DOCSLIB.ORG

Notes on the Taxonomy of Actinote Intensa Jordan (Lepidoptera: Nymphalidae: Heliconiinae) and the Description of a New Sibling Species from Eastern Ecuador

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Notes on the Taxonomy of Actinote Intensa Jordan (Lepidoptera: Nymphalidae: Heliconiinae) and the Description of a New Sibling Species from Eastern Ecuador 6 TROP. LEPID. RES., 27(1): 6-15, 2017 WILLMOTT ET AL.: A new species of Actinote Notes on the taxonomy of Actinote intensa Jordan (Lepidoptera: Nymphalidae: Heliconiinae) and the description of a new sibling species from eastern Ecuador Keith R. Willmott1, Gerardo Lamas2, and Jason P. W. Hall3 1. McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, Gainesville, Florida, USA; [email protected] 2. Museo de Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; [email protected] 3. Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington, DC 20560-0127, USA Abstract: We review the taxonomy of Actinote intensa Jordan stat. rest. and describe a new sibling species, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., from the east Andean slopes of central and southern Ecuador. The species are broadly sympatric, occur in the same sites throughout the more restricted range of the new species, and differ in a number of wing pattern characters, supported by a mean 2% pairwise divergence in their COI DNA barcodes. Resumen: Revisamos la taxonomía de la especie Actinote intensa Jordan stat. rest. y describimos una nueva especie relacionada, Actinote johncoulsoni Willmott, Lamas & Hall, n. sp., de las vertientes orientales de los Andes en el centro y sur del Ecuador. Las especies son simpátridas y ocurren en los mismos sitios en el rango más restringido de la especie nueva, y tienen una variedad de caracteres diferentes en el patrón del ala, apoyados por una divergencia promedio de 2% en sus codigos de barra del gen COI. Key words: Acraeini, Andes, cloud forest, cryptic species, DNA barcoding, Peru, wing pattern INTRODUCTION a number of species are very restricted in distribution and poorly represented in collections, and Lamas (2004) listed two Although not nearly as diverse as their Old World relatives, undescribed species under those generic names from Peru. the Neotropical Acraeini contains more than fifty species and Otherwise, no new species outside of Actinote s. s. have been the group has been the subject of a number of recent taxonomic described for more than 50 years, the most recent being Actinote studies. The generic classification of these species is currently rubrocellulata Hayward, 1960 (Lamas, 2004). unresolved, with Pierre (1987) placing all Neotropical species During a long-term survey of the butterflies of Ecuador, within the pantropical genus Acraea Fabricius, 1807, and we noticed that series from single sites of the species formerly the most recent classification (Lamas, 2004) dividing the known as “Actinote radiata” (e.g., Jordan, 1913; D’Abrera, same species among three genera, Actinote Hübner, [1819], 1987; Lamas, 2004) often apparently contained two distinct Altinote Potts, 1943, and Abananote Potts, 1943. Potts (1943), phenotypes. However, substantial wing pattern variation within partly following Jordan (1913), used characters of the scale each of those phenotypes complicated the identification of morphology on the ventral wing surfaces to separate Actinote diagnostic characters and the correct application of described and Altinote, placing Abananote as a subgenus of the latter. The names. Here, we use DNA “barcodes” to clarify species limits, monophyly of these taxa remained untested, however, until investigate possible relationships with allopatric taxa, review Silva-Brandão et al. (2008) showed that although Actinote as the identity of existing names, and describe a new