosema species using statistics as a function of K calculated over 20 replicates STRUCTURE software. a Log probability of the data, L (K), as

Fig. 2 Hierarchical organization of genetic relatedness in the and 7—C. brachypodum; 8 and 9—C. brasilianum; 10 and 11— Centrosema species STRUCTURE analysis (K = 3). The C. rotundifolium; 12 and 13—C. acutifolium; 14—C. terezae;15 proportion of membership (y-axis) assigned to the inferred and 16—C. arenarium; 17 and 18—C. tetragonolobum; 19 and genetic clusters is indicated for each individual (x-axis). The 20—C. macrocarpum; 21—C. plumieri; 22 and 23— species are: 1, 2 and 3—C. pubescens; 4 and 5—C. pascuorum;6 C. sagittatum

95%. The bootstrap values ([45) at the cluster and sub- transferability to related species without the devel- clusters indicated the robustness of the genetic rela- opment of specific microsatellite loci. These loci may tionships depicted in the dendrogram (Fig. 3). therefore be useful for genetic studies in cross- Several studies have shown that the microsatellites amplified species. developed for one species can be used in related plant species. The success of cross-species amplification is Outcrossing rate in Centrosema pubescens likely to depend not only on the evolutionary distance between the source and target species but also on the The outcrossing rate in C. pubescens was estimated rate of evolution in the genomic sequence where the with six microsatellite loci (Table 2) using 10 field- microsatellite is located (Datta et al. 2007). High grown plants as maternal parents and 20 accessions transferability of microsatellite loci has been observed per progeny (Table 1). in many other genera and species. Gaitań-Solı´s et al. For the 6 microsatellite loci, the number of alleles (2002) developed 68 Phaseolus vulgaris microsatellite per locus varied from 2 to 6 with an average of 3.8. loci and found that the transferability rate to other The observed heterozygosity varied from 0.09 to 0.42 Phaseolus species was almost 50%. Choi et al. (2004) (0.23 on average) and the expected heterozygosity showed that Medicago truncatula microsatellite loci ranged from 0.43 to 0.74 (0.58 on average). The loss could be transferred to multiple legumes. of heterozygotes could indicate some level of autog- The microsatellite loci used in this study were amy (Barkley et al. 2006). Finally, the calculated PIC efficient for analyzing genetic relationships in Cen- values varied from 0.39 to 0.61 with an average of trosema species because they presented high 0.48 (Table 4). 123 Euphytica

Fig. 3 Neighbor-joining tree of Centrosema species based on C. pubescens; 4 and 5—C. pascuorum; 6 and 7—C. brachyp- the Roger’s modified genetic distance. Each branch is color- odum; 8 and 9—C. brasilianum; 10 and 11—C. rotundifolium; coded according to membership in the K = 3 clusters identified 12 and 13—C. acutifolium; 14—C. terezae; 15 and 16— by STRUCTURE. Bootstrap values ([45) at the nodes indicate C. arenarium; 17 and 18—C. tetragonolobum; 19 and 20— the significance of clustering. Numbers at branch ends indicate C. macrocarpum; 21—C. plumieri; 22 and 23—C. sagittatum different accessions from each species evaluated: 1, 2 and 3—

Table 4 Number of alleles per locus (a), observed heterozy- Table 5 Mating system parameters in C. pubescens: multilo- gosity (HO), expected heterozygosity (HE), and polymorphism cus outcrossing rate (tm), single locus outcrossing rates (ts), information content (PIC) of C. pubescens families multilocus correlation of paternity (rp), correlation of t estimate among loci (rta), correlation of t within progenies (rt) and Loci A HO HE PIC parental coefﬁcient of inbreeding (Fm) CS21 4 0.09 0.53 0.53 Parameters Estimates (standard error) CS70 5 0.32 0.61 0.61 t 0.269 (0.069) CS98 3 0.18 0.74 0.45 m t 0.129 (0.043) CS120 2 0.23 0.69 0.38 s t - t 0.040 (0.023) CS154 6 0.16 0.43 0.56 m s r 0.139 (0.052) CS102 3 0.42 0.51 0.39 p 1/rp 7.19

rta 0.86 (0.042)

The estimated multilocus outcrossing rate (tm) was rt 0.362 (0.09)

