Asfmr1splice Variant: a Predictor of Fragile X-Associated Tremor/Ataxia

Volume 4, Number 4, August 2018 Neurology.org/NG

A peer-reviewed clinical and translational neurology open access journal

ARTICLE ASFMR1 splice variant: A predictor of fragile X-associated tremor/ataxia syndrome e246

ARTICLE Noncoding repeat expansions for ALS in Japan are associated with the ATXN8OS gene e252

ARTICLE SCN11A Arg225Cys mutation causes nociceptive pain without detectable peripheral nerve pathology e255

ARTICLE Longitudinal analysis of contrast acuity in Friedreich ataxia e250 Academy Officers Neurology® is a registered trademark of the American Academy of Neurology (registration valid in the United States). Ralph L. Sacco, MD, MS, FAAN, President Neurology® Genetics (eISSN 2376-7839) is an open access journal published James C. Stevens, MD, FAAN, President Elect online for the American Academy of Neurology, 201 Chicago Avenue, Ann H. Tilton, MD, FAAN, Vice President Minneapolis, MN 55415, by Wolters Kluwer Health, Inc. at 14700 Citicorp Drive, Bldg. 3, Hagerstown, MD 21742. Business offices are located at Two Carlayne E. Jackson, MD, FAAN, Secretary Commerce Square, 2001 Market Street, Philadelphia, PA 19103. Production offices are located at 351 West Camden Street, Baltimore, MD 21201-2436. Janis M. Miyasaki, MD, MEd, FRCPC, FAAN, Treasurer © 2018 American Academy of Neurology. Terrence L. Cascino, MD, FAAN, Past President Neurology® Genetics is an official journal of the American Academy of Neurology. Journal website: Neurology.org/ng, AAN website: AAN.com Executive Office, American Academy of Neurology Copyright and Permission Information: Please go to the journal website (www.neurology.org/ng) and click the Permissions tab for the relevant Catherine M. Rydell, CAE, Executive Director/CEO article. Alternatively, send an email to [email protected]. 20l Chicago Ave General information about permissions can be found here: https://shop.lww.com/ journal-permission. Minneapolis, MN 55415 Disclaimer: Opinions expressed by the authors and advertisers are not Tel: 612-928-6000 necessarily those of the American Academy of Neurology, its affiliates, or of the Publisher. The American Academy of Neurology, its affiliates, and the Publisher disclaim any liability to any party for the accuracy, completeness, Editorial Office efficacy, or availability of the material contained in this publication (including drug dosages) or for any damages arising out of the use Patricia K. Baskin, MS, Executive Editor or non-use of any of the material contained in this publication. Kathleen M. Pieper, Senior Managing Editor, Neurology Advertising Sales Representatives: Wolters Kluwer, 333 Seventh Avenue, Lee Ann Kleffman, Managing Editor, Neurology: Genetics New York, NY 10001. Contacts: Eileen Henry, tel: 732-778-2261, fax: 973-215- 2485, [email protected] and in Europe: Avia Potashnik, Wolters Sharon L. Quimby, Managing Editor, Neurology® Clinical Practice Kluwer, tel: +44 207 981 0722; +44 7919 397 933 or e-mail: avia.potashnik@ Morgan S. Sorenson, Managing Editor, Neurology® Neuroimmunology & Neuroinflammation wolterskluwer.com. Careers & Events: Monique McLaughlin, Wolters Kluwer, Two Commerce Cynthia S. Abair, MA, Senior Graphics Editor Square, 2001 Market Street, Philadelphia, PA 19103, tel: 215-521-8468, fax: 215- Andrea R. Rahkola, Production Editor, Neurology 521-8801; [email protected]. Robert J. Witherow, Senior Editorial Associate Reprints: Meredith Edelman, Commercial Reprint Sales, Wolters Kluwer, Two Commerce Square, 2001 Market Street, Philadelphia, PA 19103, tel: 215-356-2721; Karen Skaja, Senior Editorial Associate [email protected]; [email protected]. Kaitlyn Aman Ramm, Editorial Assistant Special projects: US & Canada: Alan Moore, Wolters Kluwer, Two Kristen Swendsrud, Editorial Assistant Commerce Square, 2001 Market Street, Philadelphia, PA 19103, tel: 215-521-8638, [email protected]. International: Andrew Andrea Willgohs, Editorial Assistant Wible, Senior Manager, Rights, Licensing, and Partnerships, Wolters Kluwer; [email protected]. Publisher Wolters Kluwer Baltimore, MD

Publishing Staff Kim Jansen, Executive Publisher Jessica Heise, Production Team Leader, Neurology Journals Megen Miller, Production Editor Steve Rose, Editorial Assistant Stacy Drossner, Production Associate A peer-reviewed clinical and translational neurology open access journal Neurology.org/NG

Neurology® Genetics

Editor Stefan M. Pulst, MD, Dr med, FAAN Vision Neurology®: Genetics will be the premier peer- reviewed journal in the ﬁeld of neurogenetics. Deputy Editor Massimo Pandolfo, MD, FAAN Mission Neurology: Genetics will provide neurologists Associate Editors with outstanding original contributions that Alexandra Durr, MD, PhD elucidate the role of genetic and epigenetic Margherita Milone, MD, PhD variation in diseases and biological traits of Raymond P. Roos, MD, FAAN the central and peripheral nervous systems. Jeﬀery M. Vance, MD, PhD

Editorial Board Editorial Tel: 612-928-6400 Hilary Coon, PhD Giovanni Coppola, MD Inquiries Toll-free: 800-957-3182 (US) ChantalDepondt, MD, PhD Fax: 612-454-2748 Brent L. Fogel, MD, PhD, FAAN [email protected] AnthonyJ. Griswold, PhD Orhun H. Kantarci, MD Julie R. Korenberg, PhD, MD Stay facebook.com/NeurologyGenetics MargheritaMilone, MD, PhD Connected Davide Pareyson, MD twitter.com/greenjournal Shoji Tsuji, MD,PhD DinekeS. Verbeek,PhD youtube.com/user/NeurologyJournal David Viskochil, MD,PhD JulianeWinkelmann, MD Juan I. Young, PhD

Neurology® Journals

Editor-in-Chief Classification of Evidence Robert A. Gross, MD, PhD, FAAN Review Team Melissa J. Armstrong, MD Deputy Editor Richard L. Barbano, MD,PhD, FAAN Bradford B. Worrall, MD, MSc, FAAN RichardM.Dubinsky,MD,MPH,FAAN Jeffrey J. Fletcher, MD, MSc Section Editors Gary M. Franklin, MD, MPH, FAAN David S. Gloss II, MD,MPH&TM Biostatistics John J. Halperin, MD,FAAN Richard J. Kryscio, PhD Jason Lazarou, MSc, MD Christopher A. Beck, PhD Steven R. Messé, MD, FAAN Sue Leurgans, PhD Pushpa Narayanaswami, MBBS, DM, FAAN fi Classi cation of Evidence Evaluations Alex Rae-Grant, MD Gary S. Gronseth, MD, FAAN

Podcasts Stacey L. Clardy, MD, PhD Jeﬀrey B. Ratliﬀ, MD, Deputy Podcast Editor

Ombudsman David S. Knopman, MD, FAAN

Scientiﬁc Integrity Advisor Robert B. Daroﬀ, MD, FAAN TABLE OF CONTENTS Volume 4, Number 4, August 2018 Neurology.org/NG

e250 Longitudinal analysis of contrast acuity in Friedreich ataxia A.G. Hamedani, L.A. Hauser, S. Perlman, K. Mathews, G.R. Wilmot, T. Zesiewicz, S.H. Subramony, T. Ashizawa, M.B. Delatycki, A. Brocht, and D.R. Lynch Open Access

e249 Population genealogy resource shows evidence of familial clustering for Alzheimer disease L.A. Cannon-Albright, S. Dintelman, T. Maness, J. Cerny, A. Thomas, S. Backus, J.M. Farnham, C.C. Teerlink, J. Contreras, J.S.K. Kauwe, and L.J. Meyer Open Access

e253 Impaired transmissibility of atypical prions from genetic CJDG114V I. Cali, F. Mikhail, K. Qin, C. Gregory, A. Solanki, M.C. Martinez, L. Zhao, B. Appleby, P. Gambetti, E. Norstrom, and J.A. Mastrianni Open Access

e255 SCN11A Arg225Cys mutation causes nociceptive pain without detectable peripheral nerve pathology R. Castoro, M. Simmons, V. Ravi, D. Huang, C. Lee, J. Sergent, L. Zhou, and J. Li Open Access

e256 Expanding the phenotype of de novo SLC25A4-linked mitochondrial disease to include mild myopathy M.S. King, K. Thompson, S. Hopton, L. He, E.R.S. Kunji, R.W. Taylor, and X.R. Ortiz-Gonzalez Open Access

e254 Carey-Fineman-Ziter syndrome with mutations in the myomaker gene and muscle fiber Editorial hypertrophy C. Hedberg-Oldfors, C. Lindberg, and A. Oldfors e247 These violent repeats have violent extends Open Access J. Couthouis and A.D. Gitler Open Access Companion article, e252 e251 Axon reflex–mediated vasodilation is reduced in proportion to disease severity in Articles TTR-FAP e252 Noncoding repeat expansions for ALS in Japan are I. Calero-Romero, M.R. Suter, B. Waeber, F. Feihl, and associated with the ATXN8OS gene T. Kuntzer Open Access M. Hirano, M. Samukawa, C. Isono, K. Saigoh, Y. Nakamura, and S. Kusunoki e257 Association study between multiple system atrophy Open Access Editorial, e247 and TREM2 p.R47H e246 ASFMR1 splice variant: A predictor of fragile K. Ogaki, M.G. Heckman, S. Koga, Y.A. Martens, C. Labbé, O. Lorenzo-Betancor, R.L. Walton, A.I. Soto, E.R. Vargas, X-associated tremor/ataxia syndrome S. Fujioka, R.J. Uitti, J.A. van Gerpen, W.P. Cheshire, S.G. Younkin, P. Vittal, S. Pandya, K. Sharp, E. Berry-Kravis, L. Zhou, B. Ouyang, Z.K. Wszolek, P.A. Low, W. Singer, G. Bu, D.W. Dickson, and J. Jackson, and D.A. Hall O.A. Ross Open Access Open Access TABLE OF CONTENTS Volume 4, Number 4, August 2018 Neurology.org/NG

e262 Conﬁrming TDP2 mutation in spinocerebellar ataxia e261 Independent NF1 mutations underlie caf´e-au-lait autosomal recessive 23 (SCAR23) macule development in a woman with segmental G. Zagnoli-Vieira, F. Bruni, K. Thompson, L. He, S. Walker, NF1 A.P.M. de Brouwer, R. Taylor, D. Niyazov, and K.W. Caldecott M.E. Freret, C. Anastasaki, and D.H. Gutmann Open Access Open Access

Clinical/Scientific Notes e263 Novel ELOVL4 mutation associated with e248 Atypical Alexander disease with dystonia, retinopathy, erythrokeratodermia and spinocerebellar ataxia and a brain mass mimicking astrocytoma (SCA 34) P.R. Bourque, J. Warman-Chardon, D.A. Lelli, L. LaBerge, C. Kirshen, K. Machol, J. Jankovic, D. Vijayakumar, L.C. Burrage, M. Jain, S.H. Bradshaw, T. Hartley, and K.M. Boycott R.A. Lewis, G.N. Fuller, M. Xu, M. Penas-Prado, M.K. Gule-Monroe, J.A. Rosenfeld, R. Chen, C.M. Eng, Y. Yang, B.H. Lee, Open Access P.M. Moretti, Undiagnosed Diseases Network, and S.U. Dhar Open Access e258 De novo DNM1L mutation associated with mitochondrial epilepsy syndrome with fever sensitivity E. Ladds, A. Whitney, E. Dombi, M. Hofer, G. Anand, V. Harrison, C. Fratter, J. Carver, I.A. Barbosa, M. Simpson, S. Jayawant, and J. Poulton Open Access e259 GLRA1 mutation and long-term follow-up of the Cover image ﬁrst hyperekplexia family Agarose gel electrophoretic analysis for the ATXN8OS gene in patients. Three patients had expansions of the CTA/CTG repeat as indicated, M. Paucar, J. Waldthaler, and P. Svenningsson while controls had a normal repeat size. See “Noncoding repeat Open Access expansions for ALS in Japan are associated with the ATXN8OS gene.” e260 Case of late-onset Sandhoﬀ disease due to a novel See e252 mutation in the HEXB gene A.R. Sung, P. Moretti, and A. Shaibani Open Access EDITORIAL OPEN ACCESS These violent repeats have violent extends

Julien Couthouis, PhD, and Aaron D. Gitler, PhD Correspondence Dr. Gitler Neurol Genet 2018;4:e247. doi:10.1212/NXG.0000000000000247 [email protected]

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease that causes pa- RELATED ARTICLE ralysis and death typically within 3 years of onset. The rapidly progressive loss of motor neurons in the brain and spinal cord leads to muscle atrophy, causing weakness, muscle fasciculations, and Noncoding repeat spasticity. This interferes with normal movement, gait, speech, and swallowing. ALS progresses expansions for ALS in inexorably, causing paralysis and eventually death. There is currently no cure for ALS and only Japan are associated with 2 drugs have been approved, but these only offer limited benefit. More effective therapeutic the ATXN8OS gene strategies are desperately needed. Page e252

Most ALS cases are sporadic, but around 10% have a family history. Although these familial cases are rarer than the sporadic ones, they have played an outsize role in contributing to insight into the causes and mechanisms of ALS. This is because these familial cases can be analyzed by genetic approaches to map and sequence genes that cause ALS. The first gene associated with familial ALS was SOD1.1 SOD1 mutations have been found in approximately 20% of familial cases, which equals approximately 2% of all ALS cases. It is believed that the ALS-causing mutations in SOD1 lead to a toxic gain of function of the protein. Clinical trials in human patients with ALS are currently under way to test the efficacy of an SOD1-lowering therapy, using antisense oligonucleotides.2 Although SOD1 mutations in ALS are relatively rare, the path from SOD1 gene discovery to targeted therapy illustrates the power of genetics in illuminating the causes of ALS, paving the path for the development of novel therapies. Owing to the explosion in new gene sequencing technologies, the number of ALS genes has been increasing exponentially1—each new gene offering the hope for a better understanding of ALS mechanisms. The identification of causative genes for ALS will also improve early diagnosis, which will un- doubtedly give therapies a better shot at success.

One of these newly discovered genes is now the most common genetic cause of ALS. Dis- covered in 2011, mutations in the C9ORF72 gene cause ;40% of familial ALS cases and ;10% of sporadic cases.1 The ALS-causing mutation in C9ORF72 is a hexanucleotide repeat expansion located in a noncoding portion of the gene. Normally, the gene harbors only a handful of GGGGCC repeats, but in individuals with C9ORF72 mutations, the number of repeats increases to hundreds or even thousands. Intense research eﬀorts are under way to deﬁne how these violent nucleotide repeat expansions in C9ORF72 cause ALS and to devise therapeutic strategies. Of interest, the repeat expansion in C9ORF72 can be traced back to a single founding event, probably in Northern Europe.3 Despite being common in Europe and North America, it is extremely rare in Asian ALS populations.4 The paucity of C9ORF72 mutations in Asia raises the question of whether repeat expansions in other genes could be more common causes of ALS in this population.

Beyond C9ORF72, repeat expansions in at least 2 other genes, NOP56 and ATXN2, have been associated with motor neuron disease, including ALS.5,6 Noncoding GGCCTG-repeat expansions in the NOP56 gene cause spinocerebellar ataxia type 36, which can present with prominent motor neuron degeneration. Long trinucleotide CAG-repeat expansions in the ATXN2 gene cause spinocerebellar ataxia type 2 (SCA2). Of interest, intermediate-length CAG repeat expansions in the same gene are associated with ALS.6 Therapeutic strategies to target ATXN2 are being pursued for SCA2 and ALS.7,8

From the Department of Genetics, Stanford University School of Medicine, CA.

Funding information and disclosures are provided at the end of the article. Full disclosure form information provided by the authors is available with the full text of this article at Neurology.org/NG. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 In this issue of Neurology® Genetics, Hirano et al.9 analyzed ataxia, hereditary spastic paraplegia, ALS, and frontotemporal the length of the repeat expansion in 3 genes, ATXN8OS, dementia. It is still unclear whether the clinical manifestations C9ORF72 and NOP56, in 103 Japanese patients with ALS. In of these mutations result from different pathologic mecha- this cohort, 3 patients harbored a pathologic expansion in the nisms, different affected cell types, or different genetic back- ATXN8OS gene. Although healthy controls harbored be- grounds harboring a diverse set of genetic modifier genes. It tween 15 and 50 CTA/CTG repeats, patients with ALS had may be beneficial to start developing and implementing broad more than 80 repeats. Since the authors found ATXN8OS multigene test panels for neurodegenerative and neuromus- repeat expansions in 3% of patients with ALS, it suggests that cular diseases, as is standard practice in cancer screening. such mutations may be relatively common in Japan. Study funding Nucleotide repeat expansions in ATXN8OS have been pre- No targeted funding reported. viously connected with another neurodegenerative disease, spinocerebellar ataxia type 8 (SCA8). SCA8 is a slowly pro- Disclosure gressive ataxia with disease onset from age 1 to the early 70s J. Couthouis has received research support from Target ALS. but typically with an adult onset.10 As opposed to the rapid A.D. Gitler has been a consultant for Aquinnah Pharma- progression observed in ALS, SCA8 progression is slow and ceuticals, Prevail Therapeutics, and Third Rock Ventures and spans decades, regardless of the initial age at onset; lifespan is has received research support from the NIH. Full disclosure typically not shortened. Initial symptoms are scanning dys- form information provided by the authors is available with the arthria with a characteristic drawn-out slowness of speech and full text of this article at Neurology.org/NG. gait instability. Various atypical clinical features have also been identified in patients carrying an ATXN8OS expansion, such References as parkinsonism, multiple-system atrophy, severe childhood 1. Brown RH Jr, Al-Chalabi A. Amyotrophic lateral sclerosis. N Engl J Med 2017;377: 1602. onset, oromandibular dystonia, dysphagia, respiratory muscle 2. Miller TM, Pestronk A, David W, et al. An antisense oligonucleotide against weakness, or seizure-like episodes. SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet Neurol 2013;12: 435–442. The next steps are to extend the analysis of ATXN8OS in 3. Smith BN, Newhouse S, Shatunov A, et al. The C9ORF72 expansion mutation is a common cause of ALS+/-FTD in Europe and has a single founder. Eur J Hum Genet a larger Japanese ALS population to confirm these exciting 2013;21:102–108. findings and to also test other Asian ALS patient populations 4. Chen Y, Lin Z, Chen X, et al. Large C9orf72 repeat expansions are seen in Chinese patients with sporadic amyotrophic lateral sclerosis. Neurobiol Aging 2016;38: (e.g., China and Korea). It will also be important to carefully 217.e215–217.e222. re-evaluate SCA8 cases and pedigrees to define the prevalence 5. Miyazaki K, Yamashita T, Morimoto N, et al. Early and selective reduction of NOP56 (Asidan) and RNA processing proteins in the motor neuron of ALS model mice. of symptoms warranting a diagnosis of ALS. Looking to the Neurol Res 2013;35:744–754. mechanism, future studies should focus on how the ATX- 6. Elden AC, Kim HJ, Hart MP, et al. Ataxin-2 intermediate-length polyglutamine expansions are associated with increased risk for ALS. Nature 2010;466:1069–1075. N8OS repeat expansions cause pathologies and how such 7. Becker LA, Huang B, Bieri G, et al. Therapeutic reduction of ataxin-2 extends lifespan pathologies contribute to motor neuron degeneration. and reduces pathology in TDP-43 mice. Nature 2017;544:367–371. 8. Scoles DR, Meera P, Schneider MD, et al. Antisense oligonucleotide therapy for spinocerebellar ataxia type 2. Nature 2017;544:362–366. The work of Hirano et al. is especially interesting in a clinical 9. Hirano M. Noncoding repeat expansions for ALS in Japan are associated with the fi ATXN8OS gene. Neurol Genet 2018;4:e252. diagnostic standpoint. We now see a signi cant genetic overlap 10. Ikeda Y, Shizuka M, Watanabe M, Okamoto K, Shoji M. Molecular and clinical between neurodegenerative diseases such as spinocerebellar analyses of spinocerebellar ataxia type 8 in Japan. Neurology 2000;54:950–955.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG ARTICLE OPEN ACCESS Noncoding repeat expansions for ALS in Japan are associated with the ATXN8OS gene

Makito Hirano, MD, PhD, Makoto Samukawa, MD, PhD, Chiharu Isono, BA, Kazumasa Saigoh, MD, PhD, Correspondence Yusaku Nakamura, MD, PhD, and Susumu Kusunoki, MD, PhD Dr. Hirano [email protected] Neurol Genet 2018;4:e252. doi:10.1212/NXG.0000000000000252 Abstract Objective To assess the contribution of noncoding repeat expansions in Japanese patients with amyotrophic lateral sclerosis (ALS).

Methods Sporadic ALS in Western countries is frequently associated with noncoding repeat expansions in the C9ORF72 gene. Spinocerebellar ataxia type 8 (SCA8) is another noncoding repeat disease caused by expanded CTA/CTG repeats in the ATXN8OS gene. Although the involvement of upper and lower motor neurons in SCA8 has been reported, a positive association between SCA8 and ALS remains unestablished. Spinocerebellar ataxia type 36 is a recently identiﬁed disease caused by noncoding repeat expansions in the NOP56 gene and is characterized by motor neuron involvement. We collected blood samples from 102 Japanese patients with sporadic ALS and analyzed the ATXN8OS gene by the PCR–Sanger sequencing method and the C9ORF72 and NOP56 genes by repeat-primed PCR assay.

Results Three patients with ALS (3%) had mutations in the ATXN8OS gene, whereas no patient had a mutation in the C9ORF72 or NOP56 gene. The mutation-positive patients were clinically characterized by neck weakness or bulbar-predominant symptoms. None of our patients had apparent cerebellar atrophy on MRI, but 2 had nonsymptomatic abnormalities in the white matter or putamen.

Conclusions Our ﬁnding reveals the importance of noncoding repeat expansions in Japanese patients with ALS and extends the clinical phenotype of SCA8. Three percent seems small but is still relatively large for Japan, considering that the most commonly mutated genes, including the SOD1 and SQSTM1 genes, only account for 2%–3% of sporadic patients each.

From the Department of Neurology (M.H., M.S., K.S., and S.K.), Kindai University Faculty of Medicine, Osakasayama, Japan; and Department of Neurology (M.H., C.I., and Y.N.), Kindai University Sakai Hospital, Japan.

The Article Processing Charge was funded by the authors. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary ALS = amyotrophic lateral sclerosis; DTR = deep tendon reﬂex; PEG = percutaneous endoscopic gastrostomy; SCA = spinocerebellar ataxia.

Amyotrophic lateral sclerosis (ALS) mostly occurs sporadically. CTA/CTG repeats in the ATXN8OS gene ranges from 15 to However, more than 10% of sporadic patients examined in 50, whereas repeats of length 80 or more are pathogenic. In Japan and in Western countries had mutations in various genes several reports, expansions of more than 50 CTA/CTG – causative for familial ALS.1 3 Noncoding six-base (GGGGCC) repeats, including intermediate expansions, were stated to repeat expansions in the C9ORF72 gene are causative for cause ataxia at some point in the life; however, there were no sporadic ALS and are frequent in Western countries (4%–21% clinical details.16,17 We also examined 10 patients who had of all sporadic ALS).2,3 By contrast, only small numbers of either sporadic or familial ALS with mutations in the SOD1 sporadic patients in Japan had mutations in the C9ORF72 gene (n = 3, 1 man and 2 women), TARDBP (n = 1, 1 man), FUS (<0.5%).4 Thus, the significance of noncoding repeat expan- (n = 1, 1 woman), VCP (n = 2, 1 man and 1 woman), or sions in ALS has not been established in Japan. SQSTM1 (n = 3, 1 man and 2 women) genes.1,13,14 When mutations in the ATXN8OS, C9ORF72,orNOP56 gene were Spinocerebellar ataxia type 8 (SCA8) is an autosomal detected, the ERBB4 and COQ2 genes and genes for SCA3, dominant neurodegenerative disease, caused by noncoding SCA6, SCA7, SCA12, SCA17, SCA31, and DRPLA were ad- CTA/CTG repeat expansions in the ATXN8OS (ATAXIN 8 ditionally examined.15,18 The patients had a diagnosis of OPPOSITE STRAND) gene.5,6 The pathogenicity of the clinically definite, probable, or possible ALS, as defined in the expanded allele has been proven using a transgenic mouse revised El Escorial diagnostic criteria. Patients with sporadic model.7 Many patients had pure cerebellar ataxia, whereas ALS included 68 men and 34 women with an age of 65 ± 12 some had parkinsonism.5,6,8 Several studies have suggested years (mean ± SD). The initial symptoms occurred in the limb the involvement of upper and lower motor neurons in SCA8, muscles in 76 patients, in the bulbar muscles in 20, in the neck but a positive association between SCA8 and ALS remains muscles in 3, in the respiratory muscles in 2, and in the unestablished.9,10 facial muscles in 1. A control group consisting of 200 apparently healthy controls (116 men and 84 women; mean age ± SD, Spinocerebellar ataxia type 36 (SCA36) is a recently identified 71 ± 7 years) was also studied. We performed haplotype disease, caused by noncoding six-base (GGCCTG) repeat analyses in patients with ATXN8OS mutations using several expansions in the NOP56 gene.11 Motor neuron involvement microsatellite markers, including YI18, D13S1296, JJ9, JJ10, becomes apparent during the disease course. and JJ12 surrounding the CTA/CTG repeats with distances of 284, 57, 17, 20, and 52 kb, respectively.16 DNA from rel- Identification of repeat abnormalities by current exome or whole- atives of patients with ALS was not available. We additionally genome analyses in ALS remains challenging, although efforts examined 2 ataxic sisters with SCA8 (aged 36 and 39 years) to are underway.12 In this report, we analyzed the ATXN8OS, compare the haplotype data with those for ALS. C9ORF72,andNOP56 genes in 102 Japanese patients with sporadic ALS and in 10 patients with mutations in various genes Standard protocol approvals, registrations, causative for ALS. and patient consents This study was approved by our institutional review board. All patients provided written informed consent. Methods Genetic testing Results All patients and controls were Japanese and were enrolled in this study from the Kinki region in Japan between 2005 and Results of genetic testing of our patients 2017. Blood samples were collected from 102 Japanese Genetic testing revealed that 3 patients with ALS had patients with sporadic ALS who had no mutations in the mutations in the ATXN8OS gene (figure 1), but none in the SOD1, FUS, TARDBP, SQSTM1, VCP, OPTN, UBQLN2, C9ORF72 gene or in the NOP56 gene. The clinical in- ATXN1, ATXN2, SMN1,orAR genes.2,11,13,14 DNA was formation of our 3 patients with ALS and 1 reported Korean extracted with a DNA extraction kit (Qiagen Inc, German- patient with an ALS-like phenotype is summarized in table 1, town, MD), and the region containing the CTA/CTG repeat and the detailed clinical history of our patients is described as of the ATXN8OS gene was amplified using PCR, as described follows. None of the controls had mutations in the ATX- previously.5,15 The amplified products were purified with gel N8OS, C9ORF72,orNOP56 genes. Controls had 26 ± 4 electrophoresis and subjected to Sanger sequencing. We an- repeats (mean ± SD), ranging from 18 to 32, in the ATX- alyzed the C9ORF72 and NOP56 genes by repeat-primed N8OS gene. Double mutations in different genes were PCR assay, as described previously.3,11 The normal number of not found in our cohort. Patient 1 had 223 repeats

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Table 1 Patients with ALS or an ALS-like phenotype associated with ATXN8OS mutations

Patient Patient 1 Patient 2 Patient 3 J Clin Neurol 2013;9:274

Sex FMFM

Age at examination (y) 56 68 76 65

Age at onset (y) 45 68 66 60

Age at PEG (y) 47 68 68 ND

Age at ventilator dependence (y) 48 68 (nasal) 71 (only night) ND

Initial symptoms Dysarthria Neck weakness Head drop Dysarthria

Rapid progression of dysphagia ++++

Rapid progression of respiratory failure ++− +

Dementia −−− ND

Ataxia −−− ? (Unsteadiness)

Parkinsonism −−− ND

Family history −−− + (ataxia)

ATXN8OS repeat no. 223 170 91 86

Repeat configuration CTA11CTG212 CTA9CTG161 CTA19CTG3CTA1CTG68 ND

MRI abnormality T2-high in the white matter Not apparent T2-high in the putaminal rim Mild cerebellar atrophy

Note — Death at 68 — Vertical nystagmus

Abbreviation: ND, not described; PEG = Percutaneous Endoscopic Gastrostomy.

