DOCSLIB.ORG

Phylogenetics and Biogeography of Cobra (Squamata: Naja) in Java, Sumatra, and Other Asian Region

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetics and Biogeography of Cobra (Squamata: Naja) in Java, Sumatra, and Other Asian Region Phylogenetics and Biogeography of Cobra 94 (Kurniawan et al.) Phylogenetics and Biogeography of Cobra (Squamata: Naja) in Java, Sumatra, and Other Asian Region Nia Kurniawan1*, Mulyadiane M. Putri1, Ahmad M. Kadafi1, Dea J. Chrestella1, Muhammad A. Fauzi1, Agung S. Kurnianto2 1Department of Biology, Faculty of Mathematics and Natural Sciences, University of Brawijaya, Malang, Indonesia 2Graduate School, University of Brawijaya, Malang, Indonesia Abstract The separation of Sumatra and Java occurred at the end of the Miocene (10 mya) to the end of Pliocene (1.8 mya). The existence of ecological variations and geographic barriers inhibits gene flow through the isolation of adaptation, geography, reproduction, inbreeding, and leading to population segregation. Cobra (genus Naja) distribution became greatly influenced by the geologic condition and sea level. This study was conducted by phylogenetic analysis towards the 16S rRNA gene. Survey was done with Visual Encounter Survey (VES) method on 6 locality. There were 3 location in Sumatra Island and the others in Java Island. Sample from other Asian region was obtained from Genbank, which are 11 individuals from China, Thailand, and Nepal. DNA extraction was done according to the QIAmp® DNA Mini Kit stand- ard protocol. The forward and reverse 16S sequences are combined with the SequencherTM version 4.1.4 program, then in BLAST (Blast Local Alignment Search Tool) at www.ncbi.nlm.nih.gov. Phylogenetic analyzes of clade A (MP = 60, ML = 54, BI = 88) indicate the presence of division into two monophyletic subclade (AI and AII). Subclade AI consists of groups of Cobra from Sunda (Thailand, Sumatra and Java). Subclade AII is a group of species N. kaouthia originating from Chumpon Province, Southern Thailand with (MP = 96, ML = 95, BI = 100). Clade B is divided into two subclasses (BI and BII). The result is supported by bootstrap value MP = 93, ML = 99, BI = 100. N. atra of Fujian Province is a sister lineage of the same species from Jiangxi Province (MP = 86, ML = 86, BI = 100). Keywords: Asian, 16s rRNA, Java, Cobra, Sumatra. INTRODUCTION variations and geographic barriers inhibits gene The evolution of South Asia’s diversity was flow through the isolation of adaptation, occurred in Paleocene epoch (60 mya-million geography, reproduction, inbreeding, and leading years ago), when the Malay Peninsula, Java, to population segregation [2]. Cobra (genus Naja) Sumatra, and Borneo still merged as a big distribution became greatly influenced by the continent, called as sundaland. Then, the geologic condition and sea level [3]. This study formation of the volcanic rings during Eocene was conducted by phylogenetic analysis towards (40 mya) and sea level fluctuations at the the 16S rRNA gene. The purpose of this study is beginning of Miocene (23.03 mya) initiated the to estimate the relationship of Naja genus in the separation between the Malay Peninsula and island of Java, Sumatra, and other Asian region Borneo. On the late Miocene, sea level based on the 16S rRNA mithocondrial gene. Zoo- fluctuations occured again and half of Java Island geography analysis is also examined for more were flooded by water. The separation of advance understanding between the correlation Sumatra and Java as well as Borneo rotational and evolution of Sundaland. changes occurred at the end of the Miocene (10 MATERIALS AND METHODS mya) to the end of Pliocene (1.8 mya) [1]. The Sampling and Preservation movement of the earth's plate during the land Survey was done with Visual Encounter Sur- evolution was separate several regions of Asia. In vey (VES) method on 6 locality. There were 3 addition, Sumatra Island is estimated to occured location in Sumatra Island and