PDF hosted at the Radboud Repository of the Radboud University Nijmegen

The following full text is a publisher's version.

For additional information about this publication click this link. http://hdl.handle.net/2066/65589

Please be advised that this information was generated on 2021-09-24 and may be subject to change. Targeting the dosage compensation complex to the male X chromosome of Drosophila melanogaster Targeting the dosage compensation complex to the male X chromosome of Drosophila melanogaster

Gene Expression programme European Molecular Biology Laboratory (EMBL) Heidelberg, Germany

And

Department of Molecular Biology Nijmegen Centre for Molecular Life Sciences (NCMLS) Radboud University Nijmegen, The Netherlands Published by the Radboud University Nijmegen Printed by Ponsen & Looijen bv, Wageningen

ISBN/EAN: 978-90-9023194-5

Cover: Artistic interpretation of a Drosophila polytene chromosome squash Targeting the dosage compensation complex to the male X chromosome in Drosophila melanogaster

Een wetenschappelijke proeve op het gebied van de Natuurwetenschappen, Wiskunde en Informatica

Proefschrift

ter verkrijging van de graad van doctor aan de Radboud Universiteit Nijmegen op gezag van de rector magnificus prof. mr. S.CJ.J. Kortmann volgens besluit van het College van Decanen in het openbaar te verdedigen op vrijdag 20 juni 2008 om 10.30 uur precies

door

Jop Haico Kind

geboren op 28 december 1978 te Lelystad Promotor: prof. dr. H.G. Stunnenberg

Copromotor: dr. A. Akhtar, European Moleculair Biology Laboratory Heidelberg, Duitsland

Leden manuscriptcommissie: prof. dr. G.J.M Martens prof. dr. C.P. Verrijzer, Erasmus Universiteit Rotterdam dr. B. van Steensel, Nederlands Kanker Instituut Amsterdam “Caminantes, no hay caminos, hay que caminar” (Text found at a monastery in Toledo, Spain)

Table of contents

Chapter 1

General introduction 09 preview 10 chromatin 10 higher order chromatin and structure 11 epigentics 13 remodeling chromatin 14 nucleosome assembly/disassembly 15 atp-dependent chromatin remodeling 16 histone variants 18 post translational modifications of histones 19 histone code 21 ptms and chromatin structure 23 thinking globally: the nuclear architecture 25 gene anchoring to the nuclear periphery 26 targeting genes to the npc by mlp1 and mlp2 27 dosage compensation 27 targeting the dosage compensation complex to the x chromosome 29 aim o f the study 30 Chapter 2 Cotransciptional recruitment of the dosage compensation complex to 41 X-linked target genes

Chapter 3 Genome-wide analysis reveals MOF as a key regulator of dosage 69 compensation and gene expression in Drosophila

Chapter 4 Nuclear pore components are involved in the transcriptional regulation 123 of dosage compensation in Drosophila

Chapter 5

Summary and general discussion 159

Acknowledgements 169

Curriculum Vitae 171

List of publications 173 General Introduction 10 Chapter 1

General Introduction

Preview

Chromosomes in the nucleus of cells contain all the information a living organism needs to carry out its life processes. Chromosomes are made up of four different nucleotides. These four molecules are comprised of a deoxyribose backbone with one of four (adenine (A), cytosine (C), guanine (G), thymine (T)) nitrogenous bases attached. Different combinations of these four bases make up genes, which encode proteins, the building blocks required to “run” a cell. Each human cell contains about 6 billion base-pairs, which equals about 2 meters in length. This poses two problems: 1) How does two meters of DNA fit in a 5-20 micrometer (a millionth of a meter) large nucleus? 2) If all cells have the same material, how does the one cell becomes muscle, whereas another cell constitutes an eyelash? The answer, which also happened to be the subject of my thesis, is chromatin.

Chromatin

The fundamental unit of chromatin is the nucleosome. Nucleosomes constitute the basic unit of chromatin. One nucleosome is made up of 8 histone proteins, two copies of each H2A, H2B, H3 and H4, around which are wrapped 147 base pairs of DNA, in 1 3/4 left-handed superhelical turns (Finch et al., 1977). In mild physiological conditions, histone H3 and H4 form a tetramer that lays at the center of the nucleosome with a H2A and H2B dimer at either side (Klug et al., 1980; Arends et al., 1991). The nucleosome plus the fifth histone H1, has been termed the chromatosome (for a review see Kornberg, 1999). Only one copy of histone H1 associates with the nucleosome and its association is not required for its constitution (Kornberg 1974). Binding of H1 to both the major groove of the nucleosome dyad and the minor groove of the linker DNA protects another 20bp of DNA (beyond the core particles 147bp) against micrococcal nuclease digestion (Noll and Kornberg 1977; Simpson 1978). The linker DNA is the “free” DNA of variable length between two nucleosomes (Spadafora et al., 1976). Based on the formation of what has been called “superstructures” upon addition of H1 to the nucleosome, H1 is believed to stabilize General Introduction 11 the nucleosome and to facilitate the formation of higher order chromatin structures (Thoma et al., 1979; Ramakrishnan et al., 1997; Bednar et al., 1998).

Higher order chromatin structures

In cells chromatin comes in two varieties, euchromatin and heterochromatin. Euchromatin is considered an open chromatin structure, whereas heterochromatin represents a highly condensed inaccessible state. Both states can be defined by the presence of distinct chromatin interacting proteins and posttranslational modifications (PTMs) (for a review see Huisinga et al., 2006). Euchromatin is also regarded as active chromatin with most genes and regulatory regions found in euchromatic regions. Heterochromatin is characteristic of gene-poor regions such as telomeres and centromeres. One can visualize heterochromatin by its distinctive bright staining with interchelating dyes such as DAPI, or by its high electron density with electron microscopy. The structure of heterochromatin is believed to be packaged in a compact regular 30nm fiber (see below) whereas euchromatin has a more discontinues nature as judged by its slower sedimentation speed in sucrose gradients (Gilbert and Allan, 2001). Wrapping DNA in nucleosomes is the first degree of compaction. The second step in chromatin condensation is the less characterized 30nm fiber formation. The 30nm fiber is composed of a tandom array of nucleosomes folded in a condensed higher order structure (Gilbert and Rasahoye, 2005). Formation of the fiber is believed to involve stabilization of the linker histone H1 and the unstructured N- terminal tails that are found to stick out from the nucleosome particle (Luger et al., 1997). An interaction has been observed between the N-terminal tail of histone H4 with the flat face surface of the H2A-H2B histone dimer of an adjacent nucleosome, suggestive of a role of this tail in across nucleosome higher-order chromatin formation (Schwartz et al., 1996; Luger et al.,1997). Interestingly, in line with this observation, fully compacted chromatin fibers can be obtained with any of the histone tails deleted except for the histone H4 N-terminus. More specifically the interaction is mediated by an interaction of the positively charged lysine-rich residues 14-19 with negatively charged acidic residues on the H2A-H2B dimer coined the “acidic patch” (Luger et al., 1997; Suto et al., 2000; Dorigo et al., 2003). The importance of this 12 Chapter 1 interaction was further highlighted by the finding that eukaryotic cells have devised a way to change the nature of the acidic patch, by the incorporation of the histone variants H2A.Z and H2ABbd (Bar body deficient). H2A.Z increases, whereas H2Abbd reduces the acidic character of the acidic patch thereby respectively stabilizing and destabilizing the inter-nucleosome interactions (Clakson et al., 1999; Chatwick and Willard 2001 and discussed below). As the N-terminal histone tails are susceptible to a wide range of covalent PTMs, another way of changing this interaction is by neutralization of the positive charge on the H4 N-tail by acetylation (discussed below). Normally interphase cellular chromatin is found as a 30nm fiber (Langmore and Schutt, 1980), Originally the histone linker H1 was placed on the inside of the 30nm fiber with the linker DNA connecting two consecutive nucleosomes within the same stack. Per turn 6-8 nucleosomes coil around a central cavity constituting the superhelix. The formation of such a superhelix is termed a one-start helix (Widom and Klug, 1985). In contrast, in the two-start model the linker DNA is found on the outside of the superhelix connecting nucleosomes of consecutive stacks (Woodcock et al., 1984). Recently, an elegant study showed that most likely the 30nm fiber forms a two-step helix (Dorigo et al., 2004). The authors use the recently identified interaction between the acidic patch and the histone H4 tail to select a pair of cystein- replacement mutants that would allow stabilization (by di-sulfite bridges) of the 30nm fiber. Such a fiber was prone to digestion by a specific restriction enzyme at a site present in the linker DNA, showing that the linker-DNA is found on the outside of the superhelix. Moreover, restriction of the linker DNA of a 10 or 12 nucleosomal repeats resulted in two products of 5 or 6 nucleosomes respectively, explanatory of a two step model with stacks formed by disulfite cross-links and linker DNA connecting nucleosomes of two adjacent stacks (Dorigo et al., 2004). Although at low-angle-X-ray diffraction most of the chromatin appears as 30nm fibers, larger structures of 60-130nm fibers have also been observed by EM. These structures, (termed “chromonema”) are actual fibers most probably comprised of higher order compaction of 30nm fibers (Belmont and Bruce, 1994). The authors estimate that the formation of these “chromonema” results in a 160-1000 compaction. Maximum compaction the two meters of DNA (in interphase cells) thus will result in 2000^m of “chromonema” to fit in a 2-20^m small nucleus. General Introduction 13

Figure 1. Different structural levels of chromatin organization.

Epigenetics

Since all cells carry the same genetic material, how then can an organism create such a diversity of cell types? The genome carries all necessary information to provide variability, but is not directly responsible for creating this diversity of cell types. DNA compacted in more or less condensed chromatin structures, occludes or allows binding DNA regulatory proteins to their template. And although DNA sequences are involved to some extent in determining nucleosome depositing (for a review see Rando and Ahmad, 2007) and higher order chromatin formation (for a review see Gilbert et al., 2005), de novo heterochromatin formation on sites normally devoid of heterochromatin shows that DNA sequences do not dictate the chromatin it is wrapped in. For example, although centromeres contain specific repeat sequences (a-satellite repeats) that are believed to facilitate constitutive (meaning obligatory silenced as opposed to faculatively silenced) heterochromatin formation (Gilbert et al., 2004), these sequences are not conserved in higher eukaryotes (Keith and Fitzgerald-Hayes, 2000) and some centromeres are formed on sites devoid of a - satellite repeats (Du Sart et al., 1997). Also new centromeres (neocentromeres) 14 Chapter 1 generally form in regions that do not contain any a-satellite repeats (Du Sart et al., 1997). In order to understand gene regulation, it is therefore of great importance to decipher the exact influence chromatin has on gene-regulation and the factors involved in changing the chromatin structure. Epigenetics is the field that studies such phenomena. The term is a conjunction of “epigenesis” (morphogenesis, development) and “genetics”, originally used to collectively describe all the events an organism undergoes from the fertilized zygote to the mature organism (Waddington, 1951). Nowadays, the term “epigenetics” refers to features such as chromatin and DNA modifications that are stable over rounds of cell divisions but do not involve changes in the underlying DNA sequence of the organism (for a review see, Bird, 2007). As my thesis deals with the epigenetics of chromatin and not with DNA modifications the focus will be solely on the inheritable changes the chromatin structure can pose on the genome. Several such epigenetic mechanisms are discussed below.

Remodeling chromatin

As described above, the nucleosome serves to compact DNA in order to fit in the nucleus, but this compaction also blocks the transcription machinery from reading the genetic material. Nucleosomes occlude transcription factor binding to promoters and hinders the polymerase as it travels along its template (for a review see, Li et al., 2007). Transcribing genes were shown to be assembled in nucleosomes (Lacy and Axel, 1975), the question is, how does the transcription machinery overcome this physical obstacle? There are a number of different ways of changing the nucleosome- DNA interaction known to date that involve, nucleosome assembly/disassembly, ATP-dependent remodeling, replication independent incorporation of histone variants and post transcriptional modifications of the histones. Each of these mechanisms will be separately discussed in the sections below.

Nucleosome assembly/disassembly

Transcription of a gene involves four steps: initiation, promoter escape, elongation and termination (for a review see, Svejstrup, 2004). The whole procedure General Introduction 15 is a complex sequence of events that involves a multitude of proteins or protein complexes that are involved in distinct steps (often more then one step) of the process (Saunders et al., 2006). Where most active promoters are cleared of nucleosomes, the body of the gene is not (Lee et al., 2004). The rate of Polymerase II transcription in in vitro transcription assays, is severely slowed down on a chromatinized template as compared to naked DNA (Kireeva et al., 2002). The transcription rate can be increased by transcription in a high salt buffer that destabilizes the nucleosomes (Kireeva et al., 2002). Thus, in order to allow Pol II transcription through nucleosomes at least partial relaxation of the nucleosome structure is required. On mechanism, which helps achieve this relaxation , is nucleosome disassembly. Nucleosomes are assembled during DNA replication in a process facilitated by histone chaperones (for a review see, Polo and Almouzni, 2006). Nucleosome assembly at replication is a step-wise process that involves different chaperons. CAF1 and/or Asf1 facilitate to deposition of H3/H4 tetramers, whereas Nap1 adds H2A/H2B at a later step to build the octasomes (for a review see, Zlatanove et al., 2007). Likewise, chaperones are also believed to be involved in nucleosome disassembly and reassembly in processes such as, DNA repair, recombination, and transcription (Polo and Almouzni, 2006). At transcribing genes, 95% of the H2A/H2B dimers and only 5% of the H3/H4 tetramer is exchanged, suggesting that the Pol II complex is able to transcribe through the H3/H4 tetramer (Thiriet and Hayes 2005). Another study suggests that only 1 H2A/H2B dimer is displaced, which would result in transcription through a hexasome (Kireeva et al., 2002). Nucleosome assembly factors normally display preference for the histones they displace and also for the assembly step they are involved in (Polo and Almouzni, 2006). For example, Asf1 and FACT are both involved in disassembly and assembly of H3/H4 and H2A/H2B respectively. Interestingly, the disassembly of H2A/H2B by NAP1 has been described to facilitate transcription factor binding (Walter et al., 1995). Spt6 facilitates chromatin assembly behind the elongating polymerase (Kaplan et al., 2003). That reassembly behind the elongating polymerase is equally important as paving the way in front of Polymerase, is illustrated by a loss of Spt6 in yeast. Loss of Spt6 results in faulty transcription initiation from cryptic promoters, a process known to be detrimental to normal transcription (Kaplan et al., 2003). Moreover in another study, the loss of Spt6 16 Chapter 1 allowed transcription to occur even in the absence of activating transcription factors, suggestive of an important role for histone reassembly in shutting off transcription (Adkins and Tyler 2006).

ATP-dependent nucleosome remodeling

Although active promoters are generally cleared from nucleosomes, throughout the cell cycle, nucleosome occupancy at promoters fluctuates with maximal depletion correlating with maximal expression levels (Hogan et al., 2006). This result argues that although the genome might encode favorable/repressive nucleosome positions that allow certain region such as promoters and regulatory regions to be free of nucleosomes (Segal et al., 2006; Ioshikhes et al., 2006), in repressive conditions, nucleosomes can be moved over unfavorable sequences. Illustrative of such a situation is a study where the in vitro nucleosome occupancy on the PHO5 and PH O 8 promoters is reconstituted in the presence or absence of Drosophila extracts. The favorable position of nucleosomes on naked DNA does not correspond to the native situation recapitulated by assembly in the Drosophila extract, showing that besides the DNA sequence, additional factors are involved in nucleosome positioning (Korber et al., 2006). One such an additional factor is Isw2 in S.cerevisiae. This enzyme has been shown to move nucleosomes against the encoded favorable position in order to block transcription. In the absence of Isw2 the nucleosomes move back and consequently allow transcription to occur (Whitehouse and Tsukiyama 2006). Moving nucleosomes along the DNA is a feature of ATP-dependent chromatin remodeling enzymes that are highly conserved proteins that belong to the swi2/snf2 helicase superfamily of ATP-ases. These proteins can be sub-dived in four families based on sequence similarity of their ATP-ase domains these are: SWI2, ISWI, Mi2/CHD and INO80 (Tsukiyama 2002; Armstrong 2007). The mechanism by which these enzymes exert their function is believed to involve sliding (in a wave like movement) of the nucleosomes along the DNA template (Flaus and Owen-Hughes 2004; Zhang et al., 2006). These enzymes are either involved in activation or repression on the level of both transcription initiation and elongation (Armstrong 2007). Although their activity is normally well defined, different activities have been General Introduction 17 observed for the same enzyme dependent on its association with different complexes (for a review see, Langst and Becker (2001). For example, the ATPase remodeling enzyme ISWI is associated with three different complexes, ACF, CHRAC and NURF. ACF and CHRAC are repressive complexes that are involved in regular spacing of nucleosomes on a DNA template in vivo, whereas NURF disrupts regular spaced nucleosomal arrays (Langst and Becker (2001).

Histone variants

An additional way to alter the chromatin structure is the exchange of conventional histones with histone variants. Several different histone variants have been discovered with the exception of histone H4. These variants are involved in many different cellular functions ranging from transcriptional activation, repression and memory to DNA damage and centromere formation. Different from conventional histones, histone variants are expressed in both a replication dependent and independent manner and are usually encoded by only one gene (for a review see, Bernstein and Hake 2006). Among the most well known histone variants is H2A.X, required for the formation of DNA-damage induced foci. H2A.X functionally differs from H2A in the presence of a unique SQ motif at its C-terminal tail. The serine 139 (S139) is phosphorylated by the ATM kinase. This phosphorylation results in the accumulation of DNA-damage response proteins at the site of the DNA double-stranded break (for a review see, Redon et al., 2002). H2A.X has also a role in meiotic silencing of the XY body in the male germline and maintenance of genomic stability (Celeste et al., 2002; Celeste et al., 2003; Fernandez-Capetillo et al., 2003). Another H2A variant with a very specific function is macro-H2A. Macro-H2A is localized to the female inactive X chromosomes (Xi) (Chakravarthy and Luger, 2006). Different versions exists of this variant that are all found to localize to the Xi (Chatwick and Willard 2001). Interestingly only macroH2A version 1.1 binds with high affinity to O-acetyl ADP-ribose a molecule also involved in telomere silencing (Liou et al., 2000; Kustatscher et al., 2005) although the function of O-acetyl ADP- ribose binding remains elusive. The mechanism by which macroH2A exert its repressive function is poorly understood, although repression of transcription by steric 18 Chapter 1 hindrance of the relatively large macro domain seems most plausible (Doyen et al., 2006) since macroH2A has been shown in vitro to be refractory to SWI/SNF remodeling (Angelov et al., 2003). Interestingly another histone variant H3.3 is enriched on the hyper active male X- chromosome in Drosophila, although different from macroH2A, this enrichment is most likely not the cause but the consequence of hyper-activity. Canonical H3 is namely replaced in a replication independent manner by H3.3 during transcription (Mito et al., 2005). H3.3 is especially interesting since it is the only histone variant that is conserved from yeast to humans (Ahmed and Henikoff 2002). Also, its deposition into transcriptionally active loci is conserved, but its role in transcription remains speculative (Ahmed and Henikoff 2002b; Janicki et al., 2004). The role that most histone variants play in histone biology at present remains uncertain. An attractive hypothesis is that histone variants could epigenetically mark transcriptional history of genes, as is proposed for H2A.Z and could be the case for H3.3 (Brickner et al., 2007). H2A.Z incorparation in the promoter of the INO1 and GAL1 genes in yeast, confers transcriptional memory that allows them to more rapidly respond upon a next round of transcriptional activation (Brickner et al., 2007). In the case of H2A.Z this property most probably involves the formation of a nucleosome structure that is less stable and could be easier to clear off promoters (Suto et al., 2000; Ramaswamy et al., 2005).

Post Translational Modifications of histones

Initially DNA was disregarded as the carrier of genetic information due to the simple nature of its molecule and its underrepresentation in the cell as opposed to proteins (Felsenfeld, 2007). Histones for a long time were believed to be the heritable material not at the least because of their apparent variety (Stedman, 1950 and for a review, Kornberg and Lorch, 1999). Nowadays we know that DNA (the genome) is the heritable material with heritable states preserved by differences in chromatin structure (the epigenome). Where the variety in histones turned out to be most likely due to degradation (kornberg and Lorch, 1999), we know now that despite of the presence of only four canonical histones, endless variations are possibly with the exchange of histone variants and especially with a repertoire of over 30 histone PTMs General Introduction 19

(for a review see, Margueron et al., 2005). At present, the PTMs known are: acetylation, methylation, phosphorylation, ubiquitination, sumulation, ADP- ribosylation and proline isomerization (for review see, Millar and Grunstein 2006). Most modifications localize to the amino-terminal tail (N-tail) and few localize to the carboxy-tail (C-tail) or the globular domains of histones. All these modifications are reversible and there are numerous enzymes that establish these modifications as well as enzymes that remove these modifications (Millar and Grunstein 2006). As the focus in this thesis is mainly on histone acetylation, other modifications are only briefly discussed. It was already noted more than 40 years ago that histone acetylation is associated with transcriptional activity (Allfrey et al., 1964). The way histone acetylation exerts its function on transcription is believed to involve at least two non- mutually exclusive mechanisms. Indirectly, PTMs can create specific platform that are recognized by chromatin binding proteins to promote distinct cellular events or directly by changing electrostatic interaction between the histones and the DNA. Only histone acetylation, through the neutralization of positive charge, and phosporylation by addition of negative charge, are likely candidates to change the electrostatic interactions between chromatin and DNA. Both mechanisms of altering chromatin structure are discussed below. 20 Chapter 1

Figure 2. Different post-translational modifications of histones. (Figure by Mikko Taipale).

The histone code

Histone tail modifications are believed to establish specific “codes” that can be read and translated into different cellular outputs (Strahl and Allis, 2000; Jenuwein and Allis, 2001). The histone code hypothesis states that (1) specific binding modules exists that bind histone tail modifications and (2) that these modifications are interdependent and create various combinations on any of the nucleosomes (3) certain combinations of histone modification have definable and predictable outcomes. Recognition of specific PTMs by chromosomal proteins is based on binding of certain domains such as the chromodomain, WD40 domain, tudor domain, MBT domain and the bromodomain to PTMs (Millar and Grundstein, 2006). Only the bromodomain is involved in the binding of acetylated lysine, all other domains are involved in binding of methylated residues. Conversely a non-modified histone tail could also serve as a binding site, such that specific modifications inhibit binding of an effecter protein. As an example deacetylated H4K16 is the substrate for the hetererochromatin protein Sir3 and the General Introduction 21

ATP-dependent chromatin-remodeling enzyme ISWI (Hecht et al., 1996; Corona et al., 2002). The “histone code hypothesis” predicts that certain single or combinatorial marks have distinct cellular outcomes. The classical example was binding of heterochomatin-like protein 1 (HP1) to methyl H3K9 by its chromodomain to promote heterochromatin formation (Bannister et al., 2001; Lachner et al., 2001). Many more of such examples thereafter were discovered that are consistent with this initial observation (Millar and Grundstein 2006; Berger, 2007). However, some histone marks are associated with both repressor and activator complexes, severely complicating the predictive outcome of certain histone modifications. For example, although di or tri methylation of histone H3 at lysine 4 is generally found associated with actively transcribed genes (Krogan et al., 2002; Ng et al., 2003; Santos-Rosa et al., 2002; Schneider et al., 2004), the mark is also the target site for a histone deacetylase (HDAC) containing Sin3-HDAC1 repressive complex that is activated upon DNA damage (Shi et al., 2006) and the CoR co-repressor complex that binds through its tandom tudor domain of JMJD2A to both H3K4me3 and H4K20me3 (Huang et al., 2006). Similarly, histone acetylation is generally associated with active transcription (Sewack et al., 2001; Schuebeler et al., 2004, Roh et al., 2005). Therefore deacetylation is logically expected to correlate with transcriptional repressive states. Although generally true, recent data also show that a number of HDACs, such as Hos2 and Rpd3 also associate with active genes. Both HDACs associate with the same portion of genes but do so at different transcriptional stages (Wang et al., 2002; De nadal et al., 2004). Moreover, not only are the same marks recognized by different complexes with different transcription implications, also PTMs thus far believed to have a transcriptional repressive role are found associated with active transcription. H3K9 (tri) methyl and HP1 are also found preferentially associated on the ORFs (open reading frame) of active genes (Vakoc et al., 2005). A result strikingly similar to the H3K36 pattern, possibly reflecting a similar role for H3K9me as that attributed to H3K36 in preventing cryptic initiation by reforming the chromatin structure in the wake of active transcription (Carrozza et al., 2005). This observation might also explain the intuitive contradictory action of JMJD2A as discussed above. Intriguingly, 22 Chapter 1 in embryonic stem cells large domains of both high H3K4me3 (active mark) and H3K27me3 (inactive mark) levels have been found, again two marks that are believed to have opposing effects on transcription (Bernstein et al., 2006). As these marks are found on genes involved in development, they might establish transcriptional potential. A similar role might explain the opposing roles attributed to H4K16 acetylation. H4K16Ac is required for preventing heterochromatin spreading at telomeres (Kimura et al., 2002; Suka et al., 2002) and is involved in the hyper­ activation of the male X-chromosome in Drosophila (for a review see, Mendjan and Akhtar, 2006). In line with an activating role for H4K16Ac in transcription, in yeast, on histone H4, only H4K16Ac has a direct effect on transcription whereas all other acetylation marks have an additive effect (Dion et al., 2005). Surprisingly therefore, is the finding that H4K16Ac in yeast negatively correlates with transcription (Kurdistani et al., 2004). Since one the early events in transcription involves histone acetylation, H4K16Ac might establish transcription potential as it has been suggested previously (Anguita et al., 2001). Therefore, although it has been very convincible shown over the past decade that histone modifications can target specific effector proteins and that certain modifications, alone or in combination, are generally correlated with distinct chromatin structures and transcriptional events, in order to “read and interpret the code” one needs to consider the regulatory context in order to understand the biological meaning of “the code” (Berger, 2007).

PTMs and chromatin structure

Although most acetylation is found in promoters and regulatory regions (Bernstein et al., 2005), a second means of acetylation-mediated transcriptional control has been correlated with broad acetylation (>100kb) that spans single genes or entire gene clusters, such as the growth hormone or ß globin locus (Elefant et al., 2000; Kinura et al., 2004). These domains are generally gene-dense and sensitive to DNaseI digestion and are therefore thought to be in an open chromatin conformation. In this case acetylation of histone tails is believed to neutralize the charge of the basic histone H3/H4 tails and thereby disrupt the interaction with the negatively charged General Introduction 23

DNA (Grundstein, 1997). Hyper-acetylation of histone tails has been shown to; weaken nucleosome stability (Brower-Toland al., 2005; Dunker et al., 2001), increase accessibility of chromatin fibers (Anderson and Widom, 2001; Gorisch et al., 2005), facilitate the H2A/H2B exchange during transcription elongation (Morales and Richard-Foy, 2000) increase RNA polymerase II elongation rates and reduce stuttering (Protacio et al., 2000). As mentioned above, fully compacted chromatin fibers can be obtained with any of the histone tails deleted except for the histone H4 N-terminus. Histone H4 thus, is the most likely candidate to pose any major structural change upon the chromatin fiber. H4K16Ac specifically has been shown to cause an increase in the a- helical content of Histone H4, and to prevent 30nm chromatin-fiber formation and cross fiber interactions (Shogren-Knaak et al., 2006). Possibly as the residues 14-19 in the histone H4 tail interact with the “acidic patch” formed by the histones H2A/H2B (Dorigo et al., 2003; Schalch et al., 2005; Fan et al., 2004) neutralisation of the positive charge by acetylation could results in weakening of the nucleosome- nucleosome interaction and a destabilization of higher-order chromatin formation. In addition, very recently it has been shown that Dot1 the H3K79 methyl-transferase (HMT) involved in heterochromatin formation in yeast, requires a charge based interaction of an acidic patch in the protein with the residues 17-19 in H4 in order to be active as a HMT (Fingerman et al., 2007). Therefore, acetylation might not only influence chromatin structure, but also possibly by a similar mechanism poses constraints on other histone modifying enzymes with opposing chromatin characteristics. As methylation does not change the charge of lysine residues, these PTMs are unlikely to have any structural consequences.

Thinking globally: The nuclear architecture

So far in this thesis, I have discussed chromatin as a more or less condensed linear template, subject to a diverse set of chromatin modifications that exert their function either directly, by electrostatic interaction, or indirectly through effector proteins. However, it is becoming extensively clear that the nucleus is built-up of subcompartments with distinct transcription activities. It is believed that this organization is important to organize and maintain the complexity of the genome. 24 Chapter 1

Therefore in order to understand the complex process of gene expression, one should study a gene of interest or chromatin region in the context of the 3D organization of the genome (Gottschling, 2007). As my thesis involves the functional characterization of nucleoporins I will focus here on the nuclear periphery. Originally the nuclear periphery, and especially the nuclear lamina, has been shown to act as a docking site for many different repressive complexes (for a review see Taddei, 2007). It has long been known through electron microscopy images that heterochromatin clusters to the nuclear periphery, and many nuclear processes that involve repressive heterochromatin formation, such as telomere clustering and the inactive X chromosome in mammals are localized at the nuclear periphery (for review see Shaklei et al., 2007). Heterochromatin extends entirely over the nuclear surface, except for a small circular space adjacent to nuclear pore complexes (NPC) (Dwyer and Blobel, 1976). This space has long been proposed to serve as a locale where transcription and much of the posttranscriptional processes would occur. The NPC in this model serves as a 3D coordination point in the nucleus for expanded (euchromatin) domains to form and simultaneously efficiently “gate” transcripts to the cytoplasm (Blobel, 1985). The view of the nuclear periphery as a repressive zone has only recently experimentally been challenged by the finding that nucleoporins interact with “expanded (transcribable) genes (Casolari et al., 2004) and a number of independent studies have shown that genes are recruited to the periphery upon transcriptional induction (Casolari et al., 2004; Brickner and Walter 2004; Abruzzi et al., 2006; Taddei et al., 2006; Cabal et al., 2006; Brickner et al., 2007). The nuclear periphery has been proposed to provide an optimal transcriptional niche in which genes are confined to 2D lateral movement along the nuclear periphery (Cabal et al., 2006; Taddei et al., 2006) functionally similar to proposed role of the locale surrounding the NPC (Blobel, 1985). Gene expression involves the concerted action of a number of processes such as, transcription initiation, elongation, termination, pre-mRNA processing, quality control and mRNP (messenger ribonucleoprotein particle) assembly and translocation to the NPC for export. These events are frequently found to be interconnected, with most factors, including export factors, already recruited to genes cotranscriptionally. For example the TREX (transcription and export) complex contains factors involved General Introduction 25 in both transcription elongation and mRNA export (Strasser et al., 2002). Furthermore, Sus1 (a component of the SAGA histone acetyltransferase complex) is not only involved in transcriptional activation, but also associates with the Sac3- Thp1-Cdc31 mRNA export complex bound to the NPC by Nup1 (Rodriquez-Navarro et al., 2004). Consequently many factors involved in different steps of gene expression are also required for anchoring genes to the nuclear periphery (for review see Cabal, 2007). Anchoring of active genes to the NPC could create an “optimal niche” to favor the coordination of the different processes occurring at an active gene as in the original version of the ‘gene gating’ hypothesis (Blobel, 1985).

Gene anchoring to the nuclear periphery

That genes localize to the nuclear periphery upon activation suggests that the periphery confers optimal expression levels. Although this is the prevalent view, there are also reports that suggest that genes do not need to be anchored to the periphery in order to be optimally expressed. Cabal et al. show that the expression levels of GAL1 are not affected when the association of this gene with the NPC is abrogated by a deletion of Nup1 (Cabal et al., 2006). Similar data exists on the heat-shock gene HSP104 (Dieppois et al., 2006). Also, transcriptional activity is not required to maintain genes on the periphery as the INO1 gene has been found to remain peripheral up to 6 generations after transcription was turned off (Brickner et al., 2007). It is therefore conceivable that genes are first activated and subsequently relocated to the periphery. The periphery might therefore not directly be involved in transcription activation but more likely has a regulatory function e.g. in maintaining expression levels or to create a platform where the multitude on different factors involved in gene expression meet and coordinate transcript maturation. On the other hand, several groups also report that artificial gene induction can be accomplished by tethering genes to the NPC (Menon et al., 2005; taddei et al., 2006, Brickner et al. 2007). Possibly, these genes profit from a reservoir of different proteins present in the NPC locale that they otherwise would not encounter. It is possible that different nucleoporins play different roles, or even different roles are 26 Chapter 1 played by the same nucleoporins. For example, nucleoporins are reported to be involved in transcriptional memory formation by a process that involves the histone variant H2A.Z (as discussed above) and also in boundary formation (Schmit et al., 2006). Similar to the situation for B-type lamin in Drosophila, nucleoporins could also establish large chromosomal domains that creates a protective transcriptionally active environment shielded off from heterochromatin spreading from neighboring sites (Brown and Silver, 2006). As all studies so far were restricted to yeast it is necessary to widen the scope and also focus on higher eukaryotes.

Targeting genes to the NPC by Mlp1 and Mlp2

Two nucleoporins involved in gene anchoring are Mlp1 and Mlp2 (mammalian TPR, Drosophila Mtor). Mlps are exclusively nuclear and part of the nuclear basket (for a review see, Hetzer et al., 2005). In yeast, Mlp1 and Mlp2 where found to be non-randomly distributed on the nuclear periphery suggesting that NPC exist that do not contain any Mlps (Galy et al., 2000). Non-random distribution of nucleoporins and the existence of different constituted NPC could mirror the underlying periodic organization of the genome as proposed by Blobel (Blobel, 1985). In higher eukaryotes however, TPR and Mtor are found evenly distributed along the periphery (Cordes et al., 1997; Mendjan et al., 2006). Mlps physically associate with a number of different mRNP components and also with the SAGA complex (Green et al., 2003; Galy et al., 2004; Vinciquerra et al., 2005). ChIP and microarray expression experiments show that Mlps associate with frequently transcribed genes with a binding profile across genes with a 3’ bias (Casolari et al., 2004; Casolari 2005). Interesting in this respect is that the 3’UTR was found indispensable for the genes translocation to the nuclear-pore (Cabbei et al., 2006; Abruzzi et al., 2006). Moreover, binding is RNA sensitive, suggesting Mlps association with genes involves the native transcript. Together with Mlps requirement for gene-anchoring (Dieppois et al., 2006), these results argue for cotranscriptional recruitment of Mlps to genes followed by stabilization or translocation of genes to the nuclear periphery. General Introduction 27

Dosage compensation

Sex determination often involves differentiation of a pair of chromosomes such that one sex retains the original two copies (homogametic) whereas in the other sex one of the homologous chromosomes degenerates almost completely with only the exception of a few sex specific genes (heterogametic). The deleterious effects of aneuploidy create the need for a compensatory process that equalizes the gene products between the two sexes (Charlesworth, 1996; Nusinow and Panning 2005).