(CTA11CTG212), and patient 2 had 170 repeats Clinical and imaging information for the 3 (CTA9CTG161). Patient 3 had 91 CTA/CTG repeats with patients with ATXN8OS-related ALS and 1 an interruption (CTA19CTG3CTA1CTG68). Interruption patient with an ALS-like phenotype by CTA in a sequence of CTG repeats has previously been The results of MRI are summarized in figure 2, A-C. The reported, but its significance is unknown.17 The haplotype detailed clinical histories of our patients are described below. analyses identified apparently different haplotypes in the patients with ALS, although their haplotypes were similar in Patients 1 part. By contrast, ataxic sisters with SCA8 had the same A 56-year-old woman, with 223 repeats, who had dysarthria haplotype except for the numbers of CTG repeats in the since the age of 45 years visited a local hospital. She had no ATXN8OS gene (table 2). These results suggested that the 3 family history or previous history of neurologic disease. The patients with ALS seemed unrelated. symptoms progressed over 1 year. She visited the local

Table 2 Result of haplotype analyses in patients with mutations in the ATXN8OS gene

Distance from CTA/CTG repeat Repeat motif Pt1 Pt2 Pt3 Ataxia1 Ataxia2

YI18 (AY561223) 284 k GATA 12/13 10/10 11/11 10/11 10/11

D13S1296 (Z51394) 57 k CA 23/26 23/23 26/27 25/26 25/26

ATXN8OS 0 CTA 11/10 9/7 19/9 7/9 7/9

ATXN8OS 0 CTG 212/17 161/20 72/15 158/15 144/15

JJ9 (AY561232) 17 k GT 12/12 13/13 12/13 12/13 12/13

JJ10 (AY561233) 20 k CT 8/9 9/9 8/10 9/10 9/10

JJ12 (AY561234) 52 k GT 14/17 17/17 14/18 16/17 16/17

Abbreviations: Ataxia1 and Ataxia2 = sisters with cerebellar ataxia; Pt 1-3 = patients with amyotrophic lateral sclerosis.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 neurogenic changes in the cranial nerve territory and upper Figure 1 Agarose gel electrophoretic analysis for the ATX- and lower limbs, with fibrillation in the right tibialis anterior N8OS – gene in patients (Pt) 1 3 muscle and fasciculation in the left trapezius and right deltoid muscle. One month later, dysphagia, dysarthria, and respiratory failure became apparent and progressed very rapidly. Two months later, atrophy of the face and limb muscles became apparent. DTRs were normal in the atrophied upper limbs, but increased in the lower limbs, with bilateral extensor planter response. The clinical diagnosis, according to the El Escorial diagnostic criteria, fulfilled the criteria for probable ALS. Videofluorography showed moderate involvement of oral and pharyngeal phases, with penetration into the larynx. The patient then received a nasal ventilator and underwent PEG about 4 months after onset. Although weakness in the 4 limbs remained mild (manual muscle testing 4/5), dysarthria and respiratory failure progressed with reduced vital capacity (49.1%). He refused tracheostomy and died of respiratory failure at age 68 years, about 5 months after onset. An autopsy was not performed. Three patients had expansions of the CTA/CTG repeat as indicated, whereas controls (C) had a normal repeat size. M, 100 base pair (bp) marker. Patient 3 A 76-year-old woman with 91 repeats noticed head dropping when walking at the age of 66 years. Ten months later (at the hospital again at the age of 46 years, with atrophy of the age of 67 years), she experienced dysphagia and weight loss, tongue, an increased jaw jerk reflex, increased deep tendon dropping from 78 to 50 kg in half a year. She had a history of reflexes (DTRs) in all 4 limbs, and positive plantar responses. complete resection of breast cancer at age 67 years. She had She was then referred to our hospital. A needle electromyo- no previous or family history of neurologic diseases. Neu- gram revealed neurogenic changes, with polyphasic or high- rologic examinations revealed severe dysphagia with aspi- amplitude neuromuscular units with long durations in the ration, dysarthria, facial weakness, and severe tongue tongue, left deltoid, and left tibialis anterior muscles. During atrophy. No nystagmus was noted. Mild weakness was ob- the following year, at the age of 47 years, dysarthria, dys- served in the neck and the right upper limb. DTRs were phagia, and neck flexor weakness became severe, but mild normal in the bilateral upper limbs and in the right patella, weakness of the limbs was seen only in the left upper ex- with decreases in the left patella tendon and bilateral Achilles tremity. Fasciculation was observed in the tongue and all 4 tendon reflexes. Bilateral extensor planter responses were limbs. She was unable to perform a spirometry because of positive. A needle electromyogram revealed neurogenic weak lip seal. She underwent percutaneous endoscopic gas- changes in all the examined muscles, including the right trostomy (PEG) at the age of 47 years. She then showed trapezius, biceps brachii, the first dorsal interosseous, rectus progressive respiratory failure and weakness and atrophy in all femoris, tibialis anterior, and tongue muscles. Fibrillation 4 limbs. She underwent tracheostomy with mechanical ven- potentials were present in the tibialis anterior and the first tilation at the age of 48 years. Her eyeball movement was not dorsal interosseous. At the age of 68 years, she began to limited and without nystagmus. At the age of 52 years, she was receive noninvasive positive pressure ventilation because of completely bedridden and moved only her fingers with very reduced vital capacity (66.2%) and underwent PEG for tube limited ranges, communicating with a computer-based tool. feeding. Cerebellar ataxia, parkinsonism, sensory distur- Cerebellar ataxia, parkinsonism, sensory disturbance, or au- bance, and autonomic failure were not apparent. MRI tonomic failure was not apparent during the disease course. revealed no apparent cerebral atrophy, but with faint T2- The clinical diagnosis, according to the El Escorial diagnostic hyperintense signals in the putaminal rim (not shown). criteria, fulfilled the criteria for definite ALS. Weakness of the upper limbs progressed slowly. She showed right vocal cord paralysis at the age of 69 years and then left Patient 2 paralysis at age 70 years, while the airway remained open. A 68-year-old man with 170 repeats noticed weakness of the She had aspiration pneumonia and underwent tracheostomy neck. Two months later, he visited our hospital at the age of 68 at the age of 71 years, 5 years after onset, but she became years. He had no previous or family history of neurologic independent of mechanical ventilation during the day after diseases. Weight loss (10 kg in 2 months) was reported. The recovery from pneumonia. She used a ventilator only during first neurologic examination revealed very mild weakness of the night for safety. The diagnostic criteria fulfilled the cri- neck flexion and flexion of the bilateral proximal upper limbs. teria for possible ALS, but with atypically slow progression. No nystagmus was noted. A spirogram revealed that % vital MRI at the age of 75 years is shown in figure 2C. She lived capacity was 81.9%. A needle electromyogram revealed alone, dealt with tube feeding and nighttime ventilation by

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 2 Imaging results for patients who had ALS with mutations in the ATXN8OS gene

(A.a–A.d) Results of MRI (Philips 1.5T, TE/TR = 100/4200 for axial T2-weighted image) of patient 1 (Pt 1) at the age of 47 years (2 years after onset). Atrophy ofthe cerebellum (A.a), pons (A.b), hippocampus (A.c, arrows), or frontal lobes (A.d) is not obvious; however, ischemic changes (A.d, arrows) in the white matter can be observed. (B.a–B.d) Results of MRI (SIEMENS Symphony 1.5T, TE/TR = 83/3400 for axial T2-weighted image and TE/TR = 12/450 for coronal T1-weighted image) of patient 2 (Pt 2) at the age of 68 years (2 months after onset). Because this patient was not able to complete the MRI examination, the sequences, angles, and resolutions were limited. Atrophy of the cerebellum (B.a, B.b), pons (B.c), hippocampus (B.c, arrows), or frontal lobes (B.d) is not obvious. (C.a–C.d) Results of MRI (SIEMENS Symphony 1.5T, TE/TR = 89/4200 for axial T2-weighted image) of patient 3 (Pt 3) at the age of 75 years (9 years after onset). Atrophy of the cerebellum (C.a), pons (C.b), hippocampus (C.c, arrows), or frontal lobes (C.d) is not obvious; however, high intensities were observed in the putamen (arrowhead). herself, and walked independently at the age of 76 years, involvement of both upper and lower motor neurons, al- more than 10 years after onset. though several atypical findings, such as mild atrophy of the cerebellum on MRI, vertical nystagmus, unsteady gait, and Discussion a family history of SCA8, precluded a diagnosis of ALS.9 A more evident involvement of lower motor neurons in SCA8 This study found that 3 sporadic patients who fulfilled the was described in an autopsied patient with atypical SCA8 and diagnosis of ALS had mutations in the ATXN8OS gene. subsequent motor neuron disease. Neuronal loss and gliosis Haplotype analyses suggested that the patients seemed un- were found in the cranial motor nucleus with basophilic related. By contrast, no patient had a mutation in the inclusions immunoreactive for TDP43, a protein causative of C9ORF72 or NOP56 gene, which was consistent with the familial ALS.10 These findings suggest that SCA8 occasionally results of other studies conducted in Japan.11,19 The ATX- affects upper and lower motor neurons, a prerequisite for N8OS gene has been viewed as causative for pure cerebellar a diagnosis of ALS. ataxia and parkinsonian disorders, both of which do not always affect motor neurons as in ALS. However, a systematic We found that the predominant clinical symptoms of patients review reported that about half of patients with SCA8 had with ATXN8OS-related ALS were neck weakness and bulbar hyperreflexia,20 an upper motor neuron sign. The phenotype signs including dysarthria and dysphagia. Neck weakness was of the reported patient from Korea mimicked ALS with a rare initial symptom in our cohort (only 3/102) and in

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 a reported study (2%).21 Of interest, neck weakness during Because noncoding repeat expansions may have some com- the disease process was a sign closely associated with bulbar mon pathomechanisms, including formation of RNA foci and symptoms.21 Bulbar-onset ALS, or ALS with bulbar sign repeat-associated non-ATG translation,34 a therapeutic ap- within 1 year of onset, has been associated with poor prog- proach to C9ORF72-related ALS may also be applicable to nosis.4 As shown in table 1, 3 of the 4 patients indeed showed ATXN8OS-related ALS. In C9ORF72-related ALS, suppres- rapid progression. However, we found that 1 patient with sion of abnormal transcription by antisense oligonucleotides a relatively small repeat size had severe and progressive bulbar is an ongoing clinical project.35 A similar method was recently symptoms at the beginning but remained ambulant and in- reported in SCA36.36 In another study, suppression of toxicity dependent of mechanical ventilation during the day, more in an abnormal ATXN8OS transcript by a certain protein in than 10 years after onset. Thus, clinical severity may vary and vivo exerted a therapeutic effect.37 Although the ATXN8OS might be associated with repeat sizes, which should be con- gene, reported to have bidirectional transcripts, may have firmed by future studies. a more complex pathomechanism,7 suppression of at least 1 pathologic pathway might help slow the disease process. Two of our patients had apparently nonsymptomatic MRI abnormalities: patient 1 had T2-hyperintense lesions in the In this study, we found that 3 patients with ALS had mutations cerebral white matter, and patient 3 had T2-hyperintense in the ATXN8OS gene. The coincidental occurrence of SCA8 lesions in the putaminal rim. The white matter lesions ob- and ALS is possible because mutations in the aforementioned served in patient 1 at the age of 47 years were a finding gene have been infrequently found in controls.5,6,38 However, relatively rare in individuals before the age of 50 years. the repeat sizes found in patients with ALS, 91-223 repeats, However, a reported 22-year-old patient who had SCA8 were not found in the reported control alleles in Japan (n = with 102 CTA/CTG repeats had T2-hyperintense lesions 654).38 The relatively low prevalence of SCA8 (0.7/100,000) in the periventricular white matter.22 Of interest, white and ALS (5/100,000) in Japan suggests that their coincidental matter lesions have been reported in some patients with coexistence is unlikely to happen in the 3 presumably un- other noncoding repeat diseases such as C9ORF72-related related patients. Three percent seems small, but is still rela- ALS23 and myotonic dystrophy type 1.24 These might tively large for Japan, because the most commonly mutated suggest the importance of noncoding repeat expansions in genes, including the SOD1 and SQSTM1 genes, each account glial degeneration. The T2-hyperintense lesions in the for 2%–3% of sporadic patients.13,19 Because ATXN8OS putaminal rim in patient 3 (without parkinsonism) was mutations were not found in general ALS in US,39 analysis of a finding often seen in multiple system atrophy of parkin- certain subtypes, such as cervical or bulbar-onset types, might sonian type, but also found in some control individuals.25 be needed. Our results may improve the understanding of the Such an MRI finding has not been described in SCA8. pathomechanism of ALS and extend the clinical phenotype of Although additional accumulation of patients will be SCA8. needed to draw firm conclusions, the MRI abnormalities might be a clue to the associations of the ATXN8OS gene, Author contributions as with nonsymptomatic atrophy in the hippocampus in M. Hirano and K. Saigoh contributed to acquisition of the VCP-related ALS.14,26 data, analysis or interpretation of the data, and drafting or revising the manuscript for intellectual content. M. Samukawa The observed finding that mutations in a single gene are and C. Isono contributed to design or conceptualization of the associated with multiple phenotypes, including ALS and spi- study, acquisition of the data, and analysis or interpretation of nocerebellar ataxia, has been described in several other genes. the data. Y. Nakamura and S. Kusunoki contributed to design In the ATXN1 gene for spinocerebellar ataxia type 1 or the or conceptualization of the study, analysis or interpretation of ATXN2 gene for spinocerebellar ataxia type 2 (SCA2), in- the data, and drafting or revising the manuscript for intermediate triplet repeat expansions or sometimes full tellectual content. expansions encoding polyglutamine proteins have been found – in patients with ALS.27 29 In addition, 2 independent reports Acknowledgment described that ataxia and ALS phenotypes were present within The authors thank Dr. Abe of Department of Neurology, the same family with ATXN2 mutations.29,30 The molecular Okayama University for technical assistance for the analysis of mechanisms underlying ATXN1-related or ATXN2-related the NOP56 gene. disorders may include altered clearance of cytosolic misfolded proteins, a mechanism shared with that for general ALS.27,31 Study funding Very recent studies demonstrated that suppression of ATXN2 This study was partly supported by Grants-in-Aid for Scien- expression by antisense oligonucleotides improved motor tific Research from the Ministry of Education, Culture, Sports, functions in SCA2 animal models32 and prolonged the life- Science and Technology of Japan (to MH16K09705). span of TDP43-related ALS models.33 These findings support the idea that 2 different phenotypes may be at least partly Disclosure related to a similar pathomechanism, which can be a thera- M. Hirano has received funding for speaker honoraria from peutic target. Daiichi Sankyo, Eisai, Otsuka Pharmaceutical, Sanofi, and

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Shire; has received Grants-in-Aid from Japan’s Ministry of 15. Isono C, Hirano M, Sakamoto H, Ueno S, Kusunoki S, Nakamura Y. Differential progression of dysphagia in heredity and sporadic ataxias involving multiple systems. Education, Culture, Sports, Science and Technology; and has Eur Neurol 2015;74:237–242. received research support from Kindai University and the 16. Ikeda Y, Dalton JC, Moseley ML, et al. Spinocerebellar ataxia type 8: molecular genetic comparisons and haplotype analysis of 37 families with ataxia. Am J Hum Japan ALS Association. M. Samukawa, C. Isono, K. Saigoh, Genet 2004;75:3–16. and Y. Nakamura report no disclosures. S. Kusunoki has re- 17. Ayhan F, Ikeda Y, Dalton JC, Day JW, Ranum LPW. Spinocerebellar ataxia type 8. In: Pagon RA, Adam MP, Ardinger HH, editors. GeneReviews®. Seattle, WA: University ceived funding for speaker honoraria from Teijin Pharma, of Washington; 1993. Nihon Pharmaceuticals, Japan Blood Products Organization, 18. Hirano M, Yamagishi Y, Yanagimoto S, Saigoh K, Nakamura Y, Kusunoki S. Time Biogen, Novartis, Dainippon Sumitomo Pharma, Kyowa course of radiological imaging and variable interindividual symptoms in amyotrophic lateral sclerosis and frontotemporal dementia associated with p.Arg487His mutation Kirin, Ono Pharmaceutical, Pfizer, Alexion, and Chugai; in the VCP gene. Eur Neurol 2017;78:78–83. serves on the editorial boards of the Journal of Neuro- 19. Nakamura R, Sone J, Atsuta N, et al. Next-generation sequencing of 28 ALS-related genes in a Japanese ALS cohort. Neurobiol Aging 2016;39:219.e1–219.e8. immunology, Clinical and Experimental Neurology, and the 20. Zeman A, Stone J, Porteous M, Burns E, Barron L, Warner J. Spinocerebellar ataxia Neurology and Clinical Neuroscience; and has received research type 8 in Scotland: genetic and clinical features in seven unrelated cases and a review fi of published reports. J Neurol Neurosurg Psychiatry 2004;75:459–465. support from Novartis, Dainippon Sumitomo Pharma, Sano , 21. Konno T, Shiga A, Tsujino A, et al. Japanese amyotrophic lateral sclerosis patients Japan Blood Products Organization, Otsuka, Kyowa Kirin, with GGGGCC hexanucleotide repeat expansion in C9ORF72. J Neurol Neurosurg Psychiatry 2013;84:398–401. Daiichi Sankyo, Eisai, Takeda, and Nihon Pharmaceuticals, as 22. Kumar N, Miller GM. White matter hyperintense lesions in genetically proven spi- well as from Japan’s Ministry of Education, Culture, Sports, nocerebellar ataxia 8. Clin Neurol Neurosurg 2008;110:65–68. 23. Oliveira Santos M, Caldeira I, Gromicho M, Pronto-Laborinho A, de Carvalho M. Science and Technology and their Agency for Medical Re- Brain white matter demyelinating lesions and amyotrophic lateral sclerosis in search and Development. Full disclosure form information a patient with C9orf72 hexanucleotide repeat expansion. Mult Scler Relat Disord 2017;17:1–4. provided by the authors is available with the full text of this 24. Hashimoto T, Tayama M, Miyazaki M, et al. Neuroimaging study of myotonic dys- article at Neurology.org/NG. trophy: I. Magnetic resonance imaging of the brain. Brain Dev 1995;17:24–27. 25. Tha KK, Terae S, Tsukahara A, et al. Hyperintense putaminal rim at 1.5 T: prevalence in normal subjects and distinguishing features from multiple system atrophy. BMC Received January 25, 2018. Accepted in final form May 7, 2018. Neurol 2012;12:39. 26. Hirano M, Matsumura R, Nakamura Y, et al. Unexpectedly mild phenotype in an ataxic family with a two-base deletion in the APTX gene. J Neurol Sci 2017;378:75–79. References 27. Elden AC, Kim HJ, Hart MP, et al. Ataxin-2 intermediate-length polyglutamine 1. Okazaki M, Suzuki H, Takahashi Y, et al. Novel mutation in the SOD1 gene in expansions are associated with increased risk for ALS. Nature 2010;466: a patient with early-onset, rapidly progressive amyotrophic lateral sclerosis. Neurol 1069–1075. Clin Neurosci 2017;5:189–191. 28. Conforti FL, Spataro R, Sproviero W, et al. Ataxin-1 and ataxin-2 intermediate-length 2. DeJesus-Hernandez M, Mackenzie IR, Boeve BF, et al. Expanded GGGGCC hex- PolyQ expansions in amyotrophic lateral sclerosis. Neurology 2012;79:2315–2320. anucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked 29. Tazen S, Figueroa K, Kwan JY, et al. Amyotrophic lateral sclerosis and spinocerebellar FTD and ALS. Neuron 2011;72:245–256. ataxia type 2 in a family with full CAG repeat expansions of ATXN2. JAMA Neurol 3. Renton AE, Majounie E, Waite A, et al. A hexanucleotide repeat expansion in C9ORF72 2013;70:1302–1304. is the cause of chromosome 9p21-linked ALS-FTD. Neuron 2011;72:257–268. 30. Baumer D, East SZ, Tseu B, et al. FTLD-ALS of TDP-43 type and SCA2 in 4. Ishiura H, Takahashi Y, Mitsui J, et al. C9ORF72 repeat expansion in amyotrophic a family with a full ataxin-2 polyglutamine expansion. Acta Neuropathol 2014; lateral sclerosis in the Kii peninsula of Japan. Arch Neurol 2012;69:1154–1158. 128:597–604. 5. Koob MD, Moseley ML, Schut LJ, et al. An untranslated CTG expansion causes 31. Park SH, Kukushkin Y, Gupta R, et al. PolyQ proteins interfere with nuclear degra- a novel form of spinocerebellar ataxia (SCA8). Nat Genet 1999;21:379–384. dation of cytosolic proteins by sequestering the Sis1p chaperone. Cell 2013;154: 6. Day JW, Schut LJ, Moseley ML, Durand AC, Ranum LP. Spinocerebellar ataxia type 134–145. 8: clinical features in a large family. Neurology 2000;55:649–657. 32. Scoles DR, Meera P, Schneider MD, et al. Antisense oligonucleotide therapy for 7. Moseley ML, Zu T, Ikeda Y, et al. Bidirectional expression of CUG and CAG ex- spinocerebellar ataxia type 2. Nature 2017;544:362–366. pansion transcripts and intranuclear polyglutamine inclusions in spinocerebellar 33. Becker LA, Huang B, Bieri G, et al. Therapeutic reduction of ataxin-2 extends lifespan ataxia type 8. Nat Genet 2006;38:758–769. and reduces pathology in TDP-43 mice. Nature 2017;544:367–371. 8. Baba Y, Uitti RJ, Farrer MJ, Wszolek ZK. Sporadic SCA8 mutation resembling cor- 34. Kearse MG, Todd PK. Repeat-associated non-AUG translation and its impact in ticobasal degeneration. Parkinsonism Relat Disord 2005;11:147–150. neurodegenerative disease. Neurotherapeutics 2014;11:721–731. 9. Kim JS, Son TO, Youn J, Ki CS, Cho JW. Non-ataxic phenotypes of SCA8 mimicking 35. Sareen D, O’Rourke JG, Meera P, et al. Targeting RNA foci in iPSC-derived motor amyotrophic lateral sclerosis and Parkinson disease. J Clin Neurol 2013;9:274–279. neurons from ALS patients with a C9ORF72 repeat expansion. Sci Transl Med 2013; 10. Yokoyama T, Ishiyama M, Hasegawa K, Uchihara T, Yagishita S. Novel neuronal 5:208ra149. cytoplasmic inclusions in a patient carrying SCA8 expansion mutation. Neuropa- 36. Matsuzono K, Imamura K, Murakami N, et al. Antisense oligonucleotides reduce thology 2014;34:27–31. RNA foci in spinocerebellar ataxia 36 patient iPSCs. Mol Ther Nucleic Acids 2017;8: 11. Kobayashi H, Abe K, Matsuura T, et al. Expansion of intronic GGCCTG hex- 211–219. anucleotide repeat in NOP56 causes SCA36, a type of spinocerebellar ataxia ac- 37. Tripathi BK, Surabhi S, Bhaskar PK, Mukherjee A, Mutsuddi M. The RNA binding companied by motor neuron involvement. Am J Hum Genet 2011;89:121–130. KH domain of Spoonbill depletes pathogenic non-coding spinocerebellar ataxia 8 12. Dolzhenko E, van Vugt J, Shaw RJ, et al. Detection of long repeat expansions from transcripts and suppresses neurodegeneration in Drosophila. Biochim Biophys Acta PCR-free whole-genome sequence data. Genome Res 2017;27:1895–1903. 2016;1862:1732–1741. 13. Hirano M, Nakamura Y, Saigoh K, et al. Mutations in the gene encoding p62 in 38. Izumi Y, Maruyama H, Oda M, et al. SCA8 repeat expansion: large CTA/CTG repeat Japanese patients with amyotrophic lateral sclerosis. Neurology 2013;80:458–463. alleles are more common in ataxic patients, including those with SCA6. Am J Hum 14. Hirano M, Nakamura Y, Saigoh K, et al. VCP gene analyses in Japanese patients with Genet 2003;72:704–709. sporadic amyotrophic lateral sclerosis identify a new mutation. Neurobiol Aging 2015; 39. Figley MD, Thomas A, Gitler AD. Evaluating noncoding nucleotide repeat expansions 36:e1601–e1606. in amyotrophic lateral sclerosis. Neurobiol Aging 2014;35:e931–e934.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 ARTICLE OPEN ACCESS ASFMR1 splice variant A predictor of fragile X-associated tremor/ataxia syndrome

Padmaja Vittal, MD, MS, Shrikant Pandya, BS, Kevin Sharp, MS, Elizabeth Berry-Kravis, MD, PhD, Lili Zhou, MD, Correspondence Bichun Ouyang, PhD, Jonathan Jackson, BS, and Deborah A. Hall, MD, PhD Dr. Hall [email protected] Neurol Genet 2018;4:e246. doi:10.1212/NXG.0000000000000246 Abstract Objective To explore the association of a splice variant of the antisense fragile X mental retardation 1 (ASFMR1) gene, loss of fragile X mental retardation 1 (FMR1) AGG interspersions and FMR1 CGG repeat size with manifestation, and severity of clinical symptoms of fragile X-associated tremor/ataxia syndrome (FXTAS).

Methods Premutation carriers (PMCs) with FXTAS, without FXTAS, and normal controls (NCs) had a neurologic evaluation and collection of skin and blood samples. Expression of ASFMR1 transcript/splice variant 2 (ASFMR1-TV2), nonspliced ASFMR1, total ASFMR1, and FMR1 messenger RNA were quantiﬁed and compared using analysis of variance. Least absolute shrinkage and selection operator (LASSO) logistic regression and receiver operating characteristic analyses were performed.

Results Premutation men and women both with and without FXTAS had higher ASFMR1-TV2 levels compared with NC men and women (n = 135,135, p < 0.0001), and ASFMR1-TV2 had good discriminating power for FXTAS compared with NCs but not for FXTAS from PMC. After adjusting for age, loss of AGG, larger CGG repeat size (in men), and elevated ASFMR1-TV2 level (in women) were strongly associated with FXTAS compared with NC and PMC (combined).

Conclusions This study found elevated levels of ASFMR1-TV2 and loss of AGG interruptions in both men and women with FXTAS. Future studies will be needed to determine whether these variables can provide useful diagnostic or predictive information.

From the Department of Neurosciences (P.V.), Northwestern Medicine Regional Medical Group, Winfield, IL; the Department of Bioengineering (S.P.), University of Illinois at Chicago; the Department of Pediatrics, Neurological Sciences, Biochemistry (K.S., E.B.-K., L.Z., J.J.), and the Department of Neurological Sciences (B.O., D.A.H.), Rush University Medical Center, Chicago, IL.

The Article Processing Charge was paid for by Neurology: Genetics. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary AR = activation ratio; ASFMR1 = antisense fragile-X mental retardation 1; ANOVA = analysis of variance; cDNA = complementary DNA; FMR1 = fragile X mental retardation 1; FXS = fragile X syndrome; FXTAS = fragile X-associated tremor/ ataxia syndrome; FXTAS-RS = FXTAS Rating Scale; LASSO = least absolute shrinkage and selection operator; mRNA = messenger RNA; NC = normal control; PMC = premutation carrier; ROC = receiver operating characteristic; TV2 = transcript variant 2; UTR = untranslated.

Fragile X-associated tremor/ataxia syndrome (FXTAS) is an are associated with the presence of neurologic symptoms in inherited neurodegenerative disorder in adults older than 50 PMC men with FXTAS. Within the CGG repeat element of years because of 55–200 (permutation range) CGG repeat the FMR1 gene, there are AGG trinucleotide interruptions expansion in the 59 untranslated (UTR) region fragile X (typically separated by 9–11 CGG repeats), which are known mental retardation 1 (FMR1) gene causing adult-onset ataxia.1 to disrupt the otherwise pure CGG repeat motif. Normal Primary features include progressive action tremor and cer- FMR1 alleles typically possess 2 or 3 AGG interruptions; ebellar ataxia, whereas associated findings include parkin- premutation alleles generally possess 2 or less interruptions, sonism, neuropathy, cognitive decline, and dysautonomia.2 whereas larger premutation alleles tend to have fewer AGG The CGG repeat in the 59 UTR is unstable and its repeat interruptions. The loss of AGG interruptions is believed to length in the normal population ranges from 6 to 55 increase the probability that large normal and small pre- repeats.3,4 More than 200 repeats (full mutation) is associated mutation size alleles will be unstable on transmission and with methylation and transcriptional silencing of FMR1 and expand to a full mutation allele on transmission from small or 14 consequent absence or deficiency of fragile X mental re- moderate size alleles. The rationale for investigating AGG tardation protein, resulting in fragile X syndrome5 (FXS). The interspersions is that pilot data from our group show that estimated prevalence of the FMR1 premutation is approxi- a lack of AGG interspersions is associated with neurologic fi mately 1/430 males and 1/209 females.6 The molecular signs. In this study, we hypothesized that elevated speci c mechanism of FXTAS includes elevated levels of the ex- splice variants (ASFMR1-TV2) of the ASFMR1 transcript and panded CGG repeat–containing messenger RNA (mRNA) a lack of AGG interspersions may play a role in FXTAS, and transcript and abnormal repeat-associated non–AUG- we attempted to determine the correlation between these initiated (RAN) translation products that lead to cellular features in development of clinical symptoms in FXTAS. toxicity and neuronal intranuclear inclusions (including DNA – damage response proteins).7 9 Methods Although there is a relationship in a large group analysis between the age at onset/motor severity of FXTAS and CGG Participants repeat size10 with increasing risk and severity at higher repeat This is a case-control study. Adult PMCs and healthy NCs lengths, the CGG repeat size alone does not fully explain risk. were recruited from the Rush University Fragile X-Associated Disorders Program. Recruitment occurred from 3 studies in- Women have a protective normal X allele, and hence, the 15–17 propensity for developing FXTAS is different between men vestigating neurologic phenotypes in PMCs and NCs and women. In carrier women, a higher activation ratio (AR) through clinics, and fragile X community events. The published criteria for FXTAS were followed to classify as possible, (percentage of cells expressing the normal FMR1 gene) may 3,4 10–12 probable, or definite FXTAS participants. lower the presence and severity of motor signs of FXTAS. It is probable, however, that there are additional secondary Standard protocol approvals, registrations, genes, medical conditions, and environmental factors that af- and patient consents ff fect the e ects of the premutation expansion and contribute to This study received approval from the Institutional Review the risk of developing symptoms. Board at the Rush University Medical Center. Written informed consent was obtained from all patients (or guardians A second gene, antisense FMR1 (ASFMR1) overlaps a portion of patients) participating in the study. The family history of of the FMR1 gene including the CGG repeat sequence, is FXS from participants (but not FXTAS or other neurologic transcribed in the reverse direction from FMR1 with 5 splice conditions in the family) was obtained. variants of unclear exact clinical impact.13 One of the variants previously described13 ASFMR1 splice variant 2 (ASFMR1 Neurologic testing transcript variant 2 [ASFMR1-TV2]) was further explored in Each subject was evaluated with a neurologic examination, the this study. Elevated levels of the expanded GCC repeat– FXTAS Rating Scale (FXTAS-RS),18 and the Total Neu- containing ASFMR1 transcript are observed in premutation ropathy Scale19 (modified to exclude those items that require carriers (PMCs),13 and small unpublished studies have sug- a nerve conduction study). The FXTAS-RS was developed to gested that certain splice variants of the ASFMR1 transcript measure the salient features of the movement disorder seen in

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG FXTAS. The scale was constructed by combining 3 published and then to the expression of an NC sample (primers and rating scales commonly used to assess tremor (Clinical Rating probes in table e-1, links.lww.com/NXG/A58). Scale for Tremor),20 ataxia (International Cooperative Ataxia Rating Scale),21 parkinsonism (Unified Parkinson’s Disease Statistical analysis Rating Scale),22 and a tandem gait item (Huntington’s Dis- Analysis of variance (ANOVA) or the Kruskal-Wallis test ease Rating Scale).23 (where appropriate) was performed to compare the levels of ASFMR1-TV2, nonspliced ASFMR1, total ASFMR1, and total CGG and AGG determination FMR1 among NCs, PMCs without FXTAS (PMC), and The FMR1 PCR assay (Asuragen Inc, Austin, TX) was per- PMCs with FXTAS (FXTAS). The sample size calculation formed on blood samples from participants using a recently was based on ANOVA comparing NCs, PMC without developed highly sensitive method, which detects all FMR1 FXTAS, and FXTAS. Pairwise comparisons were conducted expansions and allows accurate quantification of allele-specific with Bonferroni adjustment for multiple comparisons. The CGG repeat length,24,25 including identification of AGG FXTAS-RS scores were compared among different clinical interspersions, using primers that flank the repeat and internal phenotypes with ANOVA or the Kruskal-Wallis test. Receiver repeat primers. Southern blot assay was performed on sam- operating characteristic (ROC) curve analysis was performed ples from premutation women to determine the normal to evaluate the performance of ASFMR1-TV2 to discriminate AR.26,27 patients with FXTAS from others (NC and PMC). The following guide was used for interpretation: excellent 0.9–1; Fibroblast collection good 0.8–0.9; fair 0.7–0.8; poor 0.6–0.7; and fail 0.5–0.6. The Skin biopsy was performed under sterile conditions and de- Spearman correlation was used to examine the relationship livered to the laboratory immediately for processing. The skin between the CGG repeat size and the ratio of the splice biopsy was placed in culture media and later diced under variant and total ASFMR1 mRNA (table e-2, links.lww.com/ sterile conditions on a culture plate and then plated in T25 NXG/A58). Least absolute shrinkage and selection operator flasks in CHANG-Amnio™-Medium (Irvine Scientific, Santa (LASSO) logistic regression was performed to examine the Ana, CA), The flasks were incubated at 37°C with 5% carbon association of the splice variant, CGG repeat size, AGG dioxide. After cells grew out, longer-term cultures were interruptions, nonspliced ASFMR1,totalASFMR1, FMR1, maintained in Corning™ cellgro™ Cell Culture Media– and family history of FXS with FXTAS adjusted for age. Dulbecco’s Modified Eagle’s Medium supplemented with LASSO regression was used in this study to select the 10% fetal bovine serum (Gibco) and 1% Gibco® Antibiotic- strongest predictors. AR was included in the regression for Antimycotic (containing 10,000 units/mL of penicillin, woman. Data for men and women were analyzed separately 10,000 μg/mL of streptomycin, and 25 μg/mL of Gibco because the penetrance of FXTAS is much higher in men Amphotericin B). Aliquots of all cell lines were frozen and than in women. Missing data were excluded from the kept at −80° for long-term use in future studies. analysis.

