DOCSLIB.ORG

The Molecular and Morphometrical Description of a New Diplozoid

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Molecular and Morphometrical Description of a New Diplozoid Parasitol Res (2013) 112:3053–3062 DOI 10.1007/s00436-013-3480-6 ORIGINAL PAPER The molecular and morphometrical description of a new diplozoid species from the gills of the Garra rufa (Heckel, 1843) (Cyprinidae) from Turkey—including a commentary on taxonomic division of Diplozoidae Kristína Civáňová & Mustafa Koyun & Božena Koubková Received: 22 June 2012 /Accepted: 23 May 2013 /Published online: 13 June 2013 # Springer-Verlag Berlin Heidelberg 2013 Abstract The paper presents a description of Paradiplozoon the anterior part of the body. The female and male reproduc- bingolensis sp. n. from the gills of Garra rufa Heckel, 1843 tive organs and terminal part of the gut are situated in the (Cyprinidae) collected from the Göynük Stream, a tributary of posterior part. The attachment apparatus of adults consist of the Murat River, Turkey. This is the first diplozoid species to four pairs of clamps and a pair of small central hooks situated be described from G. rufa. P. bingolensis is distinguished from on the ventral side of the opisthaptor. the other valid species in the genus by the combination of the The central hooks are used by oncomiracidia to attach morphology of the sclerites of its clamps and by the size of the themselves to the host fish, while the clamps are the most central hooks. Even molecular characterization based on var- important attachment organs of diporpae and adults iability of the second internal transcribed spacer (ITS2) of the (Bychowsky and Nagibina 1959; Khotenovsky 1985). The ribosomal DNA region provided additional support of sepa- size and shape of the sclerotized parts of the haptors—apair ration of this new species from the valid ones. The sequences of central hooks and four pairs of attachment clamps—are were compared with previously published ITS2 sequences of commonly used for the species identification of diplozoids. other diplozoid species. Subsequent analysis demonstrated the In particular, the length of the central hook sickle and the uniqueness of this new parasite species and revealed uncer- shape of the anterior end of median plate and anterior joining tainties in the current taxonomic division of the Diplozoidae sclerites of the clamps were found to be the most significant that are commented in the text. features for species discrimination (Bychowsky and Nagibina 1959; Gläser and Gläser 1964; Khotenovsky 1985; Matějusová et al. 2001b, 2002, 2004). The size of Introduction clamps (length × width) depends on the total length of host fish (Matějusová et al. 2002) and therefore is not important Monogeneans belonging to the Diplozoidae are common for species determination. parasites on the gills of cyprinid fish. The life cycle is direct, Due to the complicated determination of several groups of including free-swimming oncomiracidia, larval stage monogenean parasites, molecular markers based on species- (diporpa), and adult. Two larvae (diporpae) permanently fuse specific variability in the ribosomal DNA region (rDNA) into a pair to form the sexually maturated adult. In the adult, have been designed and shown to be useful for precise the vitellaria and almost all the internal organs are situated in species identification (Cunningham 1997; Matějusová et al. 2001a; Huyse and Volckaert 2002; Zietara et al. 2002; Šimková et al. 2006). The interspecific nucleic acid variabil- ň * : K. Civá ová ( ) B. Koubková ity of internal transcribed spacers of rDNA (ITS) has also Department of Botany and Zoology, Faculty of Science, ě Masaryk University, Kotlářská 2, been used to distinguish diplozoid parasites (Mat jusová 611 37 Brno, Czech Republic et al. 2001b; Sicard et al. 2001; Matějusová et al. 2002; e-mail: [email protected] Sicard et al. 2003; Matějusová et al. 2004; Gao et al. 2007). The host fish Garra rufa (Heckel 1843) (Cyprinidae) M. Koyun “ ” Department of Biology, Science and Art Faculty, ( doctor fish ) occurs in the river basins of northern and Bingöl University, 12000 Bingöl, Turkey central regions of the Middle East, mainly in Turkey, Syria, 3054 Parasitol Res (2013) 112:3053–3062 Iraq, and Iran, and in different habitats such as rivers, lakes, of clamps and central hooks. Type specimens are deposited at small warm ponds, and small muddy streams. It lives under the Institute of Parasitology, Biology Centre of the Academy and among stones and vegetation as a bottom dweller, feed- of Sciences of the Czech Republic, České Budějovice, Czech ing on aufwuchs. It is also kept in artificial warm ponds and Republic (holotype, paratypes—cat. no. M-536) and in the pools, where these fish feed on the skin scales of bathers, Zoology Department, University of Harran, Sanliurfa, Turkey reducing illnesses such as neurodermatitis and psoriasis (paratypes—cat. no. ZMHRU-HEL-2010-97). (Krupp and Schneider 1989). This paper describes a new species of diplozoid from G. Molecular characterization of diplozoids rufa collected from the Göynük Stream, a tributary of the Murat River, Turkey. The aims of the present study were to