sibling conceived by Lamas (2004) represented a single clade, neither species that is widespread and locally common from central to Altinote nor Abananote was monophyletic. Silva-Brandão et al. southeastern Ecuador. (2008: 528) therefore suggested that “Actinote Hübner, [1819] should be expanded to include all Neotropical Acraeini”, and MATERIALS AND METHODS we follow that suggestion here, referring to Actinote in the sense of Lamas (2004) as Actinote sensu stricto (s. s.). Field work was conducted by the authors and colleagues Actinote has also been the subject of a notable number of throughout Ecuador and Peru over many years to collect new species descriptions in recent years (e.g., Penz & Francini, material for taxonomic study and document distribution and 1996; Francini et al., 2004; Paluch et al., 2006; Neild, 2008; behavior. Material was studied in numerous public and private Willmott et al., 2009). All of those species have been within collections in the Americas and Europe to examine type Actinote s. s., which reaches its highest diversity in southeastern specimens, study variation and record distribution data. The Brazil and the periphery of the Amazon basin (Silva-Brandão following collection acronyms are used: FLMNH: McGuire et al., 2008). In Andean cloud forest habitats, however, the Center for Lepidoptera and Biodiversity, Florida Museum of dominant species are those that were placed by Lamas (2004) Natural History, University of Florida, Gainesville, USA; JEPE: in the genera Abananote and Altinote. Within those groups Jean-Claude Petit collection, Ducy, France; KWJH: Keith R. WILLMOTT ET AL.: A new species of Actinote TROP. LEPID. RES., 27(1): 6-15, 2017 7 Willmott & Jason P. W. Hall collection, Gainesville, FL, USA; RESULTS AND DISCUSSION INABIO: Instituto Nacional de Biodiversidad, Quito, Ecuador; MZUJ: Muzeum Zoologiczne Uniwersytetu Jagielloñskiego, DNA barcodes Kraków, Poland; NHMUK: Natural History Museum, London, The neighbor-joining analysis of the DNA barcode UK; PIBO: Pierre Boyer collection, Le Puy, France. sequences showed a single clade containing specimens with Morphology was studied using standard techniques, with the “A. radiata” wing pattern, which was split into two distinct adult abdomens being soaked in hot 10% KOH for 10-15 clades corresponding to the two phenotypes initially recognized minutes, dissected and subsequently stored in glycerine. Body within series of sympatric specimens (Fig. 1). Examination morphology and dissections were studied using a binocular of specimens within each clade allowed the identification of microscope at up to 100x magnification. The terminology for diagnostic wing pattern differences (see Table 1) that enabled male genitalic and abdominal structures follows Scoble (1992), us to associate relevant type specimens with one of the clades, and nomenclature for venation follows Comstock & Needham A. intensa, while the other clade represents the new species (1918). We use the abbreviations DFW, VFW, DHW and VHW described here, A. johncoulsoni n. sp.. The mean pairwise for dorsal and ventral forewing and hind wing. distance between the two species was 2%, while within-group We extracted genomic DNA from legs removed from mean pairwise distances were 0.5% (A. intensa) and 0.1 % Actinote specimens using Qiagen’s DNeasy Blood & Tissue (A. johncoulsoni n. sp.). Within A. intensa, three Peruvian Kit following the manufacturer’s protocol, incubating specimens (LEP-04012, LEP-04014, LEP-04015) formed a samples overnight (24 h) and using a final elution volume of somewhat isolated clade along with a specimen (LEP-04013) 50-100 ul with the smaller elution for older specimens. We putatively from Tungurahua province in Ecuador. The latter amplified the first half of the mitochondrial gene cytochrome specimen has a similar