Genetic Diversity Assessment of Aconitum Coreanum(H. Lév

Journal of Species Research 1(2):224-231, 2012

Genetic diversity assessment of Aconitum coreanum (H. Lév.) Rapaics (Ranunculaceae), an endangered plant species in Korea, using microsatellite markers

Hyosig Won1,*, Young-Eun Yun2, Myounghai Kwak2 and Jeong Eun Han2

1Department of Biological Sciences, Daegu University, Gyeongsan 712-714, Korea 2National Institute of Biological Resources, Incheon 404-708, Korea

*Correspondent: [email protected]

To assess the genetic diversity of Aconitum coreanum (Ranunculaceae) populations in Korea, we have amplified and sequenced eight organellar marker regions, and developed and analyzed microsatellite markers. No sequence variation was detected from the eight organellar markers. Ten microsatellites were developed using Next Generation Sequencing and two microsatellite markers, AK_CA03 and AK_CT07, were identified polymorphic and applied for 143 individuals of twelve A. coreanum populations. Four and five alleles were detected for the two microsatellite loci, respectively, and number of migrants (Nm) was estimated as 1.12586. Two microsatellite marker loci showed FST of 0.205 and 0.275, respectively. The heterozygosity deficit, low level of among-population differentiation, small size of gene flow, and lack of sequence variation of the organellar markers suggest that A. coreanum is reproductively isolated from other Aconitum species and there has been continuous gene flow among the populations of A. coreanum or it has dispersed relatively recently after speciation. Though population pairwise FST’s presented significant geographic structure, further sampling and study will be necessary to confirm this. Keywords: Aconitum coreanum, conservation, genetic diversity, microsatellite, organellar marker

num was once distributed widely from central to north- INTRODUCTION ern part of Korea (Korea Biodiversity Information System; http://nature.go.kr; Lee et al., 2005), but the distribution Aconitum coreanum (H. Lév.) Rapaics is a perennial range has been reduced and found mainly in Gangwon herbaceous plant distributed in Korea, northern China, and northern Chungbuk area at the present time (Lee et Far East Russia, and Mongolia (Li and Kadota, 2001; al., 2005). Lim (2003), Noh and Park (2000), and Noh Park, 2007) and a member of Aconitum subg. Aconitum (2009) presented the phylogenetic position of A. coreanum according to Kadota (1987). Aconitum coreanum has been as basal of the Aconitum subg. Aconitum, distinct from utilized as a traditional medicinal plant in Eastern Asia, the rest of the group from the molecular phylogenetic and has been widely studied for its useful chemical com- analyses of nuclear ribosomal internal transcribed spacer ponents and effects (Bessonova et al., 1987; Dzhakhan- (nrITS) sequences, xanthine dehydrogenase gene (XDH) girov and Bessonova, 2002; Liang et al., 2012; Tang et sequences, and chloroplast psbA-trnH, rbcL-accD, and al., 2012). Due to over-exploitation for traditional medi- trnL-trnF IGS region sequences. Also, Noh (2009) dis- cinal use, populations and number of individuals have covered that there is only one nrITS sequence type and been rapidly decreasing in Korea. Thus, A. coreanum has XDH gene sequence type detected from A. coreanum, been designated and protected as Level II Endangered contrary to the multiple sequence types detected from Wild Plants by the Ministry of Environment, Republic of other tetraploid Aconitum species putatively originated Korea. by hybridization. Chromosome number of A. coreanum Aconitum coreanum is easily distinguished from other has also been reported as tetraploid (2n=32; Lee 1967; Aconitum species distributed in Korea by its erect habit, Chung et al., 2011; but, see Jin et al., 1998 for 2n=24+ deeply and finely incised leaf lobes linear to lanceolate, 1B). These suggest that A. coreanum is a distinct and re- pubescent pedicels with curved hairs, terminal 2-7-flo- productively isolated tetraploid species from other Aconi- wered inflorescence, yellowish sepals, and 3 carpels tum species in Korea. (Park, 2007). Collection history indicates that A. corea- Although A. coreanum has been designated as an en- August 2012 WON ET AL.-GENETIC DIVERSITY OF ACONITUM COREANUM 225 dangered species, there has been little study on its dis- eanum using NGS and applied them to analyze the gene- tribution, ecology, demography, reproduction, pollination tic diversity of A. coreanum populations in Korea, though mechanism, seed dispersal, and population dynamics. which we tried to understand its genetic structure and Generally, Aconitum species are known to undergo both variation. sexual and vegetative reproduction (Kadota, 1987; Oh and Park, 1998; Bosch and Waser, 1999; Chung and Park, 2000). Although the flowers of Aconitum are bisexual, MATERIALS AND METHODS protandry is common and bumble bees (Bombus Latreille) are known as major pollinators. Matured seeds are known Sampling and DNA extraction to fall down gravitationally near the mother plant, and Due to lack of survey information and reduction in dis- no other dispersal mechanisms are reported. Vegetatively, tribution area and number of individuals, we limited col- new lateral roots are formed every year, replacing previ- lection sites to Gangwon area where recent reports on ous year’s root. In planning conservation strategy and sch- population size and distribution information were avail- eme for an endangered species, understanding its gene- able (Y.-C. Kim, pers. comm.). Individuals of A. corea- tic structure and variation is also a key factor. Thus as a num were randomly and sparsely distributed over the first step to establish a conservation plan for A. coreanum, mountain slope and at least couple of meters apart from we have here developed and applied microsatellite mark- each other, in general. Thus, we had to survey at least 50 ers, which is a very powerful tool in conservation biology ×50 m area per site to find enough number of indivi- in assessing genetic variation and population structure, duals, and all the individuals spotted were sampled. Sam- to A. coreanum populations, in addition to organellar ge- ples were collected from June to October 2011. One fresh nome region sequence variation analyses. leaf was collected from each individual of 12 A. corea- Microsatellites are composed of tandem repeated 1-6 num populations for the study (Table 1). DNA was ex- base pair nucleotide motifs, referred to as short tandem tracted directly from the fresh leaf or from silica-gel dried repeats (STRs), simple sequence repeats (SSRs), simple leaf. DNeasy Plant mini kit (QIAGEN) was used to ex- sequence length polymorphisms (SSLPs) or sequence tag- tract DNA. Extracted DNA was checked for its concen- ged sites (STS) (Hamilton et al., 1999; Kalia et al., 2011). tration using 1% agarose gel electrophoresis and further Among these molecular markers, microsatellites are co- quantified using Optizen 3220 UV bio nanoliter cell (Me- dominant, highly polymorphic and have better reproduci- casys Co., Ltd.). bility. Thus, microsatellites are preferred for genetic diversity study within species or/and elucidating demogra- Amplification and sequencing of organellar markers phic history of populations (Gupta et al., 1996; Zeng et al., 2004; Tehrani et al., 2009). However, the development Eight organellar markers, chloroplast ycf3 intron, ycf4- of microsatellite through traditional method is time- psaI IGS, rbcL-accD IGS, trnT-trnL IGS, trnL intron, consuming and labor-intensive, thus has been keeping trnL-trnF IGS, atpF-atpH IGS, and mitochondrial nad1 researchers from developing and applying microsatellites exon b-c intron regions, were PCR-amplified and sequenc- contrary to its benefits. Recently, microsatellite marker ed to check any genetic variation among the individuals design using the next generation sequencing (NGS) has of A. coreanum. Chloroplast psbK-psbI IGS and psbA- become popular and cost-effective. trnH IGS regions were also included in the initial tests, Here we developed microsatellite markers for A. cor- but discarded due to PCR-amplification or sequencing

