The Molecular and Morphometrical Description of a New Diplozoid

Parasitol Res (2013) 112:3053–3062 DOI 10.1007/s00436-013-3480-6

ORIGINAL PAPER

The molecular and morphometrical description of a new diplozoid species from the gills of the Garra rufa (Heckel, 1843) (Cyprinidae) from Turkey—including a commentary on taxonomic division of Diplozoidae

Kristína Civáňová & Mustafa Koyun & Božena Koubková

Received: 22 June 2012 /Accepted: 23 May 2013 /Published online: 13 June 2013 # Springer-Verlag Berlin Heidelberg 2013

Abstract The paper presents a description of Paradiplozoon the anterior part of the body. The female and male reproduc- bingolensis sp. n. from the gills of Garra rufa Heckel, 1843 tive organs and terminal part of the gut are situated in the (Cyprinidae) collected from the Göynük Stream, a tributary of posterior part. The attachment apparatus of adults consist of the Murat River, Turkey. This is the first diplozoid species to four pairs of clamps and a pair of small central hooks situated be described from G. rufa. P. bingolensis is distinguished from on the ventral side of the opisthaptor. the other valid species in the genus by the combination of the The central hooks are used by oncomiracidia to attach morphology of the sclerites of its clamps and by the size of the themselves to the host fish, while the clamps are the most central hooks. Even molecular characterization based on var- important attachment organs of diporpae and adults iability of the second internal transcribed spacer (ITS2) of the (Bychowsky and Nagibina 1959; Khotenovsky 1985). The ribosomal DNA region provided additional support of sepa- size and shape of the sclerotized parts of the haptors—apair ration of this new species from the valid ones. The sequences of central hooks and four pairs of attachment clamps—are were compared with previously published ITS2 sequences of commonly used for the species identification of diplozoids. other diplozoid species. Subsequent analysis demonstrated the In particular, the length of the central hook sickle and the uniqueness of this new parasite species and revealed uncer- shape of the anterior end of median plate and anterior joining tainties in the current taxonomic division of the Diplozoidae sclerites of the clamps were found to be the most significant that are commented in the text. features for species discrimination (Bychowsky and Nagibina 1959; Gläser and Gläser 1964; Khotenovsky 1985; Matějusová et al. 2001b, 2002, 2004). The size of Introduction clamps (length × width) depends on the total length of host fish (Matějusová et al. 2002) and therefore is not important Monogeneans belonging to the Diplozoidae are common for species determination. parasites on the gills of cyprinid fish. The life cycle is direct, Due to the complicated determination of several groups of including free-swimming oncomiracidia, larval stage monogenean parasites, molecular markers based on species- (diporpa), and adult. Two larvae (diporpae) permanently fuse specific variability in the ribosomal DNA region (rDNA) into a pair to form the sexually maturated adult. In the adult, have been designed and shown to be useful for precise the vitellaria and almost all the internal organs are situated in species identification (Cunningham 1997; Matějusová et al. 2001a; Huyse and Volckaert 2002; Zietara et al. 2002; Šimková et al. 2006). The interspecific nucleic acid variabil- ň * : K. Civá ová ( ) B. Koubková ity of internal transcribed spacers of rDNA (ITS) has also Department of Botany and Zoology, Faculty of Science, ě Masaryk University, Kotlářská 2, been used to distinguish diplozoid parasites (Mat jusová 611 37 Brno, Czech Republic et al. 2001b; Sicard et al. 2001; Matějusová et al. 2002; e-mail: [email protected] Sicard et al. 2003; Matějusová et al. 2004; Gao et al. 2007). The host fish Garra rufa (Heckel 1843) (Cyprinidae) M. Koyun “ ” Department of Biology, Science and Art Faculty, ( doctor fish ) occurs in the river basins of northern and Bingöl University, 12000 Bingöl, Turkey central regions of the Middle East, mainly in Turkey, Syria, 3054 Parasitol Res (2013) 112:3053–3062

