REPRODUCTIONRESEARCH

Significance of aquaporins and sodium potassium ATPase subunits for expansion of the early equine conceptus

Sven Budik1, Ingrid Walter2, Waltraud Tschulenk2, Magdalena Helmreich2, Katharina Deichsel1, Fritz Pittner3 and Christine Aurich1 1Department for Animal Breeding and Reproduction, Centre for Artificial Insemination and Embryo Transfer and 2Department of Pathobiology, Institute of Histology and Embryology, University of Veterinary Medicine Vienna, Vienna A-1210, Austria 3Department of Biochemistry, University of Vienna, Vienna A-1030, Austria Correspondence should be addressed to S Budik; Email: [email protected]

Abstract

Expansion of the equine conceptus can be divided into blastocoel and yolk sac phases. The endodermal layer transforming the blastocoel into the yolk sac is completed around day 8 of pregnancy. From that time, the size of the spherical conceptus increases tremendously due mainly to the accumulation of fluid rather than cell multiplication. In this study, we have investigated the abundance and localisation of C C Na /K -ATPases and aquaporins (AQP) in the equine conceptus on days 8, 10, 12, 14 and 16 by multiplex reverse transcriptase PCR, Western blot and immunohistochemistry. During conceptus expansion, the ectoderm of the yolk sac exhibited basolateral abundance of a1ATPase, apical localisation of AQP5, and membrane and cytoplasmic expression of AQP3. With increasing conceptus size its cells showed an extensive enlargement of the apical membrane surface by microvilli. From day 14 onwards, the yolk sac endoderm forms arc- like structures with attaching sites to the ectodermal layer and shows intensive staining for a1ATPase, AQP5 and AQP3 in the membrane as well as in the cytoplasm. In the yolk sac ectoderm, the arrangement of these proteins is comparable with the collecting ducts of kidney with AQP2 being replaced by the closely related AQP5. The detection of phosphorylation sites for protein kinase A suggests a similar AQP5 traffic and regulation as known for AQP2 in the collecting ducts of the kidney. The arrangement of these proteins in equine embryos indicates at least partially the mechanism of conceptus expansion. Reproduction (2008) 135 497–508

Introduction after completion of the endodermal lining. Much less is known about yolk sac expansion than about blastocyst The equine morula or early blastocyst enters the uterus expansion. From at least as early as day 10 the yolk sac around days 5 to 6 after ovulation. Until this stage, the fluid is very markedly hypotonic until about day 18 and embryo does not increase substantially in size but it then gradually increases in tonicity (Betteridge 2007). expands rapidly between days 11 and 18, which appears Hypotonicity within the yolk sac seems to contradict the C C to be favourable for the maintenance of pregnancy hypothesis of a Na /K trans-trophoblast gradient (Ginther et al. 1985, Ginther 1992). This increase in size responsible for blastocoel expansion before day 8 is mainly caused by influx of fluid. The formation of an C C (Waelchli & Betteridge 1996). Subtrophoblastic com- osmotic gradient by a1/b1Na /K -ATPase is probably partments described in equine blastocysts (Enders et al. the driving force of water influx into the blastocoel of 1993) seem to undergo a sharp increase in tonicity equine embryos as in other mammals (DiZio & Tasca relative to the interior of the yolk sac, forming a third 1977, Manejwala et al. 1989, Betts et al.1997, Jones compartment which might be responsible for mainten- et al. 1997) because the pump is present in horse ance of the ion gradient in the equine conceptus larger embryos by day 8, the earliest stage that has been than 6 mm in diameter (Crews et al. 2007). examined (Waelchli et al.1997). Sodium ions are The water permeability of the trophoblast and yolk pumped out of the trophectodermal cell layer (which is sac wall might be mediated by aquaporins which are sealed by tight junctions) into the basolateral intercel- members of the major intrinsic protein (MIP) family. lular spaces that subsequently form the blastocoel They form transmembranous pores for water and, in case (Watson et al. 2004). After completion of the endoderm of the aquaglyceroporins, also for small solutes around day 8, the term yolk sac is used instead of (Hara-Chikuma & Verkman 2005). In epithelial tissues, blastocoel. Therefore, distinction must be made between aquaporins act as molecular water channels in the blastocoel expansion prior to and yolk sac expansion direction of osmotic gradients (Verkman et al. 1996,

q 2008 Society for Reproduction and Fertility DOI: 10.1530/REP-07-0298 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 498 S Budik and others

Verkman 1999). During blastocyst cavitation, they enhance a rapid near-isosmotic fluid transport across the (bp) trophoblast (Barcroft et al. 2003). Aquaporin 2 (AQP2) is most abundant in the apical membrane of the collecting duct cells of the kidney and is controlled at least partially by neurohormonal pathways. In the collecting ducts of the kidney, vasopressin stimulates Amplicon length vesicular transport and fusion with the apical membrane via cAMP phosphorylation (Fushimi et al.1997, Matsamura et al. 1997, Dibas et al.1998). Vasopressin is also present in equine yolk sacs during pre-attachment development 0 –3 (Waelchli et al. 2000) and the endoderm of the equine 0 5 trophoblast shares many ultrastructural features with the intercalated cells of kidney collecting tubules (Enders et al. 1993). In lung epithelial cells and the mouse lung tissue, AQP5 mRNA transcription and protein translocation to the

apical membrane are stimulated by a cAMP/protein kinase Reverse primer A (PKA)-dependent pathway (Ya ng et al. 2003). In mouse blastocysts, a variety of aquaporin transcripts are present and an increased expression at the morula– blastocyst transition has been demonstrated for the AQP3 0 –3 transcript (Edashige et al. 2000, Offenberg et al. 2000). 0 5 The immunolocalization of AQP3, AQP8 and AQP9 was investigated during murine preimplantation develop- ment. Cytoplasmic localisation of immunoreactive AQP3 protein in the blastomeres of murine eight-cell- stage embryos changes to an apolar localisation within the membrane domains of all blastomeres at the compact morula stage. At the blastocyst stage, an apolar membrane-associated distribution of AQP3 immuno- reactive protein was maintained within the inner cell mass, while trophoblast expression was restricted to the basolateral cell margins (Barcroft et al. 2003). So far, knowledge of the mechanism of equine conceptus expansion after the blastocyst stage and the role of aquaporins during this process is limited. Contrary to other domestic animals, the pre-attachment horse conceptus is of the ‘fully expanding’ type (Biggers 1972), maintaining a spherical form within the embryonic capsule which replaces the zona pellucida after hatching. This shape is beneficial during the mobile phase of pre-attachment development necessary for maintenance of pregnancy. The aim of our study was thus to elucidate the expression pattern and potential role of aquaporins and ATPases during the mobile phase of equine

conceptus development. Preliminary results of this Horse AJ514427 study have been presented and published in abstract form (Budik et al. 2006).