Genomic DNA was extracted using DNeasy Blood and provide both a morphological and molecular characterization Tissue Kit (Qiagen) and resuspended in 200 μl of AE buffer. of this new diplozoid from this host species and compare our The second internal transcribed spacer (ITS2) rDNA, a data with historical findings. meaningful genetic marker for species identification and analysis of parasite population variation, was amplified fol- lowing the method published in Matějusová et al. (2001b). Material and methods The PCR product (cca 820 bp) was visualized on 1 % GoldView-stained agarose gel and purified using High Pure Sample collection PCR Product Purification Kit (Roche). The purified PCR product was sequenced in both direc- Fish were sampled monthly (10–19 specimens each month; tions using the same primers as in the amplification reaction 120 specimens in total), from April 2010 to December 2010 (DITS2F: 5′ GGCTYRYGGNGTCGATGAAGAACGCAG by electrofishing and fishnet from the Göynük Stream, a 3′; DITS2R: 5′ GCCGGATCCGAATCCTGGTTAGTTTC tributary of the Murat River, Ilicalar-Bingöl, Turkey TTTTCCT 3′). Sequencing reactions were performed using (38°58′36.99″ N; 40°40′42.13″ E). The studied area is a the fluorescent chemistry of BigDye Terminator v3.1 Ready thermal river, which had an average water temperature of reaction Cycle Sequencing Kit. The purified products 22 °C during the time of our research (the temperature (BigDye X-Terminator Purification Kit; according to the ranged between 16 and 25 °C each month). The size (total manufacturer’s protocol) of the sequencing reaction were length) of fish ranged from 85 to 152 mm. Collected fish analyzed using an ABI 3130 Genetic Analyzer (Applied were sacrificed within 24 h and dissected to record parasites. Biosystems by Life Technologies, Carlsbad, California) un- der the appropriate module. Sequences were analyzed using Morphometric analysis Sequencing Analysis 5.2. (Applied Biosystems) and Sequencher 5.0 (Gene Codes Corp.) software. BLAST Parasites were fixed and stored in absolute ethanol at 4 °C. (blastn) searches were carried out to identify similar sequences One of the anterior parts of the parasite body was used for submitted to the EMBL nucleotide sequence database. The DNA analysis; the second anterior part was stained with nucleotide sequence of the diplozoid species characterized in iron-acetocarmine (Georgiev et al. 1986) and mounted in the present study was compared with 17 previously sequenced Canada balsam. For morphometric analysis, only one European and Chinese diplozoids submitted to nucleotide opisthaptor of each specimen was cutoff (Khotenovsky databases. As no corresponding sequences to the studied 1974) and soaked in 10 % sodium dodecyl sulfate for 30– ITS2 region of sister taxa to the Diplozoidae—Octomacridae 60 min. This was done in order to soften rigid tissue and and Discocotlidae (Boeger and Kritsky 1993)—were avail- thereby to make the clamps and central hooks clearly visible able in GenBank database, the sequence of Zeuxapta seriolae (Wong et al. 2006;Košková et al. 2010). The treated (from the related Axinidae) was used as an outgroup in all opisthaptor was washed in distilled water before being analyses. Multiple sequence alignment, the estimation of ge- mounted on a microscope slide and fixed with a mix- netic distances between species sequences, and phylogenetic ture of ammonium picrate and glycerin (Malmberg 1956; comparison were constructed in MEGA5 (Tamura et al. 2011) Khotenovsky 1974). According to the method of alcohol and BioEdit v. 7.0.9.0. (Hall 1999) software. The evolutionary fixation used for molecular analysis, the opisthaptor and the distances were computed using the Kimura two-parameter rest of the anterior part of the body needed to be fixed method (Kimura 1980); the rate variation among sites was separately; thus, the type material was composed of two slides modeled with a gamma distribution (shape parameter=1) and (clamps on one slide and the stained body on the second). A bootstrap test (1,000 replications). Phylogeny reconstruction light microscope equipped with differential interference con- was performed using MEGA5 software and evolutionary trast, a digital image analysis system (AnalySIS Five Auto), history was inferred by the following statistical methods: (1) and drawing attachment were used for morphometric analysis neighbor joining (NJ) (Saitou and Nei 1987)—Kimura two- Parasitol Res (2013) 112:3053–3062 3055 parameter model, (2) maximum parsimony (MP)—Close- Neighbor-Interchange algorithm, and (3) maximum likeli- hood (ML)—data-specific model and Nearest-Neighbor- Interchange with a discrete Gamma distribution (five catego- ries (+G, parameter=2.7990)) (Nei and Kumar 2000). To select the appropriate nucleotide substitution model of evolu- tion for ML according to the Akaike Information Criterion, corrected, the model with the lowest Bayesian Information Criterion score—GTR+G—wasconsideredtodescribethe substitution pattern the best. The bootstrap tests represent 1,000 replicates (Felsenstein 1985). Results In this work, G. rufa was registered for the first time as a host for a newly described diplozoid species, Paradiplozoon Fig.