ASFMR1 and FMR1 messenger RNA assays RNA was purified using the Qiagen RNeasy kit from blood or fibroblast samples. Samples were treated with DNase and Results screened for contamination; then, complementary DNA One hundred thirty-five participants including 56 men (mean, (cDNA) synthesis was performed using the High Capacity SD years; 65.2 ± 12.1 years) and 79 women (55.2 ± 15.5 cDNA Reverse Transcriptase Kit from Applied Biosystems, years) were recruited. Foster City, CA. The defining characteristic of ASFMR1-TV2 is the 84-nucleotide deletion near the beginning of the open Men reading frame and does include the repeat. The 84-nucleotide Men comprised 66% of those participants who met the cri- deletion excises an AUG associated with a stronger Kozack teria for FXTAS, 21% of PMCs without FXTAS and 45% of sequence than the proline reading frame.13 Because the AUG NCs. Twenty-six participants who met the criteria for FXTAS, for the polyproline frame is retained and competition is re- with a mean age of 71 ± 8.4 years, had a median CGG repeat duced, this potentially enhances the polyproline reading length of 91.5 (interquartile range [IQR] 29) (table 1). frame on ASFMR1-TV2.13 Relative expression of ASFMR1- Twelve PMC participants without FXTAS, with a mean age of TV2, nonspliced ASFMR1, total ASFMR1, and total FMR1 61 ± 11.8 years, had a median CGG repeat length of 78.5 mRNA were quantified using the VIIA 7 real-time quantitative (IQR 21). Eighteen NCs had a mean age of 59.7 ± 13.6 years PCR system (Applied Biosystems). The results were calcu- and a median CGG repeat length of 30 (IQR 10). Men with lated using a “Delta-Delta CT” (DDCT) algorithm (first FXTAS were older than PMC and NC, and the CGG repeat Delta CT [DCT] = [target expression] − [Gus-B expression]; size was higher in men with FXTAS than in PMC men and second Delta CT [DDCT] = [DCT] − normal control [NC]; NC men. Nineteen (73.1%) men with FXTAS, 3 PMCs − −DD fold increase of target vs NC = 2 (second delta CT) =2 CT; (25%), and 2 (11.8%) NC men had complete loss of AGG −DD fold increase = 2 CT) to compare relative expressions of interruptions. FXTAS-RS scores were higher in FXTAS par- target mRNA to the expression of the GUS-B control mRNA ticipants (median [IQR]: 56.5 [42]) than in the other 2

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 Table 1 Demographics in men (n = 56)

NC, N = 18 PMC, N = 12 FXTAS, N = 26 p Value

Age, mean (SD) 59.72 (13.64) 61 (11.81) 70.96 (8.38) 0.003

CGG, median (IQR) 30 (10) 78.5 (21) 91.5 (29) 0.15a

AGG, n (%) 0.0001

0 2 (11.76)1 3 (25) 19 (73.08)

≥1 15 (88.24) 9 (75) 7 (26.92)

FXTAS-RS, median (IQR) 5 (8) 7 (9.5) 56.5 (42) <0.0001

Neuropathy, median (IQR) 0(0)7 4(5)8 6(5)9 0.002

Family history, n (%) 8 (44.44) 11 (91.67) 22 (84.62) 0.003

FXTAS diagnosis (%)

Possible 2 (7.69)

Probable 10 (38.46)

Definite 14 (53.85)

Abbreviations: FXTAS = fragile X-associated tremor/ataxia syndrome; FXTAS-RS = fragile X-associated tremor/ataxia syndrome rating scale; IQR = interquartile range; NC = normal control; PMC = premutation carrier. Superscripts indicate the number of missing values. a Comparison between premutation and FXTAS.

groups (p < 0.0001). The total (modified) neuropathy score Coefficients for other independent variables including family was 6 (IQR 5) in those with FXTAS, 4 (IQR 5) in PMCs and history of FXS, nonspliced ASFMR1, total ASFMR1, and 0 (IQR 0) in NCs. Eighty-four percent (p = 0.003) of men FMR1 were shrunken to zero by the LASSO model, which with FXTAS had a family history of FXS. Participants who indicates that these variables did not have a strong relation- met the diagnostic criteria for FXTAS included 2 with pos- ship with FXTAS. sible, 10 with probable, and 14 with definite FXTAS. In men, there was a difference in all molecular variables (p < 0.01) Women among the 3 groups (table 2). Pairwise comparisons of the Thirteen participants who met the criteria for FXTAS, with molecular results were only significant when comparing a mean age of 69.8 ± 11 years, had an average CGG repeat normal vs FXTAS and normal vs PMC, but not when com- length of 92.2 ± 15.1 (table 3). Forty-four PMCs without paring PMC vs FXTAS. ROC curve analysis indicated that FXTAS, with a mean age of 50.3 ± 14.4 years, had an average ASFMR1-TV2 has a good discriminating power of FXTAS in CGG repeat length of 89.5 ± 19.6. Twenty-two NCs, with men (figure 1, A-F). The area under the curve (AUC) was a mean age of 56.4 ± 14.5 years, had an average CGG repeat 0.80 (95% CI = 0.68, 0.92). LASSO logistic regression analysis length of 31.6 ± 4.7. Women with FXTAS were older than with the adjustment of age showed that loss of AGG (co- PMC and NC, and the CGG repeat size was higher in efficient = −0.55) has strongest relationship with FXTAS, women with FXTAS than in PMC women and NC women. followed by a larger CGG repeat size (coefficient = 0.47) and Thirteen (100%) women with FXTAS, 32 PMCs (71%), and an elevated ASFMR1-TV2 level (coefficient = 0.21). 2 (9%) healthy women had complete loss of AGG

Table 2 Molecular data in men (n = 56)

NC, n = 18 PMC, n = 12 FXTAS, n = 26 p Value

ASFMR1-TV2, median 1.11 (1.42) 11.35 (20.22) 13.63 (15.74) <0.0001

Nonspliced ASFMR1, mean 0.99 (0.59) 2.17 (1.54) 1.77 (1.22) 0.02

Total ASFMR1, mean 1.04 (0.78) 4.23 (3.26) 4.27 (2.91) 0.0002

Total FMR1, median 0.94 (0.44) 1.43 (0.46)1 1.21 (0.51)1 0.02

Abbreviations: ASFMR1-TV2 = antisense fragile-X mental retardation transcript variant 2; FMR1 = fragile X mental retardation 1; FXTAS = fragile X-associated tremor/ataxia syndrome; NC = normal control; PMC = premutation carrier.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 1 ROC curve of ASFMR1-TV2

(A and B) ROC analysis indicated that ASFMR1-TV2 has a good discriminating power of FXTAS when comparing FXTAS with PMC and normal in men (A: AUC = 0.80; 95% CI = 0.68, 0.92) and women (B: AUC = 0.80; 95% CI = 0.67, 0.9). (C and D) ROC analysis indicated that ASFMR1-TV2 did not have a good discriminating power when comparing FXTAS with PMC in both men (C) and women (D) (men: AUC = 0.53, 95% CI = 0.32, 0.74; women: AUC = 0.69, 95% CI = 0.53, 0.85). (E and F) ROC analysis indicated that ASFMR1-TV2 has a good discriminating power when comparing PMC without FXTAS with normal in both men (E) and women (F) (men: AUC = 0.95, 95% CI = 0.86, 1; women: AUC = 0.92, 95% CI = 0.85, 0.99). (A–F) The green line is the diagonal reference line, and the blue line is the empirical ROC curve comparing FXTAS with NCs and premutation carriers (A and B), FXTAS with PMC (C and D), and PMC without FXTAS with controls (E and F) (The closer the ROC curve gets to the reference line, the worse the test. A large value of the AUC indicates a good test. An area of 1 means a perfect test, and 0.5 represents a worthless test). AUC = area under the curve; ASFMR1-TV2 = antisense fragile-X mental retardation-transcript variant 2; CI = confidence interval; FXTAS = fragile X-associated tremor/ataxia syndrome; NC = normal control; PMC = premutation carrier; ROC = receiver operating characteristic. interruptions. FXTAS-RS scores were higher in FXTAS FXTAS included 3 with possible, 4 with probable, and 6 with participants (median [IQR]: 30 [26]) than in the other 2 definite FXTAS. In women, ASFMR1-TV2 levels, total groups (p < 0.0001). The total (modified) Neuropathy Scale ASFMR1 levels, and FMR1 levels were different among the score was 2 (IQR = 2) in those with FXTAS, 1 (IQR = 3) in groups (table 4). There were no differences in the non- PMC and 0 (IQR = 1) in NC women (p = 0.01). More than spliced ASFMR1 levels among the groups. In women, pair- 90% of women with FXTAS and PMCs had a family history wise comparisons of the molecular results were significant of FXS. Participants who met the diagnostic criteria for when comparing between NC vs FXTAS and NC vs PMC,

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 Table 3 Demographics in women (n = 79)

NC, n = 22 PMC, n = 44 FXTAS, n = 13 p Value

Age, mean (SD) 56.36 (14.52) 50.29 (14.40) 69.77 (11.01) 0.0003

CGG, mean (SD) 31.59 (4.68) 89.52 (19.64) 92.15 (15.07) 0.66a

AR, mean (SD) NA 0.501 (0.23) 0.46 (0.31) 0.87a

AGG, n (%) <0.0001

0 2 (9.09) 32 (72.73) 13 (100)

≥1 20 (90.91) 12 (27.27) 0

FXTAS-RS, median (IQR) 3 (4) 7 (8) 30 (26) <0.0001

Neuropathy, median (IQR) 0 (1) 1 (3) 2 (2) 0.01

Family history, n (%) 5 (22.73) 40 (90.91) 12 (92.31) <0.0001

FXTAS diagnosis (%)

Possible 3 (23.08)

Probable 4 (30.77)

Definite 6 (46.15)

Abbreviations: AR = activation ratio; FXTAS = fragile X-associated tremor/ataxia syndrome; FXTAS-RS = fragile X-associated tremor/ataxia syndrome rating scale; IQR = interquartile range; NC = normal control; PMC = premutation carrier. Superscripts indicate the number of missing values. a Comparison between premutation and FXTAS.

but were not when comparing PMC vs FXTAS. ASFMR1- was also a negative correlation among the controls (correla- TV2 showed a good discriminating power of FXTAS from tion coefficient = −0.74, p = 0.02), but no correlation theROCcurveanalysis(figure 2, AUC = 0.8, 95% CI = 0.67, was found among the PMCs (CGG was adjusted for AR) 0.9). LASSO logistic regression, adjusting for age, showed (correlation coefficient = 0.08, p = 0.70). that the loss of AGG (coefficient = −0.5555) has the strongest relationship with FXTAS, followed by ASFMR1- TV2 (coefficient = 0.4747) and total ASFMR1 (coefficient = Discussion 0.2121). Other variables including family history of FXS, nonspliced ASFMR1, AR, CGG repeat size, and FMR1 did The main purpose of this study was to identify molecular not show a strong relationship with FXTAS from the LASSO markers to help predict which PMC will get FXTAS because regression model. even for male carriers, not all PMC will get the disease.14 The exact clinical impact of ASFMR1 splice variants is unclear; In men, we found a negative correlation between the CGG however; it has been postulated that in addition to FMR1, repeat size and the ratio of the splice variant and total elevated levels of the expanded GCC repeat containing the ASFMR1 mRNA among the NCs (correlation coefficient = ASFMR1 transcript are observed in PMCs and may contribute −0.62, p = 0.04), but a positive correlation among the PMCs to the variable phenotypes associated with the CGG repeat (correlation coefficient = 0.81, p < 0.0001). In women, there expansion.14

Table 4 Molecular results in women (n = 79)

NC, n = 22 PMC, n = 44 FXTAS, n = 13 p Value

ASFMR1-TV2, median 0.91 (0.67) 6.92 (10.29) 12.52 (29.37) <0.0001

Nonspliced ASFMR1, mean 0.78 (0.41) 0.93 (0.69) 1.3 (0.96) 0.1

Total ASFMR1, mean 0.93 (0.48) 2.42 (1.87) 3.52 (2.62) 0.0002

Total FMR1, median 0.89 (0.32) 1.05 (0.48) 1.22 (0.43) 0.01

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 2 Antisense FMR transcript variant 2

Defining characteristic of ASFMR1-TV2. There is an 84-nt deletion at near the beginning of the ASFMR1 ORF that has an enhanced expression compared with a healthy control. We designed strand specific primers that target the presence and absence of the 84-nt sequence to determine the fold increase relative to GUS expression for ASFMR1-TV2 spliced and nonspliced assays. ASFMR1-TV2 = antisense fragile-X mental retardation transcript variant 2; FMR = fragile X mental retardation; nt = nucleotide; ORF = open reading frame.

This is the first study to evaluate ASFMR1 splice variant levels criteria leads to the high number having the MCP sign rather in PMCs and FXTAS patients. The reason this study con- than our population of FXTAS women being different from centrated on ASFMR1-TV2 (figure 2) was because small the populations that have been published in the past. Alter- unpublished studies suggested that this splice variant of the natively, the patterns of relationships found may indicate that ASFMR1 transcript might be associated with neurologic regardless of the sample size, elevated RNA products from the symptoms in FXTAS men. This study reports elevated levels repeat-containing gene are a phenomenon more related to of ASFMR1-TV2 in FXTAS and a loss of AGG interruptions just the presence of a premutation, rather than reflecting in men with FXTAS. In addition, this study also showed that a threshold of abnormal RNAs at which symptoms occur. the FXTAS-RS and Neuropathy Scale scores were higher in RAN translation has been described in FXTAS as a potential patients with FXTAS compared with PMCs and NCs. We additional mechanism of toxicity independent of the pre- were not able to distinguish between PMCs and FXTAS with sumed RNA toxicity. Measurement of RAN translation pairwise comparisons of ASFMR1-TV2, nonspliced ASFMR1, products could be more closely correlated with amount and total ASFMR1, or total FMR1. on the time of the onset of symptoms. Additional studies may be warranted to combine molecular and other biomarkers, Although we found that ASFMR1-TV2 and lack of AGG were such as examination, imaging, or laboratory markers, to in- more common in FXTAS, the power to discriminate between crease the positive predictive value and the clinical utility. PMCs and FXTAS was not high enough to use alone di- agnostically or in a predictive manner. This may be because Both AUG-initiated and repeat-associated non-AUG (RAN) our sample sizes were too small overall. Some of the groups, translation have been shown to occur from ASFMR1 CCG such as the PMC men without FXTAS and the FXTAS repeats.28 Associated transcripts are capable of forming strong women group did not have many participants. Because the secondary structures in vitro, either RNA hairpins or disease is highly penetrant in men, it was difficult to recruit G-quadruplexes, and are important to the process underlying PMC men without FXTAS. Women with FXTAS were also RAN translation. It is yet unknown if secondary structures difficult to recruit because there is a lower prevalence in linked to ASFMR1-TV2 may also be linked to RAN trans- women. The published criteria for FXTAS3,4 were followed, lation and whether toxicity occurs from the expression of and because the women have milder features than men with proteins generated from translation of this variant. Pilot work FXTAS, many of them needed either the middle cerebellar from our research group suggests an association between the peduncle sign or brainstem white matter lesions to qualify for lack of AGG interspersions in FMR1 PMCs and higher rates probable FXTAS. Thus, the strict application of the diagnostic of neurologic signs, which was confirmed in this study. It is

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 recognized that the results regarding the lack of AGG inter- received research support from the American Brain Founda- ruptions may represent instead a relationship with the longest tion and the National Ataxia Foundation. S. Pandya and K. pure CGG repeat size. The loss of AGG interruptions is seen Sharp report no disclosures. E. Berry-Kravis serves or has in PMCs at a much higher rate than NCs because it makes served on the scientific advisory boards of Vteese, BioMarin, these repeats more unstable and hence more likely to expand Marinus, Fulcrum, Cydan, GW, and Ovid; holds a patent meiotically and (presumably) somatically in tissues. Similarly, regarding a method for assay of CCHS-causing polyalanine one would presume that PMCs with fewer AGG interruptions repeat expansion for diagnosis; receives or has received pub- would have larger pure repeats. Then, these larger pure lishing royalties for The Fragile X Tremor Ataxia Syndrome repeats are associated with enhanced transcription of the (FXTAS); consults or has consulted for Fulcrum and FMR1 and ASFMR1 loci because of changes in local Zynerba; and has received research support from Vtesse, chromatin.29,30 Additional studies are needed to determine Ovid, Neuren, NIH/NICHD, NIH/NCATS, CDC, NIH/ which factor is responsible for the association. NINDS, NIH/NIMH, and the John Merck Fund. L. Zhou, B. Ouyang, and J. Jackson report no disclosures. D.A. Hall served It is important to find molecular markers that can serve as or has served on the scientific advisory board of the National screening tools and increase diagnostic certainty, not only to Fragile X Foundation; serves or has served on the editorial help families of patients at risk of disorder but also to enable board of Neurology Today; consults or has consulted for the drug discovery, so timely treatment can be implemented. NIH; and has received research support from Pfizer, Neuro- Both PMCs and FXTAS participants had elevated levels of crine, AbbVie, NIH, Shapiro Foundation, Anti-Aging Foun- ASFMR1 splice variant 2, and loss of AGG interruptions was dation, and Parkinson Foundation. Full disclosure form associated with FXTAS in men. These markers may have information provided by the authors is available with the full utility if combined with other predictive factors to better text of this article at Neurology.org/NG. predict who will get FXTAS. Additional work also needs to be done to determine the contribution to the mechanism of Received August 14, 2017. Accepted in final form April 11, 2018. CCG-mediated toxicity in PMCs. References 1. Hagerman RJ, Leehey M, Heinrichs W, et al. Intention tremor, parkinsonism, and Author contributions generalized brain atrophy in male carriers of fragile X. Neurology 2001;57: 127–130. P. Vittal: conception of the study, subject recruitment and 2. Hall DA, O’Keefe JA. Fragile x-associated tremor ataxia syndrome: the expanding neurologic evaluation, skin biopsy, and organizing and writing clinical picture, pathophysiology, epidemiology, and update on treatment. Tremor of the first draft of the manuscript. S. Pandya and K. Sharp: Other Hyperkinet Mov (N Y) 2012;2. 3. Jacquemont S, Hagerman RJ, Leehey M, et al. Fragile X premutation tremor/ataxia performance of RNA assays. J. Jackson: performance of gen- syndrome: molecular, clinical, and neuroimaging correlates. Am J Hum Genet 2003; otyping and AGG analysis. L. Zhou: performance of geno- 72:869–878. fi 4. Brunberg JA, Jacquemont S, Hagerman RJ, et al. Fragile X premutation carriers: typing and AGG analysis, broblast cultures, and supervision characteristic MR imaging findings of adult male patients with progressive cerebellar of laboratory assays. B. Ouyang: statistical analysis. E. Berry- and cognitive dysfunction. Am J Neuroradiol 2002;23:1757–1766. 5. Pieretti M, Zhang FP, Fu YH, et al. Absence of expression of the FMR-1 gene in fragile Kravis: conception of the study, review and critique of the X syndrome. Cell 1991;66:817–822. manuscript, and oversight of laboratory studies. D.A. Hall: 6. Tassone F, Iong KP, Tong TH, et al. FMR1 CGG allele size and prevalence ascer- tained through newborn screening in the United States. Genome Med 2012;4:100. conception of the study, subject recruitment, and review and 7. Tassone F, Beilina A, Carosi C, et al. Elevated FMR1 mRNA in premutation carriers is critique of the manuscript. due to increased transcription. RNA 2007;13:555–562. 8. Todd PK, Oh SY, Krans A, et al. CGG repeat-associated translation mediates neurodegeneration in fragile X tremor ataxia syndrome. Neuron 2013;78:440–455. Acknowledgment 9. Robin G, López JR, Espinal GM, et al. Calcium dysregulation and Cdk5-ATM The authors thank the American Brain Foundation and the pathway involved in a mouse model of fragile X-associated tremor/ataxia syndrome. Hum Mol Genet 2017;26:2649–2666. National Ataxia Foundation for their support of the Clinical 10. Leehey MA, Berry-Kravis E, Goetz CG, et al. FMR1 CGG repeat length predicts Research Training Fellowship grant in Ataxia and Tracy motor dysfunction in FXTAS. Neurology 2008;70:1397–1402. 11. Berry-Kravis E, Potanos K, Weinberg D, et al. Penetrance of fragile X-associated Waliczek and Evelyn Perez for their assistance during skin tremor/ataxia syndrome (FXTAS) in two sisters related to X-inactivation pattern. biopsy and blood sample collection. They thank Integrated Ann Neurol 2005;57:144–147. 12. Hall DA, Robertson-Dick EE, O’Keefe JA, et al. Repeat size and X-inactivation in the DNA Technologies (Coralville, IA) for custom-designed clinical phenotype of fragile X premutation carrier sisters: a familial case series. Neurol primers and probes. They also thank the participants of this Genet 2016;2:e45. doi: 10.1212/NXG.0000000000000045. 13. Ladd PD, Smith LE, Rabaia NA, et al. An antisense transcript spanning the CGG study. repeat region of FMR1 is upregulated in premutation carriers but silenced in full mutation individuals. Hum Mol Genet 2007;16:3174–3187. Study funding 14. Yrigollen CM, Durbin-Johnson B, Gane L, et al. AGG interruptions within the maternal FMR1 gene reduce the risk of offspring with fragile X syndrome. Genet Med Clinical Research Training Fellowship grant in Ataxia spon- 2012;14:729–736. sored by the American Brain Foundation and the National 15. Hall D, Todorova-Koteva K, Pandya S, et al. Neurological and endocrine phenotypes of fragile X carrier women. Clin Genet 2016;89:60–67. Ataxia Foundation. 16. Berry-Kravis E, Goetz CG, Leehey MA, et al. Neuropathic features in fragile X premutation carriers. Am J Med Genet A 2007;143A:19–26. 17. Jacquemont S, Hagerman RJ, Leehey MA, et al. Penetrance of the fragile X-associated Disclosure tremor/ataxia syndrome in a premutation carrier population. JAMA 2004;291: P. Vittal has received funding for travel and/or speaker hon- 460–469. ’ 18. Leehey M, Goetz C, Berry-Kravis E. Development of the FXTAS rating scale for oraria and served on speakers bureaus of Teva Pharmaceu- quantitative motor analysis. Presented at the 10th International Congress of Par- tical Industries Ltd and Adamas Pharmaceuticals Inc. and has kinson’s Disease and Movement Disorders; October 30, 2006; Kyoto, Japan.

8 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG 19. Cornblath DR, Chaudhry V, Carter K, et al. Total neuropathy score: validation and 25. Filipovic-Sadic S, Sah S, Chen L, et al. A novel FMR1 PCR method for the routine reliability study. Neurology 1999;53:1660–1664. detection of low abundance expanded alleles and full mutations in fragile X syndrome. 20. Fahn S, Tolosa E, Marin C. Clinical rating scale for tremor. In: Jankovic J, Tolosa E, Clin Chem 2010;56:399–408. editors. Parkinson’s Disease and Movement Disorders. Baltimore, Munich: Urban & 26. Godler DE, Tassone F, Loesch DZ, et al. Methylation of novel markers of fragile X Schwartzenberg; 1987:225–234. alleles is inversely correlated with FMRP expression and FMR1 activation ratio. Hum 21. Trouillas P, Takayanagi T, Hallett M, et al. International cooperative ataxia rating scale for Mol Genet 2010;19:1618–1632. pharmacological assessment of the cerebellar syndrome: the Ataxia Neuropharmacology 27. Annemieke JMHV, Pieretti M, Sutcliffe JS, et al. Identification of a gene (FMR-1) Committee of the World Federation of Neurology. J Neurol Sci 1997;145:205–211. containing a CGG repeat coincident with a breakpoint cluster region exhibiting length 22. Fahn S, Elton R; members of the UPDRS Development Committee. Unified Par- variation in fragile X syndrome. Cell 1991;65:905–914. kinson’s disease rating scale. In: Fahn S, Marsden C, Calne D, Goldstein M, editors. 28. Krans A, Kearse M, Todd PK. Repeat-associated non-AUG translation from antisense Recent Development in Parkinson’s Disease. Florham Park, NJ: Macmillan Health CCG repeats in fragile X tremor/ataxia syndrome. Ann Neurol 2016;80:871–881. Care Information; 1987:153–164. 29. Todd PK, Oh SY, Krans A, et al. Histone deacetylases suppress CGG repeat-induced 23. Siesling S, Zwinderman AH, van Vugt JP, et al. A shortened version of the motor section neurodegeneration via transcriptional silencing in models of fragile X tremor ataxia of the Unified Huntington’s Disease Rating Scale. Mov Disord 1997;12:229–234. syndrome. PLoS Genet 2010;6:e1001240. 24. Chen L, Hadd A, Sah S, et al. An information-rich CGG repeat primed PCR that 30. Hoem G, Raske CR, Garcia-Arocena D, et al. CGG-repeat length threshold for FMR1 detects the full range of fragile X expanded alleles and minimizes the need for southern RNA pathogenesis in a cellular model for FXTAS. Hum Mol Genet 2011;20: blot analysis. J Mol Diagn 2010;12:589–600. 2161–2170.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 9 ARTICLE OPEN ACCESS Longitudinal analysis of contrast acuity in Friedreich ataxia

Ali G. Hamedani, MD, MHS,* Lauren A. Hauser, MS, Susan Perlman, MD, Katherine Mathews, MD, Correspondence George R. Wilmot, MD, PhD, Theresa Zesiewicz, MD, S.H. Subramony, MD, Tetsuo Ashizawa, MD, Dr. Hamedani [email protected] Martin B. Delatycki, MD, PhD, Alicia Brocht, MS, and David R. Lynch, MD, PhD

Neurol Genet 2018;4:e250. doi:10.1212/NXG.0000000000000250 Abstract Objective To determine the natural history of contrast acuity in Friedreich ataxia.

Methods In the Friedreich Ataxia–Clinical Outcome Measures Study, participants (n = 764) underwent binocular high- and low-contrast visual acuity testing at annual study visits. Mixed-effects linear regression was used to model visual acuity as a function of time, with random intercepts and slopes to account for intraindividual correlation of repeated measurements. A time-varying covariate was used to adjust for diabetes, and interaction terms were used to assess for effect modification by GAA repeat length, disease duration, and other variables.

Results Across a median of 4.4 years of follow-up, visual acuity decreased significantly at 100% contrast (−0.37 letters/y, 95% confidence interval [CI]: −0.52 to −0.21), 2.5% contrast (−0.81 letters/ year, 95% CI: −0.99 to −0.65), and 1.25% contrast (−1.12 letters/y, 95% CI: −1.29 to −0.96 letters/year). There was a significant interaction between time and GAA repeat length such that the rate of decrease in visual acuity was greater for patients with higher GAA repeat lengths at 2.5% contrast (p = 0.018) and 1.25% contrast (p = 0.043) but not 100% contrast. There was no effect modification by age at onset after adjusting for GAA repeat length.

Conclusions Low-contrast visual acuity decreases linearly over time in Friedreich ataxia, and the rate of decrease is greater at higher GAA repeat lengths. Contrast sensitivity has the potential to serve as a biomarker and surrogate outcome in future studies of Friedreich ataxia.

*Conducted statistical analysis (academically affiliated).

From the Department of Neurology (A.G.H., D.R.L.), University of Pennsylvania; Divisions of Neurology and Pediatrics (L.A.H., D.R.L.), Children’s Hospital of Philadelphia, PA; Department of Neurology (S.P.), University of California at Los Angeles; Departments of Neurology and Pediatrics (K.M.), University of Iowa; Department of Neurology (G.R.W.), Emory University, Atlanta, GA; Department of Neurology (T.Z.), University of South Florida, Tampa Bay; Department of Neurology (S.H.S.), University of Florida, Gainesville; Department of Neurology (T.A.), Houston Methodist Hospital, TX; Murdoch Children’s Research Institute (M.B.D.), Melbourne, Victoria, Australia; and Department of Neurology (A.B.), University of Rochester, NY.

Supported by a grant from the Friedreich Ataxia Research Alliance.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary CI = conﬁdence interval; FA-COMS = Friedreich Ataxia–Clinical Outcome Measures Study; FRDA = Friedreich ataxia; IQR = interquartile range.

Friedreich ataxia (FRDA) is the most common inherited binocularly using the 2.5% and 1.25% Low-Contrast Sloan cause of ataxia.1 Optic neuropathy is a well-known but under- Letter Charts at a distance of 2 m (Precision Vision, LaSalle, – recognized clinical manifestation of FRDA.2 5 Although vi- IL) using a protocol developed to measure visual dysfunction – sion loss is initially mild,6 8 it becomes more prominent as the in MS and Friedreich ataxia,17 and the total number of letters disease progresses, and there are numerous reports of patients correctly identiﬁed at each level of contrast was recorded. who experience dramatic subacute vision loss similar to Leber Visual acuity was measured by trained technicians, and par- – hereditary optic neuropathy.9 11 ticipants wore their standard refractive correction for distance.

Low-contrast letter acuity is a well-established clinical corre- Statistical analysis late of optic nerve disease across multiple neurologic dis- Statistical analyses were performed using STATA version 12 orders, and in FRDA, it has been found to be associated with (College Station, TX). Multilevel linear regression models predictors of disease severity such as age and GAA repeat were used to model visual acuity at both high and low contrast length; non-neurologic measures of disease severity such as as a function of time, with a random intercept and slope for the presence of diabetes, hearing loss, and cardiomyopathy; each participant to account for intraindividual correlation of and neurologic measures of disease severity such as the repeated measurements. Regression models were adjusted for Friedreich ataxia rating scale, timed 9-hole peg test (9HPT), diabetes using a time-varying covariate to capture both those and timed 25-foot walk (T25W).12,13 Because contrast acuity who had diabetes at baseline and those who were diagnosed is easily and reliably measured, there is growing interest in its with diabetes during the follow-up period. Modification of the use as a clinical predictor of disease severity and surrogate effect of time on visual acuity by GAA repeat length and age at outcome in clinical trials for FRDA, particularly among more onset was assessed using interaction terms. The duration of affected patients. follow-up was highly variable, with many participants contributing only a single baseline visit and some contributing as However, the use of contrast acuity as a biomarker in FRDA is many as 12 years of follow-up. To assess for potential in- limited by a lack of longitudinal data. To determine the nat- formation bias due to differential follow-up, linear regression ural history of contrast acuity in these patients, we performed models were constructed for the follow-up duration as a longitudinal analysis of a large prospective cohort study of a function of baseline demographic characteristics. patients with FRDA. We hypothesized that contrast acuity would decrease linearly over time and that the rate of decrease would be greater for patients with longer GAA repeat lengths Results and earlier age at onset. At the time of this analysis, the FA-COMS cohort consisted of 764 patients, of whom 50.4% were female. The median age at Methods onset was 11 years (interquartile range [IQR]: 7–17), with a median age at the baseline study visit of 23 years (IQR: Standard protocol approvals, registration, and 15–34). The smaller GAA allele had a median length of patient consents 666 repeats (IQR: 466–800), and the baseline prevalence of Institutional review board approval was obtained at each diabetes was 5%. participating site, and written informed consent was obtained from all patients for participation in the study. Of the 764 patients in the cohort, 332 participated in a single study visit and thus did not contribute data to the longitudinal Study design analysis. The remaining 432 patients were followed up for The Friedreich Ataxia–Clinical Outcome Measures Study a median of 5 visits over a median follow-up duration of 4.4 (FA-COMS) is an ongoing prospective cohort study of years (IQR: 2.0–6.3). At baseline, mean binocular visual patients with Friedreich ataxia being followed at one of 12 acuity at 100% contrast was 58.8 letters (IQR: 55–65) of – clinical sites since 2001.14 16 Baseline genetic confirmation a maximum of 70, corresponding to a Snellen visual acuity was obtained via commercial or research testing, and in- equivalent of 20/20, but 7.6% of patients had 20/40 acuity or formation regarding age at onset and other medical comor- worse. This level of acuity generally qualifies as “visually im- bidities was collected. At each annual follow-up visit, paired” and would limit the ability to drive without restric- participants underwent contrast letter acuity testing using tions in almost all US states. At 2.5% contrast, the mean retro-illuminated charts. High-contrast acuity was tested both number of letters was 31 letters (95% CI: 25–42), and at monocularly and binocularly. Low-contrast acuity was tested 1.25%, it was 25 letters (95% CI: 14–33).

