J Genet Resour2019;5(2): 149-162 Homepage: http://sc.journals.umz.ac.ir/
RESEARCH ARTICLE DOI: 10.22080/jgr.2019.2434
A Molecular Assessment of the Taxonomy of Iranian Sylvia Warblers (Aves; Sylviidae)
Raziyeh Abdilzadeh1, Mansour Aliabadian1, 2* and Urban Olsson3, 4
1 Department of Biology, Faculty of Science, Ferdowsi University of Mashhad, Mashhad, Iran 2 Research Department of Zoological Innovations (RDZI), Institute of Applied Zoology, Faculty of Science, Ferdowsi University of Mashhad, Mashhad, Iran 3 Department of Biology and Environmental Sciences, University of Gothenburg, Sweden 4 Gothenburg Global Biodiversity Centre, Göteborg, Sweden
A R T I C L E I N F O A B S T R A C T Article history: The largest genus in Sylviidae family is Sylvia, which is the archetype for Received 25 April 2019 warblers. It contains up to 28 species that are distributed in the Old World. Here, Accepted 02 July 2019 we study Iranian Sylvia using cytochrome c oxidase subunit 1 (cox1) and Available online 22 July 2019 cytochrome b (cytb) mitochondrial markers to identify them and place in a phylogenetic context using all available GenBank samples of sufficient length. Keywords: Bayesian trees for both cytb and cox1 mitochondrial markers are compatible. cox1 Previous results suggesting that the Sylvia curruca complex is separated into two cytb major clades with high support is corroborated, as our results show two main phylogeny clades, one that includes Sylvia atricapilla and Sylvia borin plus Pseudoalcippe songbirds atriceps and Lioptilus nigricapillus, and the remainder of the Sylvia species in the other one. Our study did not support the geographical groups: The West- Mediterranean group, the Central-Mediterranean group, and the East- *Corresponding author: Mediterranean or the African-European species, the African-Asian species, and M. Aliabadian the Mediterranean species inferred on molecular evidenced by previous studies. [email protected] Sylvia cantillans is divided into three clades, corroborating previous studies. We confirmed the following taxa to occur in Iran: Sylvia borin, Sylvia atricapilla, Sylvia curruca curruca, Sylvia curruca halimodendri, Sylvia althaea, Sylvia crassirostris, Sylvia mystacea and Sylvia nisoria. All Iranian samples were p-ISSN 2423-4257 conclusively identified to species level, and none of them give rise to any further e-ISSN 2588-2589 taxonomic inquiry. 2019 UMZ. All rights reserved. Please cite this paper as: Abdilzadeh R, Aliabadian M, Olsson U. 2019. A molecular assessment of the taxonomy of Iranian Sylvia warblers (Aves; Sylviidae). J Genet Resour 5(2): 149-162. doi: 10.22080/jgr.2019.2434
Introduction Mediterranean Sea and this region is reconstructed as the ancestral area for Sylvia The largest genus in the Sylviidae family is (Voelker and Light, 2011). The genus Sylvia is Sylvia, which is the archetype of warblers (Aves; comprised of about 28 species (Gill and Donsker, Sylviidae, Sylvia). Sylvia has been used 2019), depending on taxonomy often including extensively as a model system in a variety of species which were until recently placed in other ecological, genetic, morphological evolution, the genera: Parisoma, Pseudalcippe and genetics of migration, the effects of climate Horizhorinus, respectively (Blondel et al., 1996; change on migration, the evolution of range size Böhning-Gaese et al., 2003; Voelker et al., 2009; and morphological studies (Böhning-Gaese and Sibley and Monroe, 1990; Sibley and Ahlquist Bauer, 1996; Gwinner and Wiltschko, 1978; 1990). According to Clement et al., (2016), this Doswald et al., 2009). The genus is distributed genus has 25 species, whereas Dickinson and from central Eurasia to South Africa, and about Christidis (2014) divides the genus into several 70% of Sylvia species have ranges bordering the smaller genera and only includes 4 species in
This work is licensed under the Creative Commons Attribution 4.0 International License.