Iraq, and Iran, and in different habitats such as rivers, lakes, of clamps and central hooks. Type specimens are deposited at small warm ponds, and small muddy streams. It lives under the Institute of Parasitology, Biology Centre of the Academy and among stones and vegetation as a bottom dweller, feed- of Sciences of the Czech Republic, České Budějovice, Czech ing on aufwuchs. It is also kept in artificial warm ponds and Republic (holotype, paratypes—cat. no. M-536) and in the pools, where these fish feed on the skin scales of bathers, Zoology Department, University of Harran, Sanliurfa, Turkey reducing illnesses such as neurodermatitis and psoriasis (paratypes—cat. no. ZMHRU-HEL-2010-97). (Krupp and Schneider 1989). This paper describes a new species of diplozoid from G. Molecular characterization of diplozoids rufa collected from the Göynük Stream, a tributary of the Murat River, Turkey. The aims of the present study were to Genomic DNA was extracted using DNeasy Blood and provide both a morphological and molecular characterization Tissue Kit (Qiagen) and resuspended in 200 μl of AE buffer. of this new diplozoid from this host species and compare our The second internal transcribed spacer (ITS2) rDNA, a data with historical findings. meaningful genetic marker for species identification and analysis of parasite population variation, was amplified following the method published in Matějusová et al. (2001b). Material and methods The PCR product (cca 820 bp) was visualized on 1 % GoldView-stained agarose gel and purified using High Pure Sample collection PCR Product Purification Kit (Roche). The purified PCR product was sequenced in both direc- Fish were sampled monthly (10–19 specimens each month; tions using the same primers as in the amplification reaction 120 specimens in total), from April 2010 to December 2010 (DITS2F: 5′ GGCTYRYGGNGTCGATGAAGAACGCAG by electrofishing and fishnet from the Göynük Stream, a 3′; DITS2R: 5′ GCCGGATCCGAATCCTGGTTAGTTTC tributary of the Murat River, Ilicalar-Bingöl, Turkey TTTTCCT 3′). Sequencing reactions were performed using (38°58′36.99″ N; 40°40′42.13″ E). The studied area is a the fluorescent chemistry of BigDye Terminator v3.1 Ready thermal river, which had an average water temperature of reaction Cycle Sequencing Kit. The purified products 22 °C during the time of our research (the temperature (BigDye X-Terminator Purification Kit; according to the ranged between 16 and 25 °C each month). The size (total manufacturer’s protocol) of the sequencing reaction were length) of fish ranged from 85 to 152 mm. Collected fish analyzed using an ABI 3130 Genetic Analyzer (Applied were sacrificed within 24 h and dissected to record parasites. Biosystems by Life Technologies, Carlsbad, California) under the appropriate module. Sequences were analyzed using Morphometric analysis Sequencing Analysis 5.2. (Applied Biosystems) and Sequencher 5.0 (Gene Codes Corp.) software. BLAST Parasites were fixed and stored in absolute ethanol at 4 °C. (blastn) searches were carried out to identify similar sequences One of the anterior parts of the parasite body was used for submitted to the EMBL nucleotide sequence database. The DNA analysis; the second anterior part was stained with nucleotide sequence of the diplozoid species characterized in iron-acetocarmine (Georgiev et al. 1986) and mounted in the present study was compared with 17 previously sequenced Canada balsam. For morphometric analysis, only one European and Chinese diplozoids submitted to nucleotide opisthaptor of each specimen was cutoff (Khotenovsky databases. As no corresponding sequences to the studied 1974) and soaked in 10 % sodium dodecyl sulfate for 30– ITS2 region of sister taxa to the Diplozoidae—Octomacridae 60 min. This was done in order to soften rigid tissue and and Discocotlidae (Boeger and Kritsky 1993)—were avail- thereby to make the clamps and central hooks clearly visible able in GenBank database, the sequence of Zeuxapta seriolae (Wong et al. 2006;Košková et al. 2010). The treated (from the related Axinidae) was used as an outgroup in all opisthaptor was washed in distilled water before being analyses. Multiple sequence alignment, the estimation of ge- mounted on a microscope slide and fixed with a mix- netic distances between species sequences, and phylogenetic ture of ammonium picrate and glycerin (Malmberg 1956; comparison were constructed in MEGA5 (Tamura et al. 2011) Khotenovsky 1974). According to the method of alcohol and BioEdit v. 7.0.9.0. (Hall 1999) software. The evolutionary fixation used for molecular analysis, the opisthaptor and the distances were computed using the Kimura two-parameter rest of the anterior part of the body needed to be fixed method (Kimura 1980); the rate variation among sites was separately; thus, the type material was composed of two slides modeled with a gamma distribution (shape parameter=1) and (clamps on one slide and the stained body on the second). A bootstrap test (1,000 replications). Phylogeny reconstruction light microscope equipped with differential interference con- was performed using MEGA5 software and evolutionary trast, a digital image analysis system (AnalySIS Five Auto), history was inferred by the following statistical methods: (1) and drawing attachment were used for morphometric analysis neighbor joining (NJ) (Saitou and Nei 1987)—Kimura two- Parasitol Res (2013) 112:3053–3062 3055 parameter model, (2) maximum parsimony (MP)—Close- Neighbor-Interchange algorithm, and (3) maximum likelihood (ML)—data-specific model and Nearest-Neighbor- Interchange with a discrete Gamma distribution (five catego- ries (+G, parameter=2.7990)) (Nei and Kumar 2000). To select the appropriate nucleotide substitution model of evolution for ML according to the Akaike Information Criterion, corrected, the model with the lowest Bayesian Information Criterion score—GTR+G—wasconsideredtodescribethe substitution pattern the best. The bootstrap tests represent 1,000 replicates (Felsenstein 1985).

Results

In this work, G. rufa was registered for the first time as a host for a newly described diplozoid species, Paradiplozoon Fig. 2 P. bingolensis sp. n.; the arrangement of the clamps in one row (scale bar 100 μm). Photo by M. Koyun bingolensis sp. n. Adult parasites were found on the gill apparatus of garra during each particular fishing-out. In total, 92 out of 120 fish (a prevalence of 77 %) were infected. The mean intensity of infection was 1.7 per fish (range 1–4). plate is slightly rounded. Rectangular anterior joining sclerite is connected to the proximal tip of anterior jaw. The Morphological description and characterization posterior end of the median plate narrows and terminates with a wide rounded sclerite with an opening; the posterior P. bingolensis sp. n. joining sclerite is short. The sclerites of the anterior and Description according measurements performed on 30 posterior jaws are very massive; the sclerites of the posterior specimens: The mean total body length of adult specimens jaws are not divided into two parts as in other species of is 3.85 mm (3.2–4.5 mm). The body of adults is typically X- Paradiplzooon. The sclerites of the anterior jaws are turned shaped, divided into anterior and posterior parts. Between upwards in the medial line and connected with the anterior them, there is a region of fusion. The anterior part of body joining sclerite of the medial plane. The central hooks are contains vitellaria and almost all the internal organs (e.g., true to type, situated near the first pair of clamps. The length digestive tract). The female and male reproductive organs, × width (N=30; values of measurement in micrometer) of the – – terminal part of gut, and attachment apparatus are situated in first clamp is 144.7 153.3×108.5 114.6, the second clamp – – – the posterior part. This (posterior) part is without tegumental 143.8 146.3×101.2 107.4, the third clamp 150.5 151.4× – – – ridges, folds, or a saucer-like shapes; the absence of which is 97.9 101.3, and the fourth clamp 144.7 153.2×108.5 typical for all representatives of the Paradiplozoon (Fig. 1). 114.6 and the length of the central hook sickle (N=30) is – Attachment apparatus consist of four pairs of clamps and one 17.5 20.8. Drawings of the third attachment clamp of the pair of the central hooks on the ventral side of each opisthaptor. The clamps of P. bingolensis are generally built from strong sclerites (Fig. 2). The anterior end of the median

