Alpha Synuclein Is Present in Lewy Bodies in Sporadic Parkinson's

Home , Lewy body

ORIGINAL RESEARCH ARTICLE Alpha synuclein is present in Lewy bodies in sporadic Parkinson’s disease E Mezey1*, AM Dehejia2*, G Harta1, SF Suchy2, RL Nussbaum2, MJ Brownstein3 and MH Polymeropoulos2

1Basic Neuroscience Program, National Institute of Neurological Disease and Stroke, National Institutes of Health, Building 36, Room 3D06, Bethesda, MD 20892-1430; 2Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, Building 49, Room 4A66, Bethesda, MD 20892-1430; 3Section on Genetics, National Institute of Mental Health/National Human Genome Research Institute, National Institutes of Health, Building 36, Room 3D06, Bethesda, MD 10892-1430, USA

A missense mutation in the human alpha synuclein gene was recently identiﬁed in some cases of familial Parkinson’s disease (FPD). We have developed an antibody that recognizes the C- terminal 12 amino acids of the human alpha synuclein protein and have demonstrated that alpha synuclein is an abundant component of the Lewy bodies found within the degenerating neurons of patients with Parkinson’s disease (PD). The presence of alpha synuclein in Lewy bodies of sporadic PD patients suggests a central role for alpha synuclein in the pathogenesis of PD. Keywords: Parkinson’s disease; Lewy body; alpha-synuclein; ubiquitin; diffuse Lewy body disease (DLBD); Alzheimer’s disease; Pick’s disease

Parkinson’s disease is a common neurodegenerative Lewy bodies (LB) were first described in 1912 by Freid- disorder characterized by tremors, dystonia, and brady- erich H Lewy who observed them in brains from kinesia.1 It occurs in a sporadic or a familial form. We patients with PD.9 In Parkinson’s disease LB are usu- have recently demonstrated a locus for early onset FPD ally present in the brainstem, basal forebrain and the on chromosome 4q21–q23, and identified a mutation autonomic ganglia, with the highest concentrations in in the alpha synuclein gene responsible for the pheno- the substantia nigra and the locus coeruleus. Although type.2 The mutation, a single amino acid substitution first found associated with PD, Lewy bodies have been (Ala53Thr), was found in one Italian and three Greek described in other neurodegenerative disorders as well, kindreds with FPD. A second mutation, an Ala30Pro including diffuse Lewy body disease (DLBD), thought change, was subsequently described in a German kin- to be the second most frequent cause of dementia after dred.3 AD.10 In contrast to PD, DLBD is characterized by a Alpha synuclein is an abundant presynaptic protein progressive dementia along with the parkinsonian of unknown function. This protein and its homologues motor disorder. While LB are very sparse in cerebral have been isolated from fish, rats, birds and humans.4,5 cortex of patients with PD, they are frequently found It appears to reside in nerve terminals and the only in DLBD. function known to date is an involvement in the song Although the exact composition of the LB is not learning process in the zebra finch.6 The human pro- known, a number of proteins are thought to take part tein was initially identified because a peptide fragment in its formation.11–13 The most widely studies of these of alpha synuclein was found in plaques of patients proteins is ubiquitin, immunostaining for which is with Alzheimer’s disease, suggesting that mutations in commonly used to identify the LB.14 Epitopes for the this gene might be responsible for some cases of Alzh- neurofilament chain proteins M, L, and H have also eimer’s disease.7 However a search for mutations in the been identified in LB.15 Ubiquitin-reactive Lewy bodies alpha synuclein gene in families with early onset Alzh- are known to exist in different forms, including round eimer’s disease yielded no mutations.8 bodies of 2–40 ␮m diameter with a distinct core and The pathologic hallmark of Parkinson’s disease is the halo, swollen neuronal processes packed with protein Lewy