J. Eur. Orch. 50 (x): 501 – 518. 2018.

Mikael Hedrén, Richard Lorenz and David Ståhlberg

Evidence for bidirectional hybridization between Gymnadenia and Nigritella

Keywords Orchidaceae; Gymnigritella, Gymnadenia, Nigritella, Gymnigritella runei, Gymnadenia odoratissima, Gymnadenia conopsea, Nigritella rhellicani; bidirectional hybridization, pollination; Molecular analysis, minisatellite repeat region, trnL intron; flora of Härjedalen, Jämtland, Lycksele Lappmark, Sweden, Carinthia, Austria, South Tyrol, Trentino, Italy.

Summary Hedrén, M., Lorenz, R. & D. Ståhlberg (2018): Evidence for bidirectional hybridization between Gymnadenia and Nigritella.- J. Eur. Orch. 50 (x): 501- 518. Despite morphological divergence, the two orchid genera Gymnadenia and Nigritella are closely related and hybrids are often encountered at places where members of the two genera grow together. On basis of pollination studies, it has been suggested that members of Nigritella should have served as pollen parent to these hybrids. Hybridization does not go beyond primary hybrid formation, but one of the hybrids, Gymnigritella runei, is recognized as a separate species since the hybrid genotype is maintained by apomixis and it is reproducing independently of the parents. Surprisingly, a recent molecular analysis of G. runei demonstrated that this hybrid evolved by the merger of an egg cell from Nigritella and a microgamete from Gymnadenia, contrary to what has been predicted from pollination studies. Here, we conducted an extended study in which we analyzed two additional hybrid combinations known from the Alps and which each has originated repeatedly at different sites: G. conopsea × N. rhellicani, and G. odoratissima × N. rhellicani. We show that each hybrid combination has originated alternatively from Nigritella and Gymnadenia as egg parent. Our results call for renewed studies on the pollination biology of Nigritella and Gymnadenia, in particular on the movement of insects between plants of the different genera and their potential function as pollen vectors.

Journal Europäischer Orchideen 50 (x): 2018. 501 Zusammenfassung Hedrén, M., Lorenz, R. & D. Ståhlberg (2018): Nachweis bidirektionaler Hybridisierung zwischen Gymnadenia und Nigritella.- J. Eur. Orch. 50 (x): 501-518. Trotz ausgeprägter morphologischer Unterschiede sind die zwei Orchideengattungen Gymnadenia und Nigritella sehr nah verwandt, bei gemeinsamen Vorkommen von Mitgliedern der beiden Gattungen werden häufig Hybriden angetroffen. Untersuchungen ihrer Bestäubung führten zur Annahme, dass bei der Bildung dieser Hybriden der Nigritella-Partner als Pollen-Elter fungiert. Auch wenn die Hybridisierung innerhalb dieser beiden Gattungen nicht über die Bildung von Primärhybriden hinausgeht, wurde einer dieser Hybriden, Gymnigritella runei, als eigenständige Art erkannt, dessen Genotyp durch Apomixis erhalten bleibt und der sich damit unabhängig von seinen Eltern fortpflanzt.

Bei Orchideen übertragen bekanntlich die Eizellen das Plastidengenom auf die Nachkommen. Wenn bei der Hybridisierung zwischen Gymnadenia- und Nigritella-Arten der Nigritella-Partner der Pollenspender ist, muß der Gymnadenia-Elter die Eizelle zur Verfügung stellen. Gymnadenia und Nigritella unterscheiden sich in der Region repetitiver DNA-Elemente im trnL intron des Plastidengenoms in der Anzahl Wiederholungen ganz deutlich, so treten hier bei Nigritella keine, bei Gymnadenia 2-3 Wiederholungen auf. Über die Untersuchung der entsprechenden Plastidenmarker kann deshalb Vater und Mutter der durch Hybriddierung entstandenen Pflanzen eindeutig der jeweils zutreffenden Gattung zugeordnet werden.

Überraschenderweise zeigte nun eine kürzlich durchgeführte Molekularanalyse von G. runei, dass sich diese Hybridsippe, entgegen den auf Bestäubungsstudien basierenden Annahmen, aus der Verschmelzung einer Eizelle von Nigritella und einem Mikrogameten von Gymnadenia entwickelt hat. Hier berichten wir über zusätzliche Untersuchungen der zwei aus dem Alpenraum wohlbekannten Hybriden G. conopsea × N. rhellicani und G. odoratissima × N. rhellicani, die dafür von verschiedenen Wuchsorten mehrfach bemustert wurden.