In Drosophila dosage compensation is achieved by a 2-fold up-regulation of the single male X chromosome, whereas in Mammals and C.elegans up-regulation occurs in both sexes with a reduction of expression in the homogametic sex (for a review see, Straub and Becker, 2007; Deng and Disteche, 2007). Although Dosage compensation is a common phenomenon for many species, the mechanism has evolved independently several times on a relatively short time-scale. Different mechanisms have evolved by adopting different proteins or protein complexes. These involve a condensing like complex in C.elegans (for a review see, Meyer et al., 2004), and the polycomb repressive complexes PRC1 and PRC2 in addition to the histone variant macroH2A (for a review see, Heard and Disteche).

Mammals Drosophilidae C. elegans Birds

Sex XX/XY X/A ratio XX/XO ZW/ZZ determination n X X

Dosage Y XY=xx xx=XO ?? compensation X inactivation X hypertranscription X repression

Condensins Mechanism Polycomb complex MSL complex ?? Polycomb complex

Eed/Enx1 MSLs DPYs, SDCs, M IX-1 Molecules ?? BRCA1 MES proteins

RNA XIST roX1, roX2 ?? ??

Figure 3. Dosage compensation in different species 28 Chapter 1

Dosage compensation in Drosophila is accomplished by the male specific lethal (MSL) complex, which consists of five male specific lethal proteins (MSL1, MSL2, MSL3, MLE and MOF) and two non-coding RNAs (roX1 and roX2). (Mendjan and Akhtar, 2006; Straub and becker, 2007. Interestingly, the MSL proteins (except for MLE) have no known function outside of fly dosage compensation, although the proteins are highly conserved also in species with different dosage compensation mechanisms such as mammals (Marin and Baker 1998).

Targeting the dosage compensation complex to the X chromosome

The molecular mechanism underlying dosage compensation is poorly understood. Part of the function of the MSLs is thought to involve the recruitment and activation of MOF to the X-chromosome. MOF is a histone acetyltransferase (HAT) that unlike most other HATs specifically acetylates lysine 16 of histone H4 (H4K16Ac), a modification found highly enriched on the male X chromosome (Bone et al., 1994). This enrichment on the male X chromosome coincides with the MSLs (Bone et al., 1994; Smith et al., 2001). How the MSL complex distinguishes the X from the autosomes remains a mystery despite of extensive research on the subject. Recent high resolution MSL1 and MSL3 binding profiles revealed interesting insights into MSL targeting to the X chromosome. These analyses revealed that MSL1 and MSL3 are targeted primarily to actively transcribed genes with an overall enrichment towards the 3’ end (Legube et al., 2006; Alekseyenko et al., 2006; Gilfillan et al., 2006). Originally, targeting in D rosophila was believed to involve binding to a limited number of “entry sites” (Kelley et al., 1999). This model emerged from the observation that in flies mutant for either, MSL3, MLE or MOF, a heterodimer of MSL1 and MSL2 targets a limited number (35-100) of sites on the X chromosome. Interestingly, the genes coding for the non-coding RNAs in the MSL complex, rox1 and rox2 were found to constitute an entry site (for a review see, Mendjan and Akhtar, 2006; Straub and Becker, 2007). The nature and function of these sites is very poorly understood. They were believed to function as nucleation sites where the MSL complex enters, followed by spreading in cis to neighboring lower affinity sites This General Introduction 29 theory was supported by the observation that the MSL complex occasionally spreads in cis from ectopically inserted rox genes (Kelley et al., 1999; Kageyama et al., 2001). A number of recent studies however, showed that X chromosomal genes are targeted in trans in the absence of any entry sites (Demakova et al., 2003; Fagegaltier and Baker 2004; Oh et al., 2004), which makes the function of these sites in dosage compensation unclear. At present, the MSL complex is assumed to bind to variable combinations of several degenerative sequences although their predictive power is still very limited (Gilfilian et al., 2006).

Aim of the study

A fundamental question in chromatin biology is how different proteins or protein complexes are targeted to the right place at the right time. Considerable progress has been made with the discovery of a number of domains that recognize specific histone modifications, however, as different complexes recognize the same marks, being able to read a certain code is not the whole story. In addition, the great majority of global analysis of histone modifications were performed in an asynchronously cell population, providing information of only a snapshot of the whole picture. As transcription involves the subsequent recruitment of many different factors as the polymerase complex moves along the gene, it is important to study recruitment of chromatin complexes dynamically in the context of the ongoing transcription machinery. In addition, considerable evidence has highlighted the importance of studying gene expression not only as a linear chromatin template but also globally in the nuclear space. During my thesis I have studied targeting of the MSL complex in Drosophila as a model for general targeting of chromatin complexes. The aim was to study the mechanism of targeting from different angles by applying different techniques to collectively obtain a better understanding of the process, not only at the local gene level but also globally in the nuclear space. Dosage compensation in Drosophila provides excellent opportunities to study targeting of chromatin complexes, as the MSL complex is targeted to hundreds of genes individually by a process that is believed to be mechanistically similar, global analyses have great statistical power to uncover underlying principles of targeting. Furthermore the use of Drosophila as a model organism provides one with well-developed genetic tools and a detailed 30 Chapter 1 annotated genome. In the study presented here, I have combined genetics and global transcription and binding analyses as well as manipulations by RNA interference (RNAi), to gain better understanding of the mechanism underlying targeting of the MSL complex to the male X chromosome. Chapter 2 describes a detailed study on MSL targeting to the two X-linked genes, CG3016 and m of using a combination of chromatin immunoprecipitation (ChIP) and Immuno-FISH on transgenic flies. We show that MSL target recognition requires a combination of transcriptional activity and targeting elements resigning in the 3’ end of both genes. Transcription is most likely required to expose these elements for MSL recognition, as these target elements are necessary but not sufficient on themselves to recruit the MSL complex. These results have led us to propose a model of cotranscriptional recruitment of the MSL complex to X-linked genes based on 3’ target elements. In Chapter 3 we have extended our analysis to a genome-wide scale by hybridizing chromatin immunoprecipitated DNA to high-resolution tiling arrays (ChIP-on-chip) covering the entire fly genome with a 35bp resolution. We observed that on the X chromosome, whereas MSL1 and MSL3 are preferentially associated with the 3’end of genes, MOF binding sites display a bimodal distribution, associating primarily with promoter-proximal regions and 3’ ends of genes. Different from the MSL1 and MSL3 binding profiles that display almost exclusive binding to the X chromosome, MOF binds to promoter proximal regions on male autosomes and the entire female genome. Binding of MOF to promoter proximal regions is independent of the MSL complex on all chromosomes, whereas targeting to the body of dosage compensated genes is interdependent between MSL1 and MOF. Binding of MOF to autosomes is shown to be associated with cis-regulatory function, as H4K16Ac and the transcription levels of a number of genes are affected in MOF-depleted cells. In addition, a comparison between the H4K16Ac profiles between genes on the X chromosome and the autosomes revealed that the distribution of H4K16Ac is a direct reflection of a change in the MOF binding profile. Finally in Chapter 4 we discuss the biochemical purification of the MOF and MSL3 complex and the association of NUP153 and Mtor (two nucleoporins) with the MSL complex. We show that both NUP153 and Mtor are required for the characteristic localization of MSLs to the male X chromosome in male tissue culture General Introduction 31 cells. RNAi mediated depletion of these nucleoporins results in a two-fold downregulation of a number of dosage compensated genes, whereas autosomal genes and genes that are not dosage compensated remain mostly unaffected. Downregulation of these genes is the result of a loss of dosage compensation, since the same genes in a female cell line upon depletion of NUP153 and Mtor remain unaffected. These results reveal a novel physical and functional interaction of two nuclear pore components with the MSL complex. 32 Chapter 1

References

Abruzzi KC, Belostotsky DA, Chekanova JA, Dower K, Rosbash M. 3'-end formation signals modulate the association of genes with the nuclear periphery as well as mRNP dot formation. 2006 Sep 20;25(18):4253-62. Epub 2006 Aug 31. Adkins MW, Tyler JK. Transcriptional activators are dispensable for transcription in the absence of Spt6-mediated chromatin reassembly of promoter regions. Mol Cell. 2006 Feb 3;21(3):405-16. Erratum in: Mol Cell. 2006 Apr 7;22(1):147-8. Ahmad K, Henikoff S. Histone H3 variants specify modes of chromatin assembly. Proc Natl Acad Sci U S A. 2002 Dec 10;99 Suppl 4:16477-84. Epub 2002 Aug 12.. Ahmad K, Henikoff S. The histone variant H3.3 marks active chromatin by replication- independent nucleosome assembly. Mol Cell. 2002 Jun;9(6):1191-200. Alekseyenko AA, Larschan E, Lai WR, Park PJ, Kuroda MI. High-resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes Dev. 2006 Apr 1;20(7):848-57. Epub 2006 Mar 17. Allfrey vg, Faulkner r, Mirsky acetylation and methylation of histones and their possible role in the regulation of RNA synthesis. ae.proc natl acad sci u s a. 1964 may;51:786-94. Anderson JD, Widom J. Poly(dA-dT) promoter elements increase the equilibrium accessibility of nucleosomal DNA target sites. Mol Cell Biol. 2001 Jun;21(11):3830-9. Angelov D, Molla A, Perche PY, Hans F, Cote J, Khochbin S, Bouvet P, Dimitrov S.The histone variant macroH2A interferes with transcription factor binding and SWI/SNF nucleosome remodeling. Mol Cell. 2003 Apr;11(4):1033-41. Anguita E, Johnson CA, Wood WG, Turner BM, Higgs DR. Identification of a conserved erythroid specific domain of histone acetylation across the alpha-globin gene cluster. Proc Natl Acad Sci U S A. 2001 Oct 9;98(21):12114-9. Epub 2001 Oct 2. Arents A and Moudrianakis E.N. The histone fold: a ubiquitous architectural motif utilized in DNA compaction and protein dimerization. Proc. Natl. Acad. Sci. USA 93 (1995), pp. 11174-11179. Armstrong JA. Negotiating the nucleosome: factors that allow RNA polymerase II to elongate through chromatin. Biochem Cell Biol. 2007 Aug;85(4):426-434. Bannister AJ, Zegerman P, Partridge JF, Miska EA, Thomas JO, Allshire RC, Kouzarides T. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature. 2001 Mar 1;410(6824):120-4. Bednar J, Horowitz RA, Grigoryev SA, Carruthers LM, Hansen JC, Koster AJ, Woodcock CL. Nucleosomes, linker DNA, and linker histone form a unique structural motif that directs the higher-order folding and compaction of chromatin. Belmont AS, Bruce K. Visualization of G1 chromosomes: a folded, twisted, supercoiled chromonema model of interphase chromatid structure. J Cell Biol. 1994 Oct;127(2):287-302. Berger SL.The complex language of chromatin regulation during transcription. Nature. 2007 May 24;447(7143):407-12. Bernstein BE, Mikkelsen TS, Xie X, Kamal M, Huebert DJ, Cuff J, Fry B, Meissner A, Wernig M, Plath K, Jaenisch R, Wagschal A, Feil R, Schreiber SL, Lander ES. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell. 2006 Apr 21;125(2):315-26. Bernstein E, Hake SB.The nucleosome: a little variation goes a long way. Biochem Cell Biol. 2006 Aug;84(4):505-17 Blobel G. Gene gating: a hypothesis. Proc Natl Acad Sci U S A. 1985 Dec;82(24):85279. Bone JR, Lavender J, Richman R, Palmer MJ, Turner BM, Kuroda MI. Acetylated histone H4 on the male X chromosome is associated with dosage compensation in Drosophila. Genes Dev. 1994 Jan;8(1):96-104. Brickner JH, Walter P. Gene recruitment of the activated INO1 locus to the nuclear membrane. PLoS Biol. 2004 Nov;2(11):e342. Epub 2004 Sep 28. Brickner DG, Cajigas I, Fondufe-Mittendorf Y, Ahmed S, Lee PC, Widom J, Brickner JH. General Introduction 33

H2A.Z-mediated localization of genes at the nuclear periphery confers epigenetic memory of previous transcriptional state.PLoS Biol. 2007 Brower-Toland B, Wacker DA, Fulbright RM, Lis JT, Kraus WL, Wang MD. Specific contributions of histone tails and their acetylation to the mechanical stability of nucleosomes. J Mol Biol. 2005 Feb 11;346(1):135-46. Epub 2004 Dec 22. Brown CR ,Silver PA. Pore-ing the right dose. Nat Cell Biol. 2006 May;8(5):430-1. Cabal GG, Genovesio A, Rodriguez-Navarro S, Zimmer C, Gadal O, Lesne A, Buc H, Feuerbach-Fournier F, Olivo-Marin JC, Hurt EC, Nehrbass U. SAGA interacting factors confine sub-diffusion of transcribed genes to the nuclear envelope. Nature. 2006 Jun 8;441(7094):770- Casolari JM, Brown CR, Komili S, West J, Hieronymus H, Silver PA. Genome-wide localization of the nuclear transport machinery couples transcriptional status and nuclear organization. Cell. 2004 May 14;117(4):427-39. Carrozza MJ, Li B, Florens L, Suganuma T, Swanson SK, Lee KK, Shia WJ, Anderson S, Yates J, Washburn MP, Workman JL. Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription. Cell. 2005 Nov 18;123(4):581-92. Celeste A, Petersen S, Romanienko PJ, Fernandez-Capetillo O, Chen HT, Sedelnikova OA, Reina-San-Martin B, Coppola V, Meffre E, Difilippantonio MJ, Redon C, Pilch DR, Olaru A, Eckhaus M, Camerini-Otero RD, Tessarollo L, Livak F, Manova K, Bonner WM, Nussenzweig MC, Nussenzweig A. Genomic instability in mice lacking histone H2AX. Science. 2002 May 3;296(5569):922-7. Epub 2002 Apr 4. Celeste A, Fernandez-Capetillo O, Kruhlak MJ, Pilch DR, Staudt DW, Lee A, Bonner RF, Bonner WM, Nussenzweig A. Histone H2AX phosphorylation is dispensable for the initial recognition of DNA breaks. Nat Cell Biol. 2003 Jul;5(7):675-9. Chadwick BP, Willard HF.A novel chromatin protein, distantly related to histone H2A, is largely exclude from the inactive X chromosome. J Cell Biol. 2001 Jan 22;152(2):375 84. Chakravarthy S, Luger K. The histone variant macro-H2A preferentially forms hybrid nucleosomes. J Biol Chem. 2006 S 1;281(35):25522-31. Epub 2006 Jun 27. Charlesworth B. The evolution of chromosomal sex determination and dosage compensation. Curr Biol. 1996 Feb 1;6(2):149-62.. Chiu W, Garner EC, Obradovic Z. Intrinsically disordered protein. J Mol Graph Model. 2001;19(1):26-59. Clarkson MJ, Wells JR, Gibson F, Saint R, Tremethick DJ. Regions of variant histone His2AvD required for Drosophila development. Nature. 1999 Jun 17;399(6737):694-7. Cordes VC, Reidenbach S, Rackwitz HR, Franke WW. Identification of protein p270/Tpr as a constitutive component of the nuclear pore complex-attached intranuclear filaments J Cell Biol. 1997 Feb 10;136(3):515-29. Corona DF, Clapier CR, Becker PB, Tamkun JW. Modulation of ISWI function by site- specific histone acetylation. EMBO Rep. 2002 Mar;3(3):242-7. De Nadal E, Zapater M, Alepuz PM, Sumoy L, Mas G, Posas F. The MAPK Hog1 recruits Rpd3 histone deacetylase to activate osmoresponsive genes. Nature. 2004 Jan 22;427(6972):370-4. Deng X, Disteche CM. Decoding dosage compensation. Genome Biol. 2007;8(2):204. Demakova OV, Kotlikova IV, Gordadze PR, Alekseyenko AA, Kuroda MI, Zhimulev IF. The MSL complex levels are critical for its correct targeting to the chromosomes in Drosophila melanogaster. Chromosoma. 2003 Oct;112(3):103-15. Epub 2003 Sep 6. Dieppois G, Iglesias N, Stutz F. Cotranscriptional recruitment to the mRNA export receptor Mex67p contributes to nuclear pore anchoring of activated genes. Mol Cell Biol. 2006 Nov;26(21):7858-70. Epub 2006 Sep 5. Dion MF, Altschuler SJ, Wu LF, Rando OJ. Genomic characterization reveals a simple histone H4 acetylation code. Proc Natl Acad Sci U S A. 2005 Apr 12;102(15):5501-6. Epub 2005 Mar 28. 34 Chapter 1

Dorigo B, Schalch T, Kulangara A, Duda S, Schroeder RR, Richmond TJ. Nucleosome arrays reveal the two-start organization of the chromatin fiber. Science. 2004 Nov 26;306(5701):1571-3. Dorigo B, Schalch T, Bystricky K, Richmond TJ. Chromatin fiber folding: requirement for the histone H4 N-terminal tail. J Mol Biol. 2003 Mar 14;327(1):85-96. Dunker AK, Lawson JD, Brown CJ, Williams RM, Romero P, Oh JS, Oldfield CJ, Campen AM, Ratliff CM, Hipps KW, Ausio J, Nissen MS, Reeves R, Kang C, Kissinger CR, Bailey RW, Griswold MD, Du Sart D, Cancilla MR, Earle E, Mao JI, Saffery R, Tainton KM, Kalitsis P, Martyn J, Barry AE, Choo KH. A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA. Dwyer N, Blobel G. A modified procedure for the isolation of a pore complex-lamina fraction from rat liver nuclei. J Cell Biol. 1976 Sep;70(3):581-91. Elefant F, Su Y, Liebhaber SA, Cooke NE. Patterns of histone acetylation suggest dual pathways for gene activation by a bifunctional locus control region. EMBO J. 2000 Dec 15;19(24):6814-22. Fagegaltier D, Baker BS. X chromosome sites autonomously recruit the dosage compensation complex in Drosophila males. PLoS Biol. 2004 Nov;2(11):e341. Epub 2004 Oct 5. Fernandez-Capetillo O, Celeste A, Nussenzweig A. Focusing on foci: H2AX and the recruitment of DNA-damage response factors. Cell Cycle. 2003 Sep-Oct;2(5):426-7. Felsenfeld. Epigenetics by C. David Allis, Thomas Jenuwein, Danny Reinberg, and Marie- Laure Caparros. CSHL press, Oct 31, 2006. Finch J.T., Lutter L.C., Rhodes D, Brown A.S., Rushton B., Levitt M., Klug A. Structure of nucleosome core particles of chromatin. Nature 269 (1977), pp. 29-36 Flaus A, Owen-Hughes T. Mechanisms for ATP-dependent chromatin remodelling: farewell to the tuna-can octamer? Curr Opin Genet Dev. 2004 Apr;14(2):165-73. Galy V, Gadal O, Fromont-Racine M, Romano A, Jacquier A, Nehrbass U. Nuclear retention of unspliced mRNAs in yeast is mediated by perinuclear Mlp1.Cell. 2004 Jan 9;116(1):63-73. Gilbert N, Allan J. Distinctive higher-order chromatin structure at mammalian centromeres. Proc Natl Acad Sci U S A. 2001 Oct 9;98(21):11949-54. Gilbert N, Boyle S, Fiegler H, Woodfine K, Carter NP, Bickmore WA. Chromatin architecture of the human genome: gene-rich domains are enriched in open chromatin fibers. Cell. 2004 Sep 3;118(5):555-66. Gilbert N, Ramsahoye B. The relationship between chromatin structure and transcriptional activity in mammalian genomes. Brief Funct Genomic Proteomic. 2005 Jul;4(2):129- 42. Gilbert N, Gilchrist S, Bickmore WA. Chromatin organization in the mammalian nucleus. Int Rev Cytol. 2005;242:283-336. Gilfillan GD, Straub T, de Wit E, Greil F, Lamm R, van Steensel B, Becker PB. Chromosome-wide gene-specific targeting of the Drosophila dosage compensation complex. Genes Dev. 2006 Apr 1;20(7):858-70. Gorisch SM, Wachsmuth M, Toth KF, Lichter P, Rippe K. Histone acetylation increases chromatin accessibility. J Cell Sci. 2005 Dec 15;118(Pt 24):5825-34. Epub 2005 Nov 29. Gottschling, Epigenetics by C. David Allis, Thomas Jenuwein, Danny Reinberg, and Marie- Laure Caparros. CSHL press, Oct 31, 2006 Griffis ER, Craige B, Dimaano C, Ullman KS, Powers MA. Distinct functional domains within nucleoporins Nup153 and Nup98 mediate transcription-dependent mobility. Mol Biol Cell. 2004 Apr;15(4):1991-2002. Grunstein M. Histone acetylation in chromatin structure and transcription. Nature. 1997 Sep 25;389(6649):349-52. Hase ME, Cordes VC. Direct interaction with nup153 mediates binding of Tpr to the periphery of the nuclear pore complex. Mol Biol Cell. 2003 May;14(5):1923-40. General Introduction 35

Erratum in: Mol Biol Cell. 2003 Aug;14(8). Heard E, Disteche CM. Dosage compensation in mammals: fine-tuning the expression of the X chromosome. Genes Dev. 2006 Jul 15;20(14):1848-67.. Hecht A, Strahl-Bolsinger S, Grunstein M. Spreading of transcriptional repressor SIR3 from telomeric heterochromatin. Nature. 1996 Sep 5;383(6595):92-6. Hetzer MW, Walther TC, Mattaj IW. Pushing the envelope: structure, function, and dynamics of the nuclear periphery. Annu Rev Cell Dev Biol. 2005;21:347-80. Hogan GJ, Lee CK, Lieb JD. Cell cycle-specified fluctuation of nucleosome occupancy at gene promoters PLoS Genet. 2006 Sep 22;2(9):e158. Epub 2006 Aug 8. Huang Y, Fang J, Bedford MT, Zhang Y, Xu RM. Recognition of histone H3 lysine-4 methylation by the double tudor domain of JMJD2A. Science. 2006 May 5;312(5774):748-51. Epub 2006 Apr 6. Huisinga KL, Brower-Toland B, Elgin SC. The contradictory definitions of heterochromatin: transcription and silencing. Chromosoma. 2006 Apr;115(2):110-22. Epub 2006 Feb 28. Ioshikhes IP, Albert I, Zanton SJ, Pugh BF. Nucleosome positions predicted through comparative genomics. Nat Genet. 2006 Oct;38(10):1210-5. Epub 2006 Sep 10. Ishii K, Arib G, Lin C, Van Houwe G, Laemmli UK. Chromatin boundaries in budding yeast: the nuclear pore connection. Cell. 2002 May 31;109(5):551-62. Janicki SM, Tsukamoto T, Salghetti SE, Tansey WP, Sachidanandam R, Prasanth KV, Ried T, Shav-Tal Y, Bertrand E, Singer RH, Spector DL. From silencing to gene expression: real-time analysis in single cells. Cell. 2004 Mar 5;116(5):683-98. Cell. 2004 Mar 5;116(5):633-4. Jenuwein T, Allis CD. Translating the histone code. Science. 2001 Aug 10;293(5532):1074- 80. Kageyama Y, Mengus G, Gilfillan G, Kennedy HG, Stuckenholz C, Kelley RL, Becker PB, Kuroda MI. Association and spreading of the Drosophila dosage compensation complex from a discrete roX1 chromatin entry site. Kaplan CD, Laprade L, Winston F. Transcription elongation factors repress transcription initiation from cryptic sites. science. 2003 Aug 22;301(5636):1096-9. Keith KC, Fitzgerald-Hayes M. CSE4 genetically interacts with the Saccharomyces cerevisiae centromere DNA elements CDE I and CDE II but not CDE III. Implications for the path of the centromere dna around a cse4p variant nucleosome. Kelley RL, Meller VH, Gordadze PR, Roman G, Davis RL, Kuroda MI. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell. 1999 Aug 20;98(4):513-22. Kimura A, Umehara T, Horikoshi M. Chromosomal gradient of histone acetylation established by Sas2p and Sir2p functions as a shield against gene silencing. Nat Genet. 2002 Nov;32(3):370-7. Epub 2002 Oct 15. Kireeva ML, Walter W, Tchernajenko V, Bondarenko V, Kashlev M, Studitsky VM. Nucleosome remodeling induced by RNA polymerase II: loss of the H2A/H2B dimer during transcription. Mol Cell. 2002 Mar;9(3):541-52. Krogan NJ, Dover J, Khorrami S, Greenblatt JF, Schneider J, Johnston M, Shilatifard A. COMPASS, a histone H3 (Lysine 4) methyltransferase required for telomeric silencing of gene expression. J Biol Chem. 2002 Mar 29;277(13):10753-5. Epub 2002 Jan 22. Krull S, Thyberg J, Björkroth B, Rackwitz HR, Cordes VC. Nucleoporins as components of the nuclear pore complex core structure and Tpr as the architectural element of the nuclear basket.Mol Biol Cell. 2004 Sep;15(9):4261-77. Epub 2004 Jun 30. Klug A, Rhodes D, Smith J, Finch JT, Thomas JO. A low resolution structure for the histone core of the nucleosome. Nature. 1980 Oct 9;287(5782):509-16. Korber P, Barbaric S, Luckenbach T, Schmid A, Schermer UJ, Blaschke D, Horz W. The histone chaperone Asf1 increases the rate of histone eviction at the yeast PHO5 and PHO8 promoters. J Biol Chem. 2006 Mar 3;281(9):5539-45. Epub 2006 Jan 4. Kornberg R.D. Chromatin structure: a repeating unit of histones and DNA. Science 184 (1974), pp. 868-871 36 Chapter 1

Kornberg RD, Lorch Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 1999 Aug 6;98(3):285-94. Kurdistani SK, Tavazoie S, Grunstein M. Mapping global histone acetylation patterns to gene expression. Cell. 2004 Jun 11;117(6):721-33. Kustatscher G, Hothorn M, Pugieux C, Scheffzek K, Ladurner AG. Splicing regulates NAD metabolite binding to histone macroH2A. Nat Struct Mol Biol. 2005 Jul;12(7):624-5. Epub 2005 Jun 19. Lachner M, O'Carroll D, Rea S, Mechtler K, Jenuwein T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature. 2001 Mar 1;410(6824):116-20. Lacy E, Axel R. Analysis of DNA of isolated chromatin subunits. Proc Natl Acad Sci U S A. 1975 Oct;72(10):3978-82. Langmore JP, Schutt C.The higher order structure of chicken erythrocyte chromosomes in vivo. Nature. 1980 Dec 11;288(5791):620-2.Links Langst G, Becker PB. Nucleosome mobilization and positioning by ISWI-containing chromatin-remodeling factors. J Cell Sci. 2001 Jul;114(Pt 14):2561-8. Lee CK, Shibata Y, Rao B, Strahl BD, Lieb JD. Evidence for nucleosome depletion at active regulatory regions genome-wide. Nat Genet. 2004 Aug;36(8):900-5. Epub 2004 Jul 11. Legube G, McWeeney SK, Lercher MJ, Akhtar A. X-chromosome-wide profiling of MSL-1 distribution and dosage compensation in Drosophila. Genes Dev. 2006 Apr 1;20(7):871-83. Epub 2006 Mar 17. Li B, Carey M, Workman JL. The role of chromatin during transcription. Cell. 2007 Feb 23;128(4):707-19. Liou GG, Tanny JC, Kruger RG, Walz T, Moazed D. Assembly of the SIR complex and its regulation by O-acetyl-ADP-ribose, a product of NAD-dependent histone deacetylation. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature. 1997 Sep 18;389(6648):251-60. Marin I, Baker BS. Origin and evolution of the regulatory gene male-specific lethal-3. Mol Biol Evol. 2000 Aug;17(8):1240-50. Mendjan S, Akhtar A. The right dose for every sex. Chromosoma. 2007 Apr;116(2):95-106. Epub 2006 Nov 24. Menon BB, Sarma NJ, Pasula S, Deminoff SJ, Willis KA, Barbara KE, Andrews B, Santangelo GM. Reverse recruitment: the Nup84 nuclear pore subcomplex mediates Rap1/Gcr1/Gcr2 transcriptional activation. Proc Natl Acad Sci U S A. 2005 Apr 19;102(16):5749-54. Epub 2005 Apr 7. Meyer BJ, McDonel P, Csankovszki G, Ralston E. Sex and X-chromosome-wide repression in Caenorhabditis elegans. Cold Spring Harb Symp Quant Biol. 2004;69:71-9. Millar CB, Grunstein M. Genome-wide patterns of histone modifications in yeast. Nat Rev Mol Cell Biol. 2006 Sep;7(9):657-66. Epub 2006 Aug 16. Review. Mito Y, Henikoff JG, Henikoff S. Genome-scale profiling of histone H3.3 replacement patterns. Nat Genet. 2005 Oct;37(10):1090-7. Epub 2005 Sep 11. Misteli T, Gunjan A, Hock R, Bustin M, Brown DT. Dynamic binding of histone H1 to chromatin in living cells Morales V, Richard-Foy H. Role of histone N-terminal tails and their acetylation in nucleosome dynamics. Mol Cell Biol. 2000 Oct;20(19):7230-7. Ng HH, Robert F, Young RA, Struhl K. Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol Cell. 2003 Mar;11(3):709-19. Noll M, Kornberg RD. Action of micrococcal nuclease on chromatin and the location of histone H1. J Mol Biol. 1977 Jan 25;109(3):393-404 Nusinow DA, Panning B. Recognition and modification of seX chromosomes. Curr Opin Genet Dev. 2005 Apr;15(2):206-13. Oh H, Bone JR, Kuroda MI. Multiple classes of MSL binding sites target dosage compensation to the X chromosome of Drosophila. Curr Biol. 2004 Mar 23;14(6):481- General Introduction 37

7. Polo SE, Almouzni G. DNA damage leaves its mark on chromatin. Cell Cycle. 2007 Jul 18;6(19) Protacio RU, Li G, Lowary PT, Widom J. Effects of histone tail domains on the rate of transcriptional elongation through a nucleosome. Mol Cell Biol. 2000 Dec;20(23):8866-78. Ramakrishnan v. Histone H1 and chromatin higher-order structure. Crit. Rev. Eukaryot. Gene. Expr. 7 (1997), pp. 215-230 Ramaswamy A, Bahar I, Ioshikhes I.Structural dynamics of nucleosome core particle: comparison with nucleosomes containing histone variants. Proteins. 2005 Feb 15;58(3):683-96. Rando OJ, Ahmad K. Curr Opin Cell Biol. 2007 Jun;19(3):250-6. Epub 2007 Apr 26. Rules and regulation in the primary structure of chromatin. Redon C, Pilch D, Rogakou E, Sedelnikova O, Newrock K, Bonner W. Histone H2A variants H2AX and H2AZ. Curr Opin Genet Dev. 2002 Apr;12(2):162-9. Roh TY, Cuddapah S, Zhao K. Active chromatin domains are defined by acetylation islands revealed by genome-wide mapping. Genes Dev. 2005 Mar 1;19(5):542-52. Epub 2005 Feb 10. Santos-Rosa H, Schneider R, Bannister AJ, Sherriff J, Bernstein BE, Emre NC, Schreiber SL, Mellor J, Kouzarides T. Active genes are tri-methylated at K4 of histone H3. Nature. 2002 Sep 26;419(6905):407-11. Epub 2002 Sep 11 Saunders A, Core LJ, Lis JT. Breaking barriers to transcription elongation. Nat Rev Mol Cell Biol. 2006 Aug;7(8):557-67. Review. No abstract available. Schubeler D, MacAlpine DM, Scalzo D, Wirbelauer C, Kooperberg C, van Leeuwen F, Gottschling DE, O'Neill LP, Turner BM, Delrow J, Bell SP, Groudine M.The histone modification pattern of active genes revealed through genome-wide chromatin analysis of a higher eukaryote. Genes Dev. 2004 Jun 1;18(11):1263-71. Segal E, Fondufe-Mittendorf Y, Chen L, Thastrom A, Field Y, Moore IK, Wang JP, Widom J. A genomic code for nucleosome positioning. Sewack GF, Ellis TW, Hansen U. Binding of TATA binding protein to a naturally positioned nucleosome is facilitated by histone acetylation Mol Cell Biol. 2001 Feb;21(4):1404-15 Shaklai S, Amariglio N, Rechavi G, Simon AJ. Gene silencing at the nuclear periphery FEBS J. 2007 Mar;274(6):1383-92. Simpson R.T. Nucleosome positioning: occurrence, mechanisms, and functional consequences. Prog. Nucleic Acid Res. Mol. Biol. 40 (1991), pp. 143-184 Schneider R, Bannister AJ, Myers FA, Thorne AW, Crane-Robinson C, Kouzarides T. Histone H3 lysine 4 methylation patterns in higher eukaryotic genes. Nat Cell Biol. 2004 Jan;6(1):73-7. Epub 2003 Dec 7. Erratum in: Nat Cell Biol. 2004 May;6(5):465. Shi X, Hong T, Walter KL, Ewalt M, Michishita E, Hung T, Carney D, Pena P, Lan F, Kaadige MR, Lacoste N, Cayrou C, Davrazou F, Saha A, Cairns BR, Ayer DE, Kutateladze TG, Shi Y, Cote J, Chua KF, Gozani O. ING2 PHD domain links histone H3 lysine 4 methylation to active gene repression. Nature. 2006 Jul 6;442(7098):96-9. Epub 2006 May 2 Shogren-Knaak M, Ishii H, Sun JM, Pazin MJ, Davie JR, Peterson CL. Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science. 2006 Feb 10;311(5762):844-7. Schmid M, Arib G, Laemmli C, Nishikawa J, Durussel T, Laemmli UK. Nup-PI: the nucleopore-promoter interaction of genes in yeast. Mol Cell. 2006 Feb 3;21(3):379-91. Smith ER, Allis CD, Lucchesi JC. Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem. 2001 Aug 24;276(34):31483-6. Epub 2001 Jul 9. Spadafora C, Bellard M, Compton JL, Chambon P. The DNA repeat lengths in chromatins from sea urchin sperm and gastrule cells are markedly different. FEBS Lett. 1976 Oct 15;69(1):281-5 38 Chapter 1

Stedman E. Cell specificity of histones. Nature. 1950 Nov 4;166(4227):780-1. Strahl BD, Allis CD. The language of covalent histone modifications. Nature. 2000 Jan 6;403(6765):41-5. Strasser K, Masuda S, Mason P, Pfannstiel J, Oppizzi M, Rodriguez-Navarro S, Rondon AG, Aguilera A, Struhl K, Reed R, Hurt E. TREX is a conserved complex coupling transcription with messenger RNA export. Nature. 2002 May 16;417(6886):304-8. Epub 2002 Apr 28. Straub T, Becker PB. Dosage compensation: the beginning and end of generalization. Nat Rev Genet. 2007 Jan;8(1):47-57. Suto RK, Clarkson MJ, Tremethick DJ, Luger K. Crystal structure of a nucleosome core particle containing the variant histone H2A.Z. Nat Struct Biol. 2000 Dec;7(12):1121-4. Svejstrup JQ. The RNA polymerase II transcription cycle: cycling through chromatin. Biochim Biophys Acta. 2004 Mar 15;1677(1-3):64-73. Taddei A, Van Houwe G, Hediger F, Kalck V, Cubizolles F, Schober H, Gasser SM. Nuclear pore association confers optimal expression levels for an inducible yeast gene. Nature. 2006 Jun 8;441(7094):774-8. Taddei A. Active genes at the nuclear pore complex. Curr Opin Cell Biol. 2007 Jun;19(3):305-10. Epub 2007 Apr 2 Thiriet C, Hayes JJ. Replication-independent core histone dynamics at transcriptionally active loci in vivo. Thoma F, Koller T, Klug A. Involvement of histone H1 in the organization of the nucleosome and of the salt-dependent superstructures of chromatin. J Cell Biol. 1979 Nov;83(2 Pt 1):403-27 Tsukiyama T. The in vivo functions of ATP-dependent chromatin-remodelling factors. Nat Rev Mol Cell Biol. 2002 Jun;3(6):422-9. Vakoc CR, Mandat SA, Olenchock BA, Blobel GA. Histone H3 lysine 9 methylation and HP1gamma are associated with transcription elongation through mammalian chromatin. Mol Cell. 2005 Aug 5;19(3):381-91. Vinciguerra P, Iglesias N, Camblong J, Zenklusen D, Stutz F. Perinuclear Mlp proteins downregulate gene expression in response to a defect in mRNA export. EMBO J. 2005 Feb 23;24(4):813-23. Epub 2005 Feb 3. Waddington, C.H. 1956. Principles of Embryology (London: George Allen & Unwin Ltd.), 370. Wang A, Kurdistani SK, Grunstein M. Requirement of Hos2 histone deacetylase for gene activity in yeast. Science. 2002 Nov 15;298(5597):1412-4. Whitehouse I, Tsukiyama T. Antagonistic forces that position nucleosomes in vivo. Nat Struct Mol Biol. 2006 Jul;13(7):633-40. Epub 2006 Jul Widom J, Klug A. Structure of the 300A chromatin filament: X-ray diffraction from oriented samples. Cell. 1985 Nov;43(1):207-13. Woodcock CL, Frank J. Nucleosome mass distribution using image averaging. J Ultrastruct Res. 1984 Dec;89(3):295-302. Zhang Y, Smith CL, Saha A, Grill SW, Mihardja S, Smith SB, Cairns BR, Peterson CL, Bustamante C. DNA translocation and loop formation mechanism of chromatin remodeling by SWI/SNF and RSC. Mol Cell. 2006 Nov 17;24(4):559-68. Zlatanova J, Seebart C, Tomschik M. Nap1: taking a closer look at a juggler protein of extraordinary skills. 2007 May;21(7):1294-310. Epub 2007 Feb 22. General Introduction 39

Results

This thesis is based on three publications, which are presented in the following order:

Chapter 2 Kind J and A. Akhtar. Cotransciptional recruitment of the dosage compensation complex to X-linked target genes. Genes & Development. 2007 August15;21(16):2030-40.

