Report of the Tomato Genetics Cooperative

Volume 57 September 2007

THIS PAGE IS INTENTIONALLY BLANK Report of the Tomato Genetics Cooperative Number 57- September 2007

University of Florida Gulf Coast Research and Education Center 14625 CR 672 Wimauma, FL 33598 USA Foreword The Tomato Genetics Cooperative, initiated in 1951, is a group of researchers who share and interest in tomato genetics, and who have organized informally for the purpose of exchanging information, germplasm, and genetic stocks. The Report of the Tomato Genetics Cooperative is published annually and contains reports of work in progress by members, announcements and updates on linkage maps and materials available. The research reports include work on diverse topics such as new traits or mutants isolated, new cultivars or germplasm developed, interspecific transfer of traits, studies of gene function or control or tissue culture. Relevant work on the Solanaceous species is encouraged as well.

Paid memberships currently stand at approximately 121 from 21 countries. Requests for membership (per year) US$20 to addresses in the US and US$25 if shipped to addresses outside of the United States should be sent to Dr. J.W. Scott, [email protected]. Please send only checks or money orders. Make checks payable to the University of Florida. We are sorry but we are NOT able to accept cash or credit cards.

Cover. Design by Christine Cooley and Jay Scott. Depicted are “Tomatoes of the Round Table” as opposed to “Knights of the Round Table”. This year we celebrate the 50th Anniversary of the Tomato Breeders Roundtable (TBRT). See this year’s feature article for information on the history of the Tomato Breeders Roundtable.

THIS PAGE IS INTENTIONALLY BLANK TABLE OF CONTENTS TGC REPORT 57, 2007 ______Foreword ……………………………………………………………………………………………………..1 Announcements ………………………………………………………………………………………....…3 Feature Article ………………………………………………………………………………………………7 Research Reports Occurrence of Anthocyanin in Cultivated Tomato Boches, Peter S. and Myers, James R. ……………………………………………………….………14

Thifensulfuron susceptibility in tomatoes and possible linkage with blossom end rot Dick, Jim ……………………………………………………………………………………………….… 20

Co-dominant SCAR marker for detection of the begomovirus-resistance Ty-2 locus derived from Solanum habrochaites in tomato germplasm Garcia, Brenda E., Graham, Elaine, Jensen, Katie S., Hanson, Peter, Mejía, Luis and Maxwell, Douglas P. …………………………………………………………………….……..…. 21

Co-dominant SCAR Markers for Detection of the Ty-3 and Ty-3a Loci from Solanum chilense at 25 cM of Chromosome 6 of Tomato Ji, Yuanfu, Salus, Melinda S., van Betteray, Bram, Smeets, Josie, Jensen, Katie S., Martin, Christopher T., Mejía, Luis, Scott, Jay W., Havey, Michael J. and Maxwell, Douglas P. ………………………………………………………………………………..…. 25

Antioxidants in Faculty Tomatoes Kedar, N. ……………………………………………………………………………………………….. 29

Evaluation of PCR-based markers for scanning tomato chromosomes for introgressions from wild species Martin, Christopher T., Salus, Melinda S., Garcia, Brenda E., Jensen, Katie S., Montes, Luis, Zea, Carolina, Melgar, Sergio, El Mehrach, Khadija, Ortiz, Julieta, Sanchez, Amilcar, Havey, Michael J., Mejía, Luis and Maxwell, Douglas P. …………………………………………. 31

Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato Price, David L., Memmott, Frederic D., Scott, Jay W., Olson, Steve M. and Stevens, Mikel R. 35

Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm Seah, Stuart, Williamson, Valerie M., Garcia, Brenda E., Mejía, L., Salus, Melinda S., Martin, Christopher T. and Maxwell, Douglas P. ………………………………………………….. 37

Transgenic Lycopersicon ssp. plants expressing the gene for human acidic fibroblast growth factor Stoykova, Petya, Radkova, Mariana, Stoeva-Popova, Pravda, Wang, Xingzhi and Atanassov, Atanas ………………………………………………………………………………….… 41

Varietal Pedigrees ‘Fla. 8153’ tomato hybrid; Fla. 8059 and Fla. 7907 breeding lines. Scott, J.W., Baldwin, E.A., Klee, H.A., Olson, S.M., Bartz, J.A., Sims, C.A. and Brecht, J.K...... ……………………...... 44

Gc9, Gc171, and Gc173 begomovirus resistant inbreds. Scott, J.W. and Schuster, D.J...... ……………………………………………....…………… 45

Stock Lists …………………………………………………………………………………….…….….… 47 Membership List …………………………………………………………………………….……….….. 74 Author Index ………………………………………………………………………………….………….. 79

THIS PAGE IS INTENTIONALLY BLANK ANNOUNCEMENTS TGC REPORT 57, 2007 ______From the editor:

Happy Autumn to the TGC membership. In Florida this is a nice time of year because it begins to finally cool off from the 4-5 months of hot weather. Otherwise it is a nice time of year because you have the latest TGC report! This is my fifth report as editor for those who are keeping track. My thanks goes to Dolly Cummings who does a lot of the work in preparation of the TGC report and keeping our spreadsheets and mailings in order. Christine Cooley as well as Dolly have been helping with the website updates. My contact information has not changed at all for the first time in quite awhile:

Jay W. Scott, Ph.D. Gulf Coast Research & Education Center 14625 CR 672 Wimauma, FL 33598 USA Phone; 813-633-4135 Fax; 813-634-0001 Email; [email protected]

Do not hesitate to contact me if you have any questions or concerns. Also be sure to check our website for additional TGC information: http://tgc.ifas.ufl.edu/. We still have some work to do on the electronic volumes but all are available online and fairly complete searches can be done by keyword. We will continue to finalize this process in the coming year. Also, you see we are featuring the Tomato Breeders Roundtable in this issue and the website will now (or very soon) contain abstracts of the TBRT presentations. Thanks to all who have submitted reports this year and I hope you will consider submitting reports in the future. If there has been a change in your contact information please email me about it. Good luck in your 2007-2008 tomato pursuits.

Jay W. Scott Managing Editor

P.S. from Dolly: Please check your contact information in the ‘Membership List’ section to be sure that all the information we have is complete and correct. Thanks!

ANNOUNCEMENTS TGC REPORT 57, 2007 ______Upcoming Meetings

2nd International Symposium on Tomato Disease, October 8-12, 2007 (better hurry!). http://www.2istd.ege.edu.tr/index.html Tomato Disease Workshop, October 24-26, 2007, Williamsburg, VA. http://www.cpe.vt.edu/tdw. Tomato Breeders Roundtable, November 4-7, 2007, Penn State U. http://tomatoroundtable07.psu.edu/ 5th Solanceae Genome Workshop 2008, Oct 1-8, 2008, Cologne, Germany. Information will be posted at mpiz website or contact Christiane Gebhardt, [email protected], the local organizing committee representative.

ANNOUNCEMENTS TGC REPORT 57, 2007 ______

Grant Opportunity:

Request for Proposals for Tomato Germplasm Evaluation

Funding is expected to be available again in fiscal year 2008 for evaluation of tomato germplasm. Proposals must be submitted through the Crop Germplasm Committee (CGC). All proposals will be evaluated according to the national need for evaluation data, the likelihood of success, and the likelihood that the data will be entered into GRIN and shared with the user community. Evaluation priorities established by the CGC (Table 1) will provide review criteria. When all other factors are equal, preference for funding will be given to supporting those proposals forwarded by CGCs that have not received prior funding. Proposals will be reviewed by the CGC and forwarded to the USDA for consideration. Proposals must be returned to the CGC Chair by November 9, 2007 so that reviews and rankings, can be forwarded to the USDA in Beltsville by December 3, 2007.

Because of limited funds, the USDA cannot support all proposals submitted. Consequently, please be very frugal in your request for funds. In recent years, the USDA has caped budget allocations in the range of $15,000-$18,000 per project annually.

The proposal format is outlined below. Please submit proposals electronically as a PDF file to David Francis, CGC Chair, [email protected].

I. Project title and name, title of evaluators.

II. Significance of the proposal to U.S. agriculture.

III. Outline of specific research to be conducted including the time frame involved – include the number of accessions to be evaluated.

IV. Funding requested, broken down item by item. Budgets should follow USDA form ARS454 as funding will be in the form of a specific cooperative agreement. No overhead charges are permitted.

V. Personnel: A. What type of personnel will perform the research (e.g. ARS, State, or industry scientist; postdoc; grad student, or other temporary help). B. Where will personnel work and under whose supervision.

VI. Approximate resources contributed to the project by the cooperating institution (e.g. facilities, equipment, and funds for salaries).

ANNOUNCEMENTS TGC REPORT 57, 2007 ______Table 1. Crop Germplasm Committee Priorities for Tomato

Type Priority Description Bacterial Diseases High Bacterial canker Bacterial Diseases High Bacterial spot Bacterial Diseases Medium Bacterial soft rot (post harvest) Bacterial Diseases Medium Bacterial Speck Bacterial Diseases Low Bacterial Wilt Fungal Diseases High Verticillium wilt race 2 Fungal Diseases High Target Spot Fungal Diseases High Corky root Fungal Diseases Medium Late blight Fungal Diseases Medium Phytophthora root rot Fungal Diseases Medium Fruit rots Fungal Diseases Low Target spot Fungal Diseases Low Powdery mildew Viral Disease High Pepino mosaic virus Viral Disease High Non-spotted wilt tospo viruses Viral Disease High Marchites manchada syn Sinoloa necrosis Viral Disease Medium gemini viruses Viral Disease Medium Spotted wilt Viral Disease Medium CMV Viral Disease Low Beet curly top virus Viral Disease Low PVY Insect screening Protocols High Silverleaf whitefly Insect screening Protocols High Nematodes, heat stable Insect screening Protocols Medium Aphids Insect screening Protocols Medium Psylid insects Stress High Cold tolerance Stress High Heat tolerance Stress Medium Salinity tolerance Stress Medium Color disorders Horticultural High Soluble solids Horticultural High Flavor (define components) Horticultural Medium Antioxidants/nutritional content Horticultural Medium Color Horticultural Medium Sugar type Horticultural Medium Peelability/dicing Horticultural Medium Viscosity Horticultural Low Blossom-end smoothness Horticultural Low Fruit chilling tolerance Genetic Resources High Genotyping to define core collections Phenotypic characterization of segregating Genetic Resources High populations

FEATURE ARTICLE TGC REPORT 57, 2007 ______A Look Back at the Tomato Breeders Roundtable

J.W. Scott1 with contributions from Allan Stoner2, Paul Thomas3, and Jim Strobel4 1University of Florida, IFAS, Gulf Coast Research & Education Center, 14625 CR 672, Wimauma, FL 33598, USA email: [email protected] 2Retired-formerly USDA, Beltsville MD,3Retired-formerly PetoSeed Co., 4Retired, formerly University of Florida, Tropcial Research & Education Center

Introduction.

The Tomato Breeders Roundtable (TBRT) has been the premier meeting in North America for public and industry scientists interested in tomato improvement and it attracts researchers from around the world. The TBRT has a proud tradition but there is no institution or governing body that carries it forward from year to year. Rather the meeting is passed on from host to host analogous to a baton being passed between runners in a relay race. Accordingly, hosts of the meeting often feel more tired once their meeting is finished than a relay racer does after the race! Since there is no institution, there are no official archives and before all information on the history of the TBRT is lost, a retrospective seemed appropriate because modern day tomato researchers owe much to our innovative predecessors.

Be a part of this work in progress.

Of course the TBRT predates the electronic age of personnel computers and the internet. This article will take advantage of the present time period by being electronically interactive with any of you who can help with this article. Information presented will be incomplete and there may be some inaccuracies although the latter will hopefully be minimal. Hard copy will be in the 2007 TGC but I ask your help if you can make additions/corrections. Send information to me (see contact information above) and it will be updated for the web version that will be on the TGC website. So please consider this a working draft and thanks in advance for any assistance in making this historical review the best it can be. I can send an electronic version for editing in track changes if requested. If you know of someone who may have information but is not likely to see this, please send them a copy for their input. Together we can make this review the best it can be. All corrections and additions are welcome. I apologize for any inaccuracies or omissions, I did what I could with information at my disposal. Abstracts and programs of recent meetings will be posted on the TGC website. It would be possible to list programs and abstracts from at least some of the earlier meetings on the TGC website over time if there is interest. Let me know what you think about this.

Happy 50th Anniversary

Early information was obtained by contacting the contributors listed above. Allan Stoner mentioned that the impetus for the formation of TBRT was a group of people primarily interested in the Midwest canning industry in the 1950‟s. A search of early TGC‟s for information struck gold when an article by Mark Tomes of Purdue was found in The Report of the Tomato Genetics Cooperstive in 1958-volume 8:4. This report by Dr. Tomes follows:

7 FEATURE ARTICLE TGC REPORT 57, 2007 ______The Tomato Breeders Group

Several years ago an informal organization of tomato breeders was started by those attending a field day at Purdue University. Present were experiment station and university personnel from states adjacent to Indiana and tomato breeders from commercial seed houses and commercial processing corporations in the area. Dr. E.C. Stevenson of Purdue was asked to be chairman of the first steering committee which was charged with setting up a round table discussion of certain practical breeding problems. Since Drs. Alexander and Paddock had held an informal field day the prior year at Ohio, Drs. Thompson and McCollum volunteered to act as hosts for the group. Accordingly, a Tomato Breeders Round Table was held at Illinois in January of 1957. With the help of the Raw Products Research Bureau of the National Canner‟s Association, this meeting received somewhat wider publicity. Attendance included about 40 tomato breeders from areas as distant as Nebraska, New York and New Jersey. A new steering committee composed of representatives from the seed trades, the commercial processing corporations, and the universities was charged with setting up a combined field-day, discussion sessions for the summer of 1957. The Ohio group volunteered to sponsor the group and the August 8-9 session at Wooster resulted. Attendance at this session totaled around 70 with breeders present from areas as distant as Cuba, Canada, Texas, and California To date the Breeders group has operated on an informal basis. No formal organization exists, no proper name has been assigned, no dues are assessed, and no requirement for attendance exists other than an interest in the solution of practical tomato breeding problems. Those who founded the group had no intention of sponsoring another national organization. Rather, they were interested in the stimulation and practical knowledge that might be derived from the association of individuals who share a common problem. The original invitations were largely an area affair. If the group has grown, it attests only to a more widespread interest in the benefits to be derived from such an association. The group included those who feel that a solution to current tomato problems can best be achieved by the mutual discussion of methods. Others feel that methods can best be discussed with the materials at hand. To date we have had both methods sessions, and field-day, discussion meetings. Much of value in a how-to sense has been derived. Some cooperation has been stimulated, and considerable knowledge of who is doing what, how, and why has been gained. The question whether this group might conflict with TGC was discussed at an early meeting. The feeling of the group was that no conflict would result since the emphasis of the two groups was different. A session for 1958 is in the planning stage. Dr. Munger kindly consented to act as sponsor for the group at Cornell in connection with their 1958 vegetable days. Recently, however, we have had a number of requests asking that the session be scheduled in or near Indiana just preceding or following the AIBS session at Bloomington in order that travel might be reduced for those wishing to attend. An announcement will be sent to all those who have indicated an interest by past attendance. For the steering committee, Mark L. Tomes

It can be seen from Tomes‟ report that the first reference for the group to meet under the name “Tomato Breeders Round Table” was for a meeting at Illinois in 1957. Thus, 2007 marks the 50th Anniversary of the Tomato Breeders Roundtable!! As for the name, “Round Table” was used for

8 FEATURE ARTICLE TGC REPORT 57, 2007 ______30 years until 1988 when Mike Courtney was host and used the word “Roundtable”. The single word has been in favor ever since.

The Meetings.

Table 1 lists meeting dates, locations and program chairs or hosts. Note there are gaps where some of you may be able to add information and there may also be some omissions or corrections that need to be made. I started going to the TBRT in 1976 and have reasonably good information for most meetings since then. The TBRT actually met twice in 1957 but settled in to meeting once a year until 1979. There used to be steering and program committees appointed to carry out the meetings. According to Allan Stoner, the Food Processors initially kept the mailing list and treasury. After that Bill Hepler did it when he was at Penn State and then Allan Stoner maintained he records for several years in the 1970‟s. Since the 1981 meeting, mailing lists and extra meeting funds have been passed on to the host of each meeting. Of the early meetings Allan Stoner recalled “Initially, and for the first several years, the TBRT met at the LaSalle Hotel in Chicago in February. Later someone suggested in would be a good idea to meet in a warmer climate in Feb and also be able to see some tomatoes when we met, thus the meeting sites started moving around each year (not always to where there were tomatoes growing at the time; Columbus, OH, Indianapolis, College Park MD, etc.)”. Paul Thomas of PetoSeed kindly provided this synopsis of the early years. “The first meeting (sic) was held in Cleveland in 1959. At that time there was a revolution going on with tomatoes, a lot happening and there were individuals in both the land grant colleges and industry that felt the need for such a group. Mechanical harvesting of processing tomatoes was in the process of making its debut. Michigan State and UC Davis were the primary universities in the development of harvesters and tomato varieties for this program. Along with the mechanical harvest of tomatoes was work with disease resistance of the tomato. All of these programs were expanding in the late 1950‟s and early 1960‟s. In addition, the use of F-1 hybrid tomatoes for the commercial trade was making its appearance. This transition from O.P.‟s to F-1‟s was initiated primarily by Peto Seed Co. and the Joseph Harris Seed Co. As you can see, there was a lot going on in the industry and there was a definite need for an organization such as TBRT to help coordinate this change and it was a great way for scientists to meet and exchange material and ideas. In 1960, the next meeting of TBRT was moved to the La Salle Hotel in downtown Chicago where it remained for a number of years. It was felt this was more or less the center of the U.S. and accessible for people from the east, west, and south to meet. The early meetings were primarily along the practical applied type research. This seemed to be where the greatest need was. After the first few years in Chicago, it was decided to move the meetings around to various cities. Some of the early cities we visited were Denver, CO; Bradenton, FL; Homestead, FL; San Francisco, CA; and also Sacramento, CA. At about this time frame there were over 200 people working with tomatoes in almost all the land grant colleges, even Nebraska, Idaho, Montana, and Wyoming of all places. There was a great deal of interest particularly in the mechanical harvest programs that were going on. This was really a great period to be involved in the industry. A lot was going on and looking back a great deal was accomplished and the total industry, both fresh market and processing changed.” Jim Stobel had these comments: “While the early years of the TBRT involved principally processing interests, programs such as ours in Fla. were enhanced in many ways by the TBRT meetings and the day to day cooperation that originated at such meetings. In summary, the major benefit of this meeting of research personnel from the University and private business sector was the early stage sharing of valuable information and germplasm for all, of the acceleration progress for

9 FEATURE ARTICLE TGC REPORT 57, 2007 ______individual programs (and growers) by months or years. As everyone knows, publication and variety releases take years to become part of the communications network, the TBRT provided a valuable forum for all who participated”. We can all agree that the climate of free germplasm exchange has certainly changed over the last several decades!

As mentioned the TBRT was an annual meeting until1979. Several things were changing during this era: there was a decline in public breeding programs which provided a major share of the presentations at the meetings; the Midwestern canning industry, so important to the formation of the TBRT, was rapidly losing acreage and factories; and biotechnology was being born and these scientists went to other meetings to present their findings. For several years there were discussions as to whether the TBRT should meet once a year or every two years. This was finally resolved when it became a trend to meet about every 1 ½ years although the actual times of the meetings are determined in large part by the host of the next meeting. As can be seen in Table 1 all meetings have been in North America with most in the USA except for one in Canada, two in Mexico, and one in Guatemala. As indicated, the early meetings dealt largely with sharing practical methods for crop improvement during an exciting era when research published in the TGC and elsewhere was making the tomato a model genetic crop. There was more discussion at TBRT‟s than most meetings with the presentations being less formal as indicated by the name Round Table. Over the years the meetings have become more formal with a higher percentage of research presentations, but panel discussions and extensive questioning are still cornerstones of this meeting that sets it apart from most scientific meetings. Area reports are presented from around the world to keep the group up to date with emerging disease, variety, and other issues. The Tomato Crop germplasm Committee regularly meets at the TBRT and updates are given to the group on its activities. There are also reports from the germplasm center at Geneva, NY and Davis, CA as well as a brief report from the TGC Editor. With the advance of molecular technology many presentations are now molecular in nature but still with applied goals in mind for MAS etc. With the tomato genome presently being sequenced future meetings will likely have more and more functional genomics presentations that will be aimed at improved breeding efficiency. More basic genomics studies will be for the most part presented elsewhere.

The Pioneers.

One of the goals of this paper is to pay tribute to “our tomato breeding forefathers”. Although some key people will be left out that should not preclude mentioning some of the key figures who got the TBRT going and made it successful. Allan Stoner provided the following narrative: “I am pretty sure that the group was formed by a group of Experiment Station tomato breeders from several Midwestern states. Of course at that time most states had a tomato breeding program and some (Ohio, Florida, California) had two or more. My recollection is that people like Walter Brown -Ohio, Mark Tomes and E.C. Stevenson or Ken Johnson -Purdue, Shig Honma-Michigan, Anson Thompson or his predecessor at Illinois, Vic Lambeth -Missouri , Currence -Minnesota, etc. I am certain there were other Midwestern breeders involved and there may have very well been breeders from other regions involved in starting the organization as well. The National Canners Assn , later the National Food Processors Assn, was involved for many years and maintained the mailing list and collected registration fees, etc. Charles Mahoney, then Ed Crosby, and Bill Hollis were involved from the NCA. When I went to my first meeting in 1964, there were attendees from all over the country -

10 FEATURE ARTICLE TGC REPORT 57, 2007 ______Jack Hanna and Paul Smith from CA, Jim Walter and Jim Strobel from FL, Paul Leeper from TX, Carroll Barnes -Clemson, etc. There were also several processing company breeders such as Walter Virgin from Del Monte, Charlie John from Heinz, Larry Holl and Colen Wyatt from Libbys, Moore and ? (famous for recording bird calls) from Campbell Soup, etc. There were also some seed company breeders such as Paul Thomas, Tom Castle, a guy named Scott you may have known and Carl Cadregari from Harris. Other than Canadian breeders from Guelph and Beaver Lodge, Canada, I don't recall any foreign participants until later years. Jim Strobel mentioned cooperating with “Charlie John and Colon Wyatt of the H.J. Heinz Co. as well as with George Reynard and John Moore of the Campbell Soup Co. to develop stocks with a greater diversity of vine and fruit characteristics such as advances in fruit color, firmness, and jointless pedicel. We also cooperated with Paul Smith of U. of California, L.J. Alexander of Ohio State, and Jim Gilbert of Hawaii whose work in fresh market tomatoes for a variety of cultural situation and disease resistance were highly significant” Jim especially mentioned Jim Walter for his multiple disease resistant breeding work at the University of Florida. TBRT members paid tribute to Dr. Walter with a signed plaque at the 1968 meeting after his untimely death. Paul Thomas adds “There were a number of memorable scientists that attended these early meetings. Of course, most were those that fit the „character‟ designation. These included Prof. T.O. Graham of Guelph, Ontario Canada, P.A. Young of Texas, Charlie John of J.H. Heinz Company and, of course, if you wanted to, you could include your dad “Scottie” in this group.” If you will indulge me I will add that as a boy interested mostly in sports I do have distinct memories of my father going to this meeting called the Tomato Breeders Round Table in Chicago in the winter. It was due to the Round Table in the name that it stuck with me over all the other types of meetings my father took off to. I always felt he had a good time at the meetings and although I‟m sure the fun was harmless it was probably best that my mother didn‟t know everything about the trips. Later, one of my fond memories was attending the TBRT in Culiacan, Mexico in 1978 with my father (& my mother who was also there).

The Future. With so many intriguing tomato problems yet to be solved the TBRT should thrive for many decades to come. This will depend on the next generations of tomato researchers accepting the „tomato baton‟ and carrying on the legacy briefly outlined here. From what I see from all the clever young people working on tomato the prospects for the TBRT are bright indeed.