Die Befunde zeigen, dass jede der beiden Hybridkombinationen alternativ mit Nigritella oder Gymnadenia als eispendendem Elter gebildet werden kann. Von 13 analysierten Pflanzen der Hybride G. conopsea × N. rhellicani zeigten 12 für Gymnadenia charakteristische repetitive Elemente und hatten demzufolge Nigritella als Pollen-Spender und G. conopsea als Eispender, während bei einer Pflanze die Eltern in umgekehrtem Verhältnis zu dessen Entstehung beitrugen. Bei den 16 Exemplaren der Hybride G. odoratissima ×

502 Journal Europäischer Orchideen 50 (x): 2018. N. rhellicani hatten 11 N. rhellicani und 5 G. odoratissima als Eispender. Diese Verhältnisse bestätigen die erschwerte Übertragung der Pollen von einer langspornigen Gymnadenia auf Nigritella, während zwischen den kurzspornigen Arten der beiden Gattungen der Pollentransfer leichter in beiden Richtungen möglich ist. So erscheinen vertiefende Untersuchungen der Bestäubungsbiologie von Nigritella und Gymnadenia erforderlich; insbesondere könnten Studien der Bewegungsmuster von Insekten zwischen Pflanzen dieser beiden Gattungen ihre potentielle Funktion für die Pollenübertragung klären.

* * *

1. Introduction

In the Alps, diploid sexual members of Nigritella, usually N. rhellicani (Figs. 8-9), often grow in sympatry with members of Gymnadenia, either G. conopsea (Figs. 10-11) or G. odoratissima (Figs. 12-13). The two genera are closely related (PRIDGEON et al. 1997) and hybrids between them are sometimes encountered. However, the hybrids never form any major parts of the mixed populations. Although hybrids obviously could be produced, there must be some mechanism that normally prevents cross-pollination and hybrid formation. It has been suggested that one important factor for preventing hybridization may be differences in the pollination system (VÖTH 2000).

Gymnadenia conopsea is visited by a large number of insects, predominantly Lepidoptera (FÆGRI & VAN DER PIJL 1979; PROCTOR et al. 1996; VÖTH 1999; VÖTH 2000; CLAESSENS & KLEYNEN 2011). Insects observed to carry pollinaria include members of the families Pieridae, Nymphalidae, Lycaenidae, Hesperidae, and Zygaenidae (mainly day-active, Fig. 11)) and Sphingidae, Noctuidae, and Geometridae (mainly night-active). Other visitors include members of Hymenoptera and Diptera (CLAESSENS & KLEYNEN 2016). The relative importance of these groups as pollinators may differ between sites, and between day and night (MEYER et al. 2007; SLETVOLD et al. 2012; CHAPURLAT et al. 2015). [Some of the observations on visitors of G. conopsea may in fact consider G. conopsea subsp. densiflora (= G. densiflora). Although these taxa differ in the composition of floral scents (GUPTA et al. 2014), it is not clear to which degree pollinators discriminate between them (JERSÁKOVÁ et al. 2010).]

Journal Europäischer Orchideen 50 (x): 2018. 503 Likewise, visitors of G. odoratissima also include various Lepidoptera, but other groups can be important pollinators in addition (VÖTH 2000; CLAESSENS & KLEYNEN 2011, 2016; SUN et al. 2014). Insects observed to carry pollinaria include members of the Lepidopteran families Zygaenidae (day-active), and Noctuidae, Geomitridae, and Pyralidae (night-active), and Lygaeus among the Hemiptera-Lygaeidae. Additionally, observations of visitation suggest that flies within Diptera-Empididae are important pollinators in mountain habitats (SUN et al. 2014).

Finally, visitors of Nigritella include various Lepidoptera as well as members of Coleoptera, Hymenoptera and Diptera (FÆGRI & VAN DER PIJL 1979; VÖTH 2000; CLAESSENS & KLEYNEN 2011, 2016). Insects observed to carry pollinaria from Nigritella include the Lepidopteran families Pieridae, Nymphalidae, Satyridae and Zygaenidae (Figs. 1-3; mainly day-active), and Noctuidae, Geomitridae and Pyralidae (night-active), as well as bees, Hymenoptera and flies, Diptera (VÖTH 2000; CLAESSENS & KLEYNEN 2011).