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 1 Difference in binocular 100% contrast acuity between baseline and follow-up visit

The sample size at each visit is indicated in parentheses.

The mean difference in visual acuity between each follow-up time at low contrast but not high contrast. For each additional visit and the baseline study visit at 100%, 2.5%, and 1.25% tertile of GAA triplet repeat, the number of letters lost per year contrast (figures 1–3), respectively, demonstrated a generally increased by 0.26 letters (95% CI: 0.05–0.47) at 2.5% contrast linear pattern of decrease, particularly at low contrast. In and 0.21 letters (95% CI: 0.006–0.41) at 1.25% contrast. There diabetes-adjusted multilevel regression models, the average rate was no significant interaction between the age at onset and of change in vision was −0.37 letters per year at 100% contrast time. Using these interaction terms, the predicted time to loss (95% CI: −0.52 to −0.21), −0.81 letters per year at 2.5% con- of 7 letters of contrast acuity stratified by tertiles of GAA repeat trast (95% CI: −0.99 to −0.65), and −1.12 letters per year at length and age at onset is shown in tables 1 and 2. 1.25% contrast (−1.29 to −0.96). These estimates did not change after adjusting for sex, age at onset, or GAA repeat At the final follow-up, mean binocular high-contrast acuity length. However, the addition of interaction terms did reveal was 57.2 letters, again corresponding to a Snellen equivalent asignificant interaction between the GAA repeat length and of 20/20. However, the percentage of patients who saw 20/40

Figure 2 Difference in binocular 2.5% contrast acuity between baseline and follow-up visit

The sample size at each visit is indicated in parentheses.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 Figure 3 Difference in binocular 1.25% contrast acuity between baseline and follow-up visit

The sample size at each visit is indicated in parentheses.

or worse increased to 11.9%. Of the 65 patients who were seen acuity over time that is greater in subjects with higher GAA at 9 follow-up visits, 11 (16.9%) saw 20/40 or worse, and of repeat lengths. High-contrast acuity is also affected, but this the 12 patients who were seen at all 11 follow-up visits, 4 becomes apparent only at longer follow-up intervals. This (33.3%) saw 20/40 or worse. reduction in low-contrast acuity but sparing high-contrast acuity likely reflects subtle optic nerve dysfunction. Contrast Linear regression models were also constructed for the follow- sensitivity also relies on higher-order cortical visual in- up duration as a function of baseline demographic variables to tegration, and recent studies have found evidence of cognitive assess for information bias due to differential follow-up. In impairment in FRDA including with visuospatial reasoning, so univariate analyses, individuals with a history of hypertrophic it is possible that this reduction in low-contrast acuity is cardiomyopathy at baseline had an average of 0.90 less years multifactorial in etiology.18 However, cognitive impairment in of follow-up than those without (95% CI: 0.37–1.42), and the FRDA is extremely mild and detectable only by detailed follow-up duration decreased with increasing GAA repeat neuropsychological testing and thus is unlikely to affect length (0.25 less years per quintile of higher GAA repeat contrast sensitivity. The fact that low-contrast acuity dem- length, 95% CI: 0.07–0.42). Otherwise, there was no associ- onstrates a predictable decrease over time that depends on an ation between age at onset, age at diagnosis, sex, diabetes, or internal predictor of disease severity (namely, GAA repeat scoliosis and follow-up duration. length) supports its use as a potential biomarker in future studies. As a biomarker, low-contrast acuity has the advantage Discussion of being easily and reliably measured. This may be particularly relevant for gene therapy, in which treatment delivery remains In this large prospective cohort study of patients with FRDA, a challenge, particularly for inherited CNS diseases. De- there is a significant essentially linear decrease in low-contrast velopment and validation of vision-based outcomes open the

Table 2 Estimated number of years to loss of 7 letters of Table 1 Estimated number of years to loss of 7 letters of binocular 1.25% contrast acuity stratified by binocular 2.5% contrast acuity stratified by minimum GAA repeat length and age at onset minimum GAA repeat length and age at onset Minimum Age at Minimum Minimum Minimum Age at Minimum Minimum GAA 738- onset, y GAA <510 GAA 512-733 GAA 738-1320 onset, y GAA <510 GAA 512-733 1320

<8 22 8.6 5.3 <8 8.9 6.6 5.3

9–15 20 8.2 5.2 9–15 7.7 6.0 4.9

>16 18 7.9 5.1 >16 7.0 5.4 4.9

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG door to retinal gene therapy as a potential proof of concept in clinical trial studies. K. Mathews receives support for clinical Friedreich ataxia and as a clinically relevant therapeutic trials from Horizon Pharma; has served on the scientific intervention. advisory boards of DSMB, Santhera, Sarepta, BMS, and MSA; has received research funding from the NIH, the Despite being one of the largest cohorts of its kind, our study CDC, and the Friedreich’s Ataxia Research Alliance; and has experienced sample size limitations, particularly at longer received research support from PTC Therapeutics, Sarepta follow-up intervals. Although this was primarily due to cen- Therapeutics, Eli Lilly, aTyr, Pfizer, FibroGen, Roche, and soring (and possibly mortality, given the association between Italfarmaco for clinical trials. G.R. Wilmot receives research hypertrophic cardiomyopathy and shorter follow-up dura- support from the National Ataxia Foundation and Frie- tion) rather than loss to follow-up, this nevertheless intro- dreich’s Ataxia Research Alliance and support for clinical duces the potential for information bias. This becomes trials from Reata Pharmaceuticals and Biohaven Pharma- particularly relevant when calculating the time to loss of 7 ceuticals; has served on the Santhera Pharmaceuticals Sci- letters, as our estimates of low-contrast acuity at 5–10 years entific Advisory Board for Biohaven Pharmaceuticals; and are extrapolated from data collected primarily at 0–5 years. has received research support from Reata Pharmaceuticals Furthermore, although 7 letters of low contrast represent 1 and Biohaven Pharmaceuticals. T. Zesiewicz receives re- line of Snellen acuity equivalent and has been validated as search support from the Friedreich’s Ataxia Research Alli- a clinically meaningful outcome in MS and other patient ance and support for clinical trials from Retrotope, Biohaven populations because it is associated with detectable reductions Pharmaceuticals, Reata Pharmaceuticals, Takeda Pharma- in vision-related quality of life, it has not been specifically ceuticals, Pfizer, Sagene Pharmaceuticals, AbbVie, Cavion, validated in Friedreich ataxia. The degree of low-contrast Bristol-Myers Squibb, and Sage Therapeutics. She has re- acuity loss is similar in Friedreich ataxia compared with MS,14 ceived consulting fees from Steminent Inc; has served on the but this does not guarantee a similar reduction in vision- editorial board of Neurodegenerative Disease Management; related quality of life because long-standing impairment may holds a patent for varenicline in the treatment of ataxia; and go unnoticed or be well compensated by early adaptive served as a consultant for Steminent Inc. S.H. Subramony mechanisms. A recent survey of patients with FRDA and their receives research support from the NIH, Friedreich’s Ataxia families as part of a patient-focused drug development Research Alliance, National Ataxia Foundation, Muscular meeting identified vision loss as a concern, particularly when Dystrophy Association, and Myotonic Dystrophy Associa- compounded on other sources of disability,19 and in this co- tion and support for clinical trials from Horizon Pharma, hort, a notable proportion of the population had symptomatic Reata Pharmaceuticals, Ionis Pharmaceuticals, and Accel- vision loss defined as 20/40 or worse, especially later in the eron Pharma; has served on the editorial board of the disease course. However, future studies of low-contrast acuity Handbook of Clinical Neurology, 2011 edition; and has and vision-related quality of life are needed in Friedreich received research support from the NIH and STTR. T. ataxia if it is to be used as a biomarker or surrogate outcome. Ashizawa receives research support and serves on the scientific advisory boards of the NIH, National Ataxia Foun- Author contributions dation, and Myotonic Dystrophy Association; holds a patent A.G. Hamedani: conceived the study, performed primary for the DNA test for SCA10, PVA or PEG conjugates of statistical analysis, and drafted the manuscript. L. Hauser: peptides for epitope specific immunosuppression and for the critically reviewed the manuscript. S. Perelman, K. Mathews, methods and compositions involving nucleotide repeat G.R. Wilmot, T. Zesiewicz, S.H. Subramony, T. Ashizawa, disorders; and has received research support from Ionis M.B. Delatycki, and A. Brocht: participated in initial data Pharmaceuticals, Biohaven Pharmaceuticals, Biogen, collection and critically reviewed the manuscript. D.R. NINDS, the Weill Cornell Medical Colleges, and the Lynch: conceived the study and critically reviewed the MarigoldFoundation.M.B.Delatycki receives research manuscript. support from the National Health and Medical Research Council, Friedreich’s Ataxia Research Alliance, and Frie- Study funding dreich Ataxia Research Association; has served on the edi- T. Zesiewicz holds intellectual property for the use of nico- torial board of BMC Pediatric Genetics; and has received tinic agonists in cerebellar ataxias and nonataxic imbalance. T. research funding from FARA USA and Australia. A. Brocht Ashizawa’s spouse has equity in Bio-Path Holdings. reports no financial disclosures. D.R. Lynch receives research support from the NIH, Friedreich’s Ataxia Research Disclosure Alliance, and U.S. Food and Drug Administration; receives A.G. Hamedani and L. Hauser report no disclosures. S. Per- support for clinical trials from Reata Pharmaceuticals and elman receives research support from the Friedreich’s Ataxia Horizon Pharma; has received funding for travel from Research Alliance and the National Ataxia Foundation; Franklin and Marshall College; serves on the editorial board receives support for clinical trials from Biohaven Pharma- of the Journal of Neurogenetics; holds a patent for the test for ceuticals, Horizon Pharma, Reata Pharmaceuticals, Retrotope, anti-NDMA receptor encephalitis; and has received research Takeda Pharmaceuticals, and Teva; and has received funding funding from Takeda Pharmaceuticals and ENTRADA from EryDel, ViroPharma/Shire, Edison, and Pfizer for past Therapeutics. Full disclosure form information provided by

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 the authors is available with the full text of this article at 9. Givre SJ, Wall M, Kardon RH. Visual loss and recovery in a patient with Friedreich ataxia. J Neuroophthalmol 2000;20:229–233. Neurology.org/NG. 10. Diehl B, Lee MS, Reid JR, Nielsen CD, Natowicz MR. Atypical, perhaps under- recognized? An unusual phenotype of Friedreich ataxia. Neurogenetics 2010;11: Received December 23, 2017. Accepted in final form May 22, 2018. 261–265. 11. Porter N, Downes SM, Fratter C, Anslow P, Nemeth AH. Catastrophic visual loss in a patient with Friedreich ataxia. Arch Ophthalmol 2007;125:273–274. References 12. Seyer LA, Galetta K, Wilson J, et al. Analysis of the visual system in Friedreich ataxia. 1. Campuzano V, Montermini L, Molto MD, et al. Friedreich’s ataxia: autosomal re- J Neurol 2013;260:2362–2369. cessive disease caused by an intronic GAA triplet repeat expansion. Science 1996;271: 13. Lynch DR, Farmer JM, Tsou AY, et al. Measuring Friedreich ataxia: complementary 1423–1427. features of examination and performance measures. Neurology 2006;66: 2. Harding AE. Clinical features and classification of inherited ataxias. Adv Neurol 1993; 1711–1766. 61:1–14. 14. Friedman LS, Farmer JM, Perlam S, et al. Measuring the rate of progression in 3. Epstein E, Farmer JM, Tsou A, et al. Health related quality of life measures in Friedreich ataxia: implications for clinical trial design. Mov Disord 2010;25:426–432. Friedreich ataxia. J Neurol Sci 2008;272:123–128. 15. Patel M, Isaacs CJ, Seyer L, et al. Progression of Friedreich ataxia: quantitative 4. Tsou AY, Paulsen EK, Lagedrost SJ, et al. Mortality in Friedreich ataxia. J Neurol Sci characterization over 5 years. Ann Clin Transl Neurol 2016;3:684–694. 2011;307:46–49. 16. Baier ML, Cutter GR, Rudick RA, et al. Low-contrast letter acuity testing captures 5. Newman N. Hereditary optic neuropathies. In: Miller N, Newman N, editors. Walsh visual dysfunction in patients with multiple sclerosis. Neurology 2005;64:992–995. & Hoyt: Clinical Neuro-Ophthalmology, Vol. 1, 5th ed. Baltimore: Williams & 17. Lynch DR, Farmer JM, Rochestie D, Balcer LJ. Contrast letter acuity as a measure of Wilkins; 1999:741–773. visual dysfunction in patients with Friedreich ataxia. J Neuroophthalmol 2002;22: 6. Carroll WM, Kriss A, Baraitser M, Barrett G, Halliday AM. The incidence and nature 270–274. of visual pathway involvement in Friedreich’s ataxia: A clinical and visual evoked 18. Nieto A, Correia R, de Nobrega E, Monton F, Barroso J. Cognition in late-onset potential study of 22 patients. Brain 1980;103:413–434. Friedreich ataxia. Cerebellum 2013;12:504–512. 7. Fortuna F, Barboni P, Liguori R, et al. Visual system involvement in patients with 19. Friedreich’s Ataxia Research Alliance et al. The Voice of the Patient: Summary report Friedreich’s ataxia. Brain 2009;132:116–123. resulting from an externally led Patient-Focused Drug Development Meeting, 8. Pinto F, Amantini A, de Scisciolo G, Scaioli V, Guidi L, Frosini R. Visual involvement a parallel effort to the US Food and Drug Administration’s(FD’s) Patient-Focused in Friedreich’s ataxia: PERG and VEP study. Eur Neurol 1988;28:246–251. Drug Development Initiative. 2017.

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG ARTICLE OPEN ACCESS Population genealogy resource shows evidence of familial clustering for Alzheimer disease

Lisa Anne Cannon-Albright, PhD, Sue Dintelman, MS, Tim Maness, BS, Johni Cerny, BS, Alun Thomas, PhD, Correspondence Steven Backus, BS, James Michael Farnham, BS, Craig Carl Teerlink, PhD, Jorge Contreras, JD, Dr. Cannon-Albright [email protected] John S.K. Kauwe, PhD, and Laurence J. Meyer, MD, PhD

Neurol Genet 2018;4:e249. doi:10.1212/NXG.0000000000000249 Abstract Objective To show the potential of a resource consisting of a genealogy of the US record linked to National Veterans Health Administration (VHA) patient data for investigation of the genetic contribution to health-related phenotypes, we present an analysis of familial clustering of VHA patients diagnosed with Alzheimer disease (AD).

Methods Patients with AD were identified by the International Classification of Diseases code. The Ge- nealogical Index of Familiality method was used to compare the average relatedness of VHA patients with AD with expected relatedness. Relative risks for AD were estimated in first- to fifth- degree relatives of patients with AD using population rates for AD.

Results Evidence for significant excess relatedness and significantly elevated risks for AD in relatives was observed; multiple pedigrees with a significant excess of VHA patients with AD were identified.

Conclusions This analysis of AD shows the nascent power of the US Veterans Genealogy Resource, in early stages, to provide evidence for familial clustering of multiple phenotypes, and shows the utility of this VHA genealogic resource for future genetic studies.

From the Genetic Epidemiology Program (L.A.C.-A., A.T., S.B., J.M.F., C.C.T.), Department of Internal Medicine, University of Utah School of Medicine; George E. Wahlen Department of Veterans Affairs Medical Center (L.A.C.-A., L.J.M.); Pleiades Software Development (S.D., T.M.), Inc, Salt Lake City; Lineages (J.C.), Draper; SJ Quinney College of Law (J.C.), University of Utah; Department of Biology (J.S.K.K.), Brigham Young University, Provo; Department of Dermatology (L.J.M.), University of Utah School of Medicine, Salt Lake City; and Department of Veterans Affairs (L.J.M.), Washington DC.

The Article Processing Charge was funded by VHA. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary AD = Alzheimer disease; CI = conﬁdence interval; GIF = Genealogical Index of Familiality; ICD = International Classiﬁcation of Diseases; PTSD = posttraumatic stress disorder; RR = relative risk; TBI = traumatic brain injury; UPDB = Utah Population Database; VHA = Veterans Health Administration; VISN = Veterans Integrated Service Network.

The US Veterans Genealogy Project links a genealogy of the to allow more precise matching of controls; ancestral data United States with medical data for Veterans who use the allow us to identify more distantly related individuals in the Veterans Health Administration (VHA) system. While still in same generation. Of the 810,632 VHA patients with linked its infancy, at a current size of 63 million individuals with genealogy data, 184,658 patients have genealogy data for at genealogy data linked to 810,632 VHA patients, it is already least 8 of their immediate ancestors, including at least both sufficiently large for investigation of familial clustering for parents, all 4 grandparents, and at least 2 great grandparents many health-related phenotypes.1 With a resource that allows (many patients have much more genealogy data). These VHA identification of individuals with a phenotype of interest, and patients with at least 8 of their immediate ancestors were for which biological relationships are known, it is possible to analyzed here. test for an underlying genetic predisposition.2 This resource provides a unique opportunity to explore evidence for many Standard protocol approvals, registrations, phenotypes and to identify a rich resource of extended high- and patient consents risk pedigrees. Access to health data for the (unidentified) VHA patients with linked genealogy was approved by the University of Utah and Using this unique VHA resource still under creation, we Salt Lake Veterans Affairs Institutional Review Board, and present analysis of close and distant relationships among approval was obtained from an oversight committee for the individuals diagnosed with Alzheimer disease (AD). This VHA resource. analysis of familial clustering in a population of US Veterans shows significant evidence for excess relatedness, significantly Although the construction of the US genealogy to date has elevated risks in relatives, and identifies multiple extended focused on genealogy sources with life events in the Western high-risk pedigrees, confirming evidence supporting a genetic states, and the resource represents less than 25% of the final contribution to AD and displaying the potential of a powerful US genealogy to be created, VHA patients born in every state new national resource for predisposition gene identification. have been identified. Among the 810,632 Veterans who link to the genealogy, there are patients identified in all the 18 VHA Veterans Integrated Service Networks (VISNs or Methods regions) across the United States. Of the 46% of the 810,632 linked VHA patients who have VISN data available, the largest US veterans genealogy numbers of linked VHA patients were in VISN 16 (South Genealogic data for over 63 million individuals gathered from Central: 29,907), VISN 8 (Sunshine: 28,299), VISN 23 public sources have been linked to a US genealogy. This re- (Midwest: 25,618), and VISN 19 (Rocky Mountain: 23,291), source is currently based on collected genealogy data that to and the smallest numbers of linked patients were in VISN 5 date focused on Alaska, Arizona, Colorado, Idaho, Hawaii, (Capitol: 7,740), VISN 2 (Upstate New York: 7,813), and Kansas, Montana, Nebraska, Nevada, New Mexico, North VISN 3 (New York, New Jersey: 8,876). Among the 810,632 Dakota, South Dakota, Oklahoma, Oregon, Utah, Wash- Veterans who link to the genealogy, there are 154,213 female ington, Wyoming, and Massachusetts. Original sources used patients (19%); among the 184,658 patients with good an- to compile the genealogy data include vital records, church cestral data, 15% are female. A wide age range of VHA patients records, censuses from 1850 to 1940, published genealogies, linked to genealogy data, with birth years ranging from the cemetery records, including gravestone inscriptions, family early 1900s to the 1990s. The birth year distribution of the trees shared publicly online, oral history, and a variety of other 810,632 VHA patients who linked to any genealogy differed sources used by genealogists to compile family trees. The slightly from that of the 184,658 VHA patients who had demographic data for over 11 million Veterans using the VHA deeper ancestral genealogy data. Among the 810,632 linked System was record-linked to this US genealogy data using VHA patients, 11% were born before 1911, compared with GenMergeDB (pleiades-software.com), which has been used 14% of the 184,658 VHA patients who linked to ancestral to create, and link records to, multiple genealogic resources data; 16% of all 810,632 VHA patients who linked to gene- for decades.1 Over 810,000 VHA patients were record-linked alogy data were born in the 1960s to the 1990s, compared to a unique individual in the genealogy using name, birthdate, with 9% of the 184,658 VHA patients with ancestral data. and relationship data. After record linking was accomplished, These differences might be expected, given that males have no individual identifying data were used. The most important higher record linking rates than females because of fewer genealogic data for individuals are that for ancestors. We se- name changes and that individuals born less recently can be lected those VHA patients who linked to good ancestral data expected to have more descendants.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG VHA patients diagnosed with AD consider whether familial clustering might primarily be due to The VHA has used an electronic medical record system at shared exposures or behavior among close relatives, rather most VHA medical centers for inpatient and outpatient care than shared genetics, the GIF method includes a distant re- since 1994. These records provide a rich source of phenotype latedness test (dGIF). The dGIF test is performed as for the data on the 11 million Veterans who use the system. In- GIF test, but all relationships closer than third degree are ternational Classification of Diseases (ICD) Revision 9 coding ignored. Thus, the dGIF test ignores relationships most af- was used to identify patients with AD (331.0). fected by shared environment or behavior and tests for the presence of excess distant relatedness only. Significant evi- Genealogical Index of Familiality dence for excess distant relatedness is strongly suggestive of The Genealogical Index of Familiality (GIF) test is a well- a genetic contribution. The GIF statistic summarizes average established method for testing for excess relatedness. It was pairwise relatedness in a single measure. developed for use with the Utah Population Database (UPDB), the first US genealogic resource used in research,2,3 The contribution to the GIF statistic can be quantified sep- and has previously been used to establish evidence for many arately for the different genetic distances observed among disease phenotypes, e.g., all cancer,4,5 asthma mortality,6 ro- pairs of cases and controls (figure 1). The genetic distance tator cuff disease,7 lumbar disc disease,8 Alzheimer mortality,9 measure represents, for example, 1 for parent/offspring, 2 for and prostate cancer,10 among others. A similar method has siblings or grandparent/grandchild, 3 for avunculars or simi- been used to establish evidence for familial clustering for lar, 4 for first cousins or similar, 6 for second cousins or a variety of medical conditions in the Icelandic Genealogy similar, and so forth. resource.11 RRs in relatives The GIF statistic is a measure of the average pairwise re- The estimation of relative risk (RR) in relatives provides latedness for a set of individuals, for example, all VHA patients a more traditional mechanism for identifying evidence for with AD. The pairwise relatedness is measured using the a genetic contribution. A genetic contribution to a phenotype Malécot coefficient of kinship,12 which is computed from is supported when both close and distant relatives show evi- genealogy information to estimate genetic relatedness for dence of elevated risk. First-degree relatives include parents, a pair of individuals. The coefficient of kinship estimates the siblings, or offspring; second-degree relatives are the first- probability that 2 alleles at a locus are identical by descent degree relatives of first-degree relatives (e.g., uncle, grand- (inherited from a common ancestor) in a pair of individuals. mother); third-degree relatives are the first-degree relatives of All possible paths of relatedness are considered in the calcu- second-degree relatives (e.g., first cousin, great grandchild), lation. Most pairwise relationships in a large population-based and so forth. RRs were estimated for first- to fifth-degree genealogy are genetic distance = 0 (unrelated). For related relatives of VHA patients diagnosed with AD as follows; all pairs, the genetic distance increases with genetic distance, for relatives considered were also VHA patients. All 184,658 example, for parent and offspring = 1, for siblings or for patients in the VHA genealogy with genealogy data including grandparent/grandchild = 2, for avunculars = 3, for first at least 8 of 14 immediate ancestors were assigned to one of 67 cousins = 4, for second cousins = 6, and, similarly, for more cohorts based on birth year (in 5 years groups) and sex. The distant relationships. The GIF statistic is multiplied by 105 for cohort-specific rate of AD was estimated as the number of AD ease of presentation. cases in each cohort divided by the total number of linked VHA patients in the cohort. Expected numbers of first-degree The GIF test compares the average pairwise relatedness of relatives with AD were estimated by counting the number of a group of individuals to the expected average relatedness, relatives, all of whom were VHA patients with genealogy data, which is estimated for a group of similar individuals in the by cohort (without duplication), multiplying by the rate of population. The expected average pairwise relatedness for AD in each cohort, and summing over all cohorts. Observed a set of VHA patients can be estimated for a randomly selected numbers of AD cases among relatives were counted without set of matched controls for the cases from the population of all duplication. RRs were estimated for each degree of relation- VHA patients with linked genealogy data; controls are ship (= observed/expected AD patients); 95% confidence matched to cases for sex and 5-year birth year cohort. To intervals (CIs) for the RR were calculated using standard estimate the mean expected pairwise relatedness, 1,000 sets of methods.13 matched VHA controls were randomly selected and analyzed. The empirical significance of the GIF test was obtained by High-risk pedigrees comparing the case GIF statistic to the distribution of the To identify high-risk pedigrees for AD, all relationships 1,000 control GIF statistics. This comparison of average among all VHA patients with AD were analyzed. Consider- pairwise relatedness tests whether the VHA patients with AD ation of all ancestral vectors allowed identification of clusters have significantly higher relatedness than expected in the of related cases; the nearest common ancestor was identified VHA population. The GIF test does not allow determination for each independent cluster of related patients with AD. No of whether the familial clustering observed is due to envi- completely overlapping clusters were considered, but some ronmental factors, genetic factors, or some combination. To cases appeared in more than 1 cluster (or pedigree). For

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 Figure 1 Contribution to the GIF statistic by pairwise genetic distance for cases compared with the average for 1,000 sets of matched controls

a given founder of a cluster of related patients, the number of summarizes the results of the GIF analysis for AD. The GIF observed AD cases among the descendants of the founder test summary includes the sample size (n), GIF statistic for who were VHA patients was counted. To estimate the cases (case GIF), mean GIF statistic for 1,000 sets of controls expected number of patients with AD among the descendants, (mean control GIF), empirical significance for comparison of all linked VHA patients among the descendants were counted overall GIF (empirical GIF p), distant GIF statistic for cases by cohort; the number of linked VHA patients in each cohort (case dGIF), mean dGIF statistic for controls (mean control was multiplied by the cohort-specific rate for AD (estimated dGIF), and empirical significance for comparison of dGIF as described above) and summed over all cohorts. A com- (empirical dGIF p). The average pairwise relatedness for the parison of the number of observed to expected linked AD 4,117 patients with AD was higher than expected for the VHA cases among the descendants in each cluster (pedigree) was patient population (p < 0.001). When relationships closer made; if a significant excess of AD patients was observed (p < than third degree (first cousins) were ignored, the average 0.05), the pedigree was termed high-risk. pairwise relatedness of the patients with AD was still elevated over expected relatedness (dGIF p < 0.001). Results Figure 1 shows the contribution to the GIF statistic by the pairwise genetic distance for cases compared with averages for In the VHA resource, 4,117 Veterans with genealogy for at the 1,000 sets of matched controls. The effect of some data least 8 immediate ancestors and who had an ICD-9 code censoring based on the nature of the VHA data available can indicating AD were identified; 194 (5%) were female. Table 1 be observed in figure 1. Data censoring is present because

Table 1 GIF analysis in the VHA genealogy resource

Mean Mean

Disease (ICD-9 code) n Case GIF Control GIFEmpirical GIF p Case dGIF Control dGIF Empirical dGIF p