0.269 (0.069) indicating a mixed mating system Fm 0.139 (0.076) (Table 5). This result shows that 73.1% of the plants were derived from self-fertilization and 26.9% from outcrossing. The single locus outcrossing rate (ts) was multilocus and single locus outcrossing rates repre- 13% [0.129 (0.043)]. The difference in the outcross- sents an estimate of the degree of biparental ing rate (tm-ts) was signiﬁcantly different from zero inbreeding. In the presence of biparental inbreeding (4%) [0.040 (0.043)] indicating that crosses occur ts will be smaller than tm because outcrossing events between related individuals. The difference between that are not detected at a single locus have a higher 123 Euphytica probability of being detected as more loci are the estimations of outcrossing rates that were examined (Ritland 1996). obtained from F values indicate that the other species

The paternity correlation (rp) was 0.139 (0.052). should also be considered mixed mating species. For This parameter provides information about the prob- the six populations of C. acutifolium, the estimation able number of plants contributing pollen to a given of t ranged from 0.33 to 0.59, with an average of 0.40. seed parent. When rp is small, the number of plants In C. brasilianum, it ranged from 0.15 to 0.47 with an contributing pollen is large. The quantification of 1/rp average of 0.33. Finally, the values in C. pubescens provides an estimate of the effective number of pollen ranged from 0.33 to 0.56 with an average of 0.41 parents per family. Even though the progenies were (Penteado et al. 1996). derived from 10 parental plants, 7.1 plants (1/0.139) Outcrossing rates can vary widely in plant species contributed as pollen donors in the C. pubescens according to population and environmental condi- experiments. A high degree of correlation was found in tions. Climate variation can change the behavior of the estimates of t across all loci (rta) [0.86(0.042)] pollinators and the phenology of flowering plants supporting the estimates of t. The correlation of t within (Degen et al. 2004). The reproductive system plays a progenies (rt) was low [0.362 (0.09)] indicating that crucial role in the amplification and recombination of there is a small but significant difference in the the variability within species populations. Conse- outcrossing rates among progenies. The correlation quently, the random mating deviations observed in of t within progenies or the normalized variation of C. pubescens have important consequences for con- t among progenies (rt) measures the extent to which the servation and breeding. outcrossing rate differs between different progenies. The outcrossing rate can be inferred from the Acknowledgments The authors are grateful to the Embrapa inbreeding coefficient or the fixation index of the Cerrados, Brası´lia-DF and the Instituto de Zootecnia, Nova Odessa-SP for providing plant material for the study. This maternal generation (Fm) (Parzies et al. 2008). In this work was supported by the Fundaçaõ de Amparo a` Pesquisa do study, Fm was 0.139 (0.076), which corresponds to Estado de Saõ Paulo (FAPESP), which provided financial 14% inbreeding in the maternal generation. support (Project 05/51010-0) and a graduate fellowship to The genetic distance between progenies of C. pu- Sousa, A.C.B. (06/52953-8), and the Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq), which bescens ranged from 0.22 (between progenies derived awarded a research fellowship to Souza, A. P. from accessions 3 and 10) to 0.78 (between progenies derived from accessions 1 and 8) with an average 0.46 between progenies. Nei’s gene diversity among prog- References enies (GST) was 45%. The observed GST values indicated a high degree of genetic diversity among Barkley NA, Roose ML, Krueger RR, Federici CT (2006) progenies, which is in agreement with the predomi- Assessing genetic diversity and population structure in a nance of self-fertilization (Ozkan et al. 2005). citrus germplasm collection utilizing simple sequence repeat markers (SSR). Theor Appl Genet 112:1519–1531 The genus Centrosema is considered to be autog- Battistin A, Vargas MG (1989) A cytogenetic study of seven amous, but cross-pollination can occur under natural species of Centrosema (DC) Benth (Leguminosae-Papi- conditions in the presence of pollinators. The out- lionoideae). Revista Brasileira de Gene´tica 12:319–329 crossing rates estimated for two accessions of C. bra- Borges HBN (2006) Centrosema pubescens Benth (Fabaceae) reproductive biology. Cieˆncias Naturais 1:31–38 silianum using flower color as a marker were 31.2 Botstein D, White RL, Skolnick M, Davis RW (1980) Con- and 53.5% (Maass and Torres 1992). Multilocus struction of a genetic linkage map in man using restriction estimations of outcrossing from family arrays, a fragment length polymorphisms. Am J Hum Gene statistically robust method, indicate that C. acutifo- 32:314–331 Choi HK, Mun JH, Kim DJ, Zhu H, Baek JM, Mudge BR, lium should be included in the category of mixed self- Ellis N, Doyle GB, Kiss ND, Cook DR (2004) Estimating mating plant species. The estimated outcrossing rates genome conservation between crop and model legume (t) obtained for the three lines were 0.27, 0.35 and species. Proc Nat Acad Sci 101:15389–15394 0.41 (Shaw et al. 1981). Choumane W, Winter P, Weigand P, Kahl G (2000) Conser- vation and variability of sequence-tagged microsatellite Although indirect estimation of outcrossing from sites (STMSs) from chickpea (Cicer arietinum L.) within the fixation index is less precise than other methods, the genus Cicer. Theor Appl Genet 101:269–278