Although members of Lepidoptera obviously act as important pollinators in all three orchids, it appears that pollinator compositions differ between them (VÖTH 2000; SUN et al. 2014; SUN et al. 2015). In agreement with the difference in spur length between the three orchids, it looks as though G. conopsea is mostly pollinated by Lepidoptera with long probosces, G. odoratissima by Lepidoptera with medium-sized probosces and Nigritella by Lepidoptera with medium-sized to short probosces (cf. SCHIESTL & SCHLÜTER 2009). Among members of Gymnadenia, differences in scent also contribute to differentiation of pollinator faunas (HUBER et al. 2005; SCHIESTL & SCHLÜTER 2009; GUPTA et al. 2014). The appearance of intergeneric hybrids still demonstrates that the same insects occasionally transfer pollen between plants of different genera. If so, pollinaria are expected to attach at different parts of the proboscis, depending on the depth of the spur. An insect sucking nectar from the long spur of G. conopsea is likely to get pollinaria attached to the proximal part of the proboscis, near the head, whereas the pollinaria would get attached to the distal part of the probosces if it visits a Nigritella flower with a short spur (Fig. 3). If the insect has already visited a Nigritella plant when it comes to a Gymnadenia flower, then pollen from Nigritella may be deposited onto the stigma of the Gymnadenia plant. On the other hand, if the insect is already carrying pollen from a Gymnadenia plant when it visits a flower of Nigritella, then the pollen from Gymnadenia is still not likely to touch the stigma of the Gymnadenia flower. Pollen should therefore be transferred in the direction of Nigritella to Gymnadenia whenever hybrids are formed, but not the other way around (VÖTH 2000; CLAESSENS & KLEYNEN 2011).

504 Journal Europäischer Orchideen 50 (x): 2018.

Figs. 1-3: Nigritella rhellicani (red coloured variant) visted by Zygaena purpuralis (Noctuidae), Grauner Berg (2260 m asl), Südtirol, 10.7.2017 (phot. RL). The butterfly inspected several single flowers of the one spike for two minutes seven seconds searching for nectar, while three pollinaria couples were attached near the apex of its proboscis, i.e. in a position suited for pollination of other Nigritella as well as Gymnadenia flowers.

Journal Europäischer Orchideen 50 (x): 2018. 505

Fig. 4: Gym. conopsea, Ljungdalen, Härjedalen, Sweden, 20.7.2008. Fig. 5: Nig. nigra nigra, Marieby, Jämtland, Sweden, 18.6.2008. Fig. 6-7: Gymnigritella runei, Rönäs, Rödingsnäset, Lycksele Lappmark, Sweden, 18.7.2008. (RL)

506 Journal Europäischer Orchideen 50 (x): 2018. In orchids, it is the egg cell that contributes the plastid genome to the offspring (CORRIVEAU & COLEMAN 1988; CAFASSO et al. 2005). If Nigritella is the pollen parent to hybrid offspring, then Gymnadenia must be the parent providing the egg cell. Accordingly, the parent that contributed the egg cell could be traced by using molecular markers from the plastid genome.

In a previous study (HEDRÉN et al., in press), we used a plastid markers to trace the maternal origin of the Scandinavian endemic Gymnigritella runei (Figs. 6-7) , which is an apomictic species formed by hybridization between Gymnadenia conopsea (Fig. 4) and Nigritella nigra subsp. nigra (TEPPNER & KLEIN 1989). On basis of nuclear data, it has already been demonstrated that this species must have originated in a single step, by the combination of an unreduced (triploid) gamete from the likewise apomictic N. nigra subsp. nigra (Fig. 5) and a normal, reduced, haploid gamete from the sexual diploid G. conopsea (HEDRÉN et al. 2000). Surprisingly, we found that the Nigritella parent must have contributed the egg cell to this combination (and accordingly G. conopsea the pollen), contrary to what has been proposed from pollination studies.