11 FEATURE ARTICLE TGC REPORT 57, 2007 ______Table 1. Dates, locations, and hosts for meetings of the Tomato Breeders Roundtable. Year Date Location Chair 1955 Wooster, OH L. J. Alexander and E.F. Paddock 1956 West Layfayette, IN E.C. Stevenson (Purdue University) 19571 January Urbana, IL A. Thompson and (University of Illinois) McCollum 1957 August 8-9 Wooster, OH L.J. Alexander, et al. (The Ohio State Univ.) 1958 Summer Ithaca, NY H. Munger (Cornell University) 1959 February Cleveland, OH 1960 to 1967 February Chicago, IL La Salle Hotel 1968 Winter Homestead, FL J. Strobel (University of Florida) 1969 February Denver, CO 1970 February Chicago, IL Knickerbocker Hotel 1971 Unknown 1972 February Columbus, OH 1973 Bradenton, FL J.P. Crill (University of Florida) 1974 Unknown 1975 February San Francisco, CA 1976 February 12-13 Indianapolis, IN E. Tigchelaar (Purdue University) 1977 February 10-11 Toronto, Canada E.L. Cox 1978 McAllen, TX P. Leeper (Texas A&M) 1979 Ames, IA R.L. Clark (USDA) 1980 February 20-22 Culiacan, Mexico F.F. Angell 1981* February 16-20 Beltsville, MD A.K. Stoner and T.H. Barksdale 1983* March 7-10 Miami, FL R. Volin and M. Sherman 1985 March 6-8 Sacramento, CA J. Hewitt and (University of California) C. Cryder-Sower 1987 February 25-27 St. Louis, MO V.N. Lambeth (University of Missouri) 1988 February 29- March San Diego, CA M. Courtney 2 (Clemson University) 1989 Culiacan, Mexico 1991 February 18020 Windsor, Canada D.M. Smith and

12 FEATURE ARTICLE TGC REPORT 57, 2007 ______(H.J. Heinz Co.) V. Poysa 1992* April Sarasota, FL J. W. Scott and J.K. Brecht 1994 July 25-27 Fletcher, NC R.G. Gardner & P. Shoemaker 1995* September 11-14 Davis, CA R.T. Chetelat & M. (University of California) Cantwell 1997 October 12-14 Ithaca, NY S.D. Tanksley 1999** December 2-5 Detroit, MI D.M. Francis, S.A. Miller, & (The Ohio State Univ.) M. Ricker 2001 March 12-16 Antigua, Guatemala B. Heisey (Seminis Seed) 2003 April 27-30 Park City, UT M. L. Stevens (Brigham Young Univ.) 2004 October 17-20 Annapolis, MD J.R. Stommel (USDA, Beltsville) 2006* May 7-11 Tampa, FL J.W. Scott and (University of Florida) J.K. Brecht 2007 November 4-7 State College, PA M. Foolad (Penn State) 1 First meeting where the nameTomato Breeders Round Table was used * Meeting held in conjunction with Tomato Quality Workgroup ** Meeting held in conjunction with the Tomato Disease Workshop

Figure 1. The La Salle Hotel circa 1927, a major venue of the Tomato Breeders Round Table in the 1960s. It was demolished in 1976, for more information see http://chicago.urban-history.org/sites/hotels/lasalle.htm .

13 RESEARCH REPORTS TGC REPORT 57, 2007 ______Occurrence of Anthocyanin in Cultivated Tomato

Peter S. Boches and James R. Myers Department of Horticulture, Oregon State University, Corvallis, OR 97331 email: [email protected], [email protected]

Introduction

The cultivated tomato (Solanum lycopersicum) does not normally produce anthocyanins in fruit tissues (Jones et al., 2003). However, in the course of developing a high anthocyanin tomato cultivar at Oregon State University using genes introgressed from wild species, we have noticed several cultivated tomato lines (with no wild species apparently in their pedigrees) that produce anthocyanin in fruit tissues, especially in green shoulder (u+u+) genotypes. In this article we verify the presence of anthocyanin in these lines using UV-visible spectroscopy.

Materials and methods

Plant Materials Plant materials were assembled from various sources and field grown in 2006 and/or 2007 at the Oregon State University Vegetable Research Farm in Corvallis, Oregon (Table 1). Fruit of ‘Purple Smudge’ were grown by Amy Goldman in Rhinebeck, NY and shipped to Oregon for analysis. A segregating population of anthocyanin fruited seedlings of ‘Dafel’ (an F1 hybrid) were obtained from seed saved from a single plant in a seed lot that was segregating for plant type and fruit shape.

High anthocyanin breeding lines developed in our program and containing genes introgressed from wild species and non-anthocyanin containing tomatoes were included for comparison as well. The OSU high anthocyanin lines were created by crossing the accessions LA3734A (containing vio, a radiation induced mutant with high anthocyanin stems and veins), LA3736 (containing atv, a gene introgressed from S. cheesmanii LA0434 that causes high anthocyanin in stems and leaves), LA1996 (containing Aft, a gene introgressed from S. chilense that causes anthocyanin accumulation in the fruit), and LA3668 (containing Abg, an anthocyanin fruit gene introgressed from S. lycopersicoides). Although most of our stable high anthocyanin lines (e.g. P20) have LA3668 (Abg) in their pedigree, they probably do not contain Abg, since Abg can not be maintained in a homozygous state due to an inversion on the lower arm of chromosome 10 in S. lycopersicoides relative to S. lycopersicum (Canady et al., 2006).

Anthocyanin Extraction and Measurement The most highly pigmented fruit from a given line or F2 individual were selected for analysis. For stable breeding lines and named cultivars, each fruit was taken from a separate plant. For F2 individuals, multiple fruit from a single plant were sampled. In 2006, extractions were performed on frozen fruit. In 2007 extractions were performed on fresh fruit. In general, ripe fruit were selected for extraction. However, for ‘Purple Smudge’ and the ‘Dafel’ segregant progeny, extractions were performed on both ripe and green fruit.

Anthocyanins were extracted in acidified methanol using a micro-prep method. Briefly, all pigmented tissue (including the epidermis and some of the pericarp, referred to hereafter as ‘peel’) was removed

RESEARCH REPORTS TGC REPORT 57, 2007 ______from single fresh fruit and ground into a fine powder with liquid nitrogen in a mortar and pestle. Fruits were weighed before and after removing the peel to determine the total amount of pigmented tissue. A weighed sub-sample of the homogenized powder was extracted overnight in 300 µl of 1% HCl methanol at 5° C. For the material grown in 2006, a 100-300 mg sub-sample weighed to the nearest 10 mg was used. In order to increase the accuracy of the procedure, in 2007 a 75-150 mg subsample weighed to the nearest 0.1 mg was used. The extraction volume was brought to 500 µl with nanopure water and 500 µl of chloroform was added to the tube. The tubes were centrifuged for 5 minutes at 14,000 rpm and the aqueous phase was removed to a new tube. The presence of anthocyanins was verified by reading absorbance of the samples from 220-750 nm.

Monomeric anthocyanin content was measured using the pH differential method as described by Giusti and Wrolstad (2001). For the pH differential method, the samples were diluted 1:5 with the pH buffer and absorbance was read at an observed λvis-max of 540 nm. The predominant anthocyanin in tomato fruit has previously been reported to be petunidin-3-(p-coumaryl)-rutinoside-5-glucoside (Mes, 2004). For the calculation of the monomeric anthocyanin pigment content, a molecular weight of 934 and a molar absorptivity (ε) of 17000 was used, corresponding to petunidin-3-(p-coumaryl)-rutinoside- 5-glucoside in acidified methanol (Price and Wrolstad, 1995). Milligrams anthocyanin per 100 grams of pigmented tissue (peel) on a fresh weight basis was calculated as ((mg/L extract * total volume of extract)/grams peel sampled)*100. Milligrams anthocyanin per 100 grams whole fruit was calculated as (((mg/g peel)*(peel weight in g))/total fruit weight in g)*100.

Results and Discussion

The spectral characteristics of anthocyanin extracts from several tomato cultivars clearly showed that some cultivated tomatoes produce small amounts of anthocyanin in the fruit (Figure 1). In tomato cultivars with very small amounts of visible anthocyanin, such as ‘Yellow Pear’ and ‘Oregon Spring’, an absorbance peak at 540 nm was present but only weakly visible (not shown). In cultivars with modest amounts of anthocyanin such as the ‘Purple Smudge’ (Fig. 1B) and ‘Dafel’ segregant progeny (Fig. 1C), the peak at 540 nm matched that of the high anthocyanin genotype P20 x hp-2dg (Fig. 1A) and clearly differed from the profile of an extract of a tomato with the aa (anthocyanin absent) phenotype (Fig. 1D) or that of ‘Legend’ (not shown).

Monomeric anthocyanin contents of the tomato fruit extracts (Table 2) were comparable to those reported by Mes (2004) and Jones et al. (2003) for tomato skin. Mes reported an average value of 13 mg/100 g FW skin for Aft-/atvatv genotypes, and a maximum value of 300 mg/100 g FW skin for Abg- /atvatv genotypes. The value reported by Mes (2004) for Aft-/atvatv skin was lower than that reported by Jones et al. (2003) for Aft skin (~20-60 mg/100 g FW). Mes attributed these differences to the extraction method, which included more of the pericarp tissue in Mes’ extractions. The extraction procedure used here was probably more similar to that of Mes (2004). The value reported here for Aft skin (~30 mg/100 g FW peel) is intermediate between the two. The value reported here for Abg- /atvatv genotypes (84 mg/100g FW peel) is lower than that reported by Mes (2003).

None of the anthocyanin containing cultivars or their segregants had levels of anthocyanin higher than LA1996 (Aft). However, the anthocyanin content of ‘Purple Smudge’ (20 mg/100g FW peel) and the ‘Dafel’ segregant (14.07 mg/100 g FW peel) were close to LA1996 (27.02 mg/100 g FW peel) and the difference was not significant. There was a high coefficient of variation (e.g. ~8-60% for the mean

RESEARCH REPORTS TGC REPORT 57, 2007 ______mg/100 g peel in the 2006 data set) in the monomeric anthocyanin content of fruit extracts. This is a common issue in the analysis of plant secondary metabolites (Sumner et al., 2003) and was expected because anthocyanin accumulation in tomato fruit is highly dependent on exposure to light. Sumner et al. (2003) suggest that the average biological variance in plant metabolites for Medicago truncatula is 50%. The lines selected for high anthocyanin accumulation in our program (e.g. P20) typically have a very sparse canopy to allow good light penetration to the fruit. Smaller fruited types (e.g. P4 x ‘Sungold’ small fruited F2) were very high in anthocyanin on a whole fruit basis as a result of their increased surface area:volume ratio, as previously reported by Mes (2003).

The ‘Dafel’ segregant and its progeny are characterized by a very strong green shoulder, sometimes with streaks that descend midway down the fruit. In addition, the green fruit appear to be higher in anthocyanin than ripe fruit, similar to the anthocyanin accumulation pattern observed in some pepper cultivars such as ‘Riot’ or ‘Marbles’. Seed from the ‘Dafel’ segregant was planted in 2007 and the population varied significantly in the amount of green shoulder present on individual plants. Anthocyanin expression was correlated with the degree of green shoulder present, with anthocyanin expression limited to the green shoulder. Anthocyanin expression is limited to the green shoulder in ‘Oregon Spring’ as well. We have also noticed a correlation between green shoulder and anthocyanin expression in material derived from Aft and atv, such as P20. Further work on this topic by our lab may include HPLC analysis of the anthocyanin extracts from tomato cultivars such as ‘Purple Smudge’, ‘Dafel’ segregants, and ‘Oregon Spring’ and allelism tests between these cultivars and known anthocyanin fruit genes.

Acknowledgements: We expression our appreciation of the Baggett-Frazier Endowment in support of this research.

Literature Cited: Canady M.A., Ji Y., and Chetelat, R.T., 2006. Homeologous recombination in Solanum lycopersicoides introgression lines of cultivated tomato. Genetics 174: 1775-1788. Giusti M.M. and Wrolstad R.E., 2001. Unit F1.2.1-13. Characterization and measurement of anthocyanins by UV-visible spectroscopy. In: Current Protocols in Food Analytical Chemistry. R.E. Wrolstad (ed). John Wiley & Sons, NY. Jones C.M., Mes P., Myers J.R., 2003. Characterization and inheritance of the Anthocyanin Fruit (Aft) tomato. Journal of Heredity, 94:449-56. Mes P., 2004. Breeding tomatoes for improved antioxidant activity. PhD Thesis. Oregon State University. Price C.L., and Wrolstad R.E., 1995. Anthocyanin pigments of Royal Okanogan Huckleberry juice. Journal of Food Science 60: 369-374. Sumner L.W., Mendes P., Dixon R.A., 2003. Plant metabolomics: large scale phytochemistry in the functional genomics era. Phytochemistry 62:817-836.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Table 1. Plant materials used in this study. Seed Sources are as follows: Johnny’s = Johnny’s Selected Seeds, Winslow, ME; Nichols = Nichols Garden Nursery, Albany, OR; OSU = Oregon State University vegetable breeding program; Amy Goldman = Amy Goldman, pers. comm.; TGRC = Tomato Genetic Resources Center, Davis, CA.

Breeding line or cultivar Source Description ‘Dafel’ segregant and Johnny’s Anthocyanin containing segregant from ‘Dafel’ progeny and its progeny, strong streaked green shoulder (u+u+), anthocyanin fading somewhat as fruit ripens. ‘Yellow Pear’ Nichols Uniform ripening (uu) type with occasional anthocyanin in fruit, especially under stress. ‘Legend’ OSU Anthocyaninless, uniform ripening (uu), OSU developed cultivar. Used as anthocyanin free check in 2006. ‘Oregon Spring’ OSU Green shoulder (u+u+) OSU cultivar that commonly develops small amounts of anthocyanin in fruit, especially under stress. ‘Purple Smudge’ Amy PI 290858, LA2378. Cultivar that develops Goldman anthocyanin in crown, a trait that is reportedly without simple Mendelian inheritance. P13 OSU Unstable high anthocyanin breeding line developed by crossing Abg x (atv or vio), individuals expressing a strong Abg phenotype were sampled. P20 OSU Stable high anthocyanin line developed by crossing [Abg x (atv or vio)] x [atv x Aft], stable F4 individuals were sampled. P20 x ‘Sweet Baby Girl’ OSU F2 selection from a P20 x ‘Sweet Baby Girl’ F2 (Seminis) cross. P20 x LA1194 (‘aa’ F2) OSU F2 selection from a P20 x LA1194 cross displaying the ‘aa’ (anthocyanin absent) phenotype. dg P20 x hp-2 OSU F2 individuals from a P20 x (LA3005 x ‘Legend’) dg cross, selected for hp-2 and high anthocyanin phenotypes. P4 x ‘Sunsugar’ OSU F2 individuals from a (Abg x (atv or vio)) x ‘Sunsugar’ cross. P4 x ‘Sungold’ OSU F2 individuals from a (Abg x (atv or vio)) x ‘Sungold’ cross. P4 x ‘Sungold’ F2 small OSU F2 individual from a (Abg x (atv or vio)) x fruited ‘Sungold’ cross selected for very small fruit size. LA1996 (Aft) TGRC Stock Aft introgression line.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Table 2. Anthocyanin content of cultivated tomatoes and OSU high anthocyanin breeding lines as measured by the pH differential method. N= number of fruit sampled from separate plants, except for individual F2 plants where multiple fruit were sampled from a single plant; mean mg/100g peel = milligrams anthocyanin per 100 grams of pigmented tissue (peel) on a fresh weight basis; mean mg/100 g whole = milligrams anthocyanin per 100 grams whole fruit on a fresh weight basis; na= not available.

Mean mg/100 g Std Mean mg/100 Tomato Line or Cultivar N peel* dev g whole* Std dev Field Season 2006 P20 5 111.29a 8.69 3.63a 0.55 P13 9 83.68b 27.92 5.88a 3.67 b a P4 x ‘Sungold’ individual F2 small fruited 6 82.97 29.34 4.59 2.00 b,c a P4 x ‘Sungold’ individual F2 6 64.79 8.92 5.89 1.11 c,d a P4 x ‘Sunsugar’ individual F2 6 46.67 23.52 4.21 2.32 LA1996 (Aft) 6 27.02d 11.54 0.65b 0.20 ‘Dafel’ original segregant 3 14.07d,e 6.09 0.24b 0.08 ‘Oregon Spring’ 3 6.88d,e 1.75 0.13b 0.01 ‘Yellow Pear’ 6 2.61e 1.52 0.17b 0.09 ‘Legend’ 3 -0.03e 0.05 0.00b 0.00

Field Season 2007 dg a a P20 x hp-2 , multiple F2 plants 5 84.91 34.70 6.11 3.10 P20 2 78.13a 9.88 6.15a Na a a P20 x ‘Sweet Baby Girl’ individual F2 2 44.72 5.31 1.68 0.52 ‘Purple Smudge’ breaker fruit 1 20.00a Na 0.15a Na ‘Purple Smudge’ green fruit 2 18.12b 3.14 0.30b 0.06 ‘Dafel’ segregant progeny, green fruit 1 9.47b Na 0.15b Na ‘Dafel’ segregant progeny, red fruit 2 1.15b 0.56 0.02b 0.01 b P20 x LA1194 (‘aa’ F2) 1 0.04 Na na Na *Means sharing a superscript not significantly different, Fisher’s LSD, p=0.05.

RESEARCH REPORTS TGC REPORT 57, 2007 ______A B . .

C D

Figure. 1. Spectral characteristics of purified. anthocyanins from selected tomato lines. A. P20 X hp- dg dg 2 F2 individual, a high anthocyanin (Aft/atv/?Abg), high pigment (hp-2 ) breeding selection, absorbance at 540 nm= 1.303. B.‘Purple Smudge’, an anthocyanin containing cultivated tomato of uncertain origin, absorbance at 540 nm = 0.278. C. ‘Dafel’ segregant seedling, absorbance at 540 nm = 0.149. C. P20 X LA1194 ‘aa’ F2 segregant, an anthocyaninless tomato, absorbance at 540 nm = 0.003. Note differences in the scale of the absorbance axis for each inset in order to show detail.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Thifensulfuron susceptibility in tomatoes and possible linkage with blossom end rot

Jim Dick, Tomato Solutions, 23264 Mull Road, Chatham, Ontario, Canada N7M 5J4 [email protected]

Thifensulfuron (brand name Pinnacle in Canada) is a broadleaf herbicide registered on processing tomatoes in Canada. It is applied as an overall spray about 3-4 weeks after transplanting. Some hybrids and inbred lines are quite susceptible to the herbicide. An inbred line called N1069 was found to have about 10% susceptible plants. Except for the susceptibility to thifensulfuron, the plants were identical to the resistant plants. It was assumed therefore that a mutation had arisen spontaneously. Seed was saved from both resistant and susceptible lines and grown out to confirm resistance and susceptibility. The two lines bred true for either resistance or susceptibility with no segregation, and appeared exactly identical for all horticultural traits. The F1 hybrid was made between the two lines, and F2 seed was produced and grown out. The F2 population segregated for resistance and susceptibility in a 3:1 ratio indicating that there was a single recessive gene involved. Crosses made with another thifensulfuron susceptible inbred line called CC390 also indicated that a single recessive gene was involved. Hybrids using the susceptible N1069 crossed with resistant lines were all resistant. Under extremely dry conditions, it was found that the susceptibility to thifensulfuron was associated with susceptibility to blossom end rot in the N1069 inbred lines.

RESEARCH REPORTS TGC REPORT 57, 2007 ______

Co-dominant SCAR marker for detection of the begomovirus-resistance Ty-2 locus derived from Solanum habrochaites in tomato germplasm

Brenda E. Garcia1,3, Elaine Graham2, Katie S. Jensen1, Peter Hanson2, Luis Mejía3 and Douglas P. Maxwell1

1University of Wisconsin-Madison, Madison, WI 53706 2Asian Vegetable Research Center- the World Vegetable Center, Taiwan 3Universidad de San Carlos, Guatemala Email: [email protected]

Introduction: Begomoviruses are a major threat to tomato production in most sub-tropical and tropical regions (Anderson and Morales, 2005). These geminiviruses are transmitted by the whitefly (Bemisia tabaci) complex and thus, many management strategies have focused on use of insecticides. Integrated Pest Management strategies include virus-free seedlings, host-free periods, management of time and location of planting, and begomovirus-resistant hybrids (Salati et al., 2002). Breeding begomovirus-resistant hybrids has involved the introgression of resistance genes from wild tomato species. Hanson et al. (2000) mapped the introgression from Solanum habrochaites, which conditioned resistance to Tomato leaf curl virus, to the long arm of chromosome 11 between TG36 (84 cM) and TG393 (103 cM) in the breeding line H24. This resistance gene was designated Ty-2 (Hanson et al., 2006) and was reported to be associated with an introgression from TG36 (84 cM) to TG26 (92 cM). Maxwell and Mejía (2002, unpublished data) developed PCR primers from the sequence of the TG105A (90 cM) marker and amplified PCR fragments from the susceptible tomato, M82-1-8 (EU053434), H24 (EU053432) and S. habrochaites LA1223 (EU053433). Sequence alignments showed that H24 was nearly identical to the S. habrochaites and very different from M82- 1-8. Recently, Garcia and Maxwell (unpublished data) sequenced PCR fragments for the marker TG105A for begomovirus-resistant breeding lines with resistance derived from Solanum chilense and found that these lines had an introgression in this region (eg., Gc143-2, EU053431). This introgression was very different from the one in H24, and it might be an introgression for the I2 gene (91.5 cM), which is present in Gc143-2. Because of this potential confusion, it was decided to search for a better marker for the Ty-2 locus. PCR primers from the SGN website for T0302 (89 cM), C2- At5g25760 (89.5 cM), and Hba78A16T7 (89.7 cM) were used. This report describes two co-dominant SCAR markers developed from the sequence of the RFLP marker T0302 for lines with the Ty-2 locus.

PCR methods: DNA was extracted from fresh leaves of plants with PUREGENE® DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN) and DNA was adjusted to approximately 10 ng/µl. PCR parameters were for 25-µl reactions containing 2.5 µl 2.5 mM dNTPs, 5 µl 5x buffer, 2.5 µl 2.5 mM MgCl2, 0.1 µl (0.5 units) GoTaq DNA polymerase (Promega Corp., Madison, WI), 2.5 µl each forward and reverse primer at 10 μM, 2-5 µl of DNA extract, and water. PCR cycles were 94 C for 4 min, 35 cycles of 94 C for 30 sec, 55 C for 1 min or 53 C for 1.5 min, and 72 C for 1.5 min. These cycles were followed by 72 C for 10 min, and then the reaction was held at 4 C. PCR reactions were performed in the MJ DNA Engine PT200 Thermocycler™ (MJ Research Inc., Waltham, MA). PCR- amplified fragments were separated by gel electrophoresis with 1.5 or 2% agarose in 0.5 X TBE buffer and stained with ethidium bromide and visualized with UV light. ssDNA was digested in PCR reactions with shrimp alkaline phosphatase (Progmega Corp.) and exonuclease I (Epicentre,

RESEARCH REPORTS TGC REPORT 57, 2007 ______Madison, WI), and the PCR-fragments directly sequenced with Big Dye Sequencing Kit™ and analyzed by the Biotechnology Center, University of Wisconsin-Madison. The SGN primers for T0302 (T0302F/T0302R) and TY-2R1 were used at extension of 55 C and those for C2-At5g25760 (C2-11-89F/C2-11-89R), and Hba78A16T7 (BAC-11-89F/BAC-11-89R) were used at extension of 53 C. The SGN primers for T0302 are: TG0302F, 5’ TGGCTCATCCTGAAGCTGATAGCGC TG0302R, 5’ AGTGTACATCCTTGCCATTGACT A reverse primer was designed from the sequence of the T0302 fragment: TY-2R1, 5’ TGAT(T/G)TGATGTTCTC(T/A)TCTCT(C/A)GCCTG

Results and Discussion: Initial comparisons involved the susceptible line, M82-1-8 (ty-2/ty-2), and the resistant line, H24 (Ty-2/Ty-2). The PCR fragment sizes for the markers C2-At5g25760 and Hba78A16T7 were ca. 1.3 kb and 760 bp, respectively. Interestingly, the PCR primers for the T0302 marker gave ca. 800-bp and ca. 900-bp fragments for M82-1-8 and H24, respectively (Fig. 1, lane 2 and 4).

