Genetic Susceptibility to Benzene-Induced Toxicity: Role of NADPH: Quinone Oxidoreductase-11

Home , Quinone

[CANCER RESEARCH 63, 929–935, March 1, 2003] Genetic Susceptibility to Benzene-induced Toxicity: Role of NADPH: Quinone Oxidoreductase-11

Alison K. Bauer,2 Brenda Faiola, Diane J. Abernethy, Rosemarie Marchan, Linda J. Pluta, Vicki A. Wong, Kay Roberts, Anil K. Jaiswal, Frank J. Gonzalez, Byron E. Butterworth, Susan Borghoff, Horace Parkinson, Jeffrey Everitt, and Leslie Recio CIIT Centers for Health Research, Research Triangle Park, North Carolina 27709 [A. K. B., B. F., D. J. A., R. M., L. J. P., V. A. W., K. R., B. E. B., S. B., H. P., J. E., L. R.]; Baylor College of Medicine, Houston, Texas 77030 [A. K. J.]; and National Cancer Institute, Bethesda, Maryland 20892 [F. J. G.]

ABSTRACT CYP2E1 activity developed no benzene-induced myelotoxicity or hematotoxicity (9). Several groups have hypothesized that hydroqui- Enzymes that activate and detoxify benzene are likely genetic determi- none and catechol, benzene metabolites, are converted by bone mar- nants of benzene-induced toxicity. NAD(P)H: quinone oxidoreductase-1 row myeloperoxidase to reactive quinones (1,4-BQ and 1,2-BQ, re- (NQO1) detoxifies benzoquinones, proposed toxic metabolites of benzene. NQO1 deficiency in humans is associated with an increased risk of leu- spectively; Refs. 8, 10). 1,4- and 1,2-BQ can be detoxified back to HQ kemia, specifically acute myelogenous leukemia, and benzene poisoning. and catechol, respectively, by NQO1 (DT-diaphorase; E.C. 1.6.99.2). We examined the importance of NQO1 in benzene-induced toxicity by NQO1 is a 2- or 4-electron reductase that maintains quinones and their -hypothesizing that NQO1-deficient (NQO1؊/؊) mice are more sensitive derivatives in a reduced state where they can more readily be conju to benzene than mice with wild-type NQO1 (NQO1؉/؉; 129/Sv back- gated and excreted (11). Therefore, the activity of NQO1 in the bone ground strain). Male and female NQO1؊/؊ and NQO1؉/؉ mice were marrow is likely a key genetic determinant of benzene-induced exposed to inhaled benzene (0, 10, 50, or 100 ppm) for 2 weeks, 6 h/day, hematotoxicity (12). 5 days/week. Micronucleated peripheral blood cells were counted to assess An NQO1 polymorphism at position 609 in exon 6 (C3T) in the genotoxicity. Peripheral blood counts and bone marrow histology were human NQO1 gene results in a proline to serine substitution at used to assess hematotoxicity and myelotoxicity. p21 mRNA levels in bone position 187 in the amino acid structure of the NQO1 protein, result- marrow cells were used as determinants of DNA damage response. Female NQO1؊/؊ mice were more sensitive (6-fold) to benzene-induced genotox- ing in a complete loss of protein and enzyme activity. The NQO1 ,icity than the female NQO1؉/؉ mice. Female NQO1؊/؊ mice had a polymorphism frequency varies among ethnic groups, for example 9-fold increase (100 versus 0 ppm) in micronucleated reticulocytes com- 4% in Caucasians versus 22% in Chinese (12). Individuals heterozy- pared with a 3-fold increase in the female NQO1؉/؉ mice. However, the gous or homozygous for the NQO1 polymorphism have an increased induced genotoxic response in male mice was similar between the two risk of developing benzene poisoning and de novo acute leukemias in genotypes (>10-fold increase at 100 ppm versus 0 ppm). Male and female adults and children, including acute myelogenous leukemia and acute .(NQO1؊/؊ mice exhibited greater hematotoxicity than NQO1؉/؉ mice. lymphoblastic leukemia (13–15 p21 mRNA levels were induced significantly in male mice (>10-fold) from Mice with a specific deletion of NQO1 (NQO1Ϫ/Ϫ) can be used to ؊ ؊ both strains and female NQO1 / mice (> 8-fold), which indicates an directly test the role of this enzyme in the detoxification of benzene. activated DNA damage response. These results indicate that NQO1 defi- NQO1Ϫ/Ϫ mice have a portion of intron 5 and all of exon 6 of the ciency results in substantially greater benzene-induced toxicity. However, the specific patterns of toxicity differed between the male and female mice. NQO1 gene deleted, the same region where NQO1 polymorphisms in humans are found (16). From birth to 5 weeks of age, no spontaneous Ϫ Ϫ INTRODUCTION histopathological differences occur between the NQO1 / and NQO1ϩ/ϩ mice. However, as the NQO1Ϫ/Ϫ mice age, they develop Benzene is one of the few known etiological factors identified for spontaneous myelogenous hyperplasias (17). The NQO1Ϫ/Ϫ mice acute myelogenous leukemia in humans (1), and is associated with a demonstrated increased menadione toxicity and had an increased spectrum of lympho-hematopoietic cancers in humans and mice (2– susceptibility to polycyclic aromatic hydrocarbon [both benzo- 4). Potential for exposure to benzene in the workplace can be high in (a)pyrene- and 7,12-dimethylbenz(a)anthracene]-induced mouse skin certain industries, such as the production of paint and organic chem- carcinogenesis compared with NQO1ϩ/ϩ mice (16, 18). These find- icals (5). Environmental benzene exposures can also occur from ings suggest a protective role for NQO1 in protection against quinone gasoline and cigarette smoke (6, 7). A better understanding of the toxicity and carcinogenesis. mechanisms involved in benzene-induced hematotoxicity is essential In the present study, we examined the importance of NQO1 in in developing biomarkers that will identify individuals who are more benzene-induced toxicity using mice deficient in NQO1 (NQO1Ϫ/Ϫ) genetically susceptible to benzene-induced toxicity and leukemo- protein expression and activity (16). Our overall hypothesis is that genesis. NQO1Ϫ/Ϫ mice are more susceptible to benzene-induced toxicity Oxidation of benzene by CYP2E13 to reactive intermediates is a than NQO1ϩ/ϩ mice because of decreased detoxification of benzene prerequisite of cellular toxicity (Fig. 1; Ref. 8). Mice deficient in quinone metabolites. We observed that a lack of NQO1 in male mice increases benzene-induced hematotoxicity but not genotoxicity or the Received 8/8/02; accepted 1/3/03. DNA damage response. However, NQO1 appears critical in female The costs of publication of this article were defrayed in part by the payment of page mice for detoxifying the metabolites of benzene responsible for geno- charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. toxicity, hematotoxicity, and induction of the DNA damage response. 1 Supported by National Institute of Environmental Health Sciences National Research Service Award 1F32 ES11424-01 (to A. K. B.) and NIH Grant RO1 ES07943 (to A. K. J.). MATERIALS AND METHODS 2 To whom requests for reprints should be addressed, at Laboratory of Pulmonary Pathobiology, E214, Building 101, National Institute of Environmental Health Sciences, Animal Husbandry 111 T. W. Alexander Drive, Research Triangle Park, NC 27709. Phone: (919) 316-4673; Fax: (919) 541-4133; E-mail: [email protected]. Mouse Husbandry and Genotyping. The NQO1Ϫ/Ϫ and NQO1ϩ/ϩ 3 The abbreviations used are: CYP2E1, cytochrome P4502E1; BQ, benzoquinone; MN, micronuclei; NQO1, NADPH: quinone oxidoreductase-1; NCE, normochromatic mice were originally obtained from Radjendirane et al. (16) and Peters et al. reticulocyte; RET, reticulocyte; PNP, ␳-nitrophenol. (19). A detailed description of the generation of NQO1Ϫ/Ϫ mice is in Ref. 16. 929