the others in Java in last 25 million years ago (late Miocene) and Island (Table 1). Sample from other Asian region divided into west and east regions by Bukit was obtained from Genbank, which are 11 indi- Barisan mountains. The existence of ecological viduals from China, Thailand, and Nepal (Table 2). VES method identification was done based on Correspondence address: morphological characteristics, then preserved by Nia Kurnaiawan alcohol 70%. The preserved sample tissue was Email : [email protected] further extracted and cured in EDTA 4%. Address : Dept. Biology, Faculty of Mathematics and Natural Sciences, University of Brawijaya, Veteran Malang, Malang 65145. J.Exp. Life Sci. Vol. 7 No. 2, 2017 ISSN. 2087-2852 E-ISSN. 2338-1655 Phylogenetics and Biogeography of Cobra 95 (Kurniawan et al.) Table 1. Cobra (Genus: Naja) Samples Used on This Research Species Locality Island Accession Number Naja sputatrix Malang, East Java Java MG012885 Naja sputatrix Bondowoso, East Java Java MG012888 Naja sputatrix Cilacap, Central Java Java MG012889 Naja sumatrana Mandailing Natal, North Sumatra Sumatra MG012884 Naja sumatrana Medan, North Sumatra Sumatra MG012886 Naja sumatrana Bengkulu, Sumatra Sumatra MG012887 Table 2. Sequences Data of the Genus Megophrys and Out- and then homogenized. Homogenate was poured group Species from GenBank slowly into gel cast, and allowed to harden. The Species Accesion Number Locality hardened gel was inserted into electrophoresis Naja sumatrana JN687929.1 Thailand Naja kaouthia GQ359757.1 Thailand chamber and soaked in TBE (pH 8). DNA sample Naja kaouthia EU624269.1 Thailand is mixed wit loading dye, then inserted into wells Naja atra EU729432.1 Fujian, China as well as the DNA marker ladder 1 kb (1:1). Elec- Naja atra HM439991.1 Jiangxi, China Naja atra EF413645.2 Guangdong, China trophoresis then conducted at half voltage for Naja atra EF413642.2 Guangdong, China 45-60 minute. The results were documented with Naja atra EU729431.1 Yunnan, China Gel Doc. Naja naja GQ359756.1 Nepal, India Naja naja EU624270.1 Nepal, India DNA Amplification Ophiophagus hannah JN687931.1 Thailand The components were placed in microtube: DNA Extraction 3.6 µL of dH2O; 5 µL of PCR mix (Go Taq Green); DNA extraction was done according to the 0.2 µl of 16 SAR primer (F) QIAmp® DNA Mini Kit standard protocol. A total 5’CGCCTGTTTATCAAAAACAT-3’ and 16 SBR (R) 5’- of 25 mg of tissue was cut in tiny pieces and CCGGTCTGAACTCAGATCACGT3’ [5]; 0.5 µL of o placed in 1.5 ml microtube. The tissue was given DNA sample. PCR was set at: Hot start at 95 C (3 o 180 µL of ATL buffer and 20 µL of K-proteinase. minute), denaturation at 95 C (30 second), an- o o Samples were incubated in waterbath-shaker, nealing at 52 C (60 second), extension at 72 C o and was done in 56oC for 1-3 hours, then added (60 second), and post-extension at 72 C (7 mi- 200 µL of AL buffer. Sample incubation at a tem- nute). PCR cycle was repeated 34 times. o perature of 56 C was done for 10 minutes, then Phylogenetic Analysis added 200 µL of 90-100% ethanol. Each proce- The forward and reverse 16S sequences are dure is terminated with vortex. Samples were combined with the SequencherTM version 4.1.4 pipetted and inserted into 2 mL collection tube program, then in BLAST (Blast Local Alignment and placed in Dneasy Mini Spin. Centrifugation Search Tool) at www.ncbi.nlm.nih.gov. As was done at 8000 rpm (one minute), supernatant outgroup, Ophiophagus hannah (Family Elapidae) is then discarded. Spin Column was placed in new is used with DNA sequence data that is accessed collection tube and was given 500 µL of AW1 from the site www.ncbi.nlm.nih.gov. Both sample buffer. Sample then centrifuged on 8000 rpm sequences and outgroup species were aligned (one minute), supernatant is then discarded. Spin with ClustalW analysis on the MEGA6.0 program. column then placed in new collection tube (2 mL) The reconstruction of phylogenetic tree was and was added 500 µL of AW2 buffer. Centrifuga- done