Table 1. List of Aconitum coreanum populations and number of individuals sampled for genetic diversity assessment. Popn. #individuals sampled Location Seondol 23 Korea. Gangwon, Youngwol, Youngwol-eup, Bangjeol-ri Donggang 14 Korea. Gangwon, Youngwol, Youngwol-eup, Munsan-ri Hanbando 16 Korea. Gangwon, Youngwol, Seo-myeon, Sincheon, Ongjeong Baeilchi 4 Korea. Gangwon, Youngwol, Buk-myeon, Gwangdeok-ri Tongduduk 5 Korea. Gangwon, Youngwol, Seo-myeon, Gwangjeon-ri Panun 15 Korea. Gangwon, Youngwol, Jucheon-myeon, Panun-ri Gundungchi 19 Korea. Gangwon, Youngwol, Jucheon-myeon-Seo-myeon Daehwa 14 Korea. Gangwon, Pyeongchang, Daehwa-myeon, Ha-anmiri Wondongjae 8 Korea. Gangwon, Pyeongchang, Pyeongchang-eup, Majiri Hongcheon 7 Korea. Gangwon, Hongcheon, Bukbang-myeon, Busanwon-ri Daeryongsan 8 Korea. Gangwon, Chuncheon, Dong-myeon, Pyeongchon-ri Hau 10 Korea. Gangwon, Chuncheon, Buksan-myeon, Cheongpyeong-ri Total 143 226 JOURNAL OF SPECIES RESEARCH Vol. 1, No. 2 failure. We amplified and sequenced the markers using Table 2. Results of the organellar marker amplification/sequenc- primer sets developed by Taberlet et al. (1991), Demesure ing of Aconitum coreanum. One individual each from ten popula- et al. (1995), Fazekas et al. (2008), and J. Lee (pers. tions was amplified and sequenced for these markers. Amplified/sequenced G+C Variation comm.; Green Plant Research Institute, Suwon, Korea) Marker and followed the PCR and sequencing protocols of Won length (bp) content (%) observed and Renner (2005) and Won (2009). The resulting sequ- chloroplast ence chromatograms were verified and checked with Se- ycf3 intron ~550 28.2 None ycf4-psaI IGS ~490 25.4 None quencher program (ver. 4.9; Genecodes), and their lengths rbcL-accD IGS ~780 37.1 None and G+C contents were checked with PAUP* 4.0b10 trnT-trnL IGS ~670 28.5 None (Swofford, 2002) after building data matrices. trnL intron ~480 31.9 None trnL-trnF IGS ~440 33.1 None Development of Microsatellite markers atpF-atpH IGS ~530 34.2 None mitochondrion nad1 b-c intron Three A. coreanum DNA samples collected from Seon- ~580 49.8 None (partial) dol, Donggang, and Baeilchi populations were used to develop microsatellite markers. Microsatellite discovery were performed as previously described (Yu et al., 2011). DNA from one individual was subjected to sequencing Analysis of genetic diversity using microsatellite using a 1/4 plate of a Roche 454 GS-FLX titanium plat- markers form at NICEM(Seoul, Korea). The reads were assembled Two microsatellite loci, AK-CA03 and AK-CT07, were by Newbler version 2.6 (Roche Diagnostics, 454 Life amplified and genotyped for all the A. coreanum samples Science). All perfect di- and tri-nucleotide repeats were obtained to analyze their genetic diversity, following the searched against the assembled contigs and single read protocols explained previously. Amplified microsatellite using the ‘ssr_finder.pl’ perl program (Shanker et al., fragments were sent to Biomedic Ltd. (Bucheon, Gyeong- 2007). The primers to amplify discovered repeats were gi, Korea) for genotyping. Fragment size data were con- designed using Primer3 software package (http://www- verted into input data file using Convert program (Glau- genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi) bitz, 2004). Using GENEPOP (v 3.1d; Raymond and (Rozen and Skaletsky, 1998), setting with 22 bp optimal Rousset, 1995) and FSTAT (v 2.9.3.2; Goudet, 2001), we primer size (range 18-26 bp), 58�C optimal annealing estimated the proportion of polymorphic loci and the ave- temperature (range 55-62�C). rage number of alleles per locus, FIS (inbreeding coeffici- To genotype microsatellites, a 5′-M13 tail was added to ent of an individual (I), relative to the subpopulation (S)) each forward primer to allow fluorescent labeling during and FST (the effect of subpopulations (S) compared to the amplification (Schuelke, 2000). PCR mixture included total population (T)), and FIT. The observed and expect- 10 ng genomic DNA, 0.5 unit Ex-Taq polymerase (Ta- ed heterozygosity (HO and HE), population pairwise FST’s, KaRa, Japan), 1× Ex-Taq buffer, dNTP mixture (2.5 AMOVA(analysis of molecular variance) test, and Hardy- mM each), 4 pmol forward primer, 16 pmol reverse pri- Weinberg equilibrium (HWE) test using Markov Chain mer, 16 pmol fluorescent labeled M13(-21) primer (6- were done with Arlequin (ver. 3.5; Excoffier et al., 2005). FAM, NED, PET and VIC). We followed the PCR proto- The MICROCHECKER program (Van Oosterhout et cols of Schuelke(2000) and amplified PCR products were al., 2004) was used to check for null alleles and scoring checked by 2% agarose gel electrophoresis with known errors due to stuttering or large allele drop-out. DNA size marker. Then, GeneScanTM 500LIZ size stand- ard and HiDiTM formamide (Applied Biosystems, USA) were added to the PCR products and run on ABI 3730XL RESULTS (Applied Biosystems, USA) at NICEM for fragment size Organellar marker sequence detection. Genotypes were detected by GeneMarker¨ program (version 1.85; Softgenetics LLC). The amplified length and G+C contents of the eight To check whether the microsatellite primer sets proper- organellar markers amplified for the individuals of 10 A. ly amplified the designated microsatellite loci, PCR-am- coreanum populations are presented in Table 2. No sequ- plification and sequencing were done with the primer sets ence variation was detected. Chloroplast rbcL-accD IGS without adding fluorescent-labeled primer, applying the region was longest of all the markers amplified and mt same PCR cycles and sequencing protocols. Sequencing nad1 exon b-c intron showed distinctively high G+C con- products were run on ABI 3730XL (Applied Biosystems, tents compared to those of the chloroplast markers. USA) at NICEM, and sequence and fragment sizes were BLAST search of the eight marker sequences of A. corea- verified with Sequencher program (ver. 5.0l Genecodes). num confirmed that those sequences show highest se- August 2012 WON ET AL.-GENETIC DIVERSITY OF ACONITUM COREANUM 227