123 Euphytica

Choumane W, Winter P, Weigand P, Kahl G (2004) Conser- Miles JW, Clements RJ, Grof B, Serpa A (1990) Genetics vation of microsatellite flanking sequences in different and breeding of Centrosema. In: Schultze-Kraft R, Clements taxa of Leguminosae. Euphytica 138:239–245 RJ (eds) Centrosema: biology, agronomy, and utilization. Coelho ASG, 2002. BooD: avaliaçaõ dos erros associados a CIAT publication no. 92, Cali, Colombia, pp 245–270 estinativas de distaˆncias/similaridades gene´ticas atrave´s Miller MP (1997) Tools for population genetic analysis do procedimento de bootstrap com nu´mero varia´vel de (TFPGA) 1.3. A windows program for the analysis of marcadores. Computer software distributed by the author. allozyme and molecular population genetic data. Com- Laborato´rio de Gene´tica Vegetal, Instittuto de Cieˆncias puter software distributed by author. Northern Arizona biolo´gicas, Universidade Federal de Goia´s, Goiaˆnia, University, Flagstaff, Arizona Brasil. [In Portuguese] Novaes IM, Penteado MIO (1993) Chromosomic observations Creste S, Tulmann Neto A, Figueira A (2001) Detection of in Centrosema. Revista Brasileira de Gene´tica single sequence repeat polymorphisms in denaturing 16:441–447 polyacrylamide sequencing gels by silver staining. Plant Odeyinka SM, Oyedele OJ, Adeleke TO, Odedire JA (2008) Mol Biol Report 19:299–306 Reproductive performance of rabbits fed Moringa oleifera Datta SR, Rai K, Tiwari M, Kumar S (2007) Phylogenetic as a replacement for Centrosema pubescens. Reproduction analysis of pulse crops using RAPD markers. J Food 10:411–415 Legumes 20:9–11 Ozkan H, Kafkas S, Ozer M, Brandolini A (2005) Genetic Degen B, Bandou E, Caron H (2004) Limited pollen dispersal relationships among South-East Turkey wild barley pop- and biparental inbreeding in Symphonia globulifera in ulations and sampling strategies of Hordeum spontaneum. French Guiana. Heredity 93:585–591 Theo Appl Gene 112:12–20 Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS (1991) Parzies HK, Fosung Nke C, Abdel-Ghani AH, Geiger HH ‘‘Touchdown’’ PCR to circumvent spurious priming dur- (2008) Outcrossing rate of barley genotypes with different ing gene amplification. Nucleic Acids Res 19:4008 floral characteristics in drought-stressed environments in Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh Jordan. Plant Breeding 127:536–538 tissue. Focus 12:13–15 Penteado MIO, GarcıáP,Pe´rez de La Veja M (1996) Genetic Eujayl I, Sedge MK, Wang L, May GD, Chekhovskii K, variability and mating system in three species of the genus Zwonitzer JC, Mian MAR (2004) Medicago truncatula Centrosema. J Hered 87:124–130 EST-SSRs reveal cross-species genetic markers for Perrier X, Jacquemound-Collet JP (2006) DARwin software. Medicago spp. Theor Appl Genet 108:414–422 Available from http://www.darwin.cirad.fr/darwin Evanno G, Regnaut S, Goudet J (2005) Detecting the number Pritchard JK, Stephens M, Donnelly P (2000) Inference of of clusters of individuals using the software STRUC- population structure using multilocus genotype data. TURE: a simulation study. Mol Ecol 18:2611–2620 Genetics 155:945–959 Gaitań-Solı´s E, Duque MC, Edwards KJ, Tohme J (2002) Rea´tegui K, Ara M, Schaus R (1985) Evaluacioń bajo pastoreo Microsatellite repeats in common bean (Phaseolus vul- de asociaciones