by Maximum Parsimony (MP) analysis, with tion was done at 14.000 rpm (3 minute), super- bootstrap 1000 in PAUP 4.0b10a program. The natant is then discarded. Spin column then Jmodeltest 3.06 program is used for the best placed in 1.5 or 2 mL microtube. DNA was model of likelihood analysis. Analysis of MP, thawed with 200 µL AE buffer in the middle of Maximum Likelihood, and Bayesian Inference spin column. Incubation was done at one minute were performed on Mr.Bayes program ver 3.1.2 o (15-25 C), then centrifugated at 8000 rpm (1 mi- MCMC 10 million generation. Haplotype Network nute). Analysis is done with DNAsp program and Qualitative Analysis Bandelt Network. Qualitative analysis was done by agarose gel RESULT AND DISCUSSION (1%) electrophoresis [4]. Gel was made using 0.3 Qualitative Analysis g agarose and 30 mL Tris-Boric-EDTA (TBE) with The results of electrophoresis of all N. pH 8. Gel was made inside Erlenmeyer flask until sputatrix DNA samples and N. sumatrana showed boiled a little. Warm agarose was given 1 µL EtBr the presence of DNA with an ampicton size of J.Exp. Life Sci. Vol. 7 No. 2, 2017 ISSN. 2087-2852 E-ISSN. 2338-1655 Phylogenetics and Biogeography of Cobra 96 (Kurniawan et al.) 500-600 bp (Fig. 1). An amplycone length range N. atra (China), N. sputatrix (Java), and N. of 550-590 bp [6] is the result obtained from the sumatrana (Sumatra) is high (p-Distance 4-16%). amplification of 16S rRNA gene with 16 SBR The p-Distance value between N. kaothia and N. primary and 16 SAR as reverse and forward sputatrix (Java) and N. sumatrana (Sumatra) is respectively.Visualization of DNA bands describes low (p-Distance 2-3%), while p-Distance value the purity of DNA resulting from isolation between N. kaouthia with N.atra and N. naja process, hence the visualized DNA can be used as classified as high (p-Distance 9-12%).
Load more

Recommended publications
  • (Equatorial Spitting Cobra) Venom a P
    The Journal of Venomous Animals and Toxins including Tropical Diseases ISSN 1678-9199 | 2011 | volume 17 | issue 4 | pages 451-459 Biochemical and toxinological characterization of Naja sumatrana ER P (Equatorial spitting cobra) venom A P Yap MKK (1), Tan NH (1), Fung SY (1) RIGINAL O (1) Department of Molecular Medicine, Center for Natural Products and Drug Research (CENAR), Faculty of Medicine, University of Malaya, Kuala Lumpur, Malaysia. Abstract: The lethal and enzymatic activities of venom from Naja sumatrana (Equatorial spitting cobra) were determined and compared to venoms from three other Southeast Asian cobras (Naja sputatrix, Naja siamensis and Naja kaouthia). All four venoms exhibited the common characteristic enzymatic activities of Asiatic cobra venoms: low protease, phosphodiesterase, alkaline phosphomonoesterase and L-amino acid oxidase activities, moderately high acetylcholinesterase and hyaluronidase activities and high phospholipase A2. Fractionation of N. sumatrana venom by Resource® S cation exchange chromatography (GE Healthcare, USA) yielded nine major protein peaks, with all except the acidic protein peak being lethal to mice. Most of the protein peaks exhibit enzymatic activities, and L-amino acid oxidase, alkaline phosphomonoesterase, acetylcholinesterase, 5’-nucleotidase and hyaluronidase exist in multiple forms. Comparison of the Resource® S chromatograms of the four cobra venoms clearly indicates that the protein composition of N. sumatrana venom is distinct from venoms of the other two spitting cobras, N. sputatrix (Javan spitting cobra) and N. siamensis (Indochinese spitting cobra). The results support the revised systematics of the Asiatic cobra based on multivariate analysis of morphological characters. The three spitting cobra venoms exhibit two common features: the presence of basic, potentially pharmacologically active phospholipases A2 and a high content of polypeptide cardiotoxin, suggesting that the pathophysiological actions of the three spitting cobra venoms may be similar.
