US 2013 O150240A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0150240 A1 Newman et al. (43) Pub. Date: Jun. 13, 2013

(54) ENTEROBACTER SP- 638 AND METHODS OF Publication Classification USE THEREOF (51) Int. Cl. (75) Inventors: Lee Newman, Camillus, NY (US); AOIN 63/00 (2006.01) Daniel van der Lelie, Chapel Hill, NC (52) U.S. Cl. (US); Safiyh Taghavi, Chapel Hill, NC CPC ...... A0IN 63/00 (2013.01) (US) USPC ...... SO4/117 (73) Assignee: BROOKHAVEN SCIENCE ASSOCATES/BROOKHAVEN NATIONAL LABORATORY, Upton, (57) ABSTRACT NY (US) The present invention relates to a novel species of Entero (21) Appl. No.: 13/634,135 bacter, Enterobacter sp. 638, and to its use in connection, for example, with a method for increasing growth in a plant, (22) PCT Fled: Mar. 10, 2011 increasing biomass in a plant, increasing fruit and/or seed productivity in a plant, increasing disease tolerance and/or (86) PCT NO.: resistance in a plant, and increasing drought tolerance and/or S371 (c)(1), resistance in a plant, as compared to a control or wild-type (2), (4) Date: Jan. 3, 2013 plant grown under identical conditions without application of the inventive method or composition. The methods include Related U.S. Application Data applying an effective amount of a composition, which (60) Provisional application No. 61/313,415, filed on Mar. includes an isolated culture of Enterobacter sp. 638, to the 12, 2010. plant. Patent Application Publication Jun. 13, 2013 Sheet 1 of 7 US 2013/0150240 A1

Patent Application Publication Jun. 13, 2013 Sheet 2 of 7 US 2013/0150240 A1

$38,38.

tro saksskxx

Patent Application Publication Jun. 13, 2013 Sheet 3 of 7 US 2013/0150240 A1

$838. 3

Total weight of harvested tomatoes

w w w s w w s R w Ye- w SW 38 Rw ------yw w s & X s X XXXX X & s w w w 8 S s y 333 -xx-x-xx-x-xx-xxs-a-a-a-...-S s w SSSs k R &SS w Xs^ & 8'.' sx s^ w w cars % X s S S.

sw S.s' s w {{{{ % ...... ssS . is -sycy x .338:32 W S W &S S. SwSS S sysS& SS S.S s Ss sass X { im------arrara-ra-ra-ra-ra------1-1-1-1-1-1------Sssssss R-ji 28-}i 3-3. F-Aig 4-Ag 2-ág 28-Aug. diates Patent Application Publication Jun. 13, 2013 Sheet 4 of 7 US 2013/0150240 A1

SR 2: Sunflower Flowering poulou

xiii' (i

Patent Application Publication Jun. 13, 2013 Sheet 5 of 7 US 2013/0150240 A1

FGRES

838 is Patent Application Publication Jun. 13, 2013 Sheet 6 of 7 US 2013/0150240 A1

F33ra 8

------i. Patent Application Publication Jun. 13, 2013 Sheet 7 of 7 US 2013/0150240 A1

S: 3 Average Growth Rate

& Ry: 8:8: & jS3

: s: S$3. 3a; & .38:

s: assis a states US 2013/0150240 A1 Jun. 13, 2013

ENTEROBACTER SP- 638 AND METHODS OF amount effective for increasing disease tolerance in the plant. USE THEREOF The composition includes an isolated culture of Enterobacter sp. 638. CROSS-REFERENCE TO RELATED 0013. In yet an additional aspect, the invention relates to a APPLICATION method of increasing drought tolerance in a plant. The 0001. This application claims the benefit of U.S. Provi method includes applying a composition to the plant in an sional Application No. 61/313,415, filed Mar. 12, 2010, amount effective for increasing disease tolerance in the plant. which is incorporated herein by reference in its entirety. The composition includes an isolated culture of Enterobacter 0002 This invention was made with Government support sp. 638. under contract number DE-AC02-98CH10886, awarded by 0014. Other objects advantages and aspects of the present the U.S. Department of Energy. The Government has certain invention will become apparent from the following specifi rights in the invention. cation and the figures. BACKGROUND OF THE INVENTION BRIEF DESCRIPTION OF THE DRAWING(S) 0003. The present invention relates to a novel species of Enterobacter, and to its use in connection with, among other 0015 FIG. 1 is a 16S phylogenetic analysis of the Entero things, plant growth and development. bacter sp. 638 strain. 0004 Changes in the Earth's climate can be expected to 0016 FIG. 2 is a circular representation of the Entero have a strong effect on agricultural productivity. For example, bacter sp. 638 chromosome. Circles displayed (from the out increases in emissions from fossil fuel combustion are con side): the GC percent deviation (GC window-mean GC) in a sidered to have affected the Earth's climate, which have made 1000-bp window, predicted CDSs transcribed in the clock the production of biofuels from renewable resources more wise direction, predicted CDSs transcribed in the counter desirable. Another way in which climate change is expected clockwise direction, CDS in clockwise and counterclockwise to impact agricultural productivity is by increasing tempera direction colored according to their COG classes, the position tures and by affecting rainfall patterns. of all the palindromic repeats, the position of the 100 palin 0005. Although an increased demand of agricultural dromic repeats (CCCTCTCCCXXCX)GGGAGAGGG) resources in the production offeedstocks for biofuel produc (SEQID NO: 1), GC skew (G+C/G-C) in a 1000-bp window, tion is desirable, this increased demand is balanced by a and coordinates in kilo bases pair. Syntenic regions compared simultaneous increased demand for food to feed a still grow with E. coli K12 are shown with genes displayed in orange, ing world population. while genes displayed in purple correspond to non Syntenic 0006. Therefore, there is a need for sustainable practices region. Arrows indicate to putative functions of genes located that can be used to optimize the production of food and in regions that are not in synteny with E. coli K12 (for further biofuel feedstocks. Such practices would optimally increase detail on gene content for each regions see Table 1). A syn overall plant productivity in a Sustainable manner, increase tenic region is defined by a minimum of three consecutive drought tolerance in plants so that crops and feedstocks can genes that are present in a bacterial genome sequence, and withstand major fluctuations in rainfall patterns, and increase that show a similar genetic organization as for the same genes tolerance to pathogen infections in plants. in other bacterial genomes. 0017 FIG. 3 is a circular representation of the Entero SUMMARY OF THE INVENTION bacter sp. 638 plasmid pleNT638-1. Circles displayed from 0007. In one aspect, the invention relates to an isolated the outside: subdivision of pleNT-01 group of function, gene culture of Enterobacter sp. 638. annotation, the GC percent deviation (GC window-mean 0008. In another aspect, the invention relates to an inocu GC) in a 1000-bp window, predicted CDSs (red) transcribed lant for a plant. The inoculant includes an isolated culture of in the clockwise direction, predicted CDSs (blue) transcribed Enterobacter sp. 638 and a biologically acceptable medium. in the counterclockwise direction, GC skew (G+C/G-C) in a 0009. In yet another aspect, the invention relates to a 1000-bp window, transposable elements from IS elements method for increasing growth in a plant. The method includes (pink) and pseudogenes (grey). Toxinfanti T toxin (TA) sys applying a composition to the plant in an amount effective for tems are shown with an asterisk (*). increasing growth in the plant, wherein the composition 0018 FIG. 4 depicts growth indexes for poplar cuttings includes an isolated culture of Enterobacter sp. 638. inoculated with different endophytic bacteria. Growth 0010. In a further aspect, the invention relates to a method indexes were determined 10 weeks after the inoculating and for increasing biomass in a plant. The method includes apply planting of the cuttings in Sandy soil. Per condition, seven ing a composition to the plant in an amount effective for plants were used. Plants were grown in the greenhouse. Non increasing biomass in the plant. The composition includes an inoculated plants were used as references. Bars indicate stan isolated culture of Enterobacter sp. 638. dard errors. Growth indexes were calculated as (Mt-MO)/MO 0011. In yet a further aspect, the invention relates to a after 10 weeks of growth of inoculated and non-inoculated method for increasing fruit and/or seed productivity in a plants. MO, plants weight (g) at week 0; Mt, plants weight plant. The method includes applying a composition to the (g) after 10 weeks. The statistical significance of the plant in an amount effective for increasing fruit and/or seed increased biomass production of inoculated plants, compared productivity in the plant. The composition includes an iso to that of non-inoculated control plants, was confirmed at the lated culture of Enterobacter sp. 638. 5% level (**) using the Dunnett test. 0012. In an additional aspect, the invention relates to a (0019 FIG. 5 shows the effects of Enterobacter sp. 638 on method for increasing disease tolerance in a plant. The the shoot and root formation of poplar DN-34. Plants were method includes applying a composition to the plant in an incubated hydroponically in half-strength Hoagland's solu US 2013/0150240 A1 Jun. 13, 2013