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Sylvia sensu stricto. In this study, we followed considered a polytypic species, with four the IOC world bird list (Gill and Donsker, 2019). subspecies, European S. c. cantillans, albistriata, Most of the early studies related to this genus are moltonii and North African S. c. inornata based on morphology (Hall and Moreau, 1970; (Gargallo 1994; Shirihai et al., 2001; Brambilla Glutz and Bauer, 1991; Jordano, 1987). But, et al., 2008) widely distributed around the more recent studies have relied on molecular Mediterranean. They are very similar in external phylogenies as the basis for understanding morphology, and both taxonomic status and evolutionary patterns in the genus (Böhning- phylogeographic relationships among Gaese and Bauer, 1996; Böhning-Gaese et al., populations is uncertain. For many, differences 2006; Voelker and Light, 2011). Based on a in their vocalizations are useful for combination of morphological characteristics, identification. Based on the sequences of the two dispersal patterns, general ecology and behavior mitochondrial genes cytb and ND2 (NADH of species, six groups are defined in the genus dehydrogenase subunit 2), the relationships of Sylvia: Undata, Melanocephala, Hortensis, this genus were investigated and biological, Curruca, Articapilla and Communis (Glutz and geographic history reconstructed in 26 species of Bauer, 1991). Five of these groups occur in Iran, the genus Sylvia (including species formerly the exception being Undata. A molecular found in Parisoma and Horizorhinus) (Voelker phylogeny based on DNA-DNA hybridization and Light, 2011). They classified the genus into revealed that the Sylvia-Parisoma complex is 3 main clades: African-European species, monophyletic and includes three main groups of African and Asian species, species with species, the “mid-European” warblers, the genus Mediterranean dispersal (Voelker and Light, Parisoma, and the “eu-Mediterranean” Sylvia 2011). However, several important nodes in the species sensu stricto. The latter can be assigned tree had low support, and consequently a well- to three main clusters, a “West-Mediterranean” resolved phylogeny of Sylvia is still lacking. group, a ‘Central-Mediterranean group”, and an Concerning Iranian taxa, only one sequence “East-Mediterranean” group. belonging to the species Sylvia mystacea was The phylogeny results were consistent with the used by Voelker and Light (2011), while in a DNA-DNA hybridization results that included general study of songbirds, only the two species 20 species (Blondel et al., 1996). All species of Sylvia communis and S. mystacea originating Sylvia and species of the formerly recognized from Iran were included in the analyzes genus Parisoma were included in a study using (Aliabadian et al., 2009). These are the only the mitochondrial cytochrome b gene (cytb) studies that have included specimens of the (Böhning-Gaese et al., 2003). The main reason genus Sylvia originating in Iran. Our aims in this the number of species of this genus is uncertain, paper are to identify newly obtained Iranian is because of the presence of two not yet Sylvia samples by molecular methods and assess taxonomically evaluated species complexes, their phylogenetic position compared to Sylvia Sylvia curruca and Sylvia cantillans (Voelker samples present in public depositories. and Light, 2011). We here present the first phylogenetic and The Lesser Whitethroat Sylvia curruca complex taxonomic evaluation of Iranian samples of the is a group of warblers divided into at least six genus Sylvia, based on part of the mitochondrial clades (althea, blythi, halimodendri, cytochrome b and cytochrome c oxidase subunit margelanica, curruca and minula) according to 1 (cox1) genes sampled throughout Iran and Olsson et al., (2013) and Votier et al., (2016). compared with the complete dataset of sufficient Some authors treat the complex as a single length sequences from GenBank. polymorphic species (e.g. Shirihai et al., 2001; Materials and Methods Cramp, 1992; Mayr and Cottrell, 1986; Portenko, 1960; Ripley, 1982; Svensson, 1992; Sampling and GenBank dataset Williamson, 1976), two species (Loskot, 2005), Blood samples were collected from 43 Sylvia in while others divide it into three different species 12 sites from Iran (Fig. 1), comprising Arasbaran (Martens and Steil, 1997; Vaurie, 1954; Gill and (three samples), Khoy (four samples), Khalkhal Donsker, 2019). Sylvia cantillans is formally
150
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
(four samples), Zanjan (one sample), Kurdistan Minab (three samples) between July 2016 and (five samples), Tandoureh (one sample), Fars July 2017 under permit No. 96.9101 of the (seven samples), Yasuj (four samples), Kerman Iranian Department of Environment. (eight samples), Golestan (three samples) and
Fig.1. Sampling sites of Sylvia Warblers in Iran: 1=Khoy; 2=Arasbaran; 3=Khalkhal; 4=Zanjan; 5=Kurdistan; 6=Golestan; 7=Tandoureh; 8=Yasuj; 9 and 10=Fars; 11=Kerman; 12=Minab.
