DOCSLIB.ORG

Download Validation Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Download Validation Data PrimePCR™Assay Validation Report Gene Information Gene Name zinc finger with KRAB and SCAN domains 5 Gene Symbol ZKSCAN5 Organism Human Gene Summary This gene encodes a zinc finger protein of the Kruppel family. The protein contains a SCAN box and a KRAB A domain. A similar protein in mouse is differentially expressed in spermatogenesis. Two alternatively spliced transcript variants differing only in the 5' UTR have been described. Additional variants have been found but their full-length sequences have not been determined. Gene Aliases FLJ39233, KIAA1015, MGC33710, ZFP95, ZNF914 RefSeq Accession No. NC_000007.13, NT_007933.15 UniGene ID Hs.110839 Ensembl Gene ID ENSG00000196652 Entrez Gene ID 23660 Assay Information Unique Assay ID qHsaCID0022766 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000326775, ENST00000451158, ENST00000394170, ENST00000537357 Amplicon Context Sequence AGGCCCTATGGCTGCAATGAGTGTGGGAAGAACTTCGGTCGCCATTCGCATCTG ATCGAACACCTAAAACGCCACTTCAGGGAGAAATCCCAGAGATGCAGTGACAAA AGAAGTAAGAACACAAAATTAAGTGTTAAGAAGAAAATTTCAGAATATTCAGAAGC AGACATGGAACTAT Amplicon Length (bp) 148 Chromosome Location 7:99123945-99128811 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 102 R2 0.9985 cDNA Cq 21.26 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 34.61 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report ZKSCAN5, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 3/5 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. Amplicon Context Sequence This is the amplicon sequence with additional base pairs added to the beginning and/or end of the sequence. This is in accordance with the minimum information for the publication of real-time quantitative PCR experiments (MIQE) guidelines. For details, please refer to the following publication, "Primer Sequence Disclosure: A Clarification of the MIQE Guidelines" (Bustin et al 2011). Chromosome Location This is the chromosomal location of the amplicon context sequence within the genome. Assay Design Exonic: Primers sit within the same exon in the mRNA transcript and can potentially co-amplify genomic DNA. If performing gene expression analysis, it is suggested that the samples be treated with a DNase to eliminate potential unwanted signal from contaminating genomic DNA. Exon-exon junction: One primer sits on an exon-exon junction in mRNA. When performing gene expression analysis, this design approach will prevent unwanted signal from contaminating genomic DNA. Intron-spanning: Primers sit within different exons while spanning a large intron in the mRNA (intron is greater than 750bp). When performing gene expression analysis, this design approach should limit potential unwanted signal from contaminating genomic DNA. Small intron-spanning: Primers sit within different exons with a short intron in between (intron is smaller than 750bp). Small introns may not prevent unwanted signal from contaminating genomic DNA. Efficiency Assay efficiency was determined using a seven-point standard curve from 20 copies to 20 million copies. While an efficiency of 100% represents a perfect doubling of template at every cycle and is ideal, typical ranges of good assay efficiency are between 90-110%. For difficult targets, assay efficiency outside of this range are accepted and reported accordingly. R2 The R2 represents the linearity of the standard curve and how well the standard curve data points fit the linear regression line. Acceptable values are >0.98. Page 4/5 PrimePCR™Assay Validation Report cDNA Cq Cq value obtained from 25ng of cDNA transcribed from universal RNA when performing wet-lab validation of the assay. Note: Not all genes will be expressed at a detectable level in the universal RNA sample. cDNA Tm Melting temperature of the amplicon when running a melt curve analysis. gDNA Cq Cq value obtained when running the assay with 2.5ng of genomic DNA. This is more than a moderate level of genomic DNA contamination. Intron-spanning and exon-exon junction assay designs can minimize or eliminate genomic DNA detection. Note: Genomic DNA contamination is often present at variable levels. If concerned about genomic DNA contamination, the genomic DNA contamination control assay is recommended to run with your sample to determine if genomic DNA levels are sufficient to negatively impact results. Specificity This value is the percent of specific amplicon reads as measured by next generation sequencing (NGS). While 100% specificity is desirable, small decreases in specificity (<1%) can be due to NGS read errors. More significant reductions are likely due to co-amplification of homologous regions. Note: Since gene expression can be cell type and condition specific, the exact level and impact of co-amplification in a given sample is impossible to predict. If co-amplification is detected, it should be taken into consideration and reported when analyzing gene expression results. Page 5/5.