Fig. 3 P. bingolensis sp. n.; a morphology of the clamp (scale bar Fig. 1 P. bingolensis sp. n.; total view (scale bar 1 mm) 100 μm); b central hook (scale bar 20 μm) 3056 Parasitol Res (2013) 112:3053–3062 holotype with details of anterior and posterior joining The numbers of base substitutions per site from averaging sclerites of the median plate and central hook are shown over all sequence pairs between defined genera groups are in Fig 3. shown in Table 1. Distance data that are not shown also Type host: G. rufa (Heckel, 1843) (Actinopterygii, revealed that Paradiplozoon was the most variable genus Cyprinidae) (average evolutionary divergence over sequence pair within Site on host: Gills genus group—0.309±0.026); on the other hand, no variabil- Type locality: Göynük Stream, a tributary of the Murat ity was detected in Diplozoon (0.000±0.000). Eudiplozoon River, Turkey (38°58′36.99″N; 40°40′42.13″E). and Inustiatus were assigned lower distances within the Type material: Type specimens are deposited at the group—0.001±0.001 and 0.005±0.003, respectively. This Institute of Parasitology, Biology Centre of the Academy of estimation in the Sindiplozoon genus was not possible (there Sciences of the Czech Republic, České Budějovice, Czech was just one sequence in the dataset). Republic (one holotype, five paratypes—cat. no. M-536); Concerning species variability, P. hemiculteri was the the rest of measured specimens in the Zoology Department, most variable species (estimate of average evolutionary di- University of Harran, Sanliurfa, Turkey (24 paratypes—cat. vergence over sequence pairs within group—0.004±0.002; no. ZMHRU-HEL-2010-97). data not shown). In addition to this high variability in the Etymology: The specific name refers to the city in which P. hemiculteri species, it was possible to observe very weak Bingöl University is located. support for a degree of species validity with respect to Paradiplozoon and Inustiatus, as the divergences between Molecular characterization and analyses species were even smaller than those within species, e.g., when comparing DQ098883 with DQ098886 (both P. Sequenced rDNA contained partial sequences of 5.8S parabramisi)—0.001±0.001, and on the other hand, when and 28S and a complete sequence of the ITS2 region. comparing DQ098883 (P. parabramisi) with DQ098882 Regions of ambiguity were removed. The obtained final (P. parapeleci), or DQ098891 (P. diplophyllorchidis)with sequence (consensus of five individuals; 100 % identi- DQ098890 (Paradiplozoon opsariichthydis)—0.000±0.000 ty) was 725 bp long and was deposited in the (for more examples and details see Table 2). These discrep- DDBJ/EMBL/GenBank database with accession number ancies, which also flow into polytomy in the phylogenetic HE653910. The total length of the full ITS2 rDNA tree, are discussed later. sequence was 602 bp. However, the results of our analyses strongly support According to the BLAST comparison, the obtained rDNA the existence of P. bingolensis as a new species not sequence showed very little similarity to already known spe- only at the morphological but also at the molecular cies, e.g., max. identity of 75 % with Diplozoon paradoxum, level. According to the estimation of evolutionary diver- Paradiplozoon homoion,andParadiplozoon bliccae;73% gence between 32 related sequences, the most closely with Paradiplozoon pavlovskii, Paradiplozoon nagibinae, related species to P. bingolensis could be D. paradoxum Paradiplozoon megan,andSindiplozoon ctenopharyngodoni; (0.368±0.037), P. bliccae (0.370–0.371±0.038–0.039), and 71 % with Paradiplozoon hemiculteri, Paradiplozoon P. homoion (0.375±0.038), and Paradiplozoon sapae parabramisi, Paradiplozoon parapeleci, Paradiplozoon (0.380±0.040) (Table 2). jiangxiensis, Paradiplozoon diplophyllorchidis and other After the phylogeny reconstruction (Fig. 4), the fol- species. lowing optimal trees were evaluated, compared, and The analysis of the alignment containing 767 sites (in- combined together: (1) the NJ tree with a sum-of- cluding gaps) and 32 taxa in MEGA5 revealed that the ITS2 branches length of 3.44559019; (2) the MP tree (no. 1 dataset included 124 singletons, 253 conserved sites, and of 88) with a consistency index of 0.699085, a retention 498 variable sites; 372 sites were found to be parsimony index of 0.913058, and a composite index of 0.676938 informative. (0.638305) for all sites and parsimony-informative sites

Table 1 Estimation of evolutionary divergence over Paradiplozoon Diplozoon Eudiplozoon Sindiplozoon Innustiatus sequence pairs between genera groups Diplozoon 0.330 (0.029) Eudiplozoon 0.425 (0.036) 0.274 (0.029) Sindiplozoon 0.415 (0.034) 0.212 (0.023) 0.304 (0.030) Innustiatus 0.546 (0.045) 0.398 (0.038) 0.351 (0.039) 0.403 (0.037) Standard error estimates are Zeuxapta 2.303 (0.467) 2.261 (0.528) 2.314 (0.554) 3.222 (1.169) 2.315 (0.573) shown in every other column. aaio e 21)112:3053 (2013) Res Parasitol Table 2 Estimation of evolutionary divergence between sequences (corresponding to taxa in the phylogenetic tree)

12345678910111213141516

1 (0.037) (0.037) (0.049) (0.048) (0.049) (0.049) (0.048) (0.038) (0.039) (0.042) (0.041) (0.041) (0.042) (0.042) (0.038) 2 0.368 (0.000) (0.027) (0.027) (0.028) (0.028) (0.027) (0.008) (0.008) (0.052) (0.052) (0.052) (0.052) (0.053) (0.011) 3 0.368 0.000 (0.027) (0.027) (0.027) (0.027) (0.027) (0.008) (0.008) (0.052) (0.051) (0.052) (0.052) (0.052) (0.011) 4 0.465 0.274 0.272 (0.000) (0.001) (0.001) (0.000) (0.025) (0.025) (0.056) (0.054) (0.055) (0.056) (0.056) (0.027) 5 0.464 0.273 0.272 0.000 (0.001) (0.001) (0.000) (0.025) (0.025) (0.056) (0.054) (0.055) (0.056) (0.056) (0.027) 6 0.468 0.276 0.275 0.001 0.001 (0.000) (0.001) (0.025) (0.025) (0.056) (0.055) (0.056) (0.056) (0.056) (0.027) –