body, an eosinophilic cytoplasmic inclusion. deposit referred to as Lewy neurites,16 and degenerating neural processes containing a number of LB. While ubiquitin seems to be present in virtually all LB, it may Correspondence: Dr MH Polymeropoulos, Genetic Disease be a passive participant in the pathological process Research Branch, NHGRI, NIH, Bldg 49 Rm 4A66, Bethesda, MD 20892, USA. E-mail: mhpȰnhgri.nih.gov. underlying their production. In other words, ubiquitin *These authors contributed equally in this work may be attracted to filamentous protein aggregates in Received 17 March 1998; revised and accepted 5 June 1998 the cell and mount a futile attempt to target them for destruction by the proteasome. Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 494 The recent discovery of a missense mutation in the ing (3–4 changes) in PBS/0.1–0.2% Tween 20. The sec- alpha synuclein gene in some cases of FPD,2 led us to ondary Ab was horse-radish peroxidase donkey anti- the hypothesis that the mutation destabilized the struc- rabbit IgG (Amersham, Arlington Heights, IL, USA) and ture of the protein making it susceptible to self-aggre- incubated for 1 h at room temperature at 1 : 10 000 gation. In order to evaluate the role of alpha synuclein dilution. After a second 20-min wash in PBS/0.1% in the formation of LB in sporadic PD, we developed Tween 20, chemiluminescent detection of the second- an antibody (SYNC) against an oligopeptide compris- ary Ab was carried out with theÈCLı ı ˆ reagent from ing the 12 C-terminal amino acids of the alpha synuc- Amersham. Light production was detected on NEN AR lein molecule.8 Alpha synuclein is a 140-amino acid autoradiography film (New England Nuclear, Boston, protein, characterized by imperfect amino acid repeats. MA, USA). Exposure times ranged from 10–90 s. The consensus of the core of the amino acid repeat is the 6-mer Lys-Thr-Lys-Gln-Gly-Val. This core sequence Sequence analysis and the juxtaposition of the repeats is reminiscent of The oligonucleotide primers used to amplify the a similar sequence structure in apolipoprotein E. The coding exons of the alpha synuclein gene were: exon3 antibody used in this study was designed to recognize (syna8) acttggagggtttctcatg (syna23) ttgttatcctaacccat- the C-terminus of the protein—thereby avoiding any cac; exon 4 (syna3) gctaatcagcaatttaaggctag (syna13) gat- overlap with the repetitive motif. The SYNC antibody atgttcttagatgctcag; exon 5 (syna14) atggctagtggaagtgg- was shown to specifically identify a band on Western aatg (syna15) ccccacagtagtatcttgc; exon 6 (syna16) cca- blots from brain but not from liver. The size of the catccctatatgtaag (syna17) gagaaatgtgacaatgacagg; exon 7 immunoreactive band was approximately 19 kD in (syna18) ggggtttgatttttctaat (syna22) catgtattcacttcagt- size. This size is bigger than that predicted for the gaaagg. Sequence analysis was performed using stan- alpha synuclein molecule (14.4 kD), but it is consistent dard ABI fluorescent technology. with previously published observations4 that a 19-kD species reacts with antibodies directed against the C- Clinical sample terminus of the protein. The brain samples were obtained from the Harvard Brain Tissue Resource Center (Belmont, MA, USA) (PHS grant number MH/NS 31862). PD case 1 (B3671): Materials and methods 76-year-old male; PD case 2 (B3680): 72-year-old Production of antibody and Western blot analysis female; PD case 3 (B3452): 75-year-old male; PD case Polyclonal antibodies were raised against the oligopep- 4 (B2574): 80-year-old male; DLBD (B3158): 71-year- tide SEEGYQDYEPEA corresponding to amino acids old male; Pick’s disease (B3630): 64-year-old female; 129–140 of human alpha-synuclein (genbank ID Alzheimer’s disease (B3622): 87-year-old female; L08850). The oligopeptide was coupled to Keyhole Infarct (B3653): 80-year-old female; normal control Limpet Hemocyanin (KLH) via an added amino-ter- (B3863): 72-year-old female. Additional brain speci- minal cysteine