Results 1 Horse X16773-X16795 taaatatgaacccgcagc tcctcctttcacttccac 559 1 Rat J02701 cacagattcctcagatcc cacattccgcataccact 613 Characterization of equine sodium potassium ATPase a b subunits and aquaporin transcripts ATPase ATPase Primers used for reverse transcriptase PCR.

Amplification of a RNA preparation from a day 12 C C /K /K

equine conceptus by RT-PCR with primers specific for C C C C -Actin Horse AF035774 atggaatcctgtggcatc gcgcaatgatcttgatcttc 191 Table 1 Protein Organism Accession number Forward primer Na AQP1AQP2AQP3AQP4AQP5AQP5AQP6AQP7AQP8AQP9b Mouse Human Human Mouse Rat Human Rat Mouse NM007472 Rat NM000486 Human NM004925 NM009700 NM001651 NM012779 NM007473 NM022181 atcaagaagaagctcttctgg atccattacaccggctgctc NM020980 NM019158 ttcctcaccatcaacctg ccgtcttctacatcattgc atgaagaaggaggtgtgctc ctgatgtgacccacactttg tgaaaaaggaggtgtgctc tccagaagacccagtggtcatc tatgaactggtcaaagaagcc catttttgccacctatcttc ggttctctgtgtctttgcttc tccccttcttctcttctcc ctgaaccgcttcatgatcac cgttcatcttgattgtcc aggagaccaacatggctgac acgtagaagacagctcggag 200 91 gctgtaaaattctccagtctc tacacgctcacttctgtgtc aatgacagagaaaccaatggag 333 ccaccagaagttgtttcc 627 271 594 536 408 375 638 a1- and b1-subunits of Na /K -ATPase (Table 1) Na

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access Aquaporins and Na/K-ATPase 499 resulted in the expected product length of 559 bp for a1 (Table 1) resulted in a 91% homology to human AQP3 and 613 bp for b1 visualised on agarose gel (Fig. 1A). mRNA (accession number NM004925). An analysis of the Sequence analysis of the amplicon for the a1ATPase 271 bp sequence resulted in a 90% homology to human subunit using the amplification primers and comparison AQP5 mRNA (accession number NM001651). No other by nucleotide NCBI BLAST resulted in 100% consensus amplicons of expected size were detected. In case of C C with exons 4 and 5 of equine Na /K -ATPase a1- AQP2, the selected forward primer resulted in the subunit submitted previously (accession numbers amplification of a very strong band of about 750 bp X16776 and X16777). The 613 bp amplicon for the b1 (Fig. 1B). Sequence analysis of the PCR fragment after ATPase subunit was tested in the same way resulting in a cloning into pGEM-T revealed that it consisted of exons 3, C C 91% homology to sheep kidney mRNA for the Na /K - 4andthe30-untranslated end of the equine AQP5 mRNA. ATPase b1-subunit (accession number X03883). As no Unexpectedly, the AQP2 forward primer also acted as the equine sequence was present in the relevant databases reverse primer, which was confirmed by a PCR experiment for b1-subunit the sequence was submitted to EBI using only the forward primer (Fig. 2A). The coding part (accession number AJ539224). of AQP5 derived from AQP2-specific primers showed a AQP3 and AQP5 amplicons with an expected length of 91% homology to human AQP5 mRNA (accession 333 and 271 bp respectively were detected by gel analysis number BC032946). In the non-coding part, two (Fig. 1B). After excision and purification, sequencing of the sequences could be detected (bp 343–475 and RT-PCR products was performed using the amplification 611–710), showing an 85% homology to parts of the primers. The sequences obtained were submitted to non-coding 30-end of human AQP5 mRNA (accession nucleotide NCBI BLAST analysis. BLAST search of the number BC032946). The sequence obtained was sub- 333 bp sequence obtained with human AQP3 primers mitted to EBI (accession number AJ514427). In order to identify the coding part of the equine AQP5 sequence, RT-PCR was carried out using a new forward primer designed from human AQP5 sequence (accession number NM001651) and a new reverse primer from the equine sequence obtained by AQP2 forward primer (Table 1). This amplification resulted in the expected AQP5 amplicon length of 627 bp (Fig. 2A). After sequencing and NCBI BLASTanalysis, part of the sequence was submitted to EBI (accession number AJ555456). A scheme with the positions of the different primers and amplicons for AQP5 is given (Fig. 2B). No other AQP-specific products could be found in equine embryos.

Figure 2 (A) Aquaporin 5 amplicons after RT-PCR of day 15 trophoblast tissue: f, forward; r, reverse; hf, human forward; er, equine reverse (1.5% agarose gel, ethidium bromide stained, visualised by u.v). (B) Schematic drawing of primer and amplicon sites on equine AQP5 mRNA. rAQP5f/rAQP5r, forward/reverse primer designed from rat C C Figure 1 Na /K ATPase (A) and aquaporin (B) expression pattern of a AQP5 sequence; hAQP2f, AQP2 forward primer designed from human day 12 equine conceptus obtained by RT-PCR using the primers listed AQP2 sequence; hAQP5f, forward primer designed from human AQP5 in Table 1. (M: 100 bp DNA ladder, 1.5% agarose gel, ethidium sequence; eAQP5r, reverse primer designed from equine AQP5 bromide stained and visualised by u.v). sequence (all primers are listed in Table 1). www.reproduction-online.org Reproduction (2008) 135 497–508

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 500 S Budik and others

Expression pattern of ATPase a1- and b1-subunits and increased thereafter with highest values on day 14 and a AQP3 and AQP5 during conceptus expansion subsequent decrease until day 16. Also, AQP5 expression was higher in day 14 embryos (P!0.01 DNase I-digested total RNA from equine conceptuses versus days 8, 10 and 12) than in embryos of all other (days 8–16) was investigated for the expression of ATPase ages (P!0.001; Fig. 3D Table 3). The embryonic size a1- and b1-subunits in comparison with b-actin by increased continuously with the age of the embryos multiplex RT-PCR (Fig. 3A and B; Table 2). Small day 8 (P!0.001, Table 3). The diameter of the embryo was equine embryos (0.6–1.0 mm diameter) show low or significantly correlated with AQP3 expression (rZ0.663, absent expression of a1ATPase transcripts. An increase P!0.01). No significant correlations existed between close to statistical significance in the expression of diameter of the embryo and either a1-ATPase, b1-ATPase a1ATPase subunit was found in day 10 embryos and or AQP5 expression. again in day 16 embryos (PZ0.056 versus day 1, Table 3). ATPase b1 transcripts were just detectable in the small day 8 equine embryos, increased on day 10 Analysis of AQP amino acid sequences deduced from and reached maximal values on day 14 (P!0.001 versus the analysed amplicons day 1, Table 3). Between days 14 and 16, the expression The obtained cDNA sequences were translated into protein decreased again to values detected in day 10 embryos. sequences using the GCG Wisconsin package (Accelrys, Transcripts of neither AQP3 nor AQP5 were detect- San Diego, CA, USA) in order to detect aquaporin-specific able by multiplex RT-PCR in conceptuses on day 8 of amino acid motifs or regulatory sequences. The partial development (Fig. 3C and D; Table 3). AQP3 expression amino acid sequence of equine AQP5 deduced from the