Load more

Recommended publications
  • Bibliography Database of Living/Fossil Sharks, Rays and Chimaeras (Chondrichthyes: Elasmobranchii, Holocephali) Papers of the Year 2016
    www.shark-references.com Version 13.01.2017 Bibliography database of living/fossil sharks, rays and chimaeras (Chondrichthyes: Elasmobranchii, Holocephali) Papers of the year 2016 published by Jürgen Pollerspöck, Benediktinerring 34, 94569 Stephansposching, Germany and Nicolas Straube, Munich, Germany ISSN: 2195-6499 copyright by the authors 1 please inform us about missing papers: [email protected] www.shark-references.com Version 13.01.2017 Abstract: This paper contains a collection of 803 citations (no conference abstracts) on topics related to extant and extinct Chondrichthyes (sharks, rays, and chimaeras) as well as a list of Chondrichthyan species and hosted parasites newly described in 2016. The list is the result of regular queries in numerous journals, books and online publications. It provides a complete list of publication citations as well as a database report containing rearranged subsets of the list sorted by the keyword statistics, extant and extinct genera and species descriptions from the years 2000 to 2016, list of descriptions of extinct and extant species from 2016, parasitology, reproduction, distribution, diet, conservation, and taxonomy. The paper is intended to be consulted for information. In addition, we provide information on the geographic and depth distribution of newly described species, i.e. the type specimens from the year 1990- 2016 in a hot spot analysis. Please note that the content of this paper has been compiled to the best of our abilities based on current knowledge and practice, however,
    [Show full text]
  • BIO 475 - Parasitology Spring 2009 Stephen M
    BIO 475 - Parasitology Spring 2009 Stephen M. Shuster Northern Arizona University http://www4.nau.edu/isopod Lecture 12 Platyhelminth Systematics-New Euplatyhelminthes Superclass Acoelomorpha a. Simple pharynx, no gut. b. Usually free-living in marine sands. 3. Also parasitic/commensal on echinoderms. 1 Euplatyhelminthes 2. Superclass Rhabditophora - with rhabdites Euplatyhelminthes 2. Superclass Rhabditophora - with rhabdites a. Class Rhabdocoela 1. Rod shaped gut (hence the name) 2. Often endosymbiotic with Crustacea or other invertebrates. Euplatyhelminthes 3. Example: Syndesmis a. Lives in gut of sea urchins, entirely on protozoa. 2 Euplatyhelminthes Class Temnocephalida a. Temnocephala 1. Ectoparasitic on crayfish 5. Class Tricladida a. like planarians b. Bdelloura 1. live in gills of Limulus Class Temnocephalida 4. Life cycles are poorly known. a. Seem to have slightly increased reproductive capacity. b. Retain many morphological characters that permit free-living existence. Euplatyhelminth Systematics 3 Parasitic Platyhelminthes Old Scheme Characters: 1. Tegumental cell extensions 2. Prohaptor 3. Opisthaptor Superclass Neodermata a. Loss of characters associated with free-living existence. 1. Ciliated larval epidermis, adult epidermis is syncitial. Superclass Neodermata b. Major Classes - will consider each in detail: 1. Class Trematoda a. Subclass Aspidobothrea b. Subclass Digenea 2. Class Monogenea 3. Class Cestoidea 4 Euplatyhelminth Systematics Euplatyhelminth Systematics Class Cestoidea Two Subclasses: a. Subclass Cestodaria 1. Order Gyrocotylidea 2. Order Amphilinidea b. Subclass Eucestoda 5 Euplatyhelminth Systematics Parasitic Flatworms a. Relative abundance related to variety of parasitic habitats. b. Evidence that such characters lead to great speciation c. isolated populations, unique selective environments. Parasitic Flatworms d. Also, very good organisms for examination of: 1. Complex life cycles; selection favoring them 2.