residue. Antibody production was per- mens from patients with Pick’s disease, multi-infarct formed by injecting the coupled peptide into rabbits dementia and Alzheimer’s disease were obtained from using the Poly Quik protocol of Zymed Laboratories (S the NIH Pathology department. San Francisco, CA, USA). Western blots were performed using brain and liver tissue protein extracts from Immunohistochemistry Clontech (Palo Alto, CA, USA), as follows: proteins Twelve-micron thick sections were cut, placed on were extracted from whole-tissue by homogenization microscope slides, deparaffinized with xylene, rehy- at 40°C under standard conditions in the presence of drated with graded ethanol solutions, and treated with protease inhibitors (0.1 M Tris-HCl pH 7.5, 15% (v/v) glycerol, 0.2 mM EDTA, 1.0 mM DTT, 10 ␮gml−1 leu- peptin and 1.0 mM PMSF). The samples were elec- trophoresed in the presence of beta-mercapto-ethanol (5%) and SDS (2%) on a 10–20% gradient acrylamide gel in SDS/Tris/Glycine buffer. Gels were run at 200 V per 50–25 mA for 30 min. Gels were soaked in 1× (transfer buffer = 10 mM CAPS (3-[Cyclohexylamino]- 1-propane-sulfonic acid) pH 11 and 20% methanol for 15 min prior to elecrophoretic transfer (40 min/room temperature/50 V (170–100 mA). The transfer was made to Immobilon-P (PVDF). Transfer was checked by a brief staining in Coomassie-Blue R-250 (1 min) fol- Figure 1 Mutation analysis of the Ala53Thr substitution. Lanes 1, 3, 5 contain PCR products digested with Tsp45I from lowed by destaining. For immuno-detection, blots were the amygdala of the 74-year-old PD patient (lane 1), a normal blocked in 0.1–0.2% Casein/0.1–0.2% Tween 20/ control (lane 3), and a PD patient carrying the Ala53Thr phosphate-buffered saline overnight. Primary Ab mutation (lane 5). Lanes 2, 4, and 6 contain PCR products (SynC) was added at 1 : 1000 dilution of unpurified from the templates described above but not digested with anti-serum or pre-immune serum. Ab binding was for Tsp45I. Sizes of DNA fragments are indicated on the right 1–2 h at room temperature followed by 20 min of wash- in basepairs. Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 495 0.6% protease E (Sigma, St Louis, MO, USA) for escence microscope (Zeiss, Germany). Double color 30 min. Ubiquitin was stained with a mouse mono- images were generated using a double pass fluorescent clonal antibody (Zymed Laboratories, S San Francisco, filter allowing detection of both FITC-green and Cy3- CA, USA) at the dilution provided by the manufac- red. To reduce nonspecific staining when immuno- turer. Synuclein was stained using the rabbit poly- peroxidase was used, the sections were placed in 3% clonal antiserum described in the text at a dilution of hydrogen peroxide for 30 min before they were 1 : 500. immersed in BSA diluent. Following the overnight All primary and secondary antibodies were diluted incubation in primary antiserum, biotin-conjugated in BSA diluent (PBS with 1% bovine serum albumin secondary antibodies (Vectastain ABC Elite Kit, Vector and 0.6% Triton X-100). Double immunolabeling was Laboratories, Burlingame, CA, USA) were applied to performed as follows with 3 × 5 min washes in PBS the sections for 1 h at final dilutions of 1 : 500. Then between steps: to reduce nonspecific staining the sec- the sections were incubated in the avidin-biotin-per- tions were placed in BSA diluent for 30 min each. The oxidase complex (1 : 250) for 1 h, transferred to Tris- sections were incubated with the primary antisera buffered saline, and the peroxidase developed with ° overnight at 4 C, and then incubated for 1 h with the DAB (DAB solution : 40 mg% DAB, 0.016 ml H2O2 in appropriate 1 : 1000 dilution of Cy3- or 1 : 100 dilution 0.1 M Tris-HCl, pH 8.0, made freshly and used for 7– of FITC-conjugated donkey anti-IgG antiserum (F[ab′]2 10 min). The color images were scanned with a Sprint IgG-fragment, affinity purified to minimize cross- Scan 35 (Polaroid) and processed using Adobe Photo- reactivities with IgGs other than the primary antibody shop software. As mentioned in the text, replacing the (Jackson ImmunoResearch, West Grove, PA, USA). primary antibodies with preimmune serum yielded no Photomicrographs were made using an Axiphot fluor- staining, and preincubating the working dilution of the