    [Show full text]
  • Cobra Risk Assessment
    Invasive animal risk assessment Biosecurity Queensland Agriculture Fisheries and Department of Cobra (all species) Steve Csurhes and Paul Fisher First published 2010 Updated 2016 Pest animal risk assessment © State of Queensland, 2016. The Queensland Government supports and encourages the dissemination and exchange of its information. The copyright in this publication is licensed under a Creative Commons Attribution 3.0 Australia (CC BY) licence. You must keep intact the copyright notice and attribute the State of Queensland as the source of the publication. Note: Some content in this publication may have different licence terms as indicated. For more information on this licence visit http://creativecommons.org/licenses/ by/3.0/au/deed.en" http://creativecommons.org/licenses/by/3.0/au/deed.en Photo: Image from Wikimedia Commons (this image is reproduced under the terms of a GNU Free Documentation License) Invasive animal risk assessment: Cobra 2 Contents Summary 4 Introduction 5 Identity and taxonomy 5 Taxonomy 3 Description 5 Diet 5 Reproduction 6 Predators and diseases 6 Origin and distribution 7 Status in Australia and Queensland 8 Preferred habitat 9 History as a pest elsewhere 9 Uses 9 Pest potential in Queensland 10 Climate match 10 Habitat suitability 10 Broad natural geographic range 11 Generalist diet 11 Venom production 11 Disease 11 Numerical risk analysis 11 References 12 Attachment 1 13 Invasive animal risk assessment: Cobra 3 Summary The common name ‘cobra’ applies to 30 species in 7 genera within the family Elapidae, all of which can produce a hood when threatened. All cobra species are venomous. As a group, cobras have an extensive distribution over large parts of Africa, Asia, Malaysia and Indonesia.
    [Show full text]
  • Identifying Intraspecific Variation in Venom Yield of Chinese Cobra (Naja Atra) from Ten Populations in Mainland China
    Asian Herpetological Research 2019, 10(1): 32–40 ORIGINAL ARTICLE DOI: 10.16373/j.cnki.ahr.180041 Identifying Intraspecific Variation in Venom Yield of Chinese Cobra (Naja atra) from Ten Populations in Mainland China Jianfang GAO1*, Yin YIN1, Yanfu QU2, Jin WANG2, Longhui LIN1, Hongliang LU1 and Xiang JI2 1 Hangzhou Key Laboratory for Animal Adaptation and Evolution, College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 310036, Zhejiang, China 2 Jiangsu Key Laboratory for Biodiversity and Biotechnology, College of Life Sciences, Nanjing Normal University, Nanjing 210046, Jiangsu, China Abstract Detailed information on venom yield is helpful in preparing antivenoms and treating snakebites, but such information is lacking for many species of venomous snakes. The Chinese cobra (Naja atra) is a large sized, venomous snake commonly found in southeastern China, where it causes a heavy burden of snakebites. To examine the effects of various factors (morphology, sex, age, season, and geographical origin) on the venom yield in this snake, we collected venom samples of 446 individuals (426 adults and 20 neonates) from 10 populations of N. atra over an eight- year period. We used two variables, lyophilized venom mass (venom yield) and solid content of venom (% solids), to quantify the venom yield. We used linear regression analysis to check if venom yield was related to morphological factors, one-way ANOVA and one-way ANCOVA to detect the sexual, ontogenetic, and geographic variation in venom yield, and repeated-measures ANOVA to examine seasonal shifts in venom yield. Our results indicate that venom yield of N. atra is positively related to the morphological traits examined, with male snakes expelling more venom than females.