    [Show full text]
  • Co-Occurrence of Ectoparasites of Marine Fishes: a Null Model Analysis
    Ecology Letters, (2002) 5: 86±94 REPORT Co-occurrence of ectoparasites of marine ®shes: a null model analysis Abstract Nicholas J. Gotelli1 We used null model analysis to test for nonrandomness in the structure of metazoan and Klaus Rohde2 ectoparasite communities of 45 species of marine ®sh. Host species consistently 1Department of Biology, supported fewer parasite species combinations than expected by chance, even in analyses University of Vermont, that incorporated empty sites. However, for most analyses, the null hypothesis was not Burlington, Vermont 05405, rejected, and co-occurrence patterns could not be distinguished from those that might USA. arise by random colonization and extinction. We compared our results to analyses of 2 School of Biological Sciences, presence±absence matrices for vertebrate taxa, and found support for the hypothesis University of New England, that there is an ecological continuum of community organization. Presence±absence Armidale, NSW 2351, Australia. matrices for small-bodied taxa with low vagility and/or small populations (marine E-mail: [email protected] ectoparasites, herps) were mostly random, whereas presence±absence matrices for large- bodied taxa with high vagility and/or large populations (birds, mammals) were highly structured. Metazoan ectoparasites of marine ®shes fall near the low end of this continuum, with little evidence for nonrandom species co-occurrence patterns. Keywords Species co-occurrence, ectoparasite communities, niche saturation, competitive interactions, null model analysis, presence±absence matrix Ecology Letters (2002) 5: 86±94 community patterns, reinforcing previous conclusions that INTRODUCTION these parasites live in largely unstructured assemblages Parasite communities are model systems for tests of (Rohde 1979, 1989, 1992, 1993, 1994, 1998a,b, 1999; Rohde community structure because community boundaries are et al.
    [Show full text]
  • Parasites of Coral Reef Fish: How Much Do We Know? with a Bibliography of Fish Parasites in New Caledonia
    Belg. J. Zool., 140 (Suppl.): 155-190 July 2010 Parasites of coral reef fish: how much do we know? With a bibliography of fish parasites in New Caledonia Jean-Lou Justine (1) UMR 7138 Systématique, Adaptation, Évolution, Muséum National d’Histoire Naturelle, 57, rue Cuvier, F-75321 Paris Cedex 05, France (2) Aquarium des lagons, B.P. 8185, 98807 Nouméa, Nouvelle-Calédonie Corresponding author: Jean-Lou Justine; e-mail: [email protected] ABSTRACT. A compilation of 107 references dealing with fish parasites in New Caledonia permitted the production of a parasite-host list and a host-parasite list. The lists include Turbellaria, Monopisthocotylea, Polyopisthocotylea, Digenea, Cestoda, Nematoda, Copepoda, Isopoda, Acanthocephala and Hirudinea, with 580 host-parasite combinations, corresponding with more than 370 species of parasites. Protozoa are not included. Platyhelminthes are the major group, with 239 species, including 98 monopisthocotylean monogeneans and 105 digeneans. Copepods include 61 records, and nematodes include 41 records. The list of fish recorded with parasites includes 195 species, in which most (ca. 170 species) are coral reef associated, the rest being a few deep-sea, pelagic or freshwater fishes. The serranids, lethrinids and lutjanids are the most commonly represented fish families. Although a list of published records does not provide a reliable estimate of biodiversity because of the important bias in publications being mainly in the domain of interest of the authors, it provides a basis to compare parasite biodiversity with other localities, and especially with other coral reefs. The present list is probably the most complete published account of parasite biodiversity of coral reef fishes.