Since Gymnigritella runei must have evolved on a single occasion, and only represents a single instance of hybridization between Gymnadenia and Nigritella, it may not be representative for the general direction of hybridization. We therefore conducted the present study in which we analysed several additional hybrids between sexual members of the two genera collected in the Alps. The material we have analysed here obviously consists of primary hybrids. Although some of the hybrids were sampled from the same locality, we consider it unlikely that they should be the result of the same hybridization event, as they were spread out and not grouped within the sampling sites. Accordingly, we consider that each hybrid has originated independently of one another.

All samples were analysed for a repeat region located in the trnL intron in the plastid genome (BATEMAN 2001). As shown by BATEMAN (2001) and confirmed by extended screening in HEDRÉN et al. (in press), Nigritella and Gymnadenia are completely separated in the numbers of repeats at this region.

2. Methods

2.1 Sampled material

The material sampled for this study was collected on different occasions, in connection with more comprehensive sampling of members of Nigritella for

Journal Europäischer Orchideen 50 (x): 2018. 507 biosystematics studies. Either parts of inflorescences or parts of leaves were sampled. The material was dried in silica gel (CHASE & HILLS 1991), and stored at room temperature until DNA extraction. DNA was extracted according to the 2× CTAB procedure (DOYLE & DOYLE 1990). A total of 78 samples were analysed (Table 1).

Table 1. Variation in the number of 8 bp 5´-ATAGTATA repeats in the plastid trnL intron in the investigated material of Gymnadenia conopsea, G. odoratissima, Nigritella rhellicani and their intergeneric hybrids. Entries in the four columns to the right give the number of plants with a particular num- ber of repeats for each taxon and locality. Localities: Heiligenbachalm, Kärn- ten (AT), 46°56'12''N 13°44'33''E, 1930 m; Lungiarü, Südtirol (IT), 46°39'34''N 11°50'29''E, 2180 m; Monte Bondone, Trentino (IT), 46°00'41''N 11°01'30''E, 1780 m; Puflatsch, Südtirol (IT), 46°33'23''N 11°36'44''E, 2120 m; Dürrenstein, Südtirol (IT), 46°38'44''N 12°12'12''E, 2200 m.

Taxon/hybrid combination Locality # ATAGTATA repeats 0× 1× 2× 3×

G. conopsea Heiligenbachalm 10

G. odoratissima Heiligenbachalm 7 2

G. conopsea × N. rhellicani Heiligenbachalm 9 1 Lungiarü 1 Monte Bondone 1 Puflatsch 1

G. odoratissima × N. rhellicani Heiligenbachalm 4 4 1 Dürrenstein 7

N. rhellicani Puflatsch 30

2.2 Molecular analysis

To characterize the plastid genome of the extracted material, we analyzed a minisatellite repeat region in the trnL intron of the plastid genome at which Gymnadenia and Nigritella are apparently fixed for different numbers of repeats of an 8 bp long fragment 5´-ATAGTATA-3´ (BATEMAN 2001).

508 Journal Europäischer Orchideen 50 (x): 2018.

Fig. 8-9: Nigritella Fig. 10-11: Gym.conopsea Fig. 12-13: Gymnadenia rhellicani; var. alpina; fig. 10: odoratissima var. idae, fig. 8: Lungiarü, Südtirol, Dürrenstein, 17.7.2013, Grödner Joch, Südtirol, 19.7.2006; fig. 9: Seiser- Südtirol; fig. 11: mit Z. pur- 14.7.2012 (RL). alm, Südtirol, 11.7.2012 puralis, Castrinalm, 1850m, (phot. RL). Trentino, 12.7.2009 (RL)

Journal Europäischer Orchideen 50 (x): 2018. 509

Fig. 14: Gymnadenia conopsea var. Fig. 15: Gymnadenia odoratissima alpina × Nigr. rhellicani, Lungiarü, var. idae × Nigr. rhellicani, Brenta, Südtirol, 8.7.2009 (RL). Trentino, 28.7.2013; (RL).

510 Journal Europäischer Orchideen 50 (x): 2018. Enlarged studies (HEDRÉN et al, in press) have further corroborated the findings of Bateman (2001). All members of Nigritella are lacking this repeat, whereas members of Gymnadenia have (1−)2−4 repeats. We estimated the numbers of repeats by amplifying the repeat region by pcr and determining the size in base-pairs of the amplified fragment by separation on acrylamide gels.