7 0.468 0.276 0.275 0.001 0.001 0.000 (0.001) (0.025) (0.025) (0.056) (0.055) (0.056) (0.056) (0.056) (0.027) 3062 8 0.464 0.273 0.272 0.000 0.000 0.001 0.001 (0.025) (0.025) (0.056) (0.054) (0.055) (0.056) (0.056) (0.027) 9 0.370 0.047 0.048 0.255 0.255 0.258 0.258 0.255 (0.000) (0.053) (0.052) (0.053) (0.053) (0.054) (0.012) 10 0.371 0.047 0.048 0.256 0.255 0.258 0.258 0.255 0.000 (0.053) (0.052) (0.053) (0.053) (0.054) (0.012) 11 0.422 0.536 0.533 0.545 0.548 0.553 0.553 0.548 0.545 0.542 (0.002) (0.000) (0.001) (0.002) (0.050) 12 0.420 0.534 0.531 0.538 0.540 0.546 0.546 0.540 0.543 0.540 0.004 (0.002) (0.003) (0.003) (0.049) 13 0.421 0.535 0.532 0.544 0.546 0.552 0.552 0.546 0.544 0.541 0.000 0.004 (0.001) (0.002) (0.050) 14 0.424 0.539 0.536 0.548 0.551 0.556 0.556 0.551 0.548 0.545 0.001 0.006 0.001 (0.002) (0.050) 15 0.428 0.544 0.541 0.554 0.557 0.562 0.562 0.557 0.554 0.550 0.003 0.007 0.003 0.004 (0.050) 16 0.375 0.074 0.073 0.266 0.265 0.268 0.268 0.265 0.078 0.078 0.517 0.515 0.516 0.519 0.525 17 0.375 0.074 0.073 0.266 0.265 0.268 0.268 0.265 0.078 0.078 0.517 0.515 0.516 0.519 0.525 0.000 18 0.375 0.074 0.073 0.266 0.265 0.268 0.268 0.265 0.078 0.078 0.517 0.515 0.516 0.519 0.525 0.000 19 0.425 0.539 0.537 0.549 0.552 0.557 0.557 0.552 0.549 0.545 0.001 0.006 0.001 0.003 0.004 0.520 20 0.447 0.139 0.138 0.284 0.283 0.286 0.286 0.283 0.141 0.142 0.572 0.570 0.571 0.575 0.580 0.139 21 0.403 0.064 0.063 0.272 0.271 0.268 0.268 0.271 0.044 0.041 0.545 0.543 0.544 0.548 0.554 0.092 22 0.421 0.535 0.532 0.544 0.546 0.552 0.552 0.546 0.544 0.541 0.000 0.004 0.000 0.001 0.003 0.516 23 0.417 0.539 0.537 0.544 0.546 0.552 0.552 0.546 0.549 0.545 0.001 0.006 0.001 0.003 0.004 0.520 24 0.421 0.535 0.532 0.544 0.546 0.552 0.552 0.546 0.544 0.541 0.000 0.004 0.000 0.001 0.003 0.516 25 0.426 0.541 0.538 0.540 0.543 0.548 0.548 0.543 0.550 0.547 0.001 0.006 0.001 0.003 0.004 0.521 26 0.417 0.539 0.537 0.544 0.546 0.552 0.552 0.546 0.549 0.545 0.001 0.006 0.001 0.003 0.004 0.520 27 0.420 0.090 0.092 0.282 0.281 0.284 0.284 0.281 0.086 0.086 0.566 0.564 0.565 0.569 0.575 0.090 28 0.380 0.053 0.053 0.266 0.266 0.269 0.269 0.266 0.038 0.038 0.545 0.543 0.543 0.547 0.553 0.081 29 0.406 0.212 0.211 0.303 0.302 0.306 0.306 0.302 0.231 0.231 0.569 0.577 0.568 0.572 0.577 0.208 30 0.515 0.400 0.398 0.350 0.349 0.353 0.353 0.349 0.399 0.400 0.666 0.671 0.666 0.671 0.672 0.400 31 0.505 0.397 0.395 0.350 0.349 0.353 0.353 0.349 0.400 0.401 0.654 0.659 0.654 0.659 0.661 0.398 32 2.921 2.283 2.239 2.333 2.309 2.309 2.309 2.309 1.982 1.982 2.327 2.362 2.327 2.362 2.327 2.221

17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32

1 (0.038) (0.038) (0.041) (0.044) (0.042) (0.041) (0.041) (0.041) (0.042) (0.041) (0.041) (0.040) (0.041) (0.054) (0.052) (0.777) 2 (0.011) (0.011) (0.052) (0.016) (0.010) (0.052) (0.052) (0.052) (0.053) (0.052) (0.013) (0.009) (0.023) (0.040) (0.039) (0.479) 3 (0.011) (0.011) (0.052) (0.016) (0.010) (0.052) (0.052) (0.052) (0.052) (0.052) (0.013) (0.009) (0.023) (0.039) (0.039) (0.464) 4 (0.027) (0.027) (0.056) (0.028) (0.026) (0.055) (0.055) (0.055) (0.055) (0.055) (0.028) (0.026) (0.029) (0.038) (0.038) (0.538) 5 (0.027) (0.027) (0.056) (0.028) (0.026) (0.055) (0.055) (0.055) (0.055) (0.055) (0.027) (0.026) (0.029) (0.038) (0.038) (0.529) 6 (0.027) (0.027) (0.056) (0.029) (0.026) (0.056) (0.056) (0.056) (0.055) (0.056) (0.028) (0.027) (0.030) (0.038) (0.038) (0.529) 7 (0.027) (0.027) (0.056) (0.029) (0.026) (0.056) (0.056) (0.056) (0.055) (0.056) (0.028) (0.027) (0.030) (0.038) (0.038) (0.529) 3057 3058 Table 2 (continued)