7 ml of buffer B [0.05 M Tris, 0.25 M sucrose, 1 mM EDTA (Sigma; pH 7.4)], centrifuged at 105,000 ϫ g for 60 min at 4°C, resuspended in buffer C [0.1 M Ϫ K2HPO4 and 0.25 M sucrose (pH 7.4)] and frozen at 80°C until additional use. PNP hydroxylase activity was used as a measure of CYP2E1 activity and was determined by a spectrophotometric assay (22). Incubation mixtures that contained 0.1 M potassium phosphate buffer, 0.1 mM PNP, 1.0 mM ascorbate, and 0.4 mg/ml liver microsomal protein were preincubated for 3 min at 37°C before the addition of 1 mM NADPH. In control incubation mixtures, NADPH

was replaced with an equivalent amount of deionized H2O. The total incubation volume was 1 ml. The incubation was performed for 7.5 min at 37°Cin a shaking water bath and terminated by adding 0.2 ml of 1.5 N perchloric acid. The sample was diluted 10:1 with 10 N NaOH, and the absorbance was measured at 546 nm on a Beckman DU 650 spectrophotometer (Fullerton, CA). The concentration of 4-nitrocatechol was determined using an extinction coefficient of 10.28 cm2/mol (22). For immunoblots, 8 ␮g of microsomal protein per sample was electrophore- sed on a 10% polyacrylamide SDS-PAGE gel and transferred onto Immo- bilon-P Transfer membrane (Millipore, Bedford, MA). Primary polyclonal rat Fig. 1. Benzene metabolism in the liver and bone marrow. Benzene metabolism in the CYP2E1 antibody (1:1000; Gentest, Woburn, MA) in 0.5% milk in PBS was liver by CYP2E1 is followed by several possible routes of metabolism (11, 14). NQO1 detoxifies the BQs in the bone marrow to the less toxic metabolites, hydroquinone and incubated overnight at 4°C, washed in 1% milk plus 0.1% Tween 20, followed catechol. BQ, benzoquinone; DH, benzene dihydrodiol dehydrogenase; EH, microsomal by incubation in an antigoat-horseradish peroxidase antibody (1:20,000; Santa epoxide hydrolase; MPO, myeloperoxidase. This diagram is greatly simplified and does Cruz Biotechnologies, Santa Cruz, CA) in 0.5% milk in PBS. More washes not contain the entire metabolic pathway for benzene, which includes any Phase II were done, and the signal detected using West Pico Chemiluminescence metabolism of benzene. (Pierce Endogen, Rockford, IL). Densitometry was done using the BIO-RAD Quantity One Quantitation software (Version 4).