PCR reactions were performed in a reaction volume of 6.4 μL containing

4.4 μL deionised and sterilised H2O, 0.66 μL 10 × reaction buffer (100 mM Tris-HCl pH 8.3, 500 mM KCl, 15 mM MgCl2), 0.56 μL dNTPs (2.5 mM of each nucleotide), 0.25 μL Cy5-labelled primer (10 pg/μL), 0.1 μL unla- belled complementary primer (25 pmol/μL), 0.03 μL AmpliTaq polymerase (5 u/μL; Applied Biosystems), and 0.6 μL template DNA (14 ng/μL). The primers used to amplify this fragment were Cy5trnLF7, 5´− CATAGCAAATGATTCATCGC and trnLR7, 5´− TAGGGGGTTTCTATAGAACC (HEDRÉN et al. 2007).

The trnL repeat region was amplified by an initial denaturing 94 °C for 3 minutes, followed by 36 cycles of 94 °C for 30 seconds, annealing at 55.2 °C for 30 seconds, extension at 72 °C for 45 seconds, and concluded by a final extension period at 72 °C for 10 minutes.

The PCR products from each reaction were mixed with 8.5 μl formamide containing appropriate size markers to enable exact size determination of the amplified fragments. The PCR products were then heated at 94°C for ca 20 minutes before loading onto acrylamide gels and separated by size on an ALFexpress II automated sequencer (Amersham Pharmacia Biotech). Fragment sizes were determined by using ALFwin™ fragment analyser 1.03.01 software (Amersham Pharmacia Biotech).

3. Results

The number of 8 bp ATAGTATA repeats in the maternal species and their hybrids is reported in Table 1. None of the 30 plants analyzed of N. rhellicani had any 8 bp ATAGTATA repeat. All ten samples of G. conopsea had two repeats, whereas the nine samples of G. odoratissima had either two or three repeats. Of the thirteen plants analyzed from the hybrid G. conopsea × N. rhellicani (Figs. 14, 16-19), one had no ATAGTATA repeat, whereas twelve had either two or three repeats. Of the sixteen plants analyzed from the hybrid G. odoratissima × N. rhellicani (Figs. 15, 20-24), eleven had no ATAGTATA repeat, whereas five had either two or three repeats.

Journal Europäischer Orchideen 50 (x): 2018. 511 4. Discussion

We found a perfect match between the numbers of ATAGTATA repeats and parental genus, Gymnadenia with two or three repeats and Nigritella with no repeat. Although we only studied a restricted number of samples of the parental species for the present study, collected at the same sites as the hybrids, this result fully agrees with results of a much larger sample reported in HEDRÉN et al. (in press) and which include material from many additional sites.

Given that the egg parent in orchids invariably contributes the plastid genome to the embryo (CORRIVEAU & COLEMAN 1988; CAFASSO et al. 2005), hybrids with no ATAGTATA repeat must have had N. rhellicani as egg parent, whereas hybrids with two or three repeats must have had G. conopsea or G. odoratissima as egg parent. Accordingly, twelve of the analyzed hybrids between G. conopsea and N. rhellicani had G. conopsea as egg parent and one had N. rhellicani as egg parent. This result is in agreement with the prediction that pollen from Nigritella should be much more easily transferred to the stigma of a Gymnadenia plant than the other way around (VÖTH 2000). However, the finding that one hybrid had Nigritella as egg parent shows that a unilateral pattern of pollen transfer is not absolute in this hybrid combination.

Of the sixteen plants analyzed from the hybrid G. odoratissima × N. rhellicani, eleven had N. rhellicani as egg parent whereas five had G. odoratissima as egg parent. This observation is clearly different from pattern indicated from pollination studies, according to which hybrids should exclusively have been formed by Nigritella acting as pollen parent (VÖTH 2000). The finding that more than half of these hybrids has Nigritella as egg parent could possibly be due to the fact that G. odoratissima has a much shorter spur than G. conopsea, thereby approaching the short spur of Nigritella in length. Insects visiting both genera would get pollinaria deposited relatively close to each other on the proboscis, and pollen from G. odoratissima would thus be more easily deposited on the stigma of Nigritella than pollen from G. conopsea.