wing pattern to the Peruvian specimens oxidase I (COI), also known as the barcode region for (different from other TungurahuaA. intensa) and comes from the animals (Hebert et al., 2003), using primer pairs LCO same collection, so we assume that it represents a labeling error. (forward, GGTCAACAAATCATAAAGATATTGG) and The clade containing Actinote intensa and A. johncoulsoni was HCO (reverse, TAAACTTCAGGGTGACCAAAAAATCA) relatively distant from the nearest other included sequences. (Folmer et al., 1994), or LCO_nym (forward, TTTCTACAAATCATAAAGATATTGG) and HCO_nym Actinote intensa Jordan, 1910, stat. rest. (reverse, TAAACTTCAGGATGACCAAAAA) (Neild et al., (Figs. 2A-I, 3A, 4, 5D,E) 2015), or LepF1 (forward, ATTCAACCAATCATAAAGATAT) and LepR1 (reverse, AAACTTCTGGATGTCCAAAAA) Actinote radiata intensa Jordan (1910: 463). Type locality: Peru, [Pasco], (Hebert et al., 2004). For recalcitrant samples we amplified the Cushi, 1800-1900 m. Types: Lectotype ♂: “LECTOTYPE ♂ Actinote radiata intensa Jordan G. Lamas. det. 1987//Cushi, Prov. Huanuco, gene region in two fragments, using primer pairs LCO_nym Peru, 1900 m (W. Hoffmanns).//A. radiata intensa Type. Jord. Nov. Zool. and K699 (reverse, WGGGGGGTAAACTGTTCATCC), and 1910.//LECTOTYPE//Type”; Paralectotypes (6 ♂): 3 ♂, same collection Ron (forward, GGATCACCTGATATAGCATTCCC) and data as lectotype; 3 ♂, same collection data as lectotype except 1820 m, Nancy (reverse, CCTGGTAAAATTAAAATATAAACTTC) 1904; (NHMUK) (all examined). =Acraea radiata Hewitson (1868: [32], pl. [18], figs. 39-41), junior primary (Monteiro & Pierce, 2001; Elias et al., 2007). All PCR reactions homonym of Acraea zitja var. radiata Guenée, 1865. Type locality: were conducted in a 20 ul volume comprising 2 ul DNA, 0.4 ul Ecuador. Types: Lectotype ♂: “LECTOTYPE ♂ Acraea radiata of each primer (10 uM), 0.5 ul of Bovine Serum Albumin (BSA, Hewitson G. Lamas. det. 1987//Ecuador Hewitson Coll. 79.-69. Acraea 20 mg/mL) (for older samples), MgCl catalyst and Taq DNA radiata, Hew. 3//B. M. Type No. Rh 7721 Acraea radiata, ♂ Hew.// 2 LECTOTYPE//Type H. T.”; Paralectotype ♀: “PARALECTOTYPE ♀ polymerase. Typical reaction conditions were as follows: 1 min Acraea
Load more

Recommended publications
  • Astraptes Fulgerator Butterfly Ten Species in One: DNA Barcoding
    Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator Paul D. N. Hebert, Erin H. Penton, John M. Burns, Daniel H. Janzen, and Winnie Hallwachs PNAS 2004;101;14812-14817; originally published online Oct 1, 2004; doi:10.1073/pnas.0406166101 This information is current as of January 2007. Online Information High-resolution figures, a citation map, links to PubMed and Google Scholar, & Services etc., can be found at: www.pnas.org/cgi/content/full/101/41/14812 Supplementary Material Supplementary material can be found at: www.pnas.org/cgi/content/full/0406166101/DC1 References This article cites 13 articles, 2 of which you can access for free at: www.pnas.org/cgi/content/full/101/41/14812#BIBL This article has been cited by other articles: www.pnas.org/cgi/content/full/101/41/14812#otherarticles E-mail Alerts Receive free email alerts when new articles cite this article - sign up in the box at the top right corner of the article or click here. Rights & Permissions To reproduce this article in part (figures, tables) or in entirety, see: www.pnas.org/misc/rightperm.shtml Reprints To order reprints, see: www.pnas.org/misc/reprints.shtml Notes: Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator Paul D. N. Hebert*†, Erin H. Penton*, John M. Burns‡, Daniel H. Janzen§, and Winnie Hallwachs§ *Department of Zoology, University of Guelph, Guelph, ON, Canada N1G 2W1; ‡Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington, DC 20560-0127; and §Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 Contributed by Daniel H.