AD (331.0) 4,117 0.23 0.15 <0.001 0.15 0.11 <0.001

Matched AD controls 4,117 0.15 0.15 0.449 0.10 0.11 0.720

Prostate cancer (185) 12,695 0.18 0.14 <0.001 0.12 0.10 0.003

Parkinson disease (332) 3,850 0.22 0.15 0.001 0.15 0.11 0.002

Random set of patients 5,000 0.09 0.13 1.000 0.06 0.09 1.000

Bold values indicate statistical significance. Abbreviations: AD = Alzheimer disease; GIF = Genealogical Index of Familiality; ICD = International Classification of Diseases.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG diagnostic data for VHA patients were available only from data censoring issues, as discussed previously. This is apparent 1994 to present. Because medical diagnosis was only available when, for example, the different types of first-degree relatives for slightly more than 20 years (1994–2017), and because AD are considered separately; 558 of the 882 first-degree relatives is typically diagnosed in older ages, AD-affected relatives who identified were siblings, whereas only 274 were children and are in the same generation (e.g., first degree: siblings or third 50 were parents. Because only 5% of the VHA AD patients degree: cousins) are the most likely to be observed; affected were female, comparisons of effects by sex were not possible. relatives in different generations (which includes all second- For example, all the 41 affected sibling pairs observed were and fourth-degree relatives, e.g., a grandparent and grand- brothers, and both of the observed affected children of af- child) are unlikely to be observed in this narrow window. As fected parents were sons. the resource increases in size and years of data, this censoring will be lessened. High-risk pedigrees Two hundred forty-five high-risk AD pedigrees were identified To validate that control matching and selection represented (p < 0.05), with at least 2 and up to 117 related VHA AD the VHA population and to demonstrate the overall baseline patients. Figure 2 shows an example high-risk AD pedigree fi relatedness of VHA patients, we randomly selected 1 set of identi ed in the VHA genealogy resource; only the descending matched controls for the 4,117 patients with AD (termed lines to the VHA AD patients are shown. The pedigree includes “matched AD controls” in table 1); we treated this set of 6 related VHA AD patients, only 1.2 AD cases were expected randomly selected VHA patients as a set of “cases” and per- among the descendants who were VHA patients (p = 0.0012). formed GIF analysis to determine whether this single set of The pedigree founder was born in Pennsylvania in the late controls differed from 1,000 sets of matched controls (se- 1700s and has almost 6,000 descendants in the genealogy; 67 lected to match the single set of matched AD controls). This descendants are VHA-linked patients. original set of controls for patients with AD did not differ in expected relatedness from the set of 1,000 sets of matched Discussion controls (GIF p = 0.449, dGIF p = 0.720, table 1). The VHA Genealogy Resource is a unique resource that Using the same methods, we also performed GIF analyses for continues to grow and improve. We used this partially con- VHA patients diagnosed with 2 other common phenotypes structed US genealogy of over 63 million individuals linked to (prostate cancer and Parkinson disease) for purposes of almost 1 million patient records representing all VHA local comparison to AD and for comparison of results for these areas to show the potential for genetic analyses, using AD, phenotypes reported from other resources. Prostate cancer a complex disease, as an example. The Alzheimer’s Associa- cases were identified with ICD-9 code 185, and Parkinson tion (2015) has reported that AD is the sixth leading cause of disease cases were identified with ICD-9 code 332. The overall death in the United States. The annual cost of dementia in the GIF test and the distant dGIF test showed significant excess United States has been estimated to be $215 billion in 2010 relatedness for both phenotypes (table 1). These analyses and is expected to double by 2040.16 One study17 projected confirm previously published evidence of significant excess 13.8 million people diagnosed with AD dementia by 2050 in relatedness for both close and distant relationships for these 2 the United States. Although old age is the primary risk factor phenotypes from population-based genealogy resources in for AD, a genetic contribution to AD predisposition is also Utah,4,5,14 Iceland11 and Scandinavia.15 In addition, to dem- well recognized.18 Mutations in AβPP, Presenilin 1, and onstrate that not all sets of VHA patients show greater than Presenilin 2 have been implicated in familial or early-onset expected excess relatedness, we randomly selected 5,000 VHA AD; the APOE e4 allele is a major genetic risk factor for AD; patients with genealogy data and no associated phenotype. and other genetic risk factors involving lipid metabolism and – Results for the GIF analysis of this random set of patients immune function are recognized.19 22 indicate no excess relatedness (table 1). Both traumatic brain injury (TBI) and posttraumatic stress RRs in relatives disorder (PTSD) have been linked to an increased risk of AD Estimated RRs for AD among relatives of patients with AD and other dementias, and both are “signature injuries” of who are also VHA patients are shown in table 2, which dis- individuals serving in the Iraq and Afghanistan conflicts.23,24 plays degree relatedness, total number of relatives among Although AD is recognized as an important public health linked VHA patients (n), observed number of relatives with issue, the association of these military-related injuries with AD AD who were VHA patients (obs), expected number of rel- makes it of particular importance among military health atives with AD who were VHA patients (exp), RR, signifi- issues. The association of TBI and PTSD with an increased cance (p value), and 95% CI for the RR (95% CI). RRs for AD risk of AD suggests that it may be valuable to identify those were significantly elevated among first- (RR = 1.82) and fifth- military personnel at high risk of AD and to develop inter- degree relatives (RR = 1.22) of patients with AD who were ventions that could limit the progression or onset of disease. VHA patients and were elevated (RR = 1.06), but not sig- The results of this analysis of the VHA population, in com- nificantly (p = 0.380), among third-degree relatives. RR bination with similar studies, suggest that there is a genetic results for second- and fourth-degree relatives are affected by contribution to AD and that predisposition can already be

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 Table 2 Estimated RRs for AD among first-to fifth-degree relatives of patients with AD in the VHA genealogy resource

Degree relatedness n obs exp RR p Value 95% CI

First degree 882 45 24.7 1.82 0.0001 1.33–2.44

2 Sibling 558 41 20.6 1.99 4.7e 5 1.43–2.70

2 Brother 527 41 20.1 2.04 2.8e 5 1.46–2.77

Parent 50 2 1.9 1.05 1.000 0.13–3.78

Child 274 2 2.2 0.90 0.617 0.11–3.25

Son 231 2 2.2 0.93 0.637 0.11–3.37

Second degree 633 2 7.7 0.26 0.018 0.03–0.94

Grandparent 11 0 0.4

Grandchild 186 0 0.3 0.00 0.759

Father’s brother 28 0 1.1

Mother’s brother 27 1 1.2 0.86 0.674 0.02–4.77

Sister’sson 157 1 2.3 0.43 0.322

Brother’sson 133 0 1.6 0.00 0.213

Half-sibs 18 0 0.4 0.00 0.670

Father’s sister 2 0 0.1 0.00 0.931

Mother’s sister 3 0 0.03 0.00 0.967

Brother’s daughter 29 0 0.1 0.00 0.917

Sister’s daughter 39 0 0.2 0.00 0.820

Third degree 1,226 37 34.9 1.06 0.380 0.75–1.46

First cousins 984 37 33.4 1.11 0.289 0.78–1.53

Fourth degree 1,896 35 41.9 0.84 0.161 0.58–1.16

Fifth degree 4,517 152 124.6 1.22 0.016 1.03–1.43

Bold values indicate statistical significance. Abbreviations: AD = Alzheimer disease; CI = confidence interval; exp = expected number of relatives with AD who were patients with VHA; obs = observed number of relatives with AD who were patients with VHA; RR = relative risk.

recognized through knowledge of family history of AD. As AD replicated published evidence for excess familial relatedness for 2 predisposition genes are identified, increased risk may also be other common phenotypes to generalize validation of the re- recognized by screening. source. The 2 common disease phenotypes examined (prostate cancer and Parkinson disease) have previously been recognized Our analyses demonstrate significant evidence for excess fa- to have a heritable component in other populations. Analysis of milial clustering of VHA patients with AD compared with the VHA genealogy resource confirmed significant evidence for expected clustering in this population; significantly elevated excess relatedness for both phenotypes; these results additionally RRs for AD in both close and distant relatives were observed, validate the US VHA Genealogy Resource in terms of data and many pedigrees with a significant excess of AD cases have quality and power for analysis of familial clustering. been identified. This combined evidence confirms a heritable contribution to the observed familial clustering of AD. The There are limitations to this analysis. It is optimal to match pedigrees we identified suggest a highly elevated risk among controls based on all characteristics that might affect record some families. Such pedigrees are the ideal starting point for linking or that are associated with the phenotype examined; whole-genome sequence–based approaches to the identifi- we know that birth year, sex, and birth state (Utah or not) cation and characterization of rare high-penetrance variants. affect the overall relatedness of individuals in the similar UPDB genealogic resource that represents the Utah pop- In addition to the evidence presented for excess relatedness of ulation.2 For this analysis of the VHA resource, matching was individuals diagnosed with AD, using the same methods, we have performed only for birth year and sex. Although the rate of AD

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 2 Example high-risk AD pedigree identified in the VHA resource

Male founder has 2 marriages as does male grandson of the founder’s first marriage; fully shaded are AD cases.

was similar (2%) in both the 810,632 VHA patients linking to conceive of a mechanism by which significant excess re- any genealogy and the 184,658 VHA patients with at least 8 of latedness would exhibit itself in the VHA resource in the their immediate ancestors, the VHA patients with at least 8 of absence of any true heritable component. Because of cen- their immediate ancestors had a slightly lower rate of females soring, it is much more likely that the evidence of excess and represented a population born slightly later than all VHA relatedness presented is conservatively estimated. The re- patients who linked to genealogy. It is not clear what effect latedness analysis of a set of matched controls considered as these slight differences might have had on the results. His- cases and the results for the 5,000 random VHA patients with torically, race data have not been stored for the majority of no selected phenotype both demonstrated that the analysis demographic records in the VHA system, and so was un- method appropriately observes no evidence for familial clus- available. In future, as more data become available, we pro- tering for these examples. pose to use data including birth state, VISN, occupational exposures, rank, and socioeconomic status, for example, for The methods presented are robust to misclassification of matching. cases. False negatives (missing identification of true VHA AD cases) could result in failing to observe evidence for excess Data censoring is also an issue for this resource. VHA cases relatedness; this did not occur. False positives, even at a very who fail to link to genealogy data are censored, as are di- high rate, could only affect this familial clustering analysis if agnoses made outside the VHA system, or before 1994. This the assignment of the incorrect diagnosis of AD in a VHA censoring of cases might affect the estimation of rates of AD; patient occurred more often among close and distant relatives however, because rates were estimated for the entire linked of AD cases than among all VHA patients. This is unlikely, population of VHA patients and were only used as relative given the US-wide coverage of VHA patients represented and comparisons, this censoring is not expected to affect results or the distance of the genetic relationships providing evidence of tests of hypotheses. The overall rate of AD among all VHA excess clustering. patients with linked genealogy data was 2.2% (4,117/ 184,658). AD rates ranged from ;5% among male patients This VHA Genealogy Resource represents what we believe is born before 1925 decreasing to 0.1% in male patients born in already the largest genealogy linked to phenotype data based the 1960s, with rates of ;3% in females born before 1925 on its current size of over 63 million individuals and its linkage decreasing to 0.1% in female patients born in the 1950s. to medical data for over 810,000 VHA patients. This resource is still under construction; we estimate that the eventual size In addition, genealogy data may not always represent bi- of this US genealogy will exceed 300 million individuals, with ological relationships. However, such censoring is assumed to 40%–60% of the 11 million VHA patients with demographic be independent of phenotype and equally affects both cases data linked to genealogy. The analysis of the clustering of AD and controls. Finally, the data set is limited to primarily males, presented here is 1 example of the utility of the resource for individuals who are part of groups who have shared genealogic genetic studies. The utility of this resource includes (1) data, and veterans who used the VHA system; this is true of demonstration of evidence for a genetic contribution to pre- both cases and controls, but may have affected results. The disposition to many health-related phenotypes not commonly familial clustering methods presented are very robust to data observed in other populations; (2) identification and study of censoring. Controls are VHA patients, matched for sex and high-risk pedigrees informative for predisposition gene iden- birth year, and are required to have linkage to genealogy data tification; (3) estimation of family history–based risk of any of similar quality and quantity as cases. It is difficult to disorder of interest, which may be widely applicable to the US

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 population; and (4) identification of both high- and low-risk J.S.K. Kauwe: critical refinement of the manuscript. L.J. individuals for any phenotype of interest for epidemiologic Meyer: resource concept and manuscript preparation. studies or clinical trials, among others. This resource may be uniquely powerful for analysis of phenotypes that are rarely Study funding observed and highly associated with military service and may This material is based on work supported in part by the De- have an underlying genetic contribution (e.g., PTSD). partment of Veterans Affairs, Veterans Health Administration, Office of Research and Development, and RF1 AG054052 Clearly, this resource will improve in 2 distinct ways. Expan- (J.S.K.K, PI). sion of the genealogy data to all states is in progress. Second, there is enormous potential to refine the phenotypes ana- Disclosure lyzed. The use of ICD-9 diagnostic coding to identify indi- L.A. Cannon-Albright has received research support from the viduals with a phenotype is not optimal; such coding has other NIH, US Department of Veterans Affairs, US Department of purposes than research and may misrepresent the phenotype Defense, and Intermountain Research and Medical Founda- in both directions (false positives and false negatives). Future tion. S. Dintelman is or has been employed by Pleiades analysis of this resource will dictate more refined phenotype Software Development, Inc and has received research support definitions. The Electronic Medical Records and Genomics from the Department of Veterans Affairs. T. Maness is or has Network has demonstrated the benefit of more robust anal- been employed by Pleiades Software Development, Inc and ysis using multiple components of the medical record.25 Use has received research support from the Department of Vet- of natural language processing algorithms from text data in erans Affairs and Veterans Health Administration Office of medical notes may allow better identification of phenotypes Research and Development. J. Cerny is or has been employed on a large scale. The VHA is well positioned to take advantage by Lineages, Inc. and has received research support from the of these methods, specifically using the VHA Informatics and Department of Veterans Affairs. A. Thomas reports no dis- Computing Infrastructure resource. closures. S. Backus has received research support from the US Department of Health and Human Services, Veterans Affairs In conjunction with the recent Million Veterans Program Salt Lake City Health Care System, Army Medical Research sponsored by the VHA, which is collecting and storing DNA Acquisition, and NIH. J.M. Farnham reports no disclosures. and demographic and risk data for 1 million VHA patients, C.C. Teerlink has received research support from the NIH, extremely powerful genetic studies will soon be possible. With Department of Veterans Affairs, and Department of Defense. the future additions of genotypes, exposure data, and other J. Contreras has received funding for travel and/or speaker data that are envisioned, this VHA genealogy/phenotype re- honoraria from American University, Stanford University, source will allow informative genetic studies that include re- Arizona State University, University of Texas, Intel Corp, lationship data on an extremely large scale, including gene by Standards Engineering Society, Centre for International environment analyses, and analysis of other medical con- Governance Innovation, Harvard University, Tilburg Uni- ditions related to service, which cannot be studied in most versity (Netherlands), American Antitrust Institute, Jindal populations. Global University, Practicing Law Institute, University of California Berkeley, University of Nevada Las Vegas, Brigham An initial genetic analysis of AD has been presented using Young University, National Law University—Delhi, India, a powerful new and growing national resource linking gene- Leiden University, Netherlands, National Law School Uni- alogy and medical data. AD was selected as the example versity, Hispanic National Bar Association, Creative Com- phenotype, given that it is a major health issue in the United mons, Saint Louis University, Hunan University (China), States and the world and may be an important issue for the RIETI (Japan), Japan Fair Trade Commission, and Duke VHA in light of reported associations of AD with trauma. The University; receives or has received publishing royalties re- analyses confirmed evidence for an inherited component to lated to the Cambridge Handbook of Technical Standardi- AD risk, identified a current resource of high-risk pedigrees zation Law, Vol. 1, Cambridge Univ. Press 2017; has served as that could be used for predisposition gene/variant identifi- a consultant for Internet Society/IETF, International SAE cation, and confirmed the power and utility of this VHA re- Consortium Ltd, Hillcrest Laboratories, Inc., Natl. Assn. of source for genetic studies of complex human disease. State Securities Agents, IPBridge, William Hagmaier, BLU Products, Wilson Electronics, Industry Pharmacogenomic Author contributions Working Group; has received research support from the NIH, L.A. Cannon-Albright: study concept, resource creation, Arizona State University, University of Texas, International study design, analysis, and manuscript preparation. S. Din- Development Research Centre (IDRC), Centre for In- telman and T. Maness: genealogy data resource design and ternational Governance Innovation, and Huntsman Cancer construction and record linking. J. Cerny: genealogy data Institute and Foundation; and has participated in legal pro- collection and organization. A. Thomas: refinement of anal- ceedings for the Internal Revenue Service and IPBridge. J. S.K. ysis methods and tools. S. Backus: creation of genealogy/ Kauwe serves or has served on scientific advisory boards of phenotype resource and analysis tools. J.M. Farnham: re- ADx Health Care; has served on the editorial board of Alz- finement of analysis tools. C.C. Teerlink, J. Contreras, and heimer’s & Dementia; holds patents related to systems, assays,

8 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG and methods for determining risk factors for Alzheimer’s 10. Nelson Q, Agarwal N, Stephenson R, Cannon-Albright LA. A population-based analysis of clustering identifies a strong genetic contribution to lethal prostate cancer. disease; and serves or has served as a consultant for Genoma Front Genet 2013;4:152. LLC. Laurence L.J. Meyer reports no disclosures. Full dis- 11. Sveinbjornsdottir S, Hicks AA, Jonsson T, et al. Familial aggregation of Parkinsons’s disease in Iceland. NEJM 2000;343:1765–1770. closure form information provided by the authors is available 12. Malecot G. Les Mathematiques de l’heredite. Paris: Masson & Cie; 1948. with the full text of this article at Neurology.org/NG. 13. Agresti A. Categorical Data Analysis. New York: Wiley; 1990. 14. Savica R, Cannon-Albright LA, Pulst S. Familial aggregation of Parkinson disease in Received December 4, 2017. Accepted in final form May 24, 2018. Utah: a population-based analysis using death certificates. Neurol Genet 2016;2:e65. 15. Hemminki K, Dong C. Familial prostate cancer from the family-cancer database. Eur J Cancer 2000;36:229–234. References 16. Delavande A, Hurd MD, Martorell P, Langa KM. Dementia and out-of-pocket 1. Cannon-Albright LA, Dintelman S, Maness T, Backus S, Thomas A, Meyer LJ. spending on health care services. Alzheimers Dement 2013;9:19–29. Creation of a national resource with linked genealogy and phenotypic data: the 17. Hebert LE, Weuve J, Scherr PA, Evans DA. Alzheimer disease in the United States Veterans Genealogy Project. Genet Med 2013;15:541–547. (2010–2050) estimated using the 2010 census. Neurology 2013;80:1778–1783. 2. Cannon-Albright LA. Utah family-based analysis: past, present and future. Hum 18. Ridge PG, Hoyt KB, Boehme K, et al. “Assessment of the genetic variance of late-onset Hered 2008;65:209–220. Alzheimer’s disease.” Neurobiol Aging 2016;41:213–220. 3. Skolnick M. The Utah Geneological Database: a resource for genetic epidemiology. 19. Harold D, Abraham R, Hollingworth P, et al. “Genome-wide association study In: Banbury Report No 4: Cancer Incidence in Defined Populations. Cold Spring identifies variants at CLU and PICALM associated with Alzheimer’s disease.” Nat Harbor: Cold Spring Harbor Laboratories; 1980. Genet 2009;41:1088–1093. 4. Cannon L, Bishop DT, Skolnick MH, Hunt S, Lyon JL, Smart CR. Genetic epidemiology 20. Hollingworth P, Harold D, Sims R, et al. Common variants at ABCA7, MS4A6A/ of prostate cancer in the Utah Mormon genealogy. Cancer Surv 1982;1:48–69. MS4A4E, EPHA1, CD33 and CD2AP are associated with Alzheimer’s disease. Nat 5. Cannon-Albright LA, Thomas A, Goldgar DE, et al. Familiality of cancer in Utah. Genet 2011;43:429–435. Cancer Res 1994;54:2378–2385. 21. Lambert JC, Ibrahim-Verbaas CA, Harold D, et al. “Meta-analysis of 74,046 indi- 6. Teerlink CC, Hegewald MJ, Cannon-Albright LA. A genealogical assessment of heritable viduals identifies 11 new susceptibility loci for Alzheimer’s disease.” Nat Genet 2013; predisposition to asthma mortality. Am J Respir Crit Care Med 2007;176:865–870. 45:1452–1458. 7. Tashjian RZ, Farnham JM, Albright FS, Teerlink CC, Cannon-Albright LA. Evidence 22. Ridge PG, Ebbert MT, Kauwe JS. Genetics of Alzheimer’s disease. Biomed Res Int for an inherited predisposition contributing to the risk for rotator cuff disease. J Bone 2013;2013:254954. Joint Surg Am 2009;91:1136–1142. 23. Yaffe K, Vittinghoff E, Lindquist K, et al. Posttraumatic stress disorder and risk of 8. Patel AA, Spiker WR, Daubs M, Brodke D, Cannon-Albright LA. Evidence for an dementia among US veterans. Arch Gen Psychiatry 2010;67:608–613. inherited predisposition to lumbar disc disease. J Bone Joint Surg Am 2011;93:225–229. 24. Plassman BL, Havlik RJ, Steffens DC, et al. Documented head injury in early adulthood 9. Kauwe JS, Ridge PG, Foster NL, Cannon-Albright LA. Strong evidence for a genetic andriskofAlzheimer’s disease and other dementias. Neurology 2000;55:1158–1166. contribution to late-onset Alzheimer’s disease mortality: a population-based study. 25. Gottesman O, Kuivaniemi H, Tromp G, et al. The electronic medical records and PLoS One 2013;8:e77087. genomics (eMERGE) Network; past, present, and future. Genet Med 2013;15:761–771.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 9 ARTICLE OPEN ACCESS Impaired transmissibility of atypical prions from genetic CJDG114V

Ignazio Cali, PhD, Fadi Mikhail, MD, Kefeng Qin, PhD, Crystal Gregory, MS, Ani Solanki, BS, Correspondence Manuel Camacho Martinez, PhD, Lili Zhao, MS, Brian Appleby, MD, Pierluigi Gambetti, MD, Dr. Mastrianni [email protected] Eric Norstrom, PhD, and James A. Mastrianni, MD, PhD

Neurol Genet 2018;4:e253. doi:10.1212/NXG.0000000000000253 Abstract Objective To describe the clinicopathologic, molecular, and transmissible characteristics of genetic prion disease in a young man carrying the PRNP-G114V variant.

Methods We performed genetic, histologic, and molecular studies, combined with in vivo transmission studies and in vitro replication studies, to characterize this genetic prion disease.

Results A 24-year-old American man of Polish descent developed progressive dementia, aphasia, and ataxia, leading to his death 5 years later. Histologic features included widespread spongiform degeneration, gliosis, and infrequent PrP plaque-like deposits within the cerebellum and putamen, best classifying this as a Creutzfeldt-Jakob disease (CJD) subtype. Molecular typing of proteinase K-resistant PrP (resPrPSc) revealed a mixture of type 1 (;21 kDa) and type 2 (;19 kDa) conformations with only 2, rather than the usual 3, PrPSc glycoforms. Brain homogenates from the proband failed to transmit prion disease to transgenic Tg(HuPrP) mice that overexpress human PrP and are typically susceptible to sporadic and genetic forms of CJD. When subjected to protein misfolding cyclic ampliﬁcation, the PrPSc type 2 (;19 kDa) was selectively ampliﬁed.

Conclusions The features of genetic CJDG114V suggest that residue 114 within the highly conserved palindromic region (113-AGAAAAGA-120) plays an important role in prion conformation and propagation.

From the Department of Pathology (I.C., M.C.M., P.G.), Case Western University, Cleveland, OH; Department of Neurology (K.Q., F.M., C.G., A.S., L.Z., J.A.M.), University of Chicago; and Department of Biological Sciences (E.N.), DePaul University, Chicago, IL.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary BH = brain homogenate; CJD = Creutzfeldt-Jakob disease; DPBS = Dulbecco phosphate-buffered saline; DWI =diffusion- weighted imaging; gCJD = genetic CJD; GFAP = glial fibrillary acidic protein; GSS = Gerstmann-Sträussler-Scheinker; IBH = infectious BH; IHC = immunohistochemistry; MMSE = Mini-Mental State Examination; NBH = normal BH; PrPC = cellular prion protein; PK = proteinase K; PMCA = protein misfolding cyclic amplification; PTFE = polytetrafluoroethylene; sCJD = sporadic CJD; SD = spongiform degeneration; WB = Western blot.

Prion diseases are rare transmissible neurodegenerative dis- horseradish polymerase polymer for 30 minutes (Dako) be- orders that result from the accumulation of a misfolded iso- fore visualization of the immunoreactivity with Envision Flex form (PrPSc) of the cellular prion protein (PrPC).1 Several 3,39-diaminobenzidine tetrahydrochloride (Dako). subtypes are recognized based on their clinical, histopathologic, and PrPSc conformational phenotype.2 PrPSc confor- Molecular studies mation is approximated by the electrophoretic gel migration Western blot (WB) analysis was performed as previously 10 pattern of proteinase K (PK)-resistant PrPSc (resPrPSc). described. Briefly, a 10% (wt/vol) brain homogenate (BH) ResPrPSc from Creutzfeldt-Jakob disease (CJD) typically was prepared in lysis buffer (100 mM NaCl, 10 mM EDTA, displays an unglycosylated fraction that migrates at either 0.5% NP-40, 0.5% sodium deoxycholate, 10 mM Tris, pH 7.4) ;21 kDa (PrPSc type 1) or ;19 kDa (PrPSc type 2),3 along or in lysis buffer with 100 mM Tris (100 mM NaCl, 10 mM with 2 higher molecular weight monoglycosylated and digly- EDTA, 0.5% NP-40, 0.5% sodium deoxycholate, 100 mM cosylated PrPSc fractions. Experimental transmission of spo- Tris, pH 8.0) and incubated for 1 hour at 37°C with 20 or radic CJD (sCJD) and genetic CJD (gCJD) to transgenic 100 μg/mL of PK (Sigma-Aldrich), followed by termination (Tg) mice that express human (Hu) PrPC has been useful to of the reaction with 2 mM phenylmethylsulfonyl fluoride prove transmissibility.4,5 The in vitro protein misfolding cyclic (Sigma-Aldrich). Samples were then diluted 1:1 with 2X amplification (PMCA) assay has also been used to assess Laemmli sample buffer (Bio-Rad) and denatured at 100°C for transmission barriers and the propagation of PrPSc confor- 10 minutes prior loading onto 12%, 14%, or 15% poly- mational subtypes between PrP species.6,7 acrylamide gels. For experiments with PMCA, aliquots of “PMCA+” and “PMCA−” (see below) were incubated with Approximately 10% of prion diseases result from an autoso- either 100 or 50 μg/ml PK, depending on whether GlyKO mal dominant sequence change within the coding segment of Tg(HuPrP) or Tg(HuPrP ) was used as the substrate. the PRNP gene.2 A single nucleotide change within codon Incubation with PK was performed at 40°C for 60 minutes 114, resulting in a valine (V) substitution of glycine (G), has with shaking. After denaturation (at 100°C for 10 minutes), been reported in a family from China8 and Uruguay.9 We samples were precipitated with prechilled methanol (1:10 report an American case and his father. Several features of dilution) sonicated, and loaded onto a 15% Tris-Glycine gCJDG114V, including an early onset with possible incomplete precast gel (Bio-Rad). Proteins were transferred to poly- penetrance, an atypical glycosylation pattern of PrPSc and, vinylidene difluoride membranes, probed with mAb 3F4 for 2 12 most strikingly, poor transmissibility to Tg(HuPrP) mice, all hours at 1:40,000 dilution followed by incubation with of which underscore a key role for residue 114 in prion a horseradish peroxidase–conjugated goat antimouse sec- conformation and propagation. ondary Ab for 1 hour at 1:3,000 dilution. After incubation with a chemiluminescence substrate (Pierce or Amersham Biosciences), signal was recorded with a Bio-Rad XRS digital Methods document imager or visualized on Kodak films. Histopathology Protein misfolding cyclic amplification Histopathology and immunohistochemistry (IHC) of BH from 2 distinct Tg mouse models were used as the sub- formalin-fixed, formic acid–treated brain tissue were per- strate in PMCA. Tg(HuPrP) mice are hemizygous for human formed, as described previously.10 Hematoxylin and eosin PrPC, which expresses PrPC with methionine (M) at codon − − staining was performed on 5-μm sections, whereas IHC to PrP 129 (i.e., PrPC-129M) on a PrPC null background (PrP / ), at and glial fibrillary acidic protein (GFAP) was performed on 8- ;8 × normal level of PrPC.13 The TgNN6h line, hereafter μm sections. Each section was deparaffinized, rehydrated, and designated Tg(HuPrPGlyKO), expresses human PrPC with 2 immersed in tris-buffered saline with Tween 20 before in- point mutations that eliminate 2 N-linked glycosylation sites cubation with the EnVision Flex Peroxidase Blocking Reagent on human PrPC (codons 181 and 197), in which asparagine (Dako). For PrP immunostaining, sections were incubated (N) is replaced by glutamine (Q) (PrP-N181Q/N197Q).14 with hydrochloric acid (1.5 mmol/L) and microwaved for 15 These mice are homozygous for the transgene that is minutes, probed with monoclonal antibodies (mAb) 3F4 (1: expressed at ;0.6-fold that of normal mouse brain PrP levels. 1,000)11 or GFAP (1:20,000) (Sigma-Aldrich) for 60 Brains harvested from 1.5-month-old healthy Tg mice were minutes, and then washed and incubated with Envision Flex/ perfused with 5 mM EDTA in 1X Dulbecco phosphate-buffered

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG saline (1X DPBS). Ten percent normal BH was prepared in Results conversion buffer (150 mM NaCl, 1% Triton X-100, 1X Protease Inhibitor Cocktail in 1X DPBS) and centrifuged at Case report 800 × g at 4°C for 1 minute. The collected supernatants A 24-year-old right-handed white man with no known medical (hereafter designated as NBH) were used as the “substrate” history except for a mild learning disability developed general for the PMCA reaction. BH from the frontal cortex of the and episodic anxiety, intermittent confusion, fatigue, memory proband, used as “seed” (hereafter identified as infectious BH impairment, and slurred speech ;1 year before seeking medical or IBH), was prepared following the same procedure used to attention. Initial neurologic evaluation demonstrated mild generate the NBH. hypomimia, finger agnosia, and fine bilateral hand tremor. A neuropsychological battery revealed a full-scale IQ of 73, im- PMCA was performed as previously described with few mod- paired attention, concentration, memory, and mild-to-moderate ifications.15 The NBH from Tg(HuPrP) or Tg(HuPrPGlyKO) executive dysfunction. An EEG showed paroxysmal diffuse 4–5 and IBH from the proband or control cases of sCJD were Hz slow activity, with occasional sharp wave–like morphology. mixed in a 9:1 ratio in a test tube, in the presence of 0.05% An extensive workup included routine laboratory tests for de- digitonin detergent (Sigma-Aldrich) and one 2.38 mm- mentia, in addition to antithyroid antibodies, a paraneoplastic diameter polytetrafluoroethylene bead (McMaster-Carr). panel that included NMDA and GAD65 antibodies, amino acid One aliquot of the NBH-IBH mixture was subjected to profile, and heavy metal testing, all of which were negative. CSF PMCA (PMCA+), and one aliquot was stored at −80°C and cell count, glucose, protein, angiotensin converting enzyme level, used as the negative control (PMCA–). PMCA reactions were VDRL, Lyme PCR, total tau, phosphorylated tau, Aβ42, and 14- carried out in a programmable sonicator (Misonix Sonicator 3-3 protein were within normal range or negative, as was bac- S-4000; Misonix Inc, Farmingdale, NY) for a total of 96 cycles terial, acid-fast bacilli, and fungal cultures. Brain MRI was of sonication. Each cycle consisted of 30 seconds of sonication reported as normal. (Amplitude 98, wattage 230–250) and 29.5 minutes of incubation at 37°C. Over the next year, he became more withdrawn, declined cog- nitively, developed progressive clumsiness, prominent word- Standard protocol approvals, registrations, finding difficulty, and slowed motor skills that led to 3 car and patient consents accidents. At the time, he had a coarse hand and head tremor, Human-related studies were conducted under an approved cogwheel rigidity of the limbs, stooped posture, and a mildly University of Chicago Institutional Review Board protocol spastic gait with impaired arm swing. He scored 20 of 30 on the (#9713), and animal studies were performed under an ap- Mini-Mental State Examination.17 Fluorodeoxyglucose PET proved University of Chicago Institutional Animal Care and exhibited decreased but symmetric cortical metabolism, more Use Committee approval of protocol (#70735). pronounced in the posterior parietal, temporal, and occipital regions, while thalamic uptake was similar to the cortex, and PRNP gene analysis there was a relative increase in metabolic activity in the basal DNA was extracted from whole blood, and the entire coding ganglia. Diffusion-weighted imaging (DWI) sequences on MRI segment of the PRNP gene was amplified by PCR using displayed restricted diffusion throughout the cortical ribbon, and previously reported primers10 and bidirectional sequencing right, greater than left, cortical atrophy (figure 1, A and B). Over using an automated sequencer. the next 2 years, the patient developed global aphasia, choreiform movements and myoclonus of the upper extremities, increased Prion transmissions axial rigidity, and severe gait ataxia, ultimately confining him to Fresh-frozen brain from the frontal cortex was homogenized a wheelchair and eventual death 5 years from the initial onset of in 1X phosphate buffered saline to a final concentration of 1%, symptoms, at age 29 years. as previously described.16 Tg mice expressing human PrPC with Met coding at residue 129 on a mouse PrP knock-out The proband’sfathersuffered a similar course, beginning at age o/o background (i.e., Tg[HuPrP-129M]Prnp ) were previously 32 years, with progressive cognitive decline and prominent 13 constructed and described elsewhere. Mice were anes- aphasia that progressed to mutism, in addition to visual hallu- thetized with a xylazine/ketamine mixture, the head fixed in cinations, gait ataxia, postural instability, and generalized my- a small animal stereotaxic instrument (Kopf) and in- oclonus. The brain MRI report noted “diffuse cerebral atrophy, tracerebrally inoculated with BH, directly through the scalp, as markedly out of proportion for age,” but films were not avail- 13 described previously. Typical symptoms of prion disease in able for review. He died at age 34 and underwent brain autopsy, mice, including reduced spontaneous movement, scruffy coat, although PRNP gene sequencing was not performed at the hunched back, and progressively unsteady gait, were moni- time. Tissue was unavailable for genetic testing, but limited tored every other day. When symptomatic and near-terminal, fixed tissue was available for histologic staining. mice were killed and their brains harvested, freshly hemi- sectioned, half frozen in dry ice, and half fixed in 2% formalin. Pathologic studies All mouse studies were approved by the Institutional Animal Widespread spongiform degeneration (SD) and gliosis were Care and Use Committee before study. most severe in the frontal (figure 2A), temporal, and parietal

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 (not shown). IHC with anti-PrP mAb 3F4 revealed fine, Figure 1 Brain MRI of the gCJDG114V proband during the 3rd diffuse PrP staining and occasionally larger granules within year of his disease the cerebral cortex (figure 2, M–O) and neostriatum (figure 2P), as well as plaque-like PrP deposits in the putamen and cerebellum (figure 2, P and Q). IHC for GFAP in frontal and temporal lobes revealed intense reactive astrogliosis (figure 2R).