Figure 3 Age: day after ovulation (ovulation detectionZday 0); Diam (mm), diameter in millimetres; all gels, 1.5% agarose, ethidium bromide C C stained, visualised by u.v, not saturated (A) expression pattern of Na /K ATPase a1-subunit mRNA in comparison with b-actin by multiplex RT-PCR C C at days 8, 10, 12, 14 (each nZ4, left panel) and 16 (nZ3, right panel) of equine embryo development. (B) Expression pattern of Na /K ATPase b1- subunit mRNA in comparison to b-actin by multiplex RT-PCR at days 8, 10, 12, 14 (each nZ4, left panel) and 16 (nZ3, right panel) of equine embryo development. (C) Expression pattern of AQP3 mRNA in comparison to b-actin by multiplex RT-PCR at days 8, 10, 12, 14 (each nZ4, left panel) and 16 (nZ3, right panel) of equine embryo development. (D) Expression pattern of AQP5 mRNA in comparison to b-actin by multiplex RT-PCR at days 8, 10, 12, 14 (each nZ4) and 16 (nZ3) of equine embryo development.

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access Aquaporins and Na/K-ATPase 501

pGEM-T cloned 750 bp fragment obtained by RT-PCR using primers specific for human AQP2 (Table 1) is given in -actin

b Fig. 4A. The second (c-terminal) asparagine–proline–

M) alanine (NPA) aquaporin-specific motif (amino acid m

M/ residues 185–187) and a cAMP-dependent PKA phos- m ( phorylation consensus site were identical to the mouse target sequence (amino acid residues 256–259; Fig. 4A).

Primer ratio to The amino acid sequence of equine AQP5 deduced from the pGEM-T-cloned 627 bp cDNA amplicon obtained by RT-PCR using human forward and equine reverse primers

0 (Table 1) is given in Fig. 4B (submitted to EBI, accession –3 0

5 number AJ555456). During the cloning procedure, the 50-part of the amplicon was shortened. The amino acid sequence deduced from this part showed aquaporin- specific NPA motifs (aa 69–71 and 185–187), cysteine at position 182, casein kinase II phosphorylation consensus

Reverse primer site (aa 148–151) and a putative cAMP-dependent PKA phosphorylation consensus site (aa 152–156). The partial amino acid sequence of equine AQP3 as deduced from 333 bp cDNA amplicon and obtained by RT-PCR using 0 human primers (Table 1) included an aquaporin-specific –3 0

5 NPA motif (aa 83–85; Fig. 4C).

Western blotting Crude protein samples resulted in maximal amounts of C C Na /K -ATPase a1-subunit, whereas the amounts obtained after TriReagent (Sigma–Aldrich) were low (Fig. 5A). In case of AQP3 and AQP5 proteins the recovery after use of TriReagent was better than in case C C of Na /K -ATPase a1-subunit. Microsome preparations provided higher membrane protein amounts than obtained after TriReagent. Embryonic protein samples as well as positive controls resulted in detection of multiple bands, including those of expected molecular masses (w100 kDa for a1ATPase (Fig. 5A, all lanes); w28 kDa for AQP3 (Fig. 5B, lanes E and Ki) and 25–27 kDa for AQP5 (Fig. 5C, lanes E and Lu). Additional bands or band shift in case of AQP5 perhaps caused by glycosylation or degradation (Hendriks et al. 2004) were C C also detected. With the monoclonal mouse Na /K - ATPase a1-subunit antibody (clone C464.6, #05-369) no reproducible results were obtained; therefore, a poly- C C clonal antibody anti-Na /K ATPase a1 (rabbit poly- clonal antibody # 06520; Upstate Biotechnology, Lake Horse AJ514427 Placid, NY, USA) was used.

Immunohistochemistry All conceptuses showed positive immunostaining for a1 C C 1 Horse X16773-X16795 taaatatgaacccgcagc tcctcctttcacttccac 0,6/0,6 1 Rat J02701 cacagattcctcagatcc cacattccgcataccact 0,6/0,6

a b Na /K -ATPase restricted to the basolateral membrane in the trophectoderm (Fig. 6A–D). A positive immuno- reaction was also seen in the endodermal layer of the ATPase ATPase Primers and primer ratios used for reverse transcriptase multiplex PCR.

C C trophoblast in larger (days 12–14) equine conceptuses /K /K

C C (Fig. 6B and D). In contrast to the ectoderm not only the -Actin Horse NM020980 cgttcatcttgattgtcc ccaccagaagttgtttcc – Table 2 Protein Organism Accession number Forward primer Na AQP3AQP5b Human Human NM004925 NM001651 ttcctcaccatcaacctg atgaagaaggaggtgtgctc ctgaaccgcttcatgatcac tatgaactggtcaaagaagcc 0,8/0,2 0,8/0,2 Na basolateral membranes but the whole cytoplasm of the www.reproduction-online.org Reproduction (2008) 135 497–508

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 502 S Budik and others

Table 3 Relative mRNA expression of a1ATPase, b1ATPase, AQP3 and AQP5 in relation to b-actin (results of multiplex RT-PCR) in embryos of different age and size, values are meansGS.E.M.