    [Show full text]
  • Phylogenetic Relationships and Historical Biogeography of Tribes and Genera in the Subfamily Nymphalinae (Lepidoptera: Nymphalidae)
    Blackwell Science, LtdOxford, UKBIJBiological Journal of the Linnean Society 0024-4066The Linnean Society of London, 2005? 2005 862 227251 Original Article PHYLOGENY OF NYMPHALINAE N. WAHLBERG ET AL Biological Journal of the Linnean Society, 2005, 86, 227–251. With 5 figures . Phylogenetic relationships and historical biogeography of tribes and genera in the subfamily Nymphalinae (Lepidoptera: Nymphalidae) NIKLAS WAHLBERG1*, ANDREW V. Z. BROWER2 and SÖREN NYLIN1 1Department of Zoology, Stockholm University, S-106 91 Stockholm, Sweden 2Department of Zoology, Oregon State University, Corvallis, Oregon 97331–2907, USA Received 10 January 2004; accepted for publication 12 November 2004 We infer for the first time the phylogenetic relationships of genera and tribes in the ecologically and evolutionarily well-studied subfamily Nymphalinae using DNA sequence data from three genes: 1450 bp of cytochrome oxidase subunit I (COI) (in the mitochondrial genome), 1077 bp of elongation factor 1-alpha (EF1-a) and 400–403 bp of wing- less (both in the nuclear genome). We explore the influence of each gene region on the support given to each node of the most parsimonious tree derived from a combined analysis of all three genes using Partitioned Bremer Support. We also explore the influence of assuming equal weights for all characters in the combined analysis by investigating the stability of clades to different transition/transversion weighting schemes. We find many strongly supported and stable clades in the Nymphalinae. We are also able to identify ‘rogue’
    [Show full text]
  • DNA Barcodes and Cryptic Species of Skipper Butterflies in the Genus Perichares in Area De Conservacio´ N Guanacaste, Costa Rica
    DNA barcodes and cryptic species of skipper butterflies in the genus Perichares in Area de Conservacio´ n Guanacaste, Costa Rica John M. Burns*†, Daniel H. Janzen†‡, Mehrdad Hajibabaei§, Winnie Hallwachs‡, and Paul D. N. Hebert§ *Department of Entomology, National Museum of Natural History, Smithsonian Institution, P.O. Box 37012, MRC 127, Washington, DC 20013-7012; ‡Department of Biology, University of Pennsylvania, Philadelphia, PA 19104; and §Biodiversity Institute of Ontario, Department of Integrative Biology, University of Guelph, Guelph, ON, Canada N1G 2W1 Contributed by Daniel H. Janzen, December 23, 2007 (sent for review November 16, 2007) DNA barcodes can be used to identify cryptic species of skipper butterflies previously detected by classic taxonomic methods and to provide first clues to the existence of yet other cryptic species. A striking case is the common geographically and ecologically widespread neotropical skipper butterfly Perichares philetes (Lep- idoptera, Hesperiidae), described in 1775, which barcoding splits into a complex of four species in Area de Conservacio´ n Guanacaste (ACG) in northwestern Costa Rica. Three of the species are new, and all four are described. Caterpillars, pupae, and foodplants offer better distinguishing characters than do adults, whose differences are mostly average, subtle, and blurred by intraspecific variation. The caterpillars of two species are generalist grass-eaters; of the other two, specialist palm-eaters, each of which feeds on different genera. But all of these cryptic species are more specialized in their diet than was the morphospecies that held them. The four ACG taxa discovered to date belong to a panneotropical complex of at least eight species. This complex likely includes still more species, whose exposure may require barcoding.
    [Show full text]
  • The Genus Acraea (Lepidoptera : Nymphalidae) - Peter Hendry
    The genus Acraea (Lepidoptera : Nymphalidae) - Peter Hendry With the recent migration to Australia of the Tawny Coster (Acraea terpsicore (Linnaeus, 1758)), (see Creature Feature this issue), I thought it might be timely to take a look at the genus worldwide. It must be noted that due to a misidentification A. terpsicore had long been known as A. violae and many references in the literature and on the web refer to it as A. violae. As with much of the Lepidoptera the genus is in a state of flux, and has long been split into the subgenera Acraea (Acraea) and Acraea (Actinote). The genus is placed in the tribe Acraeini and until Harvey (1991) placed it in the subfamily Heliconiinae it was listed in the subfamily Acraeinae. Recent molecular work has made changes and a current listing of the tribe Acraeini, by Niklas Wahlberg, is available at http://www.nymphalidae.net/Classification/Acraeini.htm. It shows members of the old subgenus Acraea (Actinote) being placed in the genus Actinote, and the old subgenus Acraea (Acraea) becoming the genus Acraea with a subgenus Acraea (Bematistes). It also lists several Acraea as unplaced. This may further change as some believe the subgenus Acraea (Bematistes) will move to the genus Bematistes. The genus is primarily Afrotropical with only four species occurring outside this region, these being, Acraea andromacha (Fig. 1) A. meyeri (Fig. 10) A. moluccana and A. terpsicore. A fifth species the Yellow Coster Acraea (Actinote) issoria is now referred to the genus Actinote. Like many of the Nymphalidae the larvae feed on plants which contain cyanogens making the larvae and adults poisonous to predators.