In a limited number of sections from the proband’s father, SD was observed within the cerebral cortex and putamen (ﬁgure 2, G, H, and J), with sparing of the hippocampus, midbrain, pons, medulla, and cerebellum (ﬁgure 2, I, K, and L).

Genetic studies Sequencing the entire coding segment of the PRNP gene of the proband revealed a heterozygous thymine substitution of (A) DWI sequence shows restricted diffusion throughout the cortical ribbon and within the caudate nuclei. (B) FLAIR sequence shows diffuse cortical guanine at the second nucleotide of codon 114 (c.341G>T), atrophy. DWI = diffusion-weighted imaging; FLAIR = fluid-attenuated in- resulting in a change in coding from glycine (G) to valine (V) version recovery. (G114V) (figure 3A). The polymorphic codon 129, which is known to confer susceptibility to prion disease, modify disease phenotype, and influence the conformation of PrPSc, was cotices, and least severe in the occipital lobe and hippocampus homozygous for methionine (129MM) (figure 3). No other (figure 2, B and C). Severe SD was also present within the alterations were detected. Although no genetic information putamen (figure 2D), but not the adjacent globus pallidus, was available from the proband’s father, based on the early age and within the medial nuclei of the thalamus, but not the at disease onset and similarity of the presentation, we assumed lateral thalamus (not shown). The midbrain, cerebellum that he carried the same PRNP-G114V variant. A pedigree was (figure 2, E and F), pons, and medulla were also devoid of SD constructed, based on information provided by family members

Figure 2 Histopathology and immunohistochemistry of brain sections from the proband and proband’s father

(A–L) Hematoxylin and eosin (H&E) staining of the proband (A–F) and proband’s father (G–L). (A–D) Severe spongiform degeneration (SD) affecting frontal lobe (A) and putamen (D), and mild SD in the occipital lobe (B) and CA1 region of the hippocampus (C). (E–F) No SD affecting the midbrain (E) and cerebellum (F). (G, H, J) Severe SD affecting the frontal lobe (G), and mild SD in the parietal lobe (H) and putamen (J). (I, K–L) No SD affecting the hippocampus (I), midbrain (K), and cerebellum (L). Arrows in B, C, and J indicate SD. (M–Q) PrP immunostaining of the proband. (M and N) Diffuse PrP staining affecting the frontal lobe (M) and subiculum (N); the arrow in (N) indicates a cluster of larger PrP granules of different size. (O) Intense PrP staining at the interface between the dentate gyrus and Ammon horn (arrows); the inset depicts a high magnification of the area outlined by the dashed rectangle. (P and Q) Plaque-like PrP immunostaining in the putamen (P) and cerebellum (Q); antibody: 3F4. (R) Intense gliosis (arrow) affecting the temporal cortex; antibody: GFAP.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 3 Gene sequencing and pedigree analysis

(A) Chromatogram segments of the PRNP gene sequences surrounding the codon 114 sequence alteration (*) and the polymorphic codon 129. A guanine (G) to thymine (T) change at the second nucleotide of codon 114, resulting in a valine (V) substitution for glycine (G) at residue 114 of PrP. The polymorphic codon 129 was homozygous for methionine (Met). (B) Pedigree of the gCJDG114V family. The proband (IV-A) and his father (III-B) exhibited progressive dementia at young ages. Sequencing of the PRNP gene of the proband (arrow) revealed the G114V variant. DNA from the proband’s father was not available. No other family members were reportedly affected. Sequencing was performed on individuals marked with an asterisk, although none carried the G114V variant. The polymorphic codon 129 status is represented within each symbol. V = valine, M = methionine. Numbers below symbols represent the age at death or at the time of genetic testing. Square = male; circle = female; slash = deceased; filled symbol = affected individual.

(figure 3B). The paternal grandmother (II-E) was alive at 81, level of resPrPSc varied from highest in the parietal cortex to although the paternal grandfather reportedly died without lowest in the cerebellum (figure 4A). In contrast to the typical dementia at age 84 years and none of the father’s 6 siblings, resPrPSc of sCJD, resPrPSc from gCJDG114V lacked the aged 40–59 years, developed a progressive neurologic dis- diglycosylated band, exhibiting only prominent mono- order. A paternal uncle died of cancer at age 57 years (III-G) glycosylated, and less prominent unglycosylated, resPrPSc and an aunt died 3 days after birth (IIIH). We sequenced the bands. In addition, compared with the ;21 kDa gel mobility coding segment of the PRNP gene of 5 unaffected family of unglycosylated resPrPSc from all other brain regions, initial members, including the paternal grandmother (II-E), 3 of WB of resPrPSc from the frontal lobe showed a gel mobility of his father’s siblings (III-C, D, and E) and the proband’ssister ;19 kDa, matching that of PrPSc type 2 (figure 4A). Fol- (IV-B). None carried the G114V variant, and the poly- lowing multiple extended electrophoretic runs, a doublet was morphic codon 129 genotype was homozygous for Val revealed, supporting the coexistence of PrPSc types 1 and 2 in (129VV) in 4 members (II-E, III-C, III-D, and IV-B) and the frontal cortex (figure 4B).19 These findings were in- 129MV in 1 (III-E). Since the paternal grandmother (II-E) dependently replicated at the University of Chicago and Case was 129VV and the G114V change is on the 129M allele, the Western Reserve University. grandfather would be predicted to have a 129MV genotype and be a silent carrier of G114V on the 129M allele. How- Transmission studies Sc ever, surprisingly, the genotype of the proband’s aunt (III-E) Previous work shows that sequence homology between PrP C was 129MV with a normal 129M allele. and PrP at critical sites within PrP, especially at the polymorphic residue 129, is known to affect the efficiency of Typing of PrPSc transmission.5,20 As such, we used Tg(HuPrP-129M) mice The PrPSc conformation enciphers the clinicopathologic that express human PrP with Met at residue 129, to match the phenotype of prion disease.16,18 The gel mobility of resPrPSc 129 coding of the proband. Surprisingly, after nearly 700 days is an indirect measure of the PrPSc conformation. Although following intracerebral inoculation with BH from the pro- easily detected by WB within each brain region tested, the band, no clinical signs of disease or histopathologic changes

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 Figure 4 Assessment of PrPSc type and transmissibility of gCJDG114V to Tg(HuPrP) mice

(A) WB prepared from brain homogenates (BHs) of the proband and control patient with sCJDMM1 probed with mAb 3F4. Equal total protein loads compare several brain regions with a case of sCJDMM1 before (top) and after (bottom) proteinase K (PK) digestion to reveal PK-resistant PrPSc (resPrPSc). The electrophoretic profile of untreated samples from gCJDG114V and sCJDMM1 appeared similar, although after digestion, all samples from the proband lacked the diglycosylated band. The parietal lobe carried the highest level of resPrPSc. (B) WB showing coexisting resPrPSc types 1 and 2 in the frontal cortex (FC; lane 3), and type 1 in the occipital cortex (OC; lane 4) of gCJDG114V, compared with resPrPSc type 1 (lane 1) and type 2 (lane 2) from sCJDMM1 and sCJDMM2, respectively. (C) Survival times (days) of Tg(HuPrP-129M) mice following intracerebral inoculation of 30 μL of 1% frontal cortex BH from the gCJDG114V proband compared with sCJDMM1 (n = 6 mice per group). One mouse inoculated with gCJDG114V was killed 600 days after inoculation because of signs of aging, although the remainder were healthy and without symptoms after nearly 700 days when they were killed. All Tg(HuPrP-129M) mice inoculated with sCJDMM1 died with signs of prion disease (rough coat, hunched back, and unsteady gait) at 161.7 ± 4.0 days. (D) WB of representative mouse brain samples confirming the absence of resPrPSc in mice inoculated with gCJDG114V compared with the high level of resPrPSc in mice inoculated with sCJDMM1.

(not shown) were evident, whereas control Tg(HuPrP- that express a mutated form of human PrP that lacks 129M) mice inoculated with BH prepared from a case of N-linked sugar chains at residues 181 and 197 (figure 5A). sCJDMM1 yielded efficient transmission after 161.7 ± 4.0 As the control, PrPSc from sCJDMM1, with all glycoforms, days (figure 4C). WB prepared from inoculated mice revealed was robustly amplified using Tg(HuPrP) brain as the PrPC no resPrPSc from mice inoculated with gCJDG114V compared substrate (figure 5B). with robust levels of resPrPSc type 1 in mice inoculated with sCJDMM1 (figure 4D). Discussion Protein misfolding cyclic amplification We wondered whether propagation of PrPSc from We report the clinicopathologic, molecular, and transmissible gCJDG114V couldbedemonstratedusingPMCAbecause properties of gCJDG114V in an American-born individual of this technique allows for a more controlled setting that Polish descent, with no known linkage to either of the 2 might enhance prion propagation. BH from healthy previously reported families from China and Uruguay.8,9 Al- Tg(HuPrP-129M) and Tg(HuPrPGlyKO)micewasusedas though the proband and his father had a generally similar the substrate in separate reactions with PrPSc from the course that included progressive dementia and aphasia, dis- proband as the seed. The proband’sresPrPSc prepared in ease onset in the proband was marked by behavioral change, conversion bufferandnotsubjectedtoPMCAconfirmed primarily anxiety attacks, followed by extrapyramidal features, the presence, under these conditions, of mixed PrPSc types 1 myoclonus, and generalized ataxia. A similar course, with and 2 lacking the diglycosylated fraction (figure 5A). PMCA behavioral changes, was described for most of the 5 affected reactions using Tg(HuPrP) as substrate amplified PrPSc members of the Uruguayan family, although ataxia was not type 2, but not type 1. Only monoglycosylated and non- a feature. Ataxia was also not described in the Chinese family, glycosylated bands were present, confirming the absence of although aphasia was reported. DWI imaging of our proband a diglycosylated seed. Preferential PrPSc type 2 amplification revealed widespread cortical and caudate hyperintensities, was also observed using BH from Tg(HuPrPGlyKO)mice although CSF 14-3-3 protein was negative. A similar pattern

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 5 Amplification of PrPSc by protein misfolding cyclic amplification (PMCA)

Brain homogenates prepared from the frontal cortex of gCJDG114V and sCJDMM1 were used to seed the conversion of PrPC into PrPSc. (A) After PMCA (+), the ;19-kDa PK-resistant PrPSc (resPrPSc) fraction (*) from gCJDG114V, but not ;21-kDa resPrPSc (**), was amplified using PrPC from the Tg(HuPrP) or Tg(HuPrPGlyKO) mouse brain. Sporadic CJDMM1 and sCJDMM2 controls were loaded for typing purposes. (B) After PMCA (+), PrPSc from sCJDMM1 was efficiently amplified using PrPC from Tg(HuPrP) as the substrate. PMCA (−) refers to the same samples that were not subjected to PMCA reaction. The mAb 3F4 was used to probe immunoblots. Similar results were obtained from 3 independent PMCA reactions. of widespread DWI hyperintensity and negative CSF 14-3-3 phenotype, defined by the presence of multicentric PrP protein was noted in the Chinese family proband, although amyloid plaques isolated to the cerebellum or diffusely – neither of these studies were provided in the Uruguayan distributed throughout the cortex and deep nuclei.22 27 family report. Globular PrP deposits were present within the cerebellum andputamenoftheproband,buttheseweresparseand The early onset of our proband and his father compare well were not detected in his father or the 2 previously reported with onsets ranging from 18 to 45 years in the earlier gCJDG114V families.8,9 reported families. Despite the early onset of disease, which suggests high penetrance, 45- and 61-year-old asymptomatic The gel mobility of resPrPSc is an indirect measure of PrPSc carriers of the G114V variant of PRNP were reported in the conformation, which differs among the major subtypes of Uruguayan and Chinese families, which suggests incomplete prion disease.2,28 The gel migration pattern of CJD-derived or variable penetrance. Although our proband and his father resPrPSc typically includes 3 glycoforms that range from ;19 were the only 2 affected family members, the G114V variant or 21 to 30 kDa, whereas GSS-associated resPrPSc has a single was not detected in other members sampled, which limits nonglycosylated band of 7–16 kDa, representing N- and our ability to comment on penetrance. Based on the codon C-terminally cleaved PrPSc. The resPrPSc associated with 129 genotypes, we suggest that the sequence alteration could A133V has not been reported, but that from A117V,29,30 have either arisen de novo in the paternal grandfather’s S132I,22 and G131V24 conforms to the GSS pattern. That germline or that a nonpaternity event skewed the genetics of from our proband migrates more characteristically as CJD, this pedigree. However, the typically early onset and the lack despite the absence of the diglycosylated fraction. Of interest, of disease in previous generations raise questions whether a similar pattern has been reported with the T183A,31 anticipation or, more likely, other genetic or environmental V180I,32 and P105S10 variants and in a single case of sCJD.33 factors play a significant role in disease manifestation linked Although the sequence changes at residues 180 and 183 could to this genetic variant. directly interfere with nearby N-linked glycosylation sites at residue 181, the distal location of residues 105 and 114, and The pathogenicity of the G114V variant is supported by its the occurrence of this resPrPSc type in a sCJD case, suggests position within the highly conserved palindromic segment that the conformation of this rare PrPSc type favors selection of PrP (113-AGAAAAGA-120) that features directly in the of the unglycosylated and monoglycosylated PrPSc isoforms. formation of PrPSc and the PrPSc-PrPC complex that leads Although we also found a mixture of ;19- and ;21-kDa to propagation of PrPSc.21 Although the G114V and A117V resPrPSc in our proband, this feature has been reported in as variants lie within this palindrome, 3 other pathogenic many as ;40% of sCJD cases with the 129MM genotype19 alterations (G131V, S132I, and A133V) lie slightly down- and in rare cases of gCJDE200K 34 and gCJDD178N.35 Overall, stream, but still within the hydrophobic core that the clinicopathologic and molecular typing characteristics extends from residue 113 to 134. Curiously, each of these best suggest that the PRNP-G114V variant should be cate- promotes a Gerstmann-Sträussler-Scheinker (GSS) disease gorized as a CJD subtype.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 The lack of transmission of gCJDG114V to TgHuPrP mice preparation of Western blots, interpretation of data, and as- implies that the sequence change at residue 114 introduces sistance with text preparation. F. Mikhail: patient data ac- a barrier to transmission. Efficient prion transmission has been quisition, preparation of figures, and manuscript writing. shown to depend on the balance of two critical determinants: A. Solanki: breeding and maintenance of mice and inoculation (1) sequence homology between PrPSc and PrPC at key sites of and monitoring of mice for transmission studies. M.C. association within the PrPSc-PrPC interface and (2) the ability Martinez: performed PMCA. L. Zhao: mouse screening and of PrPC to acquire the conformation of PrPSc. We can speculate gene sequencing of family members and transgenic mice. that the sequence alteration at residue 114 that sits within the C. Gregory: preparation of Western blots, collection of blood highly conserved palindrome represents a mismatch at an as- samples from subjects, preparation of inoculums, and in- sociation site within the PrPSc-PrPC interface or the confor- oculation of mice for transmission studies. P. Gambetti: mation of PrPSc induced by the G114V variant falls outside the histologic studies, data interpretation, and manuscript prep- conformational repertoire that PrPC in TgHuPrP mice can aration. E. Norstorm: preparation of figures, data assessment, adopt. Although data are limited regarding the transmissibility and manuscript writing. J.A. Mastrianni: design of the study, of disease resulting from other variants within the palindromic interpretation of data, and manuscript preparation. B. Appleby: region, we have not had success transmitting GSSA117V to tissue samples and personnel resources. Tg(HuPrP) mice (unpublished observations). Whether this relates to a universal feature of GSS to poorly transmit disease Study funding compared with CJD36,37 or the sequence mismatch at residue This work was supported by an endowment from the Brain 117, was addressed by 1 group that successfully transmitted Research Foundation (J.A.M.), NIH P01AI106705, NIH GSSA117V to a Tg mouse expressing the homologous sequence 5R01NS083687, and Charles S. Britton Fund (P.G.); The change.38 In addition, a more recent study found that bank National Prion Disease Pathology Surveillance Center. voles are susceptible to GSS prions, suggesting that the sequence of bank vole PrPC can adopt the conformation of PrPSc Disclosure in GSSA117V despite the absence of homology at residue 117 I. Cali serves as an editorial board member of the World Journal between PrPSc and PrPC.39 Thus, the conformation of PrPSc of Neurology, BioMed International, and the Asian Journal of linked to the PRNP-G114V variant may, in fact, be the principal Neuroscience. K. Qin reports no disclosures. F. Mikhail has re- barrier to transmission. The finding that PMCA amplification ceived research funding from the NRSA T32 Ruth Kirschstein of this conformation was possible suggests that conditions of Training Grant. C. Gregory, A. Solanki, M.C. Martinez, and L. this artificial system are more favorable for the PrPSc-PrPC Zhao report no disclosures. P. Gambetti has served on the Sc fi association that leads to propagation of PrP . However, de- scienti c advisory board of Ferring Pharmaceuticals; holds spite the partially positive results, a conformational barrier to a patent for Sant Cruz BioTechnology (A2006-03237); and has prion propagation was still evident, based on the selective received research funding from the NIH. E. Norstrom reports Sc fi amplification of the 19-kDa resPrP fraction. Recent work no disclosures. J.A. Mastrianni has served on the scienti cad- ’ suggests that in the presence of 2 conformational subtypes of visory board of the Alzheimer s Association; has consulted for PrPSc, PMCA favors amplification of the least stable con- CVS Caremark and the Federal Trade Commission; has re- former,14 which is suggested to be the 19-kDa PrPSc fraction in ceived commercial research funding from Eli Lilly and the CMS ’ this case, based on its limited presence within the frontal lobes, and Alzheimer s Association; and has received research funding compared with the widespread presence of the 21-kDa from the Brain Research Foundation. Full disclosure form in- conformer. formation provided by the authors is available with the full text of this article at Neurology.org/NG. fi Our ndings demonstrate that the G114V variant of PRNP fi promotes a CJD clinicopathologic phenotype linked to an Received February 9, 2018. Accepted in nal form May 14, 2018. Sc atypical PrP conformation that lacks the diglycosylated References fraction and is poorly transmissible to Tg(HuPrP) mice. Al- 1. Prusiner SB. Prions (Les Prix Nobel Lecture). In: Frängsmyr T, editor. Les Prix though the G114V variant of PRNP appears to be associated Nobel. Stockholm: Almqvist & Wiksell International; 1998:268–323. 2. Brown K, Mastrianni JA. The prion diseases. J Geriatr Psychiatry Neurol 2010;23: with variable penetrance that is not yet well characterized, its 277–298. location within the highly conserved palindromic segment of 3. Parchi P, Castellani R, Capellari S, et al. Molecular basis of phenotypic variability in sporadic Creutzfeldt-Jakob disease. Ann Neurol 1996;39:767–778. the hydrophobic core of PrP and the associated atypical 4. Watts JC, Prusiner SB. Mouse models for studying the formation and propagation of conformation of PrPSc are likely to contribute to the unique prions. J Biol Chem 2014;289:19841–19849. G114V 5. Mallik S, Yang W, Norstrom EM, Mastrianni JA. Live cell fluorescence resonance properties of gCJD prions that we observed. Overall, energy transfer predicts an altered molecular association of heterologous PrPSc with these findings highlight the importance of this residue and the PrPC. J Biol Chem 2010;285:8967–8975. 6. Castilla J, Gonzalez-Romero D, Saa P, Morales R, De Castro J, Soto C. Crossing the palindrome in prion conformation and propagation and as species barrier by PrP(Sc) replication in vitro generates unique infectious prions. Cell a potential target of therapy. 2008;134:757–768. 7. Jones M, Peden AH, Head MW, Ironside JW. The application of in vitro cell-free conversion systems to human prion diseases. Acta Neuropathol 2011;121: Author contributions 135–143. 8. Ye J, Han J, Shi Q, et al. Human prion disease with a G114V mutation and I. Cali: histologic preparations, data interpretation, and gen- epidemiological studies in a Chinese family: a case series. J Med Case Rep 2008;2: eration of figures and text for manuscript preparation. K. Qin: 331.

8 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG 9. Rodriguez MM, Peoc’h K, Haik S, et al. A novel mutation (G114V) in the prion 25. Kovacs GG, Ertsey C, Majtenyi C, et al. Inherited prion disease with A117V mutation protein gene in a family with inherited prion disease. Neurology 2005;64:1455–1457. of the prion protein gene: a novel Hungarian family. J Neurol Neurosurg Psychiatry 10. Tunnell E, Wollman R, Mallik S, Cortes CJ, Dearmond SJ, Mastrianni JA. A novel 2001;70:802–805. PRNP-P105S mutation associated with atypical prion disease and a rare PrPSc con- 26. Mastrianni JA, Curtis MT, Oberholtzer JC, et al. Prion disease (PrP-A117V) pre- formation. Neurology 2008;71:1431–1438. senting with ataxia instead of dementia. Neurology 1995;45:2042–2050. 11. Kascsak RJ, Rubenstein R, Merz PA, et al. Mouse polyclonal and monoclonal antibody 27. Mohr M, Tranchant C, Steinmetz G, Floquet J, Grignon Y, Warter JM. Gerstmann- to scrapie-associated fibril proteins. J Virol 1987;61:3688–3693. Straussler-Scheinker disease and the French-Alsatian A117V variant. Clin Exp Pathol 12. Zou WQ, Puoti G, Xiao X, et al. Variably protease-sensitive prionopathy: a new 1999;47:161–175. sporadic disease of the prion protein. Ann Neurol 2010;68:162–172. 28. Parchi P, Giese A, Capellari S, et al. Classification of sporadic Creutzfeldt-Jakob 13. Telling GC, Scott M, Mastrianni J, et al. Prion propagation in mice expressing human disease based on molecular and phenotypic analysis of 300 subjects. Ann Neurol 1999; and chimeric PrP transgenes implicates the interaction of cellular PrP with another 46:224–233. protein. Cell 1995;83:79–90. 29. Yang W, Cook J, Rassbach B, Lemus A, DeArmond SJ, Mastrianni JA. A new trans- 14. Haldiman T, Kim C, Cohen Y, et al. Co-existence of distinct prion types enables genic mouse model of Gerstmann-Straussler-Scheinker syndrome caused by the conformational evolution of human PrPSc by competitive selection. J Biol Chem A117V mutation of PRNP. J Neurosci 2009;29:10072–10080. 2013;288:29846–29861. 30. Tagliavini F, Lievens PM, Tranchant C, et al. A 7-kDa prion protein (PrP) fragment, 15. Castilla J, Saa P, Morales R, Abid K, Maundrell K, Soto C. Protein misfolding cyclic an integral component of the PrP region required for infectivity, is the major amyloid amplification for diagnosis and prion propagation studies. Methods Enzymol 2006; protein in Gerstmann-Straussler-Scheinker disease A117V. J Biol Chem 2001;276: 412:3–21. 6009–6015. 16. Mastrianni JA, Nixon R, Layzer R, et al. Prion protein conformation in a patient with 31. Grasbon-Frodl E, Lorenz H, Mann U, Nitsch RM, Windl O, Kretzschmar HA. Loss of sporadic fatal insomnia. N Engl J Med 1999;340:1630–1638. glycosylation associated with the T183A mutation in human prion disease. Acta 17. Folstein M, Folstein S, McHugh PR. “Mini-mental status”: a practical method for Neuropathol (Berl) 2004;108:476–484. grading the cognitive state of patients for the clinician. J Psychiatr Res 1975;12: 32. Chasseigneaux S, Haik S, Laffont-Proust I, et al. V180I mutation of the prion protein 189–198. gene associated with atypical PrPSc glycosylation. Neurosci Lett 2006;408:165–169. 18. Telling GC, Parchi P, DeArmond SJ, et al. Evidence for the conformation of the 33. Zanusso G, Polo A, Farinazzo A, et al. Novel prion protein conformation and gly- pathologic isoform of the prion protein enciphering and propagating prion diversity. cotype in Creutzfeldt-Jakob disease. Arch Neurol 2007;64:595–599. Science 1996;274:2079–2082. 34. Kovacs GG, Seguin J, Quadrio I, et al. Genetic Creutzfeldt-Jakob disease associated 19. Cali I, Castellani R, Alshekhlee A, et al. Co-existence of scrapie prion protein types 1 with the E200K mutation: characterization of a complex proteinopathy. Acta Neu- and 2 in sporadic Creutzfeldt-Jakob disease: its effect on the phenotype and prion- ropathol 2011;121:39–57. type characteristics. Brain 2009;132:2643–2658. 35. Ha¨ık S, Peoc’h K, Brandel JP, et al. Striking PrPsc heterogeneity in inherited prion 20. Wadsworth JD, Asante EA, Desbruslais M, et al. Human prion protein with valine 129 diseases with the D178N mutation. Ann Neurol 2004;56:909–910. author reply prevents expression of variant CJD phenotype. Science 2004;306:1793–1796. 10–11. 21. Norstrom EM, Mastrianni JA. The AGAAAAGA palindrome in PrP is required to 36. Brown P, Gibbs CJ Jr, Rodgers-Johnson P, et al. Human spongiform encephalopathy: generate a productive PrPSc-PrPC complex that leads to prion propagation. J Biol the National Institutes of Health series of 300 cases of experimentally transmitted Chem 2005;280:27236–27243. disease. Ann Neurol 1994;35:513–529. 22. Hilton DA, Head MW, Singh VK, Bishop M, Ironside JW. Familial prion disease with 37. Tateishi J, Kitamoto T, Hoque MZ, Furukawa H. Experimental transmission of a novel serine to isoleucine mutation at codon 132 of prion protein gene (PRNP). Creutzfeldt-Jakob disease and related diseases to rodents. Neurology 1996;46: Neuropathol Appl Neurobiol 2009;35:111–115. 532–537. 23. Panegyres PK, Toufexis K, Kakulas BA, et al. A new PRNP mutation (G131V) 38. Asante EA, Linehan JM, Smidak M, et al. Inherited prion disease A117V is not simply associated with Gerstmann-Straussler-Scheinker disease. Arch Neurol 2001;58: a proteinopathy but produces prions transmissible to transgenic mice expressing 1899–1902. homologous prion protein. PLoS Pathog 2013;9:e1003643. 24. Jansen C, Parchi P, Capellari S, et al. A second case of Gerstmann-Straussler- 39. Pirisinu L, Di Bari MA, D’Agostino C, et al. Gerstmann-Straussler-Scheinker disease Scheinker disease linked to the G131V mutation in the prion protein gene in a Dutch subtypes efficiently transmit in bank voles as genuine prion diseases. Sci Rep 2016;6: patient. J Neuropathol Exp Neurol 2011;70:698–702. 20443.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 9 ARTICLE OPEN ACCESS SCN11A Arg225Cys mutation causes nociceptive pain without detectable peripheral nerve pathology

Ryan Castoro, DO, MS, Megan Simmons, MS, Vignesh Ravi, BS, Derek Huang, MD, Christopher Lee, MD, Correspondence John Sergent, MD, Lan Zhou, MD, PhD, and Jun Li, MD, PhD Dr. Li [email protected] Neurol Genet 2018;4:e255. doi:10.1212/NXG.0000000000000255 Abstract Objective The SCN11A gene encodes the NaV1.9 sodium channel found exclusively in peripheral nociceptive neurons.

Methods All enrolled participants were evaluated clinically by electrophysiologic studies, DNA sequencing, and punch skin biopsies.

Results All affected family members are afflicted by episodes of pain. Pain was predominantly nociceptive, but not neuropathic in nature, which led a diagnosis of fibromyalgia in some patients. All patients had normal findings in nerve conduction studies for detecting large nerve fiber neuropathies and skin biopsies for detecting small nerve fiber pathology.

Conclusions Unlike those patients with missense mutations in SCN11A, small fiber sensory neuropathy, and neuropathic pain, the Arg225Cys SCN11A in the present study causes predominantly nociceptive pain with minimal features of neuropathic pain and undetectable pathophysiologic changes of peripheral neuropathy. This finding is consistent with dysfunction of nociceptive neurons. In addition, since nociceptive pain in patients has led to the diagnosis of fibromyalgia, this justifies a future search of mutations of SCN11A in patients with additional pain phenotypes such as fibromyalgia to expand the clinical spectrum beyond painful small fiber sensory neuropathy.

From the Department of Physical Medicine and Rehabilitation (R.C.), Vanderbilt University Medical Center; Department of Neurology (M.S., V.R., D.H., C.L., J.L.), Center for Human Genetic Research, and Vanderbilt Brain Institute, Vanderbilt University Medical Center; Division of Rheumatology (J.S.), Department of Medicine, Vanderbilt University Medical Center, Nashville, TN; and Department of Neurology (L.Z.), University of Texas Southwestern Medical Center, Dallas, TX.

The Article Processing Charge was funded by NIH grant. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary ALS = amyotrophic lateral sclerosis; CMT = Charcot-Marie-Tooth; CMTES = CMT Examination Score; CMTNS = CMT neuropathy score; DP = diabetic polyneuropathy; EPS = episodic pain syndrome; IRB = institutional review board; NCS = nerve conduction study; RAPS = Rheumatoid Arthritis Pain Scale.