    [Show full text]
  • Quantitative Characterization of the Hemorrhagic, Necrotic, Coagulation
    Hindawi Journal of Toxicology Volume 2018, Article ID 6940798, 8 pages https://doi.org/10.1155/2018/6940798 Research Article Quantitative Characterization of the Hemorrhagic, Necrotic, Coagulation-Altering Properties and Edema-Forming Effects of Zebra Snake (Naja nigricincta nigricincta)Venom Erick Kandiwa,1 Borden Mushonga,1 Alaster Samkange ,1 and Ezequiel Fabiano2 1 School of Veterinary Medicine, Faculty of Agriculture and Natural Resources, Neudamm Campus, University of Namibia, P. Bag 13301, Pioneers Park, Windhoek, Namibia 2Department of Wildlife Management and Ecotourism, Katima Mulilo Campus, Faculty of Agriculture and Natural Resources, University of Namibia, P. Bag 1096, Ngweze, Katima Mulilo, Namibia Correspondence should be addressed to Alaster Samkange; [email protected] Received 30 May 2018; Revised 5 October 2018; Accepted 10 October 2018; Published 24 October 2018 Academic Editor: Anthony DeCaprio Copyright © 2018 Erick Kandiwa et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Tis study was designed to investigate the cytotoxicity and haemotoxicity of the Western barred (zebra) spitting cobra (Naja nigricincta nigricincta) venom to help explain atypical and inconsistent reports on syndromes by Namibian physicians treating victims of human ophidian accidents. Freeze-dried venom milked from adult zebra snakes was dissolved in phosphate bufered saline (PBS) for use in this study. Haemorrhagic and necrotic activity of venom were studied in New Zealand albino rabbits. Oedema-forming activity was investigated in 10-day-old Cobb500 broiler chicks. Procoagulant and thrombolytic activity was investigated in adult Kalahari red goat blood in vitro.
    [Show full text]
  • Naja Atra) Bites: Determining Bacteriology, Antibiotic Susceptibility, and the Use of Antibiotics-A Cobra BITE Study
    toxins Article Wound Infections from Taiwan Cobra (Naja atra) Bites: Determining Bacteriology, Antibiotic Susceptibility, and the Use of Antibiotics-A Cobra BITE Study Heng Yeh 1,2, Shi-Ying Gao 1 and Chih-Chuan Lin 1,2,* 1 Department of Emergency Medicine, Lin-Kou Medical Center, Chang Gung Memorial Hospital, Taoyuan 33305, Taiwan; [email protected] (H.Y.); [email protected] (S.-Y.G.) 2 School of Medicine, College of Medicine, Chang Gung University, Taoyuan 33302, Taiwan * Correspondence: [email protected] Abstract: Wound necrosis and secondary infection are common complications after Naja atra bites. Clinical tools to evaluate the infection risk after Taiwan cobra bites are lacking. In this Cobra BITE study, we investigated the prevalence of wound infection, bacteriology, and corresponding antibiotic usage in patients presenting with Taiwan cobra snakebites. Patients with wound infection lacking tissue necrosis were included in developing Cobra BITE score utilizing univariate and multiple logistic regression, as patients with wound necrosis require antibiotics for infection treatment. 8,295,497 emergency department visits occurred in the span of this study, with 195 of those patients being diagnosed as having cobra bites. Of these patients, 23 had wound necrosis, and 30 had wound infection, resulting in a wound infection rate of 27.2% (53/195). Enterococcus faecalis and Morganella morganii were the main bacteria identified in the culture report regardless of whether patients’ wounds had necrosis. As per our Cobra BITE score, the three factors predicting secondary wound infection after cobra bites are hospital admission, a white blood cell count (in 103/µL) × by neu-trophil-lymphocyte ratio value of ≥114.23, and the use of antivenin medication.