tion in the absence (Control) or presence (638) of strain 638. face-sterilized root and stem samples taken from hybrid pop Root and shoot development are presented after 1 (A) and 10 lar tree H1 1-11 that were grown in a silty loam soil with (B) weeks. groundwater below it that was contaminated with carbon 0020 FIG. 6 shows the total weight of harvested tomatoes tetrachloride or trichloroethylene. over a 4 month growing period. Plants inoculated with 0028. The Enterobacter sp. 638 strain includes a single Enterobacter sp. 638 had a 10% higher yield as compared to circular chromosome of 4,518,712 bp with an overall G+C non-inoculated control plants. content of 52.98%, and it stably includes a plasmid 0021 FIG. 7 presents a decrease in time to flowering fol pENT638-1 of 157,749 bp, having an overall G+C content of lowing inoculation of Sunflower plant inoculated with 50.57%. The pENT638-1 plasmid displays, based on GC Enterobacter sp. 638 as compared to non-inoculated Sun content, at least four distinct regions (FIG. 3). The flower plant as controls. pENT638-1 plasmid is related to F plasmids found in other 0022 FIG. 8 shows a comparison of chromatographs of Enterobacteriaceae. Plasmids of this family are involved in Enterobacter sp. 638 extracts grown in the absence (top chro host interaction and virulence, Such as pFra plasmid of the matograph) or presence (bottom chromatograph) of plant plague microbe Yersinia pestis. In pRNT638-1, however, the extracts. Note the production of Acetoin and 2,3-Butanediol pFrapathogenicity island is replaced by a unique 23-kb puta in the presence of plant extracts. This result was confirmed in tive genomic island (flanked by an integrase gene and having a definite medium containing Sucrose. a GC content that is significantly different than that of the rest 0023 FIG. 9 shows percentage of gene from a particular of the plasmid). COG class depending of their genetic localization: chromo 0029. An "isolated culture' refers to a culture of the some or plasmid pPNT638-1. Legend of the Cog class: D: microorganism that does not include other materials (i) which Cell cycle control, cell division, chromosome partitioning; M are normally found in Soil in which the microorganism grows, Cell wall/membrane/envelope biogenesis; N Cell motility; O and/or (ii) from which the microorganism is isolated. In addi Posttranslational modification, protein turnover, chaperones; tion, Such a culture may be a culture that does not contain any T Signal transduction mechanisms; U Intracellular traffick other biological, microorganism, and/or bacterial species in ing, secretion, and vesicular transport; V Defense mecha quantities sufficient to interfere with the replication of the nisms; W Extracellular structures; J Translation, ribosomal culture or to be detected by normal bacteriological, molecular structure and biogenesis; K Transcription; L Replication, biology, and/or chemical techniques. recombination and repair; C Energy production and conver sion; EAmino acid transport and metabolism; F Nucleotide B. Inoculant for a Plant transport and metabolism; G Carbohydrate transport and 0030. In another aspect, the invention relates to an inocu metabolism; H Coenzyme transport and metabolism: I Lipid lant for a plant. The inoculant includes an isolated culture of transport and metabolism; P Inorganic ion transport and Enterobacter sp. 638 and a biologically acceptable medium. metabolism; QSecondary metabolites biosynthesis, transport The terms “microbial inoculant’ or "inoculant” refer to a and catabolism; R General function prediction only; S Func preparation that includes an isolated culture of Enterobacter tion unknown. sp. 638. 0024 FIG. 10 shows distribution of the palindromic 0031) To facilitate the culture of the Enterobacter sp. 638, repeats on the chromosome of Enterobacter sp. 638. Circles the culture may be diluted, for example, with a suitable display (from the outside):): predicted CDSs transcribed in medium or carrier. A “biologically acceptable medium’ the clockwise and counterclockwise direction, the position of refers to a medium that does not interfere with the effective all the palindromic repeats and of the “CCCTCTCCCXXCX) ness of the biological activity of Enterobacter sp. 638 and GGGAGAGGG” (SEQID NO: 1) palindromic repeat found which is not toxic to Enterobacter sp. 638. on the Enterobacter sp. 638 genome, the GC percent devia 0032 Examples of a biologically acceptable medium tion, GC skew. The table on the side shows the variation of include a minimal salt medium with gluconate and a diluted XXCX) nucleotide sequences and their cumulative numbers. rich medium (/100 LB). The biologically acceptable medium 0025 FIG. 11 shows increased biomass production of may include carbon sources. Such as the following exemplary tobacco when inoculated with Enterobacter sp. 638. For com compounds: D-mannitol, lactose. Sucrose, arbutin, Salicin, parison, non-inoculated control plants and plants inoculated trehalose, D-mannose, L-arabinose, maltose, cellobiose, with Pseudomonasputida W619 were included. For tobacco, Xylose, gluconate and glucose. Preferably, the medium not only did the plants inoculated with Enterobacter sp. 638 includes glucose, Sucrose, other plant derived Sugars, and/or show the most increase growth, but also earlier onset of flow poplar extract to induce the induction of plant growth-pro ering as was seen with Sunflower. moting phytohormones (acetoin, 2,3-butanediol, see FIG. 8). 0033. In one embodiment, the inoculant further includes a DETAILED DESCRIPTION OF THE INVENTION plant-growth promoting microorganism, including, for example, a plant-growth promoting endophytic bacterium, 0026. A biological deposit of the Enterobacter sp. 638 fungus, rhizosphere bacterium and/or a mycorrhizal fungus. according to the invention was made on Mar. 4, 2011 with Specific exemplary plant-growth promoting microorganisms ATCC Patent Depository, 10801 University Blvd., Manassas, include but are not limited to members of the genera Actino Va., 2011 O. bacter; Alcaligenes, Bacillus, Burkholderia, Buttiauxella, Enterobacter, Klebsiella, Kluyvera, Pseudomonas, Rahnella, A. Culture of Enterobacter sp. 638 Ralstonia, Rhizobium, Serratia, and Stenotrophomonas. 0027. In one aspect, the invention relates to an isolated culture of Enterobacter sp. 638. Enterobacter sp. 638 is a C. Method for Increasing Growth non-phytopathogenic bacterial strain. The Enterobacter sp. 0034. In another aspect, the invention relates to a method 638 strain was isolated under aerobic conditions from Sur for increasing growth in a plant. The method includes apply US 2013/0150240 A1 Jun. 13, 2013 ing an effective amount of a composition including an iso greater growth than the corresponding control plant grown lated culture of Enterobacter sp. 638 to the plant. under identical conditions without application of the inven 0035. A “plant’ as used herein refers to any type of plant, tive method or composition. Such as a tree, shrub, flower, herb, vine, or grass. The term “plant” also refers to any part of the plant, for example, to a D. Method for Increasing Biomass whole plant, a plant part, a plant cell, or a group of plant cells, Such as plant tissue, or progeny of same. Plantlets are also 0044. In a further aspect, the invention relates to a method included within the meaning of “plant.” Plants include, for for increasing biomass in a plant. The method includes apply example, any gymnosperms and angiosperms, both mono ing an effective amount of a composition including an iso cotyledons and dicotyledons, and trees. lated culture of Enterobacter sp. 638 to the plant. 0036) Examples of monocotyledonous angiosperms 0045. The term “biomass” refers to the dry weight or fresh include, but are not limited to, asparagus, field and Sweet weight of the plant. Biomass includes, for example, all plant corn, barley, wheat, rice, Sorghum, onion, pearl millet, rye and parts unless otherwise stipulated, such as in reference to shoot oats and other cereal grains, Sugar cane, elephant grass, biomass (all above ground plant parts), leafbiomass, and root Switch grass and miscanthus. biomass. The term “dry weight” refers to the weight of a plant 0037 Examples of dicotyledonous angiosperms include, that has been dried to remove the majority of cellular water. but are not limited to tomato, tobacco, cotton, rapeseed, field The term “fresh weight” refers to the weight of a plant that has beans, soybeans, peppers, lettuce, peas, alfalfa, clover, cole not been dried to remove the majority of cellular water. Means crops or Brassica oleracea (e.g., cabbage, broccoli, cauli for measuring biomass are known in the art. flower, brussel sprouts), radish, carrot, beets, eggplant, spin 0046. The term “increasing biomass” refers to an increase ach, cucumber, Squash, melons, cantaloupe, Sunflowers and in biomass of a plant treated with a method or composition of various ornamentals. In a preferred embodiment, the plant is the invention, in which the increase in biomass is an amount a tomato. In another preferred embodiment, the plant is Sun greater than the amount of biomass in a corresponding control flower. In yet another preferred embodiment, the plant is plant grown under identical conditions without application of tobacco. the inventive method or composition. 0038 Examples of woody species of plants include pop 0047. The increase in biomass may bean increase that is 2, lar, pine, Sequoia, cedar, oak, etc. Tree species further 4, 5, 6, 8, 10, 20 (or more) fold greater as compared to the include, for example, fir, pine, spruce, larch, cedar, hemlock, biomass of a corresponding control plant grown under iden acacia, alder, aspen, beech, birch, Sweetgum, sycamore, pop tical conditions without application of the inventive method lar, willow, and the like. In a preferred embodiment, the plant or composition. For example, a plant having increased biom is a poplar. ass as compared to the wild-type plant may have 10%, 15%, 0039. As used herein, the term “increasing growth refers 20%, 25%, 30%, 40%, 50%, 60% 70%, 75%, 80%, 90%, to an increase in a growth characteristic of a plant treated with 100% or greater biomass than the corresponding control plant a method or composition of the invention, in which the grown under identical conditions without application of the increase in the growth characteristic is greater than the growth inventive method or composition. in a corresponding control plant when grown under identical E. Method for Increasing Disease Tolerance and/or Resis conditions without application of the inventive method or tance composition. A "corresponding control plant refers to a 0048. In yet another aspect, the invention relates to a wild-type plant that is of the same type or species as the plant method for increasing disease tolerance and/or resistance in a treated with a method or composition of the invention. plant. The method includes applying an effective amount of a 0040. The increase in growth can be an increase in growth composition including an isolated culture of Enterobacter sp. of a particular part of the plant. Such as the roots, shoots, 638 to the plant. While not being limited to any particular leaves, flowers, fruits, and/or seeds, or growth can be distrib theory, Enterobacter sp. 638 may increase disease tolerance uted throughout the entire plant. Means for measuring growth and/or resistance in a plant due to a production of acetoin and are known in the art. 2,3-butanediol by Enterobacter sp. 638, or due to a produc 0041 Increased growth may include, for example, an tion of the antimicrobial compounds 2-phenylethanol and increase in at least one, or a combination of the following 4-hydroxybenzoate, or via direct competition for essential characteristics in the plant and/or a part of the plant: height, nutrients via the synthesis of the siderophore enterobactin, width, mass, an accumulation of radioactive carbon, an and/or via the uptake of heterologously produced iron sidero increase in dry weight, an increase in fresh weight and/or an phore complexes by Enterobacter sp. 638. increase in the rate of such increases over a specific period of 0049. The term “disease tolerance” refers to the ability of time. a plant to endure or resist a disease while maintaining the 0.042 Increase in growth may also include, for example, ability to function and produce despite the disease. A disease an increase in the amount of fruit produced, a decrease in time includes, for example, the presence of a pathology which to flowering, and/oran increase in the mass of vegetative parts adversely affects the viability of a plant, such as, for example, that serve a useful purpose. Such as roots or tubers from plants an infection by a pathogen (e.g., a fungus, virus, or bacteria) in which these parts are a food source. in and/or on the plant. 0043. The increase in growth may be an increase that is 2, 0050. The term “disease resistance” refers to the ability of 4, 5, 6, 8, 10, 20 (or more)-fold greater as compared to the a plant to develop fewer disease symptoms following expo growth of a corresponding control plant grown under identi Sure to a disease than the corresponding control plant that cal conditions without application of the inventive method or does not exhibit disease resistance when grown under iden composition. For example, a planthaving increased growth as tical conditions and disease. Disease resistance includes com compared to the control plant may have 10%, 15%, 20%, plete resistance to the disease and/or varying degrees of resis 25%, 30%, 40%, 50%, 60% 70%, 75%, 80%, 90%, 100% or tance manifested as decreased symptoms, longer Survival, or US 2013/0150240 A1 Jun. 13, 2013 other disease parameters, such as higher yield, increased For example, a plant having increased productivity as com growth, increased biomass, accelerated fruit ripening, etc. pared to the control plant may have 10%, 15%, 20%, 25%, 0051. A disease may be, for example, a fungal infection 30%, 40%, 50%, 60% 70%, 75%, 80%, 90%, 100% or greater Such as Septoria, Melampsora, or septotina, a viral infection productivity than the corresponding control plant grown Such as the poplar mosaic virus, and/or a bacterial infection, under identical conditions without application of the inven Such as an infection from Agrobacterium, Rickettsia, or tive method or composition. Corynebacterium. G. Method for Increasing Drought Tolerance and/or Resis 0052. The term “increasing disease tolerance and/or tance resistance refers to an increase in disease tolerance and/or 0060. In another aspect, the invention relates to a method resistance of a diseased plant treated with a method or com for increasing drought tolerance and/or resistance in a plant. position of the invention, in which the disease tolerance and/ The method includes treating the plant with a composition or resistance is greater than the disease tolerance and/or resis that includes an isolated culture of Enterobacter sp. 638. tance in a corresponding control plant grown under identical While not being limited to any particular theory, Enterobacter conditions and disease. sp. 638 may increase drought tolerance and/or resistance in a 0053. The increase disease tolerance and/or resistance plant due to a production of acetoin and 2,3-butanediol by may be an increase that is 2, 4, 5, 6, 8, 10, 20 (or more) fold Enterobacter sp. 638. greater as compared to the tolerance and/or resistance of a 0061. The term “drought tolerance” refers to the ability of corresponding control plant grown under identical conditions a plant to endure or resist drought conditions. “Drought and disease exposure. For example, a plant having increased refers to a condition in which a plant is subjected to osmotic disease tolerance and/or resistance as compared to the wild stress or reduced water potential. For example, drought may type plant may have 10%, 15%, 20%, 25%, 30%, 40%, 50%, be caused by lack of available water for a period of time. 60% 70%, 75%, 80%, 90%, 100% or greater disease toler Drought conditions may be assessed by comparing the ance and/or resistance than the corresponding control plant amount of water required for growth or maturation a plant to grown under identical conditions without application of the the amount of water available to the plant. Drought conditions inventive method or composition. may be caused, for example, by lack of rainfall or irrigation, 0054 Methods for assessing disease tolerance and/or relative to the amount of water used internally or transpired by resistance are known in the art. For example, such methods a plant. may include observations and ratings of physical manifesta 0062. The term “drought resistance' refers to the ability of tions of disease symptoms, loss of plant vigor, or death, and a plant to develop fewer symptoms of water stress (e.g., lower activation of specific disease response genes, as compared to productivity, leaf loss, death) than the corresponding control a control plant. plant when grown under identical conditions of water stress. F. Method for Increasing Fruit and/or Seed Productivity Drought resistance includes complete resistance to the effects 0055. In yet a further aspect, the invention relates to a of drought (no loss of productivity) or varying degrees of method for increasing fruit and/or seed productivity in a resistance manifested as decreased symptoms or longer Sur plant. The method includes applying an effective amount of a vival. composition including an isolated culture of Enterobacter sp. 0063 Phenotypic assessment of symptoms may be used to 638 to the plant. determine whether, and to what extent, a plant is Suffering 0056 “Increasing productivity” refers to increasing the from drought. For example, drought tolerance and/or resis mass or number of fruit and/or seed produced by a plant tance may be assessed by observing and rating wilting, treated with a method or composition of the invention, in growth arrest, death, productivity, leaf loss (e.g., leafrolling, which the increase in productivity is an amount greater than leaf distortion, leaf drop, leaf Scorch), stem or twig dieback, the amount of productivity in a corresponding control plant photosynthetic efficiency, flowering, and yield level in a when grown under identical conditions without application of plant. In addition, drought tolerance and/or resistance of a the inventive method or composition. plant may be assessed, for example, by biochemical or 0057 Methods of assessing an increase in productivity nucleic acid based assays to measure expression or activation may include, for example, determining the number of fruits of specific response genes in the plant. produced by the plant, the weight of individual fruits pro 0064 Drought tolerance and/or resistance is increased in a duced by the plant, the time to flowering in the plant, the time plant if the plant demonstrates less severe symptoms of stress to fruit maturation in the plant, and/or the number of seeds caused by the drought. For example, drought tolerance and/or produced by an individual fruit or flower of the plant. resistance is increased if wilting, growth arrest, death, leaf 0058 Productivity is increased in a plant if, for example, loss (e.g., leafrolling, leaf distortion, leaf drop, leaf Scorch), the number of fruit produced by the plant is increased, the and/or stem or twig dieback is decreased when compared to a weight of individual fruits produced by the plant is increased, corresponding control plant when grown under identical con the time to flowering in the plant is decreased, the time to fruit ditions without application of the inventive method or com maturation in the plant is decreased, and/or the number of position. Other examples of an increased drought tolerance seeds produced by an individual fruit or flower of the plant is and/or resistance include an increase in productivity, plant increased when compared to a corresponding control plant vigor, photosynthetic efficiency, flowering, and/or yield level when grown under identical conditions without application of in a plant when compared to a corresponding control plant the inventive method or composition. when grown under identical conditions without application of 0059. The increase or decrease in productivity may be a the inventive method or composition. respective increase or decrease that is 2, 4, 5, 6, 8, 10, 20 (or 0065 Accordingly, the term “increasing drought toler more) fold greater or less than the productivity of a corre ance and/or resistance refers to an increase in drought toler sponding control plant grown under identical conditions ance and/or resistance of an impacted plant treated with a without application of the inventive method or composition. method or composition of the invention, in which the toler US 2013/0150240 A1 Jun. 13, 2013

ance and/or resistance is greater than the drought tolerance years at an experimental site in Washington State. In addition, and/or resistance in a corresponding control plant grown native willow (Salix gooddingii) material was collected from under identical conditions and water stress. 5-year-old native plants that had been growing in the presence 0066. The increase drought tolerance and/or resistance of both trichloroethylene (18 ppm) and carbon tetrachloride may be an increase that is 2, 4, 5, 6, 8, 10, 20 (or more) fold (12 ppm) for 5 years. Cuttings were removed from the plants greater as compared to the tolerance and/or resistance of a with clippers that were washed with ethanol between cuts and corresponding control plant grown under identical conditions placed in acetone-rinsed Volatile organic analysis vials which and water stress. For example, a plant having increased were placed on ice for shipment from the field. Roots and drought tolerance and/or resistance as compared to the con shoots were treated separately. Fresh root and shoot samples trol plant may have 10%, 15%, 20%, 25%, 30%, 40%, 50%, were vigorously washed in distilled water for 5 min, surface 60% 70%, 75%, 80%, 90%, 100% or greater drought toler sterilized for 5 minina solution containing 1% (wt/vol) active ance and/or resistance than the corresponding control plant chloride (added as a sodium hypochlorite NaOCl) solution) grown under identical conditions without application of the supplemented with 1 droplet Tween 80 per 100 ml solution, inventive method or composition. and rinsed three times in sterile distilled water. A 100-ul sample of the water from the third rinse was plated on 869 H. General Methods medium (25) to verify the efficiency of sterilization. After 0067. Any method of applying a composition to a plant sterilization, the roots and shoots were macerated in 10 ml of may be used in the methods of the present invention. Methods 10 mM MgSO4 using a Polytron PT1200 mixer (Kinematica of applying a composition on and/or in a plant are known in A6). Serial dilutions were made, and 100-ul samples were the art. In one embodiment, the composition may be inocu plated on nonselective media in order to test for the presence lated into the soil with the plant. In another embodiment, the of the endophytes and their characteristics. inventive composition may be introduced to the plant roots 0072 Enterobacter sp. 638 was isolated under aerobic through growth in a hydroponic medium or sprayed onto the conditions from Surface-sterilized root and stem samples leaves of a plant. taken from hybrid poplar tree H1 1-11 and native willow 0068. The composition of the invention may be applied to (Salix gooddingii) that were grown in a silty loam Soil with any part of the plant, including the seeds through the use of a groundwater below it that was contaminated with carbon Suitable coating mechanism or binder. The inventive compo tetrachloride or trichloroethylene and carbon tetrachloride, sition may either be applied on the plants prior to planting or respectively. Its total genomic DNA was extracted and used to be introduced into the plant furrows during planting. As amplify the 16 rRNA gene. 16S rRNA genes were PCR another example, the inventive composition may be applied to amplified using the standard 26F-1392R primer set (Amann, the roots of the plant. The inventive composition may be 1995) prepared with or without a carrier and sold as a separate inoculant to be inserted directly into the furrows into which Example 2 the plant is planted. 0069. In accordance with the methods of the invention, an Screening of Endophytic Bacteria for Plant effective amount of the inventive composition is that amount Growth-Promoting Properties in Poplar sufficient to establish sufficient bacterial growth such that the 0073 Inocula (250-ml culture) were prepared by growing desired result is achieved in the treated plant. An effective endophytic bacteria in /10-strength 869 medium (25) at 30°C. amount of the inventive composition may be determined by on a rotary shaker until a cell concentration of 10 CFU/ml known means in the art for a particular plant species. For was reached (optical density at 660 nm OD660 of 1). The example, inoculation with the inventive composition may be cells were collected by centrifugation, washed twice in 10 conducted in hydroponics for six days, and the bacterial Sus mM MgSO4, and suspended in /10 of the original volume (in pension may be refreshed after three days following inocula 10 mM MgSO4) to obtain an inoculum with a cell concen tion. tration of 10' CFU/ml. Per microbial strain tested, seven 0070. In one embodiment, the effective amount may, for cuttings from poplar (Populus deltoides X P. nigra) DN-34 of example, be any amount from about 10' to about 10" cells approximately 30 cm were weighed and placed in a 1-liter per plant. In another embodiment, the effective amount is a beaker containing 0.5 liter of a half-strength sterile Hoag cell concentration from about 10 to about 10' CFU/ml of land's nutrient solution (5), which was refreshed every 3 inoculum, more preferably from about 10° to 10 CFU/ml, days. The cuttings were allowed to root for approximately 4 and most preferably about 10 CFU/ml. In yet another weeks until root formation started. Subsequently, a bacterial embodiment, the inventive composition can be mixed with inoculum was added to eachjarat a final concentration of 10 the soil in an amount of from about 10 to 10" cells per gram CFU/ml in half-strength Hoagland's solution. After 3 days of of soil. incubation, cuttings were weighed and planted in nonsterile sandy soil and placed in the greenhouse with a constant tem EXAMPLES perature of 22°C. and 14h light-10 h dark cycle with photo synthetic active radiation of 165 mmol/m2s. After 10 weeks, Example 1 plants were harvested, and their total biomass, their increase in biomass, and the biomass of different plant tissues were Isolation and Characterization of Enterobacter sp. determined. Data were also collected from non-inoculated 638 control plants. Growth indexes were calculated as (Mt-MO)/ 0071 Root and shoot samples were collected from the MO after 10 weeks of growth in the presence or absence of 10-year-old hybrid poplar tree H1 1-11 (Populus tri endophytic inoculum, where MO is the plants weight (g) at chocarpa P deltoides) that had been growing in the pres week O and Mt is the plants weight (g) after 10 weeks. The ence of carbon tetrachloride (12 ppm homogeneously) for 8 statistical significance of the results was confirmed at the 5% US 2013/0150240 A1 Jun. 13, 2013