Much of the sampling was done in Important et al., 1991). Acrocephalus scirpaceus was used Bird Areas (IBA). Details of origin and as an outgroup for rooting the phylogeny. We GenBank accession numbers are given in Table used all available GenBank samples for both 1 and Table 2. Birds were captured using mist cox1 and cytb genes for Sylvia genus, nets and approximately 50μl of whole blood was Pseudoalcippe and Lioptilus. The included drawn from a brachial vein by insulin needles sequences were longer than 600 bp for cox1 and and was preserved into Queens’s buffer (Seutin 800 bp for cytb.
151
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Table 1. The information of Iranian Sylvia Warblers samples. Scientific name Sample ID Sample sites Coordinate Status S. borin FUM 160920225 Khoy 38° 55′ N, 44° 93′ E Breeding season S. borin FUM 161020225 Khoy 38° 55′ N, 44° 93′ E Breeding season S. curruca FUM 160920218 Khoy 38° 55′ N, 44° 93′ E Breeding season S. curruca FUM 160920222 Khoy 38° 55′ N, 44° 93′ E Breeding season S. curruca FUM 170701209 *Arasbaran 38° 98′ N, 46° 88′ E Breeding season S. curruca FUM 170701210 *Arasbaran 38° 98′ N, 46° 88′ E Breeding season S. curruca FUM 170701213 *Arasbaran 38° 98′ N, 46° 88′ E Breeding season S. curruca FUM 170522173 *Kurdistan 35° 29′ N, 46° 82′ E Breeding season S. curruca FUM 170522177 *Kurdistan 35° 29′ N, 46° 82′ E Breeding season S. curruca FUM 170522181 *Kurdistan 35° 29′ N, 46° 82′ E Breeding season S. curruca FUM 170617183 Fars 29° 57′ N, 51° 94′ E Breeding season S. curruca FUM 170617189 Fars 29° 57′ N, 51° 94′ E Breeding season S. curruca FUM 170617192 Fars 29° 57′ N, 51° 94′ E Breeding season S. curruca FUM 170617193 Fars 29° 57′ N, 51° 94′ E Breeding season S. curruca FUM 170617194 Fars 29° 57′ N, 51° 94′ E Breeding season E Breeding season ′٤١ °٥١ ,N ′3٠ °٣٠ S. curruca FUM 170618201 Yasuj E Breeding season ′٤١ °٥١ ,N ′3٠ °٣٠ S. curruca FUM 170618204 Yasuj E Breeding season ′٤١ °٥١ ,N ′3٠ °٣٠ S. curruca FUM 170618205 Yasuj E Breeding season ′٤١ °٥١ ,N ′3٠ °٣٠ S. curruca FUM 170618206 Yasuj S. curruca FUM 150806093 Zanjan 36° 57′ N, 47° 64′ E Breeding season S. curruca FUM 140802299 Khalkhal 37° 37′ N, 48° 32′ E Breeding season S. curruca FUM 140802278 Khalkhal 37° 37′ N, 48° 32′ E Breeding season S. curruca FUM 140802285 Khalkhal 37° 37′ N, 48° 32′ E Breeding season S. curruca FUM 140802282 Khalkhal 37° 37′ N, 48° 32′ E Breeding season S. mystacea FUM 170522180 *Kurdistan 35° 29′ N, 46° 82′ E Breeding season S. althaea FUM 170814232 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 170814233 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 170814234 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 170814238 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 170814239 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 170814241 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. althaea FUM 160512187 *Tandoureh 37° 58′ N, 58° 66′ E Breeding season S. halimodendri FUM 170319153 Hormozgan 27° 08′ N, 57° 01′ E Wintering S. halimodendri FUM 170319154 Hormozgan 27° 08′ N, 57° 01′ E Wintering S. halimodendri FUM 170319155 Hormozgan 27° 08′ N, 57° 01′ E Wintering S. crassirostris FUM 170617185 Fars 29° 57′ N, 51° 94′ E Breeding season S. crassirostris FUM 170617190 Fars 29° 57′ N, 51° 94′ E Breeding season S. atricapila FUM 170808217 Golestan 36° 79′ N, 54° 45′ E Breeding season S. atricapila FUM 170808221 Golestan 36° 79′ N, 54° 45′ E Breeding season S. communis FUM 170808218 Golestan 36° 79′ N, 54° 45′ E Breeding season S. communis FUM 170814240 *Kerman 29° 05′ N, 57° 53′ E Breedin g season S. communis FUM 170814242 *Kerman 29° 05′ N, 57° 53′ E Breeding season S. communis FUM 170522156 *Kurdistan 35° 29′ N, 46° 82′ E Breeding season *Important Bird Area (http://www.birdlife.org)
DNA extraction and sequencing cycling procedure were based on Patel et al., (2010). The oligomers of the forward and DNA was extracted from blood using a standard reverse primers were for AWCF: AWCF1-f: salt extraction method (Bruford et al., 1992), after incubation overnight at 40°C immersed in 5'- CGCYTWAACAYTCYGCCATCTTACC- an extraction buffer (2% sodium dodecyl sulfate 3'; and AWCR6-r: 5'- (SDS) and 0.5 mg/ml proteinase K). The mtDNA ATTCCTATGTAGCCGAATGGTTCTTT-3'; markers, cox1, and cytb were amplified using and for cytb following L-14995: 5'- published primers that cox1 primers and PCR CTCCCAGCCCCATCCAACATCTCAGCATG
152
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