Load more

Recommended publications
  • A Gene-Level Methylome-Wide Association Analysis Identifies Novel
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.201376; this version posted July 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 A gene-level methylome-wide association analysis identifies novel 2 Alzheimer’s disease genes 1 1 2 3 4 3 Chong Wu , Jonathan Bradley , Yanming Li , Lang Wu , and Hong-Wen Deng 1 4 Department of Statistics, Florida State University; 2 5 Department of Biostatistics & Data Science, University of Kansas Medical Center; 3 6 Population Sciences in the Pacific Program, University of Hawaii Cancer center; 4 7 Tulane Center for Biomedical Informatics and Genomics, Deming Department of Medicine, 8 Tulane University School of Medicine 9 Corresponding to: Chong Wu, Assistant Professor, Department of Statistics, Florida State 10 University, email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.13.201376; this version posted July 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 11 Abstract 12 Motivation: Transcriptome-wide association studies (TWAS) have successfully facilitated the dis- 13 covery of novel genetic risk loci for many complex traits, including late-onset Alzheimer’s disease 14 (AD). However, most existing TWAS methods rely only on gene expression and ignore epige- 15 netic modification (i.e., DNA methylation) and functional regulatory information (i.e., enhancer- 16 promoter interactions), both of which contribute significantly to the genetic basis ofAD.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Dynamic Transcriptomic Profiles of Zebrafish Gills in Response to Zinc
    Zheng et al. BMC Genomics 2010, 11:548 http://www.biomedcentral.com/1471-2164/11/548 RESEARCH ARTICLE Open Access Dynamic transcriptomic profiles of zebrafish gills in response to zinc depletion Dongling Zheng1,4, Peter Kille2, Graham P Feeney2, Phil Cunningham1, Richard D Handy3, Christer Hogstrand1* Abstract Background: Zinc deficiency is detrimental to organisms, highlighting its role as an essential micronutrient contributing to numerous biological processes. To investigate the underlying molecular events invoked by zinc depletion we performed a temporal analysis of transcriptome changes observed within the zebrafish gill. This tissue represents a model system for studying ion absorption across polarised epithelial cells as it provides a major pathway for fish to acquire zinc directly from water whilst sharing a conserved zinc transporting system with mammals. Results: Zebrafish were treated with either zinc-depleted (water = 2.61 μgL-1; diet = 26 mg kg-1) or zinc-adequate (water = 16.3 μgL-1; diet = 233 mg kg-1) conditions for two weeks. Gill samples were collected at five time points and transcriptome changes analysed in quintuplicate using a 16K oligonucleotide array. Of the genes represented the expression of a total of 333 transcripts showed differential regulation by zinc depletion (having a fold-change greater than 1.8 and an adjusted P-value less than 0.1, controlling for a 10% False Discovery Rate). Down-regulation was dominant at most time points and distinct sets of genes were regulated at different stages. Annotation enrichment analysis revealed that ‘Developmental Process’ was the most significantly overrepresented Biological Process GO term (P = 0.0006), involving 26% of all regulated genes.
    [Show full text]
  • The Interactome of KRAB Zinc Finger Proteins Reveals the Evolutionary History of Their Functional Diversification
    Resource The interactome of KRAB zinc finger proteins reveals the evolutionary history of their functional diversification Pierre-Yves Helleboid1,†, Moritz Heusel2,†, Julien Duc1, Cécile Piot1, Christian W Thorball1, Andrea Coluccio1, Julien Pontis1, Michaël Imbeault1, Priscilla Turelli1, Ruedi Aebersold2,3,* & Didier Trono1,** Abstract years ago (MYA) (Imbeault et al, 2017). Their products harbor an N-terminal KRAB (Kru¨ppel-associated box) domain related to that of Krüppel-associated box (KRAB)-containing zinc finger proteins Meisetz (a.k.a. PRDM9), a protein that originated prior to the diver- (KZFPs) are encoded in the hundreds by the genomes of higher gence of chordates and echinoderms, and a C-terminal array of zinc vertebrates, and many act with the heterochromatin-inducing fingers (ZNF) with sequence-specific DNA-binding potential (Urru- KAP1 as repressors of transposable elements (TEs) during early tia, 2003; Birtle & Ponting, 2006; Imbeault et al, 2017). KZFP genes embryogenesis. Yet, their widespread expression in adult tissues multiplied by gene and segment duplication to count today more and enrichment at other genetic loci indicate additional roles. than 350 and 700 representatives in the human and mouse Here, we characterized the protein interactome of 101 of the ~350 genomes, respectively (Urrutia, 2003; Kauzlaric et al, 2017). A human KZFPs. Consistent with their targeting of TEs, most KZFPs majority of human KZFPs including all primate-restricted family conserved up to placental mammals essentially recruit KAP1 and members target sequences derived from TEs, that is, DNA trans- associated effectors. In contrast, a subset of more ancient KZFPs posons, ERVs (endogenous retroviruses), LINEs, SINEs (long and rather interacts with factors related to functions such as genome short interspersed nuclear elements, respectively), or SVAs (SINE- architecture or RNA processing.