    [Show full text]
  • INSECTA: LEPIDOPTERA) DE GUATEMALA CON UNA RESEÑA HISTÓRICA Towards a Synthesis of the Papilionoidea (Insecta: Lepidoptera) from Guatemala with a Historical Sketch
    ZOOLOGÍA-TAXONOMÍA www.unal.edu.co/icn/publicaciones/caldasia.htm Caldasia 31(2):407-440. 2009 HACIA UNA SÍNTESIS DE LOS PAPILIONOIDEA (INSECTA: LEPIDOPTERA) DE GUATEMALA CON UNA RESEÑA HISTÓRICA Towards a synthesis of the Papilionoidea (Insecta: Lepidoptera) from Guatemala with a historical sketch JOSÉ LUIS SALINAS-GUTIÉRREZ El Colegio de la Frontera Sur (ECOSUR). Unidad Chetumal. Av. Centenario km. 5.5, A. P. 424, C. P. 77900. Chetumal, Quintana Roo, México, México. [email protected] CLAUDIO MÉNDEZ Escuela de Biología, Universidad de San Carlos, Ciudad Universitaria, Campus Central USAC, Zona 12. Guatemala, Guatemala. [email protected] MERCEDES BARRIOS Centro de Estudios Conservacionistas (CECON), Universidad de San Carlos, Avenida La Reforma 0-53, Zona 10, Guatemala, Guatemala. [email protected] CARMEN POZO El Colegio de la Frontera Sur (ECOSUR). Unidad Chetumal. Av. Centenario km. 5.5, A. P. 424, C. P. 77900. Chetumal, Quintana Roo, México, México. [email protected] JORGE LLORENTE-BOUSQUETS Museo de Zoología, Facultad de Ciencias, UNAM. Apartado Postal 70-399, México D.F. 04510; México. [email protected]. Autor responsable. RESUMEN La riqueza biológica de Mesoamérica es enorme. Dentro de esta gran área geográfi ca se encuentran algunos de los ecosistemas más diversos del planeta (selvas tropicales), así como varios de los principales centros de endemismo en el mundo (bosques nublados). Países como Guatemala, en esta gran área biogeográfi ca, tiene grandes zonas de bosque húmedo tropical y bosque mesófi lo, por esta razón es muy importante para analizar la diversidad en la región. Lamentablemente, la fauna de mariposas de Guatemala es poco conocida y por lo tanto, es necesario llevar a cabo un estudio y análisis de la composición y la diversidad de las mariposas (Lepidoptera: Papilionoidea) en Guatemala.