We must also consider the possibility that other groups of insects than Lepidoptera are capable of transferring pollen between the orchids (BABORKA 1994). Some of the legitimate pollinators of Nigritella with short probosces may also haphazardly visit other plants, including Gymnadenia, and may bring back pollinaria that have randomly become attached to tarsi or other parts of the body to which they are not normally attached. Nigritella have inflorescences of the so-called brush-blossom type (FÆGRI & VAN DER PIJL 1979) in which pollinator crawl around when searching for reward. Some of

512 Journal Europäischer Orchideen 50 (x): 2018. the normal pollinators of Nigritella may behave in a similar fashion when visiting other inflorescences such as those of Gymnadenia, which are not of the brush-blossom type. Similarly, yet other insects may visit flowers for shelter, as mating ground etc., and may bring with them foreign pollen from other flowers they have visited. Our results call for renewed observations of the movements of tentative pollinators on Gymnadenia and Nigritella, and the potential for intergeneric pollen carry-over. We need to learn whether hybrids with Nigritella as egg parents have originated as a result of pollen transfer by (1) long-tongued butterflies occasionally carrying Gymnadenia pollinaria at a distal position of their probosces, or (2) by short-tongued microlepidoptera and other insects occasionally visiting Gymnadenia and carrying pollen to the stigma of Nigritella, or (3) by some other underestimated process, perhaps random visits by insects just accidentally carrying pollen between members of the two genera.

It may not always be immediately evident which parental taxa that have produced the Gymnadenia × Nigritella hybrids found at sites such as Heligenbachalm where more than one taxon from either of the parental genera grow together. Of the two Gymnadenia species analyzed here, we found that G. conopsea had no more than two 8 bp repeats, whereas G. odoratissima had two or three repeats. Similarly, in a more comprehensive study (HEDRÉN et al., in press), we found no G. conopsea accession with more than two repeats, whereas G. odoratissima had up to four repeats. One of the hybrids from Heiligenbachalm that was identified as G. conopsea × N. rhellicani when sampled was found to have three repeats. This plants should therefore be reclassified as the hybrid between G. odoratissima × N. rhellicani.

Apart from hybrids between Gymnadenia and diploid members of Nigritella, several additional hybrid combination involving polyploid members of Nigritella have been reported. Some of these are critically discussed in GERBAUD & SCHMID (1999). To our knowledge, the only one of those that has been analyzed by molecular methods is G. runei. This hybrid is much closer to the Nigritella parent than to the Gymnadenia parent in morphology, a condition explained by the finding that it includes three sets of chromosomes from Nigritella and only one set from Gymnadenia (TEPPNER & KLEIN 1989; HEDRÉN et al. 2000). Genome compositions in hybrids stemming other polyploid members of Nigritella are not known, but deviations from a

1:1 contribution are nevertheless expected.

In any case, the Nigritella parent contributes more to the hybrid genome than the Gymnadenia parent, and if only genome contributions were decisive, we would expect the hybrid to be more closely similar to a Nigritella than to a

Journal Europäischer Orchideen 50 (x): 2018. 513 Gymnadenia. However, it is well known that hybrids that originate repeatedly and independently from the same parental combination may look quite different from each other (e.g., in Dactylorhiza; HEDRÉN 1996), so we still cannot trace the exact origin of a particular Gymnadenia x Nigritella hybrid on basis of its morphology. Another factor contributing to this problem is the finding that many of the G. conopsea s.s. plants found in the Alps and other Central European mountain regions are in the fact autotetraploid (TRÁVNÍČEK et al. 2012). Such plants may give rise to hybrids with a stronger contribution of the Gymnadenia genome, and it is possible that some of the plants discussed as backcrosses between primary hybrids and G. conopsea by GERBAUD & SCHMID (2001) may in fact belong to this category.

Acknowledgements

We are much indebted to the late Dr. Erich Klein for guidance at Heiligenbachalm. We are grateful to Dr. Peter Huemer and Dr. Gerhard Tarmann of Tiroler Landesmuseum Ferdinandeum at Innsbruck respectively for determination of visitors of Nigritella rhellicani from several sites in Südtirol.