level using the Dunnett test. To determine the effects of endo presence and absence of gfp-labeled derivatives of Entero phytic bacteria on the rooting of poplar DN-34, cuttings were bacter sp. 638. Root formation was very slow for non-inocu treated as described above, except that the endophytic inocu lated plants. In contrast, for cuttings that were allowed to root lum was added from day 1. in the presence of the selected endophytes, root formation 0074 Enterobacter sp. 638 isolated from poplar was was initiated within 1 week, and shoot formation was more tested for its capacity to improve the growth of their host pronounced compared to that of the non-inoculated plants plants, along with other endophytic gammaproteobacteria (FIG. 5A). After 10 weeks, root formation for the non-inocu found in poplar trees. Burkholderia cepacia Bu72, an endo lated controls was still poor; however, for plants inoculated phyte originally isolated from yellow lupine which was found with Enterobacter sp. 638, roots and shoots were well devel to have plant growth-promoting effects on poplar trees, and oped (FIG. 5B). Fluorescence microscopy was used to visu Cupriavidus metallidurans CH34 (also referred to as Ralsto alize the internal colonization of the plant roots by the gfp nia metallidurans CH34), a typical soil bacterium with no labeled strains, confirming their endophytic behavior. The known plant growth promoting effects, were included as posi formation of microcolonies on the root surface, as observed tive and negative controls, respectively. Also, non-inoculated for P. putida W619, were absent on plants inoculated with cuttings were used as controls. Enterobacter sp. 638, where only internal colonization was 0075. After root formation in hydroponic conditions and observed. No gfp expression was detected for roots from Subsequent endophytic inoculation, the poplar DN-34 cut non-inoculated control plants. tings were planted in a marginal sandy soil and allowed to grow for 10 weeks, after which the plants were harvested and Example 5 their biomasses were determined. After 10 weeks of growth, Affect of Endophytic Bacteria on Fruiting and poplar trees inoculated with M. populi BJ001 had less new Flowering Productivity biomass than the controls (FIG. 4) (P<0.05). Poplar cuttings inoculated with Enterobacter sp. 638 (P=0.018) and B. cepa 0080. To test the affect of the endophytic bacteria of mass cia BU72 (P=0.042) showed statistically better growth than of fruit production, tomato seeds (heirloom variety Brandy the control plants (FIG. 4), as was reflected by their growth wine, Park Seed) were started in a perlite/water matrix, and indexes. The plant growth-promoting effects of Enterobacter then transferred to a hydroponic solution of /2 strength Hoag sp. 638 and B. cepacia BU72 were reproducible in indepen land's solution. When plants were approximately 3 inches dently performed experiments. tall, they were transferred to solutions containing 10 CFUs 0076 Under the greenhouse conditions tested, no differ per mL of endophytic bacteria as described above. There days ences in growth indexes were found between those of the after inoculation, seedlings were planted in the greenhouse in non-inoculated control plants and those for plants inoculated ProMix, a commercial potting mix. Dates of first fruit set and with S. maltophilia R551-3, P. putida W619, and S. pro total mass of tomatoes were recorded for three months. teamaculans 568; their growth was comparable to that Tomato plants inoculated with Enterobacter 638 had a 10% observed for plants inoculated with C. metallidurans CH34. increase in fruit productivity over non-inoculated plants. Also, control plants and plants inoculated with the endophytic Non-inoculated plants produced 82 fruits with a total mass of bacteria appeared healthy, except for plants inoculated with 22.374 kg, while the inoculated plants produced 90 fruits with a combined mass of 24.909 kg (FIG. 6). M. populi BJ001, which showed signs of stress, including I0081 Sunflower seedlings (Mammoth, Park Seed) were chlorosis of the leaves. started using the method described, and time to flowering was Example 3 recorded. Undergreenhouse conditions, inoculated Sunflow ers started flowering 5 days earlier than non-inoculated Screening of Endophytic Bacteria for Plant plants, and 50% were in flower while only 10% of the non Growth-Promoting Properties in Tobacco inoculated plants were flowering; 100% of the inoculated 0077. Because Nicotiana species are used in the labora plants were flowering while only 70% of the non-inoculated tory as large-plant models for transformation and metabolite plants were flowering (FIG. 7). studies, it would be useful to be able to use such a plant for Example 6 study, even if it is not useful for field applications. Nicotiana xanthi seedlings were started in soilless growing medium, Drought Resistance and after development of primary leaves, were transferred to I0082 Hybrid poplar hardwood cuttings (OP-367 Populus hydroponic Solutions. After one week, plants were placed in deltoides x P. nigra) were placed in water for three days to solutions containing 10 CFU Enterobacter sp. 638. After 3 initiate root formation, and were then moved to a /2 strength days, inoculums were refreshed, and after an additional three Hoagland's solution containing 10 CFU per mL of endo days, plants were placed in pots in the greenhouse. phytic bacteria for three days. Cuttings were then planted in 0078 Plant growth was monitored weekly, and time to pots containing garden soil and grown in the greenhouse for onset offlowering was recorded. Plants reached full size more three months with surplus water supplied. After three months, rapidly than non-inoculated plants, and the majority of plants watering of the plants was suspended, and time to senescence were in flower one month before the same number of non was monitored. Inoculated plants on average showed a 20% inoculated plants were in flower. delay in the onset of drought symptoms, as compared to Example 4 non-inoculated plants. Effects of Endophytic Bacteria on Poplar Root Example 7 Development Disease Resistance 0079. To further test the effects of endophytic bacteria on I0083. Due to the increased vigor of the plants, as well as root development, rooting experiments were performed in the genetic elements present in the endophytic bacteria, that US 2013/0150240 A1 Jun. 13, 2013 inoculated plants will prove to be more resistant to pathogen more that 37% of all CDS, pointing to the symbiotic life styles colonization and that symptoms will be less evident on inocu of Enterobacter sp. 638 and E. coli K12 that require efficient lated plants. uptake of host-provided nutrients. Seven sets of 5S, 16S, 23S 0084) Hybrid poplar cuttings, both H1 1-11 (highly sus rRNA genes and one additional 5S rRNA gene were found. A ceptible to fungal disease) and OP-367 (resistant to fungal total of 83 tRNA genes with specificities for all 20 amino disease) will both be inoculated as described. Plants will acids, and a single tRNA for selenocysteine were identified. planted in sterile potting mix, and grown until six to eight I0089. The genome of Enterobacter sp. 638 encodes 8 leaves are present. Plants will then be exposed to fungal Sigma factors:fliA (Entó38 2509: Sigma 28), three rpoB pathogens, and monitored for both time of onset and severity like Sigma 24 (Enté38 3060, Entó38 3117 and Enté38 of physical symptoms of infection. Plants can also be ana 3389), rpoS (Enté38 3212, Sigma 38), rpoD (Enté38 lyzed to determine activity of known disease responsive 3473, Sigma 70), rpoN (Enté38 3638, Sigma 54) and rpoH genes. (Enté38 3865, Sigma 32). 0090 Enterobacter sp. 638 encodes an active dam methy Example 8 lase involved in the adenine methylation at GATC sites, as was confirmed by MboI and Sau3AI digestion of the DNA, Genome Structure and General Features the first enzyme being unable to digest the methylated Entero 0085. The genome of the gamma-proteobacterium bacter sp. 638 DNA. Enterobacter sp. 638 (FIG. 2) includes a single circular chro 0091. On the genome of Enterobactersp. 638 one hundred mosome of 4,518,712 bp with an overall G+C content of palindromic repeats (CCCTCTCCCXXCX)GGGAGAGGG) 52.98%, and it includes a plasmid pENT638-1 of 157,749bp, were found unevenly distributed over the chromosome (see having an overall G+C content of 50.57% (Table 1). The FIG. 10). These hairpin loop forming repeats (with XXCX) chromosome of Enterobacter sp. 638 displays a G+C skew mainly being TGT/ACA or AC/TG) are often located in transition, which corresponds with its replication origin duplicate or triplicate at the 3' end of genes and presumably (oriC) and terminus (FIG. 2). The oriC site contains a perfect play a role in transcription termination. DnaA-binding box (TTATCCACA) (SEQID NO: 2), which 0092. Eight Insertion Sequence (IS) elements were found is located 31.985bp upstream of the dnaAATG start codon (at on the genome of Enterobacter sp. 638: two from the IS3/ coordinate 4,487.245 bp). IS51 family (one composed of three ORFs with a frameshift I0086. The pENT638-1 plasmid displays, based on GC (Enté38 0739, Enté38 0740, Enté38 0741) and one com content, at least four distinct regions (FIG. 3). The plasmid is posed of a single ORF (Enté38 0060)), one IS element from includes an ancestral backbone, which is common to F-family the IS110 family (Enté38 1530), and three IS elements from plasmids and contains the plasmid's basic functions for trans the IS481 family (Enté38 2980, Enté38 3160 and fer and replication, and of regions that were likely acquired Entó38 3288). Some of these IS elements are delimitating via horizontal gene transfer. These regions in the pl’NT638-1 putative genomic islands (see section below). plasmid display a codon usage matrix different from the rest (0093. PlasmidpENT638-1 possesses two complete IS ele of the species of Enterobacteriaceae. In addition, these ments, one from the Tn3 family composed of one ORF regions have no synteny to sequenced chromosomes or plas (Enté38 4224) and one from the IS3/IS407 family com mids from closely related Strains, and these regions interest posed of two ORFs (Enté38 4320 and Entó38 4321), as ingly encode genes related to plant adhesion and coloniza well as two truncated transposases from the latterfamily. The tion. The stable maintenance in Enterobacter sp. 638 of complete IS and the truncated transposase from the IS3/IS407 pENT638-1 and these regions, which presumably play a role families are flanking a large region encoding genes involved in the successful interaction between Enterobacter sp. 638 in plasmid maintenance and replication (SopAB, repA) and and its plant host, seems important regarding the presence of genes involved in plasmid transfer by conjugation (tra). This six relBE toxin/anti-toxin (TA) systems. 75 kb region can be considered as the pENT638-1 backbone. 0087. In contrast, the chromosome of Enterobacter sp. 0094. When comparing the genome of Enterobacter sp. 638 encodes only three couples of toxin/anti-toxin (Ento38 638 with those of closely related strains, Enterobacter can 0434-0435, Enté38 0476-0477, and Enté38 2066-2067). cerogenus ATCC 35316 was determined to be the closest This low number is representative for host-associated organ genome with 80.4% of the CDS in synteny with Enterobacter 1SS. sp. 638, then Klebsiella pneumoniae 342 and MGH 78578 0088. The chromosome encodes 4395 putative coding (both with 74% of the CDS in synteny), followed by Citro sequences (CDS) representing a coding density of 87.9%, and bacter koseri ATCC BAA-895 (73%) and then the Escheri plasmid peNT638-1 encodes 153 putative CDS having a chia coli species (between 63 to 73%) coding density of 80.4%. After their manual annotation, 3562 0.095 The specific adaptation of Enterobacter sp. 638 to CDS (78.3%) could be assigned to a putative biological func its plant host was scrutinized through genome comparison tion, while 835 CDS (18.4%) were annotated as hypothetical with other plant associated microbes and the gastrointestinal proteins of unknown function. Conserved hypothetical pro bacterium E. coli K12 (MG1655). This strain, chosen as a teins are represented by 684 CDS (15.0%), while 151 CDS reference organism because it is the best annotated bacterial (3.3%) had no homology to any previously reported genome, shared (criteria 80% of identity on 80% of the pro sequence. Using the COGnitor module from the MaGe sys tein length) 2938 syntenic CDS (69.2% of their genome) with tem, 3597 CDS (79.1%) could be assigned to one or more Enterobacter sp. 638. The Syntenic regions are grouped in COG functional classes (see FIG. 9). The repartition of 304 syntons with an average number of 10.5 CDS per synton. Enterobacter sp. 638 CDS among the different COG classes 0096 Fifty-six regions were identified on the Entero is very similar to what is observed for E. coli K12. The three bacter sp. 638 genome, which were not in synteny with the most abundant classes are amino acid (E), carbohydrate (G) genomes of closely related bacteria. Among them, eighteen and inorganic iron (P) transport and metabolism and represent regions met the criteria for putative genomic islands (high US 2013/0150240 A1 Jun. 13, 2013

light in grey in table 2). These genomic islands carry genes GHR, Entó38 3779-Enté38 3772) involved in malonate encoding proteins involved in Sugar transport (PTS system), decarboxylation that catalyze the conversion of malonate into adhesion, pectate utilization, iron uptake trough siderophore acetate. receptors, nitrate reduction, pilus biosynthesis, as well as 0101 The diversity of sugar utilization might be related to many others transporters and regulators. Region number 47 is the diversity of glycoside hydrolases. The Enterobacter sp. an illustrative example of the acquisition of a genomic island 638 genome carries 55 genes coding putative glycoside containing genes involved in adaptation for an endophytic hydrolases, representing 24 different families (CAZy data lifestyle. This region encodes a putative pectate transporter base). In contrast, it should also be mentioned that the human and degradation proteins, which may allow strain 638 to grow pathogen Enterobacter Sakazaki possesses 63 glycoside on pectate (an important plant synthesized compound) as a hydrolases (CAZy database). carbon Source. This genomic island is flanked by an integrase 0102 Plant pathogenic bacteria and fungi gain access by gene and inserted into a tRNA-Gly site. actively degrading plant cell wall compounds using glycoside 0097 Eight phages and one putative integrated plasmid hydrolases including cellulases/endoglucanases (including were found on the chromosome. A total of 302 phage pro members of the glycoside hydrolase families GH5, GH9. teins, including 18 putative integrase genes, were identified. GH44, GH48 and GH74), lichenases (GH16) and Xylanases 0098. In addition, the Enterobacter sp. 638 chromosome (GH10, GH11). No glycoside hydrolases representing puta contains a region with Clustered Regularly Interspaced Short tive members of endo-, exo-, cellulase and hemicellulase Palindromic Repeats (CRISPR) located next to six genes families commonly used to break down plant cell wall poly (Enté38 1401-1406) encoding CRISPR-associated mers were encoded on the Enterobacter sp. 638 genome. This sequences (Cas). CRISPR are likely to provide acquired tol observation is consistent with the non phytopathogenic erance against bacteriophages. Six of the eight prophages are behaviour of Enterobacter sp. 638. However, it should be flanking by regions, which lack Synteny with the correspond noted that two endo-1,4-D-gluconases (GH8) (bcsZ: ing regions in closely related bacteria Such as E. coli K12, Enté38 3928. Enté38 3936) were found as part of a bacte O157-H7 and UTI89, Klebsiella pneumoniae MGH 78578 or rial cellulose synthesis locus. Citrobacter koseri BAA-895, and that may have been acquired through phage transduction. These regions contain Uptake of Plant Nutrients genes important in bacteria/plant interactions such as amino acid and iron/siderophore transporters, haemolysin (HCP), 0103 Organisms living in symbiotic association, like and a hemagglutinin protein and transporter (Table 2, FIG. 2). Enterobacter sp. 638 and its poplar host, for example, need to Until now, the inter- or extra-cellular mobility of the genomic share resources, therefore, it is expected that the genome of islands, phages and IS elements was not experimentally dem Enterobacter sp. 638 encodes a large diversity of transporters onstrated. that will allow it to take up plant-released nutrients. A total of 631 ORFs encode for putative transporter proteins: among Example 9 them 295 encoded ABC transporters (including one phos phate transporter), 81 encoded transporters from the major facilitator superfamily (MFS), 41 encoded transporters from Survival in the Plant Rhizosphere: Overview of the phosphotransferase system family (PTS) and 14 encoded Enterobacter sp. 638 Metabolic Capabilities transporters from the resistance nodulation and cell division 0099. In general, poplar is multiplied by cuttings, and family (RND) (see complete list of putative transporters and since the number of endophytes in cuttings is very low, many their substrates in SOM). This observation is consistent with species of endophytic bacteria have to survive in the soil prior the plant associated life style of Enterobacter sp. 638, which to colonizing poplar. Enterobacter sp. 638 is well adapted to requires efficient uptake of plant synthesized nutrients, Survive in the plant rhizosphere because it encodes many including those released into the rhizosphere. transporters involved in carbohydrate, amino-acids and iron 0104. The Enterobacter sp. 638 genome encodes many uptake, as well as some heavy metal resistance genes. Most of PTS transporters. Phylogenetic analysis was used to assign the metabolic pathways described below were confirmed by substrate specificity to the Enterobacter sp. 638 PTS trans cultivating strain 638 under selective growth conditions porters: 7 belonged to the C-glucosides (for uptake of glu (Taghavi et al. 2009). cose, N-acetylglucosamine, maltose, glucosamine and C-glu cosides), 7 to the B-glucosides (for uptake of Sucrose, Carbohydrate metabolism trehalose, N-acetylmuramic acid and B-glucosides), 2 were 0100. The Enterobacter sp. 638 genome encodes all the fructose PTS transporters (for uptake of fructose, mannitol, pathways for central metabolism, including the tricarboxylic mannose and 2-O-O-mannosyl D-glycerate) and 6 were lac acid cycle, the Entner-Doudoroff, the Embden Meyerhof-Par tose PTS transporters (for uptake of lactose, cellobiose and nas and the pentose-phosphate pathways. The strain is unable aromatic B-glucosides). to grow autotrophically, but can use a large variety of com pounds as carbon sources: D-mannitol, lactose, Sucrose, arbu Resistance to Heavy Metals tin, Salicin, trehalose, D-mannose, L-arabinose, maltose, cel lobiose, Xylose, gluconate and glucose (Taghavi et al. 2009). 0105. The Enterobacter sp. 638 genome carries genes Enterobacter sp. 638 possesses a lactase (lacz, Enté38 putatively involved in copper resistance, including a P-type 0928), a xylose isomerase (Enté38 0156) and a xyluloki ATPase CopA (Entó38 0962) whose expression is regulated nase (Enté38 0157). Lactose utilization as a sole carbon by CueR (Entó38 09630), the copper efflux operon cus Source is a characteristic of the Enterobacteriaceae. Entero ABCF (Enté38 1157-1154), the multiple copper oxidase bacter sp. 638 has the genetic capability to grow on malonate, CueC) (Enté38 0671), and an operon coding for the putative it genome contains a cluster of nine genes (mdcABCDEF CopC and CopD copper resistance proteins (Entó38 2411 US 2013/0150240 A1 Jun. 13, 2013