1 2 3 4 5 6 7

800

500

Fig. 1. PCR fragments with the Ty-2 locus primers for the T0302 marker. Lane 1, 100-bp marker (Promega Corp.); lane 2, M82-1-8 (susceptible), lane 3, TyQueen (hybrid, resistant to begomoviruses); lane 4, H24 (resistant to begomoviruses); lane 5, S. habrochaites LA0386; lane 6, S. habrochaites LA1777; lane 7, 100-bp marker.

The sequences for the three markers (T0302, Hba78A16T7, and C2_At5g25760) for the susceptible line M82-1-8 (EU046613, EU053430, EU053428, respectively) were different from the respective marker sequences from the resistant line H24 (EU046610, EU053429, EU053427, respectively). These results clearly indicated that H24 had an introgression at these three marker locations. Since the marker T0302 seemed to have the greatest potential as a SCAR marker for the Ty-2 locus, PCR fragments from two additional begomovirus-resistant lines (GIh902 and Gc143-2), which had begomovirus-resistance genes (Ty-1 and Ty-3 loci on chromosome VI, Maxwell et al., 2006) most likely derived from S. chilense, were sequenced. The sequences for GIh902 and Gc143- 2 for this T0302 fragments (792 bp) were identical to those of M82-1-8. This was in contrast to the sequences for the TG105A marker, where the Gc143-2 and GIh902 seqeunces were identical but different from the sequence for M82-1-8. Both Gc143-2 and GIh902 have tested positive for the I-2 gene and M82-1-8 tested negative for this gene (Salus and Maxwell, pers. com.). When the sequences for the T0302 PCR fragment for M82-1-8 and H24 (909 bp) were compared, there were 36 SNPs, and four indels (four indels of 1 nt, one of 2 nt, one of 3 nt, and one of 120 nt). The sequence for the T0302 marker from S. habrochaites LA0386 (909 bp, EU046611) was identical to the sequence from H24. The sequence for the T0302 marker (789 bp, EU046612) was also obtained for another accession, S. chilense LA2779, that has been used as a source of

RESEARCH REPORTS TGC REPORT 57, 2007 ______begomovirus-resistance genes (Agrama and Scott, 2006); and the T0302 sequence for LA2779 was different from those for both M82-1-8 and H24. Most notably, the 120-nt indel associated with the fragments from M82-1-8 and H24 was not present between the M82-1-8 and LA2779 sequences for T0302. These results support the presence of an introgression from S. habrochaites in H24 at this marker. This primer pair T0302F/T0302R produced two bands (800 and 900 bp) for the commercial hybrid TyQueen (Green Seeds Co., Vietnam), which is reported to have Tomato yellow leaf curl virus- resistance derived from Ty-2 gene. When tested in Guatemala in October 2006, TyQueen was moderately resistant to begomoviruses. When this primer pair was tested with additional germplasm with the Ty-2 locus from the Asian Vegetable Research and Development Center (AVRDC), CLN2460E gave the 900-bp fragment, and two lines that had shortened introgressions for the Ty-2 locus (P. Hanson, pers. com.) also gave one 900-bp fragment. Fifty-nine breeding lines and hybrids have been evaluated with these primers (T0302F/T0302R) and no unexpected results were obtained. A reverse PCR primer, TY-2R1, was designed from the alignment of the sequences for M82-1- 8 and H24 in order to produce smaller fragments for both the susceptible and resistant genotypes. The PCR primers T0302F/TY-2R1 gave a 600-bp fragment with two AVRDC lines with the Ty-2 locus, and a 450-bp fragment for three inbred lines and one hybrid all of which lacked the Ty-2 locus. Three F1 plants known to be heterozygous for the Ty-2 locus all gave three PCR fragments, 450, 600, and 700 bp (Fig. 2). The sequences of the 450- and 600-bp fragments were as expected. The 700-bp fragment is most likely a heteroduplex between the 450- and 600-bp fragments.

1 2 3 4 5 6 7 8 9 10 600 bp __

Fig. 2. Lane 1, 100 bp marker (Invitrogen, brighter band is 600 bp); Lane 2, AVRDC line with shortened Ty-2 introgression; Lane 3, H24; Lane 4, TY-Queen (Ty-2/Ty-2); Lane 4 and 5, F1 plants, Ty-2/Ty-2; Lane 7, susceptible HUJ-VF; Lane 8, TY172 and Lane 9, TY197, Lane 10, Shanty (Hazera Seeds). Note: TY172 and TY197 are resistant to begomoviruses, but lack the Ty-2 locus. HUJ-VF is an inbred line from Hebrew University of Jerusalem.

Conclusions: The two sets of primers, T0302F/T0302R and T0302F/TY-2R1, effectively detected the two genotypes, Ty-2/Ty-2 and Ty-2/Ty-2, and the T0302F/TY-2R1 primer set also gave clearer bands with the heterozygous plants than the T0302F/T0302R primers. No false positives were detected, when 59 inbred lines and hybrids were evaluated. But it is possible that this marker might not detect all lines that have the Ty-2 gene, since it is not known how closely linked this marker is to the Ty-2 gene. These T0302 primers are a better marker than a TG105A CAPS marker (Graham and Hanson, pers. com.), as the latter marker may also detect an introgression that might be associated with the I2 gene, and this would result in false positives.

Acknowledgements: This project was funded in part by USAID-CDR (TA-MOU-05-C25-037) and USAID-MERC (GEG—G-00-02-00003-00) grants to D. P. Maxwell and by the College of Agricultural and Life Sciences at University of Wisconsin-Madison. Authors thank Dr. F. Vidavski, Hebrew University of Jerusalem, for providing the inbred lines, Ih902 (parent of GIh902), HUJ-VF, and M82-1- 8; and Dr. Moshe Lapidot, Volcani Center, for inbred lines TY172 and TY197.

RESEARCH REPORTS TGC REPORT 57, 2007 ______

Literature Cited: Agrama, H.A., and Scott, J.W. 2006. Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. J. Amer. Soc. Hort. Sci. 131:267-272. Anderson, P.K., and Morales, F.J., eds. 2005. Whitefly and whitefly-borne viruses in the tropics: Building a knowledge base for global action. CIAT publication no. 341, 351 p. Hanson, P., Green, S.K., and Kuo, G. 2006. Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Tomato Genetic Cooperative Report 56:17-18. Hanson, P.M., Bernacchi, D., Green, S., Tanksley, S.D., Muniyappa, V., Padmaja, A.S., Chen, H.M., Kuo, G., Fang, D., and Chen, J.T. 2000. Mapping of a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. J. Amer. Soc. Hort. Sci. 125:15-20. Maxwell, D.P., Garcia, B.E., Martin, C.T., Salus, M.S., Jensen, K.S., and Mejía, L. 2006. PCR-based methods for tagging begomovirus-resistance genes in tomatoes. www.plantpath.wisc.edu/GeminivirusResistantTomatoes/Markers Salati, R., Nahkla, M.K. Rojas, M.R., Guzman, P., Jaquez, J., Maxwell, D.P., and Gilbertson, R.L. 2002. Tomato yellow leaf curl virus in the Dominican Republic: Characterization of an infectious clone, virus monitoring in whiteflies, and Identification of reservoir hosts. Phytopathology 92:487-496.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Co-dominant SCAR Markers for Detection of the Ty-3 and Ty-3a Loci from Solanum chilense at 25 cM of Chromosome 6 of Tomato

Yuanfu Ji1, Melinda S. Salus2, Bram van Betteray3, Josie Smeets3, Katie S. Jensen2, Christopher T. Martin2, Luis Mejía4, Jay W. Scott1, Michael J. Havey5, and Douglas P. Maxwell2

1University of Florida, IFAS, Gulf Coast Research & Education Center, 14625 CR 672, Wimauma, FL 33598 2University of Wisconsin-Madison, Dept. of Plant Pathology, 1630 Linden Dr., Madison, WI 53706 3Nunhems BV, PO Box 4005, 6080 AC Haelen, The Netherlands 4Universidad de San Carlos, Ciudad de Guatemala Zona 12, Guatemala 5University of Wisconsin-Madison, Dept. of Horticulture, Madison, WI and U.S. Dept. Agr. Email: [email protected]

Breeding for resistance to begomoviruses in tomato can be greatly aided by the availability of PCR-based markers for the various resistance loci. Four begomovirus-resistance loci or regions have been mapped to chromosome 6 (Agrama and Scott, 2006; Chagué et al., 1997; Ji and Scott, 2006b; Ji et al., 2007; Zamir et al., 1994). The Ty-1 locus, which is part of the introgression derived from Solanum chilense LA1969, is located between markers TG297 (4 cM) and TG97 (8.6 cM) (Zamir et al., 1994). Agrama and Scott (2006) reported three regions that contributed to resistance in breeding lines with introgressions from S. chilense LA2779 or LA1932. One region corresponded to the region having the Ty-1 locus. Another region was the Ty-3 locus, which was mapped to a region between cLEG-31-P16 (20 cM) and T1079 (27 cM) (Ji and Scott, 2006b; Ji et al., 2007). The third region was near the self-pruning (sp) and potato leaf (c) loci. Another begomovirus-resistance QTL, derived from an introgression from S. pimpinellifolium, was mapped near the marker TG153 (33 cM; Chagué et al., 1997). Previously, Ji and Scott (2006a, 2006b; Ji et al., 2007) reported the development of SCAR and CAPS markers linked to begomovirus resistance genes derived from S. chilense on chromosome 6, and they determined that the Ty-3 locus mapped to a region that included the FER locus (25 cM, BAC clone 56B23, AY678298). Jensen and Maxwell (Maxwell et al., 2007) found that the sequences for the G8 gene of the BAC clone 56B23 are different for lines derived from LA2779 and LA1932. To differentiate the two introgressions, the one from LA2779 is designated Ty-3 and the one from LA1932, Ty-3a. This report describes two sets of PCR primers that provide co-dominant SCAR markers for detection of the Ty-3 and Ty-3a introgressions.

Primer Design: Initially, PCR primers were designed to amplify sequences near the 5’ end of the BAC clone 56B23. These primers were used to amplify PCR fragments from the begomovirus-susceptible heritage tomato, S. lycopersicum ‘Purple Russian’, and a begomovirus-resistant breeding line, Gc43- 3, from the tomato breeding program at San Carlos University, Guatemala with an introgression in this region from S. chilense LA2779 (Mejía et al., 2005). These sequences were aligned, and forward and reverse primers designed from conserved regions: forward primer FLUW-25F (5’ CAAGTGTGCATATACTTCATA(T/G)TCACC) and reverse primer, FLUW-25R (5’ CCATATATAACCTCTGTTTCTATTTCGAC). As expected, these primers gave PCR fragments for S. lycopersicum and the S. chilense introgression of 475 and 641 bp, respectively. A third primer pair was designed to give smaller PCR fragments from the aligned sequences of the FLUW25 fragment

RESEARCH REPORTS TGC REPORT 57, 2007 ______for the forward primer and sequences 3’ of the FLUW-25R primer for the reverse primer: forward primer, P6-25-F2, 5’ GGT AGT GGA AAT GAT GCT GCT C, and reverse primer, P6-25-R5, 5’ GCT CTG CCT ATT GTC CCA TAT ATA ACC. The P6-25-F2/P6-25-R5 primers were expected to give fragment sizes for S. lycopersicum and the S. chilense LA2779 introgression of 320 bp and 453 bp, respectively.

DNA Extraction and PCR Methods: DNA was extracted from fresh leaves of plants with PUREGENE® DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN) and DNA adjusted to approximately 10 ng/µl. PCR parameters were for 25-µl reactions containing 2.5 µl 2.5 mM dNTPs, 5 µl 5x buffer, 2.5 µl 2.5 mM MgCl2, 0.1 µl (0.5 units) GoTaq DNA polymerase (Promega Corp., Madison, WI), 2.5 µl each forward and reverse primer at 10 μM, 2-5 µl of DNA extract, and water. PCR cycles were 94 C for 4 min, 35 cycles of 94 C for 30 sec, 53 C for 1 min, and 72 C for 1 min. These cycles were followed by 72 C for 10 min, and then the reaction was held at 4 C. PCR reactions were performed in the MJ DNA Engine PT200 Thermocycler™ (MJ Research Inc., Waltham, MA). PCR-amplified fragments were separated by gel electrophoresis with 1.5% agarose in 0.5 X TBE buffer, stained with ethidium bromide, and visualized with UV light. ssDNA was digested in PCR reactions with shrimp alkaline phosphatase (Promega Corp.) and exonuclease I (Epicentre, Madison, WI) and the PCR-fragments were directly sequenced with Big Dye Sequencing Kit™ and analyzed by the Biotechnology Center, University of Wisconsin-Madison.

Results and Discussion: The FLUW-25 primer pair amplified fragments of 480 bp and 640 bp from the susceptible line S. lycopersicum Heinz 1706 and from the begomovirus-resistant breeding line, Gc43-3, with an introgression from S. chilense LA2779, respectively. Surprisingly, the Gh25-3 breeding line, which was derived from the begomovirus-resistant line Ih902 (see line 902 in Vidavsky and Czosnek, 1998) with resistance reported to be from an introgression from S. habrochaites, also gave a 640-bp fragment. The heterozygous plant, Gh228-1, with resistance from Ih902, gave the two sizes, 480 and 640 bp, for the Ty-3/ty-3 genotype (Fig. 1).

1 2 3 4 5 6 Fig. 1. PCR fragments with primers FLUW25F/FLUW25R; Lane 1, 100-bp marker, 600 bp --- Invitrogen, bright band, 600 bp; Lane 2, water control; Lane 3, Gc43-3 (resistant); Lane 4, Gh228-1 (resistant, heterozygous); Lane 5, Gh25-3 (resistant); Lane 6, Heinz 1706 (susceptible).

The sequences for the FLUW25-PCR fragments from Heinz (475 bp) and Gc43-3 (641 bp) were aligned; and there were 18 SNPs and 5 indel differences (Maxwell et al., 2007). Single indels of 3, 6, 42, and 143 nt and two indels of 5 nt were present. The sequence for the fragment from Heinz had 100% nt identity with the sequence of the comparable region of the BAC clone 56B23. In another susceptible line, M82-1-8, the sequence for the 475-bp fragment was identical to that of Heinz. Surprisingly, the sequence for the 640-bp fragment from Gh25-3 with resistance from Ih902 had 100% nt identity with the fragment from Gc43-3. The two fragments from Gh228-1 had 100% nt identity with the 475- and 641-bp fragments from Heinz and Gc43-3, respectively. Additionally, the sequence of the 640-bp fragments from 11 other begomovirus-resistant breeding lines with resistance

RESEARCH REPORTS TGC REPORT 57, 2007 ______from either S. chilense LA2779 or Ih902 had 99-100% nt identity with Gc43-3. These FLUW25 primers were used to evaluate the presence of the Ty-3 locus in 102 breeding lines from the tomato breeding program at San Carlos University, Guatemala (Mejía et al., 2005), and the results were as expected except for the Gc171 line. This line was known to have an introgression, Ty-3a, in this region derived from S. chilense LA1932, but no PCR fragment was amplified by these primers. van Betteray and Smeets (unpublished) determined that the FLUW25R primer did not anneal to S. chilense LA1932 sequences. Thus, several more reverse primers were designed from the same area of the BAC clone 56B23 sequence. These were evaluated with Gc171 or lines selected from Gc171 crosses. One primer, P6-25-R5, gave fragments with FLUW25F for S. chilense LA1932 derived lines. An additional primer set, P6-25-F2 and P6-25-R5, was designed to include the 143-nt ty-3/Ty-3 indel and to give smaller fragments than the FLUW25 primer set (Fig. 2). With begomovirus-resistant breeding lines derived from either the S. chilense LA2779 source, Gc9, or the Ih902 line (Vidavsky and Czosnek, 1998), the expected 450-bp Ty-3 fragment was obtained. A 320-bp ty-3 fragment was amplified from breeding lines lacking the introgression from either of these two begomovirus- resistance sources. A 630-bp Ty-3a fragment was obtained from lines derived from S. chilense LA1932, such as Gc171. Heterozygous hybrids were easily detected with these primers which amplified two fragments corresponding to the S. lycopersicum ty-3 fragment (320 bp) and either the Ty-3 (450 bp) or the Ty-3a (630 bp) fragment (Fig. 2). No F1 hybrids were available to test for fragments with the Ty-3/Ty-3a genotype, but it is expected that this primer pair would also amplify two fragments (450 and 630 bp) with this genotype. 1 2 3 4 5 6 7

500 bp ---

Fig. 2. PCR fragments with primers P6-25-F2/P6-25-R5. Lane 1, 100-bp Brenchtop DNA ladder, Promega; Lane 2, M82-1-8 (ty-3/ty-3); Lane 3, Gc9 (Ty-3/Ty-3); Lane 4, Romelia, F1 hybrid, (Ty-3/ty-3); Lane 5, Gc171 (Ty-3a/Ty-3a); Lane 6, GTc191-3, F1 hybrid, (Ty-3a/ty-3); Lane 7, 100-bp marker.

The three sizes of the P6-25-F2/P6-25-R5 fragments were sequenced (Maxwell et al., 2007). The 320-bp and the 450-bp fragments corresponded to the sequences of S. lycopersicum and of the Ty-3 locus associated with lines derived from S. chilense LA2779, respectively. The 650-bp fragment from Gc171 had two large inserts, when compared with the S. lycopersicum sequence.

Conclusions: These two sets of primers detect co-dominant SCAR markers, FLUW25 and P6-25, for the ty-3, Ty-3 and Ty-3a loci. It is not known how closely these markers are to the functional Ty-3 gene (Ji et al., 2007), so it is possible that some breeding lines would give false negative or false positive results. It is expected that these markers will be evaluated in various tomato breeding programs.

Acknowledgements: This project was funded in part by USAID-CDR (TA-MOU-05-C25-037) and USAID-MERC (GEG—G-00-02-00003-00) grants to D. P. Maxwell, by the College of Agricultural and Life Sciences at University of Wisconsin-Madison, and by grants from Unilever Bestfoods Ltd. and the Florida Tomato Committee to J. W. Scott.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Literature Cited: Agrama, H.A., and Scott, J.W. 2006. Quantitative trait loci for tomato yellow leaf curl virus and tomato mottle virus resistance in tomato. J. Am. Hortic. Sci. 131:267-272. Chagué, V., Mercier, J.C., Guenard, M., de Courcel, A., and Vedel, F. 1997. Identification of RAPD markers linked to a locus involved in quantitative resistance to TYLCV in tomato by bulked segregant analysis. Theor. Appl. Genet. 95:671-677. Ji, Y., and Scott, J.W. 2006a. Development of breeder friendly markers for begomovirus resistance genes derived from L. chilense. Proc Tomato Breeders Table, Tampa, FL, USA. roundtable06.ifas.ufl.edu/Schedule.htm Ji, Y. and Scott, J.W. 2006b. Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6. Rept. Tomato Genetics Coop. 56:22-25. Ji, Y., Schuster, D.J., and Scott, J.W. 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol. Breeding 20:271- 284 Maxwell, D.P., Martin, C.T., Garcia, B.E., Salus, M.S., Jensen, K.S, Havey, M.J. and Mejia, L. 2007. Markers for tomato chromosomes. www.plantpath.wisc.edu/GeminivirusResistantTomatoes Mejía, L., Teni, R.E., Vidavski, F., Czosnek, H., Lapidot, M., Nakhla, M.K., and Maxwell, D.P. 2005. Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala. Acta Hort. 695:251-255. Vidavsky, F., and Czosnek, H. 1998. Tomato breeding lines immune and tolerant to tomato yellow leaf curl virus (TYLCV) issued from Lycopersicon hirsutum. Phytopathology 88:910-914. Zamir, D., Michelson, I., Zakay, Y., Navot, N., Zeidan, N., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., van-Oss, H., Kedar, N., Rabinowitch, H.D., and Czosnek, H. 1994. Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, Ty-1. Theor. Appl. Genet. 88:141-146.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Antioxidants in Faculty Tomatoes

N. Kedar

Antioxidants which are present in fruits and vegetables may help prevent cancer, arthritis and heart disease. Tomatoes also provide an important source of human nutrition because of their widespread consumption in fresh and processed forms (1). Research was performed at Harvard Medical School and other universities with yeast and mammals. Plant polyphenols (including sirtuins and resveratrol) were found to block cancer formation, promotion and progression in animals. Resveratrol has also been shown in numerous clinical trials to benefit heart disease and increasing HDL (beneficial) cholesterol. The scientists conclude that plant polyphenols increase the response to stressful conditions, decrease cancer and extend lifespan. Most of the above experiments were performed with yeast and with mice, large scale experiments with humans (7) are planned for 2007 and the researchers stress that resveratrol is also active in human cells – suggesting a potential for lengthening life and preventing or treating aging-related diseases in humans (2). It is also well known that coronary heart diseases (3) are low in southern France despite high intake of saturated fat – as a result of red wine consumption. Also, the incidence of cancer is supposed to be low because of resveratrol (C14H12O3) intake. The above materials are found in red wine, in vegetables (3) and peanuts. Nine commercial varieties of tomatoes – including Daniella – were tested in Spain for phenolic compounds, lycopene and antioxidant activity. The phenolic compounds were characterized as flavonoids (quercetin, kaempferol and nargingenin) and hydroxycinnamic acids. The antioxidant activity of tomato extracts varied with the tomato variety and the assay method used (4). The antioxidant activity of tomatoes is discussed and the experimental methods are described. The varieties are unknown in Israel except for Daniella. Commercial cooked tomato paste containing naringenin, one of the most abundant polyphenols in tomato, was tested in Italy for antioxidant activities (5). The research demonstrated, that lycopene with polyphenols enhances antioxidant properties and the results support the hypothesis that tomato benefits could be attributed to a positive synergistic action in vivo between lycopene and other constituents such as naringenin. In a recent, most interesting study on antioxidants in tomato as a function of genotype, 12 tomato varieties were tested (6). Among those varieties phenolic content was highest in the Israeli cherry cv 818, which is a cv. 139 type with added disease resistance, excellent taste and the ripening inhibitor gene nor. The second best was cv. 124 BR cherry also containing the nor long shelf life gene. In this study, phenolic content of the tomato peel was higher than the pulp. Antioxidant activity of genotypes is given in Fig. 3 in paper 3. This research showed the high potential of our cherry varieties, containing high levels of antioxidants. Our conclusions are:  There is little doubt that tomato polyphenols and lycopene have beneficial health effects.  Our cherry cvs., bred about 20 years ago, are high in polyphenols.  The new cherry cvs. 1335 and 1339 bred by Frida – as well as many new genetic types should be tested for polyphenol content.  The results will be important for human health – as well as for large scale marketing of fruits and seeds

RESEARCH REPORTS TGC REPORT 57, 2007 ______Literature: (1) Finely, J.W. 2005. Proposed criteria for assessing the efficiency of cancer reducing by plant foods. Ann. Bot. 95:1075-1096. (2) Howiz et al. 2005. Small molecule activators of sinuins extend Accharomyces cetevisiae lifespan. Nature 425:191-196. (3) Renaud, S., de Largeril, M. 1992. Wine, alcohol, platelets and the French paradox for coronary diseases. Lomet 339:1523-1526. (4) Martinez-Valverde, I. et al. 2002. Phenolic compounds, lycopene and antioxidant activity in commercial varieties of tomato (Lycopersicum esculentum). J. Sci. Food Agric. 82:323-330. (5) Bugianesi, R. et al. 2002. Naringenin from cooked tomato paste is bioavailable in men. J. Nutr. 132:3349-3352. (6) Binoy, G. et al. 2004. Antioxidants in tomato (Lycopersicum esculentum) as a function of genotype. Food Chem. 84:45-51. (7) Sinclair, D. and Komaroff, A.L. 2006. Can we slow aging? Newsweek 24: 57-59.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Evaluation of PCR-based markers for scanning tomato chromosomes for introgressions from wild species

Christopher T. Martin1, Melinda S. Salus1, Brenda E. Garcia1,2, Katie S. Jensen1, Luis Montes1,2, Carolina Zea1,2, Sergio Melgar1,2, Khadija El Mehrach1,3, Julieta Ortiz1,2, Amilcar Sanchez1,2, Michael J. Havey4, Luis Mejía1,2, and Douglas P. Maxwell1

1Department of Plant Pathology, University of Wisconsin-Madison, Madison, WI 53706 2Universidad de San Carlos, Guatemala City, Guatemala 3Université Ibn Zohr, Agadir 80000, Morocco 4Department of Horticulture, USDA, University of Wisconsin-Madison, WI 53706 Email: [email protected]

Introduction: Marker-assisted breeding can increase the efficiency of introducing disease resistance into tomato breeding lines (Foolad and Sharma, 2005; Scott, 2005). Excellent chromosome maps of markers are available on the SGN web site (www.sgn.cornell.edu), and these genetic maps have RFLP, SSRs, BAC clones, cDNAs, CAPS, ESTs, and COSII markers. The objective of our project was to locate introgressions associated with begomovirus-resistance genes in germplasm from the tomato breeding program at San Carlos University, Guatemala (Mejía et al., 2005). PCR fragments were amplified using primers for markers from the SGN web site, if available, and by designing primers, if not. These PCR fragments were directly sequenced, and the sequence of fragments from begomovirus-resistant inbred lines were compared with each other and the corresponding fragments from susceptible lines. The presence of SNPs or indels in fragments from resistant-inbred lines was assumed to indicate an introgression from a wild species.