References

BABORKA, M. (1994): Bestäuber von Nigritellen sowie Beschreibung eines Bastards zwischen Nigritella widderi und Gymnadenia.- J. Eur. Orch. 26: 88–93. BATEMAN, R.M. (2001): Evolution and classification of European orchids: insights from molecular and morphological characters.- J. Eur. Orch. 33: 33– 119. CAFASSO, D., WIDMER, A. & S. COZZOLINO (2005): Chloroplast DNA inheritance in the orchid Anacamptis palustris using single-seed polymerase chain reaction.- J. Hered 96: 66–70. CHAPURLAT, E., ÅGREN, J. & N. SLETVOLD (2015): Spatial variation in pollinator- mediated selection on phenology, floral display and spur length in the orchid Gymnadenia conopsea.- New Phytologist 208: 1264–1275. CHASE, M.W. & H.G. HILLS (1991): Silica gel: an ideal material for field preservation of leaf samples for DNA studies.- Taxon 40: 215–220. CLAESSENS, J. & J. KLEYNEN (2011): The flower of the European orchid. Form and function.- Privately published. CLAESSENS, J. & J. KLEYNEN (2016): The flower of the European orchid. Form and function. Appendix 1: Pollinators – additions 2016.- Available online at : http://media.nhbs.com/errata/220415_1.pdf

514 Journal Europäischer Orchideen 50 (x): 2018.

Fig. 16-17: Gymnadenia conopsea var. alpina× Nigritella rhellicani, Seiseralm, Südtirol, 16.7.2013 (MH, RL).

Abb. 18: Gym. conopsea × N. rhellicani, Fig. 19: Gym. conopsea × N. rhellicani, Seiseralm, 18.7.2013 (RL). Seiseralm, 23.7.2004 (RL).

Journal Europäischer Orchideen 50 (x): 2018. 515

Fig. 20-24: Gymnadenia odoratissima var. idae × Nigritella rhellicani, Südtirol. Fig. 20: Grödner Joch, 14.7.2012 (RL); fig. 21: Dürrenstein, 17.7.2013 (phot. MH); fig. 16: [pale] Fanes (RL), 20.7.2006; fig. 17: [pale] Franzenshöhe, 12.7.2017; fig. 18: [rose-coloured] Kolfuschg, 22.7.2004.

516 Journal Europäischer Orchideen 50 (x): 2018. CORRIVEAU, J.L. & A.W. COLEMAN (1988): Rapid screening method to detect potential biparental inheritance of plastid DNA and results for over 200 angiosperm species.- Am. J. Bot. 75: 1443–1458. DOYLE, J.J. & J.H. DOYLE (1990): Isolation of plant DNA from fresh tissue.- Focus 12: 13–15. FÆGRI, K. & L. VAN DER PIJL (1979): Pollination Ecology, 3rd ed.- Pergamon Press. GERBAUD, O. & W. SCHMID (1999): Die Hybriden der Gattungen Nigritella und/oder Pseudorchis [Les hybrids des genres Nigritella et/ou Pseudorchis].- Cahiers de la Société Française d´Orchidophilie 5: 1–132. GUPTA, A.K., SCHAUVINHOLD, I., PICHERSKY, E. & F.P. SCHIESTL (2014): Eugenol synthase genes in floral scent variation in Gymnadenia species.- Functional & Integrative Genomics 14: 779–788. HEDRÉN, M. (1996): Genetic differentiation, polypoidization and hybridization in Northern European Dactylorhiza (Orchidaceae): Evidence from allozyme markers.- Plant Systematics and Evolution 201: 31–55. HEDRÉN, M., KLEIN, E. & H. TEPPNER (2000): Evolution of polyploids in the European orchid genus Nigritella. Evidence from allozyme data.- Phyton (Austria) 40: 239–275. HEDRÉN, M., NORDSTRÖM, S., PERSSON, H., PEDERSEN, H.Æ. & S. HANSSON (2007): Patterns of polyploid evolution in Greek Dactylorhiza (Orchidaceae) as revealed by allozymes, AFLPs and plastid DNA data.- Amer. J. Bot. 94: 1205–1218. HEDRÉN, M., LORENZ, R., TEPPNER, H., DOLINAR, B., GIOTTA, C., GRIEBL, N., HANSSON, S., HEIDTKE, U., KLEIN, E., PERAZZA, G., STÅHLBERG, D. & B. SURINA: Evolution and systematics of polyploid Nigritella (Orchidaceae).- Nord. J. Bot. [in press]. HUBER, F.K, KAISER, R., SAUTER, W. & F.P. SCHIESTL (2005): Floral scent emission and pollinator attraction in two species of Gymnadenia (Orchidaceae).- Oecologia 142: 564–575. JERSÁKOVÁ, J., CASTRO, S., SONK, N., MILCHREIT, K., SCHÖDERBAUEROVÁ, I., TOLASCH, T. & S. DÖTTERL (2010): Absence of pollinator-mediated premating barriers in mixed-ploidy populations of Gymnadenia conopsea s.l.- Evol. Ecol. 24: 1199–1218. MEYER, B, KRÖGER, J. & I. STEFFAN-DEWENTER (2007): Contribution of diurnal and nocturnal pollinators to the reproductive success of the orchid species Gymnadenia conopsea.- Entomologia Generalis 30: 299–300. PRIDGEON, A.M., BATEMAN, R.M., COX, A.V., HAPEMAN J.R. & M.W. CHASE (1997): Phylogenetics of subtribe Orchidinae (Orchidoideae, Orchidaceae) based on nuclear ITS sequences. 1. Intergeneric relationships and polyphyly of Orchis sensu lato.- Lindleyana 12: 89–109. PROCTOR, M.C.F., YEO, P & A. LACK (1996): The natural history of pollination.- Timber Press. SCHIESTL, F.P. & P.M. SCHLÜTER (2009): Floral isolation, specialized pollination,