12). Interestingly, the strain failed to grow on 284 glucose controlled via complex regulatory networks. A key regulator minimal medium in the presence of 100 uM Cu(NO). is the hydrogen-peroxide sensor OxyR (Enté38 4025), 0106 The Enterobacter sp. 638 genome also encodes an which activates the expression of a regulon of hydrogen per arsenic/arsenate resistance cluster that was found next to the oxide-inducible genes such as katG, gor (glutathione reduc origin of replication of plasmid pPNT638-1 (arshRBC, tase, Entó38 3913), ahpC, ahpF, oxyS (a regulatory RNA, Enté38 4254-Entó38 4257), and strain 638 was found to Entó38 misc RNA 29), dips A (a DNA protection during grow Successfully on 284 glucose minimal medium in the starvation protein, Enté38 1299), fur (a DNA-binding tran presence of 200 uMarsenate (as NaHASO). Scriptional dual regulator of siderophore biosynthesis and 0107 The presence of arsenate and putative copper resis transport, Entó38 1198) and grxA (glutaredoxin, Entó38 tance genes is not unexpected, as Enterobacter sp. 638 was 1364), all of which are present in Enterobacter sp. 638. Three isolated from poplar growing in the area which was impacted glutathione S-transferase (GST) genes (Entó38 0.139, by emissions from the ASARCO smelter in Tacoma, Wash., a Enté38 0268 and Enté38 1329), a glutathione ABC trans copper smelter that during operations from 1905 through porter (GsiABCD, Enté38 1323-1326), two glutathione 1982 was considered to be one of the largest arsenic emission peroxidase (Enté38 1732 and Enté.38 2699), a gamma sources in the USA. glutamate-cysteine ligase (GishA, Entó38 3168), glu 0108. Other heavy metal resistance genes located on the tathione synthetase (GshB, Entó38 3351) and gamma chromosome include a putative chromate reductase (YieF or glutamyltranspeptidase (GGT. Entó38 3850) were found on ChrR, Enté38 4144) and a P-type efflux ATPase ZntA the genome of Enterobacter sp. 638. An AcrAB (Entó38 (Entó38 3873) involved in Zinc? cadmium/cobalt resistance. 0943-0944) locus, belonging to RND family of transporters Strain 638 was able to grow on 284 glucose minimal medium was also identified on the Enterobacter sp. 638 genome. in the presence of 500 uM ZnSO 500 uM CdCl, 100 uM CoCl2, and 50 uM NiCl2. Although it could be argued that Example 10 these genes are also present in other E. coli species, their presence may be enough to provide a selective advantage over Endophytic Colonization and Establishment in the other bacteria to survive in the rhizosphere, especially when Host Plant these metals are present. 0109 Heavy metals are also important cofactors, and the 0113 Endophytic colonization of a plant host can be Enterobacter sp. 638 genome encodes several genes involved divided into four step process (van der Lelie et al. 2009). in heavy metal uptake and efflux. Genes were found for ABC transporters involved in zinc (ZnuACB, Enté.38 2426-2428) Step 1: Moving Toward the Poplar Roots: and nickel (nik ABCDE, Enté38 1834-Enté38 1838) Motility/Chemiotaxis uptake. Nickel is an essential cofactor for urease (Dosanjh et 0114 Enterobacter sp. 638 is well equipped to actively al. 2007), and unlike E. coli K12 and S. proteamaculans 568, move towards plant roots, the preferred site of endophytic Enterobacter sp. 638 is able to convert urea into ammonia colonization. Its genome contains three flagellar biosynthesis (ureABC, Enté38 3464-Enté38 3466). operons (flgNMABCDEFGHIJKL, flhEAB fim AyralJ lpf) cheZYBR tap tar csuEDCAB int cheWA mot3A flhCD Oxidative Stress, Counteracting the Plant's Defense fliYZA fliCDSTEFGHIJKLMNOPQR, Enté38 2445-2541 Mechanism and fliEFHIJKLMNOPQR). 0110 Plants use a variety of defense mechanisms against (0.115. However, the flh operon of Enterobacter sp. 638 bacterial, viral and fungal infections, including the produc contains two insertions of pili biosynthesis genes. One of tion of reactive oxygen species (ROS) (Superoxide, hydrop these regions (cSu) is flanked by an integrase, pointing to later eroxyl radical, hydrogen peroxide and hydroxyl radical spe acquisition. Enterobacter sp. 638 also has a large number of cies), nitric oxide and phytoalexins. Prior to root pilus/fimbriae biosynthesis genes (at least 60 genes). In colonization, strain 638 has to survive in an oxidative rhizo Enterobacter sp. 638, the pilus/fimbriae biosynthesis genes sphere environment. The Enterobacter sp. 638 chromosome are grouped in 10 distinct regions. Determinants involved in encodes three Superoxide dismutases: SodA, a Mn SuperoX chemiotaxis (che) were also discovered inside the flagellar ide dismutase (Enté38 4063); SodB a Fe superoxide dismu biosynthesis gene cluster. tase (Entó38 1191); and SodC, a Cu/Zn superoxide dismu tase (Entó38 1801). It also contains three catalases, Kat. Step 2 and 3: Adhesion and Colonization of the Roots Surface (Enté38 1712), KatN (Enté38 3129) and KatG (Enté38 4032), three hydroperoxide reductases, ahpC (Enté38 0872 0116. In Enterobacter sp. 638, several genes were identi and Entó38 1145) and ahpF (Enté38 1146), two additional fied encoding proteins involved in the putative adhesion to the hydroperoxide reductases (a putative ahpC Enté38 3391 root. Many are located on genomic islands or on plasmid and Entó38 0498 having an Ahp) domain), a chloroperoxi pENT638-1, pointing towards a specific role of this plasmid dase (Enté38 1149), and two thiol peroxidases (Enté38 during this step of the plant root colonization. In particular, 2151 and Enté38 2976). pENT638-1 contains a 23 kb putative genomic island 0111. We also identified a putative organic peroxide resis (flanked by an integrase gene, and having a GC 96 of 56.2, tance protein (ohr, Entó38 0518) located next to its organic which is significantly higher that the rest of the plasmid), as peroxide sensor/regulator (ohrR, Entó38 0519). well as a putative SrfABC operon. The exact function of the 0112 Enterobacter sp. 638 seems able to detoxify free SrfABC operon remains unclear, but it is believed to be radical nitric oxide by the presence of a flavohemoprotein involved in host colonization. nitric oxide dioxygenase (Enté38 3037) and an anaerobic 0117 Many other genes involved in plant invasion are nitrate reduction operon (nor RVW, Enté38 3181-3183). present on pENT638-1, and include putative proteins with an The expression of the oxidative stress response systems is autrotransporter domain (secretion type V) and a virulence? US 2013/0150240 A1 Jun. 13, 2013 adhesion domain (hemagglutinin (Entó38 4267), pertactin involved in cellulose degradation. However, an operon (Enté38 4201 and Enté38 4206) and adhesion (Enté38 responsible for cellulose biosynthesis was identified 4317)) (FIG. 3). (Entó38 3927-3940). 0118. Hemagglutinin: 0119 The chromosome of Enterobacter sp. 638 encodes Virulence two putative hemagglutinin proteins (Entó38 0148, Entó38 3119), and a cluster composed of five genes encod I0131 Microsopic studies showed that Enterobacter sp. ing for filamentous hemagglutinin (Ento38 0052-0057). 638 colonizes the root xyleme between the lumen of the 0120 In addition, several genes were found on the chro lenticels; no intracellular colonization was observed (Taghavi mosome of Enterobacter sp. 638 encoding for autotrans et al. 2009). porter proteins with a pectin lyase/pertactin domain 0.132. Although Enterobacter sp. 638 was never found to (Enté38 1775, Enté38 0318, Enté38 0501), or an adhe act as an opportunistic pathogen in plant colonization studies, sion domain (Enté38 1867, Enté38 3408). its genome codes for several proteins putatively involved in 0121 The two Enterobacter sp. 638 yadA genes virulence. It should be noted that virulence may also require (Enté38 1867 and Enté38 4317) both encode a protein close interaction between the bacterium and its host, similar with an autotransporter domain and an invasin/adhesion to what may be required for endophytic colonization. One domain. The YadA protein might promote plant colonization/ gene (ygfA, Entó38 3317) coding for an inner membrane invasion, but could also represent a remnant of an ancient hemolysin (family III), a partial CDS (Enté38 0251) con enteric lifestyle. taining a putative hemolysin domain, and three genes hcp 0122) The hemagglutinin gene on pENT638-1 (Enté38 coding for virulence factors (Enté38 0829, Enté38 2912 4267) is surrounded by two RelB/E toxin/anti-toxin systems. and Enté38 3004) were identified. It is hypothesized that the Entó38 4267 hemagglutinin must I0133. Other putative virulence factors include pagC play an important role in root adhesion for been stabilized in (Enté38 3136) and msg.A (Enté38 1656), which are this way on the peNT638-1. Together with the hemagglutinin required for virulence and Survival within macrophages, and gene Entó38 4267, two genes (Entó38 4265-4266) coding putative virK genes (Enté38 1394 and Enté38 2409), for a protein containing a tetratricopeptide (TPR-2) repeat whose product is required for the expression and correct domain were identified, putatively involved in protein-pro membrane localization of VirC (Enté38 3560) on the bac tein interaction and the correct assembly of the adhesion terial cell surface. apparatus. 0134. However, no genes encoding for a type III secretion (0123 Type I and IV Pili: system, which is a prerequisite for an active virulent life style 0.124 Six putative usher proteins were found on the typical for pathogens Such as Erwinia and P. syringae, were Enterobacter sp. 638 genome (Enté38 0084, Enté38 0403, identified on the Enterobacter sp. 638 genome. Enté,38 0990, Enté38 1071, Enté,38 2450, and Enté38 2459). This number is much higher than the average number I0135 Finally, similar to the pENT638-1 plasmid, a of usher proteins found in other genera of plant associated SrfABC operon (Enté38 2108-Enté38 2110) was found on bacteria. the Enterobacter sp. 638 chromosomes. The function of these 0.125. On the chromosome of Enterobacter sp. 638, 56 genes in endophytic behavior remains unclear. genes involved in pili/curli/fimbriae biosynthesis were iden tified, including 6 clusters of type-I pili biosynthesis genes Step 4: Invasion of the Root and in Planta Establishment Via (Enté38 0074-0086, Enté38 0401-0409, Enté38 0987 Active Colonization O994, Enté,38 1068–1072, Enté,38 2448-2451, Enté38 2458-2462). The last two clusters are flanked and separated 0.136 Enterbacter sp. 638 may enter the plant roots at sites by genes involved in chemiotaxis and motility (flagellar bio of tissues damage because its genome sequence does not synthesis) (see section motility), and are possibly involved in encode endof exo-cellulases or hemicellulases that would biofilm formation on abiotic surfaces. This region (Enté38 allow endophytic colonization via the active breakdown of 2445-2541) represents a nice example of clustering genes plant cell walls. involved in different aspects of plant roots colonization (che miotaxis, motility, and adhesion). Pectin/Pectate Degradation 0126 Type IV Pili. 0.137 Although Enterobacter sp. 638 is notable to grow 0127. On the Enterobacter sp. 638 genome, two clusters of on pectin (poly(1,4-alpha-D-galacturonate)) as a sole carbon type-IV pili biosynthesis genes were identified, (Enté38 Source, its genome contains a genomic island encoding the 0650-0652, and Enté38 3266-3268), as well as a cluster of genes involved in the degradation of pectate, the demethy putative uncharacterized pilus biosynthesis genes (Enté38 lated backbone of pectin and a constituent of the plant cell 3804 and Enté38 3808) that are possibly involved in DNA wall. The ability of Enterobacter sp. 638 to degrade pectate uptake. could play a role in colonizing the interspatial region between 0128. Curli Fibers. plant cells. 0129. Structurally and biochemically, curli belongs to a 0.138 A secreted pectate lyase, PelB, involved in the growing class offibers known as amyloids. On the genome of cleavage of pectate into oligosaccharides with 4-deoxy-al Enterobacter sp. 638, one cluster for curli biosynthesis pha-D-galact-4-enuronosyl groups at their non-reducing (Enté38 1553-1559) was identified. ends was found next to an oligogalacturonate-specific porin, KdgM, involved in the uptake of oligogalacturonides into the Cellulose Biosynthesis periplasm. A periplasmic pectinase, PelX, encoded by a dif 0130 Consistent with its non pathogenic behavior the ferent region of the genome, is involved in periplasmic deg genome of Enterobacter sp. 638 does not encode proteins radation of oligogalacturonide. US 2013/0150240 A1 Jun. 13, 2013

0.139. On another region, a carbohydrate uptake ABC rated by an integrase and a putative adhesion/invasion gene. transporter, TogMNAB, involved in the translocation of oli Others regions involved in nitrite transport and reduction gogalacturonide across the inner membrane and several addi (nirBDC, Enté38 3793-3795), nitrate transport and reduc tional proteins, Ogl, Kdul and Kdul), involved in the degra tion (narUZYWV. Enté38 2061-Enté38 2065), and an dation of oligogalacturonide into 2-dehydro-3-deoxy-D- ammonium uptake transporter (amtE, Entó38 0919) and its gluconate, were identified. KdgK and KdgA, involved in regulator (Entó38 0918), as well as the nitrate/nitrite sensor D-glucuronate metabolism, further degrade 2-dehydro-3- protein (narO. Enté.38 2964) were also found on its chromo deoxy-D-gluconate into pyruvate and 3-phosphoglyceralde SO. hyde, both compounds of the general cellular metabolism. This region, which is flanked by a transposase from the IS481 Siderophores family, might have been acquired via horizontal gene transfer. The proteins UxaA, UxaF3, and UxaC, necessary for the alter 0.143 Enterobacter sp. 638 has developed an intermediate native pathway to degrade galacturonate into 2-dehydro-3- Solution to deal with iron uptake. Its genome contains two deoxy-D-gluconate, are also encoded by the Enterobacter sp. ferrous iron uptake systems (FeoAB, EfeUOB) and nine iron 638 chromosome. The degradation of pectate has to be well ABC transporters. regulated in order to avoid a pathogenic effect. 0144. Enterobacter sp. 638 is able to synthesize the sid 0140 Plasmid plENT638-1 carries two neighboring genes erophore enterobactin (EntD, EntF, EntC, EntE, EntB and (Entó38 4201, Enté38 4206) encoding for autrotrans EntA), to secrete it (EntS), to recover the iron-enterobactin porter proteins with a pectin lyase domain. These proteins complex using a ferric siderophore uptake system (EXbDB), may be involved in the adhesion of Enterobacter sp. 638 to the and to extract the iron using an enterobactin esterase (FeS) poplar roots or as part of a colonization mechanism that after internalization of the iron-enterobactin complex. The involves the export of enzymes able to lyse the cell walls of genes involved in this biosynthesis of enterobactin are root cells. Between these two genes, two component tran grouped together with genes encoding two ABC transporters Scriptional regulators were identified, Suggesting a tight regu involved in iron uptake (sitABCD and fepCGDB) in a large lation, as well as two additional genes involved in capsular cluster of 17 genes (Entó38 1111-1128). Furthermore, polysaccharide biosynthesis (Enté38 4207) and encoding Enterobacter sp. 638 possesses 12 outer membrane ferric and for a glycosyl transferase (Enté38 4208). Cell surface ferric-related siderophore receptors (TonB dependent), lipopolysaccharides (LPS) have been hypothesized of being which is almost double of the number found in E. coli K12 involved in host specificity, and the proximity of these genes (that only possesses 7 siderophore receptors). This observa Suggests a collaborative role in plant invasion by Entero tion is consistent for a bacterium that needs to compete for bacter sp. 638. iron. The presence of an efficient iron uptake system can The pENT638-1 Plasmid Cellobiose Phosphorylase therefore contribute to protect the host plant against fungal infection. 0141. On plasmid pENT638-1, the ndvB gene (8532 bp) located next to the plasmid's origin of replication encodes a Antimicrobial Compounds protein involved in the production of B-(1->2)-glucan. The membrane bound NdvB protein catalyzes three enzymatic 0145 Enterobacter sp. 638 was shown to constitutively activities: the initiation (protein glucosylation), elongation, produce phenylethylalcohol. This molecule, which is com and cyclization in situ of B-(1->2)-glucan, which is then monly used in perfumery, gives Enterobacter sp. 638 a pleas released into the periplasm. ant floral odor, but more interestingly has antimicrobial prop erties. Two candidate genes (Entó38 1306 and Entó38 Example 11 1876) encode an enzyme putatively involved in the conversion phenyl-acetaldehyde into phenylethylalcohol. Synergistic Interactions with the Host Plant: Plant These two genes are located on regions not syntenic with Growth Promotion and Health other closely related strains. 0146 4-hydroxybenzoate is a precursor of the important Indirect Plant Growth Promoting Effects electron carrier ubiquinone, but is also known to have anti microbial activity. Enterobacter sp. 638 possesses the ubiC Nitrogen Fixation and Metabolism (Ento38 0243) gene that codes for the putative protein able to perform this reaction. 0142 Enterobacter sp. 638 is unable to fix nitrogen and lacks the required nif genes. However, it contains the genes 0147 The Enterobacter sp. 638 genome encodes a required for dissimilatory and assimilatory nitrate reduction chloramphenicol acetyltransferase (cat, Entó38 1533) pathways. The nitrate transport and nitrate/nitrite reduction involved in chloramphenicol resistant and that may help the genes are present within two operons (nar|JHGKXL and bacteria to be survive against the antimicrobial compounds nasAB introBA nasR, Enté38 2312-Enté38 2326) sepa produced by other endophytic or rhizospheric organisms. US 2013/0150240 A1 Jun. 13, 2013 12