ATGAAACTTCG-3'; H-16065: 5'- (clade V) is sister to clade IV, which contains CTAAGAAGGGTGGAGTCTTCAGTTTTTGG Sylvia melanocephala and Sylvia mystacea. TTACAAGAC-3' (Olsson et al., 2005). Also, Sylvia layardi, Sylvia boehmi, Sylvia Total PCR reaction volumes were 25 µl, subcaeruleum and Sylvia nana constitute the containing 12.5 µl Taq DNA Polymerase Master sister clades. Sylvia nisoria is a separate clade in Mix RED (Ampliqon), 1 µl of each primer with the clade B. The cox1 Bayesian tree (Fig. 3) concentration 10 µM, 3 µl DNA, and 7.5 µl shows two main clades. S. borin and S. ddH2O. PCR products were screened on 2% atricapilla (clade B) constitute a sister group to agarose gels to confirm amplification of the the other taxa (clade A), both with 100% target fragments. The purified PCR products support. In both trees, S. cantillans (clade VI) is were sequenced by Macrogen Inc. (Seoul, South sister to S. melanocephala and S. mystacea Korea). (clade V) and the S. curruca complex (clade IX) is sister to S. crassirostris (clade VII). Iranian S. Data analysis borin (FUM 160920225 and FUM 161020225) Sequences were edited in Bioedit version 7.0.1 are part of the same clade as S. borin from (Hall, 1999). Sequences were aligned using Europe and Cyprus in the Eastern ClustalW as implemented in Mediterranean, with no signs of significant https://www.ebi.ac.uk/Tools/msa/clustalw2/. The divergence (clade I). substitution model for the Bayesian trees was S. atricapilla from North of Iran (FUM determined by jModelTest 2.1.10 (Darriba et al., 170808217 and FUM 170808221) are in the 2012). same clade as European and African (Djibouti) Molecular phylogenies were estimated by S. atricapilla, with no signs of significant Bayesian inference using MrBayes 3.2.7 divergence (clade I). (Ronquist et al., 2012) by The CIPRES Science All S. communis from Iran (FUM 170522156, Gateway V.3.3 (Miller et al., 2010) FUM 170814242, FUM 170814240 and FUM (http://www.phylo.org/index.php/). The 170808218) are in the same clade as African, preferred model for cytb was HKY+I+G European and Kazakh samples, two of them (Hasegawa et al., 1985) and the best-fitting (FUM 170814240, FUM 170814242) possibly model of nucleotide substitution for cox1 was diverging slightly (clade IV). Two samples of S. GTR+I+G (Lanave et al., 1984; Rodríguez et al., mystacea from Iran are correctly in the same 1990; Tavaré, 1986). A contiguous 651 bp clade as a Russian S. mystacea. S. crassirostris stretch of the cox1 and 842 bp portion of the cytb from Fars in Iran are in the same clade with gene were obtained from 156 and 184 taxa Greece and Norway samples, without signs of respectively and visualized in FigTree 1.4.0 significant divergence (clade V). Of course, the (Rambaut, 2008). Norway sample represents a vagrant and is not biogeographically interesting. Results Discussion Bayesian trees estimated under the HKY+I+G and GTR+I+G model, respectively, for both cytb Our analysis can be compared with the Glutz and and cox1 mitochondrial markers, are compatible. Bauer (1991) study. They proposed 6 groups: The cytb Bayesian tree (Fig. 2) shows two main Undata (S. sarda, S. undata, S. deserticola), clades (clade A and B) with high support Melanocephala (S. cantillans, S. mystacea, S. (100%). Clade A includes Pseudoalcippe melanothorax, S. ruppelli, S. melanocephala), atriceps, Lioptilus nigricapillus, Sylvia borin and Hortensis (S. leucomelaena, S. nisoria, S. Sylvia atricapilla. All other species are in Clade hortensis), Curruca (S. curruca, S. minula, S. B, which is further divided into two main althaea), Atricapilla (S. atricapilla, S. borin) and subclades. The first subclade (clade XII) consists Communis (S. communis, S. conspicillata, S. of the Sylvia curruca complex, and its sister nana) based on morphological characteristics, clade (clade XI) consists of Sylvia crassirostris, dispersal patterns, general ecology and behavior Sylvia leucomelaena, Sylvia buryi, Sylvia lugens. of species. Moreover, Sylvia hortensis. Sylvia cantillans
153
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Table 2. The information of GenBank dataset for Iranian Sylvia Warblers.
GenBank AC NO. GenBank AC NO. GenBank AC NO. Scientific name Origin Scientific name Origin Scientific name Origin cytb cox1 cytb cox1 cytb cox1 Acrocephalus South - KF614612.1 - S. layardi JF502296.1 - S. mystacea Iran JF502302.1 - scirpaceus Africa S. borin Uganda AY124540.1 - S. minula China KC512637.1 - S. melanocephala Spain AJ534544.1 - S. borin Malawi JF502280.1 - S. minula China KC512635.1 - S. melanocephala Morocco KY378798.1 - S. borin Russia JF502281.1 - S. minula China KC512634.1 - S. melanocephala Spain KY378799.1 - A
S. borin Germany AJ534549.1 - S. minula China KC512636.1 - S. melanocephala Spain KY378797.1 - bdilzadeh P. atriceps Uganda JN827158.1 - S. minula China KC512611.1 - S. sarda - FN908758.1 - P. atriceps Burundi JN827159.1 - S. minula China KC512610.1 - S. sarda Corsica JF502309.1 -
et al. L. nigricapillus South Africa JN827092.1 - S. minula China KC512609.1 - S. undata France AJ534542.1 -
L. nigricapillus South Africa JN827093.1 - S. minula China KC512608.1 - S. deserticola Morocco AJ534540.1 - , J Genet Resour S. atricapilla Russia JF502273.1 - S. minula China KC512607.1 - S. balearica Spain AJ534541.1 - 154 S. atricapilla Russia JF502276.1 - S. minula China KC512605.1 - S. melanothorax Mediterian area AJ534546.1 - S. atricapilla Greece JF502274.1 - S. minula China KC512604.1 - S. melanothorax - KJ456482.1 - S. atricapilla Greece AF074596.1 - S. minula China KC512612.1 - S. melanothorax - JF502301.1 -
S. atricapilla Greece AY308735.1 - S. minula China KC512606.1 - S. rueppelli Mediterian area AJ534547.1 - , 2019;5(2): S. atricapilla Mediterian area AM889140.1 - S. curruca England KC512659.1 - S. rueppelli - JF502307.1 - S. atricapilla Mediterian area NC010228.1 - S. curruca Sweden KC512658.1 - S. rueppelli - JF502308.1 -