Journal Europäischer Orchideen 50 (x): 2018. 517 and pollinator behavior in orchids.- Annual Review of Entomology 54: 425–446. SLETVOLD, N., TRUNSCHKE, J., WIMMERGREN, C. & J. ÅGREN (2012): Separating selection by diurnal and nocturnal pollinators on floral display and spur length in Gymnadenia conopsea.- Ecology 93: 1880–1891. SUN, M., GROSS, K. & F.P. SCHIESTL (2014): Floral adaptation to local pollinator guilds in a terrestrial orchid.- Ann. Bot. 113: 289–300. SUN, M., SCHLÜTER, P.M., GROSS, K. & F.P. SCHIESTL (2015): Floral isolation is the major reproductive barrier between a pair of rewarding orchid sister species.- J. Evol. Biol. 28: 117–129. TEPPNER, H. & E. KLEIN (1989): Gymnigritella runei spec. nova (Orchidaceae- Orchideae) aus Schweden.- Phyton (Austria) 29: 161–173. TRÁVNÍČEK, P., JERSÁKOVÁ, J., KUBÁTOVÁ, B., KREJČÍKOVÁ, J., BATEMAN, R.M., LUČANOVÁ, M. KRAJNÍKOVÁ, E., TĔŠITELOVÁ, T., ŠTÍPKOVÁ, Z., AMARDEILH, J.-P-, BRZOSKO, E., JERMAKOWICZ, E., CABANNE, O., DURKA, W., EFIMOV, P., HEDRÉN, M., HERMOSILLA, C.E., KREUTZ, K., KULL, T., TALI, K., MARCHAND, O., REY, M., SCHIESTL, F.P., ČURN, V. & J. SUDA (2012): Minority cytotypes in European populations of the Gymnadenia conopsea complex (Orchidaceae) greatly increase intraspecific and intrapopulation diversity.- Annals of Botany 110: 977–986. VÖTH, W. (1999): Lebensgeschichte und Bestäuber der Orchideen am Beispiel von Niederösterreich.- Stapfia, 65: 1–257. VÖTH, W. (2000): Gymnadenia, Nigritella und ihre Bestäuber.- J. Eur. Orch. 32: 547–573.

Authors addresses

Mikael Hedrén Dept of Biology, Lund University Sölvegatan 37 SE-223 62 Lund, Sweden e-mail: mikael.hedren[at]biol.lu.se

Richard Lorenz AHO Baden-Württemberg Leibnizstrasse 1 D-69459 Weinheim, Germany e-mail: Lorenz[at]orchids.de

David Ståhlberg Swedish Board of Agriculture 551 82 Jönköping, Sweden e-mail: david.stahlberg[at]jordbruksverket.se

518 Journal Europäischer Orchideen 50 (x): 2018.