Example 12 the tryptophane degradation pathway VII (aromatic amino acid aminotransferase, Entó38 1447). The indolpyruvate Direct Plant Growth Promotion by Enterobacter sp. decarboxylase IpdC (Entó38 2923) and the putative indole 638 3-acetaldehyde dehydrogenases (Enté38 0143) further 1-aminocyclopropane-1-carboxylate deaminase catalyze IAA Synthesis. 0148. The 1-aminocyclopropane-1-carboxylate (ACC) 0154 While there have been described what are presently deaminase (acd), (EC: 3.5.99.7) is absent from the Entero believed to be the preferred embodiments of the invention, bacter 638 genome, which confirms previous studies that the those skilled in the art will realize that changes and modifi strain is unable to metabolize ACC (Taghavi et al. 2009). cations may be made thereto without departing from the spirit However, amino acid deaminase was found, but they all lack of the invention, and it is intended to claim all Such changes the particular amino-acids E 296 and L 323 (respectively and modifications as full within the true scope of the invention replaced by a T or S and a T) that approach the pyridine as set forth in the appended claims. nitrogenatom of PLP in the active site to. TABLE 1 Production of the Roots Growth Promoting Hormones Acetoin, and 2,3-Butanediol Enterobacter sp. 638 014.9 The Enterobacter sp. 638 genome carries the gene poxB (Enté38 1387) encoding a pyruvate dehydrogenase. traits Chromosome Plasmid While the principal function of PoxB is to convert pyruvate size (bp) 4, 518, 712 157,749 into acetaldehyde, a small fraction of the pyruvate is con G + C content S2.98 50.57 verted to acetoin, as a by-product of the hydroxyethyl-thia ORF numbers 4406 152 Assigned function (including putative) 3457 108 min diphosphate reaction intermediate. Amino acid biosynthesis 174 2 0150. The Enterobacter sp. 638 genome encodes an aceto Aromatic amino acid family 28 O lactate synthase (budB, Enté.38 2027) involved in the con Aspartate family 44 O Glutamate family 47 1 version of pyruvate to acetolactate. The acetoin decarboxy Pyruvate family 35 1 lase (budA, Entó38 2026) catalyzes the conversion of Serine family 21 O acetolactate into acetoin. Acetoin can be released by the bac Histidine family 11 O teria or subsequently converted into 2,3-butanediol by the Purines, pyrimidines, nucleosides, and 93 O acetoin reductase (budC, Enté.38 2028) either by Entero nucleotides Fatty acid and phospholipid metabolism 71 O bacter sp. 638 or by the poplar. Under aerobic condition, Biosynthesis of cofactors, prosthetic groups, 195 2 acetolactate is spontaneously converted into diacetyl, which and carriers in turn can be converted into acetoin by the acetoin dehydro Central intermediary metabolism 218 2 genase protein (Ento.38 2737). Energy metabolism 553 2 Transport and binding proteins 631 3 0151. The biosynthesis of volatile compounds by Entero Percentage of transporter proteins 14% 296 bacter sp. 638 and their induction by the addition of poplar ABC family 293 2 leaf extracts was investigated via mass spectrometry. The MFS family 79 2 production of 2,3-butandiol and acetoin was seen for samples PTS family 41 O containing Enterobacter sp. 638 and poplar leaf extract RND family 14 O Amino acids, peptides and amines 118 O beginning 12 hours after induction (FIG. 8). It should be Anions 2O O noted that diacetyl synthesis could not be confirmed, but is Carbohydrates, organic alcohols, and acids 106 1 likely to occur based on the presence of the complete meta Cations and iron carrying compounds 109 1 bolic pathways for the three compounds. Additional peaks Nucleosides, purines and pyrimidines 9 O Porins 18 O were seen in both the experimental and control samples (6:42, Unknown Substrate or drugs 2 O 9:45, and 14:01) and identification of these compounds is DNA metabolism 152 4 currently being performed. Transcription 281 4 0152 The genome of Enterobacter sp. 638 lacks the genes Protein synthesis 177 O Protein fate 188 1 (acoABCX adh) involved in the catabolic conversion of Regulatory functions 515 6 acetoin and 2,3-butanediol to central metabolites. Therefore two component system 65 3 there is no antagonistic effect between the production and the Cell envelope 279 3 degradation of these plant growth hormones by Enterobacter Cellular processes 457 6 sp. 638. Biological processes 276 O RHS 2 O Plasmid functions 7 42 Production of the Plant Growth Hormone IAA putative integrated plasmid 1 O couple of toxinfanti-toxin 3 7 0153. The production of indole acetic acid (IAA) by Prophage functions 3O2 O Enterobacter sp. 638 was experimentally demonstrated Phage regions 8 (Taghavi et al. 2009). IAA biosynthesis is likely through the production of indolepyruvate as an intermediate molecule by US 2013/0150240 A1 Jun. 13, 2013

TABLE 2

alternat. Synteny Synteny Synteny Re- Repeat Pro- codon with with with gion From Enté38 to Enté38 size ORFs inttnpon ext, phage tRNA matrix K12 342 568

1241.82 O108 132857 0114 8675 2

332190 283 335579. 286 3389

8 436726 0385 441897 O391 5171 7 - I - 9 454627 O401 464O73 0410 9446 11 - I ------10 477929 0423 487952 0435 10O23 12 ------

13 852653 O750 86.0429 O756

15 1027052 O924 1042473 0937 15421 15 - I - I -

5 išti s 18 1386OO2 1260 139228O 6278 5 ------191433737 1306 1438417 4680 5 - - -- 2O 1441382. 1312 1446428 5046 3 - || - -- --

25 1886.255 1892165 26 1929035 775 1937050 1781 27 2000083 841 2001815, 1843 28 2015.509 1858 2072420 1909 56911 51 29 2115297 1949 2225.046 2051 109749 103 30 226OO61. 2081 22726.28 2096 12567 16 31 2285577 2108 2302826, 2119 17249 ES: 35

34 2534142 2346 2547263. 2356 13121 11 isis:

38 2847O62 2647 2851589 2650 39 2902726 2690 2.935856. 2719 3888 41. 32.36067. 298O 53890 299

45 3491626 3205 3495685 3208 4059 46 358195 3279 3586O7 28 4116

48 3688.251 3384 3715.198. 34.08 26947 25 - || - 49 3738O15. 3433 3750557. 3442 12542 10 - I - 50 3772O76 3463 3377701 4 3469 4938

54 4255568 3936 4269242 394.4 13674 9 - I -

56 442.5327 4O70 443777O 4081 12443 12 - I - 495 US 2013/0150240 A1 Jun 13, 2013 14

TABLE 2-continued Region Gene content Presence in (*) Remarks additional observations 1 transporter for Sugar uptake (PTS lactose transporter for Sugar uptake (PTS lactose family), Beta-glucosidase (conversion of family), Beta-glucosidase (conversion of cellobiose into glucose or glucoside into cellobiose into glucose or glucoside into glucose), filamentous haemagglutinin, glucose), filamentous haemagglutinin transporter (MFS family), Predicted Zn dependent hydrolases. ORFs of unknown function Fimbriae biosynthesis Putative membrane-associated metal-dependent inside awaa operon hydrolase, Glycosyltransferase Hemolysin activation secretion protein Rhs, peptidoglycan-binding (LysM), several Rhs partial duplication Fructokinase, fructose biphoasphate aldolase dowstream of this region an Integral membrane sensor hybrid histidine kinase precursor Is absent from the K12 genome Nickel chelation for upake or usage as cofactor, Outer membrane autotransporter with Pectin lyase fold virulence factor (adhesin) Regulator, FMN-dependent NADH aZoreductase 2, Protein of unknown function, Antibiotic resistance Fimbriae biosynthesis for adhesion?virulence, genes duplicated 10 Cytochrome, regulator, unknown function, dihydroorotase (peptidase), putative selenocysteine synthase L-seryl-tRNA(Ser) selenium transferase (Pyridoxal phosphate dependent) 11 integrase, phage protein, DNA repair (Dnd proteins), plasmid stabilization system, pectate yase, oligogalacturonate-specific porin (KodgM), protease, possible anti-oxydant, regulators, autotransporter filamentous haemagglutinin adhesin, regulator, trancriptionnal regulator involved in virulence, system de Secretion, possibly secretion of virulence factor 12 ron-hydroxymate transporter (MFS and ABC amily) 13 Regulator, ABC transporter for amino acids the synteny is broken but the genes from this region are present on the K12, 342 and 568 genomes 14a integrase, phage proteins 14b Transduction with Phage 1: alpha/beta hydrolase, fimbrial protein, amino acid transporter, methylatransferase, two component sensor/regulator, permease, S-methylmethionine transporter, S-methylmethionine: homocysteine methyltransferase, haemolysin co-regulated protein (HCP), ferric ABC transporter (syntenic with K12), integrase 15 Regulator, lactose degradation (Syntenic with K12), signal transduction (domain EAL), transporter (beta-glucoside PTS family) 16a Phage integrase, phage proteins 16b Transduction with Phage 2: Putative TonB dependent siderophore receptor, phenylalanine transporter, Nucleoside: H+ symporter, Transcriptional regulator (Lacl, XRE, TetR, LysR, GntR), permease (MFS family), fimbriae, dihydropteridine reductase, metallo hydrolase/oxidoreductase, Ferrichrysobactin TonB-dependent siderophore receptor, Enterochelin esterase, P-type ATPase transporter, RND transporter, Ribosomal large Subunit pseudouridine synthase A, Putative cold-shock DNA-binding domain protein, TonB-dependent receptor, ABC transporter for amino acids, GCN5-related N-acetyltransferase, ABC transporter for chelated iron (SitABCD) US 2013/0150240 A1 Jun. 13, 2013 15

TABLE 2-continued 17 ABC transporter Ribose uptake, ribose kinase, The flanking region Methionine metabolism (Enté38 1145-1152) coding alkyl hydroperoxide reductase (F52a subunit), chloride peroxide, and ribonuclease were found on 342 but not on 568 and partially on the K12 genome. 18 Histidine degradation (hutlGCUH) 19 Aldoketo-oxidoreductase, Glycoside hydrolase (family 1), Transporter (PTS lactose/cellobiose family, IIC subunit), Transcriptional regulator (GntR) 2O Alpha-glucosidases (glycosyl hydrolases family 31), Hexuronate transporter, Periplasmic binding protein. LacI transcriptional regulator 21 Putative Fucose 4-O-acetylase and related Cyclopropane-fatty-acyl-phospholipid acetyltransferases, phage proteins, putative synthase, Amine oxidase encoded on the TonB-dependent siderophore receptor 342 genome 22 Crispr associated protein 23 Cyclopropane-fatty-acyl-phospholipid synthase, The pyrimidine degradation Amine oxidase, transporter (MFS), pathway is present of the transcriptional regulator, Glycosyltransferase, genome of the three bacteria Methionine aminopeptidase (MAP) (Peptidase 342, 568 and K12. Next to this M), arylsulfatase: Sulfur metabolism, alternative region (Ent 1551-1562), pyrimidine degradation pathway, 342 and 568 lack a region autotransporter/Filamentous encoding for the production of haemagglutinini Adhesin (fragments), IS curli transposase (family IS110), Chloramphenicol acetyltransferase (CAT), alternative pyrimidine degradation pathway 24 Phage proteins The gene (regulators and diguanylate The region Enté38 1584-1597 cyclase) flanking region 24 involved in flagellar (Entó38 1658-1669) are absent in 568. biosynthesis is lacking in 342 (figNMABCDEFGHIJKL). The genes Enté,38 1688-1695 (phosphatidyl transferase, ABC thiosulfate sulfur transporter and thiosulfate sulfur transferase) are absent from the 568 genome. 25 TonB-dependentheme/hemoglobin receptor family protein for iron uptake 26 Autotransporter for adhesion, ABC transporter The genome of 342 and 568 contain the system for amino acid glutamine uptake, ABC transporter system for amino Putative metal-dependent RNase, acid glutamine uptake genes from consists of a metallo-beta-lactamase this region. domain and an RNA-binding KH domain, carbonic anhydrase 27 Phage integrase (fragment), incomplete phage inserted into a two component sensor regulator (RstAB) 28 Chemotaxis mobility?, Autotransporter adhesin invasin-like protein (Yada), Antibiotic biosynthesis, RND efflux system nodulation?, RND efflux system drug resistance, Unknown function but Small possible legume lectin, beta domain for attachement, MFS transporter, lysophospholipase, coagulasefibrinolysin, Phage regulator, SOS response 29 RND transporter, Pectin acetylesterase, Many possibly not an island but acquisition of discontinuous synteny: unclear gene involved in amino acid transport, Many many gene (compared with K12) during delimitation of transcriptional regulator, Putative IAA Endophytic evolution the region acetyltransferase, Sucrose fructose utilisation with PTS from the beta-gle family, synthesis of acetoin, periplasmic disulfide isomerasethiol disulphide oxidase (DsbG), depolymerisation of alginates, many transporters and many regulators 30 Glutamate ABC transporter, Amino acid ABC possibly not an island but acquisition of transporter, Chemiotaxis: aerotaxis many gene (compared with K12) during Endophytic evolution 31 Virulence proteins SrfA, methionine synthase, presence of the SrfABC genes on the 568 Polygalacturonase, pectate lyase (Secreted), genome chondroitin AC alginate lyase, together with US 2013/0150240 A1 Jun. 13, 2013 16