Chapter 3 Kind J*, Vaquerizas J*, Philipp Gebhardt, Marc Gentzel, Bertone P, Luscombe N, and A. Akhtar (2007) Genome-wide analysis reveals MOF as a key regulator of dosage compensation and gene expression in Drosophila. Cell in press.

Chapter 4 Mendjan S, Taipale M*, Kind J*, Holz H, Gebhardt P, Schelder M, Vermeulen M, Buscaino A, Duncan K, Mueller J, Wilm M, Stunnenberg HG, Saumweber H, Akhtar A. Nuclear pore components are involved in the transcriptional regulation of dosage compensation in Drosophila. Molecular Cell. 2006 March17;21(6):811-23.

* Equal contribution 40 Chapter 1 Co-transcriptional recruitment of the dosage compensation complex to X-linked target genes 42 Chapter 2

Co-transcriptional recruitment of the dosage compensation complex to X-linked target genes

Jop Kind and Asifa Akhtar

Abstract Dosage compensation is a process required to balance the expression of X-linked genes between males and females. In Drosophila this is achieved by targeting the dosage compensation complex or the MSL complex to the male X chromosome. In order to study the mechanism of targeting, we have studied two X chromosomal genes, m of and CG3016, using chromatin immunoprecipitation as well as immuno- FISH analysis on transgenic flies. We show that MSL complex recruitment requires the genes to be in a transcriptionally active state. MSL complex recruitment is reversible because blocking transcription severely reduces MSL binding to its target genes. Furthermore, targeting cues are found towards the 3’ end of the gene and depend on the passage of the transcription machinery through the gene, whereby the type of promoter and the direction of transcription are dispensable. We propose a model of dynamic MSL complex binding to active genes based on exposed DNA target elements.

Introduction

Sex determination often involves differentiation of a pair of chromosomes such that one sex retains the original two copies (homogametic), whereas in the other sex one of the homologous chromosomes degenerates almost completely with only the exception of a few sex specific genes (heterogametic). The deleterious effects of aneuploidy creates the need for a compensatory process that equalizes the gene products between the two sexes (Charlesworth and Charlesworth 2005). In Drosophila, dosage compensation occurs by increasing transcription of most genes on the single male X chromosome to compensate for transcription of both X chromosomes in females. Genetic studies have identified five male specific lethal (MSL) genes, msll, msl2, msl3, males absent on the first (mof) and maleless (mle), that are important for the regulation of dosage compensation. The products of these genes (collectively referred to as MSL genes), as well as two non-coding RNAs (roX1 Co-transcriptional recruitment of the dosage compensation complex 43 and roX2) assemble in a large complex called the dosage compensation complex (DCC) or the MSL complex, which is targeted to hundreds of sites on the male X chromosome (Lucchesi et al. 2005; Mendjan and Akhtar 2006; Straub and Becker 2007). One of the most intriguing features of the MSL complex is its ability to recognize its targets on the male X chromosome. Studies that involved P-element mediated insertions of X chromosomal genes on autosomes and X-autosome translocations have shown that most X linked genes were still targeted when inserted on an autosome. In contrast, autosomal genes translocated to the X remained untargeted (Fagegaltier and Baker 2004; Oh et al. 2004). Targeting therefore most likely happens on genes individually and may not require the presence of 35-40 so called “entry sites” (Kelley et al. 1999). Recent chromatin profiling studies, have confirmed the preference of the MSL complex for individual genes. The MSLs were found to bind locally to genes with MSL occupancy predominantly at the 3’ of genes (Alekseyenko et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). Moreover the affinity of MSL1 for its targets correlates with its dosage compensated state (Gilfillan et al. 2006; Legube et al. 2006). Therefore the affinity of the MSL complex might have evolved concurrent with the need for dosage compensation of its targets. This is in agreement with the findings that those genes strongly bound by MSL1 are more generally essential genes (Gilfillan et al. 2006). Despite the large number of MSL targets recently identified by chromatin profiling studies, a universal targeting sequence motif has not been identified for the MSL complex. Also the proposal that the MSL complex simply targets those genes on the X that are transcriptionally active does not seem to universally apply since there are many genes on the X that are transcriptionally active, but not bound by the MSLs (Alekseyenko et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). It seems conceivable that transcription is a prerequisite for target recognition but not sufficient by itself, because most target genes are transcribed and those few genes that show differential expression are only bound when the gene is active (Alekseyenko et al. 2006). Although no universal targeting sequence has been found, a number of short degenerative sequences with some predictive power have been identified (Dahlsveen et al. 2006). It is therefore possible that these degenerative sequences are only 44 Chapter 2 exposed when the gene is active and the chromatin is present in an open conformation. An assumption of the above hypothesis would be the ability of the MSL complex to associates with genes only while transcription is ongoing presumably at the stage of transcriptional elongation. Therefore targeting cues may reside in the body of the gene as opposed to the original reports of upstream enhancer sequences present in dosage compensated genes (for review see (Baker et al. 1994)), but in agreement with recent MSL profiling studies (Smith 2001; Alekseyenko et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). In order to gain better insights into targeting mechanism, we studied two neighbouring genes CG3016 and m of for their targeting properties as they recently have shown to be targeted by the MSL complex in genome-wide analysis (Gilfillan et al. 2006; Legube et al. 2006). The m of gene encodes for the histone acetyltransferase in the MSL complex that specifically acetylates lysine 16 of histone H4 (H4K16). Apart from the two roX RNA encoding genes, m of is the only other known MSL member whose gene is located on the X chromosome. Interestingly, we find that transcriptional activation is required for targeting of the MSL complex and that polymerase passage through the gene is a prerequisite for target recognition. We also show that this is true for most genes on the X chromosome as blocking transcription by aamanitin treatment, greatly reduced binding of the MSL complex to X chromosomal genes. Finally we show that in addition to transcription, targeting to the m of and CG3016 genes most likely is a combination of degenerative DNA sequences towards the 3’end of these genes only to be recognized when the gene is transcriptionally active.

Results

MSL proteins are enriched on the region spanning the mof and CG3016 genes In order to precisely map the binding pattern of MSLs on the m of and CG3016 loci we performed chromatin immunoprecipitation (ChIP) experiments in Drosophila Schneider cells (SL-2) using specific antibodies directed against MSL1, MSL3 and MOF. SL-2 cells are a male 16 hr embryonic cell line with a MSL binding pattern closely reflecting that of late stage embryos (Alekseyenko et al. 2006). The Co-transcriptional recruitment of the dosage compensation complex 45 immunoprecipitated material was analyzed by quantitative realtime PCR (Q-PCR) and presented as the percentage recovery compared to input DNA (Figure 1A). The roX2 high affinity site, which served as a positive control showed highly enriched MSL binding (lane 15) as opposed to gapdh (located on chromosome 2R) (lane 14) and the runt gene (located on the X chromosome) (lane 13), but is dosage compensated in an MSL independent fashion (Gergen 1987; Smith et al. 2001). Binding was enriched on the body of the gene for both CG3016 and m o f for all the three MSL proteins tested (Figure 1, lanes 1-12). Unlike MSL1 and MSL3, there is also considerable binding of MOF to the promoter regions (see lanes 1 and 5). Whether the binding of MOF to promoters reflects its general binding pattern on a genome wide scale remains to be tested. We next wished to test if a large genomic fragment including m of and most of CG 3016 was able to target the MSL complex ectopically when inserted on an autosomal location by means of P-element mediated transformation. As is shown in Figure 1B this 6.7kb fragment (m o f6J) showed robust MSL1 recruitment visualized by staining with an MSL1 antibody in combination with fluorescence in situ hybridization (immuno-FISH) to visualize the location of the transgene (see Materials and Methods). The presence of MSL1 and the direct visualization of targeting on polytene chromosomes enabled further detailed analysis of the nature of targeting to this locus. Taken together, these results show that MSL1 protein is enriched on m of and CG3016 genes and that this region is able to recruit MSL complex autonomously on an autosomal location. 46 Chapter 2

5 « r s • 10 12 runt gapdhroX2 r m * JÄBL\\. « gapdh roX2 1 2 3 4 5 6 7 X 9 10 11 12 U 14 15

FISH MSL1 Merge FISH MSL1 Merge

1 ' mof

f î t W , ’ 3P FISH MSL1 Merge ftíX mof y ? r •

FISH MSL1 Merge

mof P{w*mof24Aprom)

Figure 1. Transcriptional dependent recruitment of MSL1 to the mof gene. (A) ChIP in SL-2 cells on the CG3016 and mof genes with antibodies directed against MSL1, MSL3 and MOF. Levels of enrichment are determined by Q-PCR and depicted as the percentage recovery of input DNA. Position of the primer pairs is schematically shown by green arrows. (B, C, D) MSL1 immunostaining (green) in combination with DNA-FISH (red) directed against the mini-white gene of a polytene chromosome carrying an autosomal 6.7kb P-element insertion encompassing mof and the coding region of CG3016 (B), an autosomal P-element insertion of mof with its endogenous promoter (C) or without its endogenous promoter (D). Recruitment of MSL1 to the transgenes is indicated by an arrow. Position of the endogenous mof gene is shown by an asterisk. DNA was stained with Hoechst 322 (blue). Co-transcriptional recruitment of the dosage compensation complex 47

MSL1 is recruited to the mof gene in a transcription dependent manner In order to study targeting to individual genes, we first generated transgenic flies carrying the m of gene with its endogenous promoter sequences (mof35). The m of gene showed ectopic MSL1 recruitment in almost all independent lines that were observed (Figure 1C; Supplementary Table1). Recently, the MSL binding pattern to polytene chromosomes was suggested to reflect the distribution of active genes (Sass et al. 2003). Although the vast majority of genes bound by MSL1 are indeed active, a number of active genes on the X chromosome escape MSL1 binding (Alekseyenko et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). Therefore, in order to address directly whether or not transcription is a prerequisite for targeting we analyzed targeting of the MSL complex to the m o f gene in the absence of the endogenous promoter sequences (m of24A prom). Clearly targeting to these lines was lost, as we did not observe MSL1 binding on the transgene in any of the lines studied (Figure 1D; Supplementary Table1). Although the results above suggest that the absence of transcription leads to the loss of MSL1 binding, it is possible that targeting sequences are present in the promoters of the respective genes as it was originally suggested for a number of genes (Baker et al. 1994). In order to address if the promoter requirement is due to a targeting signal embedded in the promoter sequence or solely due to transcriptional activation, m of was fused downstream of the tubulin promoter. The tubulin gene is located on chromosome 3 and therefore its promoter should not contain any X chromosome specific sequences. Interestingly, a tubulin promoter driven m o f transgene (tub-mof) also showed ectopic recruitment of MSL1 (Figure 2A), as well as MSL3, MLE and MOF (Supplementary Figure 1). In contrast, tubulin driven expression of the p h o gene (Klymenko et al. 2006), encoded on the fourth chromosome, did not show any MSL1 recruitment, further confirming the specificity of MSL1 binding to the m of gene (Supplementary Figure 2A; Supplementary Table1). In order to study transcription dependent targeting at the same genomic position and thereby addressing any possible position effect variegation (PEV) related effects, we also created a transcription on/off assay by using a previously developed system that makes use of FRT-flip recombinase mediated excision of a yellow gene inserted between the tubulin promoter and the gene of interest, in our case the m of gene (Struhl and Basler 1993). When present, the yellow gene blocks transcription 48 Chapter 2 from the tubulin promoter. This assay can therefore be used to study recruitment of MSL complex to the same location in the inactive and active state. Using this assay, we observed that m of was only recognized as a MSL1 target when transcription was allowed by excision of the yellow gene (Figure 2 compare B and C; Supplementary Table1). We confirmed activation of transcription after excision of the yellow gene by rescuing the male specific lethality caused by the absence of MOF (data not shown). Since m o f driven by a tandem repeat of five GAL4 binding sites (UAS-mof) also showed targeting of MSL1 (Supplementary Figure 2B; Supplementary Table1), we conclude that targeting solely requires transcriptional activity irrespective of the promoter used. The determinant of targeting therefore, most likely is to be found in the gene region and not in the promoter sequence. Furthermore, the observation that UAS driven expression of m o f without GAL4 activation also displayed MSL1 recruitment suggest that transcription is required but the levels of transcription are not important. A limited number of sites on the X chromosome are defined as high affinity sites because they have the ability to recruit partial complexes of MSL1 and MSL2 in the absence of the other MSLs (Kelley et al. 1999). Since m o f is located in a cytological location of the previously mapped high affinity site at position 5c (Lyman et al. 1997; Demakova et al. 2003), we tested by DNA-FISH if this site coincides with the location of mof. Since homozygous msl-3083 male third instar larvae are rarely recovered, we used female flies expressing MSL2 in a msl-3083 mutant background. These flies assemble partial complexes on the X chromosome and are routinely used to study high affinity sites (Kelley et al. 1999; Kageyama et al. 2001; Dahlsveen et al. 2006). As shown in figure 2D the m o f endogenous gene is found in very close proximity to the high affinity site, but upon close examination appears to be not the site itself but just beside it (Figure 2D, see asterisks). We verified this result by crossing the genomic construct containing the m of locus (m o f 5) in an m sl-3 083 background, which also showed no targeting (data not shown). Surprisingly however, when the tubulin driven m o f transgene was crossed in an msl-3083 background we created what appeared to be a high affinity site, as we could observe recruitment of MSL1 in the absence of MSL3 (Figure 2D, arrow). We obtained similar results with this line in an mle1 mutant background albeit with a substantially weaker MSL1 recruitment (data not shown). Co-transcriptional recruitment of the dosage compensation complex 49

Taken together, the results above show that MSL complex is recruited to the m of gene in a transcription dependent manner. Our results suggest that also on other regions of the X chromosomes, otherwise known as lower affinity sites, partial MSL complexes are able to recognize their targets autonomously without MSL3 or MLE. We therefore propose that low affinity sites may override the requirement for MSL3 or MLE if their expression is driven from a strong promoter such as tubulin. This is presumably due to combinatorial effect of chromatin modifications associated with high levels of transcription that may cooperate to expose certain DNA target sequences to MSL1 and MSL2, which may not be exposed otherwise.

mof P{w+tub-mof} (MSL3 mutant)

Figure 2. m o f trangene driven by a tubulin promoter is a target for MSL1 and overcomes the requirement for MSL3. (A) Tubulin driven m of gene (B and C) Tubulin driven m o f gene (tub>y+>mof) containing a yellow gene cassette between the promoter and the gene such that mof expression becomes inducible upon excision of the yellow gene cassette by expression of flippase. Recruitment of MSL1 before (B) and after (C) excision is shown. (D) Same as in A, however in this case the transgenic line carrying tub-mof was crossed into the msl-3083 mutant background by using females mutant for msl-3083 expressing low levels of MSL2 from an Hsp83 promoter. Recruitment of MSL1 to the tub-mof 50 Chapter 2

transgene is indicated by an arrow. Position of the endogenous mof gene is shown by an asterisk. Red cross (X) represents no transcription. DNA was stained with Hoechst 322 (blue).

MSL complex targeting is compromised in a-amanitin treated cells Knowing that transcription is a prerequisite for binding of the MSL complex (Figure 2 B and C), we wished to test for the plasticity of the bound state. Somewhat conflicting hypotheses on the subject of timing and maintenance of targeting the MSL complex have been put forward recently. On one hand, the MSL complex is thought to be targeted in early development presumably following the present transcriptional pattern and maintained in the course of development irrespective of transcriptional changes (Alekseyenko et al. 2006; Legube et al. 2006). On the other hand subtle developmental changes in the binding pattern of the MSL complex on polytene chromosomes and the presence of genes in early development (6hr embryos) that are bound by MSLs but do not correlate with transcriptional status, as judged by RNA Pol II chromatin binding profiles (Gilfillan et al. 2006), suggest that differential binding takes place. Since many MSL target genes are housekeeping genes that are continuously transcribed (Gilfillan et al. 2006; Legube et al. 2006), stable binding throughout development could be the rule with some differentially transcribed genes being the exception. In order to test this hypothesis, we blocked transcription by means of a- amanitin treatment in Schneider (SL-2) cells. We argued that if binding is maintained irrespective of transcriptional changes, genes should preserve their normal MSL binding pattern when transcription is blocked. As expected, after a 20hr a-amanitin (Pol II inhibitor) treatment transcript levels of most genes tested were significantly reduced compared to untreated control levels (Figure 3A). Visually the cells showed normal morphology (data not shown) and the protein levels of MSL1 and MOF were comparable to the control situation (Figure 3B). Furthermore, roX2 RNA levels in treated cells were mildly affected in comparison to the control situation, very likely reflecting a higher stability of this RNA (Figure 3A). In addition to the m of gene we tested four additional X chromosomal genes (UCP4A, SOCS16D, CG4061 and CG3016) by ChIP. Interestingly, all the tested genes show a dramatic reduction of MSL binding following a-amanitin treatment (Figure 3C). Intriguingly, MSL binding to the high affinity sites such as roX2 and 18D was significantly less susceptible to a- Co-transcriptional recruitment of the dosage compensation complex 51 amanitin treatment, presumably reflecting their ability to recruit the complex ectopically independently of transcription (Kelley et al. 1999; Kageyama 2001; Oh et al. 2003; Oh et al. 2004). Consistent with these observations, we also found severely reduced staining of MSL1 on the X chromosomal territory in a-amanitin treated SL-2 cells in comparison to the control cells (Figure 3D). These results suggest that MSL binding is reversible and depends directly on the transcriptional state of the targets. The rigid binding of MSLs therefore is not an embryonic irreversible pre-set condition but most probably reflects the continuous transcriptional activity of its targets.

Genic sequences contribute to MSL complex recruitment on the mof gene. Although it is conceivable that targeting requires the transcription machinery to pass through the gene for a certain targeting signal to become exposed, it remains plausible that MSL binding is achieved by the recruitment of transcriptional activators to the promoter, e.g. in the scenario where the MSL complex slides along the DNA pushed forward by transcribing polymerase (Gilfillan et al. 2006). For this purpose we created a m o f construct that has the m o f endogenous promoter but in a reverse orientation (m of 3.5prom AS), such that transcription does not pass through the m of gene. As is shown in Figure 4A this transgene is unable to recruit MSL1. Thus, transcription activation is not sufficient for targeting MSL1 to mof, instead transcription needs to run through the gene to reveal m of as an MSL target. To date it remains unknown what the targeting signal embodies. A number of groups over the past years have attempted to identify a universal targeting sequence but despite these attempts, besides a number of short degenerative sequences with limited predictive power, no general binding sequence has been identified (Alekseyenko et al. 2006; Dahlsveen et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). It is possible that the predictive power of these sequences is limited because they need to be exposed in order to be recognized. It is conceivable therefore that for a target to be exposed, transcription needs to run through the gene whereby, if the signal involves degenerative DNA sequences, the orientation of transcription should not make a difference. Therefore, in order to test this hypothesis we placed a tubulin promoter at the 3 ’ end of the m o f gene such that it would make a m o f antisense transcript (tub-mof 4AS). If targeting involves a DNA element only to be recognized 52 Chapter 2 when the chromatin is in an open conformation, this transgene should retain its binding capacities for MSL1. This construct is indeed able to recruit MSL1 (Figure 4B, top panel; Supplementary Table1). Interestingly, occasional spreading was observed on one of the lines (less than 5% of the nuclei, Figure 4B, bottom panel). This is possibly caused by the presence of targeting cues towards the 3’ end, that are now more exposed due to the close proximity of the tubulin promoter. In order to test if the 3’ end of m of is essential for targeting we created a m of construct similar to m of 35 but now lacking 600bp of the 3’ end of the m of gene (m of 9A 3prime). This construct, despite being transcriptionally active (Supplementary Figure 3), failed to recruit MSL1 in all lines observed (Figure 4C, Supplementary Table 1) which is in agreement with the overall binding preference of MSLs to the 3’ end of genes (Smith 2001; Alekseyenko et al. 2006; Gilfillan et al. 2006). We next tested whether the 3’ end of the m o f gene alone is sufficient to recruit MSL1 in the absence of the surrounding sequences. However, we were unable to observe recruitment of MSL1 on this fragment (Figure 4D). Our data suggests that it is most likely that the targeting signal for the MSL complex is a DNA sequence embedded in the coding region of mof, only to be exposed when the gene is transcribed and that the sequences towards the 3’ end of m of are necessary but not sufficient for MSL1 recruitment as a small DNA element, out of context of the entire gene. Relative levels ih S1 MF n Tbln niois s niae. C CI i SL-2 in ChIP (C) indicated. as antibodies Tubulin and MOF MSL1, with probed were blots Western extracts cells. treated cells a-amanitin whole or mock from from prepared analysis blot Western (B) treatment. amanitin Q-RT- (A) a- 20hr expression(100%)a mockafternormalized analysisPCRof levels to a-amanitin. by transcription blocking upon affected severely iue . erimn o S1 n MF n crmsml ee is genes chromosomal X on MOF and MSL1 of Recruitment 3. Figure otasrpinlrcuteto h oaecmesto ope 53 complex compensation dosage the of recruitment Co-transcriptional 54 Chapter 2

cells with antibodies directed against MSL1, and MOF after 20hr mock or a- amanitin treatment. Levels of enrichment are determined by Q-PCR and depicted as the percentage recovery of input DNA. Enrichment on each gene was systematically tested using primer pairs located at the beginning, middle and end of genes. Position of the PCR probes with respect to the transcription start site (+1) is indicated on the X axis, for example for UCP4A 1st primer pair is located 367bp upstream of the transcription start site, and 2nd and 3rd primer pairs 612bp and 2860bp downstream, respectively. (D) Immunofluorescence with MSL1 (red) and Lamin (green) in Schneider (SL- 2) cells of mock or a-amanitin treated cells. DNA was stained with Hoechst 322 (blue).

Ectopic recruitment of MSL1 to CG3016 also involves transcriptional activity and sequences towards the 3’ end of the gene. In order to test whether transcription dependent recruitment of the MSL complex was not unique for the m of gene but represented a more general feature of other X chromosomal genes, we next generated independent transgenes carrying CG3016 with or without its endogenous promoter sequences (CG30163, CG3016 25A prom, Supplementary Table 1). Similar to the m o f gene, we also observed ectopic recruitment of MSL1 to CG3016 in the presence of its promoter but not in its absence (Figure 5A and B). We were next interested in studying the contribution of the sequences towards the 3’end of the CG3016 gene in MSL1 targeting. For this purpose we mapped a 339bp region near the 3’ end of CG3016 which shows maximal MSL enrichment by ChIP and sequence similarity to the previously characterized conserved consensus sequence present on both roX1/2 high affinity sites (Supplementary Figure 4, (Park et al. 2003). We therefore created transgenes containing 339bp of this sequence as a monomer (P{w+ CG3016(1581-1920)}). Interestingly, we observed that similar to the m of 3’ end, this sequence alone was unable to recruit MSL1 ectopically. Intriguingly however, multimerisation (containing 5 tandem repeats, P{w+ CG3016(1581-1920) 5mer}) of this sequence restored binding of MSL1, indicating that different from the high affinity sites that recruit MSLs as a ~300bp monomer (Kageyama 2001; Park et al. 2003; Oh et al. 2004) but similar to the m of situation, the affinity of MSL1 for the CG3016 sequences Co-transcriptional recruitment of the dosage compensation complex 55 is too low to be recognized when placed out of context of the gene itself, but can be revealed upon multimerisation (Figure 5D). The three previously mapped high affinity sites (roX1, roX2 and 18D) have been shown to maintain their ability to recruit MSL1 in a msl-3083 mutant background as a small ~300bp monomer for roX1/2 and as a multimer in the case of the 18D high affinity site (Kageyama 2001; Park et al. 2003; Oh et al. 2004). Although CG3016 is not a high affinity site we were interested to test if multimerisation of a low affinity site could overcome the requirement for MSL3. Therefore to address this issue (as described above in Figure 2D), we crossed the transgenic flies carrying the CG3016 multimer with flies expressing MSL2 in a msl-3083 mutant background and analyzed MSL1 binding to female polytene chromosomes. Interestingly, we observed that the CG3016 multimer failed to recruit MSL1 in msl-3083 mutant background (Figure 5E). These results show that similar to the m of gene, MSL complex recruitment on CG3016 gene requires transcriptional activity and sequences embedded within the body of the gene. We also show that even though multimerisation of 3’ of CG3016 restores the binding of MSL1 in the wild-type context, the affinity of MSL1 for this CG3016 sequence is too weak to be maintained in the absence of MSL3.

Discussion

In this study, we provide direct evidence for transcription dependent recruitment of the MSL complex to X-linked genes. We show that passage of the transcription machinery through the gene is important whereas the type of promoter and the direction of transcription is not. Our data demonstrates that the recruitment signal lies within the transcribed portion of the gene and that targeting occurs independently of neighboring nucleation sites as we can successfully assess recruitment of X linked genes on autosomal locations in a transcription dependent manner. Our data support a model for MSL complex targeting to transcriptionally active X linked genes, that encode a certain combination of small degenerative target sequences in their transcribed region. It has been proposed previously that one can create MSL complex binding sites on X chromosomal regions, normally devoid of the MSL complex, by driving strong transcription via 14 tandem repeats of GAL4 binding sequences (Sass et al. 2003). However, because integration of the EP lines used was random and the sites of 56 Chapter 2 insertion were not characterized, the nature of the transcribed unit was unclear and therefore any assumptions made about the importance of certain sequences, direction or strength of transcription of the targeted unit remained speculative. Furthermore, since the autosomal EP lines failed to recruit MSL complex it remained unclear to what extent the X chromosomal context played a role in MSL recruitment on these insertion sites. It may therefore be important to study MSL targeting autonomously, out of the X chromosomal context, to avoid the complication that may be caused by high local concentration of MSLs on the X chromosome in combination with strong transcriptional activation as previously reported (Sass et al. 2003). Furthermore, in contrast to what has been proposed previously (Sass et al. 2003), our data suggests that transcription alone is unlikely to be the sole targeting signal. Firstly because many genes on the X chromosome are

A * , ______(/sense mof P{ w+mof 3 5prom A S)

B

mof T T Tub

P{w*tub-mof24AS)

c ____H* mof 1.8kb P{w*mof29\3prime)

D

Endo * mof1963-253: P{w+mof3prime}

Figure 4. Targeting by MSL1 to the m of gene involves DNA sequences embedded in the coding region. MSL1 immnuostaining (green) in combination with DNA-FISH (red) for the location of the transgene for insertions containing mof with an antisense promoter (A), tubulin driven antisense mof gene (B), endogenous promoter driven mof derivative lacking Co-transcriptional recruitment of the dosage compensation complex 57

670bp of the 3’prime end (C), or endogenous promoter driven 3’ end of mof (1863-2533bp) (D). Recruitment of MSL1 to the transgenes is indicated by an arrow. DNA was stained with Hoechst 322 (blue). transcribed but not targeted by MSLs (Alekseyenko et al. 2006; Gilfillan et al. 2006; Legube et al. 2006). And secondly, as shown in this study, the m of gene looses its targeting properties without sequences towards the 3’ end while still being transcribed (Figure 4 and Supplementary Figure 3). Our data show that most likely the targeting signals for the MSL complex include DNA sequences embedded in the coding regions of m of and CG3016 only to be exposed when the gene is transcribed. These target sequences are found towards the 3’ end and are necessary but not sufficient for MSL1 recruitment, out of context of the entire gene. It remains possible however that additional elements also contribute to MSL1 target recognition. Such elements could either be DNA sequences or simply other chromatin-associated factors/modifications that facilitate MSL1 target recognition in a chromatin context. Alternatively a RNA secondary structure might be involved in MSL recruitment. Such a RNA structure would be a feature of the mRNA sequence. Since the secondary RNA structure formed is independent of the orientation of transcription, the situation created in the case where m of is transcribed in an antisense direction would be similar if not identical to the situation where m of is transcribed in sense orientation. It is unlikely however, that a natural antisense transcript is involved in MSL recruitment because a m of transgene without a promoter failed to recruit MSL1 where it would still have the potential to produced an antisense RNA molecule, if this was the case (Figure 1D). We failed to find any predicted target sequences in the m of gene and although the CG 3016 gene shows some similarity to the roX1/2 high affinity consensus sequences, CG3016 does not behave as a high affinity site, as judged by MSL3 dependent recruitment. This once again emphasizes the difficulty of predicting MSL target sequences. In agreement with previous studies, we conclude that most probably the nature of these sequences determines the affinity of MSLs for its targets and not the level of transcription as any type of promoter reveals m o f as a target (Dahlsveen et al., 2006; Gilfillian et al., 2006). 58 Chapter 2

Figure 5. Transcription dependent targeting of MSL1 to CG3016 and the identification of a targeting sequence towards the 3’ prime end of the gene. MSL1 immnuostaining (green) in combination with DNA-FISH (red) on an autosomal P-element insertion carrying CG3016 with (A) or without (B) its endogenous promoter. A 339bp fragment (represented by a white box) corresponding to nucleotide positions 1581-1920bp from the transcription start site of CG3016 (C), multimerization of the 339bp sequence (5 tandem repeats) in a wild-type (D) and in an msl-3083 mutant background (E). Recruitment of MSL1 to the transgenes is indicated by an arrow. DNA was stained with Hoechst 322 (blue).