Figure 2 Lewy bodies (LB) in the compact zone of the substantia nigra of a patient with Parkinson’s disease. Frames (a) and (b) are pictures of the same LB stained with ubiquitin (a, green) and synuclein (b, red) antibodies respectively. The two color image (c) shows ubiquitin in the core of this particle, both proteins in the middle (orange color), and synuclein in the periphery. Another double-stained LB is shown in frame (d). In this case, synuclein was stained green and ubiquitin red. Both proteins are found in the core of the LB, but tendrils of synuclein make up the periphery. This particle appears still to be growing. The LBs shown in (e) and (f) were stained with immunoperoxidase for synuclein and ubiquitin, respectively. The LB in (e) is in the cell body of a pigmented neuron. The granules seen contain neuromelanin. The size bars correspond to 10 ␮m. Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 496 anti-synuclein antiserum with 100 ␮gml−1 of synuclein swollen neurites. SYNC-positive fragments of degener- peptide blocked staining completely. ating neurites were even more common than LB and appeared to be the signature of the pathological process in the brain studied (Figure 3). The brain of an age- Results matched, asymptomatic control individual looked very We used the SYNC antibody to stain sections from the different than the PD brain. There was no evident neu- brain of a 76-year-old male who suffered from a spor- ronal loss in the substantia nigra. Only small scattered adic form of PD. The pathology report accompanying ubiquitin-positive bodies were present in the zona the sample we studied confirmed the clinical diagnosis compacta. These are commonly seen in brains from and indicated that the patient had LB disease. Geno- elderly individuals with no overt motor problems.17 typing DNA from this patient did not reveal the The only structures visualized when the synuclein Ala53Thr mutation in the alpha synuclein gene antibody was used for immunostaining were fine neu- (Figure 1). Further sequence analysis of all coding ronal processes (Figure 4). Axonal boutons were most exons of the alpha synuclein gene revealed no intensely stained. Thus, there seems to be good corre- mutations. lation between synuclein deposition and the pathology When we examined hematoxylin/eosin stained sec- of PD with Lewy bodies. Examination of the three tions of the patient’s substantia nigra (SN), we saw additional brains from patients with sporadic PD extensive neuronal loss and numerous Lewy bodies. As revealed similar SYNC immunostaining in Lewy bod- expected, these intracellular inclusions were ubiquitin ies and swollen dendritic processes. Furthermore, the positive. We were also able to stain LB with our SYNC substantia nigra and amygdala of a patient with diffuse antibody, and in double staining experiments to show Lewy body disease (DLBD) were packed with SYNC that LB contained both ubiquitin and synuclein. No positive Lewy bodies and engorged neural processes staining was found when the SYNC antibody was pre- (Figure 4). incubated with the peptide used to raise it, or with pre- We next asked whether synuclein-positive aggregates immune serum (data not shown). The double-stained were present in the brains of patients who had suffered LB typically had a relatively faint central core with a from brain illnesses other than PD (Figure 4). We began bright double stained halo, surrounded by a rim of by examining the brain of a women who had died of SYNC (Figure 2). When they were stained for synuclein Alzheimer’s disease. The neuronal cytoplasmic or ubiquitin alone, LB frequently had a lamellar inclusion characteristic of this disorder is the neurofi- appearance. The particles observed ranged in size from brillary tangle. When tangles are stained by means of a few micrometers to more than 20 micrometers in silver impregnation, they look like thick, black bands diameter, and were found in neuronal perikarya and of parallel fibers that fill the cell body. These fibers are