Day a1ATPase b1ATPase AQP3 AQP5 b-Actin Size (mm) diameter 8(nZ4) 21.6G8.3a 27.0G7.0a 0.0G0.0a 0.0G0.0a 100 0.8G0.1a 10 (nZ4) 92.5G9.9a,b 150.0G11.7b 12.0G3.7b 8.9G3.7a 100 4.3G0.9a,b 12 (nZ4) 91.3G5.6a,b 209.9G19.8c 11.8G1.8b 9.0G3.4a 100 8.1G1.2b 14 (nZ4) 85.9G7.6a,b 199.4G23.8b,c 24.5G3.8c 18.4G2.6b 100 16.5G2.1c 16 (nZ3) 133.1G63.6b 152.0G17.5b 19.0G6.0b,c 3.4G2.8a 100 26.3G2.0d P (0.056) !0.001 !0.01 !0.01 – !0.001 a,b,cValues with different letters within rows differ significantly, see table for P values, for a1ATPase statistical significance is nearly reached (PZ0.056). endodermal cells also exhibited intense staining (Fig. 6D). The cytoplasm of the cells of the yolk sac wall (endoderm In day 16 equine conceptuses, the trophectoderm and trophectoderm) stained positively for AQP3, exhibit- exhibited the same pattern of staining as seen in younger ing a granular appearance (Fig. 7). In younger conceptuses conceptuses, but with less intensity. The endoderm, on the (days 8–10) most immunoreactive protein was detected in other hand, exhibited more membrane abundance and the apical membrane of trophoblast cells (Fig. 7A and B), more intense cytoplasmatic staining of immunoreactive whereas in older ones (days 12–14) the basal and lateral protein (Fig. 6E). In the endodermal layer surrounding the membranes also stained more intensely (Fig. 7C and D). subtrophoblastic compartments immunoreactive protein In day 16 conceptuses, this tendency increased and the was more abundant in day 16 than in younger conceptuses endodermal layer which encloses the subtrophoblastic (Fig. 6E). The embryonic disc never reacted positively, C C compartments contained even more immunoreactive showing an absence of Na /K -ATPase a1-subunit in this proteins in the cell membranes than did the ectoderm tissue (Fig. 6C). In the equine kidney, serving as positive C C (Fig. 7E). The collecting duct cells of equine kidney serving control for Na /K -ATPase a1-subunit, cells of the as positive control exhibited an intense basolateral proximal tubules exhibited an intense staining of the abundance of immunoreactive protein (Fig. 7F). basolateral membranes (Fig. 6F). In equine conceptuses, immunohistochemical staining for AQP5 was positive in the apical membrane of conceptuses from day 10 onwards, but negative in younger ones (8 days; Fig. 8A–D). The staining intensity increased with the size of the conceptus. The apical membrane surface enlarged by microvilli of the cells of the trophectoderm appeared to contain high amounts of AQP5 immunoreactive protein. In addition, the cyto- plasm of those cells in larger (days 12 and 14) conceptuses showed a weak spotted positive colouring for AQP5 (Fig. 8C and D). AQP5 protein was also detected in the cytoplasm of endodermal cells on days 12 and 14. In day 16 conceptuses, immunostaining of the apical membrane of the trophectoderm remained prominent and the cytoplasm of both trophectodermal and endodermal cells exhibited more intense staining than in younger embryos (Fig. 8E). Equine lung served as a positive control exhibiting an intense staining of the apical membranes of type I pneumocytes (Fig. 8F).

Transmission electron microscopy Conceptuses at days 8, 10, 12, and 14 were investigated Figure 4 Partial amino acid sequences of equine AQP5 and AQP3 with for cellular ultrastructure by transmission electron characteristic and putative regulatory sequences: (A) amino acid microscopy. Starting on day 10 after ovulation, trophec- sequence deduced from the coding part of the w750 bp amplicon todermal cells exhibited densely arranged microvilli at (second NPA motif position 185–187, cAMP-dependent protein kinase the apical membrane (Fig. 9A–C), whereas younger A phosphorylation consensus site identical to the mouse target sequence (aa 256–259). (B) Amino acid sequence deduced from the conceptuses (day 8) showed only isolated microvilli. The equine AQP5 627bp amplicon. (C) Amino acid sequence deduced Golgi apparatus in these cells was composed of enlarged from the equine AQP3 333bp amplicon. compartments surrounded by large vesicles (Fig. 9C).

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access Aquaporins and Na/K-ATPase 503

Figure 5 Western blotting of protein samples from embryos and positive controls: (A) a1ATPase: bands at w100 kDa for day 12 equine embryos crude protein sample (Ecps), day 12 protein isolation after TriReagent (Eprot), positive control murine kidney medulla (Ki prot); (B) AQP3, bands at w30 kDa for day 12 equine embryo crude protein sample (E) and equine kidney microsome preparation (Ki), no bands of the appropriate size in equine skeletal muscle (Mu); (C) AQP5, bands at w27 and w25 kDa for day 12 equine embryo crude protein sample and equine lung (Lu); no bands of the appropriate sizes in equine skeletal muscle (Mu).

A subtrophoblastic compartment developed between fixation of the embryo thus marking the end of the mobile days 10 and 12 (Fig. 9A). Membrane-bound vesicles pre-attachment phase of equine gestation (Ginther 1983). close to the apical membrane were frequently observed The strictly apical ectodermal expression of AQP5 protein in these cells (Fig. 9B). In contrast to the trophectoderm, in the yolk sac is in agreement with the location of AQP5 cells of the embryonic disc and endoderm almost in type I alveolar cells and the abundance of AQP2 in the completely lacked microvilli at their apical membranes. collecting duct cells of the kidney (Kraine et al. 1999, Yang et al. 2003). With regard to protein homology, AQP2 is most closely related to AQP5 within the aquaporin Discussion family. A transcriptional analysis of the coding sequence This study for the first time demonstrates the existence of aquaporins 3 and 5 in pre-attachment equine concep- tuses. The development of aquaporin gene expression over time until day 16 of pregnancy suggests important functions of aquaporins during yolk sac expansion. Furthermore, our data confirm the evidence that equine C C yolk sac expansion is mediated by a1b1Na /K -ATPase (Waelchli et al. 1997). Amplicons specific for both subunits of the isoenzyme were abundant in all conceptuses examined between days 10 and 16 of pregnancy. During completion of the endodermal lining around day 8 neither aquaporin 3 nor aquaporin 5 was detectable. In contrast, AQP3 transcripts were present in all conceptuses examined between days 10 and 16. Amplicons specific for AQP5 transcripts appeared for the first time on day 10, the most pronounced gene expression was found on day 14 corresponding to the phase of the most rapid conceptus expansion. The shift of immunoreactive protein for AQP3 from an apical to a non-polar membrane distribution between days 10 and 12 coincides with the apical membrane abundance of AQP5 and surface enlargement of the apical trophoblast membrane by the formation of microvilli. These micro- villi also increase in length. The intensive surface enlargement of the apical trophectoderm membrane Figure 6 Immunohistochemistry of equine embryos: (day 8 A, C, day 12 concomitant with AQP5 presence indicates an increased C C ability to transport water through the yolk sac wall. This B, day 14 D, day 16 E, positive control equine kidney F); Na /K ATPase interpretation is also supported by the active Golgi a1 antibody; (A) basolateral staining is shown in the trophectodermal cells and a diffuse staining in the endodermal cells. The embryonic disc apparatus and the cytoplasmic vesicles found by is devoid of any immunostaining (B). YS yolk sac; Ca, capsule; transmission electron microscopy which might be ED, embryonic disc; TEc, trophectoderm; En, endoderm; SC, associated with AQP5 traffic. After day 14, AQP5 subtrophoblastic compartment; G, glomerulus; PT, proximal tubule; transcripts decreased markedly. This coincides with the Scale bars: (A) 100 mm, (B) 50 mm, (C) 50 mm, (D) 20 mm and (E) 20 mm. www.reproduction-online.org Reproduction (2008) 135 497–508