TABLE 2-continued pectate lyase important for colonisation (secreted), putative hydrolase (Secreted), Transcriptional regulator, Chemiotaxis: aerotaxis 32a Phage, phage integrase 32b Transduction with Phage 6: GCN5-related N acetyltransferase, Transcriptional regulator (TetR), N-ethylmaleimide reductase, Oxidoreductase, permease transporter, dehydrogenase, putative intracellular septation protein involved in cell division, hydrolase, membrane spanning TonB, 2-dehydropantoate, Putative drug? metabolite exporter (DMT family). 33 Integrase, nitrate reductase (NasA), nitrate Presence of the entire region reductase (NashB), nitrate transport (NrtCBA), except the integrase gene region flanked by the nar operon involved in nitrate reduction and nitrate/nitrite transport 34 oxidoreductase, Amino acid ABC transporter, purine ribonuclease efflux, trehalase (trehalose degradation), tonB-dependent siderophore 35 integrase, fimbriapili (located next to 342 is also lacking the flanking region 568 genomes are lacking the chemotaxis genes and fimbria genes) coding genes involved in fimbrial region Entó38 2477-2490 biosynthesis encoding genes for an intracellular proteasef amidase, a ferritin-like protein, an anaerobic C4-dicarboxylate transporter, a transporter (MFS family), a putative Ribose galactose isomerase, a putative metal-dependent phosphohydrolase, another ferritin iron storage protein, a tyrosine transporter and several conserved protein of unknown function. Some of these genes are also absent in K12. 36 Acyl-CoA reductase (LuxC) and Acyl-protein Next to a large region of flagelle encoding synthetase (LuxE) which are Substrat for light genes fli which is lacking in 342. production by luciferase, Transketolase, fatty acid biosynthesis 37a Transduction with Phage 7: Outer membrane protein N, N-acetylmuramic acid 6-phosphate etherase, Two-component sensor/regulator, Thiamine biosynthesis lipoprotein, Putative NADH: flavin oxidoreductase, Tartrate transporter, anaerobic class I fumarate hydratase, regulators (for cysteine biosynthesis and nitrogen assimilation), P1-type ATPase, Universal stress protein G, transporter (RND), Putative acyltransferases, palmitoyl transferase or Lipid A, shikimate transporter, AMP nucleosidase, Aminopeptidase P, four tRNA ASn locus, DNA gyrase inhibitor D-alanyl-D- alanine carboxypeptidase 37b Phage integrase, phage proteins Transduction with the phage? 38 LPS biosynthesis Most of the flanking region from Enté.38 2645 to Enté.38 2672 involved in LPS biosynthesis are absent from the 342 and 568 genomes but present in K12 39 glutathione peroxidase, phosphorilation of lipid, presence of amino acid ABC transporter, amino acid ABC transporter, diaminobutyrate diaminobutyrate catabolism in the 342 and catabolism, tyrosine kinase, phosphatase 568 genomes 40 Putative integrated plasmid: phage integrase, Putative integrated plasmid plasmid function, phage integrase, Surface reorganisation resulting in increased adherence and increased conjugation frequency 41 Transposase (IS481), Transporter (PTS Lactose family), Asparaginase, leucyl amidopeptidase 42 Transcriptional regulator, MFS transporter, beta-xylosidase, Xyloside transporter 43a Phage integrase, endonuclease, phage protein (uncomplete phage) US 2013/0150240 A1 Jun. 13, 2013 17

TABLE 2-continued 43b Transduction with Phage 8: Kinase, Sigma anti The gene encoding for non-haem sigma factor, Putative hemagglutinin hemolysin manganese-containing catalase rpoS protein, Hemagglutinin transporter (outer dependent (KatN), membrane protein, ABC permease, MFP), Cytochrome bd ubiquinol putative 2-aminoadipate transaminase, non oxidase, Subunit I & II, haem manganese-containing catalase rpoS competence damage-inducible protein A dependent (KatN), Cytochrome bd ubiquinol are present on the 342 genome. oxidase, Subunit I & II, competence damage inducible protein A, virulence membrane protein (Pag), Transcriptional regulator (LysR), Short-chain dehydrogenase/reductase, Methyltransferase type 11, putative deaminasef amidohydrolase with metallo dependent hydrolase domain, putative carbamate kinase, Xanthinefuracili vitamin C permease, putative DNA-binding transcriptional regulator 44 ABC transporter 45 ABC transporter involved in Fe3+ transport (EitABCD) 46 GCN4-N-acetyltransferase, trancriptionnal regulator, 6-P-beta-glucidase, Transporter (PTS lactosef cellobiose family), regulator lacl-like 47 Pectin degradation protein, transposase family Except the genes Entó38 3288: the IS IS481, ABC transporter (possibly for Sugar with element (IS481 family), and Enté38 3293 a specialisation in pectin transport) encoding the oligogalacturonide lyase. The (TogMNAB), Pectin degradation, genome of 568 doesn't encode the proteins Oligogalacturonate-specific porin precursor involved in pectin degradation. (product of pectin degradation), Regulator 48 Autransporter with adhesin domain, antioxidant, Molybdenum ABC transporter, Iron ABC transport protein, periplasmic-binding component, Mechanosensitive ion channel, Chemiotaxis regulator, Autransporter with a Serine-rich adhesin domain 49 Sugar transporter (MFS), Iron compound 342 genome lacks Enté38 3433-3436 binding protein of ABC transporter family, (unsaturated glucuronyl hydrolase, periplasmic component (iron-enterobactin oligosaccharide? H+ symporter, a conserved transporter), TonB-dependent siderophore protein of unknown function and a receptor transcriptional regulator (AraC family) 50 Urease (ureDABCEFG) 51a. Phage integrase, phage proteins (conserved in Some of the phage genes are syntenic with K. pneumoniae, E. coli UTI89) 568. Transduction with Phage 9: Phosphatidylglycerol-membrane-oligosaccharide glycerophosphotransferase, Transcriptional regulators (LysR, TetR, XRE), Metallo hydrolase, putative mRNA endoribonuclease, heat shock protein (DnaJ), siderophore, fused signal transducer for aerotaxis sensory, putrescine:2-oxoglutaric acid aminotransferase 52 Malonate (mdc genes), Malonate transporter Entó38 3658-3662: salicylic (family of auxin efflux carrier) (MdcF) acid transporter, putative N-acetylmannosamide kinase and N-acetylneuraminate lyase and the regulator (nanKTAR) are absent on the genome of 342 and 568 53 Fatty acid biosynthesis Except the genes Entó38 3900-3905 encoding a 4'-phosphopantetheinyl transferase (acpT), a short-chain dehydrogenase/reductase SDR precursor, a NLP/P60 protein precursor (similar to putative Cell wall-associated hydrolases (invasion-associated proteins), a HAD-superfamily hydrolase, subfamily IB (PSPase-like), a tellurium resistance protein (terC), and an Ion transport 2 protein S4 Cellulose biosynthesis (bcsZDCBA) 55 Transporter (Beta-glucoside PTS family) 56 Ribose ABC transporter, raffinose operon in addition, 568 lacks the flanking region (transportfutilisation) Enté38 4064-4070 encoding the rhaTRSBADBA (L-rhamnose: proton Symporter, DNA-binding transcriptional activator, L-rhamnose-binding, DNA binding transcriptional activator, L US 2013/0150240 A1 Jun. 13, 2013 18

TABLE 2-continued rhamnose-binding, rhamnulokinase, L rhamnose isomerase, rhamnulose-1- phosphate aldolase, D-ribose ABC transporter, periplasmic rhamnose-binding protein precursor, Ribose import ATP bindina protein rbSA 1) The coordinate given are those of the genes, not those of the repeat from phage organism used for the comparison: K.pneumoniae MGH78578, E. coii K12, O157-H7, UTI89, C. koseri BAA-895 Compared with 568 and 342, K12 and 638 have the operons: 0231-0234 porins and lipoproteins;

TABLE S1 TABLE S1-continued

(PRIMERS) (PRIMERS)

Locus Gene Sequence Tm Locus Gene Sequence Tm Ente38 2025 budRf TATTCCCGCAGGAGATTGCT 58 Enté.38 2028 budCf TTTGCGGCAGTGGAGAAAG 59 Ente38 2025 budRr AAGCTGTGACGACTGCAACATATT 59 Ente38 2028 budCr TGGCGTGATCGACT CAATTG 59 Enté.38 2026 budAf GGCGAAATGATTGCCTTCAG 59 Enté38 4249 repAf TAGCAAGAAAACAGGCGACAAGT 59 Enté.38 2026 budAir CCAGGTCATTACTGCGAAAGGT 59 Enté38 4249 repAr GCAGTCGCTCATCAGCTTGA 59 Enté.38 2027 budBf ACAGCCCCGTTGAATACGAA 59 Enté38 R0104 16Sf AGTGATTGACGTTACTCGCAGAAG 59 Ente38 2027 budBr GGGCACATAGTTGCGTTCTTC 58 Enté38 R0104 16Sr TTTACGCCCAGTAATTCCGATT 59

TABLE S4 Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté.38 O190 2.127 O.O263 10.447 protein chain J Translation, elongation factor EF- ribosomal Tu (duplicate of tufA) structure and biogenesis Enté.38 0194 2.453 0.0257 11.518 50S ribosomal subunit J Translation, protein L1 ribosomal structure and biogenesis Enté.38 O195 3.1 O.O837 3.807 50S ribosomal subunit J Translation, protein L10 ribosomal structure and biogenesis Enté.38 O197 2.372 O.O269 10.192 RNA polymerase, K Transcription beta subunit Enté.38 0200 2.687 O.O242 13.404 Phosphotransferase G Carbohydrate system, transport and lactosef cellobiose- metabolism specific IIB subunit Enté.38 O213 3.284 0.133 2.85 HU, DNA-binding T Signal transcriptional transduction regulator, alpha mechanisms Subunit Enté.38 0238 2.351 O.O2O2 17.811 maltose transporter G Carbohydrate Subunit; periplasmic- transport and binding component of metabolism ABC Superfamily Enté.38 0241 6.748 0.00954 58.758 maltose Outer G Carbohydrate membrane porin transport and (maltoporin) metabolism Enté.38 0285 2.719 O.O369 7.441 Fructose- G Carbohydrate bisphosphate transport and aldolase 1 metabolism Enté.38 0286 2.061 0.0767 4.042 Putative ABC-type R General function Sugar transport prediction only system, auxiliary component US 2013/0150240 A1 Jun. 13, 2013 19

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté,38 0287 4.625 OO166 22.815 Periplasmic ribose- G Carbohydrate binding protein of transport and ABC transport system metabolism Enté,38 0326 8.129 OO18 35.517 aspartate ammonia- C: E Energy yase production and conversion; Amino acid transport and metabolism Enté,38 0449 3.34 O.066 4.515 Putative C4- R General function dicarboxylate prediction only anaerobic carrier CSO Enté,38 0450 3.464 O.0439 6.095 Ornithine F Nucleotide carbamoyltransferase transport and (OTCase 1) metabolism Enté,38 0451 4.851 O.O779 4.01 Carbamate kinase E Amino acid transport and metabolism Enté,38 0452 4.792 O.O298 9.144 Arginine deiminase E Amino acid (ADI) (Arginine transport and dihydrolase) (AD) metabolism Enté,38 0641 2.63 O.O294 9.327 GTP-binding tubulin- D Cell cycle ike cell division control, cell protein division, chromosome partitioning Enté,38 0660 3.804 O.O179 29.044 pyruvate C; G Energy dehydrogenase, production and decarboxylase conversion; component E1, Carbohydrate hiamin-binding transport and metabolism Enté,38 0662 4.208 0.000915 219.599 lipoamide C Energy dehydrogenase, E3 production and component is part of conversion hree enzyme complexes Enté,38 0665 3.576 O.O247 13.073 bifunctional aconitate C: E Energy hydratase 2 and 2- production and methylisocitrate conversion; Amino dehydratase acid transport and metabolism Enté,38 0685 2.019 O.O799 3.932 DNA-binding T Signal transcriptional transduction regulator of rRNA mechanisms transcription, DnaK Suppressor protein Enté,38 0716 2.254 O.O262 10.425 periplasmic M Cell chaperone wall membrane? envelope biogenesis Ento38 O759 2.044 O.O348 7.757 D-sedoheptulose 7- G; M Carbohydrate phosphate isomerase transport and metabolism: Cell wall membrane? envelope biogenesis Enté,38 0896 2.304 O.O289 9.511 cytochromeo C Energy ubiquinol oxidase production and subunit IV conversion Ento38 0897 3.49 O.OSO6 5.52 cytochromeo C Energy ubiquinol oxidase production and subunit III conversion Enté,38 0898 2.487 O.103 3.372 cytochromeo C Energy ubiquinol oxidase production and subunit I conversion Enté,38 0899 3.03 O.O151 27.174 cytochromeo C Energy ubiquinol oxidase production and subunit II conversion US 2013/0150240 A1 Jun. 13, 2013 20

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté,38 0903 2.094 0.00815 50.908 peptidyl-prolyl O Posttranslational cis/trans isomerase modification, (trigger factor) protein turnover, chaperones Enté,38 O987 2.028 O.O24 12.433 Type-1 fimbrial N; U Cell protein, A chain motility: Intracellular precursor (Type-1A trafficking, pilin) Secretion, and vesicular transport Enté,38 1050 -2041 0.0481 -5.699 hypothetical protein S Function of unknown function unknown Enté,38 1053 -2.279 0.0484 -5.665 Lipolytic enzyme, G- R General function D-S-L family precursor prediction only Enté,38 1182 3.2O1 O.O161 24.254 glutamate and E: T Amino acid aspartate transporter transport and Subunit; periplasmic- metabolism; Signal binding component of transduction ABC Superfamily mechanisms Enté,38 1204 2.631 O.O184 20.459 putrescine/proton E Amino acid Symporter: transport and putrescinefornithine metabolism antiporter Enté,38 1205 4.027 O.O258 10.764 ornithine E Amino acid decarboxylase transport and isozyme, inducible metabolism Enté,38 1221 2.03 O.O244 12.635 citrate synthase C Energy production an conversion Enté,38 1224 2.59 O.O24 12.596 Succinate C Energy dehydrogenase, production an flavoprotein subunit conversion Enté,38 1226 5.448 0.0244 13.456 2-oxoglutarate C Energy decarboxylase, production an thiamin-requiring conversion Enté,38 1227 4.206 O.O.309 8.724 dihydrolipoyltransSuccinase C; I Energy production an conversion; Lipid transport and metabolism Enté,38 1228 2.918 0.0417 6.508 Succinyl-CoA C Energy synthetase, beta production an Subunit conversion Enté,38 1229 4.423 O.O171 23.421 Succinyl-CoA C Energy synthetase, NAD(P)- production an binding, alpha Subunit conversion Enté,38 1231 2.73S O.O329 8.087 cytochromed C Energy erminal oxidase, production an subunit II conversion Enté,38 1263 3.27 O. 116 3.114 Urocanate hydratase C Energy (Urocanase) production an (Imidazolonepropionate conversion hydrolase) Enté,38 1298 2.106 0.0633 4.648 glutamine transporter E: T Amino acid Subunit; periplasmic transport and binding component of metabolism; Signal ABC Superfamily transduction mechanisms Enté,38 1338 -3.1 O2 O.OS33 -5.307 Putative Fucose 4-O- G Carbohydrate acetylase and related transport and acetyltransferases metabolism Enté,38 1341 -2.111 O.OS83 -4.928 conserved D; L; N: T Cell cycle hypothetical phage control, cell exported protein of division, unknown function chromosome partitioning; Replication, recombination and repair; Cell motility; Signal US 2013/0150240 A1 Jun. 13, 2013 21

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription transduction mechanisms Enté,38 1430 2.324 O.0436 6.138 30S ribosomal subunit J Translation, protein S1 ribosomal structure and biogenesis Enté,38. 1469 2.039 O.O2S4 11.293 outer membrane M Cell protein A (3a; II*; G; d) wall membrane? envelope biogenesis Enté,38. 1490 3.067 O.15 2.63 Putative R General function oxidoreductase, prediction only short-chain dehydrogenase/reductase family Enté,38. 1499 -2.164 O.0429 -6.238 Glycosyltransferase G Carbohydrate transport and metabolism Enté,38 1514 3.223 O.O191 19.678 glucose-1- G Carbohydrate phosphataseinositol transport and phosphatase metabolism Enté,38 1526 -2.828 0.0203 -18.472 Putative U intracellular autotransporter trafficking, protein (fragment) Secretion, and vesicular transport Enté,38 1587 3.209 OO163 22.337 flagellar component N Cell motility of cell-proximal portion of basal-body rod Enté,38 1588 S.216 O.O263 10.4 flagellar component N Cell motility of cell-proximal portion of basal-body rod Enté,38 1589 3.559 O.O167 24.377 flagellar hook N Cell motility assembly protein Enté,38 1590 3.744 O.O2SS 11.515 flagellar hook protein N Cell motility Enté,38 1591 2.479 O.O333 7.975 flagellar component N Cell motility of cell-proximal portion of basal-body rod Enté,38 1596 2.019 O.149 2.64 flagellar hook- N; T Ce filament junction motility; Signal protein 1 transduction mechanisms Enté,38 1597 2.902 0.0555 5.128 flagellar hook- N Cell motility filament junction protein Enté,38 1656 -2.303 0.0245 - 12.219 Virulence protein R General function msg.A prediction only Ento,38 1657 -2-183 O.OSS4 -5.161 Methyl-accepting N; T Cell chemotaxis sensory motility; Signal transducer transduction mechanisms Enté,38 1724 2.288 O.O974 3.474 threonyl-tRNA J Translation, synthetase ribosomal structure and biogenesis Enté,38 1725 2.256 O-111 3.214 Bacterial translation J Translation, initiation factor 3 ribosomal (BIF-3) structure and biogenesis Ento,38 1750 2.083 O.O467 5.875 Formate C Energy dehydrogenase, production and nitrate-inducible, conversion major subunit Enté,38 1755 -2.084 OO612 -4.785 Hypothetical protein S Function of unknown function unknown US 2013/0150240 A1 Jun. 13, 2013 22