17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32

8 (0.027) (0.027) (0.056) (0.028) (0.026) (0.055) (0.055) (0.055) (0.055) (0.055) (0.027) (0.026) (0.029) (0.038) (0.038) (0.529) 9 (0.012) (0.012) (0.053) (0.017) (0.008) (0.053) (0.053) (0.053) (0.054) (0.053) (0.012) (0.008) (0.025) (0.040) (0.040) (0.362) 10 (0.012) (0.012) (0.053) (0.017) (0.008) (0.053) (0.053) (0.053) (0.054) (0.053) (0.012) (0.008) (0.025) (0.040) (0.041) (0.362) 11 (0.050) (0.050) (0.001) (0.055) (0.052) (0.000) (0.001) (0.000) (0.001) (0.001) (0.054) (0.053) (0.055) (0.067) (0.065) (0.583) 12 (0.049) (0.049) (0.003) (0.054) (0.052) (0.002) (0.003) (0.002) (0.003) (0.003) (0.054) (0.052) (0.056) (0.067) (0.066) (0.579) 13 (0.050) (0.050) (0.001) (0.055) (0.052) (0.000) (0.001) (0.000) (0.001) (0.001) (0.054) (0.052) (0.055) (0.067) (0.065) (0.583) 14 (0.050) (0.050) (0.002) (0.055) (0.052) (0.001) (0.002) (0.001) (0.002) (0.002) (0.054) (0.053) (0.055) (0.067) (0.065) (0.589) 15 (0.050) (0.050) (0.003) (0.056) (0.053) (0.002) (0.002) (0.002) (0.002) (0.002) (0.055) (0.053) (0.056) (0.068) (0.066) (0.583) 16 (0.000) (0.000) (0.050) (0.016) (0.013) (0.050) (0.050) (0.050) (0.050) (0.050) (0.013) (0.012) (0.022) (0.040) (0.039) (0.454) 17 (0.000) (0.050) (0.016) (0.013) (0.050) (0.050) (0.050) (0.050) (0.050) (0.013) (0.012) (0.022) (0.040) (0.039) (0.454) 18 0.000 (0.050) (0.016) (0.013) (0.050) (0.050) (0.050) (0.050) (0.050) (0.013) (0.012) (0.022) (0.040) (0.039) (0.454) 19 0.520 0.520 (0.055) (0.053) (0.001) (0.002) (0.001) (0.002) (0.002) (0.054) (0.052) (0.055) (0.068) (0.066) (0.553) 20 0.139 0.139 0.575 (0.018) (0.055) (0.055) (0.055) (0.056) (0.055) (0.018) (0.017) (0.025) (0.043) (0.043) (0.585) 21 0.092 0.092 0.549 0.149 (0.052) (0.053) (0.052) (0.053) (0.053) (0.013) (0.007) (0.027) (0.041) (0.042) (0.434) 22 0.516 0.516 0.001 0.571 0.544 (0.001) (0.000) (0.001) (0.001) (0.054) (0.052) (0.055) (0.067) (0.065) (0.583) 23 0.520 0.520 0.003 0.575 0.549 0.001 (0.001) (0.002) (0.000) (0.054) (0.053) (0.055) (0.067) (0.066) (0.583) 24 0.516 0.516 0.001 0.571 0.544 0.000 0.001 (0.001) (0.001) (0.054) (0.052) (0.055) (0.067) (0.065) (0.583) 25 0.521 0.521 0.003 0.577 0.550 0.001 0.003 0.001 (0.002) (0.055) (0.053) (0.056) (0.068) (0.066) (0.610) 26 0.520 0.520 0.003 0.575 0.549 0.001 0.000 0.001 0.003 (0.054) (0.053) (0.055) (0.067) (0.066) (0.583) 27 0.090 0.090 0.570 0.146 0.093 0.565 0.570 0.565 0.571 0.570 (0.012) (0.025) (0.041) (0.041) (0.537) 28 0.081 0.081 0.543 0.130 0.028 0.543 0.548 0.543 0.550 0.548 0.082 (0.023) (0.037) (0.038) (0.426) 29 0.208 0.208 0.572 0.240 0.239 0.568 0.572 0.568 0.574 0.572 0.239 0.213 (0.038) (0.038) (1.487) 30 0.400 0.400 0.672 0.440 0.422 0.666 0.672 0.666 0.672 0.672 0.411 0.393 0.403 (0.003) (0.566) 31 0.398 0.398 0.661 0.437 0.424 0.654 0.661 0.654 0.661 0.661 0.408 0.394 0.403 0.005 (0.572) 32 2.221 2.221 2.275 2.510 2.126 2.327 2.327 2.327 2.383 2.327 2.372 2.135 3.222 2.321 2.308