Our data may also explain in part the limited predictive power of MSL binding, since targeting only occurs when the gene is transcribed and thus the sequence is exposed. Therefore, MSL binding predictions should also take into account the transcription state of genes or possibly the chromatin state, for example by creating a genome wide DNaseI map (Sabo et al. 2004) of the X chromosome. Unlike the full length mof or CG3016 genes, the affinity of MSL1 for the 3’ end sequences of the m of and CG3016 genes is not sufficient for visualization on polytene chromosomes. Furthermore, even though multimerisation of sequences towards the 3’ of CG3016 restores the binding of MSL1 in the wild-type context, the Co-transcriptional recruitment of the dosage compensation complex 59 affinity of MSL1 for this CG3016 sequence is too weak to be maintained in the absence of MSL3. These results show that on the one hand there are “high affinity sites” such as roX genes, that display transcriptional independent MSL targeting sites, that are able to recruit MSLs as relatively small DNA sequences (Kageyama et al. 2001; Oh et al. 2004). And on the other hand the majority of sites present on the X chromosome are “low or moderate affinity sites” for MSL1 that require exposure of their target sequences presumably by transcriptional activity or artificially by multimerisation in order to be recognized as a MSL target sequence. We therefore propose a model of MSL recruitment to the majority of X-linked target genes based on a combination of active transcription and the presence of DNA target elements. Future bioinformatics studies encompassing several MSL target genes should reveal whether the 3’ end of X linked genes harbors a particular consensus sequence, binding sites for other factors or even a particular secondary structure that together with transcriptional activity contributes to MSL target recognition of X-linked genes.

Materials and Methods

Chromatin-Immunoprecipitation (ChIP) All ChIP experiments were performed at least three times using independent chromatin preparations as described in (Orlando and Paro 1993). Briefly, SL-2 cells were grown in Schneider medium (Gibco) containing 10% FCS. 1 x 108 cells were cross-linked with formaldehyde for 8 min. Sonication was performed (26x 30 sec) at maximum power (Bioruptor,CosmoBio) in lysis buffer (50 mM HEPES/KOH at pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% DOC, 0.1% SDS + Complete protease inhibitors (Roche)) . 100 ^g chromatin and 3 ^l of polyclonal antibody was used per IP (MSL1, MSL3 raised in rats and MOF raised in rabbit as described previously (Mendjan et al. 2006). Immunoprecipitated complexes were isolated by adding protein A/G-Sepharose (Roche) followed by four washing steps: 2x lysis buffer, 1x DOC buffer (10 mM Tris pH 8, 0.25 M LiCl, 0.5% NP-40, 0.5% DOC, 1 mM EDTA), 1x TE pH 8. DNA was eluted in 1x elution buffer (1%SDS, 0.1M NaHCO3) 20 min at room temperature followed by reversal of crosslinks at 65°C overnight. DNA was purified by a 30min incubation 37°C RNaseA (0.2mg/ml), 2hr Proteinase K (0.05mg/ml) followed by phenol/chlororform extraction and DNA 60 Chapter 2 precipitation. Each ChIP was resuspended in 100^l TE.

Quantitative PCR For the spanning of the cytological location 5c5 primers were designed to space approximately every 500bp, which is the average size of the chromatin used in this study (primers available upon request). The roX2, runt and gapdh primer pairs are as described in (Legube et al. 2006). Q-PCR analysis of the ChIP was performed using the SYBR Green PCR master mix (Applied Biosystem), 100 ng of each primers, and 1 ^L of the immunoprecipitated DNA, in an ABI7500 Real-time PCR Instrument (Applied Biosystem). The formula [%ChIP/input] = [E(ainput-CtChIP) * 100%] (where E represents the primer efficiency) was used to calculate the percentage recovery after ChIP as compared to input. For the analysis of the RNA levels, RNA was first reverse-transcribed using the SuperScript RT (Invitrogen), and 500 ng of random hexamer. One microliter of the cDNA was then subjected to real-time PCR using the SYBR Green PCR master mix (Applied Biosystem) and 10pmol/^l of each primer. The primers designed in the middle of the genes in the ChIP experiment were used for the analysis of the transcript levels. For the a-amanitin ChIP experiment, primer pairs were designed to amplify 100-200bp fragments in the beginning, middle and end of genes. For the Q-RT-PCR analysis of the transcript levels the RT reaction was performed as described in the RT-PCR section below. RNA levels were normalized to mitochondrial RNA and depicted as percentage recovery of input DNA after a- amanitin treatment compared to mock treated cells.

RT-PCR For RT-PCR in Supplementary Figure 3, third instar larvae were snap frozen in liquid nitrogen and crushed with a mortar and pestle. RNA was then collected following instructions from the Qiagen RNeasy kit. Reverse transcriptase (RT) reactions were performed with random hexamers using Invitrogen SupersciptII. RT reactions were loaded as a dilution series (1, 0.1, and 0.001 ^l of RT mix). For RT-PCR on the transgenes a primer specific for the CaSpeR vector was used in combination with a m of specific primer. In contrast, for the expression of the endogenous m of gene both primers were encoded within the coding sequence of mof. Co-transcriptional recruitment of the dosage compensation complex 61 a-amanitin treatment SL-2 cells were grown to a density of approximately 4 x 106 and treated for 20hr with either a-amanitin (15 ^g/_l (Sigma)) or plain insect medium. 1 x 108 cells were used for ChIP, 1x106 cells were used to make a nuclear extract as described in (Akhtar et al. 2000) and 1 x 106 cells were used for RNA purification. The samples were analysed by SDS PAGE followed by Western blot analysis.

Immuno-FISH on polytene staining Preparation of polytene chromosomes and immuno- FISH were performed as described (http://www.igh.cnrs.fr/equip/cavalli/Lab%20Protocols/Immunostaining.pdf). The location of the target genes was detected with specific probes made against the mini­ white gene present in our transgenic cassettes. The probes for FISH were generated using random primed dioxygen-dUTP labeling (Roche) of the mini-white gene. MSL1, MSL3, MOF and MLE antibodies were used at 1:500 dilution (Mendjan et al. 2006). Images were captured with an AxioCamHR CCD camera on a Zeiss Axiovert200M microscope using a 100x PlanApochomat NA 1.4 oil immersion objective.

Fly genetics Flies were raised on standard cornmeal-agar-yeast medium at 18 °C or 25 °C. To generate transgenic flies carrying different insertions all fragments were cloned using PCR based strategy (primers available on request) into the p[PCaSpeR]4 (Pirrotta 1988) vector, except for w-;P{w+ UAS-mof} and w-;P{w+ tub-mof} where the m of cDNA was cloned downstream of multiple GAL4 binding sites pP[UAST] (Brand and Perrimon 1993) and downstream of a 2.4 kb tubulin promoter sequence respectively. For the line y- w-;P{w+ tubm of } the yellow cassette was subcloned from p[PJ35] (Struhl and Basler 1993) into the tub-mof vector. Transgenic flies were made by P-element-mediated transformation of the w1118 (also referred to as w-) recipient stock (Rubin and Spradling 1982). Lines were selected for second or third chromosome insertions. To generate msl-3083 mutant larvae that carry P{w+ tub- m of } or P{ w+ cg3016 1581-1920 5mer}. y- w-; msl-3083 {hsp83-msl-2} females were crossed to w-; msl-3083 P{w+ tub-mof}/TM6C, Sb Tb or P{ w+ cg3016 1581-1920 5mer}/TM6C, Sb Tb males. msl-3083 female larvae, w-; msl-3083 P{hsp83-msl-2}/msl- 62 Chapter 2

3083 P{w+ tub-mof} were distinguished by the absence of the Tb phenotype. To create y- w-; P {w+ tub-mof} from y- w-; P{ w+ tub

Acknowledgements We thank members of the lab for helpful discussions. We thank Ann-Mari Voie for fly injections. We are grateful to Ritsuko Suyama for her excellent technical expertise for generating transgenic flies. We thank Juerg Mueller for providing the tubulin driven pho flies. We are grateful to Andreas Ladurner, Eileen Furlong, Francois Spitz for critical reading of the manuscript. This work was supported by DFG SPP1129 “Epigenetics”and the EU funded NoE “Epigenome” to A.A.

References Akhtar, A., Zink, D., and Becker, P.B. 2000. Chromodomains as RNA interaction modules. Nature 407: 405-409. Alekseyenko, A.A., Larschan, E., Lai, W.R., Park, P.J., and Kuroda, M.I. 2006. High­ resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes Dev 20(7): 848-857. Baker, B.S., Gorman, M., and Marin, I. 1994. Dosage compensation in Drosophila. AnnuRevGenet 28: 491-521. Brand, A.H. and Perrimon, N. 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118(2): 401-415. Charlesworth, D. and Charlesworth, B. 2005. Sex chromosomes: evolution of the weird and wonderful. Curr Biol 15(4): R129-131. Dahlsveen, I.K., Gilfillan, G.D., Shelest, V.I., Lamm, R., and Becker, P.B. 2006. Targeting determinants of dosage compensation in Drosophila. PLoS Genet 2(2): e5. Demakova, O.V., Kotlikova, I.V., Gordadze, P.R., Alekseyenko, A.A., Kuroda, M.I., and Zhimulev, I.F. 2003. The MSL complex levels are critical for its correct targeting to the chromosomes in Drosophila melanogaster. Chromosoma. Fagegaltier, D. and Baker, B.S. 2004. X chromosome sites autonomously recruit the dosage compensation complex in Drosophila males. PLoS Biol 2(11): e341. Gergen, J.P. 1987. Dosage Compensation in Drosophila: Evidence That daughterless and Sex-lethal Control X Chromosome Activity at the Blastoderm Stage of Embryogenesis. Genetics 117(3): 477-485. Gilfillan, G.D., Straub, T., de Wit, E., Greil, F., Lamm, R., van Steensel, B., and Becker, P.B. 2006. Chromosome-wide gene-specific targeting of the Drosophila dosage compensation complex. Genes Dev 20(7): 858-870. Kageyama, Y.M., G. Gilfillan, G. Kennedy, H.G. Stuckenholz, C. Kelley, R.L. Becker, P.B. Kuroda, M.I. 2001. Association and spreading of the Drosophila dosage compensation complex from a discrete roX1 chromatin entry site. EMBO J 20(9): 2236-2245. Co-transcriptional recruitment of the dosage compensation complex 63

Kelley, R.L., Meller, V.H., Gordadze, P.R., Roman, G., Davis, R.L., and Kuroda, M.I. 1999. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell 98(4): 513-522. Klymenko, T., Papp, B., Fischle, W., Kocher, T., Schelder, M., Fritsch, C., Wild, B., Wilm, M., and Muller, J. 2006. A Polycomb group protein complex with sequence-specific DNA-binding and selective methyl-lysine-binding activities. Genes Dev 20(9): 1110­ 1122. Legube, G., McWeeney, S.K., Lercher, M.J., and Akhtar, A. 2006. X-chromosome-wide profiling of MSL-1 distribution and dosage compensation in Drosophila. Genes Dev 20(7): 871-883. Lucchesi, J.C., Kelly, W.G., and Panning, B. 2005. Chromatin Remodeling in Dosage Compensation. Annu Rev Genet. Lyman, L.M., Copps, K., Rastelli, L., Kelley, R.L., and Kuroda, M.I. 1997. Drosophila male- specific lethal-2 protein: structure/function analysis and dependence on MSL-1 for chromosome association. Genetics 147(4): 1743-1753. Mendjan, S. and Akhtar, A. 2006. The right dose for every sex. Chromosoma. Mendjan, S., Taipale, M., Kind, J., Holz, H., Gebhardt, P., Schelder, M., Vermeulen, M., Buscaino, A., Duncan, K., Mueller, J., Wilm, M., Stunnenberg, H.G., Saumweber, H., and Akhtar, A. 2006. Nuclear pore components are involved in the transcriptional regulation of dosage compensation in Drosophila. Mol Cell 21(6): 811-823. Oh, H., Bone, J.R., and Kuroda, M.I. 2004. Multiple classes of MSL binding sites target dosage compensation to the X chromosome of Drosophila. Curr Biol 14(6): 481-487. Oh, H., Park, Y., and Kuroda, M.I. 2003. Local spreading of MSL complexes from roX genes on the Drosophila X chromosome. Genes Dev 17(11): 1334-1339. Orlando, V. and Paro, R. 1993. Mapping Polycomb-repressed domains in the bithorax complex using in vivo formaldehyde cross-linked chromatin. Cell 75(6): 1187-1198. Park, Y., Mengus, G., Bai, X., Kageyama, Y., Meller, V.H., Becker, P.B., and Kuroda, M.I. 2003. Sequence-specific targeting of Drosophila roX genes by the MSL dosage compensation complex. Mol Cell 11(4): 977-986. Pirrotta, V. 1988. Vectors for P-mediated transformation in Drosophila. Biotechnology 10: 437-456. Rubin, G.M. and Spradling, A.C. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218(4570): 348-353. Sabo, P.J., Humbert, R., Hawrylycz, M., Wallace, J.C., Dorschner, M.O., McArthur, M., and Stamatoyannopoulos, J.A. 2004. Genome-wide identification of DNaseI hypersensitive sites using active chromatin sequence libraries. Proc Natl Acad Sci U S A 101(13): 4537-4542. Sass, G.L., Pannuti, A., and Lucchesi, J.C. 2003. Male-specific lethal complex of Drosophila targets activated regions of the X chromosome for chromatin remodeling. Proc Natl Acad Sci U S A 100(14): 8287-8291. Smith, E.R., Allis CD, Lucchesi JC. 2001. Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem 276(34): 31483-31486s. Straub, T. and Becker, P.B. 2007. Dosage compensation: the beginning and end of generalization. Nat Rev Genet 8(1): 47-57. Struhl, G. and Basler, K. 1993. Organizing activity of wingless protein in Drosophila. Cell 72(4): 527-540. 64 Chapter 2

Supplementary Material

Supplementary Figurei

Supplementary Figure2

B FISH

r - ♦ UAS mof P{w+uas-mof} Co-transcriptional recruitment of the dosage compensation complex 65

Supplementary Figure3 & jyV

0.010.11.0 0.010.11.0

mof RNA

Mitochondrial RNA

123 456 789 M

Supplementary Figure4

roX2 982-1052/CG3016 1600-1680 actagtgaa---atgttatacgaaacttaacaattgccaaataatacagatcg I I I I ! INI III I I I I I I I I filli gcctgtgcatccatgtggcgcggacggtgtggct-gccaaetgg acaggtgt

a tttagagcgaga tgacaatia I I lí I I I I I I I gc---aagcggaaggactatgtacacttcccc

roX2 1053-1144/CG3016 1680-1778 gagaggcgatc.tctctcçrtatacgàgÇcttgaaaagaaag-ag'aafgcgaacggtgctggc— ttagag I IMI I I 11 I I II III I I I I I I II I 11 I gagag-c— tctc-c------atggcgccctacagcttcgtgcagccgcatctcaata— gccaggt-gag

agagatg-gcaa tactaatta------actgc Il II III I II III I cgtg-tgttgcata-tg-tttgccccagaataacaaacttcc

roX2 1161-1285/CG3016 1750-1902 tttgttggcgctaaaagtaacggaaa-ttc------gagatacttttagggctgcca I I I 11 I I I I I I I I I I I I I I 11 I I III II tatgtttgccccagaa-taac--aaacttcccctgtaaaaattatccttatatatgatc

ccttggtttccagggtgaccagaactgacacttaaat-tacatatgacaaataaagactt Il II I III I I I I I I I I I I I I I I I atttaaa tacata ta tctaaagga tatatatgtataggatatatctatagaatataggt

atctgctattgcaaa I I I I I I I I I ctttcctttt-ctaattggtgtacaaagagtagtggca 66 Chapter 2

Supplementary Tablel

genotype Nuin her MSI.-I recruitment lin es P{w' tub-mof } 5 4 P{w‘ uas-nwf }______1 5 P f w ' m o f 7} 4 2 6 5 P{w‘ mof 'A prom} 5 0 P{w~ m of 'A 3'prime} 5 0 P f ir tub-mof 4 AS} 4 3 P {w ‘ cg3QI6J > 7 6 P(w~ cg30!6 ~A prom} 5 0 P{ \i " tub >>*> m o f } 9 Ò P{ vr' tu b-m of} + > v ’ > | 2 P{ ir ' tub-plio} 3 0 Pf w’ cg3016(lS8l-\92<}i} ■ ■ P{ H'' cg3016{ 1581 1920) 5mer} 5 3 P{ ir mof Jprime} 5 0

Supplementary Figure legends

Supplementary Figure 1 Recruitment of MSL1, MSL3, MLE, and MOF on tubulin driven m of transgene (P{w+tub-mof}). Recruitment of MSL proteins to the transgene is indicated by an arrow. DNA was stained with Hoechst 322 (blue).

Supplementary Figure 2 (A) MSL1 is not recruited on transgene expressing autosomally encoded pho gene. (B) MSL1 is recruited on transgene carrying GAL4UAS driven m o f gene. Recruitment of MSL1 to the transgenes is indicated by an arrow. DNA was stained with Hoechst 322 (blue).

Supplementary Figure 3 Expression analysis by RT-PCR of the lines P{w+ m of '9A 3prime}(lanes 7-9) and P{ w+ mof 3prime} (4-6) as compared to endogenous m of expression (WT, lanes 1-3) to detect levels of m of RNA (top panel). As a loading control mitochondrial ribosomal (mt:lr) RNA was used (bottom panel). M represents DNA ladder. RT reactions were loaded as dilution series as shown. Co-transcriptional recruitment of the dosage compensation complex 67

Supplementary Figure 4 Sequence alignment using ClustalW (http://www.ebi.ac.uk/clustalw/) of the roX2 high affinity site with the 339bp CG3016 sequence. In red are conserved sequences between roX1/roX2 (Park et al. 2003). In blue are sequence motifs involved in MSL complex binding (Dahlsveen et al. 2006).

Supplementary Table 1 Number of independent fly lines tested for each transgene used in this study. Recruitment of MSL1 on each line was scored and the lines showing MSL1 recruitment are indicated. 68 Chapter 2 Genome-wide analysis reveals MOF as a key regulator of dosage compensation and gene expression in Drosophila 70 Chapter 3

Genome-wide analysis reveals MOF as a key regulator of dosage compensation and gene expression in Drosophila

Jop Kind*, Juan M Vaquerizas*, Philipp Gebhardt, Marc Gentzel, Nicholas M Luscombe, Paul Bertone and Asifa Akhtar

* these authors contributed equally to this work.

Abstract Dosage compensation, mediated by the MSL complex, regulates X chromosomal gene expression in Drosophila. High-resolution, genome-wide analysis revealed differential binding behavior of histone H4 lysine 16 (H4K16) specific histone acetyltransferase MOF whether the target gene is located on the X chromosome versus on autosomes. More specifically, on the male X chromosome, where MSL1 and MSL3 are preferentially associated with the 3’end of dosage compensated genes, MOF displays bimodal distribution binding primarily to promoters as well as the 3’ ends of genes. While on MSL1/MSL3 independent X- linked genes and autosomal genes in males and females, MOF binds primarily to promoters. Binding of MOF to autosomes is functional, as H4K16 acetylation and the transcription levels of a number of genes are affected in MOF-depleted cells. MOF is therefore involved not only in the onset of dosage compensation, but also acts as a regulator of gene expression in the Drosophila genome.

Introduction

Genetic material does not exist freely in the cell but is in complex with histone proteins to form chromatin. Histones are subject to a wide variety of post-translational modifications that impose changes on chromatin structure. Among the various histone modifications, acetylation is one of the best studied (for reviews see (Kurdistani and Grunstein, 2003; Lee and Workman, 2007; Yang and Seto, 2007)). X-chromosomal dosage compensation in Drosophila melanogaster is a model system that is used to gain better understanding of broad chromosome-wide transcriptional regulation by hyper-acetylation (for review see (Lucchesi et al., 2005; Mendjan and Akhtar, 2006; Straub and Becker, 2007)). MOF as a regulator of dosage compensation and gene expression 71

Dosage compensation is a process that balances the expression of sex-linked genes in species that have evolved unequal numbers of sex chromosomes. In D rosophila this involves hyper-activation of the single male X chromosome to equalize for the combined transcriptional activity of both female X chromosomes. This process is regulated by the MSL complex, which consists of at least five male- specific lethal proteins (MSL1, MSL2, MSL3, maleless (MLE) and males-absent-on- the-first (MOF)) and two non-coding RNAs (roX1 and roX2) (for review see (Straub and Becker, 2007)). Although the individual components of the MSL complex have been studied extensively, the molecular mechanisms underlying the process of dosage compensation remain poorly characterized. MSLs are thought to function, in part, in the recruitment and activation of MOF at the X chromosome. MOF is a histone acetyl transferase (HAT) which specifically acetylates lysine 16 of Histone H4 (H4K16Ac), a modification found highly enriched on the male X chromosome (Akhtar and Becker, 2000; Bone et al., 1994; Hilfiker et al., 1997; Smith et al., 2000). The role of H4K16Ac in transcriptional regulation is not completely understood. Drosophila MOF protein targeted to a heterologous promoter by the GAL4 DNA binding domain releases chromatin-mediated transcriptional repression by H4K16Ac in yeast (Akhtar and Becker, 2000) and causes chromatin decondensation on the male X chromosome in Drosophila (Corona et al., 2002). Although, H4K16Ac does not correlate with active genes in yeast (Kurdistani et al., 2004), it is specifically associated with the activity of a subset of genes, whereas all other acetylation marks on histone H4 exhibit an additive effect (Dion et al., 2005). H4K16Ac modifications pose a structural constraint on higher-order chromatin formation; it is therefore possible that maintenance of transcriptional potential could be one of its functions. In this role, H4K16Ac would serve to limit the association of repressive protein complexes and, in tandem, relax the chromatin fiber to permit accessibility of the transcriptional machinery (Shogren-Knaak et al., 2006). At present, the distribution of H4K16Ac across the length of gene loci, together with its presumed role in chromatin de-condensation, has given rise to the hypothesis that the MSL complex is involved in transcriptional elongation (Smith, 2001). Although MSLs are mainly studied in Drosophila, all MSL proteins have conserved orthologs in mammals (Marin, 2003). This implies functional conservation 72 Chapter 3 in species with radically different dosage compensation mechanisms. Not only do the human MSLs (hMSL) form a complex like in Drosophila, most of their interaction partners are also conserved (Mendjan et al., 2006; Smith et al., 2005; Taipale et al., 2005). Furthermore, MOF in D rosophila is the only MSL protein to bind all chromosomes independently of the MSL complex in both males and females (Bhadra et al., 1999). These properties, together with evidence of evolutionary conservation, suggest a role for both MOF and H4K16Ac in transcriptional regulation beyond the process of dosage compensation. To gain insight into the role of MOF in the regulation of gene expression, we performed a comprehensive genome-wide analysis of MOF/MSL bound DNA by a series of chromatin immunoprecipitations directed against specific MSL proteins, followed by hybridization to high-resolution tiling arrays (the ChIP-chip method; see (Horak and Snyder, 2002)). This strategy allowed us to generate binding profiles for MSL1, MSL3 and MOF, along with H4K16 acetylation, in “male” Schneider (SL-2) cells as well as MOF and H4K16Ac in “female” Kc cells (see below). These analyses were complemented with microarray-based gene expression profiles of SL-2 cells depleted of MSL1, MSL3 and MOF, and of MOF-depleted Kc cells. Our data reveal MOF as a transcriptional regulator, not only on the X chromosome but also on autosomes. Intriguingly, MOF on the X chromosome associates with promoters and the 3’ end of genes whereas on autosomes and the female genome MOF associates primarily with promoters. Furthermore, an accumulation of H4K16Ac marks is observed over entire gene loci on the X chromosome, whereby this pattern is a direct reflection of MOFs activity, while on autosomes, acetylation was found to peak towards the 5’end of target genes. Interestingly, we found that binding to 3' ends of genes by MSL1, MSL3 and MOF is interdependent on the X chromosome; however MOF association to promoter­ proximal regions was found to be independent of MSL1, similar to the binding site distribution across the autosomes. It therefore appears that the role of the MSL complex members is to recruit MOF towards the gene interior, allowing more extended acetylation toward the 3’ end. These results provide interestinginsights into the mechanism of MSL complex recruitment on dosage-compensated genes and reveal an unprecedented role of MOF on autosomes independent of the MSL complex. MOF as a regulator of dosage compensation and gene expression 73

Results

Correlated MSL binding and H4K16 acetylation on the male X chromosome We created high-resolution (35bp) genome-wide DNA-binding profiles of MSL1 and MSL3, MOF and H4K16Ac in Drosophila Schneider SL-2 cells, using the ChIP-chip method to hybridize chromatin-immonuprecipitated DNA to Affymetrix tiling arrays. To equalize for the level of histones, control ChIP samples were isolated using a Histone H4 specific antibody. ChIP DNA samples were produced and hybridized as three independent biological replicates, which showed highly reproducible binding profiles (Supplementary Figures 1 and 2). To facilitate unbiased comparisons across different ChIP-chip experiments, we considered the topmost one percent of enriched binding-site loci scored for each condition (see Experimental Procedures). The use of genome-wide tiling arrays makes it possible to study the localization of MSL1, MSL3, MOF and H4K16Ac sites systematically, on all chromosomes and at high resolution. To elucidate the properties of DNA association independently of dosage compensation, we analyzed binding site occupancy of each protein over the X chromosome and the autosomes in parallel. Chromatin profiling of MSL1, MSL3, MOF as well as H4K16 acetylation exhibited a high degree of coincidence across the X chromosome (Figure 1A). As expected, we observed a clear preference for MSL1, MSL3, MOF to bind the X chromosome rather than autosomes (Supplementary Figure 3). Further analysis revealed that 534 X-chromosomal genes were bound by the three MSL proteins (Figure 1B). To further assess the accuracy of our approach, we examined a large (~150kb) region of the X chromosome for binding of MSL1 and MOF with three independent chromatin samples followed by quantitative real-time PCR (qRT-PCR). In addition, primers were designed to amplify the roX2 and runt genes; these serve as positive and negative controls, respectively, and have been used routinely for this purpose in other studies of the MSL complex (Kind and Akhtar, 2007; Legube et al., 2006; Smith, 2001). These qRT-PCR results correlate well with the profiles generated by global ChIP-chip analyses (Supplementary Figure 4). MSL1 and MSL3 are bound to few autosomal genes whereas MOF displayed extensive binding to autosomes (Figure 1B and 1C and Supplementary Figure 5). 74 Chapter 3

Consistent with these observations, MOF was also found to associate globally to autosomes on polytene chromosomes, albeit with a clearly lower incidence of binding than on the X chromosome (Figure 1D). In contrast to MOF, only a small number of sites could be observed for MSL3 on autosomes (Figure 1D). We therefore conclude that in contrast to MSL1 and MSL3, which preferentially bind to the X chromosome, MOF also binds extensively to autosomes.

MOF displays a bimodal binding pattern on X-chromosomal genes As demonstrated here, MSL1, MSL3, and MOF display a clear preference for binding to loci across the X chromosome. Given these results, we then examined individual gene components to elucidate patterns of binding to coding sequences, introns and untranslated regions. Consistent with previous observations (Alekseyenko et al., 2006; Gilfillan et al., 2006; Legube et al., 2006), MSL1, MSL3, and MOF bind preferentially to gene loci over both intergenic regions and UTRs on the X chromosome (Supplementary Figure 6A-C). In striking contrast, however, a significant enrichment of MOF binding sites to autosomal intergenic regions and 5' UTRs was observed, whereas binding to 3' UTRs is nearly absent. (Supplementary Figure 6C, E). This marked shift in binding preference suggests diversified functional association of MOF to intragenic regions between the X chromosome and autosomes. To establish an average binding profile across regulated gene loci, oligonucleotide probesets corresponding to bound genes (on X chromosomes and autosomes) were analyzed for relative binding frequency along the scaled lengths of gene loci (Figure 2A-D, Supplementary Figure 7). In this manner, it can be seen that H4K16 acetylation gradually increases towards the 3’ ends of genes, similar to the pattern displayed by MSL1 and MSL3. Surprisingly however, MOF displays a bimodal pattern of binding towards the beginning and the 3’end of genes (compare Figure 2C to A, B and D). Similar results were obtained by performing the analyses reporting only one significant bound probe per gene per standardized region to account for gene length effects (data not shown). Distribution of individual probe intensities across individual genes further MOF as a regulator of dosage compensation and gene expression 75

MSL1 m . 1 iliiL i I iLli i llm i k

a> M SL3 E „1. ilJ [lí i, y Li Jii. i i IL iii Ii„i

Flybase m ill :iii il i uh il umilimi in; m iii mi i n il nu mit il il MH m i <->

X chromosome Autosomes MSL1 MSL3 MSL1 MSL3 B / \ 43 152 1*4 / 15 22 129 534 12

I?* 619

MSL1 :

í e » ) 1 1 1

CM MSL3 V E Ip w ,i ., 1 . .II.» 1.1 .... 1 . 1 . o«i o MOF

I’t 11. Jliilll i ,1 i l l klllili.ll lillL .lill 1 .llll.ll , 1, . Mil J ,1 íLlJlJll III l II

Flybase (♦) uiig mu inmiiiii inn in5,000 uni 000 IIIÜIIIIIHI 10.000,0001 ini 15 000,000iiiiiiiiii iiiiiii mi 30 linn 000.000 m Coordinates

Flybase lllllllllllllllllllllllllilllllllll IIIIIinilllHII!IHI«IIIIIHIIII llllllllllllllllll W

MOF MSL3 Merge

J j 3& «I»»*'** jgsf - — i X 9 / ^ / ^ y Figure 1. High resolution map of MSL1, MSL3, MOF and H4K16Ac chromatin profiling in D rosophila SL-2 cells. MOF binds the X chromosome in association with the MSL complex, but binds independently 76 Chapter 3

to autosomes. (A) Topmost 1% ranked binding loci of MSL1, MSL3, MOF and H4K16Ac on a section of the X chromosome representing 1.5 Mb. Flybase (+) and (-) represents the location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome (B) Overlap of MSL1, MSL3 and MOF target genes on the X chromosome and autosomes. (C) Comparison of the distribution of MSL1, MSL3 and MOF binding on the chromosome arm 2L. (D) Immunostaining of polytene chromosomes from male third instar larvae using antibodies against MOF (red) and MSL3 (green). DNA staining is shown in blue (Hoechst 322).

MOF displays a bimodal binding pattern on X-chromosomal genes As demonstrated here, MSL1, MSL3, and MOF display a clear preference for binding to loci across the X chromosome. Given these results, we examined individual gene components to elucidate patterns of binding to coding sequences, introns and untranslated regions. Consistent with previous observations (Alekseyenko et al., 2006; Gilfillan et al., 2006; Legube et al., 2006), MSL1, MSL3, and MOF bind preferentially to gene loci over both intergenic regions and UTRs on the X chromosome (Supplementary Figure 6A-C). In striking contrast, however, a significant enrichment of MOF binding sites to autosomal intergenic regions and 5' UTRs was observed, whereas binding to 3' UTRs is nearly absent. (Supplementary Figure 6C, E). This marked shift in binding preference suggests diversified functional association of MOF to intragenic regions between the X chromosome and autosomes. To establish an average binding profile across regulated gene loci, oligonucleotide probesets corresponding to bound genes (on X chromosomes and autosomes) were analyzed for relative binding frequency along the scaled lengths of gene loci (Figure 2A-D, Supplementary Figure 7). In this manner, it can be seen that H4K16 acetylation gradually increases towards the 3’ ends of genes, similar to the pattern displayed by MSL1 and MSL3. Surprisingly however, MOF displays a bimodal pattern of binding towards the beginning and the 3’end of genes (compare Figure 2C to A, B and D). Similar results were obtained by performing the analyses reporting only one significant bound probe per gene per standardized region to account for gene length effects (data not shown). Distribution of individual probe intensities across individual genes further confirmed that this bimodal binding of MOF as a regulator of dosage compensation and gene expression 77

MOF represent the bonafide behavior of MOF on individual genes rather then a simple superimposition of two distinct classes of sites on the X chromosome (Figure 2E and Supplementary Figure 8). Complementary analyses of MOF binding at transcription start and stop sites revealed that MOF binding peaks at promoter regions, on autosomal and X chromosomal target genes. In addition, MOF binds along the body and 3’ end of genes located on the X chromosome (Supplementary Figures 9, 10). MOF is enriched approximately 0-500bp upstream of the transcription start site, which we refer to hereafter as MOF promoter binding (Supplementary Figure 9). Intriguingly, the H4K16Ac profile across the X chromosome is enriched towards the 3’ ends of genes in a pattern very similar to the MSL3 profile (compare Figure 2B with 2D). The intensity of MOF binding at 3’ end of X-linked genes was significantly higher compared to the 5’ends (p < 4e_08) (Supplementary Figure 11A). In contrast, MOF binding on autosomes was significantly higher at 5’ends of autosomal genes (p 0.014) (Supplementary Figure 11B). It therefore appears evident that in SL-2 cells MOF binds to promoters as well as throughout the body of X-chromosomal genes, with a binding-peak at 3’ends. This in contrast to the activity observed on autosomes, where MOF binding peaks at promoters.