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté,38 1773 -2.188 0.0251 -10.953 DL-methionine P norganic ion transporter subunit; transport and periplasmic-binding metabolism component of ABC Superfamily Enté,38 1804 -2.004 O.O317 -8.356 conserved protein of S Function unknown function unknown Enté,38 1841 -2.107 O.O415 -6.448 Putative lambdoid L Replication, prophage Rac recombination integrase (fragment) and repair Enté,38 1856 -2.048 O.O317 -8.405 fragment of DNA- T Signal binding transduction transcriptional mechanisms regulator (part 2) Enté,38 1903 -2.118 0.0224 -15.399 Hypothetical protein S Function of unknown function unknown Enté,38 1915 -2.007 O.O294 –9.325 Acid shock protein R General function CSO prediction only Enté,38 1941 -2.307 O.O2S -13.516. Hypothetical S Function exported protein of unknown unknown function Enté.38 2031 -2.058 O.O382 -7.016 Periplasmic disulfide O Posttranslational isomerasethiol- modification, disulphide oxidase protein turnover, chaperones Enté.38 2051 -2.094 O.0432 -6.201 Putative F Nucleotide polyphosphate kinase transport and metabolism Ento.38 2057 2.542 O.0477 5.757 Outer membrane M Cell porin protein wall membrane? envelope biogenesis Enté.38 2166 -2.293 O.O395 -6.835 peripheral inner R General function membrane phage- prediction only shock protein Enté.38 2210 -2.647 0.0248 -11.137 fragment of S Function conserved protein of unknown unknown function (part 2) Enté.38 2218 -2.072 0.0248 -11.07 Phage protein Enté.38 2221 -2.12 0.0237 -14.041 Putative phage ipoprotein Enté.38 2243 -2.466 0.0268 -10.246 conserved protein of S Function unknown function unknown Enté.38 2246 -2.359 O.O3S3 -7.673 Hypothetical protein S Function of unknown function unknown Enté.38 2250 -2339 O.O879 -3.692 Phage DNA methylase L Replication, N-4N-6 domain recombination protein and repair Enté.38 2256 -3.509 0.0169 -23.668 Phage DNA-damage inducible protein I Enté.38 2269 -2.086 0.0247 -13.482 Prophage lambda L Replication, integrase recombination (Int(Lambda)) and repair (Prophage e14 integrase) Enté.38 2281 -2.145 0.024 -12.802 Alcohol C Energy dehydrogenase, zinc- production and binding domain conversion protein Enté.38 2282 -2.245 0.0189 -19.648 conserved membrane S Function protein of unknown unknown function Enté.38 2302 3.151 0.0753 4.113 oligopeptide E Amino acid transporter subunit; transport and periplasmic-binding metabolism component of ABC Superfamily US 2013/0150240 A1 Jun. 13, 2013 23

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté.38 2303 -2.254 O.0545 -5.217 conserved membrane S Function protein of unknown unknown function Enté.38 2306 -2.221 O.O312 -8.509 global nucleic acid- R General function binding prediction only transcriptional dual regulator H-NS Enté.38 2313 3.051 O.199 2.167 molybdenum- O Posttranslational cofactor-assembly modification, chaperone subunit protein turnover, (delta subunit) of chaperones nitrate reductase 1 Enté.38 2314 6.367 O.O415 6.486 nitrate reductase 1, C Energy beta (Fe-S) subunit production and conversion Enté.38 2315 7.849 O.O258 11.405 nitrate reductase 1, C Energy alpha subunit production and conversion Enté.38 2387 2.074 O.O294 9.374 mannose-specific G Carbohydrate enzyme IIC transport and component of PTS metabolism Enté.38 2465 2.693 O.OS48 5.199 purine-binding N; T Cell chemotaxis protein motility; Signal transduction mechanisms Enté.38 2466 3.068 O.13 2.89 fused chemotactic T Signal sensory histidine transduction kinase in two- mechanisms component regulatory system with CheB and Chey Enté.38 2497 -2.021 O.O643 -4.597 Cold shock-like K Transcription protein cspB (CSP-B) Enté.38 2502 -2.125 0.0174 -28.928 conserved protein of S Function unknown function unknown Enté.38 2508 2.655 0.0579 4.969 putative regulator of T Signal FliA activity transduction mechanisms Enté.38 25.09 2.86 O.13 2.882 RNA polymerase, J Translation, sigma 28 (sigma F) ribosomal actor structure and biogenesis Enté.38 2522 6.843 O.O198 18.732 Flagellar filament N; T Cell structural protein motility; Signal (flagellin) transduction mechanisms Enté.38 2523 5.717 0.0572 5.012 Flagellar filament N Cell motility capping protein Enté.38 2524 3.188 O.04O6 6.71 flagellar protein N: O: U Cell potentiates motility: Posttranslational polymerization modification, protein turnover, chaperones; Intracellular trafficking, Secretion, and vesicular transport Enté.38 2533 2.468 O.O388 6.904 flagellar protein N: O: U Cell motility: Posttranslational modification, protein turnover, chaperones; Intracellular trafficking, Secretion, and vesicular transport Enté.38 2534 2.8O2 O.O365 7.502 Flagellar hook-length C; N. Energy control protein production and conversion: Cell motility US 2013/0150240 A1 Jun. 13, 2013 24

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté.38 2542 -3.17 O.0476 -5.778 DNA-binding K; T Transcription; Signal transcriptional transduction activator, co- mechanisms regulator with RcsB Enté.38 2543 -2.171 0.0152 -27.401 conserved protein of S Function unknown function unknown Enté.38 2579 -2.28 0.0234 -14.287 Putative colicin N; T; U Cell motility; Signal transduction mechanisms; Intracellular trafficking, Secretion, and vesicular transport Enté.38 2610 –2.258 0.0263 -10.572 putative Slysis protein; Qin prophage Enté.38 2626 -2.122 O.O68 -4.409 Phage integrase L Replication, family protein recombination and repair Enté.38 2651 -2.429 O.O329 -8.064 dTDP-4- M Cell deoxyrhamnose-3,5- wall membrane? epimerase envelope biogenesis Enté.38 2750 4.192 O.O223 16.152 methyl-galactoside G Carbohydrate transporter subunit; transport and periplasmic-binding metabolism component of ABC Superfamily Ento.38 2795 2.662 O.O31 8.549 outer membrane M Cell porin protein C wall; membrane; envelope biogenesis Enté.38 2828 2.486 O.O284 9.737 NADH:ubiquinone C Energy oxidoreductase, chain F production and conversion Ento.38 2837 2.01 O.O286 9.639 putative phosphatase R General function prediction only Enté.38 2904 -2.736 O.O284 -9.812 Phage transcriptional K Transcription regulator, AlpA Enté.38 2958 3.828 O.O373 7.411 putative fused malic C Energy enzyme production and oxidoreductase; conversion phosphotransacetylase Enté,38 3059 4.692 O.O372 7.409 anti-sigma factor T Signal transduction mechanisms Enté,38 3076 2.493 O.O411 6.566 cold shock protein J Translation, associated with 30S ribosomal ribosomal subunit structure and biogenesis Enté,38 3088 3.12 O.O387 6.942 tRNA (guanine-1-)- J Translation, methyltransferase ribosomal structure and biogenesis Enté,38 3112 -2019 O.O814 -3.876 conserved protein of S Function unknown function unknown Enté,38 3127 -2.428 O.O452 -5.987 conserved protein of S Function unknown function unknown Enté,38 3133 -2.01 O.08 -3.929 conserved protein of S Function unknown function unknown Enté,38 3249 2.827 O.043 6.214 putative serine E Amino acid transporter transport and metabolism Enté,38 3322 2.185 O.O171 24.827 glycine E Amino acid decarboxylase, PLP- transport and dependent, subunit metabolism (protein P) of glycine cleavage complex US 2013/0150240 A1 Jun. 13, 2013 25

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté,38 3323 2.857 0.101 3.402 glycine cleavage E Amino acid complex lipoylprotein transport and metabolism Enté,38 3324 2.681 0.0931 3.563 aminomethyltransferase, E Amino acid etrahydrofolate- transport and dependent, subunit (T metabolism protein) of glycine cleavage complex Enté,38 3338 3.036 0.0172 25.473 fructose- G Carbohydrate bisphosphate transport and aldolase, class II metabolism Enté,38 3339 3.OSS O.O2S1 11.974 phosphoglycerate G Carbohydrate kinase transport and metabolism Enté,38 3532 2.017 O.0435 6.165 putative aldolase G Carbohydrate transport and metabolism Enté,38 3561 2.706 O.O174 32.635 pyruvate formate- C Energy yase 4,2- production and ketobutyrate conversion ormate-lyase Enté,38 3562 2.214 O.0429 6.316 propionate C Energy kinasefacetate kinase production and C, anaerobic conversion Ento,38 3563 4.426 0.00332 113.406 L-threonine:L-serine E Amino acid transporter transport and metabolism Enté,38 3564 2.11 O.O248 11.174 catabolic threonine E Amino acid dehydratase, PLP- transport and dependent metabolism Enté,38. 3666 2.499 O.O331 8.01750S ribosomal subunit J Translation, protein L13 ribosomal structure and biogenesis Enté,38. 3671 3.291 O.O186 29.163 malate C Energy dehydrogenase, production and NAD(P)-binding conversion Enté,38. 3679 -2051. O.124 -2.996 membrane protein of M Cell efflux system wall membrane? envelope biogenesis Enté,38 3686 2.01S O.O2S 11.894 cell wall structural M Cell complex MireBCD wall membrane? transmembrane envelope component Mrec biogenesis Enté,38 3701 -2.131 O.O253 -11.29 conserved protein of S Function unknown function unknown Ento,38 3722 -2.133 O.048 -5.712 mechanosensitive M Cell channel wall membrane? envelope biogenesis Enté,38 3723 -2.564 OO611 -4.795 conserved protein of S Function unknown function unknown Enté,38 3726 3.616 O.O248 11.127 RNA polymerase, K Transcription alpha subunit Enté,38 3729 2.758 0.0306 8.691 30S ribosomal subunit J Translation, protein S13 ribosomal structure and biogenesis Ento,38 3730 4.562 O.O242 12.313 50S ribosomal subunit J Translation, protein L36 ribosomal structure and biogenesis Enté,38 3731 2.315 O.066 4.512 preprotein U Intracellular translocase trafficking, membrane subunit Secretion, and vesicular transport US 2013/0150240 A1 Jun. 13, 2013 26

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription

638 3732 2.484 12.117 50S ribosoma Sl buni ranslation, protein L15 ribosoma SCE 8 biogenesi 638 3733 2.832 O.0307 8.659 50S ribosoma Sl buni Translation, protein L30 ribosoma SCE 8 biogenesi 638 3735 2.087 O.0483 5.676 50S ribosoma Sl buni Translation, protein L18 ribosoma SCE 8 biogenesi 638 3736 2.371 O.0477 5.736 50S ribosoma Sl buni Translation, protein L6 ribosoma

638 3737 2.068 O.129 2.923 30S ribosoma Sl buni protein S8

638 3744 2.017 4.657 50S ribosoma Sl buni protein L16

638 3745 3.16 O.O2.19 15.304 30S ribosoma Sl buni protein S3

638 3746 4.129 O.O198 17.793 50S ribosoma Sl buni protein L22

638 3747 4.589 8.444 30S ribosoma Sl buni protein S19

638 3748 3.398 13.648 50S ribosoma Sl buni protein L2 SCE 8 biogenesi 638 3749 2.993 1541S 50S ribosoma Sl buni Translation, protein L23 ribosoma SCE 8 biogenesi 638 3750 2.484 8.39 50S ribosoma Sl buni Translation, protein L4 ribosoma SCE 8 biogenesi 638 3751 O.0386 6.918 50S ribosoma Sl buni ranslation, protein L3 ribosoma SCE 8 biogenesi 638 3752 4.398 O.019 19.524 30S ribosoma Sl buni ranslation, protein S10 ribosoma SCE 8 biogenesi 638 3756 2.017 57.878 protein chain ranslation, elongation factor EF ribosoma Tu (duplicate of tufA) SCE 8 biogenesi 638 3757 2.087 8.231 protein chain ranslation, elongation factor EF ribosoma G, GTP-binding SCE 8 biogenesi 638 3816 S.186 7.667 phosphoenolpyruvate Energy carboxykinase production and conversio 638 3925 3.294 4.326 C4-dicarboxylic acid, Energy orotate and citrate production and transporter conversio US 2013/0150240 A1 Jun. 13, 2013 27

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription Enté,38 4010 2.24 17.884 DNA-binding K Transcription transcriptional dual regulator Enté,38 4063 -2339 O.0436 -6.128 Superoxide P norganic ion dismutase, Mn transport and metabolism Enté,38 4128 4.463 11.192 FO sector o C Energy (86-Oll production an ATP synthase, subunit b conversion Enté,38 4129 3.599 34.113 SeCO. O. C Energy (86-Oll production an ATP synthase, delta conversion Subuni Enté,38 4130 3.583 14.582 F1 sector o C Energy (86-Oll production an ATP synthase, alpha conversion Subuni Enté,38 4131 2.8 F1 sector o C Energy (86-Oll production an ATP synthase, gamma conversion Subuni Enté,38 4132 4.856 F1 sector o C Energy (86-Oll production an ATP synthase, beta conversion Subuni Enté,38 4133 3.713 F1 sector o C Energy (86-Oll production an ATP synthase, epsilon conversion Subuni Enté,38 4202 -2.485 -8.972 Putative two T Signal component response transduction regulator mechanisms Enté,38 4204 -2.712 -7.009 Two component T Signal transcriptional transduction regulator, LuxR family mechanisms Enté,38 4205 -2.202 O.OS 16 -5436 conserved protein of S Function unknown function unknown Enté,38 4206 -2.27 O.047 -5.835 Putative outer U intracellular membrane trafficking, autotransporter Secretion, and barrel domain vesicular CSO Enté,38 4214 -2019 -4.057 Glutamine amidotransferase-like transport and protein yfeJ metabolism Enté,38 4215 -2.SS O.04.08 -6.676 Plasmid stabilization D Cell cycle system, toxin of toxin control, cell antitoxin (TA) system division, ParE chromosome partitioning Enté,38 4228 -2.516 -4.487 ragment of toxin of D Cell cycle he RelE-ReB toxin control, cell antitoxin system; Qin division, prophage (part 2) chromosome partitioning Enté,38 4244 -2.09 -3.762 stress-induced R General function protein, ATP-binding prediction only protein Enté,38 4249 -2.253 O.0748 -4.131 Replication protein L Replication, repA recombination and repair Enté,38 4268 -3.098 -11.941 bifunctional antitoxin D Cell cycle of the ReF-ReB control, cell oxin-antitoxin division, system and chromosome transcriptional partitioning repressor; Qin prophage Enté,38 4280 -2.424 O.04.09 -6.625 Putative lytic transglycosylase, US 2013/0150240 A1 Jun. 13, 2013 28