The numbers of base substitutions per site between sequences are shown. Standard error estimates are shown above the diagonal. Data in bold relate to the new species P. bingolensis. Appellations of 112:3053 (2013) Res Parasitol 32 taxa are stated below and names in parenthesis relate to the genus group 1P. bingolensis sp. n.(Paradiplozoon), 2 AJ563372 D. paradoxum (Diplozoon), 3D. paradoxum (Diplozoon), 4 AF369758 E. nipponicum (Eudiplozoon), 5 AJ300710 E. nipponicum (Eudiplozoon), 6 DQ098895 E. nipponicum (Eudiplozoon), 7 DQ098896 E. nipponicum (Eudiplozoon), 8 DQ098897 E. nipponicum (Eudiplozoon), 9P. bliccae (Paradiplozoon), 10 AJ300712 P. bliccae (Paradiplozoon), 11 DQ098891 P. diplophyllorchidis (Paradiplozoon), 12 DQ098892 P. hemiculteri (Paradiplozoon), 13 DQ098884 P. hemiculteri (Paradiplozoon), 14 DQ098887 P. hemiculteri (Paradiplozoon), 15 DQ098888 P. hemiculteri (Paradiplozoon), 16 P. homoion (Paradiplozoon), 17 AF369760 D. homoion (Paradiplozoon), 18 AJ300715 P. homoion (Paradiplozoon), 19 DQ098885 P. jiangxiensis (Paradiplozoon), 20 AJ300711 P. megan (Paradiplozoon), 21 AJ563371 P. nagibinae (Paradiplozoon), 22 DQ098890 P. opsariichthydis (Paradiplozoon), 23 DQ098883 P. parabramisi (Paradiplozoon), 24 DQ098886 P. parabramisi (Paradiplozoon), 25 DQ098889 P. parabramisi (Paradiplozoon), 26 DQ098882 P. parapeleci (Paradiplozoon), 27 AJ300714 P. pavlovskii (Paradiplozoon), 28 AJ300713 P. sapae (Paradiplozoon), 29 DQ098898 S. ctenopharyngodoni (Sindiplozoon), 30 DQ098893 I. inustiatus (Inustiatus), 31 DQ098894 I. aristichthysi (Inustiatus), 32 EF452638 Z. seriolae (Zeuxapta) – 3062 Parasitol Res (2013) 112:3053–3062 3059

Fig. 4 Unrooted bootstrap consensus tree of MP/ML/NJ analysis based on ML tree topology with Z. seriolae (family Axinidae) as outgroup. Only bootstraps over 50 % are shown. Numbers in parenthesis indicate the number of used individual samples with an identical sequence

(in parentheses); and (3) the ML tree with the highest Chinese Paradiplozoon and, contrariwise to the genetic dis- log likelihood (−5,100.0189). This phylogenetic analysis sup- tance results, it clusters P. bingolensis in the clade with the ports the significant divergences between European and Chinese species. 3060 Parasitol Res (2013) 112:3053–3062

Conclusion from the Cyprinidae and Perciformes families (Khotenovsky 1985; Matějusová et al. 2001b, 2002, 2004; Yildirim et al. P. bingolensis differs from the other species in the genus by 2010). However, in Africa, they also parasitize members of the size of the central hook sickle, by the morphology of the the Characidae (Khotenovsky 1985; Lambert and Le Brun clamp sclerites, especially by the shape (form) of the con- 1988). All diplozoid species described in Europe are host- nection of the anterior jaws to the median plate. Important specific, except P. homoion, which has been recorded in distinguishing feature is that the posterior jaw in this species more than 15 species of cyprinid fish (Khotenovsky 1985; is not divided on medial and lateral sclerites as in the other Matějusová et al. 2002). The validities of eight European genus representatives. P. bingolensis differs also by molec- species have been confirmed by molecular–genetic methods ular comparison of the variable phylogenetic marker—ITS2 (Matějusová et al. 2001b, 2002, 2004;Sicardetal.2001, 2003). region, too. However, in Turkey, only four diplozoid species, Diplozoon barbi, Diplozoon homoion, D. paradoxum, and P. megan, and an unspecified Diplozoon sp. (Özturk et al. Discussion 2002) have been reported in freshwater fishes (according to the checklist of metazoan parasites that was compiled from The freshwater fish fauna in Turkey is rich and includes 164 parasitological studies done in Turkey between 1964 and described species of Cyprinidae (FishBase). Diplozoids are 2003; Öktener 2003). After 2003, the following species were generally considered parasites of cyprinid species but the recorded in Turkey: P. homoion (Özturk 2005; Aydogdu and host specificity differs and relates to geographical origin. In Selver 2006; Koyun and Altunel 2007; Soylu 2007; Soylu Eurasia, diplozoids have recently been confirmed in host fish and Emre 2007; Aydogdu et al. 2009; Özturk 2011), D.

Table 3 Occurrence of diplozoids in freshwater fish from Turkey (1964–2011)

Host fish/parasite species Paradiplozoon Diplozoon Paradiplozoon Diplozoon sp. Paradiplozoon Diplozoon Reference homoion paradoxum sp. Soylu 2009 megan barbi