We maintained a pathogen-free NQO1Ϫ/Ϫ colony and a 129/Sv (NQO1ϩ/ϩ) Experimental Design colony under identical husbandry and environmental conditions in the animal facility at the CIIT Centers for Health Research. All of the animal use was This study used three benzene exposure groups (10, 50, and 100 ppm conducted in facilities accredited by the Association for the Assessment and benzene) and one control unexposed group (0 ppm). Exposure levels were Accreditation of Laboratory Animal Care and approved by the CIIT Animal chosen based on toxicity in a pilot study using 0, 10, and 100 ppm benzene Care and Use Committee. Mice were housed in shoe-box cages in a humidity- exposure levels (data not shown). Mice were exposed to benzene for 6 h/day, and temperature-controlled room, and provided water and pelleted open- 5 days/week for 2 weeks, for all of the experiments based on previous studies formula rodent diet NIH-07 (Zeigler Brothers, Gardners, PA.) ad libitum. The (3, 23). A previous time course study conducted in male 129/SvJ (The Jackson mice were brother-sister mated and the offspring then genotyped for NQO1. Laboratory) mice demonstrated that the optimal sampling time point was After sequencing intron 5 (data not shown), we developed NQO1ϩ/ϩ- immediately after exposure for determining peak levels of MN-RET (immature specific primers in the region of intron 5 deleted in the NQO1Ϫ/Ϫ mice for RBC) and p21 mRNA expression relative to 12 or 24 h after exposure (data not genotyping: NQO1D1 (forward), tggagaggcagacaaatgcgca; NQO1D2 (re- shown). verse), cctgggaattgacacgggtctt. Primers specific to the neomycin cassette were After termination of exposure and chamber off-gassing, mice were eutha- used for genotyping NQO1Ϫ/Ϫ mice: NEOD1 (forward), gtactcggatggaagc- nized with an i.p. injection of 5 mg pentobarbital/mouse (Abbott Laboratories, cggtct; NEOD2 (reverse), aatatcacgggtagccaacgct (20). These primer sets were Chicago, IL). Blood was collected by cardiac puncture in microcontainers ϫ (Becton Dickinson, San Jose, CA) containing EDTA for WBC counts that used in a multiplex PCR reaction [10 PCR buffer without MgCl2 (Applied ␮ were counted on an Advia 120 Hematology System (Bayer Diagnostics, Biosystems, Foster City, CA), 2.5 mM MgCl2, 200 M deoxynucleoside triphosphates, 100 pmol/rxn NQO1D primers, 50 pmol/rxn NEOD primers, Tarrytown, NY) by Antech Diagnostics (New York, NY). Additional blood and 1.25 units AmpliTaq-gold] under these conditions: 94°C for 10 min, 30 was collected for MN analysis. Femurs were then removed, and the marrow cycles of 94°C for 1 min followed by 62°C for 1 min, and 62°C for 5 min. A cavity was flushed with RNA later (Ambion, Austin, TX) and kept at 4°C until 2% agarose ethidium bromide gel was run followed by analysis (Alpha processing occurred (Յ6 weeks). The sternum, spleen, thymus, liver, lymph Innotech Imaging System, San Leandro, CA). The NQO1ϩ/ϩ primers pro- nodes, and lung were also collected for fixation and histopathological evalu- duced a 208-bp product, and the NQO1Ϫ/Ϫ primers produced a 250-bp ation. product, allowing identification of each mouse (Fig. 2). Experimental Animals. Male and female mice 10–12 weeks old were Benzene Exposure used for this study. The mice were housed in shoe-box cages until they were Benzene exposure methods have been described in detail (23). Benzene moved to stainless-steel wire mesh cages in a Hinners-style whole-body (Sigma) purity was assessed before inhalation by the CIIT inhalation facility, inhalation chamber 2 weeks before the start of the benzene exposures. During and all of the benzene exposures were controlled by an Andover Infinity this 2-week acclimation period and the exposure period, the mice were put on system (Andover Controls Corp., Andover, MA). Benzene exposure atmo- a reversed light schedule (on at 1 a.m. and off at 1 p.m.), with exposures taking spheres were measured at least six times per exposure with infrared spectro- place during the light cycle. Only water was given during the exposures. Tissues were collected within 5 h after termination of exposure. Each exposure group including air-exposed controls was housed in a separate inhalation chamber. Mice used in the basal CYP2E1 experiment were not housed in suspended wire cages but remained in polycarbonate shoe-box caging.

PNP Hydroxylase Activity and CYP2E1 Protein Expression

Microsomes were prepared from livers excised from mice using differential centrifugation according to the method described by Guengerich (21). Briefly, livers were removed from naive male and female mice, homogenized in buffer Fig. 2. Genotyping NQO1Ϫ/Ϫ mice. Agarose gel demonstrating the NQO1ϩ/ϩ A [0.154 M KCl and 0.05 M Tris Base (Sigma, St. Louis, MO; pH 7.4)], Ϫ Ϫ ϫ fragment (208 bp) and the NQO1 / fragment (250 bp). Lane 1 is the DNA size marker centrifuged at 10,000 g for 20 min at 4°C followed by centrifugation of the (Amplisize; BIO-RAD). Lane 2 is an NQO1ϩ/ϩ mouse. Lane 3 is a NQO1ϩ/Ϫ mouse supernatant at 105,000 ϫ g for 60 min at 4°C. The pellet was resuspended in (with both fragments). Lanes 4–8 are NQO1Ϫ/Ϫ mice. 930