    [Show full text]
  • Monopisthocotylean Monogeneans) Inferred from 28S Rdna Sequences
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications from the Harold W. Manter Laboratory of Parasitology Parasitology, Harold W. Manter Laboratory of 2002 Phylogenetic Positions of the Bothitrematidae and Neocalceostomatidae (Monopisthocotylean Monogeneans) Inferred from 28S rDNA Sequences Jean-Lou Justine Richard Jovelin Lassâd Neifar Isabelle Mollaret L.H. Susan Lim See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/parasitologyfacpubs Part of the Parasitology Commons This Article is brought to you for free and open access by the Parasitology, Harold W. Manter Laboratory of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications from the Harold W. Manter Laboratory of Parasitology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Jean-Lou Justine, Richard Jovelin, Lassâd Neifar, Isabelle Mollaret, L.H. Susan Lim, Sherman S. Hendrix, and Louis Euzet Comp. Parasitol. 69(1), 2002, pp. 20–25 Phylogenetic Positions of the Bothitrematidae and Neocalceostomatidae (Monopisthocotylean Monogeneans) Inferred from 28S rDNA Sequences JEAN-LOU JUSTINE,1,8 RICHARD JOVELIN,1,2 LASSAˆ D NEIFAR,3 ISABELLE MOLLARET,1,4 L. H. SUSAN LIM,5 SHERMAN S. HENDRIX,6 AND LOUIS EUZET7 1 Laboratoire de Biologie Parasitaire, Protistologie, Helminthologie, Muse´um National d’Histoire Naturelle, 61 rue Buffon, F-75231 Paris Cedex 05, France (e-mail: [email protected]), 2 Service
    [Show full text]
  • Full and FINAL MASTERS DISCERTATION
    ASPECTS OF THE MORPHOLOGY AND ECOLOGY OF A DIPLOZOON SPECIES (MONOGENEA) FROM THE GILLS OF LABEO UMBRATUS IN THE VAAL DAM AND VAAL RIVER BARRAGE, GAUTENG, SOUTH AFRICA. LAURETTE SEDDON Supervisor: Prof. A. Avenant-Oldewage Dissertation submitted in partial fulfilment of the requirements for the degree Master of Science in Zoology in the Faculty of Science of the Rand Afrikaans University Johannesburg , May 2004 ABSTRACT To date, 4 diplozoidae parasites have been described form Africa. Two belonging to the genus Diplozoon, namely D. aegyptensis and D. ghanense from sites in Northern Africa. One belonging to the genus Neodiplozoon, namely Neodiplozoon polycotyleus . The fourth monogenean is the concern of this study which aimed to determine the exact classification of the monogenean found on the gills of Labeo umbratus in the Vaal Dam and Vaal River Barrage respectively. The study was conducted over a 13-month period, with field data collections occurring every two to three months from January 1999 to February 2000. Host fishes were collected with the aid of gill nets with mesh sizes of 90, 110 and 130mm respectively. In-field measurements were taken regarding the total length, fork length, position of parasites on the gill arches and the host gender. All parasites collected were fixed in steaming AFA and stored in 70% ethanol. Laboratory measurements of whole mounts were completed with the aid of light microscope and drawing tube attachment. Staining methods employed included Boraxcarmine-iodine, Mayer’s Hematoxylin and Horen’s Trichrome. Scanning electron microscopy was used to gather information regarding the external morphology of the parasites.
    [Show full text]
  • Seasonal Growth of the Attachment Clamps of a Paradiplozoon Sp
    African Journal of Biotechnology Vol. 11(9), pp. 2333-2339, 31 January, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3064 ISSN 1684–5315 © 2012 Academic Journals Full Length Research Paper Seasonal growth of the attachment clamps of a Paradiplozoon sp. as depicted by statistical shape analysis Milne, S. J.1,2 *# and Avenant-Oldewage, A.1 1Department of Zoology, University of Johannesburg, PO Box 524, Auckland Park, Johannesburg 2006, South Africa. 2School of Public Health, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg 2193, South Africa. Accepted 15 December, 2011 Geometric morphometric methods using computer software is a more statistically powerful method of assessing changes in the anatomy than are traditional measurements of lengths. The aim of the study was to investigate whether changes in the size and shape Paradiplozoon sp. permanent attachment clamps could be used to determine the duration of the organsism’s life-cycle in situ . A total of 149 adult Paradiplozoon sp. ectoparasites were recovered from Labeobarbus aeneus and Labeobarbus kimberlyensis in the Vaal Dam. The software tool tpsDIG v.2.1 was used on six digitised landmarks placed at the junctures between the sclerites of the attachment clamps from digital micrographs. The tpsSmall v. 2.0 and Morphologika 2 v. 2.5 software tools were used to perform principal component analysis (PCA) on this multivariate dataset. The PCA analysis indicated that the increase in size and linear change in shape of the selected landmarks, were significant predictors of the sampling season. This study suggests that it takes one year for the permanent attachment clamps of a Paradiplozoon sp.