MOF binds promoters in Kc cells Differential binding of MOF to X chromosomal genes and autosomes with respect to MSL1 and MSL3 in SL-2 cells (Figure 2C, Supplementary Figure 7C) prompted us to perform genome-wide analysis of MOF binding and H4K16Ac in Kc cells. In Kc cells, MSL2 is translationally repressed by SXL as part of the sex determination pathway (Bashaw and Baker, 1995; Zhou et al., 1995). Consequently, the MSL complex cannot assemble, and its members are unstable (Kelley et al., 1995). Kc cells may therefore be regarded as "female” cells as opposed to “male” SL- 2 cells where MSL complex members are expressed and exhibit the classical staining pattern of the male X chromosome (Duncan et al., 2006; Mendjan et al., 2006). In contrast to the pattern of activity observed in SL-2 cells, MOF binding sites and H4K16Ac marks are not restricted to the X chromosome but rather are distributed 78 Chapter 3

MSL3 B

cu ë £ R (fi 0) i C 5 ™ c 0> O ’ o e Q g> a

5 TSS END 3

MOF H4K16AC

o>i c c (D © o c r

Si Q Si Density Density

5 TSS END 3 5 TSS END 3

L»

.PH MSL1 -1 5

>10

MSL3 /w v f \

MOF

F lyB as e gene<+) 30 2,196,000 V P ^ ^ ^ ^ ^ ^ 2,200,000 2 ,2 0 2 , 0 0 0 Coordinates

F lyB as e g en o (-) ; 4

Figure 2. Bimodal distribution of MOF on X chromosomal genes. Normalized binding distribution to gene loci in SL-2 cells using topmost1% targets. Distribution of MSL1, MSL3 and MOF and H4K16Ac across the X chromosome (A-D). Genes with significant binding were scaled to similar lengths and the relative position of significant probes was computed. Bars MOF as a regulator of dosage compensation and gene expression 79

represent the number of significant probes in a given region. A continuous fit of the distribution is depicted in red. MOF binds to promoters (5’ ends) and towards the 3' ends of X-chromosomal gene loci. This bimodal binding pattern is different from the primarily 3’ enrichment of MSL1, MSL3 and H4K16Ac (A-D). TSS represents (transcription start site) and END represents (transcription stop site). (E) MSL1, MSL3 and MOF binding intensity on a single X chromosomal target gene (PH1). Flybase (+) and (-) represents the location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome. evenly across the genome in Kc cells (Supplementary Figure 3; Supplementary Figure 6E, F; Figure 3A). In addition, MOF does not display a bimodal distribution across gene loci in Kc cells, but instead is mainly restricted to promoters with a concurrent shift in the H4K16Ac profile from 3’ to 5’ enrichment (Supplementary Figure 9). Notably, when in SL-2 cells the topmost-ranked 1% significant autosomal gene targets were analysed independently of the X chromosome, the MOF and H4K16Ac profiles appear nearly identical to those obtained from Kc cells (Figure 3B). Furthermore, a significant number of genes are similarly bound by MOF on autosomes in SL-2 and Kc cells (Figure 3C). In keeping with these results, the binding-site occupancy is nearly identical between both cell types (Supplementary Figure 12). Interestingly, we found that the intensity of 5’ MOF binding was significantly higher on the X chromosome versus autosomes in both SL-2 cells (p < 2e_18) and Kc cells (p < 3e_08) (Supplementary Figure 13). Furthermore, MOF binding correlated highly significantly with H4K16Ac occupancy in both SL-2 (p < 2.2e-16) and Kc cells (p < 2.2e-16) (Figure 3D). We also found that approximately 80% of all MOF bound targets (autosomes and X chromosomes) are active genes in both SL-2 and Kc cells (Supplementary Figure 14; see Supplementary Experimental Procedures). Among the 1980 genes bound by MOF in the two cell lines, Gene Ontology (GO) analysis revealed a number of statistically over-represented biological processes related to the cell cycle (Supplementary Figure 14C, Supplementary Table 1). Similarly, a variety of other biological processes were found to be significant among genes bound independently in either SL-2 (971 genes) or Kc cells (943 genes). These results are summarized in Supplementary Tables 2 and 3. 80 Chapter 3

Taken together these results demonstrate that MOF, in addition to binding across the body of genes on the male X chromosome, binds promoters of transcriptionally active genes in both SL-2 and Kc cells on all chromosomes.

MOF binding to promoters is independent of MSL1 Global analyses in both cell types revealed that MOF resides on promoters on all chromosomes (Figure 2 and Figure 3). Invariant binding of MOF to promoters of X-linked genes between SL-2 and Kc cells (Figure 3B) argues for MSL-independent targeting of MOF to promoters on the X chromosome. To test this hypothesis, we performed RNAi-mediated depletion of MSL1 followed by ChIP-qRT-PCR analysis to study MOF recruitment. We analyzed the four X-linked genes CG8173, par-6, ucp4a and the previously identified “high-affinity site” roX2, where MSL1 recruitment has been shown to be MOF independent (Kelley et al., 1999; Park et al., 2002). PCR primers were designed to span the promoter (P1), middle (P2) and end (P3) of each gene (See Experimental Procedures). In MSL1 depleted cells, binding of MOF is severely compromised across the lengths of all four genes tested as compared to the control EGFP RNAi-treated cells, whereas MOF binding to promoter-proximal regions remained unaffected (Figure 4A-D). MOF as a regulator of dosage compensation and gene expression 81

Figure 3. MOF is bound to promoter-proximal regions on autosomes in SL-2 and Kc cells. (A) Binding profile of MOF and H4K16Ac in SL-2 and Kc cells on about 1 Megabase (MB) region of chromosome 2L. Flybase (+) and (-) represents the location of genes on the forward and reverse DNA 82 Chapter 3

strands respectively. Coordinates represent the position on the corresponding chromosome. (B) Probe frequency and density measurements of MOF binding and H4K16Ac to gene loci on the autosomes in SL-2 and Kc cells. Default binding of MOF to promoters in SL-2 and Kc cells results in a shift in the H4K16Ac pattern towards the 5' end across gene loci. (C) Overlap in MOF target genes between SL-2 and Kc cells on autosomes. (D) MOF binding significantly correlates with H4K16Ac in both SL-2 (p < 2e-16) and Kc cells (p < 2e-16).

Consistent with the ChIP-chip analysis, MOF was found to bind promoters on the same set of genes in Kc cells, without any substantial enrichment towards the interior of X chromosomal genes, with the exception of modest binding to the roX2 high affinity site (Supplementary Figure 15A). The presence of MSL1 could not be detected above threshold levels on any of the other X-chromosomal genes in Kc cells, in agreement with polytene chromosome stainings (data not shown). Similarly, MOF displayed sole promoter occupancy for an X-chromosomal gene (CG12094) and three autosomal genes (hbs1, frazzled (fra), gprk2) in SL-2 cells that were not found to be enriched by MSL1 or MSL3 (Supplementary Figure 15B). We therefore conclude that MOF recruitment to promoters is MSL-independent on dosage-compensated genes in both SL-2 and Kc cells, whereas MOF binding to the 3’ ends of these genes requires MSL1. We have previously shown that sequences towards the 3’ end of two dosage- compensated genes contain targeting cues for the MSL complex (Kind and Akhtar, 2007). We were therefore interested in testing whether MSL1 and MSL3 target the 3’ end of genes independently of MOF, and whether MOF localization to the gene interior is MSL dependent. In agreement with previous studies on polytene chromosomes, MSL1 binding to roX2 is only mildly affected upon MOF depletion. Since roX2 is a high-affinity site where partial complexes containing MSL1 can assemble independently of MOF and MSL3, this experiment showed consistency with previously published data (Kelley et al., 1999; Park et al., 2002) and confirmed the reproducibility between both experiments (Figure 4H). However, MSL1 binding to the three dosage-compensated genes or low affinity sites (Ucp4A, par-6, CG8173) is significantly reduced in cells depleted of MOF when compared to the EGFP RNAi control samples (Figure 4E-G). Therefore, we conclude that MOF is essential for MOF as a regulator of dosage compensation and gene expression 83 targeting of the MSL complex to dosage-compensated genes or low-affinity binding sites. In contrast, binding of MSL1 to high affinity sites such as roX2 is independent of MOF.

Figure 4. Binding of MOF to promoters is independent of MSL1. MOF is essential for targeting of MSL1 and MSL3 to X-linked genes, but does not itself require MSL1 for binding to promoters. Chromatin immunoprecipitation (ChIP) using MSL1 (black), MOF (red) and MSL3 (grey) antibodies in MSL1 (A-D) or MOF-depleted (E-H) cells. Binding of MSL1 (black), MOF (red) and MSL3 (grey) to the X-linked genes ucp4a, par-6, CG8173, rox2 is shown. EGFP dsRNA-treated cells were used as 84 Chapter 3

controls. ChIP is shown as percentage recovery of input DNA. Primers were positioned at the promoter (P1), middle (P2) and end (P3) of genes. The exact position of the primers is described in supplementary text. ChIP is shown as percentage recovery of input DNA (% Input). Error bars represent standard deviation (StDev) of three independent experiments.

MOF is responsible for bulk H4K16 acetylation Although MOF alone displays HAT activity in vitro (Akhtar and Becker, 2000) this has been shown to be enhanced when MOF is in complex with MSL1 and MSL3 (Morales et al., 2004). The shift in H4K16Ac 3’ enrichment on the X chromosome (Figure, 2D), to 5’ enrichment on autosomes in SL-2 and Kc cells (Figure 3B) together with the correlation between MOF binding and H4K16Ac in both SL-2 and Kc cells (Figure 3D), suggests that MOF is active as a HAT on promoters independently of the MSL complex in vivo. In order to test for HAT activity of MOF on promoters, we analyzed H4K16Ac levels for a subset of X chromosomal (CG8173, par-6, Ucp4A, roX2) and autosomal (hbs1, fra, gprk2) genes by ChIP-qRT-PCR analysis in cells depleted of MOF (Figure 5). EGFP dsRNA treated cells were used as controls. Control ChIP for histone H4 levels was performed in parallel for each condition. We were also eager to test whether the presence of MOF at promoters of X chromosomal genes in the absence of MSL1 is sufficient for HAT activity. As shown in Figure 5, while histone H4 levels remain unaffected (grey plots), we observe that H4K16Ac on the target genes is markedly reduced upon MOF depletion on both X chromosomal and autosomal targets compared to EGFP dsRNA-treated control cells (red plots). H4K16Ac levels in MSL1-depleted cells were reduced only on X-chromosomal genes, whereas in the case of autosomal MOF targets, H4K16Ac levels remained unaffected or showed only a slight increase. This could be due to an excess of available MOF protein following its apparent dissociation from the X chromosome (black plots). These results strongly suggest that MOF is directly involved in H4K16 acetylation of its target genes, and that in addition, MOF’s activity on the X chromosome is coordinated by the other MSLs similar to the behavior observed in vitro (Morales et al., 2004). These observations were further confirmed by mass spectrometric analysis of endogenous histones isolated from control EGFP- or MOF dsRNA-depleted SL-2 and MOF as a regulator of dosage compensation and gene expression 85

Kc cells (Figure 6). MOF levels were depleted to approximately 20% of those observed in EGFP dsRNA-treated samples in SL-2 and Kc cells (Figure 6A). Interestingly, we found that at steady state only about 20% of histones were mono- acetylated in SL-2 cells, and approximately 15% in Kc cells. Of this monoacteylation, H4K16Ac was accounted for by approximately 29% and 23% of total acetylation in SL-2 and Kc cells, respectively. Depletion of MOF resulted in a clear reduction of lysine 16 acetylation, such that overall monoacetylation levels dropped to approximately 11% in both cell lines. In contrast, monoacetylation at H4K5 remained unaffected (Figure 6). Taken together, these results show that MOF is responsible for the bulk of H4K16 acetylation events in both SL-2 and Kc cells.

Dosage compensation acts mainly by local binding of MSL complexes The correlation between MOF association and H4K16Ac in both SL-2 and Kc cells (Figure 3D, Figure 5) prompted us to test for the transcriptional regulation of genes by MOF in both cell types by RNAi mediated depletion followed by hybridization of the labeled transcript population to Affymetrix Drosophila 2 gene expression arrays (see Experimental Procedures). In addition, we also determined the expression profiles of SL-2 cells depleted of MSL1 and MSL3, in order to compare between regulation by MOF inside and outside the MSL context. All experiments were performed in triplicate and normalized against control EGFP dsRNA-treated samples. The three MSL proteins could be successfully depleted to a level between 10%-20% compared to EGFP RNAi-treated cells (Supplementary Figure 16). Overall, MOF depletion resulted in the most significant number of differentially expressed genes, followed by MSL3 and MSL1 in SL-2 cells (Figure 7A-D). MSL1 depletion results in down-regulation of primarily X-chromosomal genes. On the X chromosome, almost all affected genes were found to be down- regulated (Figure 7D). Interestingly, where an MSL1 knockdown almost exclusively affects X-chromosomal genes, MSL3 and MOF RNAi treatment results in both up- and down-regulation of autosomal genes (Figure 7A-D). Genes affected by MOF and MSL3 could be subcategorized into various biological functions with certain emphasis on cell cycle related processes (Supplementary Table 4). 86 Chapter 3

Figure 5. MOF is active as a histone acetyltransferase on both the X chromosome and autosomes. Chromatin immunoprecipitation (ChIP) using histone H4 and H4K16Ac-specific antibodies on four X-linked genes ucp4a, par-6, CG8173, roX2, and three autosomal genes hbs1, fra and gprk2 in MSL1- (black) and MOF-depleted (red) cells. Histone H4 ChIP (grey) remained mostly unaffected in both MSL1 and MOF dsRNA-treated cells. Primers were positioned at the promoter (P1), middle (P2) and end (P3) of genes. Exact position of the primers is described in supplementary text. ChIP is shown as percentage recovery of input DNA (% Input). Error bars represent standard deviation (StDev) of three independent experiments.

We next tested whether genes that were only upregulated (252 genes) or downregulated (217 genes) by MSL3 on autosomes were associated with a particular biological process. However, our analysis did not reveal a particularly intriguing over-represented category (Supplementary Tables 5 and 6). The majority of genes down-regulated on the X chromosome are bound by either MSL1, MSL3 or MOF (Figure 7E). We confirmed this finding by ChIP with MOF and MSL1, followed by qRT-PCR analysis of SL-2 cells depleted of these MOF as a regulator of dosage compensation and gene expression 87 proteins for 18 genes in an approximately 150kb region (see Supplementary Figure 4). As shown in Figure 7E, genes bound by MSL1 and MOF generally show good correlation with differentially down-regulated genes in the cells depleted for MOF and MSL1 (compare upper and lower panels of Figure 7F). The minority of genes that are differentially expressed but not bound could be either secondary targets or genes distally regulated via long-range elements. We conclude that, in general, genes on the X chromosome that are subject to dosage compensation are directly bound by the MSL complex in agreement with previous studies (Alekseyenko et al., 2006; Gilfilan et al., 2006). On autosomes, approximately 30% of the genes differentially regulated in MOF deprived cells are bound (Supplemental Figure 17). In Kc cells, we observed that a similar number of down-regulated genes where bound by MOF but only 15% of the up-regulated genes comprise real targets (Supplemental Figure 17). We verified gene-regulation by MOF of three target genes (hbs1, fra, gprk2) shown to display reduced H4K16Ac levels upon MOF depletion (Figure 5). We could confirm that for all three genes expression levels were reduced approximately two-fold (Supplementary Figure 18). Interestingly, although MSL1 depletion showed no effect on hbs1 and fra, expression of gprk2 was reduced similar to a MOF knockdown, indicating that in exceptional cases MSL1 is involved in the regulation of some genes on the autosomes. Taken together, these findings further support a role for MOF in the regulation of expression of genes on the X chromosome and a subset of autosomal genes. 88 Chapter 3

Total monoAc H4K16Ac H4K5Ac Figure 6. Global levels of H4K16Ac are affected upon MOF depletion in both SL-2 and Kc cells. Relative quantitative analysis of acetylation of histone H4 sites K5/K8/K12 and K16 by mass spectrometry. (A) Western blot analysis of the efficiency of MOF depletion in SL-2 (right panel) and Kc cells (left panel). Dilution of the corresponding extracts is indicated. (B) MOF as a regulator of dosage compensation and gene expression 89

Mono-acetylated peptides containing the four acetylation sites (amino acid (aa) 4-17) in relation to non-acetylated peptide H4 in SL-2 (B) and Kc (C) cells. (Columns 1, 2) Total amount of mono-acetylated peptide as fraction of non-acetylated peptide population; (Columns 3, 4) K16-mono-acetylated peptide as of fraction non-acetylated peptide population; (Columns 5, 6) K5- mono-acetylated non-acetylated peptide population. MOF-directed dsRNA interference (MOF RNAi, grey columns) in SL-2 cells leads to a reduction of the total fraction of mono-acetylated peptide in comparison with an unrelated (EGFP RNAi, black columns) control. Site-specific analysis reveals that H4K16-acetylation reflects loss of acetylation, while K5 acetylation remains unaffected. In contrast, in Kc cells overall mono-acetylation seems to be only slightly effected by dsRNA interference. Nevertheless, H4K16 site-specific mono-acetylation is reduced by a factor of 2, indicating a significant contribution to H4K16 acetylation by MOF-dependent activity in Kc cells. Error bars represent standard error of mean (SEM) of at least three independent experiments. See also supplementary experimental procedure.

Discussion

Differential distribution of the MSL complex members on target genes Consistent with previous MSL1 and MSL3 profiling studies (Alekseyenko et al., 2006; Gilfillan et al., 2006; Legube et al., 2006), we show that MSL1, MSL3, MOF and H4K16Ac display enrichment to 3’ end of genes in SL-2 cells. Surprisingly, MOF displays a bimodal binding pattern on genes residing on the X chromosome, associating with both the 3’ ends of dosage compensated genes as well as with promoter regions. Our recent observations on individual X chromosomal target genes using transgene analysis in vivo have revealed that there are at least two classes of sites; transcription independent “high affinity sites” such as roX2 and transcription dependent “low affinity sites” such as m o f or CG3016 (Kind and Akhtar 2007). Integrating the observations obtained from the genome-wide binding and RNAi mediated knockdown analysis shown here, it appears that MOF plays a central role in targeting the MSL complex to “low affinity sites” where recruitment of MSL1 and MSL3 is found to be dependent on the presence of MOF. This is in contrast to the 90 Chapter 3

“high affinity sites’ where partial complexes of MSL1/MSL2 can be recruited independently of MOF, MSL3 and MLE (Dahlsveen et al., 2006). Interestingly, we found that MOF binds not only to the male X chromosome, but also to autosomes and female chromosomes (Supplementary Figure 3). Different from the bimodal binding pattern of MOF on the male X chromosome, in Kc cells, MOF is enriched to promoters of all chromosomes similarly to the situation on the male autosomes in SL-2 cells (Figure 3B and Supplementary Figure 10). However, although the binding pattern between the X and the autosomes in Kc cells looks practically identical, the amplitude of promoter binding is significantly higher on the X chromosome than on the autosomes in Kc cells, as is the case in SL-2 cells (Supplementary Figure 13). It is possible that X chromosomal genes have as yet unidentified sequence elements that contribute towards MOF binding to promoters of X chromosomal genes in males and females. Alternatively, since reduced amount of MSL1 is expressed in females (Kelley et al., 1995) and MSL1 displays low level promoter binding on the X chromosome in SL-2 cells, it may contribute to higher amplitude of MOF binding on X chromosomal genes in both SL-2 and Kc cells compared to autosomes (Figure 2A, E, Supplementary Figure 8). As the gene density on the X chromosome is similar to that of other chromosomes (except for the fourth chromosome), this does not explain the higher amplitude of MOF binding on the X chromosome. It is therefore possible that MOF, in addition to its role in facilitating transcriptional elongation by acetylating gene loci in an MSL context, is also involved in transcriptional initiation in an MSL-independent manner perhaps by interaction with additional factors. Another interesting possibility is that the enrichment of MOF to promoters may provide a reservoir of enzyme, held in check by other factors, to be readily used by the MSL proteins or other promoter bound complexes when needed for modulating transcription levels. Chromosome Chromosome m Chromosome position of genes. (D) Venn diagram representing overlap of up- or down- or up- of overlap representing diagram Venn (D) genes. of position genes up-regulated and lines) green as (shown genes of Down-regulated cells. SL-2 distribution MOF-depleted Genome and MSL3- (A-C) MSL1-, in basis. genes differentially-expressed gene-by-gene a on chromosome iue . oae opnain cs y prglto o te X the of up-regulation by acts compensation Dosage 7. Figure son s e lns. h wie ra o te hoooe idct the indicate chromosomes the on areas white The lines). red as (shown O sargltro oaecmesto n eeepeso 91 expression gene and compensation dosage of regulator a as MOF 92 Chapter 3

regulated genes on the X chromosome or autosomes. (E) Correlation between differential expression and MSL1, MSL3 and MOF binding on the X chromosome in SL-2 cells. Each major column represents genes significantly down-regulated in the MSL1, MSL3 and MOF RNAi depletion assays respectively (note that each group of columns represent different numbers of genes, as shown in 7D). Within each group, the proportion of genes bound by MSL1, MSL3 and MOF in the ChIP-chip experiments are shaded in blue (minor columns). Genes were sorted by hierarchical clustering within each group. Unbound genes are represented as white sections. Y-axis represents the proportion of the total number of down-regulated genes on the X chromosome. (F) Correlation between binding (top) and expression (bottom) of 18 genes on the X chromosome by qRT-PCR. MOF is depicted in red and MSL1 is shown in black. Error bars represent standard deviation (StDev) of three independent experiments for both ChIP and expression analysis. (G) Working model for MOF recruitment on X-linked and autosomal genes. Our data suggest that MOF is recruited to promoter-proximal regions independently of MSL1 and MSL3. In the context of the X chromosome, the concerted action of other complex members, such as MSL1 and MSL3, allows recruitment of MOF throughout gene loci, resulting in more extended acetylation over intragenic regions peaking towards the 3’ end. In contrast, on autosomes H4K16 acetylation marks are most abundant towards the 5’ ends of genes, directly reflecting the distribution of MOF binding sites. A broader distribution of MOF protein on X linked genes, together with an extended H6K16 acetylation, may therefore confer efficient transcriptional elongation. While on autosomes, 5'-end acetylation may affect a poised state of transcriptional potential, facilitating more effective transcription factor binding and/or promoting transcription initiation. H4K16Ac is represented as red asterisks.

Intriguingly, the MSL3 profile across gene loci appeared very similar to that of H4K16Ac (Figure 2A-D), suggesting a role for MSL3 in activation and/or stabilization of H4K16Ac on X-linked genes. In support of this hypothesis, MSL3 has been shown to stimulate MOF’s HAT activity in vitro (Morales et al., 2004). Recently, MSL3 was shown to bind H3K36 trimethylated (H3K36me3) nucleosomes and H3K36me3 (which also peaks at 3’ end of genes, similar to MSLs) was shown to influence MSL binding (Bell et al., 2008; Larschan et al., 2007). In S. cerevisiae Eaf3 MOF as a regulator of dosage compensation and gene expression 93 recognition of H3K36me3 has been shown to direct Rpd3(S) to actively transcribed genes to deacetylate histones in the wake of polymerase II, preventing spurious transcription within genes from cryptic promoters (Carrozza et al., 2005). It has been proposed that the MSL complex on the X chromosome may compete for the Rpd3(S) complex, thereby increasing the overall H4K16Ac levels by reducing the turn-over rates of this modification (Larschan et al., 2007). As the 3’ ends of genes are indispensable for MSL target recognition on the X chromosome (Kind and Akhtar, 2007), we propose that MSL1 and MSL2 initially target 3’ regions by occasional recognition of degenerative DNA target elements (Dahlsveen et al., 2006; Gilfillan et al., 2006; Kind and Akhtar, 2007), possibly made accessible by low levels of H4K16Ac brought about by MOF occupancy of the promoter. MSL3 may serve to stabilize the association of MSL1/MSL2 with dosage compensated genes by binding to H3K36me3, which in turn may lead to the recruitment and stimulation of MOF to the body of the gene. It has also been proposed that local recycling of RNA polymerase II could result in enhanced mRNA production (Schubeler, 2006; Smith, 2001). MOF, with its enrichment to promoter­ proximal and 3’ regions, is a likely candidate to bridge such a loop formation. Gene structural studies should reveal whether such a gene-loop formation is involved in the process of dosage compensation.

MOF, H4K16 acetylation and gene regulation Here we present four independent lines of evidence that show that MOF is involved in H4K16Ac of a large number of genes in the male and female genome. A: MOF binding significantly correlates with H4K16Ac of all chromosomes in both SL- 2 and Kc cells (Figure 3D). B: The H4K16Ac profile across genes correlates strongly with the diversified binding of MOF between the X chromosome (peaking towards the 3’end of genes), and autosomes (peaking towards the 5’end of genes (compare Figure 2C-D with Figure 3B). C: Depletion of MOF results in a marked decrease in H4K16Ac of a number of genes on both the X chromosome and the autosomes (Figure 5). D: In MOF depleted SL-2 and Kc cells we find a more than 50% reduction in total H4K16Ac levels by mass specterometery analysis (Figure 6). Several studies have implied a structural role for histone acetylation and H4K16Ac acetylation in particular, in the packaging of DNA into chromatin. 94 Chapter 3

Interestingly, H4K16Ac has been shown to cause an increase in the a-helical content of histone H4, and to prevent 30nm chromatin-fiber formation and cross-fiber interactions (Shogren-Knaak et al., 2006). H4K16Ac might therefore serve a structural role, imparting a relaxed chromatin state that, in turn, reduces the energy required for RNA polymerase II to affect transcription through a nucleosomal template and thereby enhancing elongation efficiency (Calestagne-Morelli and Ausio, 2006). Regulation of ubiquitously-expressed (housekeeping) genes on the X chromosome by the MSL complex (Legube et al., 2006; Gilfilian et al., 2006) probably necessitates a state of continual association with its target binding sites. Elevated levels of H4K16Ac are reached on the X chromosome presumably by constant activation of MOF by MSL1 and MSL3. On the autosomes, since MOF appears to be present independently of other MSL proteins, it does not associate to the interior of gene loci but is instead promoter bound, similar to its behavior on the X chromosome in the MSL1-depleted condition (Figure 4). Assuming that MOF is involved in general transcription regulation, apart from dosage compensation, it is not surprising that MOF is required for most H4K16 acetylation (Figure 6). Similarly, MOF in mammals has been found to be responsible for most, if not all, H4K16Ac (Smith et al., 2005; Taipale et al., 2005). Interestingly, in line with a possible role for MOF in the G2/M cell cycle checkpoint in mammals (Taipale et al., 2005) we found that in both SL-2 and Kc cells, MOF-bound targets are significantly enriched for certain cell-cycle functional categories (Supplementary Tables 1, 2 and 3). It would therefore be very interesting to study gene regulation by MOF in a cell-cycle context in synchronized cells. The role of MOF mediated H4K16Ac on the autosomes remains speculative. H4K16Ac modification on autosomes by MOF may create an opportunity for transcription initiation/re-initiation, rather than being an essential mark for transcriptional activity itself (Anguita et al., 2001). This could also explain why we observe that, although MOF is generally bound to active genes (Supplementary Figure 14), approximately 30% of the autosomal bound genes are affected by MOF depletion (data not shown). MOF’s presence on autosomal genes may therefore provide a minimal landscape of H4K16Ac, maintaining a local environment with relatively open chromatin structure, presumably similar to the condition of mating MOF as a regulator of dosage compensation and gene expression 95 type loci in yeast (Johnson et al., 1990; Megee et al., 1990). Upon transcriptional cues, those genes would be able to rapidly and efficiently respond to meet the cell's requirements, as would be the case for cell-cycle related genes (as discussed above). Secondly, MOF may work together with, as yet, uncharacterized proteins which may allow RNA polymerase II to move efficiently through the chromatin template similar to the situation on the X chromosome. In fully elucidating the molecular mechanisms behind this process, a vital step will be the characterization of additional protein complexes associated with MOF, apart from the MSL complex (Dou et al., 2005; Mendjan et al., 2006; Smith et al., 2005). We propose that such complexes, comprising different trans-activating or repressive factors, may modulate MOF's HAT activity resulting in differential transcriptional outputs. Furthermore, MOF binding to promoters may allow efficient and rapid response to cellular events by recruitment/exclusion of H4K16 binding proteins or, more generally, by unique H4K16Ac-induced conformational changes to the chromatin fiber. Interestingly, one of the evolutionary conserved interacting partners of MOF is WDS, a protein in mammals shown to associate with Histone H3 lysine 4 methylation, a histone mark enriched at promoters (Dou et al., 2005; Han et al., 2006; Mendjan et al., 2006; Wysocka et al., 2005). It would be interesting to study the potential involvement of WDS or other promoter bound factors in recruiting MOF to promoters. In summary, this study has revealed that the MSL complex members do not conform to a uniform binding behavior on their target genes on the X chromosome, MSL1 and MSL3 are enriched at the 3’ end of genes while MOF shows a bimodal distribution with enrichment at promoter-proximal regions as well as 3’ ends. Our data reveal that MOF plays a central role in the targeting process on low affinity sites where recruitment of MSL1 and MSL3 appear to be dependent on the presence of MOF, in contrast to high affinity sites such as roX2 where targeting of MSL1 appears to be MOF-independent. Furthermore, the previously unappreciated binding of MOF to promoter-proximal regions on X-chromosomal as well as autosomal sites provides an opportunity to investigate additional roles of this enzyme in other cellular processes. 96 Chapter 3

Acknowledgements

We are grateful to Jos de Graaf, Tomi Bähr-Ivacevic and Vladimir Benes (EMBL Genomic Core Facility) for sample processing and hybridization to the Affymetrix tiling arrays. We are also grateful to the members of the Akhtar lab and to Wolfgang Huber and Richard Bourgon for helpful suggestions, and to Lars Steinmetz and François Spitz for critical reading of the manuscript. This work was supported by SPP1129 (Epigenetics) and Epigenome NoE under the EU Framework Programme 6.

Experimental Procedures

Chromatin immunoprecipitation (ChIP) All ChIP experiments were performed at least three times using independent chromatin preparations. The antibodies for MSL1, MSL3 and MOF are as described in (Mendjan et al., 2006). Anti-H4K16Ac (ab23352) and anti-Histone H4 (ab10158) rabbit polyclonal antibodies are from Abcam. SL-2 cells were grown in Schneider medium (Gibco) containing 10% FCS. 1 x 10A8 cells were cross-linked with formaldehyde for 8 min. Sonication was performed for 26 x 30 sec at input 5 (Bioruptor, Diagenode) in lysis buffer (50 mM HEPES/KOH at pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% DOC, 0.1% SDS + Complete protease inhibitors (Roche)). 100_g chromatin and 3_l of polyclonal antibody was used per IP. Immunocomplexes were isolated by adding protein A/G-Sepharose (Roche) followed by four washing steps: 2x lysis buffer, 1x DOC buffer (10 mM Tris at pH 8, 0.25 M LiCl, 0.5% NP-40, 0.5% DOC, 1 mM EDTA), 1x TE at pH 8. DNA was eluted in 1X elution buffer (1%SDS, 0.1M NaHCO3) 20 min R.T. followed by reversal of crosslinks at 65°C O/N. DNA was purified by a 30min incubation at 37°C RNaseA (0.2mg/ml), followed by 2hr Proteinase K digestion (0.05mg/ml), phenol/chlororform exctraction and DNA precipitation. ChIP DNA samples were resuspended in 100_l TE. We used 1_l ChIP material for each Q-PCR reaction.

Processing and hybridization of ChIP DNA Processing of the ChIP DNA samples for hybridization was performed according to (Legube et al., 2006). Hybridization, washing and scanning of arrays followed the Affymetrix ChIP-chip protocols. MOF as a regulator of dosage compensation and gene expression 97

ChIP-chip and expression data analyses and availability Microarray data are available in the ArrayExpress database (Parkinson et al., 2007) under accession numbers E-MEXP-1508 (ChIP-chip records) and E-MEXP-1505 (gene expression records). Details on ChIP-chip and gene expression data analyses are available as Supplementary Experimental Procedures.

RNA interference (RNAi) RNAi of SL-2 and Kc cells was performed as described in (Worby, 2001) with the following modifications. For all knockdowns cells where incubated with 45_g dsRNA. The cells where harvested after 4days for MSL1 RNAi and 7days for MSL3 and MOF RNAi. For both time points, GFP control RNAi experiments where performed in parallel.

Quantitative real-time PCR qRT-PCR analysis of the ChIP samples was performed using the SYBR Green PCR master mix (Applied Biosystem), 100 ng of each forward and reverse primer, and 1 ^L immunoprecipitated DNA, in an ABI7500 real-time PCR thermocycler (Applied Biosystems Inc.). The formula [%ChIP/input] = [£(Ctinput-CtChip) * 100%] (where E represents primer annealing efficiency) was used to calculate the percentage DNA recovery after ChIP as compared to the amount of input material. For quantitation of transcript levels, RNA was first reverse-transcribed using the SuperScript RT (Invitrogen), and 500ng random hexamers. One microliter of cDNA was then subjected to real-time PCR using the SYBR Green PCR master mix (Applied Biosystems) and 100ng of each primer. The primers designed in the middle of the genes in the ChIP experiment were used for the analysis of the transcript levels.