Germplasm tested: Begomovirus-resistant inbred lines used in this study were part of the tomato breeding program at San Carlos University, Guatemala City (Mejía et al., 2005). The original sources of begomovirus-resistance were hybrids or lines generously provided by colleagues from public institutions. Inbred lines derived from the hybrids (e.g., FAVI-9) provided by F. Vidavsky and H. Czosnek (1988), which had resistance genes introgressed from Solanum habrochaites LA1777 and/or LA0386, are designated G for Guatemala, then h for Hebrew University of Jerusalem (HUJ), and numbers for the cross and the selection, e.g., Gh25-3. The resistance genes in these lines originated from line 902 (Vidavsky and Czosnek, 1988). No introgressions had been detected in line 902 at the time (1998) the germplasm was received in Guatemala. P. Hanson, Asian Vegetable Research and Development Center, Taiwan, provided inbred line, H24, with resistance derived from the Ty-2 locus of S. habrochaites. This line was used solely as the standard for the introgression in chromosome 11 (Hanson et al., 2000, 2006). Three sources of begomovirus-resistance from S. chilense were obtained. J.W. Scott, University of Florida, provided begomovirus-resistant inbreds, Fla. 595-2 and Fla. 8348, derived from S. chilense LA2779 and LA2779/LA1932, respectively. These Florida inbreds have introgressions on chromosome 6 (Agrama and Scott, 2005; Ji and Scott, 2005, 2006; Ji et al., 2007). The lines Gc9 and Gc171 were selected from Fla. 595-2 and Fla. 8348, respectively. Gc9 was crossed with susceptible hybrids, and resistant-inbred lines were derived from these populations. These selections were designated G for Guatemala, then c for S. chilense, and numbers for the cross and the selection, e.g. Gc143-2. H. Czosnek, HUJ, provided TY52, an inbred with resistance from S. chilense

RESEARCH REPORTS TGC REPORT 57, 2007 ______LA1969. This line was used as the standard for the introgression for the Ty-1 locus on chromosome 6 (Zamir et al., 1994). Susceptible germplasm included M82-1-8 (Ve, F1, HUJ), Heinz 1706 (Ve, F1, Heinz Seeds), HUJ-VF (Ve, F1, HUJ), the heritage tomatoes, Purple Russian and German Pink, and the landrace of S. lycopersicum var. cerasiformae (cera), which was collected in Sanarate, Guatemala.

Results and Discussion: Primer information, sequence data and marker detection protocols for this report are available at the web site: www.plantpath.wisc.edu/GeminivirusResistantTomatoes/markers.html For several chromosomes, resistance-gene hot spots were selected as the most likely regions for detecting introgressions (Pan et al., 1999). Eighty-eight markers were evaluated on eight chromosomes. One, nine, two, one, one, and seven markers were amplified and sequenced from chromosomes 1, 2, 4, 7, 9, and 12, respectively. No evidence for introgressions from wild species was detected in begomovirus-resistant germplasm for these markers. For chromosomes 6 and 11, sequence data are reported for 38 and 15 markers, respectively, and introgressions at several markers were detected in the begomovirus-resistant germplasm. Chromosome 6, which is known to have various resistance genes (Agrama and Scott, 2006; Foolad and Shrama, 2005; Zamir et al., 1994), was studied most extensively. Markers at 5-cM intervals were amplified and sequenced. Gc9 (LA2779) and lines derived from Gc9 had an introgression from LE_HBa0037I09 (5 cM) to T0834 (32 cM). No introgression was detected from the top of the chromosome to T0270 (3.0 cM) or from marker TG365 (33.5 cM) to the bottom of the chromosome 6. Our results support the recent report by Ji et al. (2007) that some LA2779-derived inbreds similar to Gc9 had an introgression from 5.3 to 32 cM, which included the Ty-1 and Ty-3 regions. To determine if Gc9 had the Ty-1 locus, the sequence for the introgression at the Ty-1 locus (TG97, 8.5 cM, Zamir et al., 1994) of Gc9 was found to be identical to that for this region of line TY52 (Ty-1/Ty-1), and a CAPS marker was developed for this locus (Protocol I for Ty-1 locus). A SCAR marker (P6-6-F1/P6-6-R1 primers) was found at 5.5 cM for the S. chilense introgression in TY52 and some Gc9-derived lines, but this marker is not tightly linked to the Ty-1 gene (Protocol II for the Ty-1 locus). For the Ty-3 locus, FLUW25 and P6-25 (25 cM), co-dominant SCAR markers, were developed. Surprisingly, sequences of 17 markers from 6 cM (Mi23) to 32 cM (T0834) from lines derived from 902, which was derived from S. habrochaites (Vidavski and Czosnek, 1998), were identical to those from Gc9. This region included the loci for the Ty-1 and Ty-3 introgressions. One difference between 902-derived lines and Gc9 was that the REX-1 marker (ca. 5 cM) from 902- derived lines had sequences identical to that of the REX-1 marker from lines with the Mi-1.2 gene (introgressed from S. peruvianum) for resistance to root-knot nematode. Conversely, the sequence for the REX-1 marker for Gc9 was identical to that of TY52 (sequence from S. chilense). A co- dominant SCAR marker (Mi23, ca. 6 cM) for the Mi-1.2 gene was evaluated using primers developed by S. Seah and V. Williamson (per. com., University of California-Davis). This Mi23 SCAR marker is tightly linked to the Mi-1.2 gene and can be used as a CAPS marker for the Ty-1 locus in some lines (Protocol III for the Ty-1 locus). In addition, four sets of primers were designed from the REX-1 marker sequences from various wild species, and these could be used as internal control standards (ICON primers) in multiplex PCR. From this study of the markers for chromosome 6 with Gc9 and 902-derived lines, it is proposed that the order of markers in these lines is REX-1, Mi-1.2, acid phosphatase, Ty-1 and Ty-3. This order is supported by the observation that 902 has the REX-1 marker, but lacks the Mi-1.2 gene. Lines with only the Ty-1 marker (TG97) or the Ty-3 marker (FLUW25) were detected in 902-derived

RESEARCH REPORTS TGC REPORT 57, 2007 ______lines, and one line, Gh2, was homozygous for Rex-1, Mi23, Ty-1 (TG97) and Ty-3 (FLUW25) markers. As expected from the marker analysis, this line, Gh2, was resistant to root-knot nematode (bioassay by V. Williamson, Univ. of California-Davis) and also resistant to begomoviruses. Chromosome 11 is known to have an introgression from S. habrochaites for the Ty-2 gene between TG36 (84 cM) and TG26 (92 cM) (Hanson et al., 2000, 2006). Primers for four markers for this region were evaluated. Primers (T0302F/Ty-2R2) for the T0302 marker amplified different size fragments for susceptible and resistant genotypes (co-dominant T0302-Ty-2 SCAR Marker). Since the I-2 gene (91.5 cM) for resistance to Fusarium oxysporum f. sp. lycopersicum race 2 is closely linked to the Ty-2 locus, it was a concern that the T0302-Ty-2 SCAR marker might give a false positive with I-2/I-2 genotypes. Fortunately, no alien introgression was detected in lines that had the I-2 locus and lacked the Ty-2 locus. No lines with the Ty-2 and I-2 loci were available to test. For many markers, sequence is provided on the web site for various accessions of S. chilense, S. peruvianum, and S. habrochaites, e.g. REX-1, Mi23, FLUW25, T0834, and T0302.

Acknowledgements: This project was funded in part by USAID-CDR (TA-MOU-05-C25-037) and USAID-MERC (GEG—G-00-02-00003-00) grants to D. P. Maxwell and by the College of Agricultural and Life Sciences at University of Wisconsin-Madison. Authors thank colleagues who so generously provided germplasm and DNA samples. D.P. Maxwell and L. Mejía especially thank Dr. Uri Lavi, Volcani Center, Israel, for introducing us to SNPs and indels.

Literature Cited: Agrama, H.A., and Scott, J.W. 2006. Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. J. Amer. Soc. Hort. Sci. 131:267-272. Foolad, M.R., and Sharma, A. 2005. Molecular markers as selection tools in tomato breeding. Acta Hort. 695:225-240. Hanson, P.M., Bernacchi, D., Green, S., Tanksley, S.D., Muniyappa, V., Padmaja, A.S., Chen, H.M., Kuo, G., Fang, D., and Chen, J.T. 2000. Mapping of a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. J. Amer. Soc. Hort. Sci. 125:15-20. Hanson, P., Green, S.K., and Kuo, G. 2006. Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Rept. Tomato Genetic Cooperative 56:17-18. Ji, Y., and Scott, J.W. 2005. Identification of RAPD markers linked to Lycopersicum chilense derived begomovirus resistant genes on chromosome 6 of tomato. Acta Hort. 695:407-411. Ji, Y., and Scott, J.W. 2006. Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6. Rept. Tomato Genetics Coop. 56:22-25. Ji, Y., Schuster, D.J., and Scott, J.W. 2007. Ty-3, a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol. Breeding 20:271- 284 Mejía, L., Teni, R.E., Vidavski, F., Czosnek, H., Lapidot, M., Nakhla, M.K., and Maxwell, D.P. 2005. Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala. Acta Hort. 695:251-255. Pan, Q., Liu, Y.-S., Buadai-Hadrian, O., Sela, M., Carmel-Goren, L., Zamir, D., and Fluhr, R. 1999. Comparative genetics of nucleotide binding site-leucine rich repeat resistance gene homologues in genomes of two dicotyledons: Tomato and Arabidopsis. Genetics 105:309-322. Scott, J.W. 2005. Perspectives of tomato disease resistance breeding: past, present, and future. Acta Hort. 695:217-224.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Vidavsky, F., and Czosnek, H. 1998. Tomato breeding lines immune and tolerant to tomato yellow leaf curl virus (TYLCV) issued from Lycopersicon hirsutum. Phytopathology 88:910-914. Zamir, D., Ekstein-Michelson, I., Zakay, Y., Navot, N., Zeidan, M., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., van-Oss, H., Kedar, N., Rabinowitch, H.D., and Czosnek, H. 1994. Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, TY-1. Theor. Appl. Genet. 88:141- 146.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato

David L. Price1, Frederic D. Memmott1, Jay W. Scott2, Steve M. Olson3, Mikel R. Stevens1

1Brigham Young University, Department of Plant and Animal Sciences, 287 Widstoe Bldg. Box 25183, Provo, UT 84602-5183, email: [email protected]

2University of Florida, IFAS, Gulf Coast Research & Education Center, 14625 CR 672, Wimauma, FL 33598, email: [email protected]

3University of Florida, IFAS, North Florida Research & Education Center, 30 Research Road, Quincy, FL 32351-5684, email: [email protected]

Tomato spotted wilt virus (TSWV) is one of the most damaging pathogens in tomatoes (Solanum lycopersicum L.). In some areas of the world TSWV has become a limiting factor in tomato a b production (Canady et al., 2001). Several TSWV resistance genes have been identified (Sw1 , Sw1 , sw2, sw3, sw4, and Sw-5); however, Sw-5 is the only gene that has been broadly utilized in tomato breeding because of its durability to multiple tospoviruses (Boiteux and Giordano, 1992; Stevens et al, 1992). Additionally, we have tested UPV 32, which has TSWV resistance gene identified as Sw-6 (Roselló et al. 2001), with typical TSWV isolates and were unable identify this resistance in greenhouse screening conditions (Stevens, unpublished data). Although rare, there have been new TSWV isolates identified that overcome Sw-5 (Latham. and Jones, 1998; McMichael et al. 2002).

Tospovirus resistance from S. chilense has been identified by Stevens et al. (1994) and introgression from this species has demonstrated to be useful under field conditions (Canady et al., 2001). Furthermore, this germplasm has demonstrated resistance to isolates that overcome Sw-5 (Stevens, unpublished data). In a preliminary study, Scott et al., (2005) reported that resistance was controlled by one or two dominant genes. More recently we concluded that this resistance was conferred by a single dominant gene not linked to Sw-5 (Scott, Olson, and Stevens, unpublished data). This gene will tentatively be referred to as Sw-7. It is essential that linked molecular markers be identified to facilitate the deployment of Sw-7 in coordination with Sw-5. The objective in our BYU lab has been to identify molecular markers linked to this new source of tospovirus resistance.

Thirty-seven sister lines putatively containing Sw-7 (developed from F2 and BC1 plants suggesting TSWV resistance) are being used to identify the molecular markers. Eight of these selected F2 and 33 BC1 plants have undergone preliminary P AFLP analysis. Candidate markers suggesting linkage to Sw-7 have been tested using all 37 of the above mentioned lines in a second screening using the AFLP LI-COR 4300. Additionally, we have included seven Florida lines isogenic except for Sw-7. These Florida lines have undergone further crossing to elite tomato lines and thus have unique and more advanced genetic backgrounds compared to the lines used in our lab at BYU.

Our initial AFLP screenings of eight plants containing resistant/susceptible plants, along with the two parents, were screened with 256 primer combinations. Of the 256 primer combinations 16 resulted in

RESEARCH REPORTS TGC REPORT 57, 2007 ______the identification of 30 candidate markers. These 30 putative Sw-7 markers are being examined on our carefully screened 37 F2 and BC1 lines along with the seven field selected Florida lines.

One strong candidate AFLP marker has been identified (~200bp) in both the 37 greenhouse selected lines and the seven Florida field selected lines. This candidate marker is currently being prepared to be cloned and sequenced. We are hoping to use this marker to identify where in the tomato genome Sw-7 is located. Additionally, analysis with this marker is currently being conducted on a much larger TSWV resistant population derived from the same germplasm. Furthermore, we are continuing to evaluate the 29 additional AFLP markers identified in our initial marker screening. Several of these markers suggest looser linkage to Sw-7; however, our analyses of the complete set of these markers is incomplete. Development of these markers may allow us to stack Sw-7 with Sw-5 which may allow development of germplasm with broader and more stable resistance to tospoviruses.

Literature Cited Boiteux, L.S., and L.deB. Giordano. 1992. Screening Lycopersicon germplasm for resistance to a Brazilian isolate of spotted wilt virus (TSWV). Tom. Genet. Coop. Rep. 42:13-14. Canady, M.A., M.R. Stevens, M.S. Barineau, and J.W. Scott. 2001. Tomato spotted wilt virus (TSWV) resistance in tomato derived from Lycopersicon chilense Dun. LA 1938. Euphytica. 117:19-25. Latham, L.J., and R.A.C. Jones. 1998. Selection of resistance breaking strains of Tomato spotted wilt tospovirus. Ann. Appl. Biol. 133:385-402. McMichael, L. A., D.M. Persley, and J.E. Thomas. 2000. The first record of a serotype IV Tospovirus in Australia. Australas. Plant Pathol. 29:149. Roselló, S., B. Ricarte, M.J. Díez, and F. Nuez. 2001. Resistance to Tomato spotted wilt virus introgressed from Lycopersicon peruvianum in line UPV 1 may be allelic to Sw-5 and can be used to enhance the resistance of hybrids cultivars. Euphytica 119:357-367. Scott, J.W., M.R. Stevens, and S.M. Olson. 2005. An alternative source of resistance to Tomato spotted wilt virus. Tom. Genet. Coop. Rep. 55:40-41. Stevens, M.R., S. J. Scott, and R.C. Gergerich. 1992. Inheritance of a gene for resistance to Tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill. Euphytica 59:9-17. Stevens, M.R., S.J. Scott, and R.C. Gergerich. 1994. Evaluation of seven Lycopersicon species for resistance to Tomato spotted wilt virus (TVSW). Euphytica, 80:79-84.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Evaluation of a co-dominant SCAR marker for detection of the Mi-1 locus for resistance to root-knot nematode in tomato germplasm Stuart Seah1,4, Valerie M. Williamson1, Brenda E. Garcia2,3, L. Mejía3, Melinda S. Salus2, Christopher T. Martin2, and Douglas P. Maxwell2

1Department of Nematology, University of California, Davis, CA 95616 2Department of Plant Pathology, University of Wisconsin, Madison, WI 53706 3Universidad de San Carlos, Guatemala 4Current address: Commonwealth Scientific and Industrial Research Organisation (CSIRO) Entomology, Private Bag 5, Wembley, WA 6913, Australia Email: [email protected]

The Mi-1 resistance gene was introgressed into cultivated tomato from Solanum peruvianum in the 1940’s (Smith, 1944). This gene confers resistance against many isolates of the root-knot nematode species Meloidogyne incognita, M. javanica, and M. arenaria and is currently the only source of root-knot nematode resistance in modern tomato cultivars. The principle means for developing nematode-resistant tomato cultivars is by traditional breeding aided by marker-assisted selection to detect the Mi-1 gene. Co-dominant CAPS markers such as REX-1 (Williamson et al., 1994) and Cor-Mi (Contact Cornell University Foundation, Ithaca, NY) are widely used to assay for the Mi-1 gene in tomato. Although these markers are generally reliable, El Mehrach et al. (2005) found that both gave false positives for nematode resistance with germplasm derived from Ih902 (F1, F2, Ve), which has begomovirus-resistance genes reportedly introgressed from Solanum habrochaites (listed as 902 in Vidavsky and Czosnek, 1998), but is susceptible to root-knot nematode (V. Williamson, unpublished data). Ih902 is one of the main sources of begomovirus resistance in the tomato breeding program at San Carlos University (Mejía et al., 2005), and it is important to have a breeder-friendly marker that does not give false positive results. Therefore primers were designed that amplify a PCR fragment only if the Mi-1.2 gene, the functional gene for resistance (Milligan et al., 1998), is present. However, these primers do not distinguish homozygous and heterozygous plants (El Mehrach et al., 2005). Here we report evaluation of a co-dominant SCAR marker Mi-23 that is tightly linked to the Mi-1.2 gene.

Material and Methods Primers: The region on the short arm of chromosome 6 where the Mi-1 locus is located is well characterized genetically and physically (see Seah et al., 2004, 2007). The Mi-1 locus in both resistant and susceptible tomato consists of two clusters with three and four copies of Mi gene homologues, which in resistant tomatoes are separated by approximately 300 kb. Comparison of sequence downstream of Mi-1.2 with a conserved region from susceptible S. lycopersicum led to the development of primers (Mi23F and Mi23R) that flanked an indel within this conserved region (Seah and Williamson, unpublished). The sequence of Mi23F is 5’-TGG AAA AAT GTT GAA TTT CTT TTG-3’, and Mi23R is 5’- GCA TAC TAT ATG GCT TGT TTA CCC-3’. PCR protocol: DNA was extracted from fresh leaves of plants with PUREGENE® DNA Purification Kit (Gentra Systems, Inc., Minneapolis, MN) and DNA adjusted to approximately 10 ng/µl. PCR was carried out in 25-µl reactions containing 2.5 µl 2.5 mM dNTPs, 5 µl 5X buffer, 2.5 µl 2.5 mM MgCl2, 0.1 µl (0.5 units) GoTaq DNA polymerase (Promega Corp., Madison, WI), 2.5 µl each forward and reverse primer at 10 μM, 2-5 µl of DNA extract, and water. PCR cycles were 94 C for 3 min, the 35 cycles of 94 C for 30 sec, 57 C for 1 min, and 72 C for 1 min. These cycles were followed by 72 C

RESEARCH REPORTS TGC REPORT 57, 2007 ______for 10 min, and then the reaction was held at 18 C. PCR reactions were performed in the MJ DNA Engine PT200 Thermocycler™ (MJ Research Inc., Waltham, MA). Amplified fragments were separated by electrophoresis through 2% agarose in 0.5X TBE buffer, then stained with ethidium bromide, and visualized with UV light. For sequencing, ssDNA was digested in PCR reactions with shrimp alkaline phosphatase (Promega Corp.) and exonuclease I (Epicentre, Madison, WI), and the PCR fragments were directly sequenced with Big Dye Sequencing Kit™ and analyzed by the Biotechnology Center, University of Wisconsin-Madison. Germplasm: The lines M82-1-8 (Ve, F1) and Gh13 were used as the mi/mi genotypes (susceptible); these lines carried the S. lycopersicum sequence for the REX-1 marker (AY596779). Two lines, Motelle and Gh2, which are known to be homozygous for resistance to root-knot nematode (Mi/Mi genotype) have the S. peruvianum sequence for the REX-1 marker (AY729670). The F1 hybrid, Llanero (resistant to begomoviruses, GenTropic Seeds), which is heterozygous for nematode resistance (Mi/mi) (unpublished data), and Marwa (Ve, F2, N and tolerant to Tomato yellow leaf curl virus, Syngenta), which is presumed to be heterozygous for nematode resistance, were used as heterozygous controls. Other commercial F1 hybrids, which were determined to be heterozygous at the REX-1 locus by sequence analysis, were Celebrity (Seminis Seeds), Charanda (Vilmorin), Crista (Harris Moran), Dominique (Hazera Genetics), Tequila (Vilmorin), and Viva Italia (Harris Moran). Rodeo (Heinz) was homozygous at the Mi locus, as determined by the sequence of the REX-1 marker. Titrit (F1, F2, Ve, TMV, FCRR, Royal Sluis) is susceptible to RKN, but is tolerant to Tomato yellow leaf curl virus.

