6 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote Notes on the taxonomy of Actinote intensa Jordan (Lepidoptera: Nymphalidae: Heliconiinae) and the description of a new sibling species from eastern Ecuador Keith R. Willmott1, Gerardo Lamas2, and Jason P. W. Hall3 1. McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, Gainesville, Florida, USA; [email protected] 2. Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; [email protected] 3. Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington, DC 20560-0127, USA Abstract: We review the taxonomy of Actinote intensa Jordan stat. rest. and describe a new sibling species, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., from the east Andean slopes of central and southern Ecuador. The species are broadly sympatric, occur in the same sites throughout the more restricted range of the new species, and differ in a number of wing pattern characters, supported by a mean 2% pairwise divergence in their COI DNA barcodes. Resumen: Revisamos la taxonomía de la especie Actinote intensa Jordan stat. rest. y describimos una nueva especie relacionada, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., de las vertientes orientales de los Andes en el centro y sur del Ecuador. Las especies son simpátridas y ocurren en los mismos sitios en el rango más restringido de la especie nueva, y tienen una variedad de caracteres diferentes en el patrón del ala, apoyados por una divergencia promedio de 2% en sus codigos de barra del gen COI. Key words: Acraeini, Andes, cloud forest, cryptic species, DNA barcoding, Peru, wing pattern INTRODUCTION a number of species are very restricted in distribution and poorly represented in collections, and Lamas (2004) listed two Although not nearly as diverse as their Old World relatives, undescribed species under those generic names from Peru. the Neotropical Acraeini contains more than fifty species and Otherwise, no new species outside of Actinote s. s. have been the group has been the subject of a number of recent taxonomic described for more than 50 years, the most recent being Actinote studies. The generic classification of these species is currently rubrocellulata Hayward, 1960 (Lamas, 2004). unresolved, with Pierre (1987) placing all Neotropical species During a long-term survey of the butterflies of Ecuador, within the pantropical genus Acraea Fabricius, 1807, and we noticed that series from single sites of the species formerly the most recent classification (Lamas, 2004) dividing the known as “Actinote radiata” (e.g., Jordan, 1913; D’Abrera, same species among three genera, Actinote Hübner, [1819], 1987; Lamas, 2004) often apparently contained two distinct Altinote Potts, 1943, and Abananote Potts, 1943. Potts (1943), phenotypes. However, substantial wing pattern variation within partly following Jordan (1913), used characters of the scale each of those phenotypes complicated the identification of morphology on the ventral wing surfaces to separate Actinote diagnostic characters and the correct application of described and Altinote, placing Abananote as a subgenus of the latter. The names. Here, we use DNA “barcodes” to clarify species limits, monophyly of these taxa remained untested, however, until investigate possible relationships with allopatric taxa, review Silva-Brandão et al. (2008) showed that although Actinote as the identity of existing names, and describe a new sibling conceived by Lamas (2004) represented a single clade, neither species that is widespread and locally common from central to Altinote nor Abananote was monophyletic. Silva-Brandão et al. southeastern Ecuador. (2008: 528) therefore suggested that “Actinote Hübner, [1819] should be expanded to include all Neotropical Acraeini”, and MATERIALS AND METHODS we follow that suggestion here, referring to Actinote in the sense of Lamas (2004) as Actinote sensu stricto (s. s.). Field work was conducted by the authors and colleagues Actinote has also been the subject of a notable number of throughout Ecuador and Peru over many years to collect new species descriptions in recent years (e.g., Penz & Francini, material for taxonomic study and document distribution and 1996; Francini et al., 2004; Paluch et al., 2006; Neild, 2008; behavior. Material was studied in numerous public and private Willmott et al., 2009). All of those species have been within collections in the Americas and Europe to examine type Actinote s. s., which reaches its highest diversity in southeastern specimens, study variation and record distribution data. The Brazil and the periphery of the Amazon basin (Silva-Brandão following collection acronyms are used: FLMNH: McGuire et al., 2008). In Andean cloud