Barbus capito + Öktener (2003) pectoralis Capoeta trutta + Öktener (2003) Rhodeus sericeus + Öktener (2003) amarus Scardinius + Öktener (2003) erythrophthalmus Leuciscus cephalus + Öktener (2003) Rutilus rutilus + Öktener (2003) + Öktener (2003) + Özturk (2005), Özturk (2011) Alburnus alburnus + Öktener (2003) + Aydogdu and Selver (2006) Chalcalburnus + Özturk (2005) chalcoides Alburnus alburnus + Koyun and Altunel (2007) Pseudophoxinus + Soylu (2007) antalyae + Soylu and Emre (2007) Cyprinus carpio + Soylu and Emre (2007) Aydogdu et al. (2009) Abramis brama + Soylu (2009) Tilapia zilli + Yildirim et al. (2010) Parasitol Res (2013) 112:3053–3062 3061 paradoxum (see Yildirim et al. 2010), and one unspecified are worthy of further study. Gao et al. (2007) found high levels Paradiplozoon sp. (Soylu 2009). These diplozoids parasitize of interspecific similarity (>99 %) among these, as they say, 13 fish species in Turkey (12 cyprinid and 1 perciform) congeneric species and also between Inustiatus inustiatus and (Table 3). Inustiatus aritichthysi. Even the sequences of ITS2 regions in Diplozoids are characterized by high host specificity (ex- these species revealed no conclusive variability. Their ITS2 cept for P. homoion, which is a common parasite of cyprinid sequences reached 99 % of similarity. Eight hundred nine fish); P. megan is a species with a high host specificity for from 822 positions were conservative, 13 of 822 positions chub Leuciscus cephalus; D. paradoxum is a species with a were variable, and only 4 positions were parsimony informa- high host specificity for Abramis brama (Nordmann 1832; tive in their DNA molecule. As many authors state that Khotenovsky 1985; Matějusová et al. 2004). Thus, the dis- measurements of morphological characteristics may be vari- covery of parasites in other fish species in Turkey, such as D. able even within species and could be considered unreliable paradoxum on Rhodeus sericeus amarus (Geldiay and Balýk for identification (Gläser and Gläser 1964;Matějusová et al. 1974 in Öktener 2003), might be considered as species 2002; Gao et al. 2007), we suppose that taxonomical discrep- misidentification. The notable discovery of D. paradoxum ancies could be the result of poor morphological description. on the gills of Tilapia zillii (Gervais 1848) (Perciformes) was Usage of morphological differences that could depend on the published by Yildirim et al. (2010), but poor documentation host species as a determining characteristics and no molecular (a low magnification photo with no details) does not allow analysis for the diplozoid species identification is wrong correct identification to be verified either. and unfortunate. We do not agree with such a trend and Concerning the host, only a few investigations into G. we are sure that identification of mentioned Chinese species rufa parasites have been carried out. Moravec and Rahemo as different ones was incorrect according to vague description. (1993) described the occurrence of nematode larvae Therefore, we strongly recommend further reclassification of Cucullanus sp. encysted in the pericardium; Öktener them. (2003) presents the discovery of the tapeworm Ligula intestinalis and nematode Rhabdochona sp. To date, no Acknowledgments This research was supported by Czech Science species of diplozoid has been identified in G. rufa,andP. Foundation project no. P506/12/1258. The authors would like to thank Matthew Nicholls for the English revision of the draft. bingolensis represents a new species of Diplozoidae parasitizing this host. From the phylogenetic analysis (see MP/ML/NJ tree, Fig. 4), we confirmed the paraphyletic origin of the References Paradiplozoon genus and the conclusion of Matějusová et al. (2004) that P. bliccae, P. nagibinae, and P. sapae were Aydogdu A, Selver M (2006) An investigation of helminth fauna of the more closely related to D. paradoxum than to the rest of the bleak (Alburnus alburnus L.) from the Mustafakemalpasa Stream, Paradiplozoon species (e.g., P. pavlovskii, P. megan, P. Bursa, Turkey. Acta Parasitol Turc 30:69–72 homoion). Also, similarly to Matějusová and others Aydogdu A, Selver M, Aydin C (2009) Occurrence of metazoan parasites of the mirror carp (Cyprinus carpio L.) in a fish farm, (2001b), we observed that P. megan was previously the most Uluabat, Bursa, Turkey. Pakistan J Zool 41:322–326 distant species of this European clade. However, according Bychowsky BE, Nagibina LF (1959) Systematics of the genus to our new findings, it would be possible to claim that P. Diplozoon Nordmann (Monogenoidea). Zool Zh 28:362–377 bingolensis is the most distant species of the mentioned Boeger WA, Kritsky DC (1993) Phylogeny and revised classification of the Monogenoidea Bychowsky, 1937 (Platyhelminthes). Syst phylogenetic clade. Moreover, even if the genetic distances Parasitol 26(1):1–32. doi:10.1007/BF00009644 between sequences classify P. bingolensis to the clade in- Cunningham CO (1997) Species variation within the internal transcribed cluding D. paradoxum, P. bliccae, P. homoion, and P. sapae, spacer (ITS) region of Gyrodactylus (Monogenea: Gyrodactylidae) the tree topology clusters it (bootstrap support 51–67 %) to ribosomal RNA genes. J Parasitol 83:215–219 Felsenstein J (1985) Confidence limits on phylogenies: an ap- the group including Chinese species. This reflects its geo- proach using the bootstrap. Evolution 39:783–791. FishBase: http:// graphical origin of discovery (Turkey). From this, we can www.fishbase.org/search.php conclude that the new species P. bingolensis could represent Gao Q, Chen MX, Yao WJ, Gao Y, Song Y, Wang GT, Wang MX, Nie P a connecting link between European and Asian diplozoid (2007) Phylogeny of diplozoids in five genera of the subfamily Diplozoinae Palombi, 1949 as inferred from ITS-2 rDNA se- species and, therefore, we could consider it as a specific quences. Parasitology 134:695–703 Eurasian species. Moreover, P. bingolensis has a specific Georgiev B, Biserkov V, Genov T (1986) In toto staining method for host (G. rufa), which could support our conclusions. cestodes with iron acetocarmine. Helminthologia 23:279–281 From the circumstantial results of analyses of other species, Gläser HJ, Gläser B (1964) Zur Taxonomie der Gattung Diplozoon Nordmann, 1832. Z Parasitenk 25:164–192 we can suggest that the very small and nonsignificant dis- Hall TA (1999) BioEdit: a user-friendly biological sequence alignment tances between P. diplophyllorchidis, P. opsariichthydis, P. editor and analysis program for Windows 95/98/NT. Nucl Acid S parabramisi, P. parapeleci, P. jiangxiensis,andP. hemiculteri 41:95–98 3062 Parasitol Res (2013) 112:3053–3062