Results and discussion The susceptible genotypes M82-1-8 and Gh13 (mi/mi) and the resistant genotypes Motelle and Gh2 (Mi/Mi) gave PCR fragments of ca. 430 bp, ca. 380 bp (Fig. 1 or not shown), respectively, as expected for susceptible and resistant tomato. The PCR fragments from M82-1-8 and Gh2 were sequenced and a BLAST search performed at the National Center for Biotechnology Information. The 432-bp fragment (AY596779) from M82-1-8 had 100% nt identity with S. lycopersicum (cv. Heinz 1706, DQ863289) for nt 9,545-9,976, which is located between two resistance-like protein ORFs in cluster 2e. The 377-bp fragment from Gh2 had 100% nt identity with the Mi-1 locus from Motelle (AY729670, S. peruvianum introgression for Mi-1 locus) for nt 25,819-26,195 (U81378), which is located between the Mi-1.2 resistance gene and a pseudo-resistance gene (Mi-1.3) in cluster 1p. Thus, the sequence of the PCR fragments matched the areas of the S. lycopersicum and S. peruvianum genomes used to design the primers. When the two sequences were compared, there were indels of 1 nt and 56 nt, which accounted for the differences in the length of the two sequences. Besides these two indels, there were 13 SNPs between these two sequences. The heterozygous genotypes Llanero and Marwa gave three fragments, 380, 430 and 500 bp (Fig. 1), respectively. The third, slower moving PCR fragment from the heterozygous plants was hypothesized to be a heteroduplex between the two fragments (380 and 430 bp), which migrated more slowly due to the presence of a 56 nucleotide loop in the heteroduplex molecules. This hypothesis was supported by mixing approximately equal amounts of the 380 and 430-bp fragments and subjecting this mixture to the normal PCR cycle. Three bands of the same size as those from the heterozygous plant resulted from this treatment (Fig. 1, lane 5). When six commercial hybrids (Celebrity, Charanda, Crista, Dominique, Tequila and Viva Italia) with reported resistance to root-knot nematode were tested with the primers Mi23F/Mi23R, all hybrids had the three-banded pattern associated with heterozygous plants for the Mi-1 locus; and Rodeo gave the expected single 380-bp fragment for the homozygous genotype (Mi/Mi). Titrit, which lacked the Mi-1 locus gave the 430-bp

RESEARCH REPORTS TGC REPORT 57, 2007 ______fragment corresponding to that associated with the susceptible allele. The Mi23 primers were also tested on 73 breeding lines and hybrids for begomovirus resistance from the tomato breeding project at San Carlos University, Guatemala (Mejía et al., 2005), as well as on 31 other inbreds and hybrids, and unambiguous PCR patterns were obtained. Previously false positive results for the Mi-1 locus (nematode resistance) were obtained with two co-dominant CAPS markers, REX-1 and Cor-Mi, for the begomovirus-resistant breeding line, Ih902 (El Mehrach et al., 2005). The begomovirus-resistance Ty-1 locus is derived from Solanum chilense LA1969 and was mapped to the short arm of chromosome 6 (Zamir et al., 1994). The REX- 1 marker for the TY52 line, which is homozygous for Ty-1/Ty-1 (H. Czosnek, pers. com.), gives a distinct digestion pattern with TaqI restriction enzyme (three fragments, Milo, 2001). Thus, it was of value to test primers Mi23F/Mi23R with tomato lines that gave false positive REX-1 and Cor-Mi restriction digestion patterns, as well as lines known to have the S. chilense introgression for the Ty-1 locus. When Ih902, TY52, and 2 breeding lines (Gc9 and Gc143-2) with the Ty-1 locus were evaluated with the Mi23F/Mi23R primers, only one PCR fragment of 430 bp was obtained. This fragment size was approximately the same as in nematode-susceptible S. lycopersicum, and, thus, the fragment size correlated with the nematode susceptible phenotype of these lines. Sequences of PCR-fragments (EU033925) from the 4 lines were identical, and there were 16 SNPs and a 1-nt indel between this sequence and the sequence from susceptible S. lycopersicum (e.g., M82-1-8). These results indicate that primers Mi23F/R should be adaptable for detecting genotypes with the Ty-1 locus introgressed from S. chilense. This co-dominant SCAR marker has the advantage over previous PCR-based markers in that restriction enzyme digestion of the amplified product is not required, and it does not give false positive fragments with the begomovirus-resistant breeding lines derived from S. habrochaites (Vidavsky and Czosnek, 1998) and S. chilense (Ty-1 locus) (Agrama and Scott, 2006). Additionally, Mi23 may be useful for tomato breeders introgressing other traits located in the resistance gene cluster on the short arm of chromosome 6.

Acknowledgements: This project was funded in part by USAID-CDR (TA-MOU-05-C25-037) and USAID-MERC (GEG—G-00-02-00003-00) grants to D. P. Maxwell, by the College of Agricultural and Life Sciences at University of Wisconsin-Madison and University of California-Davis, and by the US Department of Agriculture’s National Research Initiative Competitive Grants Program (NRICGP; award #00-35300-9410) and the National Science Foundation Award IBN-872 3679 to V. Williamson. 1 2 3 4 5 600

400

Fig. 1. PCR with primers Mi23F/Mi23R. Lane 1, 100-bp marker (Invitrogen); lane 2, M82- 1-8; lane 3, Motelle; lane 4, Llanero (heterozygous), lane 5, equal amounts of the PCR fragments for M82-1-8 and Motelle mixed together and subjected to the standard PCR cycles. Note that three bands are present and that these correspond to the identical sizes of the bands from the heterozygous hybrid Llanero.

RESEARCH REPORTS TGC REPORT 57, 2007 ______

References: Agrama, H.A., and Scott, J.W. 2006. Quantitative trait loci for Tomato yellow leaf curl virus and Tomato mottle virus resistance in tomato. J. Amer. Soc. Hort. Sci. 131:267-272. El Mehrach, K., Mejía, L., Gharsallah-Couchane, S., Salus, M.S., Martin, C.T., Hatimi, A., Vidavski, F., Williamson, V., and Maxwell, D.P. 2005. PCR-based methods for tagging the Mi-1 locus for resistance to root-knot nematode in begomovirus-resistant tomato germplasm. Acta Hort. 695:263-270. Mejía, L., Teni, R.E., Vidavski, F., Czosnek, H., Lapidot, M., Nakhla, M.K., and Maxwell, D.P. 2005. Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala. Acta Hort. 695:251-255. Milligan, S.B., Bodeau, J., Yaghoobi, J., Kaloshian, I., Zabel, P., and Williamson, V.M. 1998. The root knot nematode-resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell 10:1307-1319. Milo, J. 2001. The PCR-based marker REX-1, linked to the gene Mi, can be used as a marker to TYLCV tolerance. Tomato Breeders Roundtable www.oardc.ohio-state.edu/tomato/TBRT%202001%20Abstracts.pdf Seah, S., Yaghoobi, J., Rossi, M., Gleason, C.A., and Williamson, V.M. 2004. The nematode resistance gene, Mi-1, is associated with an inverted chromosomal segment in susceptible compared to resistant tomato. Theor. Appl. Genet. 108:1635-1642. Seah, S., Telleen, A.C., and Williamson, V.M. 2007. Introgressed and endogenous Mi-1 gene clusters in tomato differ by complex rearrangements in flanking sequences and show sequence exchange and diversifying selection among homologues. Theor. Appl. Genet. 114:1289-1302. Smith, P.G. 1944. Embryo culture of a tomato species hybrid. Proc. Amer. Soc. Hort. Sci. 44:413- 416. Vidavsky, F., and Czosnek, H. 1998. Tomato breeding lines immune and tolerant to tomato yellow leaf curl virus (TYLCV) issued from Lycopersicon hirsutum. Phytopathology 88:910-914. Williamson, V.M., Ho, J.Y., Wu, F.F., Miller, N., and Kaloshian, I. 1994. A PCR-based marker tightly linked to the nematode resistance gene, Mi, in tomato. Theor. Appl. Genet. 87:757-763. Zamir, D., Ekstein-Michelson, I., Zakay, Y., Navot, N., Zeidan, M., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., van-Oss, H., Kedar, N., Rabinowitch, H.D., and Czosnek, H. 1994. Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, TY-1. Theor. Appl. Genet. 88:141- 146.

RESEARCH REPORTS TGC REPORT 57, 2007 ______Transgenic Lycopersicon ssp. plants expressing the gene for human acidic fibroblast growth factor

Petya Stoykova*, Mariana Radkova*, Pravda Stoeva-Popova**, Xingzhi Wang***, Atanas Atanassov* *Agrobioinstitute, 8 Dragan Tsankov blvd., 1164 Sofia, Bulgaria **Winthrop University, Rock Hill, SC 29733, USA ***Institute of Genetics and Cytology, Northeast Normal University, Changchung, China

In the past decades, genetic transformation of plants has become a rapidly expanding area with increasing commercial application of the end product. Plants as bioreactors of pharmaceutical proteins are safer in comparison to microorganisms,animals, and animal tissues because of the lack of human pathogens- prions, oncogenic DNA sequences and endotoxins (Commandeur et al., 2003, Stoger et al., 2002; Schillberg et al., 2002). In this work we report the transformation of Lycopersicon esculentum cv. Bela and the wild species L. pennellii with the gene for human acidic fibroblast growth factor (haFGF, FGF-1) and phosphomannose isomerase as a selectable marker gene. Phosphomannose isomerase (PMI) (EC 5.3.1.8) is an enzyme that is common in nature, but is less widespread in the plant kingdom. PMI catalyzes the reversible conversion of mannose-6-phosphate into fructose-6-phosphate. The gene for PMI is an appropriate selectable marker gene for positive selection of transgenic plants because plants expressing the PMI gene can assimilate the monosaccharide mannose (Joersbo et al., 1998). FGF-1 is a small nonglycosilated molecule of 17 kDa with a cytokine character that binds in a dimeric shape for excretion from the cell. It takes part in the processes of formation and migration of endothelial and smooth muscle cells which are used in therapeutic angiogenesis. The new lymph vessel growth, as well as recovery of injured ischemic blood vessels, is increased when using such therapy (Iwakura, 2001). FGF-1 is used in skin wound and burn healing (Mellin et al., 1992), as well as pressure ulcer healing (Feldman, 1994). For this study as plant material for genetic transformation we used cotyledon explants from in vitro grown 8 -10 day-old seedlings from the tomato cultivar Bela and the green-fruited species L. pennellii. The genetic transformation experiments were carried out with Agrobacterium tumefaciens strain LBA4404 supplemented with a constitutive virG mutant gene on a compatible plasmid for very efficient T-DNA transfer (Van der Fits et al., 2000). The strain carried the binary vector pM390haFGF harbouring manA gene and a cDNA of the hafgf gene both under the CaMV 35S promotor. The procedure for co-cultivation, and selection of transgenic plants followed the protocol of Sigareva et al. (2004). The following media were applied: co-cultivation medium - ½ MS salts and vitamins, 0.5 mg/L BAP, 20 g/L sucrose, 10 g/L glucose and 8 g/L agar; selection medium (for the first six weeks of development) – MS salts and vitamins, 1 mg/L zeatin, 0.01 mg/L IAA, 5 g/L glucose, 10 g/L mannose, 500 mg/L cefotaxim, and 8 g/L agar; selection medium for shoot elongation – MS salts and vitamins, 1 mg/L zeatin, 1 g/L glucose, 10 g/L mannose, 500 mg/L cefotaxim and 8 g/L agar; rooting medium – MS salts and vitamins, 10 g/L sucrose, 5 g/L mannose, 300 mg/L cefotaxim. T0 shoots that rooted on mannose-containing medium were further analyzed. To determine the presence of the transgenes, plant genomic DNA was extracted according to the protocol of Murray and Thompson (1980) and the polymerase chain reaction (PCR) was carried out with specific primers for hafgf and manA genes (data for the manA gene not shown). Primers for the hafgf gene were 5’ GGTACCATGGCTAATTACAAGAAGC 3’ (forward) and 5’ GAGCTCTTAATCAGAAGAGACTGGCA 3’ (reverse). PCR was performed in a thermal cycler using the following conditions: 1 cycle for 5 minutes at 940C; 35 cycles each of 30 seconds at 940C, 30 seconds at 580C and 30 seconds at 720C, followed by a final extension at 720C for 7 min. The amplification product for the hafgf gene was a

RESEARCH REPORTS TGC REPORT 57, 2007 ______fragment of the expected size of 423 bp, as revealed by agarose gel electrophoresis. The amplification product for the hafgf gene was established respectively in four regenerants from cv. Bela and in three regenerants from L. pennellii that were cultivated and rooted in the presence of mannose (Fig.1, Fig.2). Six of the seven regenerants were successfully micropropagated and adapted under controlled conditions in the greenhouse. To determine the expression of the hafgf transgene, we extracted total soluble protein from leaves of PCR positive and control plants. Indirect ELISA was performed using monoclonal mouse anti-haFGF antibody. The reaction was visualized with anti-mouse antibody conjugated to HRP (horseradish peroxidase) and OPD (o-phenylenediamine) was used as a substrate. The reaction was stopped with H2SO4 and the reaction was measured at OD 495nm on an ELISA reader. The analysis determined the expression of the haFGF protein in four of the seven analyzed T0 transgenic plants (Fig.3). All T0 plants were fertile (Fig.4); they were self-pollinated and produced viable seeds. Further studies are underway to analyze the expression of the hafgf transgene in the next generation.

Acknowledgements The authors would like to thank Syngenta, for providing the manA gene and Prof. Wang, Institute of Genetics and Cytology in The Northeast Normal University, Changchung, China, for providing the binary vector pM390haFGF and the anti-haFGF monoclonal antibody. This project is funded by a grant from the Bulgarian Ministry of Education and Science (K 10-02 A/2004).

Literature Commandeur U, Twyman RM, Fischer R (2003) The biosafety of molecular farming in plants. AgBiotechNet 5, ABN 110. Feldman DS (1994) New interventions in pressure ulcer treatment: regenerative skin healing. Spinal cord Injury Information Network, (http://www.spinalcord.uab.edu?show.asp?durki=21623). Iwakura M, Fujita M, Ikemoto M, Hasegawa K, Nohara R, Sasayama S, Miyamoto S, Yamazato A, Tambara K, Komeda M (2001) Myocardial ischemia enhances the expression of acidic fibroblast growth factor in human pericardial fluid. Hearth and Vessels 15 (3): 112-116. Joersbo M, Donaldson I, Kreiberg J, Petersen SG, Brunstedt J, Okkels FT (1998) Analysis of mannose selection used for transformation of sugar beet. Molecular breeding 4: 111-117. Mellin TN, Mennie RJ, Cashen DE, Ronan JJ, Capparella J, James ML, Disalvo J, Frank J, Linemeyer D, Gimenez-Gallego G, et al. (1992) Acidic fibroblast growth factor accelerates dermal wound healing. Growth Factors 7(1): 1–14. Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 8: 4321–4325. Schillberg S, Emans N, Fischer R (2002). Antibody molecular farming in plants and plant cells. Phytochem Rev 1: 45-54. Sigareva M, Spivey R, Willits MG, Kramer CM, Chang Y-F (2004) An efficient mannose selection protocol for tomato that has no adverse effect on the ploidy level of transgenic plants. Plant Cell Rep 23: 236-245. Stoger E, Sack M, Fischer R, Christou P (2002) Plantibodies: applications, advantages and bottlenecks. Curr Opin Biotechnol 13: 161-166. Van der Fits L, Deakin EA, Hoge HC, Memelink J (2000) The ternary transformation system: constitutive virG on a compatible plasmid dramatically increases Agrobacterium-mediated plant transformation. Plant Mol Biol 43: 495-502.

RESEARCH REPORTS TGC REPORT 57, 2007 ______

Figure 1. PCR analysis of DNA from L. pennellii T0 transgenic plants with primers for hafgf: (1) DNA marker, (2 - 4) transgenic plants, (5 - 7) non-transformed regenerants, (8) positive plant control, (9) negative plant control, (10) positive plasmid control. 1 2 3 4 5 6 7 8 9 10

Figure 2. PCR analysis of DNA from cv Bela T0 transgenic plants with primers for hafgf: (1) λ EcoRI/HindIII DNA marker, (2 - 4) transgenic plants, (5) negative plant control, (6) empty start, (7) positive plasmid control. 1 2 3 4 5 6 7

Figure 3. ELISA of T0 transgenic tomato plants: Lines expressing the haFGF protein Bela (B) 1 and 3 and L. pennellii (Lp) 4 and 5. Lines with no detectable haFGF protein or poor expression - Bela 2 and 7, L. pennellii 2; Positive control (Contr.); buffer control (Buff.)

A B C D E F G

1 Б2 Б3 Б7 L.p.2 Б1 L.p.4 L.p.5 1:5 1:5 1:5 1:5 1:5 1:5 1:5

2 Б2 Б3 Б7 L.p.2 Б1 L.p.4 L.p.5 1:10 1:10 1:10 1:10 1:10 1:10 1:10

3 Contr. Contr. Buff. Contr. Contr. Buff. Buff. 1:5 1:10 1:5 1:10

Figure 4. Flowering of a T0 L. pennellii transgenic plant.

THIS PAGE IS INTENTIONALLY BLANK VARIETAL PEDIGREES TGC REPORT 57, 2007 ______‘Fla. 8153’ tomato hybrid; Fla. 8059 and Fla. 7907 breeding lines. Scott, J.W., E.A. Baldwin, H.A. Klee, S.M. Olson, J.A. Bartz, C.A. Sims and J.K. Brecht. 2006.

Pedigree:

Suncoast Fla. 7547 Fla. 7236 F6 Fla. 7156 Fla. 7654 Fla. 8059 Fla. 7060 F1 F F7 Fla. 7236 8

F5 NC8276 F3 Suncoast Fla. 7482B F8 Fla. 7060

F6 Fla. 7344 Suncoast F5 Fla. 7215 NC8276 F4 F F3 Fla. 7402 6 Suncoast Fla. 8153 F6 Fla. 7182 Horizon F6 F4 Severianin F6 Fla. 7060 Hayslip

Fla.Fla. 7220 Fla. 7480 7220 Fla. 7228 (sis of 7481) F8 Fla. 7907 Fla. 7060 F5 C-28 71092 x M145 Fla. 7417 648 F6 Horizon 648648 C-28 C-28 Horizon Fla. 7213 NC8276 F2 Fla. 7344B Suncoast Fla. 7155 F4 Fla. 7214 NC8276 F2 Suncoast

Characteristics:

Fruit: Medium-large, flat round, light green shoulders, stellate and smooth blossom scar, firm, glossy red color

Plant: sp, I, I-2, I-3, Ve, Sm, ogc, medium-slightly tall vine.

Utility and maturity: Fresh market hybrid with moderate heat-tolerance (>32oC day/>21oC night), deep red interior color, good flavor under most growing conditions, high lycopene, for the premium market, early-midseason.

VARIETAL PEDIGREES TGC REPORT 57, 2007 ______Gc9, Gc171, and Gc173 begomovirus resistant inbreds. Scott, J.W. and D.J. Schuster. 2006.

Pedigrees: Fla. 7324

Israeli line Gc9 (Fla. 000595-2)F5 Fla. 7409 F4

F7 C-28 LA2779

Fla. 7777

GC173 (Fla. 024652-Y1)F7 Fla. 7771

F3 Israeli line

F4 Fla. 7409

F7 C-28

LA2779

Fla. 7655 Israeli line Gc171 (Fla. 0245259)F5 F4 Fla. 7409

C-28 F7

LA2779 Fla. 7756

F4 Fla. 7546

F5 Fla. 7060

F4 Fla. 7420

F2 Fla. 7314

LA1932

VARIETAL PEDIGREES TGC REPORT 57, 2007 ______Characteristics:

Fruit: Gc9 Medium size, flat round, light green shoulder, smooth, firm. Gc171 and Gc173 short plum, light green shoulder, firm

Plant: sp, I, I-2, Ve, Sm, Gc171 & Gc173 c2

Utility and maturity: Source of broad spectrum begomovirus resistance (TYLCV plus up to 7 bipartite viruses in Guatemala); Gc9 for fresh market is early-midseason, Gc171 and Gc173 for fresh market plums or processing variety development are early season types.

STOCK LIST TGC REPORT 58, 2008

Revised List of Wild Species Stocks

Chetelat, R. T.

C.M. Rick Tomato Genetics Resource Ctr., Department of Plant Sciences, University of California, One Shields Ave., Davis, CA 95616

The following list of 1,190 accessions of wild Lycopersicon and related Solanum species is a revision of the previous one, published in TGC vol. 54 (2004). Other types of TGRC stocks are catalogued in TGC 55 (monogenic mutants) and TGC 56 (miscellaneuous genetic stocks). Inactive accessions have been dropped and new collections added to the present list. The new material includes populations of L. chilense, L. peruvianum, S. lycopersicoides, and S. sitiens collected in N. Chile in 2005 (see TGC 56:13), as well as a L. peruvianum donated by John Rick and L. esculentum var. cerasiforme donated by Lori Pacuilla. Species are identified by both their Lycopersicon and Solanum names in the following tables. Accessions of L. peruvianum recognized by Peralta et al. (2005, Syst. Bot. 30: 424-434) as S. arcanum or S. huaylasense are indicated by superscripts after the accession numbers. Accessions that form part of the core collection are identified by an asterisk. Seed samples of most accessions are available for distribution, upon request, for valid research purposes. Some accessions may be temporarily unavailable for distribution during regeneration, and not all accessions are available for international distribution due to requirements for obtaining phytosanitary certificates. Only small quantities of seed can be provided for each accession, in most cases 25 seed per accession of the self-pollinated species, 50 for the outcrossers, and 5-10 for S. lycopersicoides, S. juglandifolium, S. ochranthum, and S. sitiens. These samples are intended to enable researchers to multiply seed to meet their own future needs. Accessions are grown for seed increase at UC-Davis, either in the field, for most of the selfing species, or in the greenhouse for the outcrossers. Accessions of the former are increased in small plots with as few as 6 plants, whereas the latter are regenerated from relatively large populations (up to 50 plants) to maintain genetic variation. For lack of space, only summary information on the collection site of each is presented here. More detailed information on each accession, including current availability, can be obtained at http://tgrc.ucdavis.edu. Geographic coordinates (lat/lon) have been detemined for most accessions collected from mainland S. America, and can be downloaded in several formats. Hundreds of images of wild populations taken in their native habitats have been added to our database. Additional information will be provided upon request.

STOCK LISTS TGC REPORT 57, 2007 ______L. cheesmanii (S. cheesmaniae) LA0166* Santa Cruz: Barranco, N of Punta Galapagos Islands Ecuador LA0421* San Cristobal: cliff E of Wreck Bay Galapagos Islands Ecuador LA0422 San Cristobal: Wreck Bay Galapagos Islands Ecuador LA0428 Santa Cruz: trail Bellavista to Miconia Zone Galapagos Islands Ecuador LA0429* Santa Cruz: crater in highlands Galapagos Islands Ecuador LA0434 Santa Cruz: Rambech Trail Galapagos Islands Ecuador LA0437 Isabela: ponds N of Villamil Galapagos Islands Ecuador LA0521 Fernandina: inside Crater Galapagos Islands Ecuador LA0522 Fernandina: outer slopes Galapagos Islands Ecuador LA0524 Isabela: Punta Essex Galapagos Islands Ecuador LA0528B Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0529 Fernandina: crater Galapagos Islands Ecuador LA0531* Baltra: Barranco slope, N side Galapagos Islands Ecuador LA0746* Isabela: Punta Essex Galapagos Islands Ecuador LA0749* Fernandina: N side Galapagos Islands Ecuador LA0927 Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0932 Isabela: Tagus Cove Galapagos Islands Ecuador LA1035 Fernandina: low elevation Galapagos Islands Ecuador LA1036* Isabela: far N end Galapagos Islands Ecuador LA1037 Isabela: Alcedo E slope Galapagos Islands Ecuador LA1039 Isabela: Cape Berkeley Galapagos Islands Ecuador LA1040 San Cristobal: Caleta Toruga Galapagos Islands Ecuador LA1041 Santa Cruz: El Cascajo Galapagos Islands Ecuador LA1042 Isabela: Cerro Santo Tomas Galapagos Islands Ecuador LA1043 Isabela: Cerro Santo Tomas Galapagos Islands Ecuador LA1138 Isabela: E of Cerro Azul Galapagos Islands Ecuador LA1139 Isabela: W of Cerro Azul Galapagos Islands Ecuador LA1402 Fernandina: W of Punta Espinoza Galapagos Islands Ecuador LA1404 Fernandina: W flank caldera Galapagos Islands Ecuador LA1406* Fernandina: SW rim caldera Galapagos Islands Ecuador LA1407 Fernandina: caldera, NW bench Galapagos Islands Ecuador LA1409 Isabela: Punta Albermarle Galapagos Islands Ecuador LA1412* San Cristobal: opposite Isla Lobos Galapagos Islands Ecuador LA1414 Isabela: Cerro Azul Galapagos Islands Ecuador LA1427 Fernandina: WSW rim of caldera Galapagos Islands Ecuador LA1447 Santa Cruz: Charles Darwin Station-Punta Galapagos Islands Ecuador LA1448 Santa Cruz: Puerto Ayora, Pelican Bay Galapagos Islands Ecuador LA1449 Santa Cruz: Charles Darwin Station, Galapagos Islands Ecuador LA1450* Isabela: Bahia San Pedro Galapagos Islands Ecuador LA3124 Santa Fe: near E landing Galapagos Islands Ecuador Total 40 accessions.