    [Show full text]
  • Long-Term Effects of Snake Envenoming
    toxins Review Long-Term Effects of Snake Envenoming Subodha Waiddyanatha 1,2, Anjana Silva 1,2 , Sisira Siribaddana 1 and Geoffrey K. Isbister 2,3,* 1 Faculty of Medicine and Allied Sciences, Rajarata University of Sri Lanka, Saliyapura 50008, Sri Lanka; [email protected] (S.W.); [email protected] (A.S.); [email protected] (S.S.) 2 South Asian Clinical Toxicology Research Collaboration, Faculty of Medicine, University of Peradeniya, Peradeniya 20400, Sri Lanka 3 Clinical Toxicology Research Group, University of Newcastle, Callaghan, NSW 2308, Australia * Correspondence: [email protected] or [email protected]; Tel.: +612-4921-1211 Received: 14 March 2019; Accepted: 29 March 2019; Published: 31 March 2019 Abstract: Long-term effects of envenoming compromise the quality of life of the survivors of snakebite. We searched MEDLINE (from 1946) and EMBASE (from 1947) until October 2018 for clinical literature on the long-term effects of snake envenoming using different combinations of search terms. We classified conditions that last or appear more than six weeks following envenoming as long term or delayed effects of envenoming. Of 257 records identified, 51 articles describe the long-term effects of snake envenoming and were reviewed. Disability due to amputations, deformities, contracture formation, and chronic ulceration, rarely with malignant change, have resulted from local necrosis due to bites mainly from African and Asian cobras, and Central and South American Pit-vipers. Progression of acute kidney injury into chronic renal failure in Russell’s viper bites has been reported in several studies from India and Sri Lanka. Neuromuscular toxicity does not appear to result in long-term effects.
    [Show full text]
  • Antimicrobial Peptides in Reptiles
    Pharmaceuticals 2014, 7, 723-753; doi:10.3390/ph7060723 OPEN ACCESS pharmaceuticals ISSN 1424-8247 www.mdpi.com/journal/pharmaceuticals Review Antimicrobial Peptides in Reptiles Monique L. van Hoek National Center for Biodefense and Infectious Diseases, and School of Systems Biology, George Mason University, MS1H8, 10910 University Blvd, Manassas, VA 20110, USA; E-Mail: [email protected]; Tel.: +1-703-993-4273; Fax: +1-703-993-7019. Received: 6 March 2014; in revised form: 9 May 2014 / Accepted: 12 May 2014 / Published: 10 June 2014 Abstract: Reptiles are among the oldest known amniotes and are highly diverse in their morphology and ecological niches. These animals have an evolutionarily ancient innate-immune system that is of great interest to scientists trying to identify new and useful antimicrobial peptides. Significant work in the last decade in the fields of biochemistry, proteomics and genomics has begun to reveal the complexity of reptilian antimicrobial peptides. Here, the current knowledge about antimicrobial peptides in reptiles is reviewed, with specific examples in each of the four orders: Testudines (turtles and tortosises), Sphenodontia (tuataras), Squamata (snakes and lizards), and Crocodilia (crocodilans). Examples are presented of the major classes of antimicrobial peptides expressed by reptiles including defensins, cathelicidins, liver-expressed peptides (hepcidin and LEAP-2), lysozyme, crotamine, and others. Some of these peptides have been identified and tested for their antibacterial or antiviral activity; others are only predicted as possible genes from genomic sequencing. Bioinformatic analysis of the reptile genomes is presented, revealing many predicted candidate antimicrobial peptides genes across this diverse class. The study of how these ancient creatures use antimicrobial peptides within their innate immune systems may reveal new understandings of our mammalian innate immune system and may also provide new and powerful antimicrobial peptides as scaffolds for potential therapeutic development.
    [Show full text]
  • Biochemical Characterization of Phospholipase A2 (Trimorphin) from the Venom of the Sonoran Lyre Snake Trimorphodon Biscutatus Lambda (Family Colubridae)
    Toxicon 44 (2004) 27–36 www.elsevier.com/locate/toxicon Biochemical characterization of phospholipase A2 (trimorphin) from the venom of the Sonoran Lyre Snake Trimorphodon biscutatus lambda (family Colubridae) Ping Huang, Stephen P. Mackessy* Department of Biological Sciences, University of Northern Colorado, 501 20th St., CB 92, Greeley, CO 80639-0017, USA Received 3 December 2003; accepted 23 March 2004 Available online 18 May 2004 Abstract Phospholipases A2 (PLA2), common venom components and bioregulatory enzymes, have been isolated and sequenced from many snake venoms, but never from the venom (Duvernoy’s gland secretion) of colubrid snakes. We report for the first time the purification, biochemical characterization and partial sequence of a PLA2 (trimorphin) from the venom of a colubrid snake, Trimorphodon biscutatus lambda (Sonoran Lyre Snake). Specific phospholipase activity of the purified PLA2 was confirmed by enzyme assays. The molecular weight of the enzyme has been determined by SDS-PAGE and mass spectrometry to be 13,996 kDa. The sequence of 50 amino acid residues from the N-terminal has been identified and shows a high degree of sequence homology to the type IA PLA2s, especially the Asp-49 enzymes. The Cys-11 residue, characteristic of the group IA 2þ PLA2s, and the Ca binding loop residues (Tyr-28, Gly-30, Gly-32, and Asp-49) are conserved. In addition, the His-48 residue, a key component of the active site, is also conserved in trimorphin. The results of phylogenetic analysis on the basis of amino acid sequence homology demonstrate that trimorphin belongs to the type IA family, and it appears to share a close evolutionary relationship with the PLA2s from hydrophiine elapid snakes (sea snakes and Australian venomous snakes).