TABLE S4-continued Microarrays

Fold Change (Rich p value T SEQ ID s Poor) (FDR) statistic FUNCTION COG.classID ClassDescription catalytic (lysozyme like virulence factors) Enté,38 4281 -2.236 O.OS33 -5.312 Putative conjugative D Cell cycle transfer: mating control, cell signal (TraM) division, chromosome partitioning Enté,38 4282 -2 O.O323 -8.245 Protein of unknown S Function function unknown Enté,38 4313 -2.362 O.O418 -6.422 Protein of unknown S Function function unknown Enté,38 4319 -2.086 O.O736 -4.179 Truncated transposase (Tn3) ENT 630192 -2.306 O.156 -2.566 exported protein of S Function unknown function unknown ENT 6301.94 -2.286 O.OSS6 -5.129 exported protein of S Function unknown function unknown ENT631068 -2732 0.0248 -11.061 protein of unknown S Function unction unknown ENT631584 -2.087 O.O37 -7.431. Putative U intracellular autotransporter trafficking, protein (fragment) Secretion, and vesicular transport ENT631894 -2.007 0.0174 -21.346 Beta-lactam R General function resistance protein prediction only ENT631979 -2.11 0.0229 -14.717 Putative IS element (IS600-like) ENT 63248O -2.222 O.OS45 -5.219 hypothetical protein S Function KOW ENT632671 -2.25 0.0249 -11.071 Hypothetical protein S Function of unknown function KOW ENT632695 -2.206 O.0523 -5.384 protein of unknown S Function unction KOW ENT633422 -2.194 0.0264 -10.451 protein of unknown S Function unction KOW ENT63.3863 2.227 O.O68 4.407 hypothetical protein S Function KOW ENT63p0011 -2.333 O.O795 -3.948 protein of unknown S Function unction KOW ENT63p0054 -2.572 O.O796 -3.945 protein of unknown S Function unction KOW ENT63p0058 -2.469 O.O637 -4.628 protein of unknown S Function unction KOW ENT63p0066 -2.112 0.0251 -11.251 protein of unknown S Function unction KOW ENT63p0067 -2.132 0.0241 - 12.455 Putative partial transposase IS3/IS407 amily ENT63p0070 -2.3 0.0375 -7.358 protein of unknown S Function unction unknown

TABLE S-3 Transporter comparison Ento38

E. coi O157- E. Carotovora K. pneumoniae

SprotS68 Entó38 K12 H7 SCRI1043 MGH78578. 342 1.A. C-Type channels The Voltage-gated Ion Channel (VIC) Superfamily 1.A.1 1 The Major Intrinsic Protein (MIP) Family 1.A.8 2 : : : : The Ammonia Transporter Channel (Amt) Family 1.A.11 1 1 1 1 1 1 1 US 2013/0150240 A1 Jun. 13, 2013 29

TABLE S-3-continued Transporter comparison Ento38

E. coi O157- E. Carotovora K. pneumoniae

SprotS68 Entó38 K12 H7 SCRI1043 MGH78578. 342 The Large Conductance Mechanosensitive Ion Channel 1.A.22 1 1 1 1 1 1 1 (MscL). Family The Small Conductance Mechanosensitive Ion Channel 1.A.23 6 7 6 6 4 7 7 (MscS) Family The Urea Transporter (UT) Family 1.A.28 O O O O O O O The CorA Metal Ion Transporter (MIT) Family 1A35 4 2 - 2 3 2 3 3

total 15 15 13 14 9 18 7 2.A. Porters (uniporters, Symporters, antiporters) The Major Facilitator Superfamily (MFS) 2.A.1 114 81 70 76 64 119 128 The Glycoside-Pentoside-Hexuronide (GPH):Cation 2.A.2 1 5 6 6 3 8 9 Symporter Family The Amino Acid-Polyamine-Organocation (APC) Family 2.A.3 21 12 22 21 11 2O 22 The Cation Diffusion Facilitator (CDF) Family 2.A.4 3 2 2 2 2 5 5 The Zinc (Zn2+)-Iron (Fe2+) Permease (ZIP) Family 2.A.S 1 1 O O O 1 1 The Resistance-Nodulation-Cell Division (RND) Superfamily 2.A.6 14 14 9 12 9 14 15 The Drug? Metabolite Transporter (DMT) Superfamily 2.A.7 26 19 16 16 19 25 28 The Gluconate:H+ Symporter (GntP) Family 2.A.8 6 2 7 4 3 4 6 The Cytochrome Oxidase Biogenesis (Oxal) Family 2.A.9 1 1 1 1 1 1 1 The 2-Keto-3-Deoxygluconate Transporter (KDGT) Family 2.A.10 O 1 1 1 1 1 1 The Citrate-Mg2+:H+ (CitM) Citrate-Ca2+:H+ (CitH) 2.A.11 O O O O 2 O O Symporter (CitMHS) Family The ATP:ADP Antiporter (AAA) Family 2.A.12 O O O O O O O The C4-Dicarboxylate Uptake (Dcu) Family 2.A.13 2 2 2 2 2 2 2 The Lactate Permease (LctP) Family 2.A.14 1 2 1 1 1 1 The Betaine/Carnitine/Choline Transporter (BCCT) Family 2.A.15 2 O 3 3 1 3 2 The Telurite-resistance/Dicarboxylate Transporter (TDT) Family 2.A. 16 1 1 1 O 1 1 The Proton-dependent Oligopeptide Transporter (POT) Family 2.A.17 4 2 4 4 1 6 5 The Ca2+:Cation Antiporter (CaCA) Family 2.A.19 2 2 2 2 2 2 2 The Inorganic Phosphate Transporter (PIT) Family 2.A.20 2 2 2 1 1 1 The Solute:Sodium Symporter (SSS) Family 2.A.21 4 3 4 4 4 4 3 The Dicarboxylate? Amino Acid:Cation (Na+ or H+) Symporter 2.A.23 4 5 3 5 6 5 5 (DAACS) Family The 2-Hydroxycarboxylate Transporter (2-HCT) Family 2.A.24 2 O O 2 2 3 The Alanine or Glycine:Cation Symporter (AGCS) Family 2.A.25 1 1 O 1 1 The Branched Chain Amino Acid:Cation Symporter (LIVCS) 2.A.26 2 1 1 1 1 Family The Glutamate:Na+ Symporter (ESS) Family 2.A.27 1 O 1 O 1 1 The Bile Acid:Na+ Symporter (BASS) Family 2.A.28 3 2 1 2 2 2 The NhaA Na+:H+ Antiporter (NhaA) Family 2.A.33 1 1 1 2 1 The NhaB Na+:H+ Antiporter (NhaB) Family 2.A.34 1 1 1 1 1 The Nhac Na:HAntiporter (Nhac) Family 2.A.35 1 O O O O O O The Monovalent Cation: Proton Antiporter-1 (CPA1) Family 2.A.36 2 2 2 2 1 3 3 The Monovalent Cation: Proton Antiporter-2 (CPA2) Family 2.A.37 4 3 3 3 2 3 3 The K+ Transporter (Trk) Family 2A38 2 2 1 1 1 The KTransporter (Trk) Family 2.A.39 2 O 2 2 2 3 4 The Nucleobase:Cation Symporter-2 (NCS2) Family 2.A.40 6 5 10 1 4 7 7 The Concentrative Nucleoside Transporter (CNT) Family 2.A.41 4 2 3 3 3 3 2 The Hydroxyl Aromatic Amino Acid Permease (HAAAP) Family 2.A.42 5 5 8 8 3 7 7 The Formate-Nitrite Transporter (FNT) Family 2.A.44 3 3 4 4 2 2 2 The Arsenite-Antimonite (Arsle) Efflux Family 2.A.45 1 1 2 1 2 2 The Benzoate:H+ Symporter (BenE) Family 2.A.46 1 1 1 1 1 1 The Divalent Anion:Na+ Symporter (DASS) Family 2.A.47 4 4 5 5 4 6 8 The Chloride Carrier/Channel (CIC) Family 2.A.49 3 3 3 3 O 4 4 The Chromate Ion Transporter (CHR) Family 2.A51 2 O O O O 1 1 The Ni2+ Co2+ Transporter (NiCoT) Family 2.A52 2 3 O O 1 3 3 The Sulfate Permease (SulP) Family 2.A53 4 2 1 1 2 4 3 The Metal Ion (Mn2+-iron) Transporter (Nramp) Family 2.A55 2 1 1 1 1 1 2 The Tripartite ATP-independent Periplasmic Transporter 2.A.56 5 4 3 O 3 O O (TRAP-T) Family The Phosphate:Na+ Symporter (PNaS) Family 2.A.58 1 1 1 1 1 1 2 The Arsenical Resistance-3 (ACR3) Family 2.A.59 O O O O O O O The C4-dicarboxylate Uptake C (DcuC) Family 2.A.61 1 2 2 2 1 1 1 The Monovalent Cation (K+ or Na+):Proton Antiporter-3 2.A.63 O O O O O O O (CPA3) Family The Twin Arginine Targeting (Tat) Family 2.A.64 4 4 4 4 4 4 4 The Multidrug? Oligosaccharidyl-lipid Polysaccharide (MOP) 2.A.66 9 8 8 8 5 6 4 Flippase Superfamily US 2013/0150240 A1 Jun. 13, 2013 30

TABLE S-3-continued Transporter comparison Ento38

E. coi O157- E. Carotovora K. pneumoniae

SprotS68 Entó38 K12 H7 SCRI1043 MGH78578. 342 The Oligopeptide Transporter (OPT) Family 2.A.67 1 O O O O O O The p-Aminobenzoyl-glutamate Transporter (AbgT) Family 2.A.68 1 1 1 2 O 1 1 The Auxin Efflux Carrier (AEC) Family 2.A.69 1 1 1 1 2 1 3 The Malonate:Na+ Symporter (MSS) Family 2.A.70 O O O O O O O The K+ Uptake Permease (KUP) Family 2.A.72 2 1 1 1 1 1 1 The Short Chain Fatty Acid Uptake (AtoE) Family 2.A.73 O O 1 O O O O The L-Lysine Exporter (LysE) Family 2.A.75 1 1 1 1 1 1 1 The Resistance to Homoserine/Threonine (RhtB) Family 2.A.76 9 4 5 5 11 7 9 The Branched Chain Amino Acid Exporter (LIV-E) Family 2.A.78 1 2 1 1 2 3 2 The Threonine/Serine Exporter (ThrE) Family 2.A.79 1 1 1 O 1 1 1 The Tricarboxylate Transporter (TTT) Family 2.A.80 3 O O O O O O The Aspartate:Alanine Exchanger (AAE) Family 2.A.81 2 2 1 O 2 2 2 The Aromatic Acid Exporter (AraE) Family 2.A.85 5 5 3 3 O 6 8 The Autoinducer-2 Exporter (AI-2E) Family (Formerly the PerM 2.A.86 4 6 O O O O O Family, TC #9.B.22) The Vacuolar Iron Transporter (VIT) Family 2.A.89 O O O O O O O

total 319 241 244 244 2O2 319 340 3.A. P. P-bond-hydrolysis-driven transporters The ATP-binding Cassette (ABC) Superfamily 3.A.1 3S4 295 210 239 358 386 422 The H- or Na'-translocating F-type, V-type 3.A.2 9 9 9 9 9 9 9 and A-type ATPase (F-ATPase) Superfamily The P-type ATPase (P-ATPase) Superfamily 3.A.3 7 8 6 6 6 9 10 The Arsenite-Antimonite (ArsAB) Efflux Family 3.4.4 O O O O O 1 2 The General Secretory Pathway (Sec) Family 3.A.S 7 6 O O O 3 3 The H+-translocating Pyrophosphatase (H+-PPase) Family 3.A.10 O O O O O O O The Septal DNA Translocator (S-DNA-T) Family 3.A.12 1 O O O O O

total 378 319 225 254 373 408 446 4.A. Phosphotransfer-driven group translocators

4. A 45 4 50 63 45 84 78 9.A. Recognized transporters of unknown biochemical mechanism The MerTP Mercuric Ion (Hg) Permease (MerTP) Family 9.A.2 O O O O O O O The YggT or Fanciful K" Uptake-B (FkuB: YggT) Family 9.A.4 1 O O O O O The Ferrous Iron Uptake (FeoB) Family 9A.8 1 2 1 1 O 1 1 The Iron Lead Transporter (ILT) Superfamily 9.A.10 1 O O O O O The Iron Lead Transporter (ILT) Superfamily 9.A.18 O 1 1 O 1 1 The Mg2 Transporter-E (MgtE) Family 9.A.19 2 2 O O 1 2 2 The Ethanolamine Facilitator (EAF) Family 9.A.28 1 O O O O O O The Putative 4-Toluene Sulfonate Uptake Permease (TSUP) 9.A.29 2 O O O O O Family The Tellurium Ion Resistance (TerC) Family 9.A.30 4 4 O O O O O The Pyocin R2 Phage P2 Tail Fiber Protein (Pyocin R2) Family 9.A.33 1 O O O O O The HlyC/CorC (HCC) Family 9.A.40 4 2 O O O O O The Capsular Polysaccharide Exporter (CPS-E) Family 9.A.41 O 9- - ). O O O O

total 17 15 2 2 1 4 4

TOTAL 774 631 534 577 630 833 885 % 15.4 14.4 12.9 10.9 14.1 16.1 15.3

SOl CeS: (1) http: www.membranetransport.org and (2) http://www.tcdb.org/

1.-2. (canceled) 12. The inoculant of claim 3, further comprising a plant 3. An inoculant for a plant, comprising an isolated culture growth promoting rrucroorgamism. of Enterobacter sp. 638 and a biologically acceptable 13. The method of claim 12, wherein the microorganism is medium. selected from the group consisting of species of Actino bacter; Alcaligenes, Bacillus, Burkholderia, Buttiauxella, 4. The inoculant of claim 3, wherein the medium further Enterobacter, Klebsiella, Kluyvera, Pseudomonas, Rahnella, comprises a phytohormone an antimicrobial compound, or a Ralstonia, Rhizobium, Serratia, and Stenotrophomonas. combination thereof. 14. A method for increasing growth in a plant, the method 5.-11. (canceled) comprising applying a composition to the plant in an amount US 2013/0150240 A1 Jun. 13, 2013

effective for increasing growth in the plant, wherein the com 32. The method of claim 30, wherein the angiosperm is position comprises an isolated culture of Enterobacter sp. sunflower. 638. 33. The method of claim 30, wherein the angiosperm is 15. The method of claim 14, comprising applying the com tobacco. position to a root, a shoot, a leaf, and/or a seed of the plant. 34. (canceled) 16. The method of claim 14, wherein the plant is an 35. A method for increasing disease tolerance in a plant angiosperm. comprising applying a composition to the plant in an amount 17. The method of claim 16, wherein the angiosperm is effective for increasing disease tolerance in the plant, wherein tOmatO. the composition comprises an isolated culture of Entero 18. The method of claim 16, wherein the angiosperm is bacter sp. 638. sunflower. 36. The method of claim 35, wherein the disease is fungal, 19. The method of claim 16, wherein the angiosperm is bacterial or viral. tobacco. 37. The method of claim 35, comprising applying the com 20. (canceled) position to a root, a shoot, a leaf, and/or a seed of the plant. 21. A method for increasing biomass in a plant, the method 38. The method of claim 37, wherein the plant is an comprising applying a composition to the plant in an amount angiosperm. effective for increasing biomass in the plant, wherein the 39. The method of claim 38, wherein the angiosperm is composition comprises an isolated culture of Enterobacter tOmatO. sp. 638. 40. The method of claim 38, wherein the angiosperm is 22. The method of claim 21, comprising applying the com sunflower. position to a root, a shoot, a leaf, and/or a seed of the plant. 41. The method of claim 38, wherein the angiosperm is 23. The method of claim 21, wherein the plant is an tobacco. angiosperm. 42. (canceled) 24. The method of claim 23, wherein the angiosperm is 43. A method of increasing drought tolerance in a plant tOmatO. comprising applying a composition to the plant in an amount 25. The method of claim 23, wherein the angiosperm is effective for increasing disease tolerance in the plant, wherein sunflower. the composition comprises an isolated culture of Entero 26. The method of claim 23, wherein the angiosperm is bacter sp. 638. tobacco. 44. The method of claim 42, comprising applying the com 27. (canceled) position to a root, a shoot, a leaf, and/or a seed of the plant. 28. A method for increasing fruit and/or seed productivity 45. The method of claim 42, wherein the plant is an in a plant, the method comprising applying a composition to angiosperm. the plant in an amount effective for increasing fruit and/or 46. The method of claim 44, wherein the angiosperm is seed productivity in the plant, wherein the composition com tOmatO. prises an isolated culture of Enterobacter sp. 638. 47. The method of claim 44, wherein the angiosperm is 29. The method of claim 28, comprising applying the com sunflower. position to a root, a shoot, a leaf, and/or a seed of the plant. 48. The method of claim 44, wherein the angiosperm is 30. The method of claim 29, wherein the plant is an tobacco. angiosperm. 49. The method of claim 44, wherein the angiosperm is a 31. The method of claim 30, wherein the angiosperm is poplar. tOmatO.