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 504 S Budik and others

Figure 9 Transmission electron micrograph of a 12-day old equine Figure 7 Immunohistochemistry of equine embryos (capsules were lost embryo: (A) border of trophectoderm and embryonic disc. Notice the during sectioning): day 8 A, day 10 B, day 12 C, day 14 D, day 16 E, distribution of microvilli at the apical cell membranes (dense at the positive control (F): equine kidney, AQP3 antibody YS, yolk sac; TEc, trophectoderm, only a few at the embryonic disc). Higher magnification trophectoderm; En, endoderm; SC, subtrophoblastic compartment; shows the membrane bound vesicles at the apical membrane (arrows) CD, collecting duct; scale bars: (A) 10 mm, (B) 10 mm, (C) 10 mm, (B) and enlarged Golgi compartments in the trophectoderm (C). (D) 10 mm, (E) 10 mm. GA, Golgi apparatus; ED, embryonic disc; TEc, trophectoderm; En, endoderm, SC, subtrophoblast compartment, VS, vesicle; scale bars: (A) 5 mm, (B) 1 mm and (C) 2 mm.

of equine AQP5, besides detecting AQP-specific amino acid motifs, resulted in the discovery of putative Caseine II and cAMP-dependent PKA consensus sequences. From the two cAMP-dependent PKA phosphorylation sites the first one (amino acid residues 152–156) is identical to one of the human target sequences and the second (amino acid residues 256–259) to one of the mouse target sequences. These conserved cAMP-PKA consensus sequences closely resemble with those of vasopressin- regulated AQP2, suggesting that equine yolk sac AQP5 too may be under neurohormonal control (Lee et al 1996). The occurrence of AQP5, detection of putative target sites for PKA and the abundance of oxytocin and vasopressin within equine conceptuses (Waelchli et al. 2000) suggest a neurohormonal control of yolk sac expansion mediated by cAMP and PKA phosphorylation. The immunohistochemistry of day 8 equine conceptuses C C clearly showed that localisation of the a1Na /K - ATPase subunit was restricted to the basolateral cell membrane of ectodermal cells of the yolk sac. This is in agreement with the theory of a trans-trophoblast ion C C gradient created by a1b1Na/K -ATPase isoform Figure 8 Immunohistochemistry of equine embryos (capsules were lost leading to blastocyst formation in mammals (Watson during sectioning except in B): day 8 A, day 10 B, day 12 C, day 14 D, 1992, Watson & Barcroft 2001). The endodermal cell day 16 E, positive control F: equine lung; the apical membrane of type I layer that develops around day 8 showed an intense but pneumocytes stains positive, AQP5 antibody; YS, yolk sac; Ca, capsule; C C ED, embryonic disc; TEc, trophectoderm; En, endoderm; SC, diffuse staining for the a1Na /K -ATPase subunit which subtrophoblastic compartment; AL, alveolus; scale bars: (A) 20 mm, affected the whole cell including the cytoplasm. Only (B) 20 mm, (C) 10 mm, (D) 10 mm and (E) 10 mm. large, i.e. day 16, equine conceptuses showed more

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access Aquaporins and Na/K-ATPase 505

C C abundant membrane a1Na /K -ATPase in this layer at create yolk sac hypotonicity and hypertonicity in the the time of enlargement of the subtrophoblastic subtrophoblastic compartments. compartments. The arc-like spaces between the trophec- The present investigation does not explain how water todermal and the endodermal cell layers serve as an from the subtrophoblast compartments can enter into the additional compartment and show higher osmolarity yolk sac without high expense of energy. In order to than the yolk sac (Enders et al. 1993, Crews et al. 2007). understand this process, further studies on transport C C Since a1Na /K -ATPase subunit is present on the systems during yolk sac expansion are needed. whole surface, the endodermal cell layer of the yolk sac wall might pump sodium ions out of the yolk sac into the subtrophoblastic compartment causing the hypotonicity of the yolk sac. With this arrangement, the subtropho- Materials and Methods blastic compartments may get sodium ions from both Animals and embryo collection cell layers, namely the trophectoderm and the endo- derm, explaining their high osmolarity (Crews et al. Six fertile Haflinger mares (Equus caballus) aged between 4 and 2007). AQP3 and AQP5 immunoreactive protein is 16 years were available for the study. They were kept in a large paddock with access to a shed. They were fed hay and mineral present in both the cell membranes and the cytoplasm of supplements twice daily and water was available ad libitum. endodermal cells of the yolk sac. In the endodermal The mares were checked for oestrous behaviour and examined layer, AQP5 membrane abundance is lower than that in daily during oestrus by rectal palpation and transrectal the trophectoderm with its kidney collecting duct-like ultrasound scanning of the uterus and ovaries using a arrangement of AQP3 and AQP5 indicating that the 7.5 MHz linear scanner (Aloka SSD-900; Aloka, Wiener endodermal layer is more resistant to water movement Neudorf, Austria). After detection of a 3.5 cm preovulatory than the trophectoderm. AQP5 as an efficient water follicle and a decrease in uterine oedema, the mares were conductor is located strictly at the apical membrane of inseminated with either native or extended (Equi Pro; Minitu¨b, the ectodermal cell layer of the yolk sac which shows an Germany) non-cooled semen. One insemination dose intensive enlargement of its surface by microvilli. contained at least 500 million progressively motile spermato- Transmission electron microscopy of embryos at different zoa. Semen was collected from fertile stallions by artificial ages showed successive surface enlargement of the vagina using routine procedures (Aurich et al. 1997). The mares apical trophoblast membrane by microvilli, large Golgi were inseminated at intervals of 48 h and checked every 24 h apparatus and multiple vesicles sometimes fusing with until ovulation was detected. Embryos were flushed between the apical membrane. A polarisation of the cells of the days 8 and 16 after ovulation (ovulation detectionZday 0) trophectoderm is necessary to transport ions, solutes and without sedation of the mares using four times 1 l PBS with Ca fluids in a directional manner (Simmons 1992). AQP3 is and Mg (137.93 mM NaCl, 2.67 mM KCl, 0.901 mM CaCl2, . . abundant in all membranes of trophectodermal cell and 0.493 mM MgCl2 6H2O, 8.06 mM Na2HPO4 7H2O, 1.47 mM is a less efficient water conductor than AQP5. Therefore, KH2PO4, pH 7.4) without addition of proteins prewarmed to we conclude that in the ectodermal cells of the yolk sac 38 8C. A collection of young embryos (including day 10) was the apical membrane with its enlarged surface and performed with a balloon catheter (V-PEFC-28-100-4S; Cook, increased abundance of AQP5 is more permeable to Brisbane, Australia, inner diameter 6 mm, outer diameter water than are the basolateral membranes. This might 9 mm, length 1000 mm) fixed cranial to the uterine cervix. In explain how hypertonicity of the subtrophoblast com- case of older embryos (days 12–16), a modified equine partments can be maintained while the yolk sac itself endotracheal tube (V-PET-26; Global Veterinary Products, becomes hypotonic. In conclusion, our findings are Daphne, AL, USA, inner diameter 26 mm, outer diameter consistent with indications of an ion gradient between 35 mm, length 1000 mm) was used. The tip of the tube was cut close to the front of the balloon and the edges were smoothed. the subtrophectodermal space and the external environ- The fluid was recovered directly into sterile glass bottles ment of the conceptus (Crews et al. 2007) being created and subsequently, if necessary, filtered with an embryo filter by the ectodermal cells of the yolk sac. The arrangement system (EmCon embryo filter; Immunosystems, Spring Valley, of aquaporins 3 and 5 suggests a mechanism analogous WI, USA). The content of the filter was transferred into a to kidney collecting duct with AQP2 being replaced by Petri dish and examined under a binocular microscope at the closely related AQP5. The control of equine yolk sac 10–20!magnification for the presence of an embryo. Once an expansion might be mediated by changes in the water embryo was detected it was washed in prewarmed PBS to permeability of the apical ectodermal membrane remove attaching cells and scored for quality and size through differences in AQP5 abundance. This process (McKinnon & Squires 1988). Large embryos (diameter more seems to be under the control of PKA phosphorylation than w0.5 cm) visible to the naked eye were scored and driven by cAMP. Vasopressin in the yolk sac could washed directly in the bottles used for collection. If larger participate in the regulation of AQP5 function as it serves conceptuses ruptured during the flushing procedure they were for AQP2 in kidney collecting ducts. The abundance of recovered by filtration of the collection fluid through an C C a1Na /K ATPase in the endoderm of the yolk sac embryo filter (EmCon, diameter of the pores 75 mm) and might indicate an active ATP-consuming system to subsequently washed in a Petri dish. For RT-PCR, the embryos www.reproduction-online.org Reproduction (2008) 135 497–508