    [Show full text]
  • P. 1 AC27 Inf. 7 (English Only / Únicamente En Inglés / Seulement
    AC27 Inf. 7 (English only / únicamente en inglés / seulement en anglais) CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA ____________ Twenty-seventh meeting of the Animals Committee Veracruz (Mexico), 28 April – 3 May 2014 Species trade and conservation IUCN RED LIST ASSESSMENTS OF ASIAN SNAKE SPECIES [DECISION 16.104] 1. The attached information document has been submitted by IUCN (International Union for Conservation of * Nature) . It related to agenda item 19. * The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CITES Secretariat or the United Nations Environment Programme concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author. AC27 Inf. 7 – p. 1 Global Species Programme Tel. +44 (0) 1223 277 966 219c Huntingdon Road Fax +44 (0) 1223 277 845 Cambridge CB3 ODL www.iucn.org United Kingdom IUCN Red List assessments of Asian snake species [Decision 16.104] 1. Introduction 2 2. Summary of published IUCN Red List assessments 3 a. Threats 3 b. Use and Trade 5 c. Overlap between international trade and intentional use being a threat 7 3. Further details on species for which international trade is a potential concern 8 a. Species accounts of threatened and Near Threatened species 8 i. Euprepiophis perlacea – Sichuan Rat Snake 9 ii. Orthriophis moellendorfi – Moellendorff's Trinket Snake 9 iii. Bungarus slowinskii – Red River Krait 10 iv. Laticauda semifasciata – Chinese Sea Snake 10 v.
    [Show full text]
  • Selective Toxicity of Caspian Cobra (Naja Oxiana) Venom on Liver Cancer Cell Mitochondria
    460 Asian Pac J Trop Biomed 2017; 7(5): 460–465 HOSTED BY Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Biomedicine journal homepage: www.elsevier.com/locate/apjtb Original article http://dx.doi.org/10.1016/j.apjtb.2017.01.021 Selective toxicity of Caspian cobra (Naja oxiana) venom on liver cancer cell mitochondria Enayatollah Seydi1,2, Shabnam Babaei1, Amir Fakhri1, Jalal Pourahmad1* 1Department of Pharmacology and Toxicology, Faculty of Pharmacy, Shahid Beheshti University of Medical Sciences, P.O. Box 14155-6153, Tehran, Iran 2Department of Occupational Health Engineering, Research Center for Health, Safety and Environment (RCHSE), Alborz University of Medical Sciences, Karaj, Iran ARTICLE INFO ABSTRACT Article history: Objective: To explore the cytotoxicity effects of Caspian cobra (Naja oxiana or Received 5 Sep 2016 N. oxiana) venom on hepatocytes and mitochondria obtained from the liver of HCC rats. Received in revised form 19 Oct, 2nd Methods: In this study, HCC was induced by diethylnitrosamine (DEN), as an initiator, revised form 24 Oct, 3rd revised form and 2-acetylaminofluorene (2-AAF), as a promoter. Rat liver hepatocytes and mito- 21 Nov 2016 chondria for evaluation of the selective cytotoxic effect of N. oxiana venom were isolated Accepted 25 Dec 2016 and mitochondria and cellular parameters related to apoptosis signaling were then Available online 12 Jan 2017 determined. Results: Our results showed a raise in mitochondrial reactive oxygen species (ROS) level, swelling in mitochondria, mitochondrial membrane potential (Djm) collapse and Keywords: release of cytochrome c after exposure of mitochondria only isolated from the HCC group Naja oxiana with the crude venom of the N.