Mutations in genes encoding voltage-gated sodium channels In addition to medical history and neurologic examination, 10 (Nav) have been instrumental to the understanding of the CMT neuropathy score was obtained from all patients. mechanisms underlying pain. This has mainly involved 3 The score comprised sensory/motor symptoms and physical — fi types of Nav Nav1.7, Nav1.8, and Nav1.9. The key protein ndings in limb sensation/muscle strength. The electro- α element, -subunit, of these Nav is encoded by SCN9A, physiologic portion of the score was omitted to produce the – SCN10A, and SCN11A genes,1 3 respectively. CMT Examination Score (CMTES) and will be described separately. The CMTES ranges from 0 to 28, with higher Genotype and phenotype associations have not been clear in scores indicating an increase in disease severity. mutations of SCN11A. Three patients with L811P and L1302F missense mutations develop congenital insensitivity Nerve conduction studies to pain.4,5 Other missense mutations (Ile381Thr, Lys419Asn, Nerve conduction study (NCS) data were acquired using 11 Ala582Thr, Ala681Asp, Ala842Pro, Leu1158Pro, and conventional methods. For motor nerves, the distal stimu- Phe1689Leu) were associated with painful sensory neuropa- lation distances for motor conduction studies were 7 cm in the thy.4 These 7 mutations were not verified through cose- arms and 9 cm in the legs. For the sensory nerves, the gregation analysis. Finally, 4 additional missense mutations (Arg225Cys, Ala808Gly, Arg222His, and Arg222Ser) were – identified in 4 large Asian families and an Argentina family,6 8 Figure 1 Family pedigree and DNA sequencing results each cosegregated with family members affected by episodic pain syndrome (EPS). However, EPS was not systematically characterized; in particular, it is unknown whether these patients have pathologic or electrophysiologic changes in peripheral nerves.

The Arg225Cys mutation in SCN11A is predicted to aﬀect the S4 voltage sensor domain. This domain consists of an α-helix with positively charged amino acids such as arginine and lysine that allow for ion exchange. Patch-clamp studies have demonstrated increased conductance for mutant Arg225Cys, with no eﬀect on activation or inactivation potentials when compared with wild type.9

In this study, we report a family with the Arg225Cys missense mutation in SCN11A that exhibits no clinical and pathophysiologic evidence of peripheral neuropathy, but nociceptive pain. This disassociation suggests dysfunctional nociceptive neurons by the mutation.

Methods Patients The affected proband (0001) was initially evaluated at the Vanderbilt Rheumatology Clinic for fibromyalgia. She was then referred to the Vanderbilt Charcot-Marie-Tooth (CMT) clinic. The remaining 1 unaffected and 5 affected family members were enrolled and evaluated at the Clinical Research Center at Vanderbilt University Medical Center (figure 1A). (A) Family pedigree: filled shapes represent affected members, and unfilled This study was approved by the local institutional review shapes represent unaffected members. The arrow points to the proband. (B) Representative sanger sequencing traces were from an affected and an board (IRB). A written consent form was obtained from all unaffected participant. The box outlies the mutated nucleotide. participants.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG stimulation distance was 14 cm for median, ulnar, and sural The neuropathic and nociceptive subscores were compared nerves but 10 cm for the radial nerves. using the Wilcoxon signed-rank test. It should be clarified that this study is not aimed at validating new pain scales, but at DNA sequencing using the previously published scales to characterize the pain The proband’s DNA was initially studied by targeted gene- features quantitatively. panel next-generation sequencing, a commercial diagnostic service provided by Medical Neurogenetics (Atlanta, GA). Standard protocol approvals, registrations, The panel (NGS400) covers 39 pain-related genes. Its tech- and patient consents nique was similar to what was described.12 This project was approved by the Vanderbilt University IRB. All patients consented to participation in this study. DNA from blood cells was extracted from all other family members using a commercial kit (#A1620; Promega, Madi- son, WI). DNA was then sequenced by Sanger sequencing for Results the Arg225Cys mutation. Primers were designed as 59- Patients present with pain that has episodic, TCGATTTCACCTTGGAGGTC-39 and 59-CAGTTAG- length-dependent, and inflammatory features CACAGTGCCTGGA-39. PCR products were sequenced in GenHunter Corporation (Nashville, TN). Clinical phenotypes Patient II-5 Human skin biopsy and intraepidermal nerve This is a 29-year-woman with a chief complaint of chronic fiber density pain. She came to the Vanderbilt Rheumatology clinic for This technique has been detailed before.13 In brief, punch skin evaluation of fibromyalgia. Pain is mainly concentrated in feet biopsies (3 mm in diameter) were obtained from the distal leg but only 1 place at a time. She describes it as “deep, aching” and distal and proximal thigh of all participants. The tissues pain. It typically lasts from 15 to 30 minutes. It starts mildly were fixed in fixatives (4% paraformaldehyde). The tissues and then peaks. Affected areas may be warm during these were shipped to the coauthor’s (L.Z.) laboratory for pro- episodes but range of motion, strength, and sensation are cessing. Epidermal nerve fibers were stained with antibodies intact and showed no erythema or swelling. Pain occurred against PGP9.5 and counted under light microscopy. The daily during her childhood, but now twice per week. Pain is experimenter who processed and counted the skin biopsies mostly at night and may wake her up from sleep but some- was blinded to the patient’s ID and genotypic information. times during the day. She rates pain at 6–7 of 10. It is often worsened with weather changes but could occur without Pain questionnaires obvious reason. Ibuprofen helps but cannot prevent the To characterize the nature of pain in the affected family recurrence. After she was seen in the Vanderbilt CMT clinic, members, we have identified 2 pain scales in the literature. she discontinued ibuprofen for 12 months but took gaba- The Rheumatoid Arthritis Pain Scale was developed to eval- pentin that failed to control pain. Ibuprofen was restarted. uate nociceptive pain in patients with rheumatoid arthritis.14 Because of the features and the responsiveness of pain to Symptoms disappeared when she was pregnant but returned NSAIDs in our patients, this pain scale was considered to be 2 months after childbirth. She denied a history of diabetes, suitable. We omitted those questions specific for arthritis or renal disease, vitamin deficiency, or HIV infection. She is joint problems. The painDETECT scale was developed to a practicing optometrist with no history of cognitive evaluate neuropathic pain and was able to distinguish neu- dysfunction. ropathic pain from nociceptive pain in previously published – studies.15 17 We reworded the questions to improve their On neurologic examination, she was found to have normal clarity for patients. The questionnaire is detailed in supple- cranial nerve functions. Her muscle strength was 5 on the mentary materials (links.lww.com/NXG/A60). Medical Research Council scale in all muscle groups. Sensa- tion was intact to light touch, pinprick, and vibration. Deep The pain scale was first tested in patients with amyotrophic tendon reflexes were normal. Her CMTES was 0. lateral sclerosis (ALS) and diabetic polyneuropathy (DP). The study was conducted on consecutively identified patients A complete laboratory evaluation for systemic rheumatologic with DP and ALS at the Vanderbilt Neurology Clinic over disorders was performed. It revealed a mildly elevated a 12-month period. Participants were excluded if they were erythrocyte sedimentation rate of 32 (range 0–20), otherwise younger than 18 years, if they had a coexisting medical con- normal for antinuclear antibodies and creatine kinase. dition that may cause significant pain such as severe cervical or lumbar spine disease, rheumatoid arthritis, or osteoarthritis, Patient I-1 or if they answered “no” for the first question. We contacted The proband’s aunt is a 53-year-old woman. She had a normal patients by telephone to administer the scale prospectively developmental history. Her symptoms started in early child- after verbal consent was obtained. The scale was then applied hood. Pain occurred in her bilateral knees, ankles, and toes to the affected family members with the mutation in SCN11A. and was about 3–4 times per week. She describes pain as dull/

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 aching type. It was made worse by exertion and weather We verified the Arg225Cys mutation using Sanger sequencing changes and made better by taking nonsteroidal anti- in our laboratory (figure 1B). Arg225Cys was found only in inflammatory drugs (NSAIDs). It typically lasts 20–30 minutes. affected family members (0001, 0100, 0101, 0103, 1000, and She denied numbness or tingling associated with her pain. Of 1001) but absent in a nonaffected family member (0102). interest, at the age of ;20 years, her symptoms including pain resolved spontaneously. She denied fainting, sweating, or The mutation was evaluated by 2 servers—PolyPhen-2 and orthostasis associated with the pain episodes. Her neurologic Sorting Intolerant from Tolerant (SIFT).18 Both PolyPhen-2 and examination was normal. The CMTES was 0 at her clinic visit. SIFT predicted that Arg225Cys is pathogenic. In addition, the The remaining 4 affected members in table 1 showed symp- Arg225Cys allele was absent in 107,784 chromosomes of control toms similar to the 2 cases detailed above. population in the ExAC database (exac.broadinstitute.org/).

Taken together, these 6 affected members demonstrated the Laboratory tests showed no pathophysiologic following key phenotypic features: (1) pain is episodic and fits abnormalities in both small and larger nerve with nociceptive or inflammatory pain, but not neuropathic fibers of patients affected by the disease pain, in nature; (2) sites of pain are length dependent, and all Missense mutations in Nav1.7, Nav1.8, and Nav1.9 have all 6 patients have pain mainly in feet and distal legs; (3) been associated with painful sensory neuropathy with pure NSAIDs, but not gabapentin, are effective in all 6 patients, small nerve fibers affected or small fibers predominantly 4 supporting inflammatory pain; and (4) all patients have no damaged. To further clarify this issue, we performed NCS in abnormal physical findings. all our participants (table 2). There was no evidence of peripheral neuropathy in all studied participants. DNA analysis shows a missense mutation of Arg225Cys in the SCN11A gene NCS mainly tests larger diameter nerve fibers but is in- The proband’s DNA was initially studied by targeted next- sensitive to the changes in small diameter nerve fibers.19 We generation sequencing (Medical Neurogenetics, Atlanta). thus performed skin biopsies to quantify intraepidermal nerve This test covered 39 pain-related genes (mnglabs.com/). It fiber density. This test targets nonmyelinated sensory nerve detected a missense mutation of p.Arg225Cys in SCN11A. fibers and is highly sensitive in diagnosing small fiber sensory The same mutation has been reported to be pathogenic for neuropathy.13 All studied participants showed normal EDNF EPS in 2 Chinese families.6 (table 3). Therefore, there is no evidence of small and larger

Table 1 Clinical phenotype in patients with the Arg225Cys mutation in SCN11A

Age/ Duration, Identificationa Sex Frequencyb Factorc min Nature Severityd Npe Ncf Localization Medication

II-5 29/F 2/wk PAg 10–20 Deep ache 4 0 4 Feet and Ibuprofen and hands acetaminophen

II-1 30/M 2/mo PA and 30 Deep ache, mild 5 2 17 Limbs Ibuprofen and WCh burning, and naproxen mild tingling

II-2 28/M 2/wk PA and 20–30 Deep and 5 0 16 Feet, legs, Ibuprofen and WC throbbing ache and hands naproxen

II-3i 27/F NA NA NA NA 0 0 0 NA NA

II-4 22/F 1–2/d PA and 10–30 Deep ache 4.5 0 4 Feet, legs, Ibuprofen WC and hands

I-1j 53/F NA PA and NA NA 0 0 0 NA NA WC

I-2 51/F 2/mo PA and 45–60 Cold, gnawing 4 0 13 Limbs Ibuprofen and WC ache, and sharp acetaminophen

Abbreviation: NA = not applicable. a Identification used in the pedigree. b Pain frequency. c Factors exacerbating or triggering pain. d Visual analog scale (1–10). e Neuropathic score. f Nociceptive score. g Prolonged activities. h Weather change. i This participant had no mutation found in SCN11A and thus exhibited no symptom. j This patient’s symptoms resolved spontaneously in her 20s, thus exhibited no phenotype at the clinical visit.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Table 2 Quantification of epidermal nerve fiber density in patients with the Arg225Cys mutation in SCN11A

Identificationa Age Distal leg Distal thigh Proximal thigh

Normsb 20–29 11.3 ± 5.9 15.5 ± 5.9 13.2 ± 6.1

II-5 29 18.1 19.1 26.4

II-1 30 13.2 13.5 13.8

II-2 28 8.9 14.8 14.8

II-3 27 13.6 17.5 17.9

II-4 22 13.6 16.3 20.4

Norms 50–59 14.4 ± 5.7 21.4 ± 14.1 17.9 ± 11.2

II-1 53 10.2 14.4 16.5

II-2 51 11.4 20.4 22.3 a Identification used in the pedigree. b Normative values from previously published data. The unit is “nerve fibers/mm surface length of skin.”

fiber peripheral neuropathy in our patients with the Arg225- or minimal neuropathic pain (9.0 ± 7.2 nociceptive vs 0.3 ± Cys mutation. 0.82 neuropathic; p = 0.015). Note that participant #1000 has not had pain since her 20s due to spontaneous remission. She Evaluation through pain questionnaires is also was removed from the statistical comparison between neu- supportive of a nociceptive or inflammatory ropathic and nociceptive pain. pain, not neuropathic pain To systematically characterize pain in patients with the Arg225Cys mutation, we used previously published scales Discussion that were designed to detect nociceptive and neuropathic pain.14,15 ALS primarily affects motor nerves. It is mainly Our study has identified a Caucasian family afflicted by associated with nociceptive pain. By contrast, patients with a missense mutation of Arg225Cys in SCN11A that has not diabetic neuropathy are well known to develop neuropathic been described in North America except in Asian families.6 In pain.20 We therefore tested the scale to determine whether the considering the cosegregation of the mutation with affected – scale can show the difference of neuropathic vs nociceptive family members in previously reported families6 8 plus the pain in these 2 populations of patients. The distribution of family reported in the present study, the Arg225Cys is clearly demographics was similar between DP and ALS groups (table pathogenic. However, we found no pathophysiologic evi- e-1 and figure e-1, links.lww.com/NXG/A60). Patients with dence of peripheral neuropathy in our patients. DP showed significantly more neuropathic pain than nociceptive pain (p = 0.01). By contrast, participants with ALS All affected patients exhibit features of nociceptive pain that is showed more nociceptive pain (p = 0.02). typically seen in patients with rheumatoid arthritis or other inflammatory joint diseases but does not fit with neuropathic We then administered the scale to patients with the pain. In addition, patients are all responsive to NSAIDs but Arg225Cys mutation (table 1). Patients with the Arg225Cys not drugs against neuropathic pain. These observations sup- mutation showed almost exclusively nociceptive pain but no port inflammatory stimuli that either evoked or exacerbated

Table 3 Nerve conduction studies

Sensory NCS Motor NCS

DL (ms)/Amp (mV)/CV (m/s) DL (ms)/Amp (mV)/CV (m/s)

Identification Median Ulnar Sural Median Ulnar Peroneal

Normsa 3.5/22.0/50.0 3.5/10.0/50.0 4.4/6.0/40.0 4.4/4.0/49.0 3.3/6.0/49.0 6.5/2.0/44.0

I-1 2.9/36.0/50.0 3.2/17.9/58.0 2.4/9.1/52.0 2.9/7.0/51.0 3.3/8.6/51.6 3.5/2.9/50.0

I-2 3.1/47.0/61.0 4.0/18.7/54.0 3.4/8.3/47.0 2.7/6.7/49.0 3.2/8.1/49.0 3.1/3.2/55.0

Abbreviations: Amp = amplitude; CV = conduction velocity; DL = distal latency; NCS = nerve conduction study. a Lower limit of normal.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 pain along with the dysfunctional nociceptive neurons by the fibers. This pain phenotype is also consistent with the hy- mutation. perexcitability observed in dorsal root ganglion neurons 6 expressing the mutant Nav1.9. This phenotype is clearly Nociceptive pain in these patients was often described as an distinct from neuropathic pain observed in patients with aching type pain, which is commonly associated with muscu- painful small fiber sensory neuropathy and other missense loskeletal or joint pain. During their pain episodes, symptoms mutations in Nav. were commonly described as originating unilaterally with point tenderness and would slowly, in a matter of minutes to hours, Author contributions ascend proximally in the affected limb. In the lower extremity, R. Castoro: participated in conceptualization of the study, pain was described as ascending to the mid-lateral thigh; data acquisition, analyzed and interpreted data, and drafted however, 2 patients were affected as proximal as the hip. the manuscript. M. Simmons, L. Zhou, V. Ravi, D. Huang, C. Lee, and J. Sergent: acquisition of data. J. Li: conceptual- Of note, 1 patient (II-1) described their pain as having ized the study, analyzed and interpreted data, drafted the a burning and tingling sensation on their questionnaire, which manuscript, and supervised the study. was mild (1 on scale of 1–5). However, these were not the features in other patients. Otherwise, his pain description was Study funding largely nociceptive in features. Thus, if there were any neu- This research is supported by grants from the NINDS ropathic features of pain, it was minimal. (R01NS066927), the Muscular Dystrophy Association, and the National Center for Advancing Translational Sciences Of interest, in our family, the most common exacerbating (UL1TR000445). factors for pain was exertion/physical activity and weather changes, both of which have been associated with increased Disclosure localized inflammation. In line with this issue, SCN11A R. Castoro, M. Simmons, V. Ravi, and D. Huang report no knockout mice showed impairment of somatic inflammatory disclosures. C. Lee has served on the commercial advisory 21,22 pain behavior Together, these observations also suggest board of CSL Behring. J. Sergent has received research sup- that pain by the Arg225Cys mutation may involve partic- port from the NIH. L. Zhou reports no disclosures. J. Li has ipations of other cell types such as inflammatory cells. served on the scientific advisory boards of the Muscular Dystrophy Association and the Charcot-Marie-Tooth Asso- The exact pathogenic mechanisms between neurons, glia and ciation and serves on the editorial boards of the Journal of the inflammatory cells in relation to pain are unknown. Pain may Peripheral Nervous System, Experimental Neurology, Neurology: arise from the distal part of peripheral nerves since pain shows Neuroimmunology & Neuroinflammation, and Neural Re- a clear length-dependent pattern in all studied patients with generation Research. Full disclosure form information provided the Arg225Cys mutation. by the authors is available with the full text of this article at Neurology.org/NG. Missense mutations in Nav have been associated with painful 1,4,23 sensory neuropathies. This is well expected for Nav1.7 Received February 14, 2018. Accepted in final form May 21, 2018. and Nav1.8, given the known biology of the 2 types of Nav. However, this association is not well explained in patients References 1. Dib-Hajj SD, Rush AM, Cummins TR, et al. Gain-of-function mutation in Nav1.7 in with mutations in Nav1.9 since Nav1.9 is exclusively expressed familial erythromelalgia induces bursting of sensory neurons. Brain 2005;128: in nociceptive neurons. Indeed, our patients rarely presented 1847–1854. 2. Cox JJ, Reimann F, Nicholas AK, et al. An SCN9A channelopathy causes congenital with features of neuropathic pain. Some patients with the inability to experience pain. Nature 2006;444:894–898. Arg225Cys mutation have even been diagnosed with fibro- 3. Faber CG, Lauria G, Merkies IS, et al. Gain-of-function Nav1.8 mutations in painful myalgia. Furthermore, both NCS and skin biopsies showed no neuropathy. Proc Natl Acad Sci USA 2012;109:19444–19449. 4. Huang J, Han C, Estacion M, et al. Gain-of-function mutations in sodium channel – evidence of peripheral neuropathy. Therefore, the EPS phe- Nav1.9 in painful neuropathy. Brain 2014;137:1627 1642. notype with nociceptive pain observed in the present study is 5. Leipold E, Hanson-Kahn A, Frick M, et al. Cold-aggravated pain in humans caused by a hyperactive NaV1.9 channel mutant. Nat Commun 2015;6:10049. well in line with the known biology of Nav1.9. Clinicians may 6. Zhang XY, Wen J, Yang W, et al. Gain-of-Function mutations in SCN11A cause add EPS into their differential diagnosis when dealing with familial episodic pain. Am J Hum Genet 2013;93:957–966. 7. Okuda H, Noguchi A, Kobayashi H, et al. Infantile pain episodes associated with novel cases presenting no peripheral neuropathy but nociceptive Nav1.9 mutations in familial episodic pain syndrome in Japanese families. PLoS One pain. This observation also redirects our attention to addi- 2016;11:e0154827. 8. Han C, Yang Y, Te Morsche RH, et al. Familial gain-of-function Nav1.9 mutation in tional pain phenotypes that may relate to the genetic alter- a painful channelopathy. J Neurol Neurosurg Psychiatry 2017;88:233–240. ations in SCN11A. 9. Leng XR, Qi XH, Zhou YT, Wang YP. Gain-of-function mutation p.Arg225Cys in SCN11A causes familial episodic pain and contributes to essential tremor. J Hum Genet 2017;62:641–646. Here, we have described EPS in a Caucasian family with the 10. Murphy SM, Herrmann DN, McDermott MP, et al. Reliability of the CMT neuropathy score (second version) in Charcot-Marie-Tooth disease. J Peripher Nerv Syst Arg225Cys mutation in SCN11A. Detailed characterization of 2011;16:191–198. the family enables us to reveal pain likely arising from dys- 11. Li J, Krajewski K, Shy ME, Lewis RA. Hereditary neuropathy with liability to pressure palsy: the electrophysiology fits the name. Neurology 2002;58:1769–1773. functional nociceptive neurons of peripheral nerves that lacks 12. Hu B, Arpag S, Zuchner S, Li J. A novel missense mutation of CMT2P alters tran- detectable pathologic alterations in large and small nerve scription machinery. Ann Neurol 2016;80:834–845.

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG 13. Lauria G, Lombardi R, Borgna M, et al. Intraepidermal nerve fiber density in rat foot 18. Lopes MC, Joyce C, Ritchie GR, et al. A combined functional annotation score for pad: neuropathologic-neurophysiologic correlation. J Peripher Nerv Syst 2005;10: non-synonymous variants. Hum Hered 2012;73:47–51. 202–208. 19. Aaij R, Adeva B, Adinolfi M, et al. Search for long-lived particles decaying to jet pairs. 14. Anderson DL. Development of an instrument to measure pain in rheumatoid arthritis: Eur Phys J C Part Fields 2015;75:152. rheumatoid Arthritis Pain Scale (RAPS). Arthritis Rheum 2001;45:317–323. 20. Bouhassira D, Letanoux M, Hartemann A. Chronic pain with neuropathic characteristics 15. Freynhagen R, Baron R, Gockel U, Tolle TR. painDETECT: a new screening in diabetic patients: a French cross-sectional study. PLoS One 2013;8:e74195. questionnaire to identify neuropathic components in patients with back pain. Curr 21. Priest BT, Murphy BA, Lindia JA, et al. Contribution of the tetrodotoxin-resistant Med Res Opin 2006;22:1911–1920. voltage-gated sodium channel NaV1.9 to sensory transmission and nociceptive be- 16. Fishbain DA, Cole B, Lewis JE, Gao J. What is the evidence that neuropathic pain is havior. Proc Natl Acad Sci USA 2005;102:9382–9387. present in chronic low back pain and soft tissue syndromes? An evidence-based 22. Amaya F, Wang H, Costigan M, et al. The voltage-gated sodium channel Na(v)1.9 is structured review. Pain Med 2014;15:4–15. an effector of peripheral inflammatory pain hypersensitivity. J Neurosci 2006;26: 17. Ahmed S, Magan T, Vargas M, Harrison A, Sofat N. Use of the painDETECT tool in 12852–12860. rheumatoid arthritis suggests neuropathic and sensitization components in pain 23. Dib-Hajj SD, Cummins TR, Black JA, Waxman SG. Sodium channels in normal and reporting. J Pain Res 2014;7:579–588. pathological pain. Annu Rev Neurosci 2010;33:325–347.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 ARTICLE OPEN ACCESS Expanding the phenotype of de novo SLC25A4- linked mitochondrial disease to include mild myopathy

Martin S. King, PhD,* Kyle Thompson, PhD,* Sila Hopton, BSc, Langping He, PhD, Edmund R.S. Kunji, PhD, Correspondence Robert W. Taylor, PhD, FRCPath, and Xilma R. Ortiz-Gonzalez, MD, PhD Dr. Ortiz-Gonzalez [email protected] Neurol Genet 2018;4:e256. doi:10.1212/NXG.0000000000000256 Abstract Objective To determine the disease relevance of a novel de novo dominant variant in the SLC25A4 gene, encoding the muscle mitochondrial adenosine diphosphate (ADP)/adenosine triphosphate (ATP) carrier, identiﬁed in a child presenting with a previously unreported phenotype of mild childhood-onset myopathy.

Methods Immunohistochemical and western blot analysis of the patient’s muscle tissue were used to assay for the evidence of mitochondrial myopathy and for complex I–V protein levels. To determine the eﬀect of a putative pathogenic p.Lys33Gln variant on ADP/ATP transport, the mutant protein was expressed in Lactococcus lactis and its transport activity was assessed with fused membrane vesicles.

Results Our data demonstrate that the heterozygous c.97A>T (p.Lys33Gln) SLC25A4 variant is associated with classic muscle biopsy findings of mitochondrial myopathy (cytochrome c oxidase [COX]-deficient and ragged blue fibers), significantly impaired ADP/ATP transport in Lactococcus lactis and decreased complex I, III, and IV protein levels in patient’s skeletal muscle. Nonetheless, the expression levels of the total ADP/ATP carrier (AAC) content in the muscle biopsy was largely unaffected.

Conclusions This report further expands the clinical phenotype of de novo dominant SLC25A4 mutations to a childhood-onset, mild skeletal myopathy, without evidence of previously reported clinical features associated with SLC25A4-associated disease, such as cardiomyopathy, encephalopathy or ophthalmoplegia. The most likely reason for the milder disease phenotype is that the overall AAC expression levels were not aﬀected, meaning that expression of the wild-type allele and other isoforms may in part have compensated for the impaired mutant variant.

*These authors contributed equally to the manuscript.

From the Medical Research Council Mitochondrial Biology Unit (M.S.K., E.R.S.K.), University of Cambridge, Wellcome Trust/MRC Building, Cambridge Biomedical Campus, UK; Wellcome Centre for Mitochondrial Research (K.T., S.H., L.H., R.W.D.), Institute of Neuroscience, Newcastle University, UK; and Department of Neurology (X.R.O.), Perelman School of Medicine, Division of Neurology and Center for Mitochondrial and Epigenomic Medicine, The Children’s Hospital of Philadelphia, University of Pennsylvania.

The Article Processing Charge was funded by the Wellcome Centre for Mitochondrial Research. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (CC BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary: AAC = ADP/ATP carrier; ADP = adenosine diphosphate; ATP = adenosine triphosphate; COX = cytochrome c oxidase; CHOP = Children’s Hospital of Philadelphia; CK = creatine kinase; mtDNA = mitochondrial DNA; OXPHOS = oxidative phosphorylation; PEO = progressive external ophthalmoplegia.

SLC25A4 (ANT1 and AAC1) gene mutations cause an in- full mitochondrial DNA (mtDNA) sequencing (in blood and triguing spectrum of human disease, with dominant mutations muscle) were obtained via the next-generation sequencing first reported in adults with progressive external oph- panel. thalmoplegia (PEO),1 whereas recessive loss-of-function mutations cause cardiomyopathy and skeletal myopathy.2,3 Standard protocol approvals, registrations, Furthermore, SLC25A4 de novo dominant mutations can and patient consents ’ present in neonates with lactic acidosis, severe hypotonia, and Informed consent was obtained from the child s parents to ’ respiratory failure.4 Here, we report a patient who presented enroll in a human subject s research protocol approved by the at age 2 years with mild weakness and hypotonia and was Institutional Review Board at CHOP. found to have a novel de novo heterozygous SLC25A4 variant Human muscle immunohistochemistry (c.97A>T;p.Lys33Gln). and analysis Standard histologic and histochemical analyses were per- The SLC25A4 gene encodes the mitochondrial AAC1, which formed on 10-μm transversely oriented muscle cryosections. imports ADP into the mitochondrion and exports ATP.5 Quadruple immunofluorescence analysis of NDUFB8 Humans have 4 AAC isoforms, with AAC1 being specificto (complex I) and COXI (complex IV)7 and western blot the heart, skeletal muscle, and brain.6 Previous functional analysis3 were performed as previously reported. mtDNA studies correlating the rate of ADP/ATP exchange with copy number assessment in muscle was undertaken as phenotype severity have only partially solved the puzzle. In described.8 dominant-acting mutations, the rate of transport does seem to correlate with clinical severity, with mutations associated with Functional studies of p.Lys33Gln variant in PEO having higher residual ADP/ATP transport rates com- Lactococcus lactis pared with de novo mutations associated with severe neonatal 4 The SLC25A4 gene was cloned into the L. lactis expression disease. However, loss-of-function recessive mutations vector pNZ8048 by established procedures,9 and the present later than de novo cases with a predominant cardiac p.Lys33Gln variant was introduced and confirmed by se- phenotype, despite in vitro functional studies showing es- 4 quencing. Growth of L. lactis, membrane isolation, vesicle sentially no measurable ADP/ATP exchange preparation, transport assays, and western blot analysis were performed as reported.4,9 Here, we report that the de novo dominant variant p.Lys33Gln in SLC25A4 is clinically associated with mild myopathy despite significant mitochondrial pathology in Results muscle biopsy and functional data showing abolished ADP/ ATP exchange in vitro. This case expands the known phe- Patient results notype of SLC25A4 disease to include childhood-onset mild Histopathologic assessment of skeletal muscle from the pa- skeletal myopathy without evidence of cardiac, brain, or tient demonstrated a mosaic pattern of cytochrome c oxidase fi fi fl extraocular muscle involvement. (COX) de ciency ( gure 1A). Quadruple immuno uores- cence analysis confirmed a mitochondrial defect involving both complexes I and IV with some fibers exhibiting normal Methods protein expression (figure 1B). MtDNA copy number was decreased to approximately 40% in patient muscle compared Case presentation with age-matched controls. Western blot analysis showed A 2-year old girl presented to the neurology clinic at the a slight decrease in AAC protein levels, associated with more Children’s Hospital of Philadelphia (CHOP) for hypotonia markedly decreased steady-state protein levels of components and mild gross motor delays. Neurologic examination at of respiratory complexes (CI, CIII, and CIV) in patient presentation was only remarkable for hypotonia and a 1- skeletal muscle (figure 1C). handed Gower maneuver, suggestive of mild weakness. Family history was unremarkable. Laboratory workup found Genetic testing revealed a heterozygous SLC25A4 variant elevated creatine kinase (CK) (616 U/L, normal 60–305) and (c.97A>C, p.Lys33Gln) that was confirmed to have arisen de lactic acidosis (3.76 mM, normal 0.8–2.0) levels; therefore, novo following parental testing. Serial cardiac evaluations muscle biopsy and subsequent genetic testing were pursued. including ECG, echocardiogram, and Holter monitoring were Clinical testing for nuclear mitochondrial disease genes and unremarkable from diagnosis at age 2 years to current age of 8

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 1 The de novo p.Lys33Gln mutation leads to OXPHOS defect in muscle