S. atricapilla Greece JF502275.1 - S. curruca Sweden KC512655.1 - S. conspicillata Senegal AJ534539.1 - 149 S. cantillans Sweden LN650644.1 - S. curruca Sweden KC512656.1 - S. conspicillata Spain KF517355.1 - - 162 S. cantillans UK HF562847.1 - S. curruca Sweden KC512652.1 - S. conspicillata Spain KF517358.1 -
S. cantillans Italy JN048682.1 - S. curruca Sweden KC512654.1 - S. conspicillata Spain KF517367.1 - S. cantillans France JN048676.1 - S. curruca Germany AJ534536.1 - S. conspicillata Spain KF517357.1 - S. cantillans France JN048679.1 - S. curruca Sweden KC512653.1 - S. conspicillata Spain KF517353.1 - S. cantillans France JN048677.1 - S. curruca Sweden KC512657.1 - S. conspicillata Spain KF517352.1 - S. cantillans Spain AJ534543.1 - S. margelanica Mongolia KC512603.1 - S. conspicillata Cape Verde KF517361.1 - S. cantillans Senegal JF502283.1 - S. margelanica China KC512591.1 - S. conspicillata Morocco KF517360.1 - S. mystacea Kuwait AJ534545.1 - S. margelanica China KC512590.1 - S. conspicillata Morocco KF517359.1 -
154
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Table 2: Continuous GenBank AC NO. GenBank AC NO. GenBank AC NO. Scientific name Origin Scientific name Origin Scientific name Origin cytb cox1 cytb cox1 cytb cox1 S. margelanica China KC512585.1 - S. conspicillata Spain KF517356.1 - S. althaea Kazakhstan KC512557.1 - S. margelanica China KC512584.1 - S. conspicillata Spain KF517354.1 - S. althaea Kyrgyzstan KC512566.1 - S. margelanica China KC512588.1 - S. conspicillata Portugal KF517365.1 - S. althaea Kyrgyzstan KC512565.1 - S. margelanica China KC512582.1 - S. conspicillata Cape Verde KF517363.1 - S. althaea Pakistan KC512563.1 - Abdilzadeh S. margelanica China KC512580.1 - S. conspicillata Cape Verde KF517362.1 - S. althaea Kazakhstan KC512570.1 - S. margelanica China KC512577.1 - S. cconspicillata Spain KF517366.1 - S. crassirostris Mediterian area AJ534535.1 - S. margelanica China KC512576.1 - S. conspicillata Cape Verde KF517364.1 - S. crassirostris Mediterian area NC010229.1 -
et al. S. margelanica Kazakhstan KC512575.1 - S. communis Germany AJ534538.1 - S. crassirostris Mediterian area AM889141.1 - ,
S. margelanica China KC512589.1 - S. communis Russia JF502288.1 - S. crassirostris Greece JF502290.1 - J Genet Resour S. margelanica China KC512581.1 - S. communis Germany JF502285.1 - S. crassirostris Greece JF502295.1 - S. margelanica China KC512578.1 - S. communis Russia JF502287.1 - S. lugens Ethiopia AJ534532.1 -
155 S. margelanica China KC512579.1 - S. communis Slovakia HQ608840.1 - S. lugens Tanzania JF502298.1 -
S.margelanica China KC512574.1 - S. communis Greece JF502286.1 - S. buryi Saudi Arabia AJ534531.1 - , 2019;5(2): S. margelanica China KC512573.1 - S. nisoria Austria AJ534527.1 - S. buryi - JF502282.1 - S. margelanica China KC512587.1 - S. nisoria Moldova JF502305.1 - S. hortensis Spain AJ534534.1 - S. margelanica China KC512586.1 - S. nisoria Russia JF502306.1 - S. leucomelaena Saudi Arabia AJ534533.1 -
149 S. margelanica China KC512583.1 - S. layardi South Africa AJ534528.1 - S. boehmi Ethiopia AJ534530.1 - - S. blythi Kazakhstan KC512452.1 - S. layardi South Africa JF502297.1 - S. boehmi Kenya JF502279.1 - 162
S. blythi Kazakhstan KC512451.1 - S. althaea Kyrgyzstan KC512568.1 - S. boehmi Kenya JF502278.1 - S. blythi Kazakhstan KC512450.1 - S. althaea Kazakhstan KC512567.1 - S. subcaeruleum South Africa AJ534529.1 - S. blythi Kazakhstan KC512449.1 - S. althaea Kyrgyzstan KC512564.1 - S. subcaeruleum South Africa JF502311.1 - S. blythi Kazakhstan KC512448.1 - S. althaea Kyrgyzstan KC512562.1 - S. subcaeruleum South Africa KY273786.1 - S. halimodendri Oman KC512542.1 - S. althaea Kyrgyzstan KC512561.1 - S. subcaeruleum South Africa JF502310.1 - S. halimodendri Oman KC512541.1 - S. althaea Kyrgyzstan KC512560.1 - S. nana Mediterian area AJ534537.1 - S. althaea Afghanistan KC512572.1 - S. althaea Kyrgyzstan KC512559.1 - S. nana South Africa JF502303.1 -
S. althaea Kazakhstan KC512569.1 - S. althaea Kyrgyzstan KC512558.1 - S. atricapilla Russia - GQ482701
155
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Table 2: Continuous
GenBank AC NO. GenBank AC NO. GenBank AC NO. Scientific name Origin Scientific name Origin Scientific name Origin cytb cox1 cytb cox1 cytb cox1 S. atricapilla Netherlands - KF946870.1 S. communis Russia - GQ482719.1 S. curruca Mongolia - GQ482724.1 S. atricapilla Russia - GQ482707.1 S. communis Netherlands - KF946877.1 S. nisoria Kazakhstan - GQ482733.1 S. atricapilla Netherlands - KF946866.1 S. communis Netherlands - KF946878.1 S. nisoria Norway - GU571647.1 S. atricapilla Netherlands - KF946871.1 S. communis Netherlands - KF946879.1 S. nisoria Norway - GU571648.1
S. atricapilla Norway - GU571641.1 S. communis Norway - GU571643.1 S. nisoria Kazakhstan - GQ482736.1 Abdilzadeh S. atricapilla Sweden - GU572115.1 S. curruca Netherlands - KF946887.1 S. nisoria Russia - GQ482735.1 S. atricapilla Cyprus - KT803684.1 S. curruca Netherlands - KF946888.1 S. nisoria Russia - GQ482734.1