    [Show full text]
  • The Speciation History of Heliconius: Inferences from Multilocus DNA Sequence Data
    The speciation history of Heliconius: inferences from multilocus DNA sequence data by Margarita Sofia Beltrán A thesis submitted for the degree of Doctor of Philosophy of the University of London September 2004 Department of Biology University College London 1 Abstract Heliconius butterflies, which contain many intermediate stages between local varieties, geographic races, and sympatric species, provide an excellent biological model to study evolution at the species boundary. Heliconius butterflies are warningly coloured and mimetic, and it has been shown that these traits can act as a form of reproductive isolation. I present a species-level phylogeny for this group based on 3834bp of mtDNA (COI, COII, 16S) and nuclear loci (Ef1α, dpp, ap, wg). Using these data I test the geographic mode of speciation in Heliconius and whether mimicry could drive speciation. I found little evidence for allopatric speciation. There are frequent shifts in colour pattern within and between sister species which have a positive and significant correlation with species diversity; this suggests that speciation is facilitated by the evolution of novel mimetic patterns. My data is also consistent with the idea that two major innovations in Heliconius, adult pollen feeding and pupal-mating, each evolved only once. By comparing gene genealogies from mtDNA and introns from nuclear Tpi and Mpi genes, I investigate recent speciation in two sister species pairs, H. erato/H. himera and H. melpomene/H. cydno. There is highly significant discordance between genealogies of the three loci, which suggests recent speciation with ongoing gene flow. Finally, I explore the phylogenetic relationships between races of H. melpomene using an AFLP band tightly linked to the Yb colour pattern locus (which determines the yellow bar in the hindwing).
    [Show full text]
  • Lepidoptera: Nymphalidae) En Dos Especies De Passiflora
    R158evista Colombiana de Entomología 36 (1): 158-164 (2010) Desarrollo, longevidad y oviposición de Heliconius charithonia (Lepidoptera: Nymphalidae) en dos especies de Passiflora Development, longevity, and oviposition of Heliconius charithonia (Lepidoptera: Nymphalidae) on two species of Passiflora CAROLINA MILLÁN J.1, PATRICIA CHACÓN C.2 y GERMÁN CORREDOR3 Resumen: El desarrollo de Heliconius charithonia en dos especies de plantas hospederas se estudió en el mariposario del Zoológico de Cali (Colombia) entre diciembre de 2007 y octubre de 2008. Se siguió el desarrollo de larvas pro- venientes de 90 y 83 huevos puestos en Passiflora adenopoda y P. rubra respectivamente. Se midió la duración de los cinco instares larvales, así como el peso y longitud pupal. Los adultos emergidos se marcaron, midieron, sexaron y se liberaron en el área de exhibición del mariposario y se hicieron censos semanales para estimar la longevidad. La sobrevivencia larval fue mayor en P. adenopoda (76,4%) con respecto a P. rubra (33,9%). La mortalidad pupal alcanzó un 3% en P. rubra mientras en P. adenopoda todas las pupas fueron viables. Los resultados idican que P. adenopoda es el hospedero de oviposición más propicio para la cría masiva de H. charithonia, ya que en dicho hospedero se observó un mejor desarrollo larval, pupas más grandes y más pesadas, y los adultos mostraron mayor longitud alar y mayor longevidad (140 días vs 70 días). La preferencia de oviposición mostraron que del total de huevos (N = 357) el 71% fué depositado sobre P. adenopoda, aun en aquellos casos en que las hembras se desarrollaron sobre P. rubra.
    [Show full text]
  • Redalyc.Acraea Wigginsi Occidentalis (Bethune-Baker, 1926), a New
    SHILAP Revista de Lepidopterología ISSN: 0300-5267 [email protected] Sociedad Hispano-Luso-Americana de Lepidopterología España Tropek, R.; Jansta, P.; Lestina, D. Acraea wigginsi occidentalis (Bethune-Baker, 1926), a new butterfly for Nigeria, with remarks on its habitat and known distribution (Lepidoptera: Nymphalidae) SHILAP Revista de Lepidopterología, vol. 41, núm. 161, marzo, 2013, pp. 163-165 Sociedad Hispano-Luso-Americana de Lepidopterología Madrid, España Available in: http://www.redalyc.org/articulo.oa?id=45528755014 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative 163-165 Acraea wigginsi occiden 10/3/13 19:00 Página 163 SHILAP Revta. lepid., 41 (161), marzo 2013: 163-165 CODEN: SRLPEF ISSN: 0300-5267 Acraea wigginsi occidentalis (Bethune-Baker, 1926), a new butterfly for Nigeria, with remarks on its habitat and known distribution (Lepidoptera: Nymphalidae) R. Tropek, P. Jansta & D. Lestina Abstract Acraea wigginsi occidentalis (Bethune-Baker, 1926) is recorded in Nigeria for the first time, in the Gotel Mountains, close to the Cameroonian border. All of its known distribution is summarized, including four new records from Cameroon. Its occurrence in the degraded submontane grasslands is also discussed as the reason why it has been rarely observed. KEY WORDS: Lepidoptera, Nymphalidae, Acraeini, Afromontane butterflies, Cameroon Volcanic Line, faunistics, Nigeria. Acraea wigginsi occidentalis (Bethune-Baker, 1926), una nueva mariposa para Nigeria, con indicaciones sobre su habitat y distribución conocidea (Lepidoptera: Nymphalidae) Resumen Se cita por primera vez para Nigeria a Acraea wigginsi occidentalis (Bethune-Baker, 1926), en las Montañas Gotel, próximas al borde cameroniano.