    [Show full text]
  • Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms
    Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhai, Guangju, Alexander Teumer, Lisette Stolk, John R. B. Perry, Liesbeth Vandenput, Andrea D. Coviello, Annemarie Koster, et al. 2011. Eight common genetic variants associated with serum DHEAS levels suggest a key role in ageing mechanisms. PLoS Genetics 7(4): e1002025. Published Version doi:10.1371/journal.pgen.1002025 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:5146966 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms Guangju Zhai1., Alexander Teumer2., Lisette Stolk3,4., John R. B. Perry5,6., Liesbeth Vandenput7., Andrea D. Coviello8., Annemarie Koster9., Jordana T. Bell1,6, Shalender Bhasin10, Joel Eriksson7, Anna Eriksson7, Florian Ernst2, Luigi Ferrucci11, Timothy M. Frayling5, Daniel Glass1, Elin Grundberg1,12, Robin Haring13,A˚ sa K. Hedman6, Albert Hofman4,14, Douglas P. Kiel15, Heyo K. Kroemer16, Yongmei Liu17, Kathryn L. Lunetta18, Marcello Maggio19, Mattias Lorentzon7, Massimo Mangino1, David Melzer5, Iva Miljkovic20, MuTHER Consortium, Alexandra Nica12,21, Brenda W. J. H. Penninx22, Ramachandran S. Vasan8,23, Fernando Rivadeneira3,4, Kerrin S. Small1,12, Nicole Soranzo1,12, Andre´ G. Uitterlinden3,4,14, Henry Vo¨ lzke24, Scott G.
    [Show full text]
  • Downloaded from Here
    bioRxiv preprint doi: https://doi.org/10.1101/017566; this version posted November 19, 2015. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 1 Testing for ancient selection using cross-population allele 2 frequency differentiation 1;∗ 3 Fernando Racimo 4 1 Department of Integrative Biology, University of California, Berkeley, CA, USA 5 ∗ E-mail: [email protected] 6 1 Abstract 7 A powerful way to detect selection in a population is by modeling local allele frequency changes in a 8 particular region of the genome under scenarios of selection and neutrality, and finding which model is 9 most compatible with the data. Chen et al. [2010] developed a composite likelihood method called XP- 10 CLR that uses an outgroup population to detect departures from neutrality which could be compatible 11 with hard or soft sweeps, at linked sites near a beneficial allele. However, this method is most sensitive 12 to recent selection and may miss selective events that happened a long time ago. To overcome this, 13 we developed an extension of XP-CLR that jointly models the behavior of a selected allele in a three- 14 population tree. Our method - called 3P-CLR - outperforms XP-CLR when testing for selection that 15 occurred before two populations split from each other, and can distinguish between those events and 16 events that occurred specifically in each of the populations after the split.
    [Show full text]
  • The Interactome of KRAB Zinc Finger Proteins Reveals the Evolutionary History of Their Functional Diversification
    Research Collection Journal Article The interactome of KRAB zinc finger proteins reveals the evolutionary history of their functional diversification Author(s): Helleboid, Pierre-Yves; Heusel, Moritz; Duc, Julien; Piot, Cecile; Thorball, Christian W.; Coluccio, Andrea; Pontis, Julien; Turelli, Priscilla; Aebersold, Ruedi; Trono, Didier Publication Date: 2019-09-16 Permanent Link: https://doi.org/10.3929/ethz-b-000360670 Originally published in: The EMBO Journal 38(18), http://doi.org/10.15252/embj.2018101220 Rights / License: Creative Commons Attribution 4.0 International This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library Resource The interactome of KRAB zinc finger proteins reveals the evolutionary history of their functional diversification Pierre-Yves Helleboid1,†, Moritz Heusel2,†, Julien Duc1, Cécile Piot1, Christian W Thorball1, Andrea Coluccio1, Julien Pontis1, Michaël Imbeault1, Priscilla Turelli1, Ruedi Aebersold2,3,* & Didier Trono1,** Abstract years ago (MYA) (Imbeault et al, 2017). Their products harbor an N-terminal KRAB (Kru¨ppel-associated box) domain related to that of Krüppel-associated box (KRAB)-containing zinc finger proteins Meisetz (a.k.a. PRDM9), a protein that originated prior to the diver- (KZFPs) are encoded in the hundreds by the genomes of higher gence of chordates and echinoderms, and a C-terminal array of zinc vertebrates, and many act with the heterochromatin-inducing fingers (ZNF) with sequence-specific DNA-binding potential (Urru- KAP1 as repressors of transposable elements (TEs) during early tia, 2003; Birtle & Ponting, 2006; Imbeault et al, 2017). KZFP genes embryogenesis. Yet, their widespread expression in adult tissues multiplied by gene and segment duplication to count today more and enrichment at other genetic loci indicate additional roles.