S. atricapilla Djibou - MF580223.1 S. curruca Netherlands - KF946889.1 S. nisoria Netherlands - KF946891.1 et al.
S. atricapilla Sweden - GU572116.1 S. curruca Netherlands - KF946890.1 S. nisoria Sweden - GU572122.1 , J Genet Resour S. atricapilla Russia - GQ482709.1 S. curruca Norway - GU571645.1 S. nisoria Sweden - GU572123.1 S. atricapilla Russia - GQ482705.1 S. curruca Norway - GU571646.1 S. mystacea Russia - GQ482730.1 S. atricapilla Russia - GQ482702.1 S. curruca Russia - GQ482729.1 S. mystacea Russia - JQ176321.1
156 S. atricapilla Russia - GQ482703.1 S. curruca Sweden - GU572121.1 S. melanocephala Cyprus - KT803679.1 , 2019;5(2):
S. atricapilla Russia - GQ482704.1 S. curruca Cyprus - KT803683.1 S. melanocephala Cyprus - FJ465368.1 S. atricapilla Russia - GQ482706.1 S. curruca Turkey - KX283164.1 S. melanocephala Cyprus - FJ465369.1 S. atricapilla Netherlands - KF946868.1 S. curruca Turkey - KX283165.1 S. cantillans Greece - JQ176318.1
S. atricapilla Netherlands - KF946869.1 S. curruca Russia - GQ482722.1 S. conspicillata Cyprus - KT803681.1 149
KP780415.1 - S. atricapilla Russia - GQ482708.1 S. curruca Russia - GQ482728.1 S. undata - - 162 S. atricapilla Turkey - KX283161.1 S. curruca Russia - GQ482721.1 S. melanothorax Cyprus - KT803682.1
S. crassirostris Greece - JQ176320.1 S. curruca Russia - GQ482727.1 S. communis Norway - GU571642.1 S. crassirostris Norway - GU571644.1 S. curruca Mongolia - GQ482723.1 S. communis Russia - GQ482714.1 S. curruca Netherlands - KF946883.1 S. curruca Kazakhstan - GQ482725.1 S. communis Kazakhstan - GQ482717.1 S. curruca Netherlands - KF946884.1 S. curruca Russia - GQ482726.1 S. communis Russia - GQ482720.1 S. curruca Netherlands - KF946885.1 S. curruca Netherlands - KF946881.1 S. communis Netherlands - KF946876.1 S. curruca Netherlands - KF946886.1 S. curruca Netherlands - KF946882.1 S. communis Netherlands - KF946880.1 S. communis Russia - GQ482718.1 S. curruca Russia - JQ176319.1 S. communis Russia - GQ482715.1
156
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Table 2: Continuous GenBank AC NO. GenBank AC NO. GenBank AC NO. Scientific name Origin Scientific name Origin Scientific name Origin cytb cox1 cytb cox1 cytb cox1 S. communis Russia - GQ482716.1 S. borin Netherlands - KF946875.1 S. cantillans - - KX224439.1 S. communis Sweden - GU572119.1 S. borin Russia - GQ482713.1 S. cantillans - - KX224433.1
S. communis Sweden - GU572120.1 S. borin Sweden - GU572117.1 S. cantillans - - KX224432.1 Abdilzadeh
S. communis Cyprus - KT803680.1 S. borin Cyprus - KT803685.1 S. cantillans - - KX224431.1 Abdilzadeh S. nana Mongolia - GQ482731.1 S. borin Sweden - GU572118.1 S. cantillans - - KX224430.1
S. nana Mongolia - GQ482732.1 S. cantillans - - KX224442.1 S. cantillans - - KX224429.1 et al
.
S. nana Mongolia - JQ176322.1 S. cantillans - - KX224441.1 S. cantillans - - KX224428.1 et al. , J Genet Resour S. borin Russia - GQ482710.1 S. cantillans - - KX224440.1 S. cantillans - - KX224427.1 , S. borin Russia - GQ482711.1 S. cantillans - - KX224438.1 S. cantillans - - KX224426.1 J Genet Resour S. borin Russia - GQ482712.1 S. cantillans - - KX224437.1 S. cantillans - - KX224425.1 S. borin Netherlands - KF946873.1 S. cantillans - - KX224436.1 S. cantillans - - KX224424.1
S. borin Acrocephalus , 2019;5(2): Netherlands - KF946872.1 S. cantillans - - KX224435.1 - - KC755399.1 157 scirpaceus , 2019;5(2):
S. borin Netherlands - KF946874.1 S. cantillans - - KX224434.1 - - - -
149
- 149 162 -
162
157
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Abdilzadeh
et al. , J Genet Resour 158
, 2019;5(2):
149 - 162
Fig. 2. Phylogeny of Sylvia warblers, based on Bayesian analyses of mitochondrial cytb: Clade A) P. atriceps, L. nigricapillus, S. borin and S. atricapilla; Clade B) All other species in Sylvia genus. The cytb analysis recovers eight groups (Greek numbers).