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 506 S Budik and others were transferred into a small amount of PBS in an Eppendorf Reverse transcriptase PCR or Falcon tube and stored at K80 8C till RNA preparation. Total embryonic or tissue RNA was reversely transcribed using For immunohistochemistry, the embryos were placed in specific primers designed from human, mouse or rat sequences formol (4% buffered). Embryos to be analysed by transmission (Table 1). The reaction was performed using the one-step electron microscopy were fixed in 2.5% glutaraldehyde. RT-PCR kit (Qiagen) according to the description of the manufacturer, using 30 pmol of each primer and more than Collection of tissue samples for reverse transcriptase 1 pg total RNA. The cycling profile was 30 min at 50 8C (RT), PCR (RT-PCR) 10 min at 95 8C (polymerase activation); 40 times cycle: 94 8C for 1 min, 52 8Cfor1min,728C for 1 min for PCR Samples from equine lung, kidney cortex and medulla to be amplification; 72 8C for 10 min for final extension and final used as positive controls were collected from euthanised horses storage at 4 8C overnight. at necropsy. The samples were put into Eppendorf tubes and K stored at 80 8C. Multiplex reverse transcriptase PCR (multiplex RT-PCR) In order to evaluate the expression of a1, b1ATPase subunits as Extraction of RNA and protein well as AQP3 and AQP5 relative to the expression of b-actin, multiplex RT-PCR was performed using RNase free DNase I After homogenisation of frozen single embryos or tissue (#EN0521; Fermentas, Vilnius, Lithuania)-digested total RNA samples with a glass homogeniser, total RNA and total protein obtained after TriReagent (Sigma–Aldrich) extraction from were extracted by means of TriReagent (T9424 Sigma–Aldrich) equine embryos flushed on days 8, 10, 12, 14 (each nZ4) according to the manufacturer’s protocol. Quantification of and 16 (nZ3). Primer concentrations were found empirically. total RNA was performed by spectrophotometry and similar The concentrations and primers used are summarised in amounts were used for RT-PCR. Proteins from the same samples Table 2. The cycling profile for multiplex RT-PCR was the were extracted according to the manufacturer’s protocol. same as that applied for RT-PCR, but only 25 amplification cycles were done. Microsome preparation Analysis of agarose gels For selective enrichment of membrane proteins (positive Evaluation of agarose gels and semiquantitative analysis of the controls in Western blotting), microsomes were prepared as multiplex RT-PCR was performed using Molecular Imager Gel follows: the tissue was homogenised in 0.1 M sodium Doc XR System (Bio-Rad Laboratories). phosphate buffer (pH 7.4), centrifuged 9000 g for 20 min at 4 8C. The supernatant was transferred to a new Eppendorf tube Sequencing of aquaporin RT-PCR products and diluted 2.5-fold in 0.1 M sodium phosphate buffer (pH 7.4), 0.25 M sucrose and again centrifuged 9000 g for Products amplified by aquaporin-specific primers were separ- 20 min at 4 8C. ated by electrophoresis on 1.5% agarose gel containing ethidium bromide using TAE buffer (40 mM Tris base, 20 mM glacial acetic acid, 1 mM EDTA, pH 8.5) and 6! loading dye Crude protein lysates (Fermentas). After u.v. detection, bands of interest were Small pieces of tissue were homogenised using a 2 ml glass excised, cleaned by Qiaex II kit (Qiagen) and sequenced homogeniser (Dounce; VWR, Vienna, Austria) and sonicated using the primers for amplification (IBL, Vienna, Austria). The subsequently in 2! SDS sample buffer (100 mM Tris–HCl (pH sequences were compared with those from the database using 6.8), 200 mM dithiothreitol (DTT), 4% SDS, 0.1% bromophe- standard nucleotide blast search (http://www.ncbi.nlm.nih. nol blue, 20% glycerol) using an ultrasonic disintegrator gov/blast/). Equine sequences not known so far were submitted (Sonoplus HD 70, Bandelin, Berlin, Germany) in order to to EBI databases (www.ebi.ac.uk). fracture the genomic DNA. Cloning of RT-PCR fragments

RT-PCR and cloning of RT-PCR amplicons Purified products were ligated to the A/T cloning vector pGEM- T (Promega) overnight at 4 8C and Escherichia coli DHF2a CaCl competent cells were transformed by heat shock, rolled PCR primers 2 1 h at 37 8Cin2! TY (medium containing tryptone/yeast Primer sequences for PCR were designed from sequences extract: 16 g tryptone, 10 g yeast extract, 5 g/l NaCl) without obtained from PubMed nucleotide search (http://www.ncbi. ampicillin. Subsequently, the bacterial suspension was plated nlm.nih.gov/entrez/query.fcgi) using the Prime program of the on 2! TYagar plates for blue white selection (ampicillin, IPTG GCG Wisconsin package (Accelrys). Preferably, primer pairs (isopropyl-b-D-thiogalactopyranoside), X-gal (5-bromo-4- resulting in intron spanning products binding in conserved chloro-3-indolyl-b-D-galactopyranoside), both Fermentas). regions of the sequences were selected in order to optimise After overnight incubation, white colonies were picked from fitting for equine sequences and allowing distinction between the plates, put into 3 ml of 2! TYand shaken overnight at 37 8C cDNA-derived and genomic products (Table 1). for miniprep. The next day, miniprep was performed using the