Figure 3 Synuclein-positive structures in the substantia nigra of a Parkinson’s disease patient. Synuclein (black) was visualized using immunoperoxidase and the sections were then Giemsa stained. Frame (a) shows a Lewy body in the perykaryon of a neuron. An enlarged, synuclein stained process is seen emanating from the cell. Frames (b) and (c) illustrate ‘ballooned’ neurites with large synuclein inclusions. Those in (b) have a beaded appearance. The ﬁeld shown in frame (d) is not atypical. The zona compacta is full of synuclein-positive neuritic fragments. The size bars correspond to 10 ␮m. Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 497

Figure 4 Synuclein staining in a normal brain and brains of patients who had illnesses other than Parkinson’s disease. A normal substantia nigra (a) has fine scattered synuclein-positive neurites among its pigmented neurons. The substantia nigra of a patient with diffuse Lewy body disease (DLBD) (b), has many pigmented neurons with one or more Lewy bodies in their perikarya. In addition there are many stained Lewy neurites and engorged processes. Synuclein-positive swollen processes are even more prominent in the amygdala of the same patient. There the Lewy bodies tend to be smaller than in the substantia nigra, and they are more amorphous in structure (c). In the hippocampus of a patient who had Alzheimer’s disease, many engorged neurites are synuclein-positive (d) and Lewy body-like round inclusions are found in some neurons in the substantia nigra of the same patient (e and f). In Pick’s disease the characteristic Pick bodies in cortical neurons (arrows point at some) are strongly positive using silver impregnation (g) and immunostained for Tau (h) but the same inclusions are not stained with synuclein (i). The brains were stained with immunoperoxidase as described. Scale bars represent 10 ␮mina,b,c,d,e,f,and 30 ␮m in g–i. immunoreactive for paired helical filaments and tau, reflected AD or ischemic alterations. For this reason, and can be seen in axons and dendrites many cell we studied additional brains from patients with multi- diameters from the neuronal cell body. Indeed, a dense infarct dementia and ‘pure’ Alzheimer’s disease. We meshwork of ‘neuropil threads’ is commonly saw no specific staining in the brains with infarcts, but observed,18,19 and this meshwork appeared to be syn- again saw synuclein-positive neuritic tangles in layers uclein-positive in layers 5 and 6 of the hippocampus 5 and 6 of the brain from the patient with Alzheimer’s of the brain we studied (Figure 4 d–f). These layers disease. On the other hand, synuclein-stained tangles undergo pseudolamellar necrosis following anoxic epi- in neuronal perikarya were rare, but we did see synucl- sodes, and given the presence of severe arteriosclerotic ein in intraneuronal aggregates in pigmented neurons changes in the first brain we examined, we could not be in the lateral portion of the substantia nigra. Some of sure whether the staining we saw in the hippocampus these had the lamellar appearance of Lewy bodies; Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 498 others were rather amorphous looking. Whether this is extremes of temperature.21 In addition, one can a common feature Alzheimer’s disease, or peculiar to imagine genetic alterations that might contribute to the the patient we studied remains to be seen. development of PD, including possible alterations in Along with tangles, plaques are another hallmark of proteins commonly found in LB, such as the NF-H, L, Alzheimer’s disease, and may ultimately occupy one and M proteins,15 and genes responsible for the oxidat- third