158
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Abdilzadeh
et al. , J Genet Resour 159 , 2019;5(2):
149
Fig. 3. Phylogeny of Sylvia warblers, based on Bayesian analyses of mitochondrial cox1: Clade A) S. borin and S. atricapilla; Clade B) All other species in - Sylvia genus. The cytb analysis recovers eight groups (Greek numbers). 162
159
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
In our cytb analysis we recovered two main All Iranian samples were conclusively identified clades and eight groups compatible with this to species level, and none of them give rise to taxonomy (Fig. 3), I: Atricapilla (S. atricapilla, any further taxonomic inquiry. S. borin), II: Nisoria (S. nisoria), III: Undata (S. Acknowledgements undata, S. balearica, S. deserticola, S. sarda), IV, V, VI, VII, VIII: Melanocephala (S. This research funded by Ferdowsi University of melanocephala, S. melanothorax, S. rueppelli, S. Mashhad (3.42780). We thankful to the mystacea, S. cantillans, S. communis, S. department of Environment (DOE) for providing conspicillata), IX: Nana (S. nana, S. the permit and logistical support for blood subcaeruleum), X: Layardi (S. layardi, S. sampling in Iran (No. 96.9101). We appreciate boehmi), XI: Hortensis (S. hortensis, S. the contributions in the early stages of this crassirostris, S. leucomelaena, S. lugens, S. research by former supervisor, the late Prof. buryi), XII: Curruca ( margelanica, blythi, Jamshid Darvish. We are grateful to Vali Ebadi althaea, curruca, minula, halimodendri). and Leila Noorani that provided samples from According to the cytb tree (Fig. 2), S. atricapilla Khalkhal and Tandoureh respectively, Maliheh and S. borin belong in the same clade as Pirayesh helped in lab works and Hassan Pseudoalcippe atriceps and Lioptilus Abdilzadeh, Mehri Ahmadi, Mehdi Elahi, nigricapillus (clade B). This clade is so deeply Vajiheh Ghaemi, Somayyeh Pourebrahimi, diverged from the rest of the included species Mohammad Safrang, Sajjad Jafari, Babak (clade A) that treatment as a separate genus may Mousavi, Dr. Arya Shafayipour, Dr. Reza be warranted. Moussavi-Harami, the Galeshi family, According to Blondel et al., (1996), there were Mohammad Ebrahim Sehat, Hossein Barahoyi, three main groups based on DNA-DNA Yahya Tarahhomi and also, not least, all the hybridization: A West-Mediterranean group, a environment guards from the sampling areas for Central-Mediterranean group, and an East- their helping in both sampling and a variety of Mediterranean. Also, based on Voelker and different ways. Light (2011), based on the two mitochondrial Conflicts of interest genes cytb and ND2, this genus was divided into three main clades, the African-European species, The authors have no conflict of interest to the African-Asian species, and the declare. Mediterranean species. Our study doesn’t References support these results and we didn’t recover these groups. All Iranian samples were conclusively Aliabadian M, Kaboli M, Nijman V, Vences M. identified to species level. 2009. Molecular identification of birds: performance of distance-based DNA Conclusion barcoding in three genes to delimit parapatric According to the Baysian trees, S. atricapilla and species. Plos One 4(1): e4119. S. borin are in the same clade as Pseudoalcippe Blondel J, Catzeflis F, Perret P. 1996. Molecular atriceps and Lioptilus nigricapillus. This clade is phylogeny and the historical biogeography of so deeply diverged from the rest of the included the warblers of the genus Sylvia (Aves). J species that treatment as a separate genus may be Evol Biol 9: 871–891. warranted. In our cytb analysis we recovered two Böhning-Gaese K, Bauer HG. 1996. Changes in main clades and eight groups. Our study did not species abundance, distribution, and diversity support the geographical groups according the in a central European bird community. previous studies: The West-Mediterranean, the Conserv Biol 10(1): 175-187. Central-Mediterranea and the East- Böhning-Gaese K, Caprano T, Van Ewijk K, Mediterranean groups. We confirmed the Veith M. 2006. Range Size: Disentangling following taxa to occur in Iran: Sylvia borin, current traits and phylogenetic and Sylvia atricapilla, Sylvia curruca curruca, Sylvia biogeographic factors. Am Nat 167: 555-567 curruca halimodendri, Sylvia althaea, Sylvia Böhning-Gaese K, Schuda MD, Helbig AJ. crassirostris, Sylvia mystacea and Sylvia nisoria. 2003. Weak phylogenetic effects on
160
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
ecological niches of Sylvia warblers. J Evol Hall BP, Moreau RE. 1970. An atlas of Biol 16: 956-965. speciation in African passerine birds. Brambilla M, Vitulano S, Spina F, Baccetti N, Trustees of the British Museum (Natural His- Gargallo G, Fabbri E, Guidali F, Randi E. tory), London. 