Table 3. Total occurrence of repeats in Aconitum coreanum genomes. No. of repeat count 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Total Di-nucleotide AT/TA 1919 243 35 15 4 9 5 4 - 1 - 1 ------2236 CA/AC/GT/TG 1476 181 40 19 8 5 1 1 ------1731 CT/TC/GA/AG 1913 236 72 36 16 6 3 1 1 ------2284 GC/CG 89 8 1 ---- 1 ------99 Tri-nucleotide AAT/ATA/TAA/TTA/TAT/ATT 194 34 11 5 1 2 ------1 248 AAC/ACA/CAA/GTT/TGT/TTG 228 56 18 8 2 - 1 ---1 ------314 AAG/AGA/GAA/CTT/TCT/TTC 479 68 19 4 5 ------575 ATG/TGA/GAT/CAT/ATC/TCA 151 46 4 2 ------203 ACC/CAC/CCA/GGT/GTG/TGG 163 42 10 3 ------218 ACG/CGA/GAC/CGT/GTC/TCG 16 ------16 AGT/GTA/TAG/ACT/CTA/TAC 35 ------35 AGC/GCA/CAG/GCT/CTG/TGC 54 18 2 2 ---1 ------77 AGG/GAG/GGA/CCT/TCT/TCC 120 29 20 4 4 2 1 2 ------182 CCG/CGC/GCC/CGG/GCG/GGC 6 3 ------9 AAA 1 ------1