to one half of the cerebral cortex. These usually ive state of a cell, such as the superoxide dismutases. have a central core of amyloid protein surrounded by It is conceivable that a combination of these factors masses of neuritic processes, astrocytes, and microglia. may be responsible for initiating the growth of the Individual plaques may coalesce to form aggregates Lewy bodies and thereby causing the neuronal cell 1 mm across. Plaques were not stained by the anti-syn- damage that eventually leads to the symptoms of PD. uclein antibody. It should be noted that this antibody The observation of a plethora of fragmented cells and is directed against the C-terminus of synuclein which processes containing alpha synuclein in the diseased is not present in the fragment of the protein originally substantia nigra raises the question of their eventual isolated from Alzheimer’s plaques. If it is true that pla- fate. It is possible that the alpha synuclein aggregates ques are rich in the NAC35 fragment of alpha synucl- may be taken up by other cells—after sick cells and ein, they are not rich in the full length protein. their neurites break down—seeding the disease. This Next we studied Pick’s disease, a rare form of late process of seeding has already been shown to operate onset, slowly progressive cerebral cortical atrophy, in prion diseases and the [PSI+] phenotype in the especially affecting the frontal and temporal cortices. yeast.22,23 There one sees neuronal loss, gliosis, and swollen, The mechanism we have proposed above may be a pale, pear-shaped Pick cells, but not plaques or tangles. rather general one. Different clinical syndromes may In addition, some neurons contain argyrophilic Pick be caused by the abnormal conformation of certain pro- bodies. These are fairly well defined, round, inclusions teins whose patterns of expression and the insults to which can sometimes nearly fill the cytoplasm. They which they are exposed will determine the features of seem to be comprised of masses of tubules and fila- the disorder. ments. We could detect readily Pick bodies on archival sections of brains from patients who had died of Pick’s Acknowledgements disease stained by silver impregnation or immunocyto- The authors would like to thank Dr S Vincent of the chemistry with anti-tau antibodies. These bodies were Harvard Brain Tissue Resource Center for providing easy to see in sections cut from the same block as the brain samples, Drs C Lavedan and M Palkovits for their original ones and counterstained with Geimsa stain, valuable advice and discussions and D Leja for help in but they appeared to contain no alpha-synuclein. creating the photo montages presented.

Discussion References The presence of the alpha synuclein in the Lewy body 1 Parkinson J. An Essay on the Shaking Palsy. Sherwood, Neely and suggests that it may have a key role in the development Jones: London, 1817. of this aggregate. Similar results have been recently 2 Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra described by Spillantini et al,20 using antibodies A et al. Mutation in the ␣-synuclein gene identified in families with Parkinson’s disease. Science 1997: 276: 2045–2047. directed towards different regions of the alpha synucl- 3 Kruger R, Kuhn W, Muller T et al Ala30Pro mutation in the gene ein protein. This finding of alpha synuclein in the LB encoding alpha-synuclein in Parkinson’s disease. Nat Genet 1998; of sporadic PD cases suggests that the importance of 18: 106–108. alpha synuclein may extend well beyond a few cases 4 Maroteaux L, Scheller RH. The rat brain synucleins; family of pro- of FPD, and indeed represent a common pathway, as a teins transiently associated with neuronal membrane. Brain Res Mol Brain Res 1991; 11: 335–343. primary or secondary factor in the pathophysiology of 5 Jakes R, Spillantini MG, Goedert M. Identification of two distinct Parkinson’s disease in general. These results are con- synucleins from human brain. FEBS Lett 1994; 