forest habitats, however, the Center for Lepidoptera and Biodiversity, Florida Museum of dominant species are those that were placed by Lamas (2004) Natural History, University of Florida, Gainesville, USA; JEPE: in the genera Abananote and Altinote. Within those groups Jean-Claude Petit collection, Ducy, France; KWJH: Keith R. WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 7 Willmott & Jason P. W. Hall collection, Gainesville, FL, USA; RESULTS AND DISCUSSION INABIO: Instituto Nacional de Biodiversidad, Quito, Ecuador; MZUJ: Muzeum Zoologiczne Uniwersytetu Jagielloñskiego, DNA barcodes Kraków, Poland; NHMUK: Natural History Museum, London, The neighbor-joining analysis of the DNA barcode UK; PIBO: Pierre Boyer collection, Le Puy, France. sequences showed a single clade containing specimens with Morphology was studied using standard techniques, with the “A. radiata” wing pattern, which was split into two distinct adult abdomens being soaked in hot 10% KOH for 10-15 clades corresponding to the two phenotypes initially recognized minutes, dissected and subsequently stored in glycerine. Body within series of sympatric specimens (Fig. 1). Examination morphology and dissections were studied using a binocular of specimens within each clade allowed the identification of microscope at up to 100x magnification. The terminology for diagnostic wing pattern differences (see Table 1) that enabled male genitalic and abdominal structures follows Scoble (1992), us to associate relevant type specimens with one of the clades, and nomenclature for venation follows Comstock & Needham A. intensa, while the other clade represents the new species (1918). We use the abbreviations DFW, VFW, DHW and VHW described here, A. johncoulsoni n. sp.. The mean pairwise for dorsal and ventral forewing and hind wing. distance between the two species was 2%, while within-group We extracted genomic DNA from legs removed from mean pairwise distances were 0.5% (A. intensa) and 0.1 % Actinote specimens using Qiagen’s DNeasy Blood & Tissue (A. johncoulsoni n. sp.). Within A. intensa, three Peruvian Kit following the manufacturer’s protocol, incubating specimens (LEP-04012, LEP-04014, LEP-04015) formed a samples overnight (24 h) and using a final elution volume of somewhat isolated clade along with a specimen (LEP-04013) 50-100 ul with the smaller elution for older specimens. We putatively from Tungurahua province in Ecuador. The latter amplified the first half of the mitochondrial gene cytochrome specimen has a similar wing pattern to the Peruvian specimens oxidase I (COI), also known as the barcode region for (different from other TungurahuaA. intensa) and comes from the animals (Hebert et al., 2003), using primer pairs LCO same collection, so we assume that it represents a labeling error. (forward, GGTCAACAAATCATAAAGATATTGG) and The clade containing Actinote intensa and A. johncoulsoni was HCO (reverse, TAAACTTCAGGGTGACCAAAAAATCA) relatively distant from the nearest other included sequences. (Folmer et al., 1994), or LCO_nym (forward, TTTCTACAAATCATAAAGATATTGG) and HCO_nym Actinote intensa Jordan, 1910, stat. rest. (reverse, TAAACTTCAGGATGACCAAAAA) (Neild et al., (Figs. 2A-I, 3A, 4, 5D,E) 2015), or LepF1 (forward, ATTCAACCAATCATAAAGATAT) and LepR1 (reverse, AAACTTCTGGATGTCCAAAAA) Actinote radiata intensa Jordan (1910: 463). Type locality: Peru, [Pasco], (Hebert et al., 2004). For recalcitrant samples we amplified the Cushi, 1800-1900 m. Types: Lectotype ♂: “LECTOTYPE ♂ Actinote radiata intensa Jordan G. Lamas. det. 1987//Cushi, Prov. Huanuco, gene region in two fragments, using primer pairs LCO_nym Peru, 1900 m (W. Hoffmanns).//A. radiata intensa Type. Jord. Nov. Zool. and K699 (reverse, WGGGGGGTAAACTGTTCATCC), and 1910.//LECTOTYPE//Type”; Paralectotypes (6 ♂): 3 ♂, same collection Ron (forward, GGATCACCTGATATAGCATTCCC) and data as lectotype; 3 ♂, same collection data as lectotype except 1820 m, Nancy (reverse, CCTGGTAAAATTAAAATATAAACTTC) 1904; (NHMUK) (all examined). =Acraea radiata Hewitson (1868: [32], pl. [18], figs. 39-41), junior primary (Monteiro & Pierce, 2001; Elias et al., 2007). All PCR reactions homonym of Acraea zitja var. radiata Guenée, 1865. Type locality: were conducted in a 20 ul volume comprising 2 ul DNA, 0.4 ul Ecuador. Types: Lectotype ♂: “LECTOTYPE ♂ Acraea radiata of each primer (10 uM), 0.5 ul of Bovine Serum Albumin (BSA, Hewitson G. Lamas. det. 1987//Ecuador Hewitson Coll. 79.-69. Acraea 20 mg/mL) (for older samples), MgCl catalyst and Taq DNA radiata, Hew. 3//B. M. Type No. Rh 7721 Acraea radiata, ♂ Hew.// 2 LECTOTYPE//Type H. T.”; Paralectotype ♀: “PARALECTOTYPE ♀ polymerase. Typical reaction conditions were as follows: 1 min Acraea