    [Show full text]
  • The Changing Chromatome As a Driver of Disease: a Panoramic View from Different Methodologies
    The changing chromatome as a driver of disease: A panoramic view from different methodologies Isabel Espejo1, Luciano Di Croce,1,2,3 and Sergi Aranda1 1. Centre for Genomic Regulation (CRG), Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2. Universitat Pompeu Fabra (UPF), Barcelona, Spain 3. ICREA, Pg. Lluis Companys 23, Barcelona 08010, Spain *Corresponding authors: Luciano Di Croce ([email protected]) Sergi Aranda ([email protected]) 1 GRAPHICAL ABSTRACT Chromatin-bound proteins regulate gene expression, replicate and repair DNA, and transmit epigenetic information. Several human diseases are highly influenced by alterations in the chromatin- bound proteome. Thus, biochemical approaches for the systematic characterization of the chromatome could contribute to identifying new regulators of cellular functionality, including those that are relevant to human disorders. 2 SUMMARY Chromatin-bound proteins underlie several fundamental cellular functions, such as control of gene expression and the faithful transmission of genetic and epigenetic information. Components of the chromatin proteome (the “chromatome”) are essential in human life, and mutations in chromatin-bound proteins are frequently drivers of human diseases, such as cancer. Proteomic characterization of chromatin and de novo identification of chromatin interactors could thus reveal important and perhaps unexpected players implicated in human physiology and disease. Recently, intensive research efforts have focused on developing strategies to characterize the chromatome composition. In this review, we provide an overview of the dynamic composition of the chromatome, highlight the importance of its alterations as a driving force in human disease (and particularly in cancer), and discuss the different approaches to systematically characterize the chromatin-bound proteome in a global manner.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano Et Al
    US 20090269772A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0269772 A1 Califano et al. (43) Pub. Date: Oct. 29, 2009 (54) SYSTEMS AND METHODS FOR Publication Classification IDENTIFYING COMBINATIONS OF (51) Int. Cl. COMPOUNDS OF THERAPEUTIC INTEREST CI2O I/68 (2006.01) CI2O 1/02 (2006.01) (76) Inventors: Andrea Califano, New York, NY G06N 5/02 (2006.01) (US); Riccardo Dalla-Favera, New (52) U.S. Cl. ........... 435/6: 435/29: 706/54; 707/E17.014 York, NY (US); Owen A. (57) ABSTRACT O'Connor, New York, NY (US) Systems, methods, and apparatus for searching for a combi nation of compounds of therapeutic interest are provided. Correspondence Address: Cell-based assays are performed, each cell-based assay JONES DAY exposing a different sample of cells to a different compound 222 EAST 41ST ST in a plurality of compounds. From the cell-based assays, a NEW YORK, NY 10017 (US) Subset of the tested compounds is selected. For each respec tive compound in the Subset, a molecular abundance profile from cells exposed to the respective compound is measured. (21) Appl. No.: 12/432,579 Targets of transcription factors and post-translational modu lators of transcription factor activity are inferred from the (22) Filed: Apr. 29, 2009 molecular abundance profile data using information theoretic measures. This data is used to construct an interaction net Related U.S. Application Data work. Variances in edges in the interaction network are used to determine the drug activity profile of compounds in the (60) Provisional application No. 61/048.875, filed on Apr.