345: 27–32. sistent with our hypothesis that the missense Ala53Thr 6 George JM, Jin H, Woods WS, Clayton DP. Characterization of a mutation seen in FPD cases leads to an abnormal con- novel protein regulated during the critical period for song learning in the zebra finch. Neuron 1995; 15: 361–372. formation of the protein which is prone to self aggre- 7 Ueda K, Fukushima H, Masliah E, Xia Y, Iwai A, Yoshimoto M et gation and which may promote the development of the al. Molecular cloning of cDNA encoding an unrecognized compo- structure described as LB. Our previous genotyping nent of amyloid in Alzheimer disease. Proc Natl Acad Sci USA data of 52 sporadic cases of PD suggest that the 1993, 90: 11282–11286. Ala53Thr mutation is unlikely to be the cause of spor- 8 Xia Y, Rohan de Silva HA, Rosi BL, Yamaoka LH, Rimmler JB, Pericak-Vance MA et al. Genetic studies in Alzheimer’s disease adic PD 2, but it is possible that other factors could with an NACP/alpha-synuclein polymorphism. Ann Neurol 1996; cause a change in the conformation of otherwise nor- 40: 207–215. mal alpha synuclein molecules, leading to the develop- 9 Lewy F. Zur pathologischen Anatomie der Paralysis agitans. Dtsch ment of LB. Changes in the conformation of proteins Z Nervenheikd 1913; 50: 50–55. 10 Kosaka K, Yoshimura M, Ikeda K, Budka H. Diffuse Lewy body could theoretically be promoted by a number of agents disease: progressive dementia with abundant cortical Lewy bodies including other abnormally shaped proteins (as in the and senile changes of varying degree—a new disease? Clin Neuro- prion diseases), free radicals, oxidation, reduction, or pathol 1984; 31: 85–192. Alpha synuclein in sporadic Parkinson’s disease E Mezey et al 499 11 Pollanen MS, Dickson DW, Bergeron CM. Pathology and biology of 17 Dickson DW, Wertkin A, Kress Y, Ksiezak-Reding H, Yen SH. the Lewy body. J Neuropathol Exp Neurol 1993; 52: 183–191. Ubiquitin immunoreactive structures in normal human brains. Dis- 12 Iwatsubo T, Saido TC, Mann DM, Lee VM, Trojanowski JQ. Full- tribution and developmental aspects. Lab Invest 1990; 63: 87–99. length amyloid-beta (1-42(43)) and amino-terminally modified and 18 Schmidt M, Murray J, Trojanowski J. Continuity of neuropil threads truncated amyloid-beta 42(43) deposit in diffuse plaques. Am J with tangle-bearing and tangle-free neurons in Alzheimer’s disease Pathol 1996; 149: 1823–1830. cortex. A confocal laser scanning microscopy study. Molec Chem 13 Gai WP, Blessing WW, Blumbergs PC. Ubiquitin-positive degener- Neuropathol 1993; 18: 299–312. ating neurites in the brainstem in Parkinson’s disease. Brain 1995; 19 Braak H, Braak E, Grundke-Iqbal I et al. Occurrence of neuropil 118: 1447–1459. threads in the senile human brain and in Alzheimer’s disease: a 14 Lennox G, Lowe J, Landon M, Byrne EJ, Mayer RJ, Godwin-Austen third location of paired helical filaments outside of neurofibrillary RB. Diffuse Lewy body disease: correlative neuropathology using tangles and neuritic plaques. Neurosci Lett 1986; 65: 351–355. anti-ubiquitin immunocytochemistry. J Neurol Neurosurg Psy- 20 Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, chiatry 1989; 52: 1236–1247. Goedert M. Nature 1997; 388: 839–840. 15 Hill WD, Lee VM, Hurtig HI, Murray JM, Trojanowski JQ. Epitopes 21 Grune T, Reinheckel T, Davies KJ. Degradation of oxidized proteins located in spatially separate domains of each neurofilament subunit in mammalian cells. FASEB J 1997; 11: 526–534. are present in Parkinson’s disease Lewy bodies. J Comp Neurol 22 Horwich AL, Weissman JS. Deadly conformations—protein mis- 1991; 309: 150–160. folding in prion disease. Cell 1997; 89: 499–510. 16 Dickson DW, Crystal H, Mattiace LA, Kress Y, Schwagerl A, Ksie- 23 Lindquist S. Mad cows meet psi-chotic yeast: the expansion of the zak-Reding H et al. Diffuse Lewy body disease: light and electron microscopic immunocytochemistry of senile plaques. Acta Neuro- prion hypothesis. Cell 1997: 89: 495–498. pathol 1989; 78: 572–584.