Table 4. Primer sequence and characteristics of 10 microsatellite loci in Aconitum coreanum.

Locus Repeat motif Primer sequence (5′-3′)Tm(�C) Size range (bp) Na HO HE

AK_AT03 AT(10) F:ACGATTCCGTCGTATAACAATC 56 267 1 -- R:GGAATTAGTTCCTGAGTCCCTT

AK_AT08 AT(6) F:CATCTCTCCGAAAGACAATCTC 56 240 1 -- R:TTTATTTTTATTCGGACATGGG

AK_AT13 AT(6) F:GCAGAAACCAATACTGACCACT 56 224 1 -- R:GGAATTACCCAAGAGATGTCAA

AK_AT14 AT(6) F:ACGATTCCGAAGTATGACAATC 56 218 1 -- R:ATCCCTTTTGAAGTGGGTTAAT

AK_AT20 AT(6) F:GACCCAAAAGTGACTCAAAAAG 56 241 1 -- R:ACCACACTCTAACCGTATGTCC

AK_CT07 CT(7) F:TTCATATTGATCAAGTCCACCA 56 169-177 4 0.20 0.64** R:TCAGCAGGTTCTGTCCTTATTT

AK_CT14 CT(6) F:CAAATGATAGTTAGATCAAAAG TACG 56 176 1 -- R:AAATTTTAAGGTTTCGGGTCT

AK_CT16 CT(6) F:GTTATAAATTGTGGATCGCCAG 56 224 1 -- R:CAAAGATACCTTCCAAGTGGC

AK_CT18 CT(6) F:TTTGTTATAATTGTGGATCGCC 56 226 1 -- R:CAAAGATACCTTCCAAGTGGC

AK_CA03 CA(7) F:AATAAGCAATGTTGGTTGGAAG 56 238-242 3 0.33 0.58* R:TTGAGTACCACTTGGTCGAAAT

Significant Hardy-Weinberg Equilibrium (HWE) departures for each locus was determined by adding *=P⁄0.05, **=P⁄0.01 -; monomorphic data quence similarities with other Aconitum sequences alrea- quences was CT (35.97%), followed by AT (35.21%), CA dy on GenBank (data not shown). repeats (27.26%), and GC (1.56%). The AT repeats among di-nucleotide repeats were the longest with 15 repeats Microsatellite marker development and assessment (30 bp), the AAT among tri-nucleotide repeats with 21 repeats (63 bp). From higher copy numbers, 48 microsa- We obtained 265,470 reads (87.99 Mb) from 1/4 plate tellite primer sets were examined for amplification. Ten run using 454 GS-FLX titanium. The identified di- and microsatellites (20.83%) were successfully amplified and tri- repeats were shown in Table 3. The most frequent were tested for polymorphism further with 15 randomly di-nucleotide type found from A. coreanum genome se- chosen individuals from three populations. Among 10 228 JOURNAL OF SPECIES RESEARCH Vol. 1, No. 2

Table 5. Microsatellite allele frequencies detected from the Aconitum coreanum populations in Korea. AK_CA03 AK_CT07 Popn. N 235 237 239 241 N 170 172 174 178 180 Seondol 23 0.109 0.630 0.261 0 23 0.304 0.587 0.043 0 0.065 Donggang 14 0.464 0.143 0.393 0 11 0.364 0.136 0.318 0.182 0 Hanbando 16 0.156 0.594 0.250 0 16 0.531 0.250 0.219 0 0 Baeilchi 4 0 1.000 0 0 3 0 1.000 0 0 0 Tongduduk 5 0.100 0.900 0 0 5 0.100 0.800 0.100 0 0 Panun 15 0.033 0.767 0.200 0 15 0.233 0.767 0 0 0 Gundungchi 19 0.105 0.605 0.289 0 15 0.033 0.567 0.400 0 0 Daehwa 14 0.107 0.857 0.036 0 12 0.167 0.250 0.583 0 0 Wondongjae 7 0.286 0.286 0.429 0 7 0.143 0.286 0.571 0 0 Hongcheon 7 0 0.714 0.286 0 7 0.214 0.329 0.357 0 0 Daeryongsan 8 0 0.062 0.938 0 8 0 1.000 0 0 0 Hau 10 0 0 0.950 0.050 10 0 0.950 0.050 0 0 Total 142 0.127 0.547 0.336 0.004 132 0.216 0.542 0.216 0.015 0.011