L. cheesmanii f. minor (S. galapagense) LA0317* Bartolome Galapagos Islands Ecuador LA0426 Bartolome: E of landing Galapagos Islands Ecuador LA0436* Isabela: Villamil Galapagos Islands Ecuador LA0438 Isabela: coast at Villamil Galapagos Islands Ecuador LA0480A Isabela: Cowley Bay Galapagos Islands Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. cheesmanii f. minor (S. galapagense) LA0483 Fernandina: inside crater Galapagos Islands Ecuador LA0526* Pinta: W side Galapagos Islands Ecuador LA0527 Bartolome: W side, Tower Bay Galapagos Islands Ecuador LA0528 Santa Cruz: Academy Bay Galapagos Islands Ecuador LA0530 Fernandina: crater Galapagos Islands Ecuador LA0532 Pinzon: NW side Galapagos Islands Ecuador LA0747 Santiago: Cape Trenton Galapagos Islands Ecuador LA0748 Santiago: E Trenton Island Galapagos Islands Ecuador LA0929 Isabela: Punta Flores Galapagos Islands Ecuador LA0930 Isabela: Cabo Tortuga Galapagos Islands Ecuador LA1044 Bartolome Galapagos Islands Ecuador LA1136* Gardner-near-Floreana Islet Galapagos Islands Ecuador LA1137* Rabida: N side Galapagos Islands Ecuador LA1141* Santiago: N crater Galapagos Islands Ecuador LA1400 Isabela: N of Punta Tortuga Galapagos Islands Ecuador LA1401* Isabela: N of Punta Tortuga Galapagos Islands Ecuador LA1403 Fernandina: W of Punta Espinoza Galapagos Islands Ecuador LA1408 Isabela: SW volcano, Cape Berkeley Galapagos Islands Ecuador LA1410* Isabela: Punta Ecuador Galapagos Islands Ecuador LA1411 Santiago: N James Bay Galapagos Islands Ecuador LA1452 Isabela: E slope Volcan Alcedo Galapagos Islands Ecuador LA1508 Corona del Diablo (near Floreana) Galapagos Islands Ecuador LA1627 Isabela: Tagus Cove Galapagos Islands Ecuador LA3909 Bartolome: tourist landing Galapagos Islands Ecuador Total 29 accessions.

L. chilense (S. chilense) LA0130 Moquegua Moquegua Peru LA0294 Tacna Tacna Peru LA0456 Clemesi Moquegua Peru LA0458 Tacna Tacna Peru LA0460 Palca Tacna Peru LA0470 Taltal Antofagasta Chile LA1029 Moquegua Moquegua Peru LA1030 Tarata Rd. Tacna Peru LA1782 Quebrada de Acari Arequipa Peru LA1917 Llauta (4x) Ica Peru LA1930 Quebrada Calapampa Arequipa Peru LA1932* Minas de Acari Arequipa Peru LA1938* Quebrada Salsipuedes Arequipa Peru LA1958* Pampa de la Clemesi Arequipa Peru LA1959 Huaico Moquegua Moquegua Peru LA1960* Rio Osmore Moquegua Peru LA1961 Toquepala Tacna Peru LA1963* Rio Caplina Tacna Peru LA1965* Causiri Tacna Peru LA1967* Pachia, Rio Caplina Tacna Peru LA1968 Cause seco Tacna Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. chilense (S. chilense) LA1969* Estique Pampa Tacna Peru LA1970 Tarata Tacna Peru LA1971* Palquilla Tacna Peru LA1972 Rio Sama Tacna Peru LA2404 Arica to Tignamar Tarapaca Chile LA2405 Tignamar Tarapaca Chile LA2406 Arica to Putre Tarapaca Chile LA2731 Moquella Tarapaca Chile LA2737 Yala-yala Tarapaca Chile LA2739 Cruce Nama a Camina Tarapaca Chile LA2746 Asentamiento-18 Tarapaca Chile LA2747 Alta Azapa Tarapaca Chile LA2748* Soledad Antofagasta Chile LA2749 Punta Blanca Antofagasta Chile LA2750* Mina La Despreciada Antofagasta Chile LA2751 Pachica (Rio Tarapaca) Tarapaca Chile LA2753 Laonzana Tarapaca Chile LA2754 W of Chusmisa Tarapaca Chile LA2755* Banos de Chusmisa Tarapaca Chile LA2757 W of Chusmisa Tarapaca Chile LA2759* N of Mamina Tarapaca Chile LA2762 Quebrada Mamina-Parca Tarapaca Chile LA2764 Codpa Tarapaca Chile LA2765 Timar Tarapaca Chile LA2767* Chitita Tarapaca Chile LA2768 Empalme Codpa Tarapaca Chile LA2771 Above Poconchile Tarapaca Chile LA2773* Zapahuira Tarapaca Chile LA2774 Socorama Tarapaca Chile LA2778* Chapiquina Tarapaca Chile LA2779 Cimentario Belen Tarapaca Chile LA2780 Belen to Lupica Tarapaca Chile LA2879* San Roque de Peine Antofagasta Chile LA2880 Quebrada Tilopozo Antofagasta Chile LA2882 Camar Antofagasta Chile LA2884* Ayaviri Antofagasta Chile LA2887 Quebrada Bandurria Antofagasta Chile LA2888 Loma Paposo Antofagasta Chile LA2891 Taltal Antofagasta Chile LA2930* Quebrada Taltal Antofagasta Chile LA2931* Guatacondo Tarapaca Chile LA2932 Quebrada Gatico, Mina Escalera Antofagasta Chile LA2946 Guatacondo Tarapaca Chile LA2949 Chusmisa Tarapaca Chile LA2952 Camiña Tarapaca Chile LA2955 Quistagama Tarapaca Chile LA2980 Yacango Moquegua Peru LA2981A Torata to Chilligua Moquegua Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. chilense (S. chilense) LA3111 Tarata outskirts Tacna Peru LA3112 Estique Pampa Tacna Peru LA3113 Apacheta Tacna Peru LA3114 Quilla Tacna Peru LA3115 W of Quilla Tacna Peru LA3153 Desvio Omate (Rio de Osmore) Moquegua Peru LA3155 Quinistaquillas Moquegua Peru LA3355 Cacique de Ara Tacna Peru LA3356 W of Tacna Tacna Peru LA3357 Irrigacion Magollo Tacna Peru LA3358 Rio Arunta, Cono Sur Tacna Peru LA3784 Rio Chaparra Arequipa Peru LA3785 Terras Blancas Arequipa Peru LA3786 Alta Chaparra Arequipa Peru LA4107 Catarata Taltal Antofagasta Chile LA4108 Caleta Punta Grande Antofagasta Chile LA4109 Quebrada Cañas Antofagasta Chile LA4117 San Pedro de Atacama to Paso Jama #1 Antofagasta Chile LA4117B San Pedro de Atacama to Paso Jama #2 Antofagasta Chile LA4118 Toconao Antofagasta Chile LA4119 Socaire Antofagasta Chile LA4120 Cahuisa Tarapaca Chile LA4121 Pachica to Porosa Tarapaca Chile LA4122 Chiapa Tarapaca Chile LA4124 Camina Tarapaca Chile LA4127 Alto Umayani Tarapaca Chile LA4129 Pachica (Rio Camarones) Tarapaca Chile LA4132 Esquina Tarapaca Chile LA4319 Alto Rio Lluta Tarapaca Chile LA4321 Quebrada Cardones Tarapaca Chile LA4324 Estacion Puquio Tarapaca Chile LA4327 Pachica, Rio Camarones Tarapaca Chile LA4329 Puente del Diablo, Rio Salado Antofagasta Chile LA4330 Caspana Antofagasta Chile LA4332 Rio Grande Antofagasta Chile LA4333 Talabre Antofagasta Chile LA4334 Quebrada Sicipo Antofagasta Chile LA4335 Quebrada Tucuraro Antofagasta Chile LA4336 Quebrada Cascabeles Antofagasta Chile LA4337 Quebrada Paposo Antofagasta Chile LA4338 Quebrada Taltal, Estacion Breas Antofagasta Chile LA4339 Quebrada Los Zanjones Antofagasta Chile Total 111 accessions.

L. chmielewskii (S. chmielewskii) LA1028* Casinchihua Apurimac Peru LA1306* Tambo Ayacucho Peru LA1316* Ocros Ayacucho Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. chmielewskii (S. chmielewskii) LA1317* Hacienda Pajonal Ayacucho Peru LA1318* Auquibamba Apurimac Peru LA1325* Puente Cunyac Apurimac Peru LA1327 Soracata Apurimac Peru LA1330 Hacienda Francisco Apurimac Peru LA2639B Puente Cunyac Apurimac Peru LA2663* Tujtohaiya Cusco Peru LA2677* Huayapacha #1 Cusco Peru LA2678 Huayapacha #2 Cusco Peru LA2679 Huayapacha #3 Cusco Peru LA2680* Puente Apurimac #1 Cusco Peru LA2681 Puente Apurimac #2 Cusco Peru LA2695* Chihuanpampa Cusco Peru LA2917 Chullchaca Ancash Peru LA3642 Ankukunka Cusco Peru LA3643 Colcha Cusco Peru LA3644 Puente Tincoj Cusco Peru LA3645 Boca del Rio Velille Cusco Peru LA3648 Huallapachaca Apurimac Peru LA3653 Matara Apurimac Peru LA3654 Casinchigua to Chacoche Apurimac Peru LA3656 Chalhuani Apurimac Peru LA3658 Occobamba Apurimac Peru LA3661 Pampotampa Apurimac Peru LA3662 Huancarpuquio Apurimac Peru Total 28 accessions.

L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA0168 New Caledonia French Oceania LA0292* Santa Cruz Galapagos Islands Ecuador LA0349 Unknown Origin Unknown LA0384 Chilete (Rio Jequetepeque) Cajamarca Peru LA0475 Sucua Morona-Santiago Ecuador LA0476 Sucua Morona-Santiago Ecuador LA1025* Oahu: Wahiawa Hawaii USA LA1203 Ciudad Vieja Guatemala LA1204* Quetzaltenango Guatemala LA1205 Copan Honduras LA1206* Copan Ruins Honduras LA1207 Mexico LA1208 Sierra Nevada Colombia LA1209 Colombia LA1226 Sucua Morona-Santiago Ecuador LA1227 Sucua Morona-Santiago Ecuador LA1228* Macas, San Jacinto de los Monos Morona-Santiago Ecuador LA1229 Macas Plaza Morona-Santiago Ecuador LA1230 Macas Morona-Santiago Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA1231 Tena Napo Ecuador LA1247 La Toma Loja Ecuador LA1268 Chaclacayo Lima Peru LA1286* San Martin de Pangoa Junin Peru LA1287 Fundo Ileana #1 Junin Peru LA1289 Fundo Ileana #3 Junin Peru LA1290 Mazamari Junin Peru LA1291 Satipo Granja Junin Peru LA1307* Hotel Oasis, San Francisco Ayacucho Peru LA1308 San Francisco Ayacucho Peru LA1310 Hacienda Santa Rosa Ayacucho Peru LA1311-1 Santa Rosa Puebla Ayacucho Peru LA1311-10 Santa Rosa Puebla Ayacucho Peru LA1311-11 Santa Rosa Puebla Ayacucho Peru LA1311-12 Santa Rosa Puebla Ayacucho Peru LA1311-13 Santa Rosa Puebla Ayacucho Peru LA1311-14 Santa Rosa Puebla Ayacucho Peru LA1311-15 Santa Rosa Puebla Ayacucho Peru LA1311-16 Santa Rosa Puebla Ayacucho Peru LA1311-17 Santa Rosa Puebla Ayacucho Peru LA1311-18 Santa Rosa Puebla Ayacucho Peru LA1311-19 Santa Rosa Puebla Ayacucho Peru LA1311-2 Santa Rosa Puebla Ayacucho Peru LA1311-3 Santa Rosa Puebla Ayacucho Peru LA1311-4 Santa Rosa Puebla Ayacucho Peru LA1311-5 Santa Rosa Puebla Ayacucho Peru LA1311-6 Santa Rosa Puebla Ayacucho Peru LA1311-7 Santa Rosa Puebla Ayacucho Peru LA1311-8 Santa Rosa Puebla Ayacucho Peru LA1311-9 Santa Rosa Puebla Ayacucho Peru LA1312-2* Paisanato Cusco Peru LA1312-3 Paisanto Cusco Peru LA1312-4 Paisanato Cusco Peru LA1314* Granja Pichari Cusco Peru LA1320* Hacienda Carmen Apurimac Peru LA1323* Pfacchayoc Cusco Peru LA1324 Hacienda Potrero, Quillabamba Cusco Peru LA1328 Rio Pachachaca Apurimac Peru LA1334 Pescaderos Arequipa Peru LA1338* Puyo Napo Ecuador LA1372 Santa Eulalia Lima Peru LA1385* Quincemil Cusco Peru LA1386 Balsas Amazonas Peru LA1387 Quincemil Cusco Peru LA1388* San Ramon Junin Peru LA1420* Lago Agrio Napo Ecuador LA1421 Santa Cecilia Napo Ecuador LA1423 Near Santo Domingo Pichincha Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA1425* Villa Hermosa Cauca Colombia LA1426 Cali Cauca Colombia LA1429* La Estancilla Manabi Ecuador LA1453* Kauai: Poipu Hawaii USA LA1454 ? Mexico LA1455 Gral Teran Nuevo Leon Mexico LA1456* Papantla Vera Cruz Mexico LA1457 Tehuacan Puebla Mexico LA1458 Huachinango Puebla Mexico LA1461* University Philippines, Los Banos Philippines LA1464* El Progreso, Yoro Honduras LA1465 Taladro, Comayagua Honduras LA1467 Cali Cauca Colombia LA1468 Fte. Casa, Cali Cauca Colombia LA1479 Sucua Morona-Santiago Ecuador LA1480 Sucua Morona-Santiago Ecuador LA1481 Sucua Morona-Santiago Ecuador LA1482* Segamat Malaysia LA1483* Trujillo Saipan LA1509* Tawan Sabah Borneo LA1510 Mexico LA1511* Siete Lagoas Minas Gerais Brazil LA1512 Lago de Llopango El Salvador LA1540 Cali to Popayan Cauca Colombia LA1542* Turrialba Costa Rica LA1543* Upper Parana Brazil LA1545 Becan Ruins Campeche Mexico LA1546 Papantla Vera Cruz Mexico LA1548 Fundo Liliana Junin Peru LA1549 Chontabamba Pasco Peru LA1569 Jalapa Vera Cruz Mexico LA1574 Nana Lima Peru LA1619 Pichanaki Junin Peru LA1620* Castro Alves Bahia Brazil LA1621 Rio Venados Hidalgo Mexico LA1622* Lusaka Zambia LA1623 Muna Yucatan Mexico LA1632 Puerto Maldonado Madre de Dios Peru LA1654 Tarapoto San Martin Peru LA1655 Tarapoto San Martin Peru LA1662 El Ejido Merida Venezuela LA1667 Cali Cauca Colombia LA1668 Acapulco Guerrero Mexico LA1673 Nana Lima Peru LA1701 Trujillo La Libertad Peru LA1705 Sinaloa Mexico LA1709 Desvio Yojoa Honduras LA1710 Cariare Limon Costa Rica

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA1711 Zamorano Honduras LA1712 Pejibaye Costa Rica LA1713 CATIE, Turrialba Costa Rica LA1909 Quillabamba Cusco Peru LA1953 La Curva Arequipa Peru LA2076 Naranjitos Bolivia LA2077 Paco, Coroica La Paz Bolivia LA2078* Mosardas Rio Grande de Sol Brazil LA2079 Maui: Kihei Hawaii USA LA2080 Maui: Kihei Hawaii USA LA2081 Maui: Kihei Hawaii USA LA2082 Arenal Valley Honduras LA2085 Kempton Park S. Africa LA2095* La Cidra Loja Ecuador LA2121 Yacuambi-Guadalupe Zamora-Chinchipe Ecuador LA2122A Yacuambi-Guadalupe Zamora-Chinchipe Ecuador LA2122B Yacuambi-Guadalupe Zamora-Chinchipe Ecuador LA2122C Yacuambi-Guadalupe Zamora-Chinchipe Ecuador LA2122D Yacuambi-Guadalupe Zamora-Chinchipe Ecuador LA2123A La Saquea Zamora-Chinchipe Ecuador LA2123B La Saquea Zamora-Chinchipe Ecuador LA2126A El Dorado Zamora-Chinchipe Ecuador LA2126B El Dorado Zamora-Chinchipe Ecuador LA2126C El Dorado Zamora-Chinchipe Ecuador LA2126D El Dorado Zamora-Chinchipe Ecuador LA2127 Zumbi Zamora-Chinchipe Ecuador LA2129 San Roque Zamora-Chinchipe Ecuador LA2130 Gualaquiza Zamora-Chinchipe Ecuador LA2131* Bomboiza Zamora-Chinchipe Ecuador LA2135 Limon Santiago-Morona Ecuador LA2136 Bella Union Santiago-Morona Ecuador LA2137* Tayusa Santiago-Morona Ecuador LA2138A Chinimpini Santiago-Morona Ecuador LA2138B Chinimpini Santiago-Morona Ecuador LA2139A Logrono Santiago-Morona Ecuador LA2139B Logrono Santiago-Morona Ecuador LA2140A Huambi Santiago-Morona Ecuador LA2140B Huambi Santiago-Morona Ecuador LA2140C Huambi Santiago-Morona Ecuador LA2141 Rio Blanco Santiago-Morona Ecuador LA2142 Cambanaca Santiago-Morona Ecuador LA2143 Nuevo Rosario Santiago-Morona Ecuador LA2177A San Ignacio Cajamarca Peru LA2177B San Ignacio Cajamarca Peru LA2177C San Ignacio Cajamarca Peru LA2177E San Ignacio Cajamarca Peru LA2177F San Ignacio Cajamarca Peru LA2205A Santa Rosa de Mirador San Martin Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA2205B Santa Rosa de Mirador San Martin Peru LA2308* San Francisco San Martin Peru LA2312 Jumbilla #1 Amazonas Peru LA2313 Jumbilla #2 Amazonas Peru LA2392* Jakarta Indonesia LA2393 Mercedes Canton Hoja Ancha Guanacaste Costa Rica LA2394 San Rafael de Hoja Ancha Guanacaste Costa Rica LA2402* Florianopolis Santa Catarina Brazil LA2411 Yanamayo Puno Peru LA2616 Naranjillo Huanuco Peru LA2617 El Oropel Huanuco Peru LA2618 Santa Lucia, Tulumayo Huanuco Peru LA2619* Caseria San Augustin Loreto Peru LA2620 La Divisoria Loreto Peru LA2621 3 de Octubre Loreto Peru LA2624 Umashbamba Cusco Peru LA2625 Chilcachaca Cusco Peru LA2626 Santa Ana Cusco Peru LA2627 Pacchac, Chico Cusco Peru LA2628 Echarate Cusco Peru LA2629 Echarate Cusco Peru LA2630 Calzada Cusco Peru LA2631 Chontachayoc Cusco Peru LA2632 Maranura Cusco Peru LA2633 Huayopata Cusco Peru LA2635 Huayopata Cusco Peru LA2636 Sicre Cusco Peru LA2637 Sicre Cusco Peru LA2640 Molinopata Apurimac Peru LA2642 Molinopata Apurimac Peru LA2643 Bella Vista Apurimac Peru LA2660 San Ignacio de Moxos Beni Bolivia LA2664 Yanahuana Puno Peru LA2665 San Juan del Oro Puno Peru LA2666 San Juan del Oro Puno Peru LA2667 Pajchani Puno Peru LA2668 Cruz Playa Puno Peru LA2669 Huayvaruni #1 Puno Peru LA2670* Huayvaruni #2 Puno Peru LA2671 San Juan del Oro, Escuela Puno Peru LA2673 Chuntopata Puno Peru LA2674 Huairurune Puno Peru LA2675* Casahuiri Puno Peru LA2683 Consuelo Cusco Peru LA2684 Patria Cusco Peru LA2685 Gavitana Madre de Dios Peru LA2686 Yunguyo Madre de Dios Peru LA2687 Mansilla Madre de Dios Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA2688* Santa Cruz near Shintuyo #1 Madre de Dios Peru LA2689 Santa Cruz near Shintuyo #2 Madre de Dios Peru LA2690 Atalaya Cusco Peru LA2691 Rio Pilcopata Cusco Peru LA2692 Pilcopata #1 Cusco Peru LA2693 Pilcopata #2 Cusco Peru LA2694 Aguasantas Cusco Peru LA2696 El Paramillo, La Union Valle Colombia LA2697 Mata de Cana, El Dovio Valle Colombia LA2698 La Esperanza de Belgica Valle Colombia LA2700 Aoti, Satipo Junin Peru LA2702 Kandy #1 Sri Lanka LA2709* Bidadi, Bangalore Karnataka India LA2710* Porto Firme Brazil LA2782 El Volcan #1 - Pajarito Antioquia Colombia LA2783* El Volcan #2 - Titiribi Antioquia Colombia LA2784 La Queronte Antioquia Colombia LA2785 El Bosque Antioquia Colombia LA2786 Andes #1 Antioquia Colombia LA2787 Andes #2 Antioquia Colombia LA2789 Canaveral Antioquia Colombia LA2790 Buenos Aires Antioquia Colombia LA2791 Rio Frio Antioquia Colombia LA2792 Tamesis Antioquia Colombia LA2793 La Mesa Antioquia Colombia LA2794 El Libano Antioquia Colombia LA2795 Camilo Antioquia Colombia LA2807 Taypiplaya Yungas Bolivia LA2811 Cerro Huayrapampa Apurimac Peru LA2814 Ccascani, Sandia Puno Peru LA2841 Chinuna Amazonas Peru LA2842 Santa Rita San Martin Peru LA2843 Moyobamba mercado San Martin Peru LA2844 Shanhao San Martin Peru LA2845* Mercado Moyobamba San Martin Peru LA2871* Chamaca Sud Yungas Bolivia LA2873 Lote Pablo Luna #2 Sud Yungas Bolivia LA2874 Playa Ancha Sud Yungas Bolivia LA2933 Jipijapa Manabi Ecuador LA2977 Belen Beni Bolivia LA2978 Belen Beni Bolivia LA3123 Santa Cruz: summit Galapagos Islands Ecuador LA3135 Pinal del Jigue Holguin Cuba LA3136 Arroyo Rico Holguin Cuba LA3137 Pinares de Mayari Holguin Cuba LA3138 El Quemada Holguin Cuba LA3139 San Pedro de Cananova Holguin Cuba LA3140 Los Platanos Holguin Cuba

STOCK LISTS TGC REPORT 57, 2007 ______L. esculentum var. cerasiforme (S. lycopersicum var. cerasiforme) LA3141 Guira de Melena La Habana Cuba LA3162 N of Copan Honduras LA3452 CATIE, Turrialba Turrialba Costa Rica LA3623 Tablones Manabi Ecuador LA3633 Botanical garden Ghana LA3652 Matara Apurimac Peru LA3842 El Limon, Maracay Araguay Venezuela LA3843 El Limon, Maracay Aragua Venezuela LA3844 Algarrobito Guarico Venezuela LA4133 Makapuu Beach, Oahu Hawaii USA LA4352 Bamoa Sinaloa Mexico LA4353 Guasave Sinaloa Mexico Total 271 accessions (see additional ones listed as ‘Latin American cultivars’ in TGC 56).