    [Show full text]
  • A Time-Calibrated Phylogeny of the Butterfly Tribe Melitaeini
    UC Davis UC Davis Previously Published Works Title A time-calibrated phylogeny of the butterfly tribe Melitaeini. Permalink https://escholarship.org/uc/item/1h20r22z Journal Molecular phylogenetics and evolution, 79(1) ISSN 1055-7903 Authors Long, Elizabeth C Thomson, Robert C Shapiro, Arthur M Publication Date 2014-10-01 DOI 10.1016/j.ympev.2014.06.010 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Molecular Phylogenetics and Evolution 79 (2014) 69–81 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev A time-calibrated phylogeny of the butterfly tribe Melitaeini ⇑ Elizabeth C. Long a, , Robert C. Thomson b, Arthur M. Shapiro a a Center for Population Biology and Department of Evolution and Ecology, University of California, Davis, CA 95616, USA b Department of Biology, University of Hawaii at Manoa, Honolulu, HI 96822, USA article info abstract Article history: The butterfly tribe Melitaeini [Nymphalidae] contains numerous species that have been the subjects of a Received 10 March 2014 wide range of biological studies. Despite numerous taxonomic revisions, many of the evolutionary Revised 22 May 2014 relationships within the tribe remain unresolved. Utilizing mitochondrial and nuclear gene regions, we Accepted 11 June 2014 produced a time-calibrated phylogenetic hypothesis for 222 exemplars comprising at least 178 different Available online 18 June 2014 species and 21 of the 22 described genera, making this the most complete phylogeny of the tribe to date. Our results suggest that four well-supported clades corresponding to the subtribes Euphydryina, Keywords: Chlosynina, Melitaeina, and Phyciodina exist within the tribe.
    [Show full text]
  • DNA Barcoding Confirms Polyphagy in a Generalist Moth, Homona Mermerodes (Lepidoptera: Tortricidae)
    Molecular Ecology Notes (2007) 7, 549–557 doi: 10.1111/j.1471-8286.2007.01786.x BARCODINGBlackwell Publishing Ltd DNA barcoding confirms polyphagy in a generalist moth, Homona mermerodes (Lepidoptera: Tortricidae) JIRI HULCR,* SCOTT E. MILLER,† GREGORY P. SETLIFF,‡ KAROLYN DARROW,† NATHANIEL D. MUELLER,§ PAUL D. N. HEBERT¶ and GEORGE D. WEIBLEN** *Department of Entomology, Michigan State University, 243 Natural Sciences Building, East Lansing, Michigan 48824, USA, †National Museum of Natural History, Smithsonian Institution, Box 37012, Washington, DC 20013-7012, USA, ‡Department of Entomology, University of Minnesota, 1980 Folwell Avenue, Saint Paul, Minnesota 55108–1095 USA, §Saint Olaf College, 1500 Saint Olaf Avenue, Northfield, MN 55057, USA,¶Department of Integrative Biology, University of Guelph, Guelph, Ontario, Canada N1G2W1, **Bell Museum of Natural History and Department of Plant Biology, University of Minnesota, 220 Biological Sciences Center, 1445 Gortner Avenue, Saint Paul, Minnesota 55108–1095, USA Abstract Recent DNA barcoding of generalist insect herbivores has revealed complexes of cryptic species within named species. We evaluated the species concept for a common generalist moth occurring in New Guinea and Australia, Homona mermerodes, in light of host plant records and mitochondrial cytochrome c oxidase I haplotype diversity. Genetic divergence among H. mermerodes moths feeding on different host tree species was much lower than among several Homona species. Genetic divergence between haplotypes from New Guinea and Australia was also less than interspecific divergence. Whereas molecular species identification methods may reveal cryptic species in some generalist herbivores, these same methods may confirm polyphagy when identical haplotypes are reared from multiple host plant families. A lectotype for the species is designated, and a summarized bibliography and illustrations including male genitalia are provided for the first time.