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access Aquaporins and Na/K-ATPase 507

Invisorb miniprep kit (Invitek, Berlin, Germany). After control Germany) and cut at 3 mm. Endogenous peroxidase activity was digestion of the plasmids using the restriction enzymes Apa I blocked by incubation of the sections in 0.6% H2O2 for 15 min. and Sac I (Fermentas), the plasmid preparations containing Incubation in 1.5% normal goat or rabbit serum respectively inserts with the expected length were sent to the sequencing was used to minimise non-specific antibody binding. service (IBL). Identification of the cloned insert was performed Subsequently, slides were incubated with primary antibody using primers M13-47 and M13-48. (dilution 1:100) overnight at 4 8C. The primary antibodies used were as follows: a polyclonal goat antibody directed against the C-terminus of human AQP5 (G-19: sc-9890; Santa Cruz Protein analysis Biotechnology), a polyclonal rabbit antibody against rat AQP3 residues 275–292 (#AB3276, Chemicon) and a monoclonal SDS-PAGE of proteins C C mouse Na /K -ATPase a1-subunit antibody (clone C464.6, The discontinuous standard system described by Laemmli #05-369; Upstate Biotechnology). As secondary antibody for (1970) was utilised in a vertical mini gel system (Bio-Rad) with AQP5, a biotinylated anti-goat antibody (Vector Laboratories 12% polyacrylamide. For sample preparation, the protein Inc., Burlingame, CA, USA) was used. Vectastain ABC kit solutions were mixed with the same volume 2! SDS-sample (Vector Laboratories) was utilised to enhance binding signals buffer (100 mM Tris–HCl (pH 6.8), 200 mM DTT, 4% SDS, and for horseradish peroxidase coupling. For AQP3 detection, a 0.1% bromophenol blue, 20% glycerol) and denatured for poly-horse radish peroxidase anti-rabbit IgG (Powervision; 5 min at 95 8C. The conditions for running were: current, ImmunoVision Technologies, Daly City, CA, USA) was used as 30 mA and voltage, 120 V. secondary antibody. Subsequently, sections were washed and developed in DAB substrate (30,3-diaminobenzidine, Sigma; Western blotting 10 mg/50 ml in 0.1 M Tris buffer (pH 7.4) and 0.03% H2O2) for 10 min at room temperature. After washing, the sections were After electrophoresis, the gels were equilibrated for 10 min in counterstained with haematoxylin, dehydrated and mounted on transfer buffer (25 mM Tris–Cl, 192 mM glycine, 20% metha- DPX (Fluka, Buchs, Switzerland). nol). Blotting was performed with a semi-dry blotting device (Bio-Rad) for 1.5 h at 15 V and 200 mA. Blocking was performed for 30 min in 1! PBS (137 mM NaCl, 2.7 mM Transmission electron microscopy KCl, 100 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), 0.05% Tween-20, 2% gelatine powder from fish skin (G7041, Sigma). Specimens were fixed in 2.5% glutaraldehyde and postfixed in Then the membrane was washed three times with 1! PBS, 1% phosphate-buffered osmium tetraoxide (Plano W. Plannet 0.05% Tween-20 and incubated with primary antibody over- GmbH, Wetzlar, Germany). Dehydration was performed in a night at 4 8C. The primary antibodies were diluted as follows: series of graded ethanol solutions. Infiltration with propylene C C anti-Na /K -a1ATPase (rabbit polyclonal antibody #06520, oxide (Merck) was followed by increasing the ratios of epoxy resin (Serva, Heidelberg, Germany) to propylene oxide (1:1, Upstate Biotechnology), 1:1000; 200 ml rabbit anti-AQP3 3:1) and finally pure resin. After an additional change, the resin affinity-purified polyclonal antibody #AB3276 (Chemicon, was polymerised at 60 8C. Ultrathin sections were cut at 70 nm, Temecula, CA, USA), 1:200; goat polyclonal antibody AQP5 stained with alkaline lead citrate and methanolic uranyl (G-19): sc-9890 (Santa Cruz Biotechnology, Santa Cruz, CA, acetate, and viewed with an electron microscope (EM 900; USA), 1:200. After washing three times with 1! PBS, 0.05% Zeiss, Oberkochen, Germany). Tween-20 the membrane was incubated with HPR-conjugated secondary antibody of the corresponding species for 1.5 h at room temperature. Subsequently, it was washed again three Statistical analysis times with 1! PBS, 0.05% Tween-20. Finally, detection by ECL (ECLplus, Amersham) was carried out according to the Statistical comparisons were made with the SPSS statistics manufacturer’s protocol. Exposure was carried out in an package (SPSS, Chicago, IL, USA). ANOVA and subsequent exposure cassette (Kodak, Biome; VWR). Duncan’s test were used to compare mRNA expression of a1ATPase, b1ATPase, AQP3 and AQP5 relative to b-actin and Stripping of Western blot nitrocellulose membranes embryonic size between embryos of different age. Correlations between a1ATPase, b1ATPase, AQP3, AQP5 and sizes of the Antibodies bound to Western blot nitrocellulose membranes embryos were analysed and Pearson’s coefficients of corre- were removed by incubation for 30 min at 50 8Cin50ml lation were calculated. For all comparisons, P!0.05 was stripping solution (100 mM b-mercaptoethanol, 2% SDS, considered significant. 62.5 mM Tris–Cl (pH 6.7)). After this treatment, membranes were blocked again and exposed to the primary antibody of choice. Acknowledgements

Immunohistochemistry The authors are grateful to the Mehl-Muelhens-Stiftung for financial support of the study. The work of Julia Maderner and Equine embryos from days 8, 10, 12, 14 and 16 (nZ2 for each Gisi Pittner for help with the graphics is greatly acknowledged. age) were immersion-fixed in 4% buffered formalin. Formalin- The authors declare that there is no conflict of interest that fixed samples were embedded in Histocomp (Vogel, Giessen, would prejudice the impartiality of this scientific work. www.reproduction-online.org Reproduction (2008) 135 497–508

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access 508 S Budik and others