photometers (MIRAN 1A; The Foxboro Co., Foxboro, MA). The chambers RESULTS were operated with a continuous flow of HEPA-filtered air at ϳ1800 liters/ min. Control mice (0 ppm) were exposed to a continuous flow of conditioned Comparison of Basal CYP2E1 Activity and Protein Expression HEPA-filtered air in inhalation chambers. in Liver Microsomes. To assess any differences in response between the NQO1Ϫ/Ϫ and NQO1ϩ/ϩ mice exposed to benzene, the basal MN Analysis in Blood Using a Flow Cytometric Method CYP2E1 levels were determined for the two strains. PNP activity as a measure of CYP2E1 activity was significantly lower in both genders The enumeration of MN is a measure of genotoxicity (24). The Prototype in the NQO1Ϫ/Ϫ versus NQO1ϩ/ϩ mice, whereas CYP2E1 protein Microflowplus Mouse Micronucleus Analysis kit and protocol (Litron Labora- expression in the two strains in either gender was not significantly tories, Rochester, NY) were used to evaluate the MN-RET and MN-NCE in different (Table 1). Therefore, differences because of CYP2E1 levels mouse blood using malaria-infected cells as a reference standard to consis- between NQO1Ϫ/Ϫ and NQO1ϩ/ϩ mice would not be expected to tently define the micronucleus analysis windows, and to establish daily proper play a role in any differences seen with respect to benzene. ␮ photomultiplier tubes voltages and compensation (25). Briefly, 50 l of blood Genotoxicity in Mice Exposed to Inhaled Benzene. The fre- were collected and prepared for the determination of MN in RBCs as described quency of MN RBC was determined in mice exposed to 0, 10, 50, or (Litron Laboratories). Malaria-infected cells were used to define gating win- 100 ppm benzene. An exposure-dependent increase in MN-RET oc- dows and PMT settings for detection by flow cytometry (25). Nucleated cells curred in both male NQO1Ϫ/Ϫ and NQO1ϩ/ϩ mice; at 100 ppm in the peripheral blood other than the RET and NCE were gated out. MNs were Ͼ defined as propidium iodide-positive cells, RETs were identified using specific inhaled benzene induced 10-fold increase in MN-RET. However, no antibody (CD-71) as CD71-positive cells, and NCEs were identified as CD71- significant differences between the two genotypes were seen at any of negative cells. CD71 is only expressed in RETs (26). In an initial pilot study, the exposure levels (Fig. 3A). Similarly, significant increases in MN- the MNs were also assessed in the bone marrow by manual counts of acridine- NCE occurred only at the 100-ppm exposure level, although no orange stained cytospins of bone marrow cells. The percentage of MN-RET in biologically significant differences were seen between the two geno- the bone marrow manual counts was not different from in the blood by flow types of male mice (Fig. 3B). The difference in the degree of the cytometry. response between the MN-RET and the MN-NCE is likely because of the short exposure period (2 weeks), which is not sufficient for Histopathology maturation of RET to NCE. There was no exposure-dependent increase in MN-RET or MN- After necropsy, thymus, sternum, spleen, liver, lymph nodes, and fixative- NCE in female NQO1ϩ/ϩ mice (Fig. 3, C and D). In contrast, female infused lungs were placed into 10% neutral buffered formalin (Fisher, Fair NQO1Ϫ/Ϫ mice exhibited an exposure-dependent increase in MN in Lawn, NJ) for 48 h. Sternal tissues were decalcified in 7.5% formic acid for both populations of cells similar to the increases seen in the male mice 72 h and then processed routinely. All of the tissues were embedded in (Fig. 3, C and D). The difference in MN-RET response between 0 and paraffin, subjected to microtomy at 4 ␮m, and prepared routinely for H&E 100 ppm in the female NQO1Ϫ/Ϫ mice constitutes a 9-fold-increase (Sigma) sections. Bone marrow cellularity was assessed by evaluating five images, each representing 0.259 mm2 of marrow from each animal taken from over unexposed mice compared with a 3-fold-increase over unex- ϩ ϩ standardized regions of mid-sternebrae marrow cavities. Images were acquired posed mice in the female NQO1 / mice. In addition, male ϩ ϩ using a Spot RT digital camera (Diagnostic Instruments, Inc., Sterling Heights, NQO1 / mice were significantly more sensitive than female ϩ ϩ MI) on a Zeiss Axioscop 2 microscope (Carl Zeiss, Inc., Thornwood, NY) NQO1 / mice in MN responsiveness to inhaled benzene, as re- using Image-Pro Plus software (Media Cybernetics, Silver Spring, MD). ported by others previously (28–31). Analysis of Hematotoxicity and Myelotoxicity Levels in Mice Real-Time Quantitative Reverse Transcription-PCR for p21 Exposed to Benzene. Benzene-induced hematotoxicity results in a mRNA Expression decrease in total WBC counts and bone marrow cellularity (3, 32). We examined these parameters in the NQO1Ϫ/Ϫ versus the NQO1ϩ/ϩ Total RNA from bone marrow was isolated using the Qiagen RNAeasy kit mice. Male NQO1Ϫ/Ϫ mice exhibited significant hematotoxicity at a (Qiagen, Valencia, CA), which includes treatment with DNase I. Reverse- lower benzene exposure level (50 ppm) than male NQO1ϩ/ϩ mice ␮ transcription reactions were performed with 2 g of total RNA using random (Fig. 4A). At the 100 ppm level, both strains, NQO1ϩ/ϩ and hexamers as primers according to the Reverse Transcription kit from Applied NQO1Ϫ/Ϫ, developed hematotoxicity compared with unexposed Biosystems. The Applied Biosystems 7700 Prism Sequence Detection System mice but did not different from each another. In female mice, the using Sybr green (Applied Biosystems) was used to quantify p21 mRNA levels NQO1Ϫ/Ϫ mice were also significantly more sensitive to benzene- by PCR using specific primers (27). PCR reaction conditions and data analysis induced hematotoxicity at the 50 and 100 ppm levels compared with were performed according to the manufacturer’s recommended protocol (User ϩ ϩ bulletin no. 2, Applied Biosystems Prism 7700 Sequence Detection System). the NQO1 / mice (Fig. 4B). Ϫ Ϫ All of the samples were run in triplicate using gapdh as the calibrator gene, NQO1 / mice had slightly greater bone marrow cellularity noted ϩ ϩ because gapdh levels do not change across genotypes or with benzene expo- in sternebrae than did NQO1 / mice (see Fig. 5), consistent with sure (27).