L. hirsutum (S. habrochaites) LA0094 Canta-Yangas Lima Peru LA0361* Canta Lima Peru LA0386 Cajamarca Cajamarca Peru LA0387 Santa Apolonia Cajamarca Peru LA1033 Hacienda Taulis Lambayeque Peru LA1295 Surco Lima Peru LA1298 Yaso Lima Peru LA1347* Empalme Otusco La Libertad Peru LA1352 Rupe Cajamarca Peru LA1353* Contumaza Cajamarca Peru LA1354 Contumaza to Cascas Cajamarca Peru LA1361* Pariacoto Ancash Peru LA1362 Chacchan Ancash Peru LA1363* Alta Fortaleza Ancash Peru LA1366 Cajacay Ancash Peru LA1378 Navan Lima Peru LA1391 Bagua to Olmos Cajamarca Peru LA1392 Huaraz - Casma Road Ancash Peru LA1393 Huaraz - Caraz Ancash Peru LA1557 Huaral to Cerro de Pasco, Rio Chancay Lima Peru LA1559 Desvio Huamantanga Lima Peru LA1560* Matucana Lima Peru LA1648 Above Yaso Lima Peru LA1681 Mushka Lima Peru LA1691 Yauyos Lima Peru LA1695 Cacachuhuasiin, Cacra Lima Peru LA1696 Huanchuy to Cacra Lima Peru LA1717 Sopalache Piura Peru LA1718 Huancabamba Piura Peru LA1721* Ticrapo Viejo Huancavelica Peru LA1731* Rio San Juan Huancavelica Peru LA1736 Pucutay Piura Peru LA1737 Cashacoto Piura Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. hirsutum (S. habrochaites) LA1738 Desfiladero Piura Peru LA1739 Canchaque to Cerran Piura Peru LA1740* Huancabamba Piura Peru LA1741 Sondorilla Piura Peru LA1753 Surco Lima Peru LA1764 West of Canta Lima Peru LA1772 West of Canta Lima Peru LA1775 Rio Casma Ancash Peru LA1777* Rio Casma Ancash Peru LA1778 Rio Casma Ancash Peru LA1779 Rio Casma Ancash Peru LA1918* Llauta Ayacucho Peru LA1927 Ocobamba Ayacucho Peru LA1928* Ocana Ayacucho Peru LA1978 Colca Ancash Peru LA2155* Maydasbamba Cajamarca Peru LA2156 Ingenio Montan Cajamarca Peru LA2158* Rio Chotano Cajamarca Peru LA2159 Atonpampa Cajamarca Peru LA2167* Cimentario Cajamarca Cajamarca Peru LA2171 El Molino Piura Peru LA2196 Caclic Amazonas Peru LA2314 San Francisco Amazonas Peru LA2321 Chirico Amazonas Peru LA2324 Leimebamba Amazonas Peru LA2329* Aricapampa La Libertad Peru LA2409* Miraflores Lima Peru LA2552 Las Flores Cajamarca Peru LA2556 Puente Moche La Libertad Peru LA2567 Quita Ancash Peru LA2574 Cullaspungro Ancash Peru LA2648 Santo Domingo Piura Peru LA2650* Ayabaca Piura Peru LA2651 Puente Tordopa Piura Peru LA2722 Puente Auco Lima Peru LA2812 Lambayeque Lambayeque Peru LA2975 Coltao Ancash Peru LA2976 Huangra Ancash Peru LA3794 Alta Fortaleza Ancash Peru LA3796 Anca, Marca Ancash Peru LA3854 Llaguén La Libertad Peru LA4137 Barrio Delta, Cajamarca Cajamarca Peru Total 75 accessions.

L. hirsutum f. glabratum (S. habrochaites) LA0407* Mirador, Guayaquil Guayas Ecuador LA1223* Alausi Chimborazo Ecuador LA1252 Loja Loja Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. hirsutum f. glabratum (S. habrochaites) LA1253 Pueblo Nuevo - Landangue Loja Ecuador LA1255 Pedistal Loja Ecuador LA1264 Bucay Chimborazo Ecuador LA1265 Rio Chimbo Chimborazo Ecuador LA1266* Pallatanga Chimborazo Ecuador LA1624* Jipijapa Manabi Ecuador LA1625 S of Jipijapa Manabi Ecuador LA2092 Chinuko Chimborazo Ecuador LA2098* Sabianga Loja Ecuador LA2099 Sabianga to Sozorango Loja Ecuador LA2100 Sozorango Loja Ecuador LA2101 Cariamanga Loja Ecuador LA2103* Lansaca Loja Ecuador LA2104 Pena Negra Loja Ecuador LA2105 Jardin Botanico, Loja Loja Ecuador LA2106 Yambra Loja Ecuador LA2107 Los Lirios Loja Ecuador LA2108 Anganumo Loja Ecuador LA2109* Yangana #1 Loja Ecuador LA2110 Yangana #2 Loja Ecuador LA2114 San Juan Loja Ecuador LA2115 Pucala Loja Ecuador LA2116 Las Juntas Loja Ecuador LA2119* Saraguro Loja Ecuador LA2124 Cumbaratza Zamora-Chinchipe Ecuador LA2128* Zumbi Zamora-Chinchipe Ecuador LA2144 Chanchan Chimborazo Ecuador LA2174* Rio Chinchipe Cajamarca Peru LA2175 Timbaruca Cajamarca Peru LA2204 Balsapata Amazonas Peru LA2855 Mollinomuna, Celica Loja Ecuador LA2860* Cariamanga Loja Ecuador LA2861 Las Juntas Loja Ecuador LA2863 Macara Loja Ecuador LA2864 Sozorango Loja Ecuador LA2869 Matola-La Toma Loja Ecuador LA3862 Purunuma Loja Ecuador LA3863 Sozoranga Loja Ecuador LA3864 Yangana Loja Ecuador Total 42 accessions.

L. parviflorum (S. neorickii) LA0247* Chavinillo Huanuco Peru LA0735 Huanuco to Cerro de Pasco Huanuco Peru LA1319 Abancay Apurimac Peru LA1321 Curahuasi Apurimac Peru LA1322* Limatambo Cusco Peru LA1326 Rio Pachachaca Apurimac Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. parviflorum (S. neorickii) LA1329* Yaca Apurimac Peru LA1626A* Mouth of Rio Rupac Ancash Peru LA1716* Huancabamba Piura Peru LA2072 Huanuco Huanuco Peru LA2073 Huanuco, N of San Rafael Huanuco Peru LA2074 Huanuco Huanuco Peru LA2075 Huanuco Huanuco Peru LA2113* La Toma Loja Ecuador LA2133* Ona Azuay Ecuador LA2190* Tialango Amazonas Peru LA2191 Campamento Ingenio Amazonas Peru LA2192 Pedro Ruiz Amazonas Peru LA2193 Churuja Amazonas Peru LA2194 Chachapoyas West Amazonas Peru LA2195 Caclic Amazonas Peru LA2197 Luya Amazonas Peru LA2198 Chachapoyas East Amazonas Peru LA2200* Choipiaco Amazonas Peru LA2201 Pipus Amazonas Peru LA2202 Tingobamba Amazonas Peru LA2315 Sargento Amazonas Peru LA2317 Zuta Amazonas Peru LA2318 Lima Tambo Amazonas Peru LA2319* Chirico Amazonas Peru LA2325* Above Balsas Amazonas Peru LA2403 Wandobamba Huanuco Peru LA2614 San Rafael Huanuco Peru LA2615 Ayancocho Huanuco Peru LA2639A Puente Cunyac Apurimac Peru LA2641 Nacchera Apurimac Peru LA2727 Ona Azuay Ecuador LA2847 Suyubamba Amazonas Peru LA2848 Pedro Ruiz Amazonas Peru LA2862 Saraguro-Cuenca Azuay Ecuador LA2865 Rio Leon Azuay Ecuador LA2913 Uchucyaco - Hujainillo Huanuco Peru LA3651 Matara Apurimac Peru LA3655 Casinchigua to Chacoche Apurimac Peru LA3657 Casinchigua to Pichirhua Apurimac Peru LA3660 Murashaya Apurimac Peru LA3793 Huariaca to San Rafael Huanuco Peru LA4020 Gonozabal Loja Ecuador LA4021 Guancarcucho Azuay Ecuador LA4022 Pueblo Nuevo Azuay Ecuador LA4023 Paute Azuay Ecuador Total 51 accessions.

STOCK LISTS TGC REPORT 57, 2007 ______L. pennellii (S. pennellii) LA0716* Atico Arequipa Peru LA0751 Sisacaya Lima Peru LA1272* Pisaquera Lima Peru LA1273 Cayan Lima Peru LA1275 Quilca road junction Lima Peru LA1277* Trapiche Lima Peru LA1282* Sisacaya Lima Peru LA1297 Pucara Lima Peru LA1299 Santa Rosa de Quives Lima Peru LA1303 Pampano Huancavelica Peru LA1340* Capillucas Lima Peru LA1356 Moro Ancash Peru LA1367* Santa Eulalia Lima Peru LA1376 Sayan Lima Peru LA1515 Sayan to Churin Lima Peru LA1522* Quintay Lima Peru LA1656* Marca to Chincha Ica Peru LA1657 Buena Vista to Yautan Ancash Peru LA1674* Toparilla Canyon Lima Peru LA1693 Quebrada Machurango Lima Peru LA1724 La Quinga Ica Peru LA1732* Rio San Juan Huancavelica Peru LA1733 Rio Canete Lima Peru LA1734 Rio Canete Lima Peru LA1735 Rio Canete Lima Peru LA1809 El Horador (playa) Piura Peru LA1940 Rio Atico, Km 26 Arequipa Peru LA1941 Rio Atico, Km 41 Arequipa Peru LA1942 Rio Atico, Km 54 Arequipa Peru LA1943 Rio Atico, Km 61 Arequipa Peru LA1946* Caraveli Arequipa Peru LA2560* Santa to Huaraz Ancash Peru LA2580* Valle de Casma Ancash Peru LA2657 Bayovar Piura Peru LA2963* Acoy Arequipa Peru LA3635 Omas Lima Peru LA3788 Rio Atico, Km 10 Arequipa Peru LA3789 Rio Atico, Km 26 Arequipa Peru LA3791 Caraveli Arequipa Peru Total 39 accessions.

L. pennellii var. puberulum (S. pennellii) LA0750 Ica to Nazca Ica Peru LA1302* Quita Sol Ica Peru LA1649 Molina Ica Peru LA1911 Locari Ica Peru LA1912 Cerro Locari Ica Peru LA1920* Cachiruma (Rio Grande) Ayacucho Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. pennellii var. puberulum (S. pennellii) LA1926 Agua Perdida (Rio Ingenio) Ica Peru LA3665 Ica to Nazca (Rio Santa Cruz) Ica Peru LA3778 Palpa to Nazca Ica Peru Total 9 accessions.

L. peruvianum (S. peruvianum, S. arcanum, or S. huaylasense) LA0098 Chilca Lima Peru LA0103* Cajamarquilla Lima Peru LA0107* Hacienda San Isidro, Rio Canete Lima Peru LA0110 Cajacay Ancash Peru LA0111 Supe Lima Peru LA0153* Culebras Ancash Peru LA0370 Hacienda Huampani Lima Peru LA0371 Supe Lima Peru LA0372 Culebras #1 Ancash Peru LA0374 Culebras #2 Ancash Peru LA0378a Cascas Cajamarca Peru LA0392a Llallan Cajamarca Peru LA0441*a Cerro Campana La Libertad Peru LA0444* Chincha #1 Ica Peru LA0445 Chincha #2 Ica Peru LA0446* Atiquipa Arequipa Peru LA0448 Chala Arequipa Peru LA0451 Arequipa Arequipa Peru LA0453 Yura Arequipa Peru LA0454 Tambo Arequipa Peru LA0455 Tambo Arequipa Peru LA0462 Sobraya Tarapaca Chile LA0464 Hacienda Rosario Tarapaca Chile LA0752* Sisacaya Lima Peru LA1027a Cajamarca Peru LA1031a Balsas Amazonas Peru LA1032a Aricapampa La Libertad Peru LA1133 Huachipa Lima Peru LA1161 Huachipa Lima Peru LA1270 Pisiquillo Lima Peru LA1271 Horcon Lima Peru LA1274* Pacaibamba Lima Peru LA1278 Trapiche Lima Peru LA1281 Sisacaya Lima Peru LA1300 Santa Rosa de Quives Lima Peru LA1304 Pampano Huancavelica Peru LA1305* Ticrapo Huancavelica Peru LA1331* Nazca Ica Peru LA1333 Loma Camana Arequipa Peru LA1336* Atico Arequipa Peru LA1337 Atiquipa Arequipa Peru LA1339* Capillucas Lima Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. peruvianum (S. peruvianum, S. arcanum, or S. huaylasense) LA1346* Casmiche La Libertad Peru LA1350 Chauna Cajamarca Peru LA1351a Rupe Cajamarca Peru LA1358 Yautan Ancash Peru LA1360* Pariacoto Ancash Peru LA1364*h Alta Fortaleza Ancash Peru LA1365* Caranquilloc Ancash Peru LA1368 San Jose de Palla Lima Peru LA1369 San Geronimo Lima Peru LA1373 Asia Lima Peru LA1377 Navan Lima Peru LA1379 Caujul Lima Peru LA1394a Balsas - Rio Utcubamba Amazonas Peru LA1395a Chachapoyas Amazonas Peru LA1396a Balsas (Chachapoyas) Amazonas Peru LA1473 Callahuanca, Santa Eulalia valley Lima Peru LA1474* Lomas de Camana Arequipa Peru LA1475 Fundo 'Los Anitos', Barranca Lima Peru LA1513 Atiquipa Arequipa Peru LA1517 Irrigacion Santa Rosa Lima Peru LA1537 (self-compatible selection) LA1554 Huaral to Cerro de Pasco, Rio Chancay Lima Peru LA1556 Hacienda Higuereta Lima Peru LA1609 Asia - El Pinon Lima Peru LA1616 La Rinconada Lima Peru LA1626*a Mouth of Rio Rupac Ancash Peru LA1647* Huadquina, Topara Ica Peru LA1653 Uchumayo, Arequipa Arequipa Peru LA1675 Toparilla Canyon Lima Peru LA1677* Fundo Huadquina, Topara Ica Peru LA1692 Putinza Lima Peru LA1694 Cacachuhuasiin, Cacra Lima Peru LA1708*a Chamaya to Jaen Cajamarca Peru LA1744 Putinza Lima Peru LA1910* Tambillo Huancavelica Peru LA1913 Tinguiayog Ica Peru LA1929 La Yapana (Rio Ingenio) Ica Peru LA1935 Lomas de Atiquipa Arequipa Peru LA1937* Quebrada Torrecillas Arequipa Peru LA1944 Rio Atico Arequipa Peru LA1945* Caraveli Arequipa Peru LA1947 Puerto Atico Arequipa Peru LA1949 Las Calaveritas Arequipa Peru LA1951 Ocona Arequipa Peru LA1954* Mollendo Arequipa Peru LA1955 Matarani Arequipa Peru LA1973* Yura Arequipa Peru LA1975 Desvio Santo Domingo Lima Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. peruvianum (S. peruvianum, S. arcanum, or S. huaylasense) LA1977 Orcocoto Lima Peru LA1981h Vocatoma Ancash Peru LA1982*h Huallanca Ancash Peru LA1983h Rio Manta Ancash Peru LA1984*a Otuzco La Libertad Peru LA1985a Casmiche La Libertad Peru LA1989 (self-fertile, bilaterally compat. selection) LA2068 Chasquitambo Ancash Peru LA2157a Tunel Chotano Cajamarca Peru LA2163* Cochabamba to Yamaluc Cajamarca Peru LA2164a Yamaluc Cajamarca Peru LA2172*a Cuyca Cajamarca Peru LA2185*a Pongo de Rentema Amazonas Peru LA2326*a Above Balsas Amazonas Peru LA2327a Aguas Calientes Cajamarca Peru LA2328*a Aricapampa La Libertad Peru LA2330a Chagual La Libertad Peru LA2331a Agallapampa La Libertad Peru LA2333 Casmiche La Libertad Peru LA2388a Cochabamba to Huambos (Chota) Cajamarca Peru LA2553*a Balconcillo de San Marcos Cajamarca Peru LA2555a Marical - Castilla La Libertad Peru LA2561h Huallanca Ancash Peru LA2562h Canyon del Pato Ancash Peru LA2563 Canon del Pato Ancash Peru LA2565 Potrero de Panacocha a Llamellin Ancash Peru LA2566 Cullachaca Ancash Peru LA2573 Valle de Casma Ancash Peru LA2575 Valle de Casma Ancash Peru LA2581 Chacarilla (4x) Tarapaca Chile LA2717 Chilca Lima Peru LA2721 Putinza Lima Peru LA2724 Huaynilla Lima Peru LA2732* Moquella Tarapaca Chile LA2742 Camarones-Guancarane Tarapaca Chile LA2744* Sobraya Tarapaca Chile LA2745 Pan de Azucar Tarapaca Chile LA2770 Lluta Tarapaca Chile LA2808*h Huaylas Ancash Peru LA2809h Huaylas Ancash Peru LA2834 Hacienda Asiento Ica Peru LA2959 Chaca to Caleta Vitor Tarapaca Chile LA2962 Echancay Arequipa Peru LA2964 Quebrada de Burros Tacna Peru LA2981B Torata to Chilligua Moquegua Peru LA3154 Otora-Puente Jahuay Moquegua Peru LA3156 Omate Valley Moquegua Peru LA3218 Quebrada Guerrero (Islay) Arequipa Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. peruvianum (S. peruvianum, S. arcanum, or S. huaylasense) LA3219 Catarindo (Islay) Arequipa Peru LA3220 Cocachacra Arequipa Peru LA3636 Coayllo Lima Peru LA3637 Coayllo Lima Peru LA3639 Ccatac Lima Peru LA3640 Mexico City Mexico LA3664 Nazca grade Ica Peru LA3666 La Yapa Ica Peru LA3781 Quebrada Oscollo (Atico) Arequipa Peru LA3783 Rio Chaparra Arequipa Peru LA3787 Alta Chaparra Arequipa Peru LA3790 Caraveli Arequipa Peru LA3795 Alta Fortaleza Ancash Peru LA3797 Anca, Marca (Rio Fortaleza) Ancash Peru LA3799 Río Pativilca Ancash Peru LA3853 Mollepampa La Libertad Peru LA3858 Canta Lima Peru LA3900 (CMV tolerant selection) LA4125 Camina Tarapaca Chile LA4128 Pachica (Rio Camarones) Tarapaca Chile LA4316 Kuntur Wasi Cajamarca Peru LA4317 Rio Lluta, desembocadura Tarapaca Chile LA4318 Sora - Molinos, Rio Lluta Tarapaca Chile LA4325 Caleta Vitor Tarapaca Chile LA4328 Pachica, Rio Camarones Tarapaca Chile Total 163 accessions. h = S. huaylasense a = S. arcanum

L. peruvianum f. glandulosum (S. corneliomulleri) LA0364 9 Km W of Canta Lima Peru LA0366 12 Km W of Canta Lima Peru LA1283 Santa Cruz de Laya Lima Peru LA1284 Espiritu Santo Lima Peru LA1292* San Mateo Lima Peru LA1293 Matucana Lima Peru LA1294 Surco Lima Peru LA1296 Tornamesa Lima Peru LA1551 Rimac Valley, Km 71 Lima Peru LA1552 Rimac Valley, Km 93 Lima Peru LA1646 Yaso Lima Peru LA1722 Ticrapo Viejo Huancavelica Peru LA1723 La Quinga Ica Peru Total 13 accessions.

L. peruvianum var. humifusum (S. arcanum) LA0385 San Juan Cajamarca Peru LA0389 Abra Gavilan Cajamarca Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. peruvianum var. humifusum (S. arcanum) LA2150 Puente Muyuno Cajamarca Peru LA2151 Morochupa Cajamarca Peru LA2152* San Juan #1 Cajamarca Peru LA2153 San Juan #2 Cajamarca Peru LA2334 San Juan Cajamarca Peru LA2548 La Muyuna Cajamarca Peru LA2550 El Tingo, Chorpampa Cajamarca Peru LA2582 San Juan (4x) Cajamarca Peru LA2583 (4x) Total 11 accesesions.