    [Show full text]
  • SVA) Retrotransposons in Shaping the Human Genome
    Edinburgh Research Explorer The Role of SINE-VNTR-Alu (SVA) Retrotransposons in Shaping the Human Genome Citation for published version: Gianfrancesco, O, Geary, B, Savage, A, Billingsley, K, Bubb, V & Quinn, J 2019, 'The Role of SINE-VNTR- Alu (SVA) Retrotransposons in Shaping the Human Genome', International Journal of Molecular Sciences, vol. 20, no. 23. https://doi.org/10.3390/ijms20235977 Digital Object Identifier (DOI): 10.3390/ijms20235977 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: International Journal of Molecular Sciences General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 09. Oct. 2021 International Journal of Molecular Sciences Article The Role of SINE-VNTR-Alu (SVA) Retrotransposons in Shaping the Human Genome Olympia Gianfrancesco 1,2, Bethany Geary 3 , Abigail L. Savage 1 , Kimberley J. Billingsley 1, Vivien
    [Show full text]
  • Supplemental Data Inter-Individual Variability in Gene Expression
    DMD #42028 Supplemental data Inter-individual variability in gene expression profiles in human hepatocytes and comparison with HepaRG cells Alexandra ROGUE, Carine LAMBERT, Catherine SPIRE, Nancy CLAUDE and André GUILLOUZO Drug and metabolism disposition Supplemental Table 3: Genes expressed only in HepaRG cells located on the chromosome 7 Gene symbol Gene description SEPT13 septin 13 SEPT14 hCG_18833 ACHE acetylcholinesterase (Yt blood group) AMPH amphiphysin ANKIB1 ankyrin repeat and IBR domain containing 1 ANKMY2 ankyrin repeat and MYND domain containing 2 ANLN anillin, actin binding protein AP1S1 adaptor-related protein complex 1, sigma 1 subunit ATXN7L1 ataxin 7-like 1 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 C7orf31 hCG_39028 C7orf38 chromosome 7 open reading frame 38 C7orf41 chromosome 7 open reading frame 41 C7orf53 chromosome 7 open reading frame 53 CADPS2 Ca++-dependent secretion activator 2 CALCR calcitonin receptor CALN1 calneuron 1 CASD1 CAS1 domain containing 1 CBLL1 Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 CCDC132 coiled-coil domain containing 132 CD36 CD36 molecule (thrombospondin receptor) CDC14C CDC14 cell division cycle 14 homolog C (S. cerevisiae) CHN2 chimerin (chimaerin) 2 CHRM2 cholinergic receptor, muscarinic 2 CLDN15 claudin 15 CLIP2 CAP-GLY domain containing linker protein 2 CNPY4 canopy 4 homolog (zebrafish) COX19 COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) CROT carnitine O-octanoyltransferase DBF4 DBF4 homolog (S. cerevisiae)
    [Show full text]
  • High Throughput Gene Expression Analysis Identifies Reliable Expression Markers of Human Corneal Endothelial Cells
    High Throughput Gene Expression Analysis Identifies Reliable Expression Markers of Human Corneal Endothelial Cells Zhenzhi Chng1, Gary S. L. Peh2, Wishva B. Herath3, Terence Y. D. Cheng1, Heng-Pei Ang2, Kah-Peng Toh2, Paul Robson3, Jodhbir S. Mehta2,4,5*, Alan Colman1* 1 A*STAR Institute of Medical Biology, Singapore, Singapore, 2 Tissue Engineering and Stem Cell Group, Singapore Eye Research Institute, Singapore, Singapore, 3 Genome Institute of Singapore, Singapore, Singapore, 4 Singapore National Eye Centre, Singapore, Singapore, 5 Department of Clinical Sciences, Duke-NUS Graduate Medical School, Singapore, Singapore Abstract Considerable interest has been generated for the development of suitable corneal endothelial graft alternatives through cell-tissue engineering, which can potentially alleviate the shortage of corneal transplant material. The advent of less invasive suture-less key-hole surgery options such as Descemet’s Stripping Endothelial Keratoplasty (DSEK) and Descemet’s Membrane Endothelial Keratoplasty (DMEK), which involve transplantation of solely the endothelial layer instead of full thickness cornea, provide further impetus for the development of alternative endothelial grafts for clinical applications. A major challenge for this endeavor is the lack of specific markers for this cell type. To identify genes that reliably mark corneal endothelial cells (CECs) in vivo and in vitro, we performed RNA-sequencing on freshly isolated human CECs (from both young and old donors), CEC cultures, and corneal stroma. Gene expression of these corneal cell types was also compared to that of other human tissue types. Based on high throughput comparative gene expression analysis, we identified a panel of markers that are: i) highly expressed in CECs from both young donors and old donors; ii) expressed in CECs in vivo and in vitro; and iii) not expressed in corneal stroma keratocytes and the activated corneal stroma fibroblasts.
    [Show full text]