References Laemmli U 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 680–685. Aurich JE, Scho¨nherr U, Hoppe H & Aurich C 1997 Effects of antioxidants Lee MD, Bhakta KY, Raina S, Yonescu R, Griffin CA, Copeland NG, on motility and membrane integrity of chilled-stored stallion semen. Gilbert DJ, Jenkins NA, Preston GM & Agre P 1996 The human Theriogenology 48 185–192. Aquaporin-5 gene (molecular characterisation and chromosomal Barcroft LC, Offenberg H, Thomsen P & Watson AJ 2003 Aquaporin location). Journal of Biological Chemistry 271 8599–8604. proteins in murine trophectoderm mediate transepithelial water move- Manejwala FM, Cragoe EJ Jr & Schultz RM 1989 Blastocoel expansion in ments during cavitation. Developmental Biology 256 342–354. the preimplantation mouse embryo: Role of extracellular sodium and Betteridge KJ 2007 Equine embryology: an inventory of unanswered chloride and possible apical routes of their entry. Developmental Biology questions. Theriogenology 68 (Supplement 1) S9–S21. 133 210–220. Betts DH, MacPhee DJ, Kidder GM & Watson AJ 1997 Ouabain sensitivity Matsamura Y, Uchida S, Rai T, Sasaki S & Marmo F 1997 Transcriptional and expression of the Na/K-ATPase alpha - and beta -subunit isoform regulation of aquaporin-2 water channel gene by cAMP. Journal of the genes during bovine early development. Molecular Reproduction and American Society of Nephrology 8 861–867. Development 46 114–126. McKinnon AO & Squires EL 1988 Morphologic assessment of the equine Biggers JD 1972 Mammalian blastocyst and amnion formation. In The embryo. Journal of the American Veterinary Medical Association 192 Water Metabolism of the Fetus, pp 3–31. Eds AC Barnes & AE Seeds. Springfield, IL: Thomas. 401–406. Budik S, Walter I, Tschulenk W, Helmreich M, Pittner F & Aurich C 2006 Offenberg H, Barcroft LC, Caveney A, Viuff D, Thomsen PD & Watson AJ Molecular aspects of equine blastocyst formation in relation to 2000 mRNAs encoding aquaporins are present during murine pre- ultrastructure. Reproduction in Domestic Animals 41 336. implantation development. Molecular Reproduction and Development Crews LJ, Waelchli RO, Huang CX, Canny MJ, McCully ME & Betteridge KJ 57 323–330. 2007 Electrolyte distribution and yolk sac morphology in frozen hydrated Simmons C 1992 The development of cellular polarity in transport epithelia. equine conceptuses during the second week of pregnancy. Reproduction, Seminars in Perinatology 16 78–89. Fertility and Development 19 804–814. Verkman AS 1999 Lessons on renal physiology from transgenic mice Dibas AI, Mia AJ & Yorio T 1998 Aquaporins (water channels): role of lacking aquaporin water channels. Journal of the American Society of vasopressin-activated water transport. Proceedings of the Society for Nephrology 10 1126–1135. Experimental Biology and Medicine 219 183–199. Verkman AS, van Hoek AN, Ma T, Frigeri A, Skach WR, Mitra A, DiZio SM & Tasca RJ 1977 Sodium-dependent amino acid transport in Tamaraooii BK & Farinas J 1996 Water transport across mammalian cell C C preimplantation mouse embryos, III. Na -K -ATPase-linked mechanism membranes. American Journal of Physiology 270 C12–C30. in blastocysts. Developmental Biology 59 198–205. Waelchli RO & Betteridge KJ 1996 Osmolality of equine blastocyst fluid Edashige K, Sakamoto M & Kasai M 2000 Expression of mRNAs of the from day 11 to day 25 of pregnancy. Reproduction, Fertility and aquaporin family in mouse oocytes and embryos. Cryobiology 40 171–175. Development 8 981–988. Enders AC, Schlafke S, Lantz KC & Liu IKM 1993 Endoderm cells of the Waelchli RO, Mac Phee DJ, Kidder GM & Betteridge KJ 1997 Evidence for equine yolk sac from day 7 until formation of the definitive yolk sac the presence of sodium – and potassium – dependent adenosine placenta. Equine Veterinary Journal Supplement 15 3–9. triphosphatase alpha1 and beta1 subunit isoforms and their probable Fushimi K, Sasaki S & Marumo F 1997 Phosphorylation of Serine 256 is role in blastocyst expansion in the preattachment horse conceptus. required for cAMP-dependent regulatory exocytosis of the aquaporin-2 Biology of Reproduction 57 630–640. water channel. Journal of Biological Chemistry 272 14800–14804. Waelchli RO, Shand NA, Roud HK, Alexander SL & Betteridge KJ 2000 Ginther OJ 1983 Fixation and orientation of the early equine conceptus. Oxytocin and Vasopressin accumulation in the equine conceptus during Theriogenology 19 613–623. the second to fifth weeks of gestation. Theriogenology 53 287. Ginther OJ 1992 Embryology and placentation. In Reproductive Biology of Watson AJ 1992 The cell biology of blastocyst development. Molecular the Mare, edn 2, pp 345–418. Cross Plains, WI: Equiservices. Reproduction and Development 3 492–504. Ginther OJ, Bergfeld DR, Leith GS & Scraba ST 1985 Early embryonic loss in mares: incidence and ultrasonic morphology. Theriogenology 24 73–86. Watson AJ & Barcroft LC 2001 Regulation of blastocyst formation. Frontiers Hara-Chikuma M & Verkman AS 2005 Aquaporin-3 functions as a glycerol in Bioscience 6 708–730. transporter in mammalian skin. Biology of the Cell 97 479–486. Watson AJ, Natale DR & Barcroft LC 2004 Molecular regulation of Hendriks G, Koudijs M, van Balkom BW, Oorschot V, Klumperman J, blastocyst formation. Animal Reproduction Science 82–83 583–592. Deen PM & van der Sluijs P 2004 Glycosylation is important for cell Yang F, Kawedia JD & Menon AG 2003 Cyclic AMP regulates Aquaporin 5 surface expression of the water channel aquaporin-2 but is not essential expression at both transcriptional and post transcriptional levels through for tetramerization in the endoplasmic reticulum. Journal of Biological a protein kinase A pathway. Journal of Biological Chemistry 278 Chemistry 279 2975–2983. 32173–32180. Jones DH, Davies TC & Kidder GM 1997 Embryonic expression of the putative g subunit of the sodium pump is required for acquisition of fluid transport capacity during mouse blastocyst development. Journal of Cell Received 25 June 2007 Biology 139 1545–1552. First decision 27 July 2007 Kraine CM, Towne JE & Menon AG 1999 Cloning and characterisation of murine AQP 5: evidence of a conserved aquaporin gene cluster. Revised manuscript received 12 December 2007 Mammalian Genome 10 498–505. Accepted 2 January 2008

Reproduction (2008) 135 497–508 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/28/2021 12:37:19PM via free access