    [Show full text]
  • SEM Study of Diplozoon Kashmirensis (Monogenea, Polyopisthocotylea) from Crucian Carp, Carassius Carassius
    SEM study of Diplozoon kashmirensis (Monogenea, Polyopisthocotylea) from Crucian Carp, Carassius carassius Shabina Shamim, Fayaz Ahmad Department of Zoology, University of Kashmir, Srinagar – 190 006, Kashmir, J&K, India ABSTRACT Using Scanning Electron Microscopy the external morphology of the helminth parasite Diplozoon kashmirensis (Monogenea, Diplozoidae) from the fish Carassius carassius is described herein for the first time. The present study is a part of the parasitological work carried out on the fishes of Jammu and Kashmir. These fish helminthes are ectoparasites, blood feeding found on gills of fishes. They have extraordinary body architecture due to their unique sexual behavior in which two larval worms fuse together permanently resulting in the transformation of one X shaped duplex individual. Oral sucker of the prohaptor has a partition giving it a paired appearance. The opisthohaptor present on hind body contains four pairs of clamps on each haptor of the pair, a pair of hooks and a concave terminal end. Body is composed of tegmental folds to help the worms in fixing to the gills. This type of strategy adapted for parasitic life in which two individuals permanently fuse into a single hermaphrodite individual without any need to search for mating partner and presence of highly sophisticated attachment structures, shows highest type of specialization of diplozoid monogeneans. In this study we used SEM to examine the surface topography of Diplozoon kashmiriensis, thereby broadening our existing knowledge of surface morphology of fish helminthes. Key Words – Carassius carassius, Diplozoon kashmirensis, Monogenea, Opisthohaptor, SEM. I INTRODUCTION Monogenea is one of the largest classes within the phylum Platyhelminthes and they usually possess anterior and posterior attachment apparatus that are used for settlement, feeding, locomotion and transfer from host to host [1, 2, 3].
    [Show full text]
  • APPENDIX 1 Classified List of Fishes Mentioned in the Text, with Scientific and Common Names
    APPENDIX 1 Classified list of fishes mentioned in the text, with scientific and common names. ___________________________________________________________ Scientific names and classification are from Nelson (1994). Families are listed in the same order as in Nelson (1994), with species names following in alphabetical order. The common names of British fishes mostly follow Wheeler (1978). Common names of foreign fishes are taken from Froese & Pauly (2002). Species in square brackets are referred to in the text but are not found in British waters. Fishes restricted to fresh water are shown in bold type. Fishes ranging from fresh water through brackish water to the sea are underlined; this category includes diadromous fishes that regularly migrate between marine and freshwater environments, spawning either in the sea (catadromous fishes) or in fresh water (anadromous fishes). Not indicated are marine or freshwater fishes that occasionally venture into brackish water. Superclass Agnatha (jawless fishes) Class Myxini (hagfishes)1 Order Myxiniformes Family Myxinidae Myxine glutinosa, hagfish Class Cephalaspidomorphi (lampreys)1 Order Petromyzontiformes Family Petromyzontidae [Ichthyomyzon bdellium, Ohio lamprey] Lampetra fluviatilis, lampern, river lamprey Lampetra planeri, brook lamprey [Lampetra tridentata, Pacific lamprey] Lethenteron camtschaticum, Arctic lamprey] [Lethenteron zanandreai, Po brook lamprey] Petromyzon marinus, lamprey Superclass Gnathostomata (fishes with jaws) Grade Chondrichthiomorphi Class Chondrichthyes (cartilaginous
    [Show full text]
  • Attachment Structure of Wood Ticks; a Fine Structure Study