    [Show full text]
  • Biodiversity
    1 CHAPTER 2 Biodiversity Kevin J. Gaston Biological diversity or biodiversity (the latter term The scale of the variety of life is difficult, and is simply a contraction of the former) is the variety of perhaps impossible, for any of us truly to visua- life, in all of its many manifestations. It is a broad lize or comprehend. In this chapter I first attempt unifying concept, encompassing all forms, levels to give some sense of the magnitude of biodiver- and combinations of natural variation, at all levels sity by distinguishing between different key ele- of biological organization (Gaston and Spicer ments and what is known about their variation. 2004). A rather longer and more formal definition Second, I consider how the variety of life has is given in the international Convention on changed through time, and third and finally Biological Diversity (CBD; the definition is how it varies in space. In short, the chapter will, provided in Article 2), which states that inevitably in highly summarized form, address “‘Biological diversity’ means the variability the three key issues of how much biodiversity among living organisms from all sources includ- there is, how it arose, and where it can be found. ing, inter alia, terrestrial, marine and other aquatic ecosystems and the ecological complexes of which 2.1 How much biodiversity is there? they are part; this includes diversity within species, between species and of ecosystems”.Whichever Some understanding of what the variety of life definition is preferred, one can, for example, comprises can be obtained by distinguishing be- speak equally of the biodiversity of some given tween different key elements.
    [Show full text]
  • Mt Mabu, Mozambique: Biodiversity and Conservation
    Darwin Initiative Award 15/036: Monitoring and Managing Biodiversity Loss in South-East Africa's Montane Ecosystems MT MABU, MOZAMBIQUE: BIODIVERSITY AND CONSERVATION November 2012 Jonathan Timberlake, Julian Bayliss, Françoise Dowsett-Lemaire, Colin Congdon, Bill Branch, Steve Collins, Michael Curran, Robert J. Dowsett, Lincoln Fishpool, Jorge Francisco, Tim Harris, Mirjam Kopp & Camila de Sousa ABRI african butterfly research in Forestry Research Institute of Malawi Biodiversity of Mt Mabu, Mozambique, page 2 Front cover: Main camp in lower forest area on Mt Mabu (JB). Frontispiece: View over Mabu forest to north (TT, top); Hermenegildo Matimele plant collecting (TT, middle L); view of Mt Mabu from abandoned tea estate (JT, middle R); butterflies (Lachnoptera ayresii) mating (JB, bottom L); Atheris mabuensis (JB, bottom R). Photo credits: JB – Julian Bayliss CS ‒ Camila de Sousa JT – Jonathan Timberlake TT – Tom Timberlake TH – Tim Harris Suggested citation: Timberlake, J.R., Bayliss, J., Dowsett-Lemaire, F., Congdon, C., Branch, W.R., Collins, S., Curran, M., Dowsett, R.J., Fishpool, L., Francisco, J., Harris, T., Kopp, M. & de Sousa, C. (2012). Mt Mabu, Mozambique: Biodiversity and Conservation. Report produced under the Darwin Initiative Award 15/036. Royal Botanic Gardens, Kew, London. 94 pp. Biodiversity of Mt Mabu, Mozambique, page 3 LIST OF CONTENTS List of Contents .......................................................................................................................... 3 List of Tables .............................................................................................................................
    [Show full text]