2008. A molecular phylogeny of the Sylvia Hall T. 1999. BIOEDIT: a user-friendly cantillans complex: cryptic species within the biological sequence alignment editor and Mediterranean basin. Mol Phylogenet Evol analysis program for Windows 95/98/NT. 48(2): 461-472. Nucl Acids Res 41: 95-98. Bruford MW, Hanotte O, Brookfield JFY, Burke Hasegawa M, Kishino K, Yano T. 1985. Dating T. 1992 Single-locus and multilocus DNA the human-ape splitting by a molecular clock fingerprint. In AR Hoelzel (Ed.), Molecular of mitochondrial DNA. J Mol Evol 22:160- genetic analysis of populations: a practical 174. approach (pp. 225-270) Oxford, IRL Press, Jordano P. 1987. Frugivory, external UK. morphology and digestive system in Clements JF, Schulenberg TS, Iliff MJ, Mediterranean sylviid warblers Sylvia spp. Roberson D, Fredericks TA, Sullivan BL, Ibis 129: 175-189. Wood CL. 2016. The eBird/Clements Lanave C, Preparata C, Saccone C, Serio G. checklist of birds of the world. The Cornell 1984. A new method for calculating Lab Ornithology Ithaca, New York. evolutionary substitution rates. J Mol Evol Cramp S. 1992. The Birds of the Western 20: 86-93. Palearctic, Vol. 7. Oxford University Press, Loskot VM. 2005. Morphological variation and Oxford. taxonomic revision of five south-eastern Darriba D, Taboada GL, Doallo R, Posada D. subspecies of Lesser Whitethroat Sylvia 2012. jModelTest 2: more models, new curruca (L.) (Aves: Sylviidae). Zool heuristics and parallel computing. Nat Mededelingen Leiden 79: 157-165. Methods 9(8), 772. Martens J, Steil B. 1997. Reviergesänge und Dickinson EC, Christidis L. (Eds.) 2014. The Speziesdifferenzierung in der Howard and Moore complete checklist of the Klappergrasmücken-GruppeSylvia [curruca]. birds of the world. 4th ed., Vol. 2- passerines, J Ornithol 138: 1-23. Aves Press, Eastbourne, UK. Mayr E, Cottrell GW. 1986. Checklist to the Doswald N, Willis SG, Collingham YC, Pain DJ, Birds of the World, vol. XI. Museum of Green RE, Huntley B. 2009. Potential Comparative Zoology, Cambridge, MA. impacts of climatic change on the breeding Miller MA, Pfeiffer W, Schwartz T. 2010 and non-breeding ranges and migration November. Creating the CIPRES science distance of European Sylvia warblers. J gateway for inference of large phylogenetic Biogeogr 36:1194-1208 trees. In 2010 Gateway Computing Gargallo G, 1994. On the taxonomy of the Environments Workshop (GCE). pp. 1-8. western Mediterranean islands populations of IEEE. Subalpine Warbler Sylvia cantillans. Bull. Br. Olsson U, Alström P, Ericson PG, Sundberg P. Ornithol. Club 114: 31-36 2005. Non-monophyletic taxa and cryptic Gill F, Donsker D. 2019. IOC world bird list species-evidence from a molecular phylogeny (Vol 9.1). https://doi.org/Doi of leaf-warblers (Phylloscopus, Aves). Mol 10.14344/IOC.ML.9.1. Phylogenet Evol 36: 261-276. Glutz VBU, Bauer KM. 1991. Handbuch der Olsson U, Leader P J, Carey G J, Khan AA, vögel mitteleuropas, band 12/I, Passeriformes Svensson L, Alström P. 2013. New insights (3. Teil). Aula, Wiesbaden. into the intricate taxonomy and phylogeny of Gwinner E, Wiltschko W. 1978. Endogenously the Sylvia curruca complex. Mol Phylogenet controlled changes in migratory direction of Evol 67(1): 72-85. the Garden Warbler, Sylvia borin. J Comp Patel S, Waugh J, Millar CD, Lambert DM. Physiol 125:267-273. 2010. Conserved primers for DNA barcoding historical and modern samples from New
161
Abdilzadeh et al., J Genet Resour, 2019; 5(2): 149-162
Zealand and Antarctic birds. Mol Ecol evolution. Yale University Press. Resour 10(3): 431-438. Sibley CG, Monroe BL. 1990. Distribution and Portenko LA. 1960. The birds of the USSR. Part taxonomy of birds of the world. Yale IV. Acad Sci, USSR, Russian. University Press. Rambaut A. 2008. FigTree, a graphical viewer of Svensson L. 1992. Identification guide to phylogenetic trees. Retrieved from european passerines, Fourth ed. Stockholm. http://tree.bio.ed.ac.uk/software/figtree/ Tavaré S. 1986. Some probabilistic and Ripley SD. 1982. A synopsis of the birds of statistical problems on the analysis of DNA India and Pakistan: together with those of sequences. Lec Math Life Sci 17: 57-86 Nepal, Bhutan, Bangladesh, and Sri Lanka / Vaurie C. 1954. Systematic notes on Palearctic Rodríguez J, Oliver L, Marín A, Medina R. birds, No 11. Sylviinae: the genus Sylvia. Am 1990. The general stochastic model of Mus Novit 1692: 1-17. nucleotide substitution. J Theor Biol 142: Voelker G, Light JE. 2011. Palaeoclimatic 485-501. events, dispersal and migratory losses along Ronquist F, Teslenko M, Van Der Mark P, Ayres the Afro-European axis as drivers of DL, Darling A, Höhna S, Larget B, Liu L, biogeographic distribution in Sylvia warblers. Suchard MA, Huelsenbeck, JP. 2012. Bmc Evol Biol 11(1): 163. MrBayes 3.2: efficient Bayesian phylogenetic Voelker G, Melo M, Bowie RCK. 2009. A gulf inference and model choice across a large of Guinea island endemic is a member of a model space. Syst Biol 61(3): 539-542. Mediterranean-centered bird genus. Ibis Seutin G, White BN, Boag PT. 1991. 151(3): 580-583 Preservation of avian blood and tissue Votier SC, Aspinall S, Bearhop S, Bilton D, samples for DNA analyses. Can J Zool 69(1): Newton J, Alström P, Olsson U. 2016. Stable 82-90. isotopes and mtDNA reveal niche segregation Shirihai H, Gargallo G, Helbig A, Harris A, but no evidence of intergradation along a Cottridge D, Roselaar D. 2001. Sylvia habitat gradient in the Lesser Whitethroat warblers: identification, taxonomy and complex (Sylvia curruca; Passeriformes; phylogeny of the Genus Sylvia. Christopher Aves). J Ornithol 157(4): 1017-1027. Helm, AC Black, London. Williamson, K. 1976. Identification for Ringers Sibley CG, Ahlquist, JE. 1990. Phylogeny and No. 3: The Genus Sylvia, Second Reprinted. classification of birds: a study in molecular British Trust for Ornithology, Tring.
162