    Heckmann Pakistan Journal of Parasitology 65; June 2018 ATTACHMENT STRUCTURE OF WOOD TICKS; A FINE STRUCTURE STUDY Richard Heckmann Department of Biology - 1114 MLBM, Brigham Young University, Provo,Utah 84602 USA Abstract: The mouthparts of four species of ticks (Rhipicephalus, Amblyomma, Dermacenter and Haemaphysalis) were viewed with SEM and compared to one species of mite (Varrao). The ticks have the characteristic pedipalps, chelicera and hypostome to attach and feed on hosts. The appendage modification for host attachment was viewed including the pulvilli and Haller’s organ. Specific mouthparts were scanned with x-ray (XEDS) and the barbs of the hypostome were cut with a gallium ion beam (LIMS). For comparison, the mouthparts of a mite (Varrao) were included in the study. Those organisms studied belonged to the Acarina. Keywords: Ticks, Mites, Mouthparts, Hypostome, Acarina. INTRODUCTION The mouthparts of a tick are designed for puncture of a host skin and then feed on the host body fluids, especially blood. During the feeding process the eight leg Acarinid can transmit many diseases may acquired by human hosts. Birds, mammals and reptiles are infected with blood feeding ticks. (Macnair, 2016) reported that approximately 850 species have been described worldwide (Wikipedia). Tick, 2018 and Sonenshine, 1991 had suggested that ticks are important vector of disease in humans and animals. Mouthparts of ticks have three visible components for mouthparts. The two outside parts which are joined are highly mobile palps also called (pedipalps) in between these are paired chelicerae which protect the hypostome. While ticks are deeding the palps more laterally. Beak-like projections are present or the bared hyperstome, this structure plunges while feeding on host skin.
    [Show full text]
  • The Parasite Release Hypothesis and the Success of Invasive Fish in New Zealand
    http://researchcommons.waikato.ac.nz/ Research Commons at the University of Waikato Copyright Statement: The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand). The thesis may be consulted by you, provided you comply with the provisions of the Act and the following conditions of use: Any use you make of these documents or images must be for research or private study purposes only, and you may not make them available to any other person. Authors control the copyright of their thesis. You will recognise the author’s right to be identified as the author of the thesis, and due acknowledgement will be made to the author where appropriate. You will obtain the author’s permission before publishing any material from the thesis. The parasite release hypothesis and the success of invasive fish in New Zealand A thesis submitted in partial fulfilment of the requirements for the degree of Master of Science in Biological Science at The University of Waikato by Keshi Zhang The University of Waikato 2012 Abstract Non-indigenous species are commonly released from their native enemies, including parasites, when they are introduced into new geographical areas. This has been referred to as the enemy release hypothesis and more strictly as the parasite release hypothesis. The loss of parasites is commonly inferred to explain the invasiveness of non-indigenous species. I examined parasite release in New Zealand non-indigenous freshwater fishes. A literature review was undertaken in order to collate lists of the known parasite fauna of 20 New Zealand non-indigenous freshwater fish species.
    [Show full text]
  • Helminths (Parasitic Worms) Helminths
    Helminths (Parasitic worms) Multicellular - tissues & organs Degenerate digestive system Reduced nervous system Complex reproductive system - main physiology Complex life cycles Kingdom Animalia Phylum Platyhelminths Phylum Nematoda Flatworms Roundworms Helminths - Important Features Significant variation in size Millimeters to Meters in length Nearly world-wide distribution Long persistence of helminth parasites in host PUBLIC HEALTH Indistinct clinical syndromes Protective immunity is acquired only after many years (decades) Poly-parasitism Greatest burden is in children Malnutrition, growth/development retardation, decreased work Morbidity proportional to worm load Helminths (Parasitic worms) Kingdom Animalia Phylum Platyhelminths Phylum Nematoda Tubellarians Monogenea Trematodes Cestodes Free-living Monogenetic Digenetic Tapeworms worms Flukes Flukes 1 Phylum Platyhelminths General Properties (some variations) Bilateral symmetry Generally dorsoventrally flattened Body having 3 layers of tissues with organs and organelles Body contains no internal cavity (acoelomate) Possesses a blind gut (i.e. it has a mouth but no anus) Protonephridial excretory organs instead of an anus Nervous system of longitudinal fibers rather than a net Reproduction mostly sexual as hermaphrodites Some species occur in all major habitats, including many as parasites of other animals. Planaria - Newest model system? Planaria - common name Free-living flatworm Simple organ system RNAi - yes! Large scale RNAi screen Amazing power
    [Show full text]