Table 1 Basal levels of CYP2E1 activity and protein content in NQO1ϩ/ϩ versus Statistical Analysis NQO1Ϫ/Ϫ mice in both genders All of the data are presented as the mean Ϯ SE. A three-way ANOVA was Quantitation of protein a b done on each variable with the three main effect factors of gender, strain, and CYP2E1 activity content (normalized Genotype Gender (nmol/min/mg Ϯ SE) values Ϯ SE) exposure level, and their first order interactions. If any of the interactions were NQO1ϩ/ϩ Male 2.12 Ϯ 0.31 (4)c 1.00 Ϯ 0.03 (6) significant, additional analyses were done so that the nature of the interaction NQO1ϩ/ϩ Female 1.80 Ϯ 0.19 (4) 1.00 Ϯ 0.01 (7) could be understood. Tukey’s multiple comparison procedure was used to NQO1Ϫ/Ϫ Male 1.26 Ϯ 0.17d (4) 0.99 Ϯ 0.06 (6) determine differences among significant factors with three or more levels. NQO1Ϫ/Ϫ Female 1.21 Ϯ 0.13d (3) 1.08 Ϯ 0.05 (5) P Ͻ 0.05 was used as the level of significance for all of the statistical tests. A a CYP2E1 activity was measured by ␳-nitrocatechol formed. This experiment was Pearson correlation coefficient was calculated for the two variables, MN-RET performed twice. b Relative densitometric units from immunoblots were normalized to NQO1ϩ/ϩ mice. percentages and p21 mRNA fold-increases. Statistical analyses were done c Number of mice used per group. using SAS Statistical Software (SAS Institute, Inc., Cary, NC). d P Ͻ 0.05 for NQO1Ϫ/Ϫ versus NQO1ϩ/ϩ mice. 931

Fig. 3. A comparison of benzene-induced MN in RET and NCE populations in the peripheral blood of NQO1ϩ/ϩ versus NQO1Ϫ/Ϫ mice. A, percentage of MN-RET in male NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. B, MN-RET in female NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. C, MN-NCE in male NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. D, MN- NCE in female NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. Data represent mean (n ϭ 5 per strain, gender, and exposure level and was repeated twice); bars, ϮSE. indicates significant differences from unexposed ء mice (0 ppm; P Ͻ 0.05); ϩ indicates significant differences between NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice (P Ͻ 0.05).

the myeloid hyperplasia that has been reported previously to develop Male NQO1Ϫ/Ϫ mice were not more sensitive to the effects of spontaneously in these animals (17). A dose-related benzene-induced benzene-induced genotoxicity or to p53-regulated DNA damage re- bone marrow hypoplasia was noted (Fig. 6). Marrow cellularity was sponse than NQO1ϩ/ϩ mice. In contrast, female NQO1Ϫ/Ϫ mice diminished with no discernible effects on specific cell lineages evalu- had a 6-fold higher MN response than the female NQO1ϩ/ϩ mice. able on histopathology. Lesions were noted in sternal marrows of The hematotoxic response to benzene was dramatically altered in both male NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice, and in female NQO1Ϫ/Ϫ male and female NQO1Ϫ/Ϫ mice. Male NQO1Ϫ/Ϫ were sensitive to mice exposed to 100 ppm of benzene. Diminution of cellularity was hematotoxicity at lower exposure levels than male NQO1ϩ/ϩ mice, not noted in lower benzene exposure concentration groups. No com- and female NQO1Ϫ/Ϫ mice were susceptible to benzene-induced pound-induced histopathological lesions were noted in spleen, thymus, liver, lung, or lymph node tissues that were evaluated. Assessment of a DNA Damage Response in Mice Exposed to Benzene. When DNA is damaged, p53 is activated to transcribe several genes, such as p21, a cyclin-dependent kinase inhibitor that can lead to cell cycle arrest (33, 34). Previously, our laboratory and others demonstrated that p21 is highly expressed in the bone marrow in response to benzene (27, 35). We quantified bone marrow p21 mRNA levels in both the male and female mice (Fig. 7). In male mice from both genotypes, there was a Ͼ10-fold increase in expression of p21 mRNA levels at 100 ppm of benzene compared with unexposed mice (Fig. 7A); however, no significant differences were seen between the two genotypes. Female NQO1Ϫ/Ϫ mice also had a significant induction of p21 mRNA compared with female NQO1ϩ/ϩ mice (Fig. 7B).

DISCUSSION Benzene has long been recognized as a human health concern, because several groups demonstrated that individuals occupationally exposed to benzene were at a much higher risk of developing leukemias than the normal population (36–39). Whereas the exact metabolites responsible for the carcinogenic, hematotoxic, and genotoxic effects of benzene are uncertain, several reports discussing benzene toxicity have demonstrated that a synergy exists between combina- tions of benzene metabolites including phenol, HQ, catechol, and Fig. 4. Hematology in the peripheral blood of NQO1ϩ/ϩ versus NQO1Ϫ/Ϫ mice after muconaldehyde, another pathway in benzene metabolism (10, 40). exposure to inhaled benzene. A, total numbers of WBCs in the peripheral blood in male NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. B, total numbers of WBCs in the peripheral blood in Our study demonstrates that NQO1 plays a role in benzene detoxifi- female NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. Data represent one experiment and are the cation in mice and supports the need to assess enzymes specific for means (n ϭ 7) per strain, gender, and exposure level; bars, ϮSE. This experiment was ;indicates significant differences from unexposed mice (0 ppm ء .repeated twice benzene metabolism to identify polymorphisms with functional P Ͻ 0.05); ϩ indicates significant differences between NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice consequences. (P Ͻ 0.05). 932

Fig. 6. Image analysis of sternums from NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice from both genders. A, quantitation of total cellularity in sternums of female NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. B, quantitation of total cellularity in sternums of male NQO1ϩ/ϩ and indicates ء .NQO1Ϫ/Ϫ mice. Data represent mean and n ϭ 5 mice per group; bars, ϮSE significant differences from unexposed mice (0 ppm; P Ͻ 0.05); ϩ indicates significant differences between NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice (P Ͻ 0.05).