Table 6. Gene diversity, number of alleles, allelic richness of the microsatellite markers detected from the Aconitum coreanum populations in Korea. AK_CA03 AK_CT07 Popn. gene diversity #alleles allelic richness gene diversity #alleles allelic richness Seondol 0.536 3 2.375 0.577 4 2.496 Donggang 0.626 3 2.597 0.773 4 3.280 Hanbando 0.577 3 2.523 0.637 3 2.651 Baeilchi 0 1 1.000 0 1 1.000 Tongduduk 0.200 2 1.600 0.400 3 2.200 Panun 0.381 3 1.973 0.371 2 1.830 Gundungchi 0.564 3 2.404 0.552 3 2.166 Daehwa 0.261 3 1.744 0.614 3 2.573 Wondongjae 0.714 3 2.851 0.631 3 2.622 Hongcheon 0.429 2 1.930 0.667 3 2.809 Daeryongsan 0.125 2 1.375 0 1 1.000 Hau 0.100 2 0.130 0.100 2 1.300 Total - 4 2.482 - 5 2.689

Table 7. Estimates of heterozygosity, F statistics of the microsatellite marker loci detected from the Aconitum coreanum populations in Korea.

Locus HO HE FIS FST FIT Dst Dst′ HT′ Gst AK_CA03 0.401 0.585 0.079 0.275 0.332 0.196 0.214 0.595 0.340 AK_CT07 0.250 0.615 0.500 0.205 0.603 0.128 0.140 0.594 0.220 Mean 0.326 0.600 0.304 0.239 0.471 0.162 0.177 0.594 0.280

HO: observed heterozygosity; HE: expected heterozygosity under H-W equilibrium; FIS: inbreeding coefficient of an individual (I) relative to the subpopulation

(S); FST: the effect of subpopulations (S) compared to the total population (T); FIT: inbreeding coefficient of an individual (I) compared to the total population

(T); Dst: amount of gene diversity among samples; Dst′: amount of gene diversity among samples, independent of the number of samples; HT′: overall gene

diversity, independent of the number of samples; Gst: an estimator of the parameter FST. microsatellite markers, only two markers (AK_CT07 plified for the 142 individuals of 12 A. coreanum popula- and AK_CA03) were polymorphic (Table 4). These two tions, while AK_CT07 microsatellite marker was amplifi- markers showed significant departure from Hardy- ed for 132 samples (Table 5). Four alleles (235, 237, 239, Weinberg equilibrium (P⁄0.05). 241 bp fragments) and five alleles (170, 172, 174, 178, 180 bp fragments) were detected for AK_CA03 and AK_ Analysis of Genetic diversity using Microsatellite CT07 loci, respectively (Table 5). 237 bp fragment and 172 bp fragment were the most common alleles for AK_ AK_CA03 microsatellite marker was successfully am- CA03 and AK_CT07 loci, respectively. 241 bp fragment August 2012 WON ET AL.-GENETIC DIVERSITY OF ACONITUM COREANUM 229

Table 8. Population pairwise FST′s estimated from the microsatellite markers of Aconitum coreanum populations in Korea. Popn. SD DG HB BI TD PU GD DH WD HC DR HU Seondol (SD) 0.000 Donggang (DG) 0.016 0.000 Hanbando (HB) -0.022 -0.012 0.000 Baeilchi (BI) -0.037 -0.083 -0.070 0.000 Tongduduk (TD) 0.040 -0.072 -0.011 -0.024 0.000 Panun (PU) -0.028 0.018 -0.024 0.002 0.111 0.000 Gundungchi (GD) -0.023 0.024 -0.019 -0.022 0.060 -0.030 0.000 Daehwa (DH) 0.059 -0.037 0.014 -0.061 -0.069 0.110 0.081 0.000 Wondongjae (WD) -0.049 -0.027 -0.052 -0.084 -0.025 -0.054 -0.049 0.014 0.000 Hongcheon (HC) -0.019 0.040 0.001 0.158 0.259 -0.020 -0.034 0.246 -0.053 0.000 Daeryongsan (DR) 0.513 0.448 0.535 0.911 0.874 0.642 0.491 0.815 0.433 0.600 0.000 Hau (HU) 0.599 0.529 0.620 0.938 0.909 0.721 0.582 0.857 0.540 0.705 0.055 0.000

*Significant pairwise FST values (P⁄0.01) are bold-faced.