Immuno-FISH on polytene chromosomes Preparation of polytene chromosomes and immuno-FISH were performed as described (http://www.igh.cnrs.fr/equip/cavalli/Lab%20Protocols/Immunostaining.pdf). Probes for FISH were generated using random-primed dioxygen-dUTP labeling (Roche) of the mini-white gene. Rat MSL1 antibody was used at 1:500 dilution. Images were captured with an AxioCamHR CCD camera on a Zeiss Axiovert200M microscope using a 100x PlanApochomat NA 1.4 oil immersion objective. 98 Chapter 3

References

Akhtar, A., and Becker, P. B. (2000). Activation of transcription through histone H4 acetylation by MOF, an acetyl transferase essential for dosage compensation in Drosophila. Mol Cell 5, 367-375. Alekseyenko, A. A., Larschan, E., Lai, W. R., Park, P. J., and Kuroda, M. I. (2006). High­ resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes Dev 20, 848-857. Anguita, E., Johnson, C. A., Wood, W. G., Turner, B. M., and Higgs, D. R. (2001). Identification of a conserved erythroid specific domain of histone acetylation across the alpha-globin gene cluster. Proc Natl Acad Sci U S A 98, 12114-12119. Bashaw, G. J., and Baker, B. S. (1995). The msl-2 dosage compensation gene of Drosophila encodes a putative DNA- binding protein whose expression is sex specifically regulated by Sex- lethal. Development 121, 3245-3258. Bell, O., Conrad, T., Kind, J., Wirbelauer, C., Akhtar, A., and Schubeler, D. (2008). Transcription-coupled methylation of histone H3 at lysine 36 regulates dosage compensation by enhancing recruitment of the MSL complex in Drosophila. Mol Cell Biol. Bhadra, U., Pal-Bhadra, M., and Birchler, J. A. (1999). Role of the male specific lethal (msl) genes in modifying the effects of sex chromosomal dosage in Drosophila. Genetics 152, 249-268. Bone, J. R., Lavender, J., Richman, R., Palmer, M. J., Turner, B. M., and Kuroda, M. I. (1994). Acetylated histone H4 on the male X chromosome is associated with dosage compensation in Drosophila. Genes Dev 8, 96-104. Calestagne-Morelli, A., and Ausio, J. (2006). Long-range histone acetylation: biological significance, structural implications, and mechanisms. Biochem Cell Biol 84, 518­ 527. Carrozza, M. J., Li, B., Florens, L., Suganuma, T., Swanson, S. K., Lee, K. K., Shia, W. J., Anderson, S., Yates, J., Washburn, M. P., and Workman, J. L. (2005). Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription. Cell 123, 581-592. Corona, D. F., Clapier, C. R., Becker, P. B., and Tamkun, J. W. (2002). Modulation of ISWI function by site-specific histone acetylation. EMBO Rep 3, 242-247. Dahlsveen, I. K., Gilfillan, G. D., Shelest, V. I., Lamm, R., and Becker, P. B. (2006). Targeting determinants of dosage compensation in Drosophila. PLoS Genet 2, e5. Dion, M. F., Altschuler, S. J., Wu, L. F., and Rando, O. J. (2005). Genomic characterization reveals a simple histone H4 acetylation code. Proc Natl Acad Sci U S A 102, 5501­ 5506. Dou, Y., Milne, T. A., Tackett, A. J., Smith, E. R., Fukuda, A., Wysocka, J., Allis, C. D., Chait, B. T., Hess, J. L., and Roeder, R. G. (2005). Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121, 873-885. Duncan, K., Grskovic, M., Strein, C., Beckmann, K., Niggeweg, R., Abaza, I., Gebauer, F., Wilm, M., and Hentze, M. W. (2006). Sex-lethal imparts a sex-specific function to UNR by recruiting it to the msl-2 mRNA 3' UTR: translational repression for dosage compensation. Genes Dev 20, 368-379. Gilfillan, G. D., Straub, T., de Wit, E., Greil, F., Lamm, R., van Steensel, B., and Becker, P. B. (2006). Chromosome-wide gene-specific targeting of the Drosophila dosage compensation complex. Genes Dev 20, 858-870. Han, Z., Guo, L., Wang, H., Shen, Y., Deng, X. W., and Chai, J. (2006). Structural basis for the specific recognition of methylated histone H3 lysine 4 by the WD-40 protein WDR5. Mol Cell 22, 137-144. MOF as a regulator of dosage compensation and gene expression 99

Hilfiker, A., Hilfiker-Kleiner, D., Pannuti, A., and Lucchesi, J. C. (1997). mof, a putative acetyl transferase gene related to the Tip60 and MOZ human genes and to the SAS genes of yeast, is required for dosage compensation in Drosophila. Embo J 16, 2054­ 2060. Horak, C. E., and Snyder, M. (2002). ChIP-chip: a genomic approach for identifying transcription factor binding sites. Methods Enzymol 350, 469-483. Johnson, L. M., Kayne, P. S., Kahn, E. S., and Grunstein, M. (1990). Genetic evidence for an interaction between SIR3 and histone H4 in the repression of the silent mating loci in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 87, 6286-6290. Kelley, R. L., Meller, V. H., Gordadze, P. R., Roman, G., Davis, R. L., and Kuroda, M. I. (1999). Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell 98, 513-522. Kelley, R. L., Solovyeva, I., Lyman, L. M., Richman, R., Solovyev, V., and Kuroda, M. I. (1995). Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. Cell 81, 867-877. Kind, J., and Akhtar, A. (2007). Cotranscriptional recruitment of the dosage compensation complex to X-linked target genes. Genes Dev 21, 2030-2040. Kurdistani, S. K., and Grunstein, M. (2003). Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Biol 4, 276-284. Kurdistani, S. K., Tavazoie, S., and Grunstein, M. (2004). Mapping global histone acetylation patterns to gene expression. Cell 117, 721-733. Larschan, E., Alekseyenko, A. A., Gortchakov, A. A., Peng, S., Li, B., Yang, P., Workman, J. L., Park, P. J., and Kuroda, M. I. (2007). MSL complex is attracted to genes marked by H3K36 trimethylation using a sequence-independent mechanism. Mol Cell 28, 121-133. Lee, K. K., and Workman, J. L. (2007). Histone acetyltransferase complexes: one size doesn't fit all. Nat Rev Mol Cell Biol 8, 284-295. Legube, G., McWeeney, S. K., Lercher, M. J., and Akhtar, A. (2006). X-chromosome-wide profiling of MSL-1 distribution and dosage compensation in Drosophila. Genes Dev 20, 871-883. Lucchesi, J. C., Kelly, W. G., and Panning, B. (2005). Chromatin Remodeling in Dosage Compensation. Annu Rev Genet. Marin, I. (2003). Evolution of chromatin-remodeling complexes: comparative genomics reveals the ancient origin of "novel" compensasome genes. J Mol Evol 56, 527-539. Megee, P. C., Morgan, B. A., Mittman, B. A., and Smith, M. M. (1990). Genetic analysis of histone H4: essential role of lysines subject to reversible acetylation. Science 247, 841-845. Mendjan, S., and Akhtar, A. (2006). The right dose for every sex. Chromosoma. Mendjan, S., Taipale, M., Kind, J., Holz, H., Gebhardt, P., Schelder, M., Vermeulen, M.,Buscaino, A., Duncan, K., Mueller, J., et al. (2006). Nuclear pore components are involved in the transcriptional regulation of dosage compensation in Drosophila. Mol Cell 21, 811-823. Morales, V., Straub, T., Neumann, M. F., Mengus, G., Akhtar, A., and Becker, P. B. (2004). Functional integration of the histone acetyltransferase MOF into the dosage compensation complex. Embo J 23, 2258-2268. Park, Y., Kelley, R. L., Oh, H., Kuroda, M. I., and Meller, V. H. (2002). Extent of chromatin spreading determined by roX RNA recruitment of MSL proteins. Science 298, 1620­ 1623. Parkinson, H., Kapushesky, M., Shojatalab, M., Abeygunawardena, N., Coulson, R., Farne, A., Holloway, E., Kolesnykov, N., Lilja, P., Lukk, M., et al. (2007). ArrayExpress--a public database of microarray experiments and gene expression profiles. Nucleic Acids Res 35, D747-750. Schubeler, D. (2006). Dosage compensation in high resolution: global up-regulation through local recruitment. Genes Dev 20, 749-753. 100 Chapter 3

Shogren-Knaak, M., Ishii, H., Sun, J. M., Pazin, M. J., Davie, J. R., and Peterson, C. L. (2006). Histone H4-K16 acetylation controls chromatin structure and protein interactions. Science 311, 844-847. Smith, E. R., Allis CD, Lucchesi JC. (2001). Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem 276, 31483-31486s. Smith, E. R., Cayrou, C., Huang, R., Lane, W. S., Cote, J., and Lucchesi, J. C. (2005). A human protein complex homologous to the Drosophila MSL complex is responsible for the majority of histone H4 acetylation at lysine 16. Mol Cell Biol 25, 9175-9188. Smith, E. R., Pannuti, A., Gu, W., Steurnagel, A., Cook, R. G., Allis, C. D., and Lucchesi, J. C. (2000). The drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation [In Process Citation]. Mol Cell Biol 20, 312-318. Straub, T., and Becker, P. B. (2007). Dosage compensation: the beginning and end of generalization. Nat Rev Genet 8, 47-57. Taipale, M., Rea, S., Richter, K., Vilar, A., Lichter, P., Imhof, A., and Akhtar, A. (2005). hMOF Histone Acetyltransferase Is Required for Histone H4 Lysine 16 Acetylation in Mammalian Cells. Mol Cell Biol 25, 6798-6810. Worby, C., Simonson-Leff N, Dixon JE. (2001). RNA interference of gene expression (RNAi) in cultured Drosophila cells. Sci STKE 1, 95. Wysocka, J., Swigut, T., Milne, T. A., Dou, Y., Zhang, X., Burlingame, A. L., Roeder, R. G., Brivanlou, A. H., and Allis, C. D. (2005). WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. Cell 121, 859-872. Yang, X. J., and Seto, E. (2007). HATs and HDACs: from structure, function and regulation to novel strategies for therapy and prevention. Oncogene 26, 5310-5318. Zhou, S., Yang, Y., Scott, M. J., Pannuti, A., Fehr, K. C., Eisen, A., Koonin, E. V., Fouts, D. L., Wrightsman, R., Manning, J. E., and et al. (1995). Male-specific lethal 2, a dosage compensation gene of Drosophila, undergoes sex-specific regulation and encodes a protein with a RING finger and a metallothionein-like cysteine cluster. Embo J 14, 2884-2895. MOF as a regulator of dosage compensation and gene expression 101

Supplementary Material

Supplementary Figure1

MSL1Chr2L

WU.1 maan

1 input.«/»)

jet «

MU1 ita» 1U

■ 1 i * « I » « i uaaaa > winae >mo*m > ton one *oaoM (oenMiwin t f t ------* ------m • 1 • f i t

MSLIChrX

M ill - Inmn O-iil >UOM JȐ

MV 1 Ilo» IV

• - A - ■ A . i l i t , .a. . à i kÀ k ÌL k * . J , i ü L .

■aa aac i too oso 1:10000 17» odo 1710000 1 '«eooo ■ rio 000 1 ruaco i m n 1 t*o 000 C w d m m

•i «*>•«■■ m m • • 4 BHH 1 • t m w i i m m 102 Chapter 3

Supplementary Figure2

MOFChr2R

t-AlájLL

ÍAÁ.JMfcl. Ul... - LtijJ.. i- U,lWtuA..U.U*. liiAil D

E MOF - Input (m /s) F i

*Vl40.0«J —ftSCoo

h w

MOFChrX Supplementary Figure3 Supplementary

Proportion of bound probes per class Ö 8 Ö Ö Ö 3 Ö 8 o 8 O sargltro oaecmesto n eeepeso 103 expression gene and compensation dosage of regulator a as MOF S1 S3 O HK6c cO KcH4K16Ac KcMOF H4K16Ac MOF MSL3 MSL1 h. X Chr. a Autosomes ■ 104 Chapter 3

Supplementary Figure4 MOF as a regulator of dosage compensation and gene expression 105

Supplementary Figure5

MSL1

MSL3

MOF

Flybase (♦) ni iiiim n i l im mi» limili! m r ti mu i m 10.000.000 10200.000 10.400.000 10.600.000 10.800.000 11.000.000 11.200.000 11.400.000 Coordinate: Flybaso (-) li in mimiiiii iiiiiiriiiJi i í hi in i mu m ui i i n 106 Chapter 3 Chapter 106 Supplementary Figure6 Supplementary A

% of bound probes per dass ao of (sound probes per ctass % of bound probes per dass » ! J] 0 _ » « •» - 5 I S.ä u E t g c c g c c c c c S * *n r» * SS» g,C ® = u c 2 i 3 s S ■f - £ -- j J M n - 2 f h­ f— K o 2 O Ç- D / ƒ , / * ^ l E D S1 SL-2 MSL1 â I I â MOF SL-2 MOF C MOF Kc MOF c / c c cr cr cc c/7

8

[ ƒ/<#£*> 5 § f •5c S è ■n «o"O * 1 c _ i0 13 * I „ I I CJ ■ o S "" c a a. a. 2 1” <0 i s O o o O ' M i H „ q B c *

_ dB ] i □ _ ii 2 I 0 & i ii & S o 1 l i n o 2 2 S ■ è o ÚJ u ç < 1 o 1 <3 3 s s 8 s? H4K16AC SL-2 H4K16AC H4K16AC Kc H4K16AC 2 I i2 MSL3 SL-2 MSL3 o o □ ■ h. X Chr. Autosomes H_U u]n MOF as a regulator of dosage compensation and gene expression 107

Supplementary Figure7 Autosomes A

o c CD MSL1 D cr o

B

O c MSL3 CD3 cr CD Ul

c a) ill MOF =3 cr CD

TSS END 3

>. 0 c 0) H4K16AC rj cr

1 Density Density Density Density LL

5 TSS 108 Chapter 3

Supplementary Figure8

Supplementary Figure9 MOF as a regulator of dosage compensation and gene expression 109

Supplementary Figure10

MOF SL-2 (all chr.) - autosomes

Distance from trans, stop site (bp) B MOF SL-2 (all ehr.) - ehr X

co 3a)

Distance from trans, stop site (bp)

MOF Kc (all ehr.) - autosomes

cS' CD O'3

-2000 -1000 0 1000 2000 Distance from trans, stop site (bp)

MOF Kc (all ehr.) - ehr X

o> c 3(D ca) r 0e+00 0e+00 1e-04 2e-04 3e-04 4e-04 5e-04 0,00000 0.00010 0.00020 0.00030 0e+00 1e-04 2e-04 3e-04 4e-04 5e-04 0.00000 0.00010 0.00020 0.00030 Distance from trans, stop site (bp) 110 Chapter 3

Supplementary Figure11

A Chr X signal (SL-2)

£ wc &c 75c O) ‘53 Q. £0 1 Q. £ O

5' end 3' end MOF binding

B Autosomes signal (SL-2)

cw £c 15c O) CO Q. ic0 1 Q. ■C o

5' end 3' end MOF binding MOF as a regulator of dosage compensation and gene expression 111

Supplementary Figure12

MOF SL-2 (autosomes only) o o 00

o o CD

o § I 0)O’ ^

o C\Jo

-2000 -1000 0 1000 2000 Distance from TSS (bp)

B MOF Kc (autosomes only)

o o CD

O in

o o

o>* § § O- ” Q) LL O C\J

O 0e+00 0e+00 2e-04 4e-04 6e-04 8e-04 1e-03 0e+00 2e-04 4e-04 6e-04 8e-04 1e-03

Distance from TSS (bp) 112 Chapter 3

Supplementary Figure13

Signal 5' end (autosome vs X) - SL-2

C & C "ÏÖ C cn ‘(/j Q. !E 0 1 Q. -C O

MOF binding 5' end

B Signal 5' end (autosome vs X) - Kc

£

Autosomes Chr. X MOF binding 5' end MOF as a regulator of dosage compensation and gene expression 113

Supplementary Figure14

All chromosomes (SL-2) Active MOF bound

B All chromosomes (Kc) Active MOF bound

All chromosomes MOF (SL-2) MOF (Kc)

971 1980 943 114 Chapter 3 Chapter 114 X X chromosome CG8173 Ucp4A A- g- PAR-6 o2 0.15 ^ roX2 Supplementary Figure15 Supplementary a* 0.1 0.1 a* ? ? ** ** £ 0.2 p « 0.4 3 I 3 0.3 0.05 0 250 02 02 0.3 0.3 0.6 0.1 0.5 0.1 2 0 0.1 0.2 0.4 05 L L L L L 1P2 P1 P1 P1 P1 2P3 P2 P3 P2 P2 L P3 P3 I M SL I I SL M I MOF B n X o o V) k. o E o E 01 CG12094 Frazzled PK f 0.2 f- GPRK2 B1 2 £ HBS1 £ 15£ s? 0.4 ^ £ 5 I 0 8 0.5 25 3.5 0.1 0.3 0.2 0.6 1.4 1.5 0 3 1

- - L . _ . L L L P1 pi i p P1 SL-2 Cells SL-2 2 P3 P2 P3 P2 P2 P2 j k P3 P3 li S M □ MOF MOF U SU M MOF as a regulator of dosage compensation and gene expression 115

Supplementary Figure16

EGFP MSL3

100% 50% 20% 100% 100% 100%

-M SL3

Tubulin

EGFP MOF

20% 50% 100% 100%■ ■ ■ 100% ■ ■ ■ 100% ■ ■ I 116 Chapter 3

Supplementary Figure17

Autosome Top 1%

Bound ] Unbound ~o

QJ tn -O

0 J ChIP-chip (bound genes)

RNAi down- up- down- up- (affected genes) regulated regulated regulated regulated

MOF SL-2 MOF Kc MOF as a regulator of dosage compensation and gene expression 117

Supplementary Figure18

1.4 1.2 MSL1RNAÌ MOF RNAi 1 0) —I c 0.8 o 2 0.6 a >< m 0.4 0.2

0 HBS1 Fra gprk2

Supplementary Figure legends

Supplementary Figure 1. Processing of ChIP-chip data for MSL1. All ChIP-chip assays were performed in triplicates. Triplicates were averaged and normalized to 10% input DNA (For input DNA six replicates were used; only three are shown here for visualization purposes), followed by smoothening of the data by using averaging of intensities within a 500bp sliding window. Probes with the topmost ranked signal intensity (1%) were selected as significantly enriched in the ChIP sample. This metric allows for unbiased 118 Chapter 3 comparison of significant binding sites across multiple ChIP experiments where antibody affinities and immunoprecipitation enrichment levels differ. Profiles for regions of chromosomes 2L and X are illustrated. (A) GCRMA-normalized intensity values for individual probes across three biological replicates (light orange). (B) Mean intensity values of the three biological replicates of MSL1 binding (orange). (C) GCRMA-normalised intensity and mean values for the genomic DNA control (light and dark grey). (D) Ratios of MSL1-binding and control mean intensity signals (light blue). (E) Smoothed ratios using a 500-bp sliding window centred on each probe (dark blue). (F) Topmost ranked 1% significant ratio signal (dark blue). Flybase (+) and (-) represents the location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome.

Supplementary Figure 2. Same as in Supplementary Figure 1 for MOF binding on chromosomes 2R and X. (A) GCRMA-normalized intensity values for individual probes across three biological replicates (light orange). (B) Mean intensity values of the three biological replicates of MOF binding (orange). (C) GCRMA-normalised intensity and mean values for the genomic DNA control (light and dark grey). (D) Ratios of MOF-binding and control mean intensity signals (light blue). (E) Smoothed ratios using a 500-bp sliding window centred on each probe (dark blue). (F) Topmost ranked 1% significant ratio signal (dark blue). Flybase (+) and (-) represents the location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome.

Supplementary Figure 3. Proportion of MSL1, MSL3 and MOF binding, and H4K16Ac for the X chromosome vs. autosomes in SL-2 cells, and MOF binding and H4K16Ac in Kc cells. Bars represent the number of significant probes on autosomes and the X chromosome for each marker, divided by the total number of probes representing autosomes (dark blue) and the X chromosome (light blue), respectively.

Supplementary Figure 4. (A) ChIP of a large ~150kb region on the X chromosome generated by ChIP-qRT- MOF as a regulator of dosage compensation and gene expression 119

PCR and by using the significance ranking method described in Supplementary Figure 1. ChIP assays were performed using MSL1 and MOF antibodies, represented in black and blue columns, respectively. The genes used for the qRT-PCR are depicted in red in the ChIP-chip window. Generally three primer-pairs per gene represent the start, middle and end of each gene (shown as a black line, arrows indicate direction of transcription for each gene). For small genes, two primer-pairs were designed in the start and end of the genes as indicated. (B) Representation of binding by MSL1, MSL3 and MOF to the genes as indicated in red according to the ChIP-chip analysis. Flybase (+) and (-) represents the location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome.

Supplementary Figure 5. Distribution of MSL1, MSL3 and MOF binding across a 1.5Mb section of autosome 2L are shown to compare with the distribution in Figure 1A. Flybase (+) and (-) represents location of genes on the forward and reverse DNA strands respectively. Coordinates represent the position on the corresponding chromosome.

Supplementary Figure 6. Genomic distribution of MSL1 (A), MSL3 (B) and MOF (C), and H4K16Ac (D) binding in SL-2 cells. Similar analyses were also performed for MOF binding (E) and H4K16Ac (F) in Kc cells. All probes in the Drosophila tiling array were classified based on their mapping to the Drosophila genome (Ensembl v41; Flicek et al., 2008) as located in: (i) intergenic regions; (ii) the 10kb upstream the transcription start site of genes; (iii) genes; (iv) exons and UTRs; (v) introns; (vi) coding sequences; (vii) UTRs; (viii) 5’ UTRs; and (ix) 3’ UTRs. Bars represent the percentage of probes per class with significant binding for each factor in autosomes (dark grey) and X chromosome (light grey). n corresponds to the total number of significant probes per class for each sample.

Supplementary Figure 7. MOF is enriched on promoters of X-linked genes on autosomes in SL-2 cells. Normalized binding distribution to gene loci in SL-2 cells using topmost1% targets. 120 Chapter 3

Distribution of MSL1, MSL3 and MOF binding, and H4K16Ac across autosomes (A­ D). Genes with significant binding were scaled to a similar length and the relative position of significant probes was computed. Bars represent number of significant probes in a given region. A continuous fit of the distribution is depicted in red. MOF binds to promoters (5’ ends) on autosomes, in addition to 3' ends of X-chromosomal gene loci. TSS (transcription start site) and END (transcription stop).

Supplementary Figure 8. Individual probe intensity of MSL1, MSL3 and MOF on two X chromosomal genes, CG2712 (position on X: 2.588-2.591MB) and crm (position on X: 2.595-2.590MB). Flybase (+) and (-) represents location of genes on the forward and reverse DNA strands respectively. Coordinates represent position on the X chromosome.

Supplementary Figure 9. MOF binding signal distribution across a 2kb section around the transcription start site (TSS) of bound genes. (A) and (C) MOF binding to X chromosomal genes in SL- 2 cells and Kc cells respectively. (B) and (D) MOF binding to autosomal genes in SL- 2 cells and Kc cells respectively. Histograms represent the number of significant probes in a given region. A continuous fit of the distribution is depicted in red.

Supplementary Figure 10. Transcription-Stop site analysis of MOF binding in SL-2 and Kc cells. MOF binding signal distribution across a 2kb section around the transcription stop site (TStopS) of bound genes. (A) MOF binding to autosomal genes in SL-2 cells. (B) MOF binding to X chromosomal genes in SL-2 cells. (C) MOF binding to autosomal genes in Kc cells. (D) MOF binding to X chromosomal genes in Kc cells. Bars represent number of significant probes in a given region. A continuous fit of the distribution is depicted in red.

Supplementary Figure 11. 5’ to 3’ MOF binding signal intensity comparison on the X chromosomes and autosomes in SL-2 cells. Boxplots represent MOF binding intensity distribution for the 4kb regions centered around the transcription start site (5’ end) and transcription MOF as a regulator of dosage compensation and gene expression 121 stop site (3’ end) of X chromosomal genes (A) and autosomal ones (B). The median intensity of the group is depicted with a solid line inside the boxes. Boxes show the inter-quantile range (IQR), and values 1.5 times more extreme than the IQR are shown individually. MOF shows a significant higher levels of binding at the 3’ end of genes on chromosome X (p < 2.2e-16). In contrast, MOF binding for autosomal genes is significantly stronger for the 5’ end of genes (p < 2.2e-16).

Supplementary Figure 12. MOF binding signal distribution across a 2kb section around the transcription start site (TSS) of bound autosomal genes. (A) MOF binding to autosomal genes in SL-2 cells. (B) MOF binding to autosomal genes in Kc cells. Bars represent number of significant probes in a given region. A continuous fit of the distribution is depicted in red.

Supplementary Figure 13. 5’ end MOF binding signal intensity comparison on the X chromosomes and autosomes, for SL-2 and Kc cells. Boxplots represent MOF binding intensity distribution for the 4kb regions centered around the transcription start site (5’ end) of each autosomal and X chromosomal located gene with significant binding for SL-2 (A) and Kc cells (B). The median intensity of the group is depicted with a solid line inside the boxes. Boxes show the inter-quantile range (IQR), and values 1.5 times more extreme than the IQR are plotted individually. In SL-2 cells (A) MOF displays a significant stronger binding in genes located in the X chromosome (p < 2e-18). (B) A similar trend is observed for MOF binding in Kc cells (p < 3e_08).

Supplementary Figure 14. MOF binding and gene expression state in SL-2 and Kc cells. Genes were classified as being expressed (active) or inactive (absent) using the R implementation of the MAS5.0 algorithm available in the affy Bioconductor package. Genes called present in all three replicates were classified as active genes (see supplementary experimental procedures). (A) Overlap between active genes and MOF bound genes in SL-2 cells. (B) Active and MOF bound genes overlap in Kc cells. (C) MOF binding overlap between SL-2 and Kc cells. 122 Chapter 3

Supplementary Figure 15. (A) ChIP-qPCR using either MSL1- (black) or MOF (red) antibodies in Kc cells on the X chromosomal genes ucp4A, par-6, CG8173 and roX2. (B) ChIP-qPCR using either MSL1 (black) or MOF (red) or MSL3 (grey) antibodies in SL-2 cells on autosomal (hbs1, fra, gprk2) or a MOF bound X chromosomal gene CG12094. ChIP is shown as percentage recovery of input DNA. Primers were positioned at the start (P1), middle (P2) and end (P3) of genes. Exact position of the primers is described in supplementary text.

Supplementary Figure 16. Western blot analyses of MSL1, MSL3 and MOF depleted SL-2 cells, as compared to EGFP control dsRNA treated cells. Dilution of the whole cell extract of the EGFP is indicated. In the case of MSL1, MSL3 and MOF RNAi, only the 100% sample of the three independent RNAi experiments was loaded for comparison. Antibody against a- tubulin was used as a loading control. Protein size markers are indicated in kDa.

Supplementary Figure 17. MOF binding for affected genes across autosomes following MOF RNAi knockdowns. Each major column represents the total number of affected autosomal genes (up- and down-regulated) in the MOF-depleted SL-2 and Kc cells respectively. Blue sections correspond to MOF bound genes in each cell type. White sections represent genes differentially up- or down-regulated not bound by MOF. Significant binding was obtained using a 1% rank-based procedure restricted to autosomal probes. Y-axis represents the proportion of the total number of affected genes on autosomes.

Supplementary Figure 18. MOF regulates expression levels of a subset of autosomal target genes. Transcript levels of the genes hbs1, fra and gprk2 by qRT-PCR in SL-2 cells depleted of MSL1 (black) and MOF (red) as compared to EGFP depleted cells. Transcript levels were normalized to the mitochondrial transcript mtr2. Nuclear pore components are involved in the transcriptional regulation of dosage compensation in Drosophila 124 Chapter 4

Nuclear pore components are involved in the transcriptional regulation of dosage compensation in Drosophila

Sascha Mendjan, Mikko Taipale§, Jop Kind§, Herbert Holz, Philipp Gebhardt, Malgorzata Schelder, Michiel Vermeulen, Alessia Buscaino, Kent Duncan, Juerg Mueller, Matthias Wilm, Henk Stunnenberg, Harald Saumweber, Asifa Akhtar

§ these authors contributed equally to this work.

A bstract Dosage compensation in Drosophila is dependent on MSL proteins and involves hypertranscription of the male X chromosome, which ensures equal X-linked gene expression in both sexes. Here, we report the purification of enzymatically active MSL complexes from Drosophila embryos, Schneider cells, and human HeLa cells. We find a stable association of the histone H4 lysine 16 specific acetyltransferase MOF with the RNA/protein containing MSL complex as well as with an evolutionary conserved complex. We show that the MSL complex interacts with several components of the nuclear pore in particular Mtor/TPR and Nup153. Strikingly, knockdown of Mtor or Nup153 results in loss of the typical MSL X-chromosomal staining and dosage compensation in Drosophila male cells but not in female cells. These results reveal an unexpected physical and functional connection between nuclear pore components and chromatin regulation through MSL proteins, highlighting the role of nucleoporins in gene regulation in higher eukaryotes.

Introduction

Gene expression is a highly complex process that involves several levels of regulation. It is a challenge to understand the interplay of these different regulation processes that range from chromatin remodeling and histone modifications to the coupling of transcription to RNA processing and export through the nuclear pore (for reviews see (Maniatis and Reed, 2002; Narlikar, 2002). An important, but poorly understood mechanism of chromatin regulation is spatial positioning in the nucleus Nuclear pore components and the regulation of dosage compensation 125 and chromosomal architecture. Recent studies on the ß-globin locus and HoxB cluster suggest that histone modifications and chromatin condensation cannot solely account for transcriptional regulation, but that spatial positioning and chromosomal compartmentalization also play a central role in gene expression (for review see (Sproul et al., 2005)). Two prominent model systems, which permit investigation of the relationship between transcriptional activity, chromatin structure, and chromosomal compartmentalization, are the inactive female X chromosome in mammals and the hyperactive D rosophila male X chromosome. Both of these model systems are involved in the process of dosage compensation, which ensures equalization of X- linked gene expression in the different sexes. It occurs in various organisms where sex is determined by heteromorphic sex chromosomes, including mammals, nematodes, and fruit flies. Although species use different mechanisms to achieve dosage compensation, a common theme is the specific alteration of the X- chromosome chromatin structure in one sex to modulate transcription of X-linked genes. Dosage compensation in Drosophila is achieved by an approximately two-fold transcriptional up-regulation of X-linked genes in males. Genetic screens for male- specific lethality in D rosophila have identified genes essential for dosage compensation. The encoded proteins have been termed male-specific lethals (MSLs) and include MSL-1, MSL-2, MSL-3, MLE, and MOF. Together with these proteins, two non-coding RNAs roX1 and roX2 form the dosage compensation complex (DCC) (For review see (Lucchesi et al., 2005)). Another reported member of the DCC is the histone kinase JIL-1. Although mutation in jil-1 does not result in a male-specific phenotype, JIL-1 protein physically associates with the DCC and leads to enrichment of phosphorylation of serine 10 at histone H3 (H3S10P) on the male X (Jin et al., 2000). The dosage compensation complex defines the D ro so p h ila male X chromosome as a specific chromatin domain with unique properties, which permits the subtle (2-fold) co-regulation of hundreds of genes in the course of cell differentiation and fly development (Sass et al., 2003). How this X-specific up- regulation is coordinated with gene-specific requirements remains a mystery. The current model posits that the DCC functions as a chromatin remodeling complex, 126 Chapter 4 which stimulates transcriptional elongation by histone H4 lysine 16 acetylation (Smith et al., 2001). It is likely that the mechanism of MSL function includes general factors involved in gene expression. These potentially essential or redundant components collaborating with MSLs would not be detected in a genetic screen for male-specific lethality in flies. We decided therefore to take a systematic, biochemical approach to find dosage compensation complex interactors. In this study, we have used affinity purification with subsequent extensive mass-spectrometric analysis to purify and identify proteins associated with MSLs in flies and humans. We have isolated several new MSL-interacting proteins from fly embryos, Schneider SF4, and human HeLa cells. We demonstrate that there are evolutionary conserved MSL complexes of very similar composition in flies and humans. In addition, we show that MOF associates with another evolutionary conserved NSL complex. Surprisingly, we observed the co-purification of several nucleoporins in flies (including the mammalian TPR ortholog Mtor) and the co­ purification of TPR in humans. We found that Mtor and Nup153 are required for correct localization of MSL proteins on the X chromosome and dosage compensation in male but not in female cells. These results illustrate an unexpected connection between components of the nuclear pore complex and dosage compensation in Drosophila.

Results

TAP-MOF and MSL-3FLAG proteins are functional and associate with the MSL complex In order to purify the native RNA/protein-containing MSL complex, we generated transgenic flies expressing either TAP-tagged MOF (TAP-MOF) or FLAG- tagged MSL-3 (MSL-3FLAG). MSL-3FLAG was expressed in an msl-3 mutant background, thus eliminating any potential competition by endogenous MSL-3. The TAP-MOF and MSL-3FLAG transgenes rescued the male-specific lethality associated with m of and msl-3 mutations, and the fusion proteins localized correctly to the male X chromosome (Supplementary Figure S1 and data not shown). This demonstrates that the tagged transgenes are functional. Nuclear pore components and the regulation of dosage compensation 127

Figure 1: Purification of the MOF and MSL-3 protein complexes. A: Western blot analysis of the TAP-MOF purification for MSL proteins. All MSL proteins except MLE could be detected in the final eluate. NXF1 served as a negative control. B: Intact RNAs co-purify with both TAP-MOF and MSL-3FLAG in Drosophila embryos. Northern blot analysis of roX1 and roX2 RNAs compared with control 18S ribosomal RNA. C-E: Silver staining of co-purified proteins from stable TAP-MOF Schneider SF4 cells (C), TAP- MOF transgenic embryos (D), and MSL-3FLAG transgenic embryos (E), 128 Chapter 4

Molecular markers are indicated in kDa. Asterisks indicate degradation products.F: Histone H4 specific HAT activity of TAP-MOF and MSL- 3FLAG eluates on reconstituted polynucleosomes. Autoradiograph (top panel) and the corresponding Coomassie gel (middle panel) of histones separated by SDS-PAGE are shown. Western blot analysis of a corresponding blot probed with H4K16Ac-specific antibody is shown in the bottom panel.G: Purification of the HA-2xFLAG-hMOF complex. A representative silver-stained gel is shown. Asterisks indicate degradation products. H: Confirmation of hMOF protein interactions by western blotting. The abundant nuclear protein RCC1 was used as a control.

Nuclear extracts were prepared from transgenic and wild-type embryos. All purifications were performed under conditions that preserve RNA integrity. Four of the five MSL proteins (MSL-1, MSL-2, MSL-3 and MOF) consistently co-purified and eluted from the calmodulin (TAP) and FLAG beads (Figure 1A and Supplementary Figure S1). We opted for higher stringency during the purification to minimize contamination of non-specific RNAs and proteins. We did not obtain significant co-purification of either MLE or JIL-1. Northern blot (Figure 1B) and RT- PCR (Supplementary Figure S1) analyses confirmed that both roX1 and roX2 RNAs were enriched and intact in TAP-MOF and MSL-3FLAG affinity eluates. Furthermore, we did not observe any enrichment of 18S ribosomal RNA (Figure 1B) or U6 RNA (Supplementary Figure S1), indicating minimal contamination by these abundant nuclear RNAs. In order to compare purifications between embryos and tissue culture cells, we also generated Drosophila SF4 cells stably expressing TAP-MOF. TAP-MOF elutes from SF4 nuclear extracts revealed similar co-purification of MSLs as from embryos (data not shown). Taken together, these data demonstrate that purifications via tagged MOF and MSL-3 result in consistent co-purification of MSL proteins, and that roX RNAs are stable components of the complex.