Fig. 5. Histopathology of NQO1ϩ/ϩ and NQO1Ϫ/Ϫ sternums. A, bone marrow from control (air-exposed) female NQO1ϩ/ϩ mouse depicting normal cellularity of midsternal sternebrae. B, bone marrow from control (air-exposed) female NQO1Ϫ/Ϫ mouse showing increased cellularity compared with A believed to represent spontaneous myeloid hyperplasia associated with NQO1 deficiency. C, hypocellular marrow from sternebrae of female NQO1Ϫ/Ϫ mouse exposed to 100 ppm benzene for 14 days. H&E stained. Bar ϭ 50 ␮M.

hematotoxicity, whereas female NQO1ϩ/ϩ mice were not. The difference in responses between the male NQO1Ϫ/Ϫ and NQO1ϩ/ϩ mice with respect to genotoxicity and hematotoxicity suggests that different metabolites are responsible for DNA damage (not NQO1-dependent) than those responsible for hematotoxicity (NQO1- dependent). Fig. 7. p21 mRNA expression in bone marrow of NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice The shape of the dose-response curve for benzene-induced p21 exposed to benzene. A, quantitative analysis of p21 mRNA levels in male NQO1ϩ/ϩ and Ϫ Ϫ mRNA levels correlated significantly with the shape of the dose- NQO1 / mice. The Y-axis represents the fold change in the p21 expression relative to unexposed (0 ppm) bone marrow cells. B, quantitative analysis of p21 mRNA levels in response for genotoxicity (r ϭ 0.909; P Ͻ 0.0001). p21 mRNA female NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice. Data represent mean (n ϭ 3 for 0 ppm; n ϭ 4 levels in the male NQO1Ϫ/Ϫ and NQO1ϩ/ϩ mice were both for 10 and 50 ppm; n ϭ 6 for 100 ppm) from one experiment; bars, ϮSE. This experiment ;indicates significant differences from unexposed mice (0 ppm ء .Ͼ Ϫ Ϫ was repeated twice highly induced ( 10-fold), whereas female NQO1 / mice had P Ͻ 0.05); ϩ indicates significant differences between NQO1ϩ/ϩ and NQO1Ϫ/Ϫ mice significantly higher p21 levels than female NQO1ϩ/ϩ mice. (P Ͻ 0.05). 933