Table 9. Hierarchical nested analysis of molecular variance (AMOVA). Source d.f. S.S. Variance % Var Statistics P-value No grouping Among populations 11 116.556 0.39913 22.86 FST=0.229 ⁄0.0001 Within populations 272 366.416 1.34712 77.14 Total 283 482.972 1.74624 Regional grouping (Chuncheon vs. the other region) Among group 1 103.504 1.62537 54.71 FGT=0.547 0.0235 Among populations within groups 10 13.052 -0.00178 -0.06 FPG=-0.001 0.5064 Within populations 272 366.416 1.34712 45.35 FPT=0.547 ⁄0.0001 Total 283 482.972 2.97070 of AK_CA03 locus was only detected from Hau popula- of genetic variation. Without regional grouping, 77.1% tion. 178 bp and 180 bp fragments of AK_CT07 locus of variance was distributed within population and 22.9% were detected only from Donggang and Seondol popula- among population, respectively (Table 9). When two Chun- tion, respectively. In case of allelic richness, gene diver- cheon populations were treated as separate group from sity, and the number of alleles, AK_CT07 locus showed the rest, 54.7% of variance was accounted for by among higher statistics than AK_CA03 locus (Table 6). Gene- regional groups, although the F statistic is not signifi- rally, more than three alleles were detected from the pop- cant (P=0.0235). Still, 45.4% of variance was distribut- ulations bigger than population size of 10 individuals. ed within populations (P⁄0.0001). Among population Although Wondongjae population is small (n=7), it variance was negligible with P=0.5064. shows highest allelic richness for AK_CA03 locus, while Donggang population show highest allelic richness for AK_CT07 locus. Geographically, populations in Chun- DISCUSSION cheon area, Daeryongsan and Hau populations, showed lower gene diversity and allelic richness than those in Both the two microsatellite loci discovered in this study Youngwol, Hongcheon, and Pyeongchang. The expected significantly deviated from the Hardy-Weinberg equili- heterozygosity under HWE was not much different from brium. The reason for the deviation may reside in the fail- the values of the microsatellite test, but the observed hete- ure of amplification of marker due to the existence of rozygosity was slightly larger for the population data variation at the 3′ terminal of the primers (Jarne and La- (Table 7). The mean FST was 0.239 and the number of goda, 1996; Dakin and Avise, 2004), over-representation migrants (after correction for size; Nm) was estimated as of homozygote over heterozygote due to over-replication 1.12586 by GENEPOP. Population pairwise FST’s pre- of specific alleles through competitive PCR (partial null), sented significant geographic structure (Table 8). Two heterozygote deficit, presence of null allele, very small Chuncheon populations presented significantly large pair- population size (An et al., 2010; Wang et al., 2011), or wiase FST values with the rest of the populations (Table effect of natural selection and genetic structure of the 8). Hierarchical nested analysis of molecular variance population (Wahlund effect). Such null allele can mis- (AMOVA) was done to evaluate the geographic structure lead the results by making analyses of microsatellite com- 230 JOURNAL OF SPECIES RESEARCH Vol. 1, No. 2 plicated. Heterozygote deficit of A. coreanum may have Lim at Daegu University, Young-Chul Kim at Korea been caused by small population size studied and/or excess Botanic Garden for their help with DNA sampling and of selfing over outcrossing due to the low density of A. collection, and Wonju Regional Environmental Office coreanum in the field. As the density and population size for help with collection permit. Also, authors thank three of A. coreanum are generally small, this may have been anonymous reviewers for their insightful comments and a major cause for deviation from HWE. Also the lack of suggestions. active seed dispersal mechanism for Aconitum may have reduced chance to exchange genetic material. Thus, once the size of population declines and fragmented, local popu- REFERENCES lations of A. coreanum may easily undergo selfing and lose genetic variation. An, H.S., J.-h. Lee, J.K. Noh, H.C. Kim, C.J. Park, B.H. Min Lack of sequence variation of the eight organellar mark- and J.-I. Myeong. 