    [Show full text]
  • List of Reptile Species in Hong Kong
    List of Reptile Species in Hong Kong Family No. of Species Common Name Scientific Name Order TESTUDOFORMES Cheloniidae 4 Loggerhead Turtle Caretta caretta Green Turtle Chelonia mydas Hawksbill Turtle Eretmochelys imbricata Olive Ridley Turtle Lepidochelys olivacea Dermochelyidae 1 Leatherback Turtle Dermochelys coriacea Emydidae 1 Red-eared Slider * Trachemys scripta elegans Geoemydidae 3 Three-banded Box Turtle Cuora trifasciata Reeves' Turtle Mauremys reevesii Beale's Turtle Sacalia bealei Platysternidae 1 Big-headed Turtle Platysternon megacephalum Trionychidae 1 Chinese Soft-shelled Turtle Pelodiscus sinensis Order SQUAMATA Suborder LACERTILIA Agamidae 1 Changeable Lizard Calotes versicolor Lacertidae 1 Grass Lizard Takydromus sexlineatus ocellatus Scincidae 11 Chinese Forest Skink Ateuchosaurus chinensis Long-tailed Skink Eutropis longicaudata Chinese Skink Plestiodon chinensis chinensis Five-striped Blue-tailed Skink Plestiodon elegans Blue-tailed Skink Plestiodon quadrilineatus Vietnamese Five-lined Skink Plestiodon tamdaoensis Slender Forest Skink Scincella modesta Reeve's Smooth Skink Scincella reevesii Brown Forest Skink Sphenomorphus incognitus Indian Forest Skink Sphenomorphus indicus Chinese Waterside Skink Tropidophorus sinicus Varanidae 1 Common Water Monitor Varanus salvator Dibamidae 1 Bogadek's Burrowing Lizard Dibamus bogadeki Gekkonidae 8 Four-clawed Gecko Gehyra mutilata Chinese Gecko Gekko chinensis Tokay Gecko Gekko gecko Bowring's Gecko Hemidactylus bowringii Brook's Gecko* Hemidactylus brookii House Gecko* Hemidactylus
    [Show full text]
  • Taxonomic Status of Cobras of the Genus Naja Laurenti (Serpentes: Elapidae)
    Zootaxa 2236: 26–36 (2009) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2009 · Magnolia Press ISSN 1175-5334 (online edition) In praise of subgenera: taxonomic status of cobras of the genus Naja Laurenti (Serpentes: Elapidae) VAN WALLACH1, 4, WOLFGANG WÜSTER2 & DONALD G. BROADLEY3 1Museum of Comparative Zoology, Harvard University, Cambridge MA 02138, USA. E-mail: [email protected] 2School of Biological Sciences, Bangor University, Bangor LL57 2UW, UK. E-mail: [email protected] 3Biodiversity Foundation for Africa, P.O. Box FM 730, Famona, Bulawayo, Zimbabwe. E-mail: [email protected] 4corresponding author Abstract The genus Naja Laurenti, 1768, is partitioned into four subgenera. The typical form is restricted to 11 Asian species. The name Uraeus Wagler, 1830, is revived for a group of four non-spitting cobras inhabiting savannas and open formations of Africa and Arabia, while Boulengerina Dollo, 1886, is applied to four non-spitting African species of forest cobras, including terrestrial, aquatic and semi-fossorial forms. A new subgenus is erected for seven species of African spitting cobras. We recommend the subgenus rank as a way of maximising the phylogenetic information content of classifications while retaining nomenclatural stability. Key words: Naja, Uraeus, Boulengerina, Afronaja subgen. nov., taxonomy, Africa, Asia Introduction The scientific nomenclature of life serves the key function of providing labels for the cataloguing of the Earth’s biodiversity and thus for information retrieval. In order to make a system of classification predictive, it is generally agreed that a classification should reflect the current state of knowledge about the evolutionary relationships within a group, which, in the case of a nested, hierarchical system of nomenclature, means recognizing only monophyletic groups as named taxa.
    [Show full text]