Mass spectrometric analysis of TAP-MOF and MSL-3FLAG purifications identify interacting proteins MSL-3 and MOF-associated proteins were identified by mass spectrometry. MALDI-TOF, nanoelectrospray, and LC-MS/MS analyses identified a number of proteins that consistently co-purified with MOF and MSL-3 (Figure 1C-E). Control Nuclear pore components and the regulation of dosage compensation 129 purifications performed from wild-type cells and embryos demonstrated that these proteins specifically interact with the tagged proteins (Figure 1C-E). In addition to MSL proteins, we identified a number of previously characterized proteins in the complexes. The TAP-MOF complex contained Z4 (Eggert et al., 2004), Chriz/Chromator (Rath et al., 2004), MBD-R2, Mtor (Zimowska et al., 1997), Nup153 (Sukegawa and Blobel, 1993), wds (Hollmann et al., 2002), and a-tubulin. Essentially the same components were purified from embryos and cells with two exceptions. Dis3 (Cairrao et al., 2005) and Chd1 (Stokes et al., 1996) were identified in embryos but not in SF4 cells, while Nup98 (Radu et al., 1995) was only detected in the SF4 cell purification (compare Figures 1C and 1D). Cell type specific interactions or varying abundances in extracts may account for the observed difference in the TAP-MOF associated proteins. Mass-spectrometric analysis of MSL-3FLAG purification identified Mtor, MBD-R2, Nup160 and Nup154, Dis3, Rrp6, a-tubulin and EIF-4B (Figure 1E). Additionally, four uncharacterized proteins (CG1135/MCRS2, CG4699/NSL1, CG18041/NSL2, and CG10081/NSL3) were identified in TAP-MOF purifications (Table 1). We named the other new proteins NSLs (non-specific lethals), because disruption of these genes by P-element insertions in Drosophila is lethal in both sexes, in contrast to male-specific lethal genes (data not shown). 130 Chapter 4

Table 1 Drosophila Human Mascot score Mascot score Name (number of peptides ) Domains (number of oeptldes) Name MOF 1251 (34) chromo barrel MYST homology 879(57) hMOF

MSL-1 344 (14) coiled-coil, REHE 530(30) hMSL1 MSL-2 (7) RING fìnger. PHD finger 353(18) hMSL2 MSL-3 240 (24) chromo barrel, MRG homology 359(33) hMSL3 no clear orthotog N/A 2xTudor 174 (9) PHF20L1 Mtor (18) colled-col (30) TPR Nup153 (13) zinc finger, Ran binding domain not found (Nup1 53) Z4 156 (7) CTCF-like zinc finger N/A no clear ortholog Chromator/Chriz 58(2) Chromodomain N/A no clear ortholog

M8D-R2 561 (18) ;h a p \ 2x1 udor, M BD\ ZnF, PHD finge 155(12) PHF20

NSL1 (CG4699) 370(18) coiled-coil. PEHE 864(31) hNSL1 (KIAA1267) NSL2 (CG18041) 98(10) two C/H rich domains 75(8) hNSL2 (FLJ20436) NSL3 (CG9233) 244 (14) hydrolase fold 840(36) hNSL3 (FLJ10081 ) WDS 137 (9) seven WD40 repeats 347 (35) WDR5 dMCRS2 (CG 1135) 331 (16) forehead-associated domain (FHA) 471(39) MCRS2 Dis3 (10) nucleotide-binding domain not found DIS3 (dHCF1) not found Kelch repeats, Fn3 885(18) HCF-1 (OGT) not found TPR, glycosyltransferase 174 (9) OGT no clear ortholog N/A forkhead, FHA 130(10) ILF-1

Table 1: List of the proteins identified in TAP-MOF and HA-2xFLAG- hMOF purifications. Compilation of mass spectrometry data obtained using LC-MS/MS and MALDI-TOF from MOF complexes isolated from Drosophila embryos and human HeLa cells. For proteins identified by MALDI-TOF using peptide search tool (www.ma.nn.embl-heidelberg.de). only the number of peptides is indicated. :PHF20 lacks the THAP and MBD domains present in the Drosophila ortholog, MBD-R2.

TAP-MOF and FLAG MSL-3 eluted complexes are enzymatically active We next examined the enzymatic activity of the purified complexes. Both TAP-MOF and MSL-3FLAG elutions were enriched in histone H4-specific acetylation activity when subjected to histone acetyltransferase assays on reconstituted polynucleosomes. Strikingly, the acetylation was specific for lysine 16 of histone H4 (Figure 1F), and no enrichment of histone H4 lysine 12 or histone H3 lysine 23 acetylation was observed (data not shown). Thus, both purifications resulted in elution of enzymatically active complexes. Nuclear pore components and the regulation of dosage compensation 131

MOF complexes are evolutionary conserved All Drosophila MSL proteins have mammalian orthologs. To address the evolutionary conservation, we purified the human hMOF-containing complexes from a stable HeLa cell line expressing hMOF tagged with one haemagglutinin (HA) and two FLAG epitopes (HA-2xFLAG-hMOF). The characterization of the interacting proteins revealed striking similarities in the complex composition between flies and humans (Figure 1G and Table 1). Co-purification of mammalian MSL orthologs showed that DCC is an evolutionary conserved protein complex. hMSL1, hMSL2, and hMSL3 were all present in the hMOF complex (Figure 1G and Table 1). Similar to Drosophila DCC, RNA helicase A (the ortholog of MLE) was not present in the complex, which is consistent with our previous observations (Taipale et al., 2005). Furthermore, we identified two isoforms of hMSL3, hMSL3a and hMSL3c, co-purifying with hMOF. The former represents the full-length protein, while the latter is an alternative splice isoform lacking the N-terminal chromo-barrel domain (Figures 1G and 1H, and data not shown). In addition to the MSL proteins, most of the other proteins co-purifying with TAP-MOF were also found in the hMOF complex (Table 1). Z4 and Chriz/Chromator (Chr) lack clear mammalian orthologs, which could explain their absence (data not shown). However, the Mtor ortholog TPR was identified in the HA-2xFLAG-hMOF purification. Human-specific proteins included the transcriptional coactivator HCF-1, O-linked N-acetylglucosaminetransferase OGT, and the forkhead and FHA domain containing transcription factor ILF-1/FOXK2. Interaction of hMSL3, hNSL1, hNSL2, hNSL3, and HCF-1 was further confirmed by western blot analysis of eluted complex (Figure 1H). Similar to the TAP-MOF and MSL-3FLAG complexes, the HA- 2xFLAG-hMOF complex specifically acetylated histone H4 at lysine 16 on mononucleosomes (Supplementary Figure S1). Taken together, the data demonstrate that MOF interactions are evolutionary conserved, and that the DCC is an evolutionary ancient complex that acetylates histone H4 at lysine 16. 132 Chapter 4

MOF associates with two distinct multiprotein complexes in fruit flies and mammals In this study, we have focused on the interaction of MSL proteins with Z4, MBD-R2, Mtor, and Nup153 in D rosophila for which we generated specific antibodies. Co-immunoprecipitation experiments with MOF and MBD-R2 antibodies confirmed that Mtor, Nup153, Z4, Chr, and MBD-R2 interact with MOF, albeit with varying efficiencies (Figure 2A). The interaction of MBD-R2 with MOF was stronger than with Mtor or Z4 in these assays, as indicated by the amount of protein immunoprecipitated compared with the input. Further immunoprecipitation experiments showed robust interactions of NSL1, WDS, MBD-R2, Chr, MSL-1, and MSL-3 with MOF (Figure 2B). However, NSL1 and MSL-1 interacted with a non-overlapping set of proteins. WDS, Chr, MBD-R2, and MOF co-immunoprecipitated with NSL1. MSL-1 interacted with MSL-3 and MOF, to a lesser extent with Chr but not with the other proteins. Interactions were specific, as we could not detect co-immunoprecipitation of the abundant nuclear proteins Mi-2 or NXF1 (Figure 2B). To further verify the presence of two complexes, HeLa nuclear extract was separated on 20-50% glycerol gradient, and collected fractions were analyzed by western blotting (Figure 2C). While human NSL1 and NSL3 predominantly resided in a ~300-400 kDa complex, hMSL3 was present in a low-molecular weight complex of ~100-200 kDa (Figure 2C). However, hMOF could be detected in both NSL and MSL fractions. Also HCF-1 sedimented into many fractions, which is consistent with previous observations (Wysocka et al., 2003). Further analysis of NSL1 revealed that similar to MSL-1, it also contains a PEHE domain. MSL-1 interacts with MOF via its PEHE domain in vitro (Morales et al., 2004). Interestingly, we find that the PEHE domain of hNSL1 interacted directly with hMOF in a GST pull-down assay, whereas Drosophila ESC (extra sex combs) protein did not show any interaction (Figure 2D). Our data indicate that MOF is a subunit of at least two independent protein complexes in Drosophila and mammals. These complexes are bifurcated, most likely, by a direct interaction of MSL-1 and NSL1 with MOF. Nuclear pore components and the regulation of dosage compensation 133

Figure 2: MOF associates with two distinct complexes in fruit flies and mammals A: Immunoprecipitation from Drosophila embryo nuclear extract with a-MOF or a-MBD-R2 antisera. The blot was probed with various antibodies as indicated. B: Same as in A except immunoprecipitations were performed with NSL1, MOF and MSL-1 antibodies. C: 20-50% glycerol gradient fractionation of HeLa nuclear extract. Fractions were probed with antibodies against hMOF, hMSL1, hNSL1, hNSL3, and HCF-1.D: GST pulldown assay with PEHE domain of hNSL1 and GST only. Equal amounts of hMOF and dESC were used in the reaction. 134 Chapter 4

Localization of MSL proteins is unaffected in Z4 hypomorphic mutants or in MBD-R2 depleted cells To examine the role of Z4 protein in dosage compensation we performed immunolocalisation studies on polytene chromosomes in wild type flies and hypomorphic mutants of Z4 protein (Eggert et al., 2004). These studies revealed that although Z4 and Chriz bind interbands on all chromosomes, they do not show extensive colocalization with MSL proteins on the male X chromosome (Supplementary Figure S2). In Z4 mutants, all MSL proteins remained associated with the X chromosome, albeit with a more diffuse staining profile (Supplementary Figure S2). Since MOF and MBD-R2 robustly co-immunoprecipitate (Figure 2A), we next tested the effect of its depletion on the localization of MSL proteins on the male X chromosome in SL-2 cells. MBD-R2 protein appeared nuclear in control EGFP dsRNA treated cells (Supplementary Figure S2). We could deplete 90% of MBD-R2 protein as detected by western blot analysis (Supplementary Figure S2). However, localization of MSL1, MSL-3 and MOF appeared unaffected in these cells (Supplementary Figure S2). These results show that MOF interacts with Z4, Chriz, and MBD-R2, but disruption of this interaction does not affect the localization of MSL proteins on the X chromosome. However, these proteins may be involved in other stages of dosage compensation.

Mtor and Nup153 are required for the X-chromosomal localization of the MSL proteins. Interestingly, the nuclear pore associated protein Mtor/TPR was identified in all four purifications. Mtor is proposed to be a part of the nuclear basket, interacting with Nup153 and is implicated in spindle matrix assembly in Drosophila (Cordes et al., 1998; Zimowska et al., 1997). Since Mtor mutants cause embryonic lethality in Drosophila (Qi et al., 2004), we used RNAi in SL-2 cells to study the function of Mtor and Nup153 proteins in dosage compensation. However, depletion of some nucleoporins can lead to defects in nucleo-cytoplasmic transport. Therefore, to exclude this possibility, we prepared extracts separating cytoplasmic and nuclear fractions. RNAi-mediated knockdown of Mtor and Nup153 depleted 90% and 70- Nuclear pore components and the regulation of dosage compensation 135

80% of the proteins, respectively (Figure 3A, compare lanes 1-3 with lanes 5-7 and 9­ 11). Endogenous MSL-1, MSL-2, MOF, MSL-3, MLE, and Z4 protein levels remained unaffected and mainly nuclear (Figure 3A, compare lanes 1-3 with 4, 5-7 with 8, and 9-12 with 12; Supplementary Figure S3). roX2 RNA levels were reduced approximately two-fold, but remained nuclear (Supplementary Figure S3). roX1 RNA is not expressed in SL-2 cells and was therefore not included in the analysis. In EGFP dsRNA-treated cells, immunostaining for MSL-1, MSL-3, or MOF visualized by confocal microscopy appears as a clear X-chromosomal territory staining (Figure 3B panels A-C). Mtor and Nup153 predominantly localize to the nuclear rim (Figure 3B, panels D-E) as visualized by co-staining with wheat germ agglutinin (WGA). Z4 in SL-2 cells appeared nuclear (absent from the nucleolus), which is consistent with it being a chromatin-interacting protein (Figure 3B, panel F, (Eggert et al., 2004). In MSL-1 dsRNA treated cells, MSL-1, MSL-3, and MOF were no longer enriched on the X chromosome, yet localization of Mtor, Nup153, and Z4 remained unaffected (Supplementary Figure S3). These results are consistent with MSL-1 being important for the localization of other MSL proteins (Buscaino et al., 2003). Interestingly, cells treated with Nup153 or Mtor dsRNA displayed a phenotype similar to that of MSL-1 knockdown cells. The typical localization of MSL-1, MSL- 3, and MOF on the X chromosome was compromised (Figure 3B panels G-I and panels M-O). In over 90% of the cells, no clear X-chromosomal staining was detectable. Nup153 and Mtor knockdown resulted in residual staining of the X chromosome with MSL-1 and MSL-3 in about 5% of cells (Figure 3B, panels G, H and panels M, N, see arrows). In contrast, MOF was readily detectable in the nucleus, yet appeared evenly dispersed in the nucleoplasm (panels I, O). Nuclear pore complexes were still intact as shown by nuclear rim staining with WGA (Figure 3B, panels J, P). Consistent with previous reports, loss of Nup153 also affected Mtor localization (Hase and Cordes, 2003) (Figure 3B, compare panel E with K). 136 Chapter 4

EGFP RNAi Mtor RNAi Nup153 RNAi c _ N C c 100% 30% 10% 100% 100% 30% 10% 100% 100% 30% 10% 100%

Mtor ---- Nup153 — MSL-1 --- fe É - " MOF mmm — - m m — — mm — - — '

MSL-3

Z4 • — - m - _ Tubulin 5 6 7 8 9 10 11 12

B EGFP RNAi Nup153 RNAi Mtor RNAi +WGA +WGA +WGA a m 9 ' 0 0 . Q MSL-1 £) O b h " r f j 0 MSL-3 /"S V ^ J 0 c ¡ o o o c c MOF 0

d o j P

Nup153 0 Q

e k 9 0 q Mtor o 0 Ö 0 o f I r o o Z4 0 °

Figure 3: Mtor and Nup153 knockdown in SL-2 cells causes delocalization of MSL proteins from the X chromosome A: SL-2 cells were incubated with EGFP, Mtor, or Nup153 dsRNA. 100%, 30% or 10% of the nuclear extracts (N) and 100% of the cytoplasmic extracts (C) were separated on SDS-PAGE and western blot analysis was performed. Blots Nuclear pore components and the regulation of dosage compensation 137

were probed with the antibodies against Mtor, Nup153, MSL-1, MOF, MSL- 3, Z4, and tubulin as indicated. B: Confocal microscopy was performed on SL-2 cells treated with EGFP, Nup153 and Mtor dsRNAs. For this purpose, cells were immunostained with antibodies against MSL-1 (panels a, g, m), MSL-3 (panels b, h, n), MOF (panels c, i, o), Nup153 (panels d, j, p), Mtor (panels e, k, q) and Z4 (panels f, l, r). In addition, cells were also incubated with FITC-labeled WGA (green) to visualize the nuclear envelope (+WGA panel). Arrows indicate residual staining of MSL-1 and MSL-3 in Mtor knockdown cells in 5% of total population.

We did not observe significant changes in total MSL protein levels or a change in distribution between nuclear versus cytoplasmic extracts after depletion of Mtor or Nup153. Thus, the observed loss of typical X-chromosomal staining in Mtor and Nup153 depleted cells is not due to changes in MSL protein abundance or defective nuclear transport. However, to further address whether the loss of MSL localization on the X chromosome in Mtor depleted cells could be due to defects in general mRNA export, the intracellular distribution of bulk mRNA in Mtor cells was analyzed by in situ hybridization with fluorescently labeled oligo(dT) probe (Figure 4). As previously reported, cells depleted of NXF1 showed substantial nuclear accumulation of poly(A)+ RNAs consistent with its essential role in RNA export (Herold et al., 2003). MSL-1 localization remained unaffected in NXF1 depleted cells. In contrast, we did not observe a significant nuclear accumulation of poly(A)+ RNA in Mtor depleted cells yet typical MSL staining on the X chromosome was compromised in these cells. (Figure 4B). This effect was specific, since depletion of several other nucleoporins (Nup164, Nup160, Nup98, Nup214 and Nup62) did not affect localization of MSL proteins on the X chromosome, although both growth and appearance of these cells was affected (Figure 5 and data not shown). Taken together, our data indicate that the MSL proteins specifically require Nup153 and Mtor for correct localization to the male X chromosome. 138 Chapter 4

Figure 4: Mtor knockdown in SL-2 cells does not cause bulk mRNA accumulation in the nucleus. A: SL-2 cells were incubated with EGFP, Mtor, or NXF1 dsRNA. 100%, 30% or 10% of total extracts were separated on SDS-PAGE and western blot analysis was performed. Blots were probed with the antibodies against NXF1, Mtor, MSL-1 and tubulin as indicated. B: Nuclear pore components and the regulation of dosage compensation 139

Confocal microscopy was performed on SL-2 cells treated with EGFP, Mtor or NXF1 dsRNAs. Cells were immunostained with antibodies against MSL-1 (red) and Nup153 (green). Poly(A)+ RNA was detected by fluorescent in situ hybridization (FISH) using labeled oligo dT probe (yellow). (Lucchesi et al., 2005)).

Nup153 and Mtor are required for transcriptional regulation of dosage compensated genes The absence of MSL proteins in male flies leads to an approximately two-fold transcriptional down-regulation of dosage compensated X-linked genes (reviewed in Lucchesi et al., 2005). To determine whether Mtor and Nup153 are required for dosage compensation, we measured gene expression by quantitative RT-PCR after Mtor and Nup153 knockdown. We analyzed classical dosage compensated genes pgd, BRC and dspt6 as well as the roX2 gene, which acts as a high affinity site for the dosage compensation complex on the X chromosome. The X-linked runt gene, which is dosage compensated in an MSL-independent manner (Smith et al., 2001), and four autosomal genes GAPDH, AcCoAS, E4BP, and Polli were included as controls. Interestingly, expression of all the X-linked genes tested was reduced approximately two-fold in MSL-1, Mtor, and Nup153 depleted cells in comparison to EGFP dsRNA treated cells (Figure 6A, compare white columns to grey and black columns). We did not observe significant down-regulation of runt, GAPDH, or E4BP, while AcCoAS expression increased slightly in MSL-1 depleted cells (light grey columns). The effect of Mtor and Nup153 on dosage compensation was specific, since the depletion of five other nucleoporins (Nup62, Nup98, Nup154, Nup160, Nup214) did not affect dosage compensation of X chromosomal genes (Figure 6B). Instead, we observed an accumulation of almost all RNAs tested suggesting a general RNA transport defect in Nup98, Nup154, and Nup160 depleted cells. Finally, we tested whether Nup153 and Mtor were essential for dosage compensation only in male cells or whether there was a general requirement for these nucleoporins in female cells for X chromosomal genes. For this purpose, we compared the expression levels of dosage-compensated and autosomal genes in SL-2 cells and Kc cells. We could verify that Kc cells are indeed female, as they express SXL, the female-specific regulator of sex determination and dosage compensation, but express very little MSL-2 (Figure 6C compare lanes 1-3 with lanes 7, 8). We 140 Chapter 4 could efficiently deplete Mtor and Nup153 also in Kc cells (data not shown), but we did not observe a significant reduction in expression of pgd, BRC, and dspt6 in these cells, in contrast to SL-2 cells (Figure 6D). Taken together, these results show a specific requirement for Mtor and Nup153 for dosage compensation of pgd, BRC, and dspt6 in male cells.

Nup98 Nup154 4 Days 7 Days

MSL-1 Nup153 MSL-1+Nup153 Nup153 MSL-1+Nup153 vj b » ^

MSL-2 Mtor MSL-2+Mtor MSL-1+Nup153

% A fi A

MSL-1 Nup153 MSL-1+Nup153

, y

Figure 5: Depletion of Nup160, Nup154, Nup98, Nup62 and Nup214 does not affect X chromosomal localization of MSL proteins A: Quantitative RT-PCR analysis of the knockdown efficiency of Nup160, Nup154, Nup98, Nup62 and Nup214 in two different experiments (1 and 2; indicated as twin columns). RNA concentration was measured relative to PolII transcripts in mock. Levels of a particular transcript in mock samples were normalized to 100%. B: Growth curve of cells depleted for various nucleoporins as indicated. Cells were counted after 0, 3, 5, and 8 days after dsRNA Nuclear pore components and the regulation of dosage compensation 141

treatment. C: Confocal microscopy was performed on SL-2 cells treated with Nup154, Nup160, Nup98, Nup62 and Nup214 dsRNA. For this purpose cells were immunostained with either MSL-1, MSL-2, Nup153 or Mtor as indicated. The right panels correspond to merged images.

Discussion

MOF associates with two distinct multiprotein complexes The purification of the MSL complex revealed quite an unusual complex composition. One would expect that a complex thought to modulate transcription and/or chromatin structure would contain a significant number of classical transcription factors, some of the numerous components associated with RNA polymerase II, or at least subunits of the ubiquitous chromatin remodeling and modifier complexes. However, none of these components were found. Instead, there seems to be a core MSL complex that interacts sub-stoichiometrically with nucleoporins (Mtor, Nup153, Nup160, Nup98, and Nup154), interband-binding proteins (Z4, Chromator/Chriz), and exosome components (Rrp6, Dis3). Our results suggest that MOF is a subunit of two independent complexes in mammals and fruit flies. Several lines of evidence support this notion. This includes co-immunoprecipitation experiments and glycerol gradient centrifugation. Furthermore, hMOF was recently found in the MLL1 methyltransferase complex together with HCF-1, MCRS2, WDR5, NSL1, and PHF20, but this complex did not contain hMSL1 (Dou et al., 2005). Finally, purification of the hMSL3 complex (data not shown) provides further evidence that hMSL3 does not associate with many of the MOF-interacting proteins. Therefore, we suggest that the NSL complex contains at least MOF, NSL1, NSL2, NSL3, MCRS2, MBD-R2, WDS, and in humans also HCF- 1 and OGT. The results presented here also suggest a molecular mechanism as to how the MOF complexes bifurcate. Both MSL-1 and NSL1 contain a PEHE domain in their C-terminus. The NSL1 PEHE domain interacts directly with hMOF in vitro (Figure 2D), and Drosophila MSL-1 has been shown to interact directly with MOF through the same domain (Morales et al., 2004). Furthermore, MSL-1 is required for full 142 Chapter 4 activity of MOF in vitro and for the assembly of the DCC on the male X chromosome (Morales et al., 2004). MSL-1 and NSL1 are the only two genes with a PEHE domain in the D rosophila genome (Marin, 2003), suggesting that it is an evolutionary conserved MOF-interacting domain. We postulate that MSL1 and NSL1 serve as mutually exclusive bridging factors that assemble two different complexes around MOF, a histone H4 lysine 16 specific acetyltransferase.

Biochemical and functional association of nucleoporins with the dosage compensation complex In the current study, we have focused on the mechanism of DCC function in Drosophila. All three purifications resulted in enzymatically active complexes with consistent co-purification of MSL-1, MSL-2, MSL-3, MOF, roX1 and roX2 but not of MLE or JIL-1. The absence of MLE was expected since its interaction with MSLs has reported to be salt and detergent sensitive (Smith et al., 2000). It is likely that JIL-1, like MLE, is sensitive to the purification conditions used in this study. To examine the function of the new interacting proteins in dosage compensation, we studied mutant flies and used RNAi in cell culture. In Z4 mutants or in MBD-R2 depleted SL-2 cells, MSL localization on the X chromosome was not affected. Consequently, these proteins are not required for MSL recruitment or they have an alternative function with MOF that is independent of its role in dosage compensation. However, we have discovered an unexpected link between dosage compensation and the nuclear pore. Depletion of either Mtor or Nup153, but not of other nucleoporins or NXF1 delocalized MSL proteins from the X chromosome. The effects observed were not due to a general transport defect, since all the five MSL proteins and roX2 RNA remained nuclear in Mtor and Nup153 depleted cells and we did not observe accumulation of bulk mRNA in these cells (Figure 3 and 4 and data not shown). Consistent with these observations, we show that Mtor and Nup153 are required for proper dosage compensation of several classical MSL-dependent dosage- compensated genes in SL-2 cells. The expression of these genes was not affected in female Kc cells. An important question raised from our study is whether the observed effects are due to a soluble fraction of Mtor and Nup153 in the nucleus or due to their Nuclear pore components and the regulation of dosage compensation 143 function as components of the nuclear pore complex (NPC). We favor the latter. Firstly, Nup153 staining is exclusively peripheral. Secondly, depletion of Nup153 delocalizes Mtor from the nuclear periphery and increases the soluble pool of Mtor in the nucleoplasm (Figure 4 and (Hase and Cordes, 2003)), but MSL proteins still remained delocalized in Nup153 depleted cells. Finally, the fact that several nucleoporins, which exist together only at the nuclear pore, were co-purified with the MSL complexes strongly favors the idea that there is an interaction between the DCC and the intact NPC. This interaction is sub-stoichiometric, but with clear functional importance for DCC assembly or maintenance on the X chromosome.

The MSLs, higher-order chromatin structure, and nuclear periphery A wealth of information has been generated in budding yeast regarding nuclear organization and gene regulation. For instance, yeast telomeres associate with the nuclear periphery and form a transcriptionally silenced chromatin domain (Feuerbach et al., 2002). However, a number of recent studies have shown that nuclear periphery is not just a domain of gene inactivation, but also of activation (Ishii et al., 2002; Schmid et al., 2004). Consistent with these observations, yeast MLP1 and MLP2 (Mtor orthologs in yeast) associates with transcriptionally active genes and are involved in re-localization of active genes to the nuclear periphery (Casolari et al., 2005). Furthermore, MLPs are involved in chromatin domain formation and pre-mRNA quality control (Sommer and Nehrbass, 2005). Interestingly in Schneider cells, male embryos, salivary glands, and imaginal discs, the Drosophila male X chromosome appears localized at or near the nuclear periphery and in most cases even follows the nuclear rim curvature (data not shown). The inactive X in mammals also localizes close to the nuclear periphery as the Barr body. Like the Drosophila male X chromosome, the inactive X has to be globally controlled (inactivated) and is characterized by a special histone modification (trimethylation of lysine 27 of histone H3). Another common feature between mammals and Drosophila is that non-coding RNAs play an essential role (for review see (Reik and Lewis, 2005)). A possible model that can account for these intriguing similarities is that the nuclear periphery is used to generate transcriptional domains that can be transcriptionally active or inactive in order to achieve co-regulation of gene expression for a subset of genes (Misteli, 2005). In the case of the Drosophila 144 Chapter 4 male X chromosome, hundreds of genes with different basal transcriptional properties need to be co-activated by a factor of two. This kind of a subtle transcriptional co­ regulation of a whole chromosome may be achieved by partial compartmentalization of the X chromosome mediated by the nucleoporin-MSL interaction, allowing the formation of hyper-acetylated chromatin domains with unique transcriptional and/or posttranscriptional properties. It is important to emphasize that Mtor and Nup153 may be required for general chromatin organization (not just individual chromosomes) through their interaction with chromatin-associated proteins. The dosage compensation complex might mediate X-chromosomal tethering to the nuclear pore, as a mechanism to co- regulate a large set of genes by creating chromosomal loops or domains. This could happen by direct or indirect interactions of MSLs with Mtor/Nup153 located at or near high affinity sites along the X chromosome, which are the binding sites of the dosage compensation complex. Interactions with nuclear pore components may also be used to “economize resources” and/or for efficient coupling of transcription to processing of the newly transcribed co-regulated messages. Similar models have been proposed previously (Blobel, 1985; Weintraub, 1985). In summary, the purification of the MSL complex has revealed an unexpected link between dosage compensation and the nuclear pore complex. In the context of data from other systems this allows us to formulate new hypotheses about the mechanism of dosage compensation that will be exciting to test in the future. Nuclear pore components and the regulation of dosage compensation 145

pgd BRC dspt6 E4BP GAPDH Figure 6: Nup153 and Mtor knockdown in SL-2 cells shows down- regulation of X-linked gene expression. A: Quantitative PCR analysis of pgd, BRC, dspt6, runt, GAPDH, AcCoAS and E4BP in EGFP (white), MSL-1 (light grey), Nup153 (dark grey) and Mtor (black) dsRNA treated cells. Results of two independent experiments are shown as twin columns for example (EGFP-1 (lane 1) and EGFP-2 (lane 2). Error bars are standard deviations within each experiment. Expression levels were normalized against autosomal gene Polii and set to 100% for each gene in EGFP treated 146 Chapter 4

cells. Y-axis shows RNA levels in percentage (%). B: Quantitative PCR analysis of pgd, BRC, GAPDH and EF4BP in EGFP (white), Nup153 (dark grey), Mtor (black), Nup214 (grey), Nup62 (light grey) Nup98 (light blue),and Nup154 (light purple), Nup160 (dark purple) and MSL-1 (dark blue) dsRNA treated SL-2 cells. Error bars are standard deviations within each experiment. Expression levels were normalized against autosomal gene Polli and set to 100% for each gene in EGFP treated cells. Y-axis shows RNA levels in percentage (%). C: Kc cells were treated with dsRNAs targeting Sex-lethal (SXL) (lanes 4-6) or EGFP (lane 8) as a negative control. Untreated SL-2 (lanes 1-3) and Kc cells (lane 7) were incubated under mock RNAi conditions in parallel. Cells were collected after 7 days and 10 micrograms of whole cell protein extracts were used for SDS-PAGE and immunoblotting with antibodies against MSL-2, SXL, or a-tubulin as indicated. D: Quantitative PCR analysis of pgd, BRC, dspt6, EF4B and GAPDH in EGFP (white), Nup153 (dark grey) and Mtor (black) dsRNA treated Drosophila Kc cells. Results of two independent experiments are shown as twin columns for example (EGFP-1 (lane 1) and EGFP-2 (lane 2) and so on). Error bars are standard deviation within each experiment. Expression levels were normalized against autosomal gene Polii and set to 100% for each gene in EGFP treated cells. Y-axis shows RNA levels in percentage (%).

Experimental Procedures

Transgenic flies The coding regions of MOF and MSL-3 were fused in frame to the C-terminus of TAP- or N-terminus of FLAG-tag respectively in the CaSpeR-tub vector (detailed map available on request). 4 independent lines were tested for rescue function of the tub-NTAP-Mof transgene, w cv mof1/ FM7 virgins were crossed to w; tub-NTAP-Mof/ Balancer transgenic males and their progeny screened for presence of w cv mof/Y; tub-NTAP-Mof/+ males. 2 independent lines were tested for rescue function of the tub-MSL-3-CFLAG transgene, virgins w; w+ msl-3-flag/CyO msl-3-FLAG; msl- 3/msl-3 were crossed with males w; w+ msl-3-FLAG/CyO; msl-3/TM6C and their progeny screened for the presence of the TM6C balancer. Nuclear pore components and the regulation of dosage compensation 147

HAT assay on polynucleosomes Polynucleosomes were prepared with recombinant Xenopus histones and incubated with control, TAP-MOF, MSL-3FLAG, HA-2xFLAG-hMOF extracts or eluates of the corresponding purifications and HAT assay performed as described previously (Akhtar and Becker, 2000).

Extract preparation and biochemical purification Nuclear extracts (25 mg/ml) were prepared from Drosophila embryos (0-12hr collections) essentially as previously described (Varga-Weisz et al., 1997). The TAP purification protocol (Rigaut et al., 1999) was adapted as follows. All buffers contained 25 mMHepes pH 7.6 instead of Tris-HCL, KCl instead of NaCl, 1/100 volume of RNasin (Promega), 0.2% Tween20, and 20% glycerol. FLAG purification was performed as above using M2-FLAG beads (Sigma). The FLAG-bound protein complex was eluted in elution buffer IgGEl150 (20mM Hepes pH7.6, 150mM KCl, 5mM MgCl2, 0.5 mM EDTA, 20% glycerol and 0.4mM PMSF, 200ng/ml FLAG peptide, 1/100 elution volume RNAsin (Promega)). For purification of the hMOF complex, HeLa cells were stably transfected with N- terminally tagged HA-2xFLAG-hMOF construct cloned in the pcDNA3.1(+) (Invitrogen, USA) vector. Nuclear extracts were prepared as described (Dignam et al., 1983) and the FLAG purification performed as described above. Elution fractions were pooled and subjected to a-HA (Roche) immunoprecipitation. Bound proteins were washed with HEMG200 buffer. Before elution in SDS loading buffer, beads were washed briefly with TEMG200 where Hepes buffer was replaced with Tris-HCl. Silver staining and mass spectrometry was performed as previously described (Shevchenko, 1996). For GeLC-MS/MS analysis, purified protein complexes were separated briefly on SDS-PAGE. The gel lane was fixed, cut and subsequently reduced and alkylated. Proteins were digested with trypsin (Promega) and eluted with TFA. Peptide identification was performed using a nano-HPLC Agillent 1100 nanoflow system connected online to a 7-Tesla linear quadrupole ion trap-Fourier transform (LTQ-FT) mass spectrometer (Thermo Electron, Bremen, Germany) as described (Olsen et al., 2004). 148 Chapter 4

Antibodies and co-immunoprecipitation assays MSL-3, MOF, MLE antibodies were produced against full-length proteins. Fragments of MSL-1 (1-584 aa), Mtor (1419-1931 aa), Z4 (292-779 aa), NSL-1 (1019-1287), and hNSL1 (759-1105 aa) were used to immunize rats. A fragment of Nup153 (1137­ 1488 aa) and MBD-R2 (90-607 aa) and hNSL3 (325-607 aa) was used to immunize rabbits. For co-immunoprecipitation (IP) experiments, 80 ^l of nuclear extract (25 mg/ml) was used. IPs were performed in IP100-buffer (HEMG100-150, 0,5 % Tween 20, 0,2 mg/ml BSA, 0,2 mM PMSF, 0,5 mM DTT, 1x Complete protease inhibitors tablet). Unless otherwise indicated extracts were incubated with 5 ^l of the respective antibody serum or pre-immune serum for 2 hours, rotating at 4°C.