2010. Ten new microsatellite markers ers amplified and sequenced in this study again confirms in cutlassfish Trichiurus lepturus derived from an enrich- the results of Lim (2003) and Noh (2009) where A. core- ed genomic library. Anim. Cells. Syst. 14:169-174. anum showed lack of genetic variation while other tetra- Bessonova, I.A., M.S. Yunusov, V.G. Kondrat’ev and A.I. ploid Aconitum species show polymorphisms and multi- Shreter. 1987. Alkaloids of Aconitum coreanum. I. Struc- ple sequence types. This strongly suggests that A. corea- ture of acorine. Chemistry of Natural Compounds 23:573- num might have long been reproductively isolated from 575. other tetraploid Aconitum species in Korea and/or main- Bosch, M. and N.M. Waser. 1999. Effects of local density tained as a distinct evolutionary lineage. While A. corea- on pollination and reproduction in Delphinium nuttallia- num is genetically distinct from other Aconitum, uniform num and Aconitum columbianum (Ranunculaceae). Amer. sequence type of A. coreanum suggests that there has J. Bot. 86:871-879. been continuous gene flow among them or it has dis- Chung, K.-S., B. Nam, M.S. Park, J.A. Eom, B.-U. Oh and persed relatively recently after speciation. The number G.Y. Chung. 2011. Chromosome numbers of eight taxa of migrants (Nm) and FST values estimated from the micro- of Aconitum L. in Korea and their systematic signific- satellite loci are relatively small (Nm=1.12586; FST= ance (Ranunculaceae). Korean. J. Pl. Taxon. 41:215-222. 0.205 and 0.275) and 77.1% of molecular variance are Chung, M.G. and C.-W. Park. 2000. Notes on spatial genetic accounted for by within population variance. This indi- structure in a hybrid population between Aconitum japo- cates that there is not much genetic differentiation among nicum subsp. napiforme and A. jaluense (Ranuncula- A. coreanum populations in Korea. This fits with the idea ceae). Ann. Bot. Fenn. 37:243-247. that A. coreanum may have dispersed rapidly recently. Dakin, E.E. and J.C. Avise. 2004. Microsatellite null alleles However, significant population pairwise FST estimates in parentage analysis. Heredity 93:504-509. of A. coreanum in Korea suggests that there exists evident Demesure, B., N. Sodzi and R.J. Petit. 1995. A set of univer- geographic differentiation. This may have been caused sal primers for amplification of polymorphic non-coding by sampling artifact, though, since we have collected regions of mitochondrial and chloroplast DNA in plants. mainly around Youngwol, with extra two populations Mol. Ecol. 4:129.131. from Chuncheon, at least 60 km apart from Pyeongchang Dzhakhangirov, F.N. and I.A. Bessonova. 2002. Alkaloids and Youngwol. The lack of significance of F statistics of Aconitum coreanum. X. Curare-like activity-structure in hierarchical nested AMOVA indicates that still the relationship. Chemistry of Natural Compounds 38:74-77. genetic variance are represented by within population Excoffier, L., G. Laval and S. Schneider. 2005. Arlequin ver. variance. Wider and denser population sampling and in- 3.0: An integrated software package for population gene- creases in the sample size may reduce the effect of popu- tics data analysis. Evolutionary Bioinformatics Online 1: lation differentiation. Further long-term monitoring and 47-50. study on reproductive biology will help understand the Fazekas, A.J., K.S. Burgess, P.R. Kesanakurti, S.W. Gra- genetic structure and dynamics of A. coreanum and will ham, S.G. Newmaster, B.C. Husband, D.M. Percy, M. help conserve and recover natural populations. Hajibabaei and S.C. H. Barrett. 2008. Multiple multilo- cus DNA barcodes from the plastid genome discriminate plant species equally well. Public Library of Science ACKNOWLEDGEMENTS ONE 3: e2802. doi:10.1371/journal.pone.0002802. Glaubitz, J.C. 2004. CONVERT: a user friendly program to This project was supported by a grant entitled “The reformat diploid genotypic data for commonly used popu- Genetic Evaluation of Important Biological Resources lation genetic software packages. Molecular Ecology Notes (2011)” from the National Institute of Biological Re- 4:309-310. sources. Authors thank Joo Hwan Kim and Chang Kun Goudet, J. 2001. FSTAT, a program to estimate and test gene August 2012 WON ET AL.-GENETIC DIVERSITY OF ACONITUM COREANUM 231