NQO1 has been shown to stabilize p53 protein in vitro (41), and 8. Smith, M. T. The mechanism of benzene-induced leukemia: a hypothesis and spec- NQO1Ϫ/Ϫ mice express less p53 protein basally than their wild- ulations on the causes of leukemia. Environ. Health Perspect. 104(Suppl. 6): 1219– 1225, 1996. type counterparts (17). In our study, male NQO1Ϫ/Ϫ mice had a 9. Valentine, J. L., Lee, S. S., Seaton, M. J., Asgharian, B., Farris, G., Corton, J. C., slightly lower p21 induction than the NQO1ϩ/ϩ mice, which Gonzalez, F. J., and Medinsky, M. A. Reduction of benzene metabolism and toxicity in mice that lack CYP2E1 expression. Toxicol. Appl. Pharmacol., 141: 205–213, supports these other studies. 1996. In this study, there was a Ͼ10-fold increase in MN-RET in male 10. Ross, D. The role of metabolism and specific metabolites in benzene-induced toxicity: NQO1ϩ/ϩ mice compared with female NQO1ϩ/ϩ mice at the same evidence and issues. J. Toxicol. Environ. Health A, 61: 357–372, 2000. 11. Cadenas, E., Hochstein, P., and Ernster, L. Pro- and antioxidant functions of quinones exposure. In addition, p21 mRNA induction levels were distinctly and quinone reductases in mammalian cells. Adv. Enzymol. Relat. Areas Mol. Biol., different. Other studies have demonstrated gender differences in MN, 65: 97–146, 1992. sister chromatid exchanges, and benzene metabolism (28–31). Our 12. Ross, D., Kepa, J. K., Winski, S. L., Beall, H. D., Anwar, A., and Siegel, D. NAD(P)H:quinone oxidoreductase 1 (NQO1): chemoprotection, bioactivation, data indicate that NQO1 is critical in female mice for detoxifying the gene regulation and genetic polymorphisms. Chem. Biol. Interact., 129: 77–97, benzene metabolites responsible for genotoxicity and hematotoxicity, 2000. 13. Rothman, N., Smith, M. T., Hayes, R. B., Traver, R. D., Hoener, B., Campleman, S., whereas it is critical only in male mice for detoxifying metabolites Li, G. L., Dosemeci, M., Linet, M., Zhang, L., Xi, L., Wacholder, S., Lu, W., Meyer, responsible for hematotoxicity. These findings support the idea that K. B., Titenko-Holland, N., Stewart, J. T., Yin, S., and Ross, D. Benzene poisoning, benzene metabolism in mice is gender-specific and that different a risk factor for hematological malignancy, is associated with the NQO1 609C–ϾT mutation and rapid fractional excretion of chlorzoxazone. Cancer Res., 57: 2839– metabolites or metabolic pathways may be responsible for benzene- 2842, 1997. induced genotoxicity versus hematotoxicity. 14. Smith, M. T., Wang, Y., Kane, E., Rollinson, S., Wiemels, J. L., Roman, E., Roddam, Little research has been conducted in humans to determine whether P., Cartwright, R., and Morgan, G. Low NAD(P)H:quinone oxidoreductase 1 activity is associated with increased risk of acute leukemia in adults. Blood, 97: 1422–1426, gender differences in susceptibility to benzene-induced toxicity exist. 2001. Most of the epidemiological studies done to date pooled data from all 15. Krajinovic, M., Sinnett, H., Richer, C., Labuda, D., and Sinnett, D. Role of NQO1. of the exposure levels because of a small cohort size for women and, MPO and CYP2E1 genetic polymorphisms in the susceptibility to childhood acute lymphoblastic leukemia. Int. J. Cancer, 97: 230–236, 2002. thus, did not analyze the effects of gender at specific exposure levels 16. Radjendirane, V., Joseph, P., Lee, Y. H., Kimura, S., Klein-Szanto, A. J., Gonzalez, (42, 43). None of these epidemiology studies demonstrated a gender F. J., and Jaiswal, A. K. Disruption of the DT diaphorase (NQO1) gene in mice leads to increased menadione toxicity. J. Biol. Chem., 273: 7382–7389, 1998. difference with benzene-induced toxicity. Thus far, there are no 17. Long, D. J., II, Gaikwad, A., Multani, A., Pathak, S., Montgomery, C. A., Gonzalez, published studies assessing gender with respect to NQO1 deficiency F. J., and Jaiswal, A. K. Disruption of the NAD(P)H:quinone oxidoreductase 1 in humans. (NQO1) gene in mice causes myelogenous hyperplasia. Cancer Res., 62: 3030–3036, 2002. In conclusion, this study demonstrates the importance of NQO1 18. Long, D. J., Waikel, R. L., Wang, X. J., Perlaky, L., Roop, D. R., and Jaiswal, with respect to benzene-induced toxicity in mice. Epidemiology A. K. NAD(P)H:quinone oxidoreductase 1 deficiency increases susceptibility to studies have linked NQO1 deficiency and an increased risk of benzo(a)pyrene-induced mouse skin carcinogenesis. Cancer Res., 60: 5913–5915, 2000. developing benzene poisoning and leukemias in humans (13, 14). 19. Peters, J. M., Cattley, R. C., and Gonzalez, F. J. Role of PPAR ␣ in the mechanism The increased sensitivity of NQO1 mice to benzene-induced cyto- of action of the nongenotoxic carcinogen and peroxisome proliferator Wy-14, 643. Carcinogenesis (Lond.), 18: 2029–2033, 1997. toxic and genotoxic effects combined with spontaneously devel- 20. Beck, E., Ludwig, G., Auerswald, E. A., Reiss, B., and Schaller, H. Nucleotide oping myelogenous hyperplasias may make the NQO1Ϫ/Ϫ mice sequence and exact localization of the neomycin phosphotransferase gene from more susceptible to developing leukemias and lymphomas (17). transposon Tn5. Gene, 19: 327–336, 1982. 21. Guengerich, F. P. Analysis and characterization of enzymes. In: A. W. Hayes Whereas no gender differences have yet been ascribed to human (ed.), Principles and Methods of Toxicology, pp. 784–785. New York: Raven NQO1 deficiency, our results in female mice necessitate a more Press, 1989. detailed evaluation of the NQO1 polymorphism in humans. Addi- 22. Reinke, L. A., and Moyer, M. J. p-Nitrophenol hydroxylation. A microsomal oxidation which is highly inducible by ethanol. Drug Metab. Dispos., 13: 548–552, 1985. tional analyses are ongoing with these mice to determine strain and 23. Healy, L. N., Pluta, L. J., James, R. A., Janszen, D. B., Torous, D., French, J. E., and gender differences with respect to benzene metabolism and re- Recio, L. Induction and time-dependent accumulation of micronuclei in peripheral ϩ Ϫ sponse to benzene exposure. blood of transgenic p53 / mice. Tg. AC (v-Ha-ras) and parental wild-type (C57BL/6 and FVB/N) mice exposed to benzene by inhalation. Mutagenesis, 16: 163–168, 2001. 24. MacGregor, J. T., Heddle, J. A., Hite, M., Margolin, B. H., Ramel, C., Salamone, ACKNOWLEDGMENTS M. F., Tice, R. R., and Wild, D. Guidelines for the conduct of micronucleus assays in mammalian bone marrow erythrocytes. Mutat. Res., 189: 103–112, 1987. 25. Dertinger, S. D., Torous, D. K., and Tometsko, K. R. Simple and reliable enumeration We thank Jason Rose, James Mangum, Earl Tewksbury, the CIIT necropsy of micronucleated reticulocytes with a single-laser flow cytometer. Mutat. Res., 371: and histopathology unit, the animal care unit, and the CIIT inhalation unit for 283–292, 1996. all of their help with this study. We also thank Dr. Barbara Kuyper for editorial 26. Serke, S., and Huhn, D. Identification of CD71 (transferrin receptor) expressing review, Drs. David Dorman and Kevin Gaido for critically reviewing the erythrocytes by multiparameter-flow-cytometry (MP-FCM): correlation to the quantitation of reticulocytes as determined by conventional microscopy and by MP-FCM manuscript, and Dennis House for statistical analysis. using a RNA-staining dye. Br. J. Haematol., 81: 432–439, 1992. 27. Boley, S. E., Wong, V. A., French, J. E., and Recio, L. p53 heterozygosity alters the mRNA expression of p53 target genes in the bone marrow in response to inhaled REFERENCES benzene. Toxicol. Sci., 66: 209–215, 2002. 28. Kenyon, E. M., Seeley, M. E., Janszen, D., and Medinsky, M. A. Dose-, route-, and 1. Sanz, G. F., Sanz, M. A., and Vallespi, T. Etiopathogeny, prognosis and therapy of sex-dependent urinary excretion of phenol metabolites in B6C3F1 mice. J. Toxicol. myelodysplastic syndromes. Hematol. Cell Ther., 39: 277–294, 1997. Environ. Health, 44: 219–233, 1995. 2. Hayes, R. B., Yin, S. N., Dosemeci, M., and Linet, M. Benzene and lymphohema- 29. Harper, B. L., Ramanujam, V. M., and Legator, M. S. Micronucleus formation by topoietic malignancies in humans. Am. J. Ind. Med., 40: 117–126, 2001. benzene, cyclophosphamide, benzo(a)pyrene, and benzidine in male, female, preg- 3. Farris, G. M., Robinson, S. N., Gaido, K. W., Wong, B. A., Wong, V. A., Hahn, nant female, and fetal mice. Teratog. Carcinog. Mutagen., 9: 239–252, 1989. W. P., and Shah, R. S. Benzene-induced hematotoxicity and bone marrow compen- 30. Luke, C. A., Tice, R. R., and Drew, R. T. The effect of exposure regimen and duration sation in B6C3F1 mice. Fundam. Appl. Toxicol., 36: 119–129, 1997. on benzene-induced bone marrow damage in mice. II. Strain comparisons involving 4. Cronkite, E. P., Drew, R. T., Inoue, T., Hirabayashi, Y., and Bullis, J. E. Hemato- B6C3F1, C57B1/6 and DBA/2 male mice. Mutat. Res., 203: 273–295, 1988. toxicity and carcinogenicity of inhaled benzene. Environ. Health Perspect., 82: 31. Meyne, J., and Legator, M. S. Sex-related differences in cytogenetic effects of 97–108, 1989. benzene in the bone marrow of Swiss mice. Environ. Mutagen., 2: 43–50, 1980. 5. Ayres, P. H., and Taylor, W. D. Solvents. In: A. H. Hayes (ed.), In Principles and 32. Ward, E., Hornung, R., Morris, J., Rinsky, R., Wild, D., Halperin, W., and Guthrie, Methods of Toxicology, Ed. 2, p. 111. New York: Raven Press Ltd., 1989. W. Risk of low red or white blood cell count related to estimated benzene exposure 6. Runion, H. E., and Scott, L. M. Benzene exposure in the United States 1978–1983: in a rubberworker cohort (1940–1975). Am. J. Ind. Med., 29: 247–257, 1996. an overview. Am. J. Ind. Med., 7: 385–393, 1985. 33. Prives, C., and Hall, P. A. The p53 pathway. J. Pathol., 187: 112–126, 1999. 7. Wallace, L. Major sources of exposure to benzene and other volatile organic chem- 34. Taylor, W. R., and Stark, G. R. Regulation of the G2/M transition by p53. Oncogene, icals. Risk Anal., 10: 59, 1990. 20: 1803–1815, 2001. 934