L. pimpinellifolium (S. pimpinellifolium) LA0100 La Cantuta (Rimac Valley) Lima Peru LA0114 Pacasmayo La Libertad Peru LA0121 Trujillo La Libertad Peru LA0122 Poroto La Libertad Peru LA0369 La Cantuta (Rimac Valley) Lima Peru LA0373* Culebras #1 Ancash Peru LA0375 Culebras #2 Ancash Peru LA0376 Hacienda Chiclin La Libertad Peru LA0381 Pongo La Libertad Peru LA0391 Magdalena (Rio Jequetepeque) Cajamarca Peru LA0397 Hacienda Tuman Lambayeque Peru LA0398 Hacienda Carrizal Cajamarca Peru LA0400* Hacienda Buenos Aires Piura Peru LA0411* Pichilingue Los Rios Ecuador LA0412 Pichilingue Los Rios Ecuador LA0413 Cerecita Guayas Ecuador LA0417* Puna Guayas Ecuador LA0418 Daule Guayas Ecuador LA0420 El Empalme Guayas Ecuador LA0442* Sechin Ancash Peru LA0443 Pichilingue Los Rios Ecuador LA0480 Hacienda Santa Inez Ica Peru LA0722 Trujillo La Libertad Peru LA0753 Lurin Lima Peru LA1236 Tinelandia, Santo Domingo Pichincha Ecuador LA1237* Atacames Esmeraldas Ecuador LA1242 Los Sapos Guayas Ecuador LA1243 Co-op Carmela Guayas Ecuador LA1245* Santa Rosa El Oro Ecuador LA1246* La Toma Loja Ecuador LA1248 Hacienda Monterrey Loja Ecuador LA1256 Naranjal Guayas Ecuador LA1257 Las Mercedes Guayas Ecuador LA1258 Voluntario de Dios Guayas Ecuador LA1259 Catarama Los Rios Ecuador LA1260 Pueblo Viejo Los Rios Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. pimpinellifolium (S. pimpinellifolium) LA1261* Babahoyo Los Rios Ecuador LA1262 Milagro Empalme Guayas Ecuador LA1263 Barranco Chico Guayas Ecuador LA1269 Pisiquillo Lima Peru LA1279* Cieneguilla Lima Peru LA1280 Chontay Lima Peru LA1301* Hacienda San Ignacio Ica Peru LA1332 Nazca Ica Peru LA1335* Pescaderos Arequipa Peru LA1341 Huampani Lima Peru LA1342 Casma Ancash Peru LA1343 Puente Chao La Libertad Peru LA1344 Laredo La Libertad Peru LA1345 Samne La Libertad Peru LA1348 Pacasmayo La Libertad Peru LA1349 Cuculi Lambayeque Peru LA1355 Nepena Ancash Peru LA1357 Jimbe Ancash Peru LA1359 La Crau Ancash Peru LA1370 San Jose de Palla Lima Peru LA1371* Santa Eulalia Lima Peru LA1374 Ingenio Ica Peru LA1375* San Vicente de Canete Lima Peru LA1380 Chanchape Piura Peru LA1381 Naupe Lambayeque Peru LA1382 Chachapoyas to Balsas Amazonas Peru LA1383 Chachapoyas to Bagua Amazonas Peru LA1384 Quebrada Parca Lima Peru LA1416 Las Delicias Pichincha Ecuador LA1428 La Estancilla Manabi Ecuador LA1466 Chongoyape Lambayeque Peru LA1469 El Pilar, Olmos Lambayeque Peru LA1470 Motupe to Desvio Olmos-Bagua Lambayeque Peru LA1471 Motupe to Jayanca Lambayeque Peru LA1472 Quebrada Topara Lima Peru LA1478* Santo Tome (Pabur) Piura Peru LA1514 Sayan to Churin Lima Peru LA1519 Vitarte Lima Peru LA1520 Sayan to Churin Lima Peru LA1521* El Pinon, Asia Lima Peru LA1547* Chota to El Angel Carchi Ecuador LA1561 San Eusebio Lima Peru LA1562 Cieneguilla Lima Peru LA1571 San Jose de Palle Lima Peru LA1572 Hacienda Huampani Lima Peru LA1573 Nana Lima Peru LA1575 Huaycan Lima Peru LA1576* Manchay Alta Lima Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. pimpinellifolium (S. pimpinellifolium) LA1577 Cartavio La Libertad Peru LA1578* Santa Marta La Libertad Peru LA1579 Colegio Punto Cuatro #1 Lambayeque Peru LA1580 Colegio Punto Cuatro #2 Lambayeque Peru LA1581 Punto Cuatro Lambayeque Peru LA1582* Motupe Lambayeque Peru LA1583 Tierra de la Vieja Lambayeque Peru LA1584* Jayanca to La Vina Lambayeque Peru LA1585 Cuculi Lambayeque Peru LA1586* Zana, San Nicolas La Libertad Peru LA1587 San Pedro de Lloc La Libertad Peru LA1588 Laredo to Barraza La Libertad Peru LA1589 Viru to Galunga La Libertad Peru LA1590* Viru to Tomaval La Libertad Peru LA1591 Ascope La Libertad Peru LA1592 Moche La Libertad Peru LA1593* Puente Chao La Libertad Peru LA1594 Cerro Sechin Ancash Peru LA1595 Nepena to Samanco Ancash Peru LA1596 Santa to La Rinconada Ancash Peru LA1597 Rio Casma Ancash Peru LA1598 Culebras to La Victoria Ancash Peru LA1599* Huarmey Ancash Peru LA1600 Las Zorras, Huarmey Ancash Peru LA1601 La Providencia Lima Peru LA1602* Rio Chillon to Punchauca Lima Peru LA1603 Quilca Lima Peru LA1604 Horcon Lima Peru LA1605 Canete - San Antonio Lima Peru LA1606* Tambo de Mora Ica Peru LA1607 Canete - La Victoria Lima Peru LA1608 Canete - San Luis Lima Peru LA1610 Asia - El Pinon Lima Peru LA1611 Rio Mala Lima Peru LA1612 Rio Chilca Lima Peru LA1613 Santa Eusebia Lima Peru LA1614 Pampa Chumbes Lima Peru LA1615 Piura to Simbala Piura Peru LA1617* Tumbes South Tumbes Peru LA1618 Tumbes North Tumbes Peru LA1628 Huanchaco La Libertad Peru LA1629 Barrancos de Miraflores Lima Peru LA1630 Fundo La Palma Ica Peru LA1631 Planta Envasadora San Fernando (Moche) La Libertad Peru LA1633 Co-op Huayna Capac Ica Peru LA1634 Fundo Bogotalla #1 Ica Peru LA1635 Fundo Bogotalla #2 Ica Peru LA1636 Laran Ica Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. pimpinellifolium (S. pimpinellifolium) LA1637 La Calera Ica Peru LA1638 Fundo El Portillo Lima Peru LA1645 Banos de Miraflores Lima Peru LA1651 Vivero, La Molina Lima Peru LA1652 Cieneguilla Lima Peru LA1659* Pariacoto Ancash Peru LA1660 Yautan to Pariacoto Ancash Peru LA1661 Esquina de Asia Lima Peru LA1670 Rio Sama Tacna Peru LA1676 Fundo Huadquina, Topara Ica Peru LA1678 San Juan Lucumo de Topara Ica Peru LA1679 Tambo de Mora Ica Peru LA1680 La Encanada Lima Peru LA1682 Montalban, San Vicente Lima Peru LA1683* Miramar Piura Peru LA1684 Chulucanas Piura Peru LA1685 Marcavelica Piura Peru LA1686 Valle Hermosa #1 Piura Peru LA1687 Valle Hermoso #2 Piura Peru LA1688 Pedregal Piura Peru LA1689* Castilla #1 Piura Peru LA1690 Castilla #2 Piura Peru LA1697 Hacienda Quiroz, Santa Anita Lima Peru LA1719 E of Arenillas El Oro Ecuador LA1720 Yautan Ancash Peru LA1728 Rio San Juan Ica Peru LA1729 Rio San Juan Ica Peru LA1742 Olmos-Marquina Lambayeque Peru LA1781 Bahia de Caraquez Manabi Ecuador LA1921 Majarena Ica Peru LA1923 Cabildo Ica Peru LA1924* Piedras Gordas Ica Peru LA1925 Pangaravi Ica Peru LA1933 Jaqui Arequipa Peru LA1936 Huancalpa Arequipa Peru LA1950 Pescadores Arequipa Peru LA1987 Viru-Fundo Luis Enrique La Libertad Peru LA1992 Pichicato Lima Peru LA1993 Chicama Valley? Lima Peru LA2093 La Union El Oro Ecuador LA2096 Playa Loja Ecuador LA2097 Macara Loja Ecuador LA2102* El Lucero Loja Ecuador LA2112 Hacienda Monterrey Loja Ecuador LA2145 Juan Montalvo Los Rios Ecuador LA2146 Limoncarro La Libertad Peru LA2147 Yube Cajamarca Peru LA2149 Puente Muyuno Cajamarca Peru

STOCK LISTS TGC REPORT 57, 2007 ______L. pimpinellifolium (S. pimpinellifolium) LA2170 Pai Pai Cajamarca Peru LA2173* Cruz de Huayquillo Cajamarca Peru LA2176 Timbaruca Cajamarca Peru LA2178 Tororume Cajamarca Peru LA2179 Tamboripa - La Manga Cajamarca Peru LA2180 La Coipa Cajamarca Peru LA2181* Balsa Huaico Cajamarca Peru LA2182 Cumba Amazonas Peru LA2183* Corral Quemado Amazonas Peru LA2184 Bagua Amazonas Peru LA2186 El Salao Amazonas Peru LA2187 La Caldera Amazonas Peru LA2188 Machugal #1 Amazonas Peru LA2189 Machugal #2 Amazonas Peru LA2335 (tetraploid) LA2340 (tetraploid) LA2345 (autodiploid) LA2346 (autodiploid) LA2347 (autodiploid) LA2348 (l, x) LA2389 Tembladera Cajamarca Peru LA2390 Chungal Cajamarca Peru LA2391 Chungal to Monte Grande Cajamarca Peru LA2401* Moxeque Ancash Peru LA2412 Fundo Don Javier, Chilca Lima Peru LA2533* Lomas de Latillo Lima Peru LA2576 Valle de Casma Ancash Peru LA2578 Tuturo Ancash Peru LA2585 (4x) LA2645 Desvio Chulucanas-Morropon Piura Peru LA2646 Chalaco Piura Peru LA2647 Morropon-Chalaco Piura Peru LA2652 Sullana Piura Peru LA2653 San Francisco de Chocon Querecotillo Piura Peru LA2655 La Huaca to Sullana Piura Peru LA2656 Suarez Tumbes Peru LA2659 Castilla, Univ. Nac. de Piura Piura Peru LA2718 Chilca Lima Peru LA2725 Tambo Colorado Ica Peru LA2805 LA2831 Rio Nazca Ica Peru LA2832 Chicchi Tara Ica Peru LA2833 Hacienda Asiento Ica Peru LA2836 Fundo Pongo Ica Peru LA2839 Tialango Amazonas Peru LA2840 San Hilarion de Tomaque Amazonas Peru LA2850 Santa Rosa, Manta Manabi Ecuador LA2851 La Carcel de Montecristo Manabi Ecuador

STOCK LISTS TGC REPORT 57, 2007 ______L. pimpinellifolium (S. pimpinellifolium) LA2852* Cirsto Rey de Charapoto Manabi Ecuador LA2853 Experiment Station, Portoviejo-INIAP Manabi Ecuador LA2854 Jipijapa Manabi Ecuador LA2857 Isabela: Puerto Villamil Galapagos Islands Ecuador LA2866 Via a Amaluza Loja Ecuador LA2914A Urb. La Castellana, Surco Lima Peru LA2914B La Castellana, Surco Lima Peru LA2915 El Remanso de Olmos Lambayeque Peru LA2934 Carabayllo Lima Peru LA2966 La Molina Lima Peru LA2974 Huaca del Sol La Libertad Peru LA2982 Chilca #1 Lima Peru LA2983 Chilca #2 Lima Peru LA3158 Los Mochis Sinaloa Mexico LA3159 Los Mochis Sinaloa Mexico LA3160 Los Mochis Sinaloa Mexico LA3161 Los Mochis Sinaloa Mexico LA3468 La Molina Vieja Lima Peru LA3634 Santa Rosa de Asia Lima Peru LA3638 Ccatac Lima Peru LA3798 Río Pativilca Ancash Peru LA3803 Pacanguilla La Libertad Peru LA3852 Atinchik, Pachacamac Lima Peru LA3859 (TYLCV resistant selection) LA3910 Near tortoise preserve, Santa Cruz Galapagos Islands Ecuador LA4027 Olmos-Jaen Road Lambayeque Peru LA4138 El Corregidor, La Molina Lima Peru Total 255 accessions.

S. juglandifolium LA2120 Sabanilla Zamora-Chinchipe Ecuador LA2134 Tinajillas Zamora-Chinchipe Ecuador LA2788 Quebrada la Buena Antioquia Colombia LA3322 Quito Pinchincha Ecuador LA3323 Manuel Cornejo Astorga Pinchincha Ecuador LA3324 Sabanillas Zamora-Chinchipe Ecuador LA3325 Cordillera de los Huacamayos Morona Santiago Ecuador LA3326 San Ysidro de Yungilla Chimborazo Ecuador Total 8 accessions. (some available only in limited seed quantities or unavailable).

S. lycopersicoides LA1964 Chupapalca Tacna Peru LA1966 Palca Tacna Peru LA1990 Palca Tacna Peru LA2385 Chupapalca to Ingenio Tacna Peru LA2386 Chupapalca Tacna Peru LA2387 Lago Aricota (Tarata) Tacna Peru LA2407 Arica to Putre Tarapaca Chile

STOCK LISTS TGC REPORT 57, 2007 ______S. lycopersicoides LA2408 Above Putre Tarapaca Chile LA2730 Moquella Tarapaca Chile LA2772 Zapahuira Tarapaca Chile LA2776 Catarata Perquejeque Tarapaca Chile LA2777 Putre Tarapaca Chile LA2781 Desvio a Putre Tarapaca Chile LA2951 Quistagama Tarapaca Chile LA4018 Lago Aricota Tacna Peru LA4123 Camina Tarapaca Chile LA4126 Camina - Nama Tarapaca Chile LA4130 Pachica (Rio Camarones) Tarapaca Chile LA4131 Esquina Tarapaca Chile LA4320 Alto Rio Lluta Tarapaca Chile LA4322 Quebrada Cardones Tarapaca Chile LA4323 Putre Tarapaca Chile LA4326 Cochiza, Rio Camarones Tarapaca Chile Total 23 accessions.

S. ochranthum LA2118 San Lucas Loja Ecuador LA2160 Acunac Cajamarca Peru LA2161 Cruz Roja Cajamarca Peru LA2162 Yatun Cajamarca Peru LA2166 Rocoto-Pacopampa Cajamarca Peru LA2682 Chinchaypujio Cusco Peru LA3647 Chinchaypujio Cusco Peru LA3649 Curpahuasi – Pacaipampa Apurimac Peru LA3650 Choquemaray Apurimac Peru Total 9 accessions.

S. sitiens LA1974 Chuquicamata Antofagasta Chile LA2876 Chuquicamata Antofagasta Chile LA2877 El Crucero Antofagasta Chile LA2878 Mina La Exotica Antofagasta Chile LA2885 Caracoles Antofagasta Chile LA4105 Mina La Escondida Antofagasta Chile LA4110 Mina San Juan Antofagasta Chile LA4112 Aguada Limon Verde Antofagasta Chile LA4113 Estacion Cere Antofagasta Chile LA4114 Pampa Carbonatera Antofagasta Chile LA4115 Quebrada desde Cerro Oeste de Paqui Antofagasta Chile LA4116 Quebrada de Paqui Antofagasta Chile LA4331 Cerro Quimal Antofagasta Chile Total 13 accessions.

MEMBERSHIP LIST TGC REPORT 57, 2007 ______Membership List

Aarden, Harriette, Western Seed International BV, Burgemeester Elsenweg 53, Naaldwik, Holland, THE NETHERLANDS, 2671 DP, [email protected]

Adams, Dawn, Campbell, R & D, 28065 CR 104, Davis, CA, USA, 95616, [email protected]

Bar, Moshe, Zeraim Gedera LTD, Seed Co, P.O. Box 103, Gedera, ISRAEL, 70750, [email protected]

Barker, Susan, University of Western Australia, School of Plant Biology M084, 35 Stirling Hwy, Crawley, WA, AUSTRALIA, 6009, [email protected]

Beck Bunn, Teresa, Seminis Veg Seeds, 37437 State Hwy 16, Woodland, CA, USA, 95695, [email protected]

Bontems, Sylvain, Syngenta Seeds, Domaine du Moulin, Sarrains, FRANCE, 84360

Bosveld, Paul, H.J. Heinz Co. of Canada, Erie St South, Leamington, Ontario, CANADA, N8H 3W8

Brusca, James, Harris Moran Seed Co, 9241 Mace Blvd, Davis, CA, USA, 95616, [email protected]

Buonfiglioli, Carlo, Della Rimembranze nr. 6A, San Lazzaro di Savena, Bologna, ITALY, 40068, [email protected]

Burdick, Allan, 3000 Woodkirk Dr., Columbia, MO, USA, 65203, [email protected]

California Tomato Research Institute, Inc., Library, 18650 E. Lone Tree Rd., Escalon, CA, USA, 95320-9759

Carrijo, Iedo Valentim, Rua Joao Angelo do Pinho 77 Apto 102, Betim, MG, BRAZIL, 32.510-040, [email protected]

Chetelat, Roger, University of California, Dept of Veg Crops, One Shields Ave, Davis, CA, USA, 95616-8746, [email protected]

Cirrulli, Matteo, Universita degli Studi di Bari, Dipartimento di Biol. E Patologia Veget., Via Amendola 165-A, Bari , ITALY, 70126, [email protected]

Cuartero, Jesus, E.E. LaMayora- CSIC, Algarrobo-Costa, Malaga, SPAIN, 29750

MEMBERSHIP LIST TGC REPORT 57, 2007 ______deHoop, Simon Jan, East West Seed Co. Ltd, PO Box 3, Bang Bua Thong, Nonthaburi, THAILAND, 11110, [email protected]

Dhaliwal, M.S., Department of Vegetable Crops, P.A.U. Ludhiana, PANJAB, INDIA, 141004,

Dick, Jim, Tomato Solutions, 23264 Mull Rd, Chatham, Ontario, CANADA, N7M 5J4, [email protected]

Fellner, Martin, Acad. of Sci. of the Czech Rep, Inst. Of Expt. Botany, Slechtitelu 11, Olomouc-Holice, CZECH REPUBLIC, 78371, [email protected]

Fernandez-Munoz, Rafael, E.E. LaMayora- CSIC, Algarrobo-Costa, Malaga, SPAIN, 29750, [email protected]

Fleck, Chuck, ConAgra Foods, 2121 2nd St #B-102, Davis, CA, USA, 95616

Francis, David, The Ohio State University, Hort and Crop Sci, 1680 Madison Ave, Wooster, OH, USA, 44691, [email protected]

Ganal, Martin, TraitGenetics GmbH, Am Schwabeplan 1b, D-06466 Gatersleben, GERMANY, [email protected]

Georgiev, Hristo Atanasov, POB 373, Telde, Las Palmas de Gran Canaria, SPAIN, 35200, [email protected]

Goldman, Amy P., Rare Forms, 164 Mt View Rd, Rhinebeck, NY, USA, 12572, [email protected]

Grivet, Laurent, Syngenta Seeds, 12 Chemin de l'Hobit BP 27, Saint Sauveur, FRANCE, F- 31790, [email protected]

Hadapad, Shreeshail, May Seed Co, Sr Vegetable Breeder, Samanli, Mah. Yigitler Cad. No 28, Vildirim, Bursa, TURKEY, 16280, [email protected]

Hayashi, Masako Yaguchi, Asahi Industries, Biol.Engineering Lab, 222 Watarase, Kamikawa, Kodama-gun, Saitama-ken, JAPAN, 367-0394, [email protected]

Herlaar, Fritz, Enza Zaden Export B.V., P.O. Box 7, AA Enkhuizen, THE NETHERLANDS, 1600, [email protected]

Hernandez, Ambrosio, Western Seed Semillas SA, Apdo de Correos 22, Carrizal Ingenio, Las Palmas, SPAIN, 35240

Hoogstraten, Jaap, Seminis Veg Seeds, Postbus 97, 6700 AB Wageningen, THE NETHERLANDS

MEMBERSHIP LIST TGC REPORT 57, 2007 ______Inai, Shuji, Nippon Del Monte Corp., Research and Development, 3748 Shimizu-Cho, Numata, Gunma-ken, JAPAN, 378-0016

Iwasaki, Shunya, Sakata Seed Co., Kimitu Station, 358 Uchikoshi, Sodegaura, Chiba, JAPAN, 299-0217, [email protected]

Jacoby, Daniel, 1957 N. Honore Ave. , Apt C215, Sarasota, FL, USA, 34235

Kaplan, Boaz, Nirit Seeds, Ltd, , P.O. Box 95, Moshav Hadar, Am, ISRAEL, 42935, [email protected]

Kedar, N, Hebrew University, Ag, Food & Enviro Quality Sciences, P.O.B. 12, Rehovot, ISRAEL, 76100, [email protected]

Kuehn, Michael, Harris-Moran Seed Co, 1102 Griffin Way, Winters, CA, USA, 95694-2322, [email protected]

Lewis, Mark, Sakata Seed America, 105 Boronda Rd, Salinas, CA, USA, 93907, [email protected]

Liedl, Barbara, WVSU, 201 ACEOP Admin Bldg, PO Box 1000, Institute, WV, USA, 25112-1000, [email protected]

Maris, Paul, DeRuiter Seeds, R&D NL BV, Leeuwenhoekweg 52, Bergschenhoek, THE NETHERLANDS, 2661CZ, [email protected]

Maxwell, Douglas P., Univ. of WI, Dept of Plant Pathology-Russell Laboratories, 1630 Linden Drive, Madison, WI, USA, 53706-1598

McGlasson, Barry, University of Western Sydney, Centre for Plant and Food Science, Locked Bag 1797, Penrith South DC, NSW, AUSTRALIA, 1797, [email protected]

Min, Chai, Beijing Vegetable Research Center (BVRC), PO Box 2443, Beijing, PEOPLES REPUBLIC of CHINA, 100089, [email protected]

Miranda, Baldwin, 1519 Ivygate Ln, Naples, FL, USA, 34105, [email protected]

Murao, Kazunori, Sakata Seed Co., Kimitu Station, 358 Uchikoshi, Sodegaura, , Chiba, JAPAN, 299-0217

Myers, Jim, Oregon State University, Dept. of Horticulture, rm 4017, Ag & Life Sci Bldg., Corvallis, OR, USA, 97331, [email protected]

Nakamura, Kosuke, Kagome Co. Ltd., 17 Nishitomiyama, Nasushiobarashi, Tochigi, JAPAN, 329-2762, [email protected]

MEMBERSHIP LIST TGC REPORT 57, 2007 ______

Nguyen, Vinh Huv, EastWest Seed Vietnam, Xuan Thoi Thuong, Hoc Mon Dist, Ho Chi Minh City, VIETNAM, [email protected]

Ozminkowski, Richard, Heinz N.A., PO Box 57, Stockton, CA, USA, 95201, [email protected]

Pape, Greg, 1181 Trieste Dr, Hollister, CA, USA, 95023

Sasaki, Seiko, Plant Breeding Station of Kaneko Seeds, 50-12, Furuichi-machi 1-chome, Maebashi City, Gunma, JAPAN, 371-0844,

Schaareman, Rob, Syngenta Seeds, Inc, Young Plant Production, Noordlierweg 14, DeLier, LV, THE NETHERLANDS, 2678

Schotte, TP, De Ruiter Seeds, R&D, Leeuwenhoekweg 52, THE NETHERLANDS, 2661 CZ,

Serquen, Felix, Syngenta Seeds, 21435 Road 98, Woodland, CA, USA, 95695, [email protected] Sharma, R.P., U. of Hyderabad, Dept. of Plant Sciences, School of Life Sciences, Hyderabad, INDIA, 500 046, [email protected]

Shintaku, Yurie, 2-10-2, Shimizu, Suginami-ku, Tokyo, JAPAN, 167-0033

Stack, Stephen, Colorado State U, Biology, Fort Collins, CO, USA, 80523-1878, [email protected]

Stamova, Boryana, 2825 Bidwell St, Apt 4, Davis, CA, USA, 95618

Stamova, Liliana, 1632 Santa Rosa St., Davis, CA, USA, 95616, [email protected]

Stevens, Mikel, Brigham Young Univ., 275 Widtsoe Bldg, PO. Box 25183, Provo, UT, USA, 84602, [email protected]

Stoeva-Popova, Pravda, Winthrop University, Department of Biology, 202 Life Sciences Building, Rock Hill, SC, USA, 29732, [email protected]

Stommel, John, USDA-ARS Vegetable Lab, Beltsville Ag. Res. Ctr., 10300 Baltimore Avenue, Beltsville, MD, USA, 20705, [email protected]

Takizawa, Kimiko, Japan Horticultural Production and Research Instit, 2-5-1 Kamishiki, Matsudo-shi, Chiba, JAPAN, 270-2221, [email protected] vanBetteray, Bram, Nunhems Netherlands BV, R& D Library, postbus 4005, Haelen, , THE NETHERLANDS, 6080AA, [email protected]

MEMBERSHIP LIST TGC REPORT 57, 2007 ______Vecchio, Franco, Nunhems Italy SRL, Via Ghiarone 2, Sant' Agata, Bolognese (BO), ITALY, 40019

Verhoef, Ruud, Rijk Zwaan Breeding BV, Postbus 40, ZG De Lier, THE NETHERLANDS, 2678

Verschave, Philippe, Vilmorin, Centre de Recherche la Costiere, Ledenon, , FRANCE, 30210, [email protected]

Volin, Ray, Western Seed Americas, Inc., 15165 Dulzura Ct, Rancho Murieta, CA, USA, 95683-9120, [email protected]

Vulkova, Zlatka, Agrbioinstitute, Blvd. Dragan Tsankov No. 8, Sofia, BULGARIA, 1163

Walker, Ryan, Campbell Seeds, R & D, 28605 CR 104, Davis, CA, USA, 95618, [email protected]

The University of Warwick, Library, Warwick HRI, Wellesbourne, Warwick, Warwickshire, UNITED KINGDOM, CV35 9EF, [email protected]

Wolff, David, Sakata Seed America, P.O. Box 1118, Lehigh Acres, FL, USA, 33970-1118, [email protected]

Zamir, Dani, Hebrew Univ of Jerusalem, Dept of Field Crops, POB 12, Rehovot, ISRAEL,

AUTHOR INDEX TGC REPORT 57, 2007 ______AUTHOR INDEX

Atanassov Atanas 41 Baldwin, E.A. 44 Bartz, J.A. 44 Betteray, Bram van 25 Boches, Peter S. 14 Brecht, J.K. 44 Chetelat, R. T. 47 Dick, Jim 20 El Mehrach, Khadija 31 Garcia, Brenda E. 21, 31, 37 Graham, Elaine 21 Hanson, Peter 21 Havey, Michael J. 25, 31 Jensen, Katie S. 21, 25, 31 Ji, Yuanfu 25 Kedar, N. 29 Klee, H.A. 44 Martin, Christopher T. 25, 31, 37 Maxwell, Douglas P. 21, 25, 31, 37 Mejía, Luis 21, 25, 31, 37 Melgar, Sergio 31 Memmott, Frederic D. 35 Montes, Luis 31 Myers, James R. 14 Olson, Steve 35, 44 Ortiz, Julieta 31 Price, David L. 35 Radkova, Mariana 41 Salus, Melinda S. 25, 31, 37 Sanchez, Amilcar 31 Schuster, D. 45 Scott, Jay W. 7, 25, 35, 44, 45 Seah, Stuart 37 Sims, C.A. 44 Smeets, Josie 25 Stevens Mikel R. 35 Stoeva-Popova, Pravda 41 Stoykova, Petya 41 Wang, Xingzhi 41 Williamson, Valerie M. 37 Zea, Carolina 31