diversities and fixation indices (version 2.9.3). http:// Korea. Academy Publishing Co., Seoul, Korea. pp. 176- www.unil.ch/izea/softwares/fstat.html. 182. Gupta, P.K., H.S. Balyan, P.C. Sharma, B. Ramesh. 1996. Raymond M. and F. Rousset. 1995. GENEPOP (version 1.2): Microsatellites in plants: a new class of molecular mark- population genetics software for exact tests and ecumeni- ers. Curr. Sci. 70:45-54. cism. J. Heredity 86:248-249 Hamilton, M.B., E.L. Pincus, A. Di Fiore and R.C. Flei- Rozen, S. and H.J. Skaletsky. 1998. Primer 3. Code avai- scher. 1999. Universal linker and ligation procedures for lable at http://www.genome.wi.mit.edu/genome_software/ construction of genomic DNA libraries enriched for mi- other/primer3.html. crosatellites. BioTechniques 27:500-507. Schuelke, M. 2000. An economic method for the fluorescent Jarne, P. and P.J. LLagoda. 1996. Microsatellites, from labeling of PCR fragments. Nat. Biotechnol. 18:233-234. molecules to populations and back. Trends Ecol. Evol. Shanker, A., A. Bhargava, R. Bajpai, S. Singh, S. Srivastava 11:424-429. and V. Sharma. 2007. Bioinformatically mined simple Jin, W., C. Chen, and E.B. Wang. 1998. A karyotaxono- sequence repeats in UniGene of Citrus sinensis. Sci Hor- mical study on 6 species of Aconitum in Liaoning area. tic-Amsterdam 113:353-361. Bull. Bot. Res., Harbin 18:163-172 (in Chinese). Swofford, D.L. 2003. PAUP*. Phylogenetic Analysis Using Kadota, Y. 1987. A revision of Aconitum subgenus Aconi- Parsimony (* and Other Methods). Version 4. Sinauer tum (Ranunculaceae) of East Asia. Sanwa Shoyaku, Utsu- Associates, Sunderland, Massachusetts. nomiya. Taberlet, P., L. Gielly, G. Patou and J. Bouvet. 1991. Uni- Kalia, R.K., M.K. Rai, S. Kalia, R. Singh, and A.K. Dhawan. versal primers for amplification of three noncoding re- 2011. Microsatellite markers: An overview of the recent gions of chloroplast DNA. Pl. Mol. Biol. 17:1105-1109. progress in plants. Euphytica 177:309-334. Tang, Q.-Fa., W.-C. Ye, J.-H. Liu and C.-H. Yang. 2012. Lee, H.-W., H.-R. Chung, T.-H. Roh, Y.-H. Kwon, C.-H. Three new hetisine-type diterpenoid alkaloids from Aco- Kim, J.-O. Hyun and I.-S. Jang. 2005. Categorization nitum coreanum. Phytochemistry Letters 5:397-400. and Conservation of the Threatened Plant Species in Tehrani, M.S., M.M. Mardi, J. Sahebi, P. Catalan and A. Environmental Impact Assessment. Korea Environment Diaz-Perez. 2009. Genetic diversity and structure among Institute (in Korean). Iranian tall fescue populations based on genomic-SSR Lee, Y.N. 1967. Chromosome numbers of flowering plants and EST-SSR marker analysis. Plant. Syst. Evol. 282: in Korea. J. Korean Res. Inst. Ewha Women’s Univ. 11: 57-70. 455-478. Van Oosterhout, C., W.F. Hutchinson, D.P.M. Wills and P. Li, L. and Y. Kadota. 2001. Aconitum. In: Flora of China Shipley. 2004 MICRO-CHECKER: software for identi- Editorial Committee (eds.), Flora of China, vol. 6, Caryo- fying and correcting genotyping errors in microsatellite. phyllaceae through Lardizabalaceae. Missouri Botanical Mol Ecol Notes 4:535-538 Garden Press, Missouri. pp. 150-227. Wang, Y., F. Wang, Y.H. Shi, Z.F. Gu and A.M. Wang. 2011. Lim, C.E. 2003. Chloroplast DNA Sequence Variation of Development and characterization of 60 microsatellite Aconitum L. subgenus Aconitum (Ranunculaceae) in Ko- markers in the abalone Haliotis diversicolor. Genet. Mol. rea: Interspecific Relationships and Hybridization. Ph. Res. 10:860-866. D. thesis, Seoul National University, Seoul. Won, H. and S.S. Renner. 2005. The internal transcribed Liang, M., S. Li, B. Shen, J. Cai, C. Li, Z. Wang, X. Li, J. spacer of nuclear ribosomal DNA in the gymnosperm Gao, H. Huang, X. Zhang and J. Li. 2012. Anti-hepato- Gnetum. Mol. Phylogen. Evol. 36:581-597. carcinoma effects of Aconitum coreanum polysaccharides. Won, H. 2009. Phylogenetic position of Corchoropsis Sie- Carbohydrate Polymers 88:973-976. bold & Zucc. (Malvaceae s.l.) inferred from plastid DNA Noh, T.-K. 2009. Hybridization in Aconitum subgenus Aco- sequences. J. Plant Biol. 52:411-416. nitum (Ranunculaceae) at Mt. Jiri in Korea. Ph.D. Disserta- Yu, J.-N., C. Won, J. Jun, Y. Lim and M. Kwak. 2011. Fast tion. Seoul National University (in Korean). and cost-effective mining of microsatellite markers using Noh, T.-K. and C.-W. Park. 2000. ITS sequence variation of NGS technology: An example of a Korean water deer Korean Aconitum (Ranunculaceae) species. The 55th Hydropotes inermis argyropus. PLoS ONE 6(11):e26933. annual meeting of the Korean Association of Biological Zeng, L., T.-R. Kwon, X. Liu, C. Wilson, C.M. Grieve and Sciences. P. 100 (in Korean). G.B. Gregorio. 2004. Genetic diversity analyzed by mi- Oh, S. and C.-W. Park. 1998. Crossability of the Aconitum crosatellite markers among rice (Oryza sativa L.) geno- jaluense species complex (Ranunculaceae) in Korea. Ko- types with different adaptations to saline soils. Plant Sci. rean J. Biol. Sci. 2:435-438. 166:1275-1285. Park, C.W. 2007. Aconitum. In: Flora of Korea Editorial Committee (eds.), The Genera of Vascular Plants of Submitted: July 16, 2012, Accepted: August 24, 2012