Huyse T, Volckaert FAM (2002) Identification of host-associated species Özturk MO (2005) Helminth fauna of two cyprinid fish species complex using molecular and morphometric analyses, with the (Chalcalburnus chalcoides Guldenstadt 1972, Rutilus rutilus L.) description of Gyrodactylus rugiensoides n. sp. (Gyrodactylidae, from Lake Uluabat, Turkey. Hacettepe J Biol Chem 34:77–91 Monogenea). Int J Parasitol 32:907–919 Özturk MO (2011) Investigation on Paradiplozoon homoion Khotenovsky IA (1974) A method for making preparations of (Monogenea, Diplozoidae) infection of some fishes from Lake diplozoons. Zool Zh 53:1079–1080 Manyas (Balikesir). Firat Univ J Sci 23:57–61 Khotenovsky IA (1985) Fauna of the USSR. Monogenea. Nauka, Özturk MO, Oguz MC, Aydogdu A (2002) An investigation of meta- Leningrad zoan parasitic fauna of pike (Esox lucius L.) and rudd (Scardinius Kimura M (1980) A simple method for estimating evolutionary rate of erythrophthalmus L.) from the Karacabey Lagoon. Türkyie base substitutions through comparative studies of nucleotide se- Parazitol Derg 26:25–328 quences. J Mol Evol 16:111–120 Saitou N, Nei M (1987) The neighbor-joining method: a new method Košková E, Matějusová I, Civáňová K, Koubková B (2010) Ethanol- for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425 fixed material used for both classical and molecular identification Sicard M, Desmarais E, Lambert A (2001) Caractérisation moléculaire purposes: Eudiplozoon nipponicum (Monogenea: Diplozoidae) as des populations de Diplozoidae sur cinq espèces de Cyprinidae: a case parasite species. Parasitol Res 107:909–914. doi:10.1007/ nouvelles donées sur la spécificité parasitaire. Sciences de la vie s00436-010-1949-0 324:709–717 Koyun M, Altunel FN (2007) Metazoan parasites of bleak (Alburnus Sicard M, Desmarais E, Vigneux F, Shimazu T, Lambert A (2003) alburnus), crucian carp (Carassius carassius) and golden carp Molecular phylogeny of the Diplozoidae (Monogenea, (Carassius auratus) in Enne Dam Lake, Turkey. Int J Zool Res Polyopisthocotylea) parasitizing 12 species of Cyprinadea 3:94–100 (Teleostei): new data about speciation. In: Combes C, Jourdane J Krupp FW, Schneider W (1989) The fishes of the Jordan River drainage (eds) Taxonomy, ecology and evolution of metazoan parasites. basin and Azraq Oasis. Fauna Saudi Arab 10:347–416 Universitaires de Perpignan, Perpignan, pp 199–211 Lambert A, Le Brun N (1988) Hypothese sur l’origine biogeographique Šimková A, Matějusová I, Cuningham CO (2006) Molecular phylogeny de Diplozoon (Monogenea, Polyopisthocotylea). Ann Parasit Hum of the Dactylogyridae sensu Kritsky & Boeger (1989) (Monogenea) Comp 63:99–102 using the D1-D3 domains of large ribosomal subunit rDNA. Malmberg G (1956) [On the occurrence of Gyrodactylus on Swedish Parasitology 133:43–53. doi:10.1017/S0031182006009942 fishes.] Skrifterutgivna av Sodra Sveriges Fiskeriforening,pp19–76 Soylu E (2007) Seasonal occurrence and site selection of Matějusová I, Gelnar M, McBeath AJA, Collins CM, Cunningham CO Paradiplozoon homoion (Bychowsky & Nagibina, 1959) on the (2001a) Molecular markers for gyrodactylids (Gyrodactylidae: gills of Pseudophoxinus antalyae Bogutskaya, 1992 from Kepez- Monogenea) from five fish families (Teleostei). Int J Parasitol Antalya, Turkey. Bull Eur Ass Fish Pathol 27:70–73 31:738–745 Soylu E (2009) Monogenean parasites on the gills of some fish species Matějusová I, Koubková B, D’Amelio S, Cunningham CO from Lakes Sapanca and Durusu, Turkey. J Fish Aquat Sci (2001b) Genetic characterization of six species of diplozoids 26:247–251 (Monogenea; Diplozoidae). Parasitology 123:465–474. doi:10.1017/ Soylu E, Emre Y (2007) Monogenean and cestode parasites of S0031182001008617 Pseudophoxinus antalyae, Bogutskaya 1992 and Cyprinus carpio, Matějusová I, Koubková B, Gelnar M, Cunningham CO (2002) Linnaeus 1758 from Kepez Antalya, Turkey. Bull Eur Ass Fish Paradiplozoon homoion Bychowsky & Nagibina, 1959 versus P. Pathol 27:23–28 gracile Reichenbach-Klinke, 1961 (Monogenea): two species or Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) phenotypic plasticity? Syst Parasitol 53:39–47. doi:10.1023/ MEGA5: molecular evolutionary genetics analysis using maxi- A:1019945921143 mum likelihood, evolutionary distance, and maximum parsimony Matějusová I, Koubková B, Cunningham CO (2004) Identification of methods. Mol Biol Evol 28:2731–2739. doi:10.1093/molbev/ European diplozoids (Monogenea, Diplozoinae) by restriction di- msr121 gestion of ribosomal RNA internal transcribed spacer. J Parasitol Wong WL, Tan WB, Lim LH (2006) Sodium dodecyl sulphate as a 90:817–822. doi:10.1645/GE-138R rapid clearing agent for studying the hard parts of monogeneans Moravec F, Rahemo ZIF (1993) Pericardium of Garra rufa (Pisces, and nematodes. J Helminth 80:87–90 Cyprinidae) as the site of infection of cucullanus larvae (Nematoda). Yildirim YB, Zeren A, Genc E, Erol C, Konas E (2010) Parasitological Folia Parasitol 40:145–146 investigation on commercially important fish and crustacean spe- Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford cies collected from the TIGEM (Dortyol Turkey) ponds. J Anim University Press, New York Vet Adv 9:1597–1602 Nordmann A (1832) Mikrographische Beiträge zur Naturgeschichte der Zietara MS, Huyse T, Lumme J, Volckaert FAM (2002) Deep wirbellosen Thiere 1. Berlin divergence among subgenera of Gyrodactylus inferred from Öktener A (2003) A checklist of metazoan parasites recorded in fresh- rDNA ITS region. Parasitology 124:39–52. doi:10.1017/ water fish from Turkey. Zootaxa 394:1–28 S0031182001008939