de gramıńeas y leguminosas forrageiras garis): isolation, characterization, and cross-species en Yurimaguas, Peru´. Pasturas Tropicales 7:11–14 amplication in Phaseolus ssp. Crop Sci 42:2128–2136 Ritland K (1989) Correlated matings in the partial selfer Gutierrez MV, Vaz Patto MC, Huguet T, Cubero JL, Mimulus guttatus. Evolution 43:849–859 Moreno MT, Torres AM (2005) Cross-species amplifica- Ritland K (1996) Estimators for pairwise relatedness and tion of Medicago truncatula microsatellite across three individual inbreeding coefficients. Gene Res 67:175–185 major pulse crops. Theor Appl Genet 110:1210–1217 Ritland K (2002) Extensions of models for the estimation of Holton TA, Christopher JT, Clure LM, Harker N, Henry RJ mating system using n independent loci. Heredity (2002) Identification and mapping of polymorphic SSR 88:221–228 markers from expressed gene sequences of barley and Ritland K, Jain S (1981) A model for the estimation of out- wheat. Mol Breeding 9:63–71 crossing rate and gene frequencies using independent loci. Humphreys LR, Ivory DA, Wong CC, Topark-Ngarm A (1990) Heredity 47:35–52 Regional experience with Centrosema: tropical Asia and Schultze-Kraft R, Clements RJ (1990) Biology, agronomy and Pacific. In: Schultze-Kraft R, Clements RJ (eds) Centro- utilization. CIAT publication no. 92, Cali, Colombia sema: biology, agronomy, and utilization. Centro Inter- Schultze-Kraft R, Clements RJ, Keller-Grein G (1997) Cen- national de Agricultura Tropical [CIAT], Cali, Columbia, trosema: biologıá, agronomıá y utilizacioń. International pp 543–558 Center for Tropical Agriculture—CIAT, Cali, Columbia Keller-Grein G, Schultze-Kraft R, Franco LH, Ramirez G Shaw DV, Kahler AL, Allard RW (1981) A multilocus esti- (2000) Multilocational agronomic evaluation of selected mator of mating system parameters in plants populations. Centrosema pubescens germplasm on acid soils. Tropical Proc Nat Acad Sci 78:1298–1302 Grasslands 34:65–77 Sousa ACB, Carvalho MA, Boaventura LR, Sforça DA, Lewis P, Zaykin D (2002) Genetic data analysis (GDA): Campos T, Jungmann L, Zucchi MI, Jank L, Souza AP computer program for the analysis of allelic data (Soft- (2009) Microsatellite markers in tropical legume (Cen- ware), version 1.1 (d12). http://alleyn.eeb.uconn.edu/gda/ trosema pubescens Benth.): development, characteriza- Maass BL, Torres AM (1992) Outcrossing in the tropical for- tion, and cross-species amplification in Centrosema sp. age legume Centrosema brasilianum (L) Benth. Book of Conserv Gene Res 1:347–352 Poster Abstracts XIIIth Eucarpia Congress. Angers, Tessier C, David J, Boursiquot P, Charrier A (1999) Optimi- France, pp 465–466 zations of the choice of molecular markers for varietal 123 Euphytica

identiﬁcation in Vitis vinifera L. Theor Appl Genet biology, agronomy and utilization. International Center 98:171–177 for Tropical Agriculture—CIAT, Cali, Columbia, pp 1–27 Varshney RK, Graner A, Sorrells ME (2005) Genic microsat- Wu KS, Tanksley SD (1993) Abundance, polymorphism and ellite markers in plants: features and applications. Trends genetic mapping of microsatellites in rice. Mol Gen Biotechnol 23:48–55 Genomics 241:225–235 Williams RJ, Clements RJ, 1990. Taxonomy of Centrosema. In: Schultze-Kraft R, Clements RJ (eds) Centrosema:

123

View publication stats