RTPCR and Northern blot analysis RNA was isolated from 150^l input extracts and elution fractions by extraction with TRIZOL (Invitrogen). RT-PCR was performed according to the manufacturer’s protocol (Invitrogen) using specific primers for rox1 (P1- CTATCAGTAGCAGTACACACTCTA, P2-CATCGTGCAACAATCCCAAAG), rox2 (P1-CTTCAGTTTGCATTGCGACTTG, P2- G C C A T C G A A A G G G T A A A T T G G ) , U6 (P1- C T T G C T T C G G C A G A A C A T A T A C T A A A A , P2- AAAAATGTGGAACGCTTCACGATT). The Northern blot analysis and FISH using poly d(T) probe was performed as previously described (Herold et al., 2001). For qRT-PCR, RNA was isolated using the RNaeasy Kit (Qiagen), DNaseI treated, and 300-750ng of total RNA were used in a RT reaction. RT was performed as described above. Cytoplasmic and nuclear RNA isolation was performed as previously described (Herold et al., 2001). qRT-PCR was performed on a Applied Biosystems (AP) Cycler7500 with SYBR-detection and the amplification curves were analyzed with the corresponding AP-software. Each qPCR was repeated at least 4 times, values were normalized to corresponding EGFP and p o lii values and standard deviation within each experiment was calculated. Nuclear pore components and the regulation of dosage compensation 149

Immunofluroresence and confocal microscopy Preparation of polytene chromosomes was performed as described http://www.igh.cnrs.fr/equip/cavalli/Immunostaining.rtf). Apart from a-GFP antibody (1:50) (Torrey Pines Biolabs), a-Nup153 (1:50) and a-Chriz (1:1000) antibodies, all other antibodies were used at 1:500 dilution. For polytene chromosomes, images were captured with an AxioCamHR CCD camera on a Zeiss Axiovert200M microscope using a 100X PlanApochomat NA 1.4 oil immersion objective. Alternatively, images were taken using appropriate filter combinations with a Deltavision Spectris optical sectioning microscope (DeltaVision, Issaquah, USA). Images were arranged with Adobe Photoshop.

RNAi in SL-2 cells RNAi in SL-2 cells were performed as described previously (Buscaino et al., 2003) with the following modifications. SL-2 cells were incubated with 45 ^g of MSL-1 and harvested after 4 days. For knockdown of nucleoporins and MBD-R2 45 ^g of the corresponding dsRNA was added on day 1 and day 3 and cells harvested on day 9 and 7 respectively.

Acknowledgements

We thank D. Arndt-Jovin, H. Eggert, A. Gortchakov, J. Lucchesi, M. Kuroda, P. Becker, W. Herr, S. Gigliotti, N. Xylourgidis, H. Brock, V. Cordes, B. Papp, and T. Klymenko for providing reagents. We are also grateful to M. Hentze for support and to I. Mattaj, M. Hentze, J. Ellenberg, E. Izaurralde, V. Cordes, D. Zink, A. Ladurner, S. Kass and members of the lab for critical reading of the manuscript and helpful discussions. KD is a recipient of EC Marie Curie Incoming International Fellowship (IIF) under the 6th Framework. JK is funded by DFG ”SPP1129: Epigenetics’’. PG is supported by an "E-STAR" fellowship funded by the EC's FP6 Marie Curie Host fellowship for Early Stage Research Training under contract number MEST-CT- 2004-504640. This work was partially funded by the EUFP6”Epigenome” NoE and SFB “transregio TR5”. 150 Chapter 4

References

Akhtar, A., and Becker, P. B. (2000). Activation of transcription through histone H4 acetylation by MOF, an acetyl transferase essential for dosage compensation in Drosophila. Mol Cell 5, 367-375. Blobel, G. (1985). Gene gating: a hypothesis. Proc Natl Acad Sci U S A 82, 8527-8529. Buscaino, A., Kocher, T., Kind, J. H., Holz, H., Taipale, M., Wagner, K., Wilm, M., and Akhtar, A. (2003). MOF-regulated acetylation of MSL-3 in the Drosophila dosage compensation complex. Mol Cell 11, 1265-1277. Cairrao, F., Arraiano, C., and Newbury, S. (2005). Drosophila gene tazman, an orthologue of the yeast exosome component Rrp44p/Dis3, is differentially expressed during development. Dev Dyn 232, 733-737. Casolari, J. M., Brown, C. R., Drubin, D. A., Rando, O. J., and Silver, P. A. (2005). Developmentally induced changes in transcriptional program alter spatial organization across chromosomes. Genes Dev 19, 1188-1198. Cordes, V. C., Hase, M. E., and Muller, L. (1998). Molecular segments of protein Tpr that confer nuclear targeting and association with the nuclear pore complex. Exp Cell Res 245, 43-56. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11, 1475-1489. Dou, Y., Milne, T. A., Tackett, A. J., Smith, E. R., Fukuda, A., Wysocka, J., Allis, C. D., Chait, B. T., Hess, J. L., and Roeder, R. G. (2005). Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121, 873-885. Eggert, H., Gortchakov, A., and Saumweber, H. (2004). Identification of the Drosophila interband-specific protein Z4 as a DNA-binding zinc-finger protein determining chromosomal structure. J Cell Sci 117, 4253-4264. Feuerbach, F., Galy, V., Trelles-Sticken, E., Fromont-Racine, M., Jacquier, A., Gilson, E., Olivo-Marin, J. C., Scherthan, H., and Nehrbass, U. (2002). Nuclear architecture and spatial positioning help establish transcriptional states of telomeres in yeast. Nat Cell Biol 4, 214-221. Hase, M. E., and Cordes, V. C. (2003). Direct interaction with nup153 mediates binding of Tpr to the periphery of the nuclear pore complex. Mol Biol Cell 14, 1923-1940. Herold, A., Klymenko, T., and Izaurralde, E. (2001). NXF1/p15 heterodimers are essential for mRNA nuclear export in Drosophila. Rna 7, 1768-1780. Herold, A., Teixeira, L., and Izaurralde, E. (2003). Genome-wide analysis of nuclear mRNA export pathways in Drosophila. Embo J 22, 2472-2483. Hollmann, M., Simmerl, E., Schafer, U., and Schafer, M. A. (2002). The essential Drosophila melanogaster gene wds (will die slowly) codes for a WD-repeat protein with seven repeats. Mol Genet Genomics 268, 425-433. Ishii, K., Arib, G., Lin, C., Van Houwe, G., and Laemmli, U. K. (2002). Chromatin boundaries in budding yeast: the nuclear pore connection. Cell 109, 551-562. Jin, Y., Wang, Y., Johansen, J., and Johansen, K. M. (2000). JIL-1, a chromosomal kinase implicated in regulation of chromatin structure, associated with the male specific lethal (MSL) Dosage Compensation Complex. Journal of Cell Biology 149, 1005-1010. Lucchesi, J. C., Kelly, W. G., and Panning, B. (2005). Chromatin Remodeling in Dosage Compensation. Annu Rev Genet. Maniatis, T., and Reed, R. (2002). An extensive network of coupling among gene expression machines. Nature 416, 499-506. Marin, I. (2003). Evolution of chromatin-remodeling complexes: comparative genomics reveals the ancient origin of "novel" compensasome genes. J Mol Evol 56, 527-539. Misteli, T. (2005). Concepts in nuclear architecture. Bioessays 27, 477-487. Nuclear pore components and the regulation of dosage compensation 151

Morales, V., Straub, T., Neumann, M. F., Mengus, G., Akhtar, A., and Becker, P. B. (2004). Functional integration of the histone acetyltransferase MOF into the dosage compensation complex. Embo J 23, 2258-2268. Narlikar, G. J., Fan, H.Y., Kingston, R.E. (2002). Cooperation between complexes that regulate chromatin structure and transcription. Cell 108, 475-487. Olsen, J. V., Ong, S. E., and Mann, M. (2004). Trypsin cleaves exclusively C-terminal to arginine and lysine residues. Mol Cell Proteomics 3, 608-614. Qi, H., Rath, U., Wang, D., Xu, Y. Z., Ding, Y., Zhang, W., Blacketer, M. J., Paddy, M. R., Girton, J., Johansen, J., and Johansen, K. M. (2004). Megator, an essential coiled-coil protein that localizes to the putative spindle matrix during mitosis in Drosophila. Mol Biol Cell 15, 4854-4865. Radu, A., Moore, M. S., and Blobel, G. (1995). The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex. Cell 81, 215-222. Rath, U., Wang, D., Ding, Y., Xu, Y. Z., Qi, H., Blacketer, M. J., Girton, J., Johansen, J., and Johansen, K. M. (2004). Chromator, a novel and essential chromodomain protein interacts directly with the putative spindle matrix protein skeletor. J Cell Biochem 93, 1033-1047. Reik, W., and Lewis, A. (2005). Co-evolution of X-chromosome inactivation and imprinting in mammals. Nat Rev Genet 6, 403-410. Rigaut, G., Shevchenko, A., Rutz, B., Wilm, M., Mann, M., and Seraphin, B. (1999). A generic protein purification method for protein complex characterization and proteome exploration. Nat Biotechnol 17, 1030-1032. Sass, G. L., Pannuti, A., and Lucchesi, J. C. (2003). Male-specific lethal complex of Drosophila targets activated regions of the X chromosome for chromatin remodeling. Proc Natl Acad Sci U S A 100, 8287-8291. Schmid, M., Durussel, T., and Laemmli, U. K. (2004). ChIC and ChEC; genomic mapping of chromatin proteins. Mol Cell 16, 147-157. Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68, 850-858. Smith, E. R., Allis CD, Lucchesi JC. (2001). Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem 276, 31483-31486s. Smith, E. R., Pannuti, A., Gu, W., Steurnagel, A., Cook, R. G., Allis, C. D., and Lucchesi, J. C. (2000). The drosophila MSL complex acetylates histone H4 at lysine 16, a chromatin modification linked to dosage compensation [In Process Citation]. Mol Cell Biol 20, 312-318. Sommer, P., and Nehrbass, U. (2005). Quality control of messenger ribonucleoprotein particles in the nucleus and at the pore. Curr Opin Cell Biol 17, 294-301. Sproul, D., Gilbert, N., and Bickmore, W. A. (2005). The role of chromatin structure in regulating the expression of clustered genes. Nat Rev Genet 6, 775-781. Stokes, D. G., Tartof, K. D., and Perry, R. P. (1996). CHD1 is concentrated in interbands and puffed regions of Drosophila polytene chromosomes. Proc Natl Acad Sci U S A 93, 7137-7142. Sukegawa, J., and Blobel, G. (1993). A nuclear pore complex protein that contains zinc finger motifs, binds DNA, and faces the nucleoplasm. Cell 72, 29-38. Taipale, M., Rea, S., Richter, K., Vilar, A., Lichter, P., Imhof, A., and Akhtar, A. (2005). hMOF Histone Acetyltransferase Is Required for Histone H4 Lysine 16 Acetylation in Mammalian Cells. Mol Cell Biol 25, 6798-6810. Varga-Weisz, P. D., Wilm, M., Bonte, E., Dumas, K., Mann, M., and Becker, P. B. (1997). Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II [published erratum appears in Nature 1997 Oct 30;389(6654):1003]. Nature 388, 598-602. 152 Chapter 4

Weintraub, H. (1985). Assembly and propagation of repressed and depressed chromosomal states. Cell 42, 705-711. Wysocka, J., Myers, M. P., Laherty, C. D., Eisenman, R. N., and Herr, W. (2003). Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4 methyltransferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes Dev 17, 896­ 911. Zimowska, G., Aris, J. P., and Paddy, M. R. (1997). A Drosophila Tpr protein homolog is localized both in the extrachromosomal channel network and to nuclear pore complexes. J Cell Sci 110 (Pt 8), 927-944. 5 Nuclear pore components and the regulation of dosage compensation 153

Supplementary Material

Supplementary Figure 1

MSL-3FLAG MOF MERGE roU) 03Oi l l LL —1 * CO CO _J * CO CO I E

MOF B MSL-3 PAP (TAP-MOF) MERGE * #v -4 + m . mm ' MSL-1 M • • • «A * ¡A ; ( Í t _ 4 m MSL-3 * /■* ^► V c V 1 2 3 4

E D +RT -RT O) O) O) O) co 03 (0 co +RT -RT LL LL LL LL CO CO CO CO _l _J _J _J C/D 1 - CO I- CO f - CO 2 § 5 § 1 EE 1 1 EE roX2

roX1

U6

G IP Input hMOF complex + “ +

H3 — Pc H2A/H2B H4 — Rpd3 H4Atail

1 »• • — Ph wt H4Atail mononucleo somes — MOF

^ — MSL-3 hMOF complex

— MBD-R2 H3 H3K14AC H2A/H2B

Z4 H4K12AC

Mtor H4K16AC

■«* H3 H2A/H2B Ponceau

1 2 3 4 5 mononucleosomes 154 Chapter 4

Supplementary Figure 2

MSL-3FLAG MOF MERGE O) O) c CO (0 _ LL LL co co 1 -% *■ _l1 _l w t: w t: r 1 1 E E

• • • m o f B MSL-3 PAP (TAP-MOF) MERGE * *'#v ^ to» » 1 MSL-1 ¿Ík * - / i > • O t . V * ^ V i»

D +RT -RT cn O) O) O) (0 (0 (0 co +RT -RT LL LL Ll LL CO CO CO n _l _J _j C/D I- C/D l- C/D (- C/D 2 § 5 § I EE II EE roX2

roX1

U6

G IP Input hMOF complex + “ +

Autoradiograph u 9m - mí H4 H4Atail

H3 M l — PC H2A/H2B H4 — Rpd3 H4AtaN

- • - Ph wt H4Atail mononucleo somes - - m * — MOF

w m — MSL-3 hMOF complex H3 H3K14AC H2A/H2B

H4K12AC

H4K16AC

- H3 « H2A/H2B Ponceau

1 2 3 4 5 mononucleosomes Nuclear pore components and the regulation of dosage compensation 155

Supplementary Figure 3

roX2-Nuöear roX2-Cytopi*smc GAPDH-Noctear GAPOKCylopiasnnc

C MSL-1 RNAi +WGA

MSL-1 O /~> KJ

O MSL-3 o o MOF o o Nup153 vi

Mtor \ I • o 0

i %

Z4 156 Chapter 4

Supplementary Figure S1 A: Co-localization of MOF and MSL-3FLAG on the male X chromosome in transgenic larvae, visualized by immunostaining of polytene chromosomes with a-MSL-3 and a-MOF antibodies. B: Localization of TAP-MOF protein to the male X chromosome. Squashes of polytene chromosomes were stained with a-MSL-3 and a-protein A (PAP) antibody to detect specifically TAP-MOF. C: Western blot analysis of MSL proteins eluted in the MSL-3FLAG purification. I: Input, E: Eluate. D: RT-PCR of roX1 and roX2 RNAs in eluates of the MSL-3FLAG purification. Lanes 1-4 (reactions with reverse transcriptase), lanes 5-8 (reactions without reverse transcriptase) U6 RNA is shown as a control. E: RT-PCR analysis of roX1 and roX2 RNAs in eluates from TAP-MOF purification. Lanes 1-4 (reactions with reverse transcriptase), lanes 5-8 (reactions without reverse transcriptase). U6 RNA serves as a control. F: Control immunoprecipitation (IP) experiment with a-Mi2 (lane 1) or a-Pc (lane 2) antibodies. Following binding to beads, samples were separated by SDS-PAGE. Western blot analysis was performed with antibodies against the indicated proteins. Input represents the 5%, 1% or 0.5% (lanes 1-3) of starting extract used for IP. G: HAT activity of HA-2xFLAG-hMOF eluates. (Top panel) Reconstituted mononucleosomes with wild-type H4 (wt) or tailless H4 (H4Dtail) were used as a substrate. (Bottom panel) western blot with specific antibodies against acetylated lysines. Ponceau staining verified equal loading.

Supplementary Figure S2 A: Polytene chromosomes were isolated from 3rd instar larvae from wildtype (WT) or Z4 hypomorphic mutants. Chromosomes were immunostained with the combination of either MSL-1 (red) and Chriz (green) antisera or MOF (red) and Z4 (green) antisera. All polytene preparations were co-stained with DAPI to visualize DNA (blue). Last panel also shows the merge of green and red channels. B: SL-2 cells were incubated with EGFP or MBD-R2 dsRNA. Following protein knockdown, cells were harvested and nuclear (N) and cytoplasmic extracts (C) were prepared and separated by SDS-PAGE. Western blot analysis was performed with the Nuclear pore components and the regulation of dosage compensation 157 antibodies against MBD-R2, MOF, Mtor, MSL-3 and Tubulin as indicated. The top two panels show short and long exposure of the MBD-R2 blot demonstrating efficient knockdown. C: Confocal microscopy was performed on SL-2 cells treated with EGFP or MBD-R2 dsRNA. For this purpose cells were immunostained with MBD-R2, Z4, MSL-1, MOF, Nup153 or WGA as indicated. Merge pictures are indicated in corresponding right panels.

Supplementary Figure S3 A: Western blot analysis of nuclear (N) versus cytoplasmic (C) extracts prepared from cells treated with Mtor, Nup153 or EGFP dsRNA (same experiment as in Figure 3). Blots were probed with antibodies generated against MLE, MSL-2, or tubulin as indicated. B: RNA was isolated from nuclei or cytoplasm of corresponding cells and analyzed by quantitative RT-PCR for roX2, GAPDH and PolII RNA. Y-axis corresponds to RNA levels in percentage (%). C: Confocal microscopy was performed on Schneider cells treated with MSL-1 dsRNA. For this purpose cells were immunostained for MSL-1, MSL-3, MOF, Nup153, Mtor or Z4. In addition, all cells were incubated with WGA (green) to visualize the nuclear envelope (+WGA). 158 Chapter 4 Summary and General Discussion 160 Chapter 5

Summary and General Discussion

In this thesis I have presented the work of three separate studies in which different approaches were chosen to study the common theme of targeting the MSL complex to the male X chromosome in Drosophila. All three studies highlight different aspects of targeting that ultimately converge in a single unified model that, contributes to a better understanding of not only dosage compensation but also to the mechanism of chromatin regulated transcriptional control.

Cotranscriptional recuitment of the MSL complex to X-linked genes based on exposed 3’ target sequences In chapter 2 I have used fly genetics to study targeting of the MSL complex to two X-linked genes in great detail. Interestingly, one of the genes studied encodes the MSL complex member MOF, which is the only MSL gene, besides the genes that code for roxl and rox2 to reside on the X-chromosome. I found that m of and the gene directly upstream CG3016 are DCC target genes when inserted ectopically in an autosomal location by p-element mediated transformation. This finding showed, in addition to several other studies (Demakova et al., 2003; Fagegaltier and Baker 2004; Oh et al., 2004; Alekseyenko et al., 2006; Gilfilian et al., 2006) that the DCC complex is targeted to genes individually and therefore does not require entry sites (thereafter referred to as high affinity sites) for nucleation and spreading as has been proposed previously (Kelley et al., 1999). High affinity sites have been defined as sites that retain partial complexes of MSL1/MSL2 in msl3, mle and m of mutant backgrounds (Kelley et al., 1999). Interestingly, m of and CG3016 only constitute ectopic binding sites for the MSL complex when transcriptionally active, whereby the type of promoter is fully dispensable, showing that it is solely the act of transcription that reveals these genes as target sites. This observation is in agreement with three recent reports that show by ChIP-chip that the MSL targets preferentially active genes (Alekseyenko et al., 2006; Gilfilian et al., 2006; Legube et al., 2006). It is likely that the minority of sites that recruit the MSL complex independent of transcription are the high affinity sites based on two observation presented in this thesis. 1) Blocking transcription by means of a-amanitin results in a loss of MSL targeting to all sites except the previously identified high affinity sites on 19D and roX2. 2) The m of gene Summary and General Discussion 161 that normally does not constitute a high affinity site can be transformed into a high affinity site by driving its transcription from a tubulin promoter. This suggests that MSL targeting sequences normally embedded in chromatin, can be exposed by driving transcription from a very active promoter such as tubulin. Therefore, high affinity sites most likely do not need to be exposed to be visible as MSL target sites, whereas all other sites on the X chromosome need transcription in order to be recognized as genes “to be dosage compensated”. Therefore, the MSL complex most likely, is not involved in transcriptional initiation, but only associates with its targets while transcription is ongoing, possibly facilitating transcriptional elongation as has been proposed previously (Smith et al., 2001; Alekseyenko et al., 2006; Gilfillian et al., 2006). Consequently, the high affinity sites do not constitute dosage compensated genes. Their true identity and function remains a mystery to date and should be a primary focus in future research. In line with the observation that not all active genes on the X chromosome are MSL targets, is the finding that transcription of m of and CG3016 alone is not sufficient for MSL recruitment. Targeting is the result of a combination of transcription and sequence determinants in the 3’end of both genes. Although necessary for MSL recruitment, these sequences towards the 3’ end on their own -unlike high affinity sites- are not sufficient to ectopically target the MSL complex, unless the signal is artificially enhanced by mulimerisation. Taken together the data presented in the first part of this thesis support a model of co-transcriptional MSL complex recruitment to genes based on exposed target sequences towards the 3’ end of genes.

MOF as a general transcriptional regulator In chapter 3 I have utilized genome-wide transcription and binding techniques to gain better understanding in the general patterns that lie at the basis of dosage compensation and -as it turned out- general transcriptional regulation. I performed ChIP with antibodies raised against MSL1, MSL3 MOF, H4K16Ac and histone H4 followed by hybridization to high-resolution genome-wide tilling arrays. In addition, genome-wide expression profiles were created following RNAi mediated knockdowns of the same proteins. Intriguingly, this study revealed that MOF, besides its function in dosage compensation, is also involved in general transcriptional regulation independently of the MSL complex. 162 Chapter 5

Surprisingly, MOF on the X chromosome displays a bimodal binding preference to both the 3’ end of dosage compensated genes as well as to promoter proximal regions, unlike MSL1, MSL3 and H4K16Ac which are enriched to the body of genes with a 3’ preference. Binding of MOF to promoter proximal regions is independent of the MSL complex, whereas binding to the body of genes is MSL1 dependent. Although MOF is still enriched on promoter proximal regions in the absence of the MSL complex, its HAT activity is greatly reduced as judged by the diminished H4K16Ac levels on the body of X-linked genes in MSL1 depleted cells. Interestingly, MOFs HAT activity in vitro has been shown to be boosted in complex with both MSL1 and MSL3 (Morales et al., 2004). In line with this finding, the H4K16Ac profile across genes is basically a blueprint of the MSL3 profile suggestive of a role for MSL3 in activation and/or stabilization of H4K16Ac on X-linked genes in vivo. Taken together, these and the above-discussed data lead to a model of transcriptional dependent 3’ end recognition most likely by MSL1 and MSL2 followed by translocation and activation of MOF from promoter proximal regions to the body of genes. MSL3 presumably has a role in modulating MOF’s HAT activity and might thereby create an open chromatin structure at the 3’end that facilitates the recognition of certain target sequences at the 3’ end of genes by MSL1 and MSL2 as discussed in the first section. Surprisingly, binding of MOF to promoter proximal regions is not restricted to X chromosomal genes. MOF displays invariant binding to promoter proximal regions on autosomes and binds in female Kc cells. Unlike, the situation on the X chromosome however, most MOF target genes on the autosomes and in Kc cells are not differentially regulated in MOF depleted cells. The stable association of MSL1 and MSL3 with X-linked genes most likely reflects the continuous expression of its target genes (Gilfilian et al., 2006) Similarly the lower correlation between the MOF bound- and affected population on autosomes could be the result of discontinuous expression of MOF targets on autosomes. In this scenario, MOF would be continuously bound to promoter proximal regions awaiting transcriptional cues that would result in relocation of MOF to the body of genes for transient H4K16Ac. Alternatively, the conformation of the gene could be such that the gene-body is brought in contact with MOF. These premises are under current investigation. Summary and General Discussion 163

In any case, MOF is active as an HAT and is involved in transcriptional regulation on autosomes for the genes tested in this study. It would be of great interest to investigate if MOF on autosomes is similarly transactivated as is the case on the X chomosome. In this respect it is important to note that MOF does not only reside in the MSL complex but also additionally in another evolutionary conserved complex coined the “non specific lethal” (NSL) complex. A role for the NSL complex in MOF regulation is currently under investigation in our lab. The MOF complex purification in flies and humans was performed by Sascha Mendjan and Mikko Taipale and brings me to chapter four of my thesis.

A role for NUP153 and Mtor in targeting the MSL complex to the X chromosome MOF associates with an unexpected set of very interesting proteins. Although, perhaps even more surprising was the absence of any components believed to be directly involved in the regulation of transcription. Therefore, the protein constitution of the purified MOF complex, gave little clues on what the mechanism of dosage compensation could be. Most proteins in the MOF complex were either poorly characterized or not previously studied in a transcriptional context. The only proteins known to associate with ongoing transcription were the exosome components Dis3 and Rrp6, involved in mRNA surveillance (Andrulis et al., 2001). Therefore, either the mechanism by which MSLs exert their function was fundamentally different from the prevalent model, or the new MSL associates, were involved in processes they had so far not known to be affiliated with. Two such proteins that I started characterizing were the nucleoporins NUP153 and Mtor. Mtor is anchored to the nuclear pore complex (NPC) by NUP153 and both proteins are components of the nuclear basket (Krull et al., 2004; Hase and Cordes, 2003). Surprisingly, in SL2 cells depleted of either of these proteins, the characteristic X chromosomal staining by the MSL complex was severely compromised. These results were neither the effect of non-specific protein or RNA leakage to the cytoplasm, nor a general effect attributed to a loss of NPC components. Moreover the expression of a number of X-linked genes was decreased approximately two-fold in cells depleted of either Mtor or NUP153 in male SL2 cells but not in female Kc cells, whereas transcript levels of an autosomal control gene and the runt gene (a MSL 164 Chapter 5 independent dosage compensated gene) remained unchanged. This report to our knowledge was the first and sofar the only report on transcriptional control by nucleoporins in higher eukaryotes. Based on our results, Brown and Silver (Brown and Silver, 2006) proposed that the role for nucleoporins in regulation of dosage compensation could be to “tether the X chromosome to the NPC and coregulate genes by creating chromosomal loops or domains”. This would then in turn “create a unique domain within the nucleus that could recruit factors that would specifically increase expression of X-linked male genes” (Brown and Silver, 2006). Although it is possible that such domains are established, data presented in this thesis suggests that the MSL complex is targeted on a “gene by gene” basis and thus at least for recruitment of the MSL complex such a “loop formation” is not required. Also H4K16Ac does not establish large hyper- acetylated domains on the X chromosome as suggested by this model, but displays a profile that is mostly restricted to genes. Possible other factors that are required to confer optimal (two-fold) expression levels, only associate with X-linked genes when they are in association with the NPC. However, the loss of MSL staining to the X chromosome in Mtor or NUP153 depleted cells suggests that the role of the NUP153 and Mtor, at least in part, is to target the MSL complex to the X chromosome. In yeast, several nucleoporins have been implicated in the epigenetic control of gene expression. Presumably the most notable example is NUP2p. NUP2p can prevent the spread of active or inactive chromatin domains, a function known as boundary activity when artificially tethered between genes (Ishii et al., 2002). Such a role could functionally relate to the proposed NP mediated loop formation of dosage compensated domains (Brown and Silver, 2006). An association with the NPC might create domains that would restrict heterochromatin from active H4K16Ac dosage compensated regions or conversely, refine the MSL complex to its targets. Interestingly, double mutants of Mlp1 and Mlp2, the Mtor homologues in yeast, although not essential for boundary activity themselves, in combination with mutations of boundary elements are found to significantly decrease boundary activity (Dilworth et al., 2005). Furthermore, Mlp1 and Mlp2 have been implicated in telomere and mating-type loci silencing at the nuclear periphery and the organization of functional nuclear subcompartments (Galy et al., 2000; Feuerbach et al. 2002). Summary and General Discussion 165

Interestingly, by ChIP, Mlp1 has been shown to associate with distinct genomic elements. In addition to association with telomeres and the mating type loci, Mlp1 is also enriched on activate open reading frames with enrichment towards the 3’ end of genes similar to the MSL proteins (Casolari et al., 2004; Dilworth et al., 2005). Intriguingly, the association of Mlp1 with active genes, unlike with intergenic regions, is RNase sensitive (Casolari et al., 2004). Given that Mlp1 has direct links to mRNA export factors and is involved in transcription dependent translocation of genes to the nuclear periphery, these observations imply a role for Mlp in cotranscripional recruitment to genes followed by translocation to the nuclear periphery (see introduction). In this respect, it is interesting to note that NUP153 in mammalian cells is mobile during interphase in a transcription dependent manner (Griffes et al., 2004). Thus, similar to targeting of the MSL complex to X-linked genes, NUP153 and Mtor could be targeted to genes cotranscriptionally followed by translocation of these genes to the nuclear periphery, to confer optimal (two-fold) expression levels. The functional interaction of nucleoporins with the MSL complex, as presented in this thesis, highlights the importance to put more emphasis on the spatial organizations of chromatin domains in specialized sub compartments within the nucleus. In order to establish a comprehensive three-dimensional view of chromatin organization, it would be of great importance to not only combine different chromatin binding data but also to include data that reveal the spatial organization of chromatin, such as chromatin conformation capture (3C) and DNA Fluorescent In Situ Hybridization (DNA-FISH). Combining chromatin-binding data with spatial data on chromatin folding and positioning, will likely dramatically change our current one­ dimensional view on chromatin into a three-dimensional highly integrated view on chromatin regulation of gene-expression. 166 Chapter 5

Figure 5. Two different models of NUP153 and Mtor imposed chromatin organization of dosage compensated domains. 1) Loop-formation of large structural dosage compensated domains by tethering to the nuclear periphery. 2) Formation of dosage compensated domains by direct gene-to-gene binding of NUP153 and Mtor to dosage compensated genes.

References

Alekseyenko AA, Larschan E, Lai WR, Park PJ, Kuroda MI. High-resolution ChIP-chip analysis reveals that the Drosophila MSL complex selectively identifies active genes on the male X chromosome. Genes Dev. 2006 Apr 1;20(7):848-57. Epub 2006 Mar 17. Andrulis ED, Werner J, Nazarian A, Erdjument-Bromage H, Tempst P, Lis JT. The RNA processing exosome is linked to elongating RNA polymerase II in Drosophila. Nature. 2002 Dec 19-26;420(6917):837-41. Brown CR, Silver PA. Pore-ing the right dose. Nat Cell Biol. 2006 May;8(5):430-1. Summary and General Discussion 167

Casolari JM, Brown CR, Komili S, West J, Hieronymus H, Silver PA. Genome-wide localization of the nuclear transport machinery couples transcriptional status and nuclear organization. Cell. 2004 May 14;117(4):427-39. Demakova OV, Kotlikova IV, Gordadze PR, Alekseyenko AA, Kuroda MI, Zhimulev IF. The MSL complex levels are critical for its correct targeting to the chromosomes in Drosophila melanogaster. Chromosoma. 2003 Oct;112(3):103-15. Epub 2003 Sep 6. Dilworth DJ, Tackett AJ, Rogers RS, Yi EC, Christmas RH, Smith JJ, Siegel AF, Chait BT, Wozniak RW, Aitchison JD The mobile nucleoporin Nup2p and chromatin-bound Prp20p function in endogenous NPC-mediated transcriptional control. J Cell Biol. 2005 Dec 19;171(6):955-65. Fagegaltier D, Baker BS. X chromosome sites autonomously recruit the dosage compensation complex in Drosophila males. PLoS Biol. 2004 Nov;2(11):e341. Epub 2004 Oct 5. Galy V, Gadal O, Fromont-Racine M, Romano A, Jacquier A, Nehrbass U. Nuclear retention of unspliced mRNAs in yeast is mediated by perinuclear Mlp1.Cell. 2004 Jan 9;116(1):63-73. Feuerbach F, Galy V, Trelles-Sticken E, Fromont-Racine M, Jacquier A, Gilson E, Olivo- Marin JC, Scherthan H, Nehrbass U. Nuclear architecture and spatial positioning help establish transcriptional states of telomeres in yeast. Nat Cell Biol. 2002 Mar;4(3):214- 21. Gilfillan GD, Straub T, de Wit E, Greil F, Lamm R, van Steensel B, Becker PB. Chromosome-wide gene-specific targeting of the Drosophila dosage compensation complex. Genes Dev. 2006 Apr 1;20(7):858-70. Griffis ER, Craige B, Dimaano C, Ullman KS, Powers MA. Distinct functional domains within nucleoporins Nup153 and Nup98 mediate transcription-dependent mobility. Mol Biol Cell. 2004 Apr;15(4):1991-2002. Hase ME, Cordes VC. Direct interaction with nup153 mediates binding of Tpr to the periphery of the nuclear pore complex. Mol Biol Cell. 2003 May;14(5):1923-40. Ishii K, Arib G, Lin C, Van Houwe G, Laemmli UK. Chromatin boundaries in budding yeast: the nuclear pore connection. Cell. 2002 May 31;109(5):551-62. Kelley RL, Meller VH, Gordadze PR, Roman G, Davis RL, Kuroda MI. Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell. 1999 Aug 20;98(4):513-22. Krull S, Thyberg J, Björkroth B, Rackwitz HR, Cordes VC. Nucleoporins as components of the nuclear pore complex core structure and Tpr as the architectural element of the nuclear basket.Mol Biol Cell. 2004 Sep;15(9):4261-77. Epub 2004 Jun 30. Legube G, McWeeney SK, Lercher MJ, Akhtar A. X-chromosome-wide profiling of MSL-1 distribution and dosage compensation in Drosophila. Genes Dev. 2006 Apr 1;20(7):871-83. Epub 2006 Mar 17. Morales V, Richard-Foy H. Role of histone N-terminal tails and their acetylation in nucleosome dynamics. Mol Cell Biol. 2000 Oct;20(19):7230-7. Oh H, Bone JR, Kuroda MI. Multiple classes of MSL binding sites target dosage compensation to the X chromosome of Drosophila. Curr Biol. 2004 Mar 23;14(6):481- 7. Smith ER, Allis CD, Lucchesi JC. Linking global histone acetylation to the transcription enhancement of X-chromosomal genes in Drosophila males. J Biol Chem. 2001 Aug 24;276(34):31483-6. Epub 2001 Jul 9. 168 Chapter 5