35. Yoon, B. I., Hirabayashi, Y., Kawasaki, Y., Kodama, Y., Kaneko, T., Kim, D. Y., and 41. Asher, G., Lotem, J., Cohen, B., Sachs, L., and Shaul, Y. Regulation of p53 stability Inoue, T. Mechanism of action of benzene toxicity: cell cycle suppression in hemo- and p53-dependent apoptosis by NADH quinone oxidoreductase 1. Proc. Natl. Acad. poietic progenitor cells (CFU-GM). Exp. Hematol., 29: 278–285, 2001. Sci. USA, 98: 1188–1193, 2001. 36. Aksoy, M., and Erdem, S. Followup study on the mortality and the development of 42. Rothman, N., Smith, M. T., Hayes, R. B., Li, G. L., Irons, R. D., Dosemeci, M., Haas, R., leukemia in 44 pancytopenic patients with chronic exposure to benzene. Blood, 52: Stillman, W. S., Linet, M., Xi, L. Q., Bechtold, W. E., Wiemels, J., Campleman, S., 285–292, 1978. Zhang, L., Quintana, P. J., Titenko-Holland, N., Wang, Y. Z., Lu, W., Kolachana, P., 37. Aksoy, M., Erdem, S., and DinCol, G. Leukemia in shoe-workers exposed chronically Meyer, K. B., and Yin, S. An epidemiologic study of early biologic effects of benzene in to benzene. Blood, 44: 837–841, 1974. Chinese workers, Environ. Health Perspect., 104(Suppl. 6): 1365–1370, 1996. 38. Infante, P. F., Rinsky, R. A., Wagoner, J. K., and Young, R. J. Leukaemia in benzene 43. Yin, S. N., Hayes, R. B., Linet, M. S., Li, G. L., Dosemeci, M., Travis, L. B., Li, workers. Lancet, 2: 76–78, 1977. C. Y., Zhang, Z. N., Li, D. G., Chow, W. H., Wacholder, S., Wang, Y. Z., Jiang, Z. L., 39. Vigliani, E. C., and Forni, A. Benzene and leukemia. Environ. Res., 11: 122–127, Dai, T. R., Zhang, W. Y., Chao, X. J., Ye, P. Z., Kou, Q. R., Zhang, X. C., Lin, X. F., 1976. Meng, J. F., Ding, C. Y., Zho, J. S., and Blot, W. J. A cohort study of cancer among 40. Snyder, R. Overview of the toxicology of benzene. J. Toxicol. Environ. Health A., 61: benzene-exposed workers in China: overall results. Am. J. Ind. Med., 29: 227–235, 339–346, 2000. 1996.

935

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2003 American Association for Cancer Research. Genetic Susceptibility to Benzene-induced Toxicity: Role of NADPH: Quinone Oxidoreductase-1

Alison K. Bauer, Brenda Faiola, Diane J. Abernethy, et al.

Cancer Res 2003;63:929-935.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/63/5/929

Cited articles This article cites 39 articles, 9 of which you can access for free at: http://cancerres.aacrjournals.org/content/63/5/929.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/63/5/929.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/63/5/929. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.