(A) Histopathologic analysis of patient skeletal muscle sections showing hematoxylin and eosin (H&E) staining (far left), COX histochemistry (middle left), SDH histochemistry (middle right), and sequential COX-SDH histochemistry (far right). Scale bar = 100 μm. (B) Respiratory chain profile following quadruple oxidative phosphorylation immunofluorescence analysis of cryosectioned muscle from the index case, confirming the presence of fibers lacking complex I (NDUFB8) and complex IV (COXI) protein. Each dot represents the measurement from an individual muscle fiber, color coded according to its mitochondrial mass (blue-low, normal-beige, high-orange, and very high–red). Gray dashed lines indicate SD limits for the classification of fibers. Lines next to x- and y-axes represent the levels (SDs from the average of control fibers after normalization to porin/VDAC1 levels; _z= Z-score, see Methods section of Rocha et al. 2015 for full description of statistics7) of NDUFB8 and COX1, respectively (beige = normal [>−3], light beige = intermediate positive [−3to−4.5], light purple = intermediate negative [−4.5 to −6], and purple = deficient [<−6]). Bold dotted lines indicate the mean expression level observed in respiratory normal fibers. (C) Western blot analysis of AAC and OXPHOS complex subunits on control and patient skeletal muscle samples. AAC = ADP/ATP carrier; ADP = adenosine diphosphate; ATP = adenosine triphosphate; COX = cytochrome c oxidase; GADPH = Glyceraldehyde 3-phosphate dehydrogenase; OXPHOS = oxidative phosphorylation; SDH = succinate dehydrogenase. years. Neurologic evaluations remain stable, only remarkable measured for an empty vector control (figure 3A), wild-type for mild proximal weakness, hyperCKemia, and lactic acidosis, SLC25A4 (figure 3B), and p.Lys33Gln, using the specificin- with normal extraocular movements and no cognitive hibitor carboxyatractyloside as control (figure 3C). The mutant abnormalities. protein is expressed to approximately the same levels as wild- type in lactococcal membranes, suggesting that the mutation Assessment of SLC25A4 p.Lys33Gln does not affect biogenesis, protein folding, or targeting to variant function the membrane in this expression system (figure 3D). The The transport mechanism of SLC25A4 involves the disrup- p.Lys33Gln mutant was not able to transport ADP (figure 3E). tion and formation of the matrix and cytoplasmic salt bridge network in an alternative way (figure 2A).5 Residue Lys33 in SLC25A4, which is conserved among AAC from fungi, plants, Discussion and metazoans (figure 2B), forms a salt bridge with the conserved Asp232 in the matrix network (figure 2, C and D). Previously, we have functionally characterized the effect of 9 The p.Lys33Gln mutation would eliminate this interaction, as pathogenic variants in human SLC25A4 using L. lactis, de- glutamine is a neutral amino acid residue and too short to termining residual transport activity compared with wild-type form a hydrogen bond (figure 2E). Below the salt bridge is protein.4 Broadly speaking, residual transport activities of the Gln37 that forms a highly conserved glutamine brace10 (figure mutants segregate with the associated clinical phenotype; 2, B–D), which would also be disrupted by the mutation mutations associated with adult-onset dominant PEO display (figure 2E). higher residual transport activities (24%–56%) than mutations associated with recessive disease, which were effectively We introduced the p.Lys33Gln mutation into the human nonfunctional.4 There was also a correlation between the SLC25A4 sequence and expressed it L. lactis membranes. The severity of the clinical phenotype and residual transport ac- uptake of radio-labeled ADP in exchange for loaded ADP was tivity of previously documented dominant mutations, with

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 Figure 2 The p.Lys33Gln mutation eliminates a conserved salt bridge interaction of the matrix network

(A) Transport cycle of the mitochondrial AAC SLC25A4. The disruption and formation of salt bridges between positively (blue) and negatively (red) charged residues of the cytoplasmic and matrix networks, top and bottom respectively, change the access of the substrates to the central substrate binding site, indicated by a hexagon, from the intermembrane space (i) and matrix (m) side of the membrane. The imported ADP is shown in green sphere representation and the exported ATP in cyan. (B) Amino acid sequence alignment of AAC1 sequences of fungi, plants, and metazoan, showing that Lys33, Gln37, and Asp232 are highly conserved amino acid residues. (C) Lateral view of the human ADP/ATP carrier from the membrane, showing the residues of the matrix and cytoplasmic networks (blue and red sticks) and substrate binding site (green sticks, hexagon). ADP (light blue ball and stick) and the glutamine brace (light green stick) are also shown. Residue Lys33 that is mutated is shown in yellow. (D) Cytoplasmic view of the carrier showing only the residues of the matrix salt bridge network of SLC25A4 (blue and red sticks). (E) As (D), except for the p.Lys33Gln mutation, which is shown in magenta. The ionic interactions (black dash lines) are indicated with plus and minus signs. The model of human SLC25A4 was generated in SwissModel, using the structure of the closely related bovine mitochondrial AAC as template (PDB file: 1OKC). Adapted from Figure 3 in reference 4. AAC = ADP/ATP carrier; ADP = adenosine diphosphate; ATP = adenosine triphosphate.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 3 Transport activity of human SLC25A4 and SLC25A4 p.Lys33Gln

Transport of [14C]-labeled ADP into vesicles of L. lactis membranes expressing (A) an empty vector control, (B) SLC25A4, or (C) SLC25A4 p.Lys33Gln in the presence (black symbols) or absence (white symbols) of 20 μM carboxyatractyloside. Transport was initiated by the addition of 5 μM[14C]-ADP and was terminated by filtration and washing at the indicated time intervals. The data are represented by the average and SD of 4 assays. (D) Expression levels of wild type and p.Lys33Gln determined by western blot analysis. (E) Transport rate of the empty vector control, human SLC25A4, and p.Lys33Gln, corrected for background binding. AAC = ADP/ATP carrier; ADP = adenosine diphosphate; ATP = adenosine triphosphate. mutations associated with inherited PEO showing higher undetectable.3 These data suggest that the clinical severity of activity than mutations associated with de novo severe neo- de novo dominant mutations in SLC25A4 could be explained natal presentation.3 by the relative expression of wild-type and mutant alleles and the expression of other AAC isoforms, rather than the It remains unclear exactly why the presently documented case transport activity of the mutant variant alone. with the de novo dominant c.97A>T(p.Lys33Gln) SLC25A4 variant presents with a much milder clinical phenotype than This report expands the clinical phenotype for SLC25A4- the other de novo cases3 despite the p.Lys33Gln mutant associated mitochondrial disease, with the mildest childhood- protein revealing essentially null ADP/ATP transport activity onset presentation to date. (figure 3E). This case further supports that residual ADP/ ATP transport activity of mutant AAC1 is only part of the Author contributions puzzle. In vivo, there are 3 other AAC isoforms with varying X.R. Ortiz-Gonzalez, R.W. Taylor, and E.R.S. Kunji: study expression levels in different tissues. Also, since the de novo concept and design and study supervision. R.W. Taylor and variants are heterozygous, the relative expression ratios of E.R.S. Kunji: study funding. M.S. King, K. Thompson, S. wild-type vs mutant AAC1, as well as other isoforms, will have Hopton, and L. He: experimental data acquisition and anal- an effect on the overall transport capacity. Their relative ex- ysis. M.S. King and K. Thompson: statistical analysis for expression levels of carriers cannot be assessed from messenger perimental data. X.R. Ortiz-Gonzalez: clinical data RNA levels, as there are many poorly characterized steps in- acquisition. X.R. Ortiz-Gonzalez, R.W. Taylor, E.R.S. Kunji, volved in their biogenesis and turnover, and the available anti- M.S. King, and K. Thompson: data interpretation and critical bodies are unable to distinguish between the various isoforms. revision of the manuscript for important intellectual content.

Despite these issues, there is a clear correlation between the Study funding severity of OXPHOS dysfunction in skeletal muscle and the R.W. Taylor is supported by the Wellcome Centre for Mito- clinical phenotype between the current and previously chondrial Research (203105/Z/16/Z), the Medical Research reported de novo mutations. Patients with p.Arg80His or Council (MRC) Centre for Translational Research in Neuro- p.Arg235Gly mutations, showing severe neonatal pre- muscular Disease, Mitochondrial Disease Patient Cohort (UK) sentations, had markedly decreased levels of total AAC (G0800674), the Lily Foundation, the UK NIHR Biomedical (<30%),3 whereas there is only a slight decrease in the current Research Centre for Ageing and Age-related disease award to patient (figure 1C). Similarly, the mosaic pattern of OXPHOS the Newcastle upon Tyne Foundation Hospitals NHS Trust, deficiency (figure 1, A and B) is not seen in previously the MRC/EPSRC Molecular Pathology Node, and the UK documented de novo cases, where steady state protein levels NHS Highly Specialised Service for Rare Mitochondrial Dis- of various OXPHOS components were completely orders of Adults and Children. The research of M.S. King and

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 E.R.S. Kunji was funded by the MRC programme grant MC_ 2. Palmieri L, Alberio S, Pisano I, et al. Complete loss-of-function of the heart/muscle- specific adenine nucleotide translocator is associated with mitochondrial myopathy UU_00015/1. X.R. Ortiz-Gonzalez is supported by the Robert and cardiomyopathy. Hum Mol Genet 2005;14:3079–3088. Wood Johnson Foundation Harold Amos Faculty De- 3. Strauss KA, Dubiner L, Simon M, et al. Severity of cardiomyopathy associated with adenine nucleotide translocator-1 deficiency correlates with mtDNA haplogroup. velopment Award and the NIH (5K12NS049453-08). Proc Natl Acad Sci USA 2013;110:3453–3458. 4. Thompson K, Majd H, Dallabona C, et al. Recurrent de novo dominant mutations in Disclosures SLC25A4 cause severe early-onset mitochondrial disease and loss of mitochondrial DNA copy number. Am J Hum Genet 2016;99:860–876. K. Thompson, S. Hopton, L. He, E.R.S. Kunji, M.S. King, and 5. Kunji ER, Aleksandrova A, King MS, et al. The transport mechanism of the mito- R.W. Taylor report no disclosures. X.R. Ortiz-Gonzalez has re- chondrial ADP/ATP carrier. Biochim Biophys Acta 2016;1863:2379–2393. 6. Dolce V, Scarcia P, Iacopetta D, Palmieri F. A fourth ADP/ATP carrier isoform in ceived funding for travel/speaker honoraria from BioMarin and man: identification, bacterial expression, functional characterization and tissue dis- has received research support from the NINDS and the Robert tribution. FEBS Lett 2005;579:633–637. 7. Rocha MC, Grady JP, Grunewald A, et al. A novel immunofluorescent assay to Wood Johnson Foundation. Full disclosure form information investigate oxidative phosphorylation deficiency in mitochondrial myopathy: un- provided by the authors is available with the full text of this article derstanding mechanisms and improving diagnosis. Sci Rep 2015;5:15037. 8. Blakely E, He L, Gardner JL, et al. Novel mutations in the TK2 gene associated with at Neurology.org/NG. fatal mitochondrial DNA depletion myopathy. Neuromuscul Disord 2008;18: 557–560. Received February 14, 2018. Accepted in final form May 15, 2018. 9. King MS, Boes C, Kunji ER. Membrane protein expression in Lactococcus lactis. Methods Enzymol 2015;556:77–97. 10. Ruprecht JJ, Hellawell AM, Harding M, Crichton PG, Mccoy AJ, Kunji ERS. References Structures of yeast mitochondrial ADP/ATP carriers support a domain-based 1. Kaukonen J, Juselius JK, Tiranti V, et al. Role of adenine nucleotide translocator 1 in alternating-access transport mechanism. Proc Natl Acad Sci USA 2014;111: mtDNA maintenance. Science 2000;289:782–785. E426–E434.

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG ARTICLE OPEN ACCESS Carey-Fineman-Ziter syndrome with mutations in the myomaker gene and muscle ﬁber hypertrophy

Carola Hedberg-Oldfors, PhD, Christopher Lindberg, MD, PhD, and Anders Oldfors, MD, PhD Correspondence Dr. Hedberg-Oldfors Neurol Genet 2018;4:e254. doi:10.1212/NXG.0000000000000254 [email protected] Abstract Objective To describe the long-term clinical follow-up in 3 siblings with Carey-Fineman-Ziter syndrome (CFZS), a form of congenital myopathy with a novel mutation in the myomaker gene (MYMK).

Methods We performed clinical investigations, repeat muscle biopsy in 2 of the siblings at ages ranging from 11 months to 18 years, and whole-genome sequencing.

Results All the siblings had a marked and characteristic facial weakness and variable dysmorphic features aﬀecting the face, hands, and feet, and short stature. They had experienced muscle hypotonia and generalized muscle weakness since early childhood. The muscle biopsies revealed, as the only major abnormality at all ages, a marked hypertrophy of both type 1 and type 2 ﬁbers with more than twice the diameter of that in age-matched controls. Genetic analysis revealed biallelic mutations in the MYMK gene, a novel c.235T>C; p.(Trp79Arg), and the previously described c.271C>A; p.(Pro91Thr).

Conclusions Our study expands the genetic and clinical spectrum of MYMK mutations and CFZS. The marked muscle fiber hypertrophy identified from early childhood, despite apparently normal muscle bulk, indicates that defective fusion of myoblasts during embryonic muscle development results in a reduced number of muscle fibers with compensatory hypertrophy and muscle weakness.

From the Department of Pathology and Genetics (C.H.-O., A.O.), Sahlgrenska Academy, University of Gothenburg, and Department of Neurology (C.L.), Neuromuscular Center, Sahlgrenska University Hospital, Gothenburg, Sweden.

The Article Processing Charge was funded by the Swedish Research Council. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

– Carey-Fineman-Ziter syndrome (CFZS, MIM 254940) is an myocytes in the skeletal muscle.2 6 In this article, we describe autosomal recessive inherited disorder. Clinically, patients are a family with 3 siblings affected with CFZS due to biallelic described as having nonprogressive congenital myopathy with mutations in MYMK. marked facial weakness, together with other clinical attributes such as Moebius and Pierre Robin sequence, facial abnormalities, and growth delay. Recently, autosomal recessive Methods mutations in the gene myomaker (MYMK/TMEM8C) were found to be associated with CFZS.1 Patients This Swedish family had 3 affected children with healthy MYMK is a plasma transmembrane protein and is necessary unrelated parents (figure 1L). A summary of results from the for the fusion of mononuclear myoblasts to multinucleate clinical investigations is given in table.

Figure 1 Clinical features and pedigree

(A–D) Facial photographs of individuals II:1 and II:3 demonstrating facial weakness, slight ptosis, broad nasal tip, and in II:1, also slight retrognathia and some degree of epicanthus. (E–G and M) All 3 siblings had small hands with brachydactyly and short tapering fingers, with the thumbs situated proximally on the hands. (K) Individual II:1 also had camptodactyly. (H–J) They had small feet with short toes and sandal gap deformity. (I, J, and M) Individuals II:2 and II:3 appeared puffy on the dorsal aspects of the hands and feet. (L) Pedigree.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Table Clinical findings

Individual II:1 II:2 II:3

Sex Male Female Female

Age at last examination (y) 37 31 28

Descent Swedish Swedish Swedish

Height (cm)a 167 158 160

Phenotype

Facial weakness Severe Severe Severe

Broad nasal tip Yes Yes Yes

Retrognathia Slight Marked Absent

Dysarthria Moderate Severe Moderate

Tongue/hypoglossia Small and short Weakness Weakness (slight)

Palatal weakness Yes Yes Yes (slightly)

Pectoralis hypoplasia Yes No No

Scoliosis No Yes (15°–25°) No

Muscle weakness

Neck flexors None Severe Severe

Hands Moderate Severe None

Proximal upper extremities Slight Slight None

Proximal lower extremities Slight Slight Slight

Distal lower extremities Slight Slight Slight

Laboratory testing

EMG NA Myopathic (age 17 y) NA

Forced vital capacity 2.15/49 2.1/66b 2.9/88 (L/% predicted)

Electrocardiography Normal (age 36 y) AV block grade II (age 30 y) Normal (age 28 y)

Echocardiography Normal (age 36 y) Normal (age 28 y) Normal (age 20 y)

Creatine kinase (IU/L) 840 (<294) 1,200 (<210) 294 (<210)

Muscle pathology Hypertrophy of type 1 and 2 fibers Hypertrophy of type 1 and 2 fibers NA

DNA analysis MYMK Compound heterozygous; c.235T>C; Compound heterozygous; c.235T>C; Compound heterozygous; c.235T>C; c.271C>A c.271C>A c.271C>A

Predicted protein change p.(Trp79Arg); p.(Pro91Thr) p.(Trp79Arg); p.(Pro91Thr) p.(Trp79Arg); p.(Pro91Thr)

Abbreviations: MYMK = myomaker; NA, not available. a Parental height: mother 163 cm and father 183 cm. b Technical difficulties.

All siblings presented at birth with hypotonia and feeding II:2 since 6 years of age, and II.3 since 26 years of age due to diﬃculties. They started to walk at around 15 months of age, myopia. Individual II.2 had a hearing impairment involving but they used the Gower maneuver to come to an upright low-frequency tones and started to use a hearing aid at 9 years position. Individual II:1 was operated for cryptorchidism at 6 of age. All had normal cognitive function. weeks of age. All siblings had Achilles tendon contractures, but only individual II:1 had been operated with lengthening of At the time of genetic diagnosis in 2017, they all exhibited severe both Achilles tendons at the age of 9 years. They were facial weakness together with dysmorphic features (ﬁgure 1A–K hypermobile in most joints, including the elbows. All used and M, table). They showed slight bilateral ptosis, individual II:1 glasses, individual II:1 since 13 years of age due to hyperopia, had slight limitation of eye abduction, and individuals II:1 and II:

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 2 had a slight defect in elevation of the eyes. Individual II:3 had variants that were predicted to be damaging using SIFT (sorting abifid uvula and an exostosis in the midline of the palate. intolerant from tolerant algorithm), Mutation Taster, and PolyPhen2, analyzing whether the variants affected con- Standard protocol approvals, registrations, served amino acids and whether they are uncommon in and patient consents the population (using 1000 Genomes [1000genomes.org/], The study complied with the Declaration of Helsinki, and NHLBI Exome Sequencing Project [evs.gs.washington.edu/ informed consent was obtained from the patients. EVS/], and the Genome Aggregation Database [gnomAD] [gnomad.broadinstitute.org/]), to reduce the number of var- Morphological analysis iants. Sanger sequencing was used for confirmation and analysis Open skeletal muscle biopsies from the vastus lateralis of the of mutations identified in individuals I:2, II:1, and II:3. quadriceps muscle were performed. Specimens were snap-frozen in liquid propane chilled with liquid nitrogen for cryostat Results sectioning and histochemistry.7 Morphometric analyses of type 1 and type 2 muscle fibers were performed on adenosine Morphological analysis triphosphatase–stained sections (pH 9.4). Muscle biopsy at the ages of 4.4 years and 6.3 years in individual II:1 and at the ages of 11 months and 18 years in Molecular genetic analysis individual II:2 showed (on all occasions) marked hypertrophy Whole-genome sequencing was performed on genomic DNA of both type 1 and type 2 fibers (figure 2, A–C). The median from individual II:2 using the TruSeq PCR free library prepara- muscle fiber diameter was more than twice as large as in age- tionkit,andtheIlluminaHiSeqXplatformwasusedfor matched controls (figure 2D). A few internalized nuclei were sequencing (Illumina, San Diego, CA). The paired-end reads observed in individual II:2 at 18 years of age, and at that age, were aligned to the reference genome (hg19) using the CLC there were also some irregularities in the intermyofibrillar Biomedical Genomics workbench (Qiagen, Hilden, Germany). network as revealed by Nicotinamide adenine dinucleotide Data were analyzed using Ingenuity Variant Analysis (NADH)-tetrazolium reductase staining (figure 2, B–C). (ingenuity.com/products/variant-analysis) (Qiagen). We There was no increase in interstitial connective tissue, and no performed a search for compound heterozygous or homozygous necrotic or regenerating muscle fibers were observed.

Figure 2 Muscle histology and morphometric analysis demonstrating muscle fiber hypertrophy, occasional internalized nuclei and slight irregularity in the muscle fiber intermyofibrillar network

(A) Muscle fiber hypertrophy affecting both type 1 fibers (dark) and type 2 fibers (unstained) (adenosine triphosphatase, pH 4.3). (B) Muscle fiber hypertrophy and some internalized nuclei (hematoxylin and eosin). (C) Muscle fiber hypertrophy and patchy irregularities of the intermyofibrillar network (NADH-tetrazolium reductase). (D) Results from morphometric analysis. The lesser inner diameters (micrometers) of type 1 and type 2 fibers of 100 adjacent muscle fibers were measured in 4 different muscle biopsies from individuals II:1 and II:2 at different ages. Measurement of the lesser inner diameter avoids the risk of errors caused by oblique sections and was also used in the previously published measurements on controls that were used as references in this study.7 The results are given as medians, quartiles, and range. The median is at the border between the red and green boxes. The top of the green box is the 75th percentile of the sample, and the bottom of the red box is the 25th percentile. Normal mean diameters in age-matched controls are indicated with asterisks. Child controls included both males and females, and adult controls included females only. 1 = type 1 fibers; 2 = type 2 fibers.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Molecular genetic analysis (c.271C>A; p.(Pro91Thr)) associated with CFZS (figure Individuals II:1, II:2, and II:3 were all biallelic for 3, A–D).1 2 missense mutations in the MYMK gene (TMEM8C) (figure 3C). One was a missense mutation (c.235T>C; Other candidate genes associated with myopathies according p.(Trp79Arg)) not previously described. The second to the NMD Gene Table 2017 (musclegenetable.fr/) were mutation was a previously described missense mutation excluded.8 Sanger sequencing confirmed both mutations in all

Figure 3 Molecular genetics

(A) Illustration showing all the pathogenic mutations identified in myomaker (MYMK). The novel mutation c.235T>C (M1) and the previously described mutation c.271C>A (M2) identified in the 3 siblings in this study are indicated (NM_001080483.2). (B) The 2D structure of MYMK showing the location of mutations (illustration adapted from reference 1). The p.Trp79Arg (M1) is located in one of the transmembrane domains and changes the large, nonpolar tryptophan (Trp/W) residue at position 79 to the large, positively charged arginine (Arg/R) residue―thus creating a shift in polarity from nonpolar to positively charged. (C) Pedigree of the family. Filled squares and circles indicate individuals with Carey-Finman-Ziter syndrome. Asterisk indicates the individual analyzed by whole-genome sequencing. (D) Illustration showing the evolutionary conservation of amino acids, the p.Trp79Arg (M1) with a conservation phyloP p value of 5.834E−5. The blue bars in the upper part show the residues that were found to be mutated.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 3 siblings, and the mother was a heterozygous carrier of the postnatal day 7, suggesting that the lack of MYMK is in- mutation c.271C>A; p.(Pro91Thr). compatible with life.4 This suggests that the mutations identified in patients with CFZS in humans give rise to partially functioning MYMK protein, which has also been Discussion supported by functional studies.1 The p.(Pro91Thr) mutation has some residual function and is therefore compatible Here, we have described 3 siblings with CFZS due to with life in combination with null alleles.1 The individuals biallelic missense mutations in MYMK, adding to the re- described in this report carry the p.(Pro91Thr) mutation on cent description of 8 individuals with MYMK mutations.1 1 allele, and most likely, the combination with the mutation Our cases show the same clinical spectrum of muscle on the other allele, p.(Trp79Arg), leads to a severely reduced weakness, where profound facial muscle weakness is the function of the MYMK protein. clinical hallmark of the disease. Severe neck flexor weakness, short stature, small hands and feet, and hyperlaxity of Our study provides additional evidence for the association most joints in combination with distal contractures are between CFZS and MYMK mutation. The marked muscle additional clues to the correct diagnosis. Restrictive lung fiber hypertrophy despite the normal or reduced muscle bulk disease was described in the previous series of patients, and identified from early childhood indicates that defective fusion in 2 of our patients, a limitation in forced vital capacity was of myoblasts during embryonic muscle development results in found, but to date, none of them have shown any clinical reduced numbers of muscle fibers, with consequent hyper- symptoms of hypoventilation. One of our patients had trophy and muscle weakness. hearing impairment, which has also been described previously in CFZS.9 Author contributions C. Hedberg-Oldfors performed the genetic analysis, interpreted All siblings in this report were biallelic for MYMK missense the data, and drafted and revised the manuscript. C. Lindberg mutations: p.(Pro91Thr) and p.(Trp79Arg). The performed the clinical examinations, interpreted the data and p.(Pro91Thr) mutation has been identified in 4 of 5 ap- revised the manuscript. A. Oldfors performed the muscle pa- parently unrelated families already described.1 This mu- thology analysis and drafted and revised the manuscript. tation has also been identified in 328 of 276,516 alleles, but only in heterozygous individuals in the gnomAD database. Acknowledgment The second mutation, p.(Trp79Arg), was not present in The authors thank Brith Leidvik for technical assistance and gnomAD, is predicted by in silico programs to be delete- the patients for their support. rious, and alters a phylogenetically highly conserved residue. Study funding This study was supported by the Research Fund for Neuro- Our patients had had muscle hypotonia and weakness since muscular Disorders in West Sweden and by the Swedish early childhood and had been considered to have a congen- Research Council (project no. 2012-02014). ital myopathy. The 4 muscle biopsies performed in 2 of the individuals at various ages, with the earliest biopsy per- Disclosure formed at 11 months of age and the latest at 18 years, C. Hedberg-Oldfors reports no disclosures. C. Lindberg has revealed a remarkable hypertrophy of both type 1 and type 2 received research support from the following foundations: muscle fibers as the only important pathology at all time Sweden Muskelfonden and Neuroförbundet. A. Oldfors serves points. Results from 1 muscle biopsy in a previous report on the editorial board of Neuromuscular Disorders; receives demonstrated marked muscle fiber hypertrophy, but mainly publishing royalties from Elsevier publishing for “Muscle Biopsy: affectingthetype2fibers.1 This marked hypertrophy with- A Practical Approach”; and has received research funding from out any apparent increase in muscle bulk indicates a re- the Swedish Research Council and the World Muscle Society. duction in the number of muscle fibers to approximately one Full disclosure form information provided by the authors is quarter of normal in our patients. One may postulate that available with the full text of this article at Neurology.org/NG. muscle fiber hypertrophy, also seen in other neuromuscular fi diseases such as spinal muscular atrophy,10 compensates for Received January 20, 2018. Accepted in nal form May 7, 2018. the loss of functioning muscle fibers.Atpresent,themark- fi References edly reduced number of muscle bers seen in our CFZS 1. Di Gioia SA, Connors S, Matsunami N, et al. A defect in myoblast fusion underlies patients from early childhood onward remains unexplained. Carey-Fineman-Ziter syndrome. Nat Commun 2017;8:16077. 2. Gamage DG, Leikina E, Quinn ME, Ratinov A, Chernomordik LV, Millay DP. However, as MYMK is essential for the fusion of mono- Insights into the localization and function of myomaker during myoblast fusion. J Biol nuclear myoblasts to multinucleate myocytes during em- Chem 2017;292:17272–17289. 4,11 3. Goh Q, Millay DP. Requirement of myomaker-mediated stem cell fusion for skeletal bryonic muscle development, onemayspeculatethat muscle hypertrophy. Elife 2017;6:e20007. a reduced MYMK function due to mutations in MYMK may 4. Millay DP, O’Rourke JR, Sutherland LB, et al. Myomaker is a membrane activator of − − play a role. Newborn MYMK / mice have profound muscle myoblast fusion and muscle formation. Nature 2013;499:301–305. 5. Millay DP, Sutherland LB, Bassel-Duby R, Olson EN. Myomaker is essential for weakness, lack multinucleated muscle fibers, and die before muscle regeneration. Genes Dev 2014;28:1641–1646.

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG 6. Mitani Y, Vagnozzi RJ, Millay DP. In vivo myomaker-mediated heterologous fusion 9. Carey JC. The Carey-Fineman-Ziter syndrome: follow-up of the original siblings and and nuclear reprogramming. FASEB J 2017;31:400–411. comments on pathogenesis. Am J Med Genet A 2004;127A:294–297. 7. Dubowitz V, Sewry CA, Oldfors A. Muscle Biopsy: A Practical Approach. Philadelphia, PA: 10. Kingma DW, Feeback DL, Marks WA, Bobele GB, Leech RW, Brumback RA. Se- Elsevier; 2013:1–592. lective type II muscle ﬁber hypertrophy in severe infantile spinal muscular atrophy. 8. Kaplan JC, Hamroun D, Rivier F, Bonne G. The 2017 version of the J Child Neurol 1991;6:329–334. gene table of neuromuscular disorders. Neuromuscul Disord 2016;26: 11. Chen EH, Olson EN. Unveiling the mechanisms of cell-cell fusion. Science 2005;308: 895–929. 369–373.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 ARTICLE OPEN ACCESS Axon reﬂex–mediated vasodilation is reduced in proportion to disease severity in TTR-FAP

Ir`ene Calero-Romero, MD, Marc R. Suter, MD, Bernard Waeber, MD, Francois Feihl, MD,* Correspondence and Thierry Kuntzer, MD* Dr. Kuntzer [email protected] Neurol Genet 2018;4:e251. doi:10.1212/NXG.0000000000000251 Abstract Objective To evaluate the area of the vascular ﬂare in familial amyloid polyneuropathy (FAP).

Methods Healthy controls and patients with genetically confirmed FAP were prospectively examined, on the upper and lower limbs, for thermal sensitivity (Medoc TSA-II thermal analyzer) and for axon reflex-mediated flare. The latter was induced by iontophoresis of histamine on the forearm and leg on 2 different visits. We used laser Doppler imaging (LDI) to measure the flare area (LDIflare).

Results Six patients had FAP of variable severity; 1 had generalized analgesia secondary to leprosy (used as a positive control). The median Neurological Impairment Score–Lower Limbs (NIS-LLs) was6(0–27). The warmth detection thresholds in the feet were higher in patients (median 43°, interquartile range 39.0°–47.6°) compared with controls (37.4°, 35.3°–39.2°), indicating small fiber impairment. On the leg, LDIflare was smaller in the patients on 2 consecutive visits (controls: median 13.0 and 13.3 cm2, IQR 9.7–22.8 and 8.3–16.9; patients 6.9 and 8.0 cm2, 2.6–10.8 and 6.4–12.1; p = 0.011). LDIflare on the leg was correlated with NIS-LL (Spearman rank correlation 0.73, p = 0.09 on the first visit; Spearman rank correlation 0.85, p = 0.03 on the second visit).

Conclusions Our study underscores that histamine-induced axon reﬂex–mediated vascular ﬂare on the leg is reduced in proportion to disease severity in patients with FAP.

*Co-senior last authors.

From the Division of Clinical Pathophysiology (I.C.-R., B.W., F.F.), Department of Anaesthesiology, Pain Centre (M.R.S.), and Nerve-Muscle Unit, Neurology Service, Department of Clinical Neurosciences (T.K.), Lausanne University Hospital (CHUV), University of Lausanne, Switzerland.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary ATTR = amyloid transthyretin; AUC = area under the curve; FAP = familial amyloid polyneuropathy; LDI = laser Doppler imaging; NIS-LL = Neurological Impairment Score—Lower Limbs; NSS = Neurological Symptom Score; PND = polyneuropathy disability; QST = quantitative sensitivity testing; ROC = receiver operating characteristic; SkBF = skin blood ﬂow; TTR = transthyretin.

Familial amyloid polyneuropathies (FAPs) are a group of life- amyloid TTR (ATTR) mutation confirmed genetically. threatening multisystem disorders transmitted as an autoso- Patients with liver transplantation could be included. All mal dominant trait. Nerve lesions are induced by deposits of patients underwent systematic interview and examination by amyloid fibrils most commonly due to a transthyretin (TTR) the same neurologist (T.K.) and had a thorough laboratory gene mutation. The most frequently identified cause is the and imaging workup. Clinical symptoms were assessed by the TTR Val30Met mutation.1,2 TTR-FAP typically causes early Neurological Symptom Score (NSS) that includes motor, length-dependent small fiber polyneuropathy with alteration sensory, and autonomic items.8 The examination performed of temperature and pain sensations including neuropathic in a temperature-controlled room included testing muscle pain. This neurologic deficit typically points to involvement of strength, tendon reflexes, and sensory function testing in- unmyelinated and small myelinated fibers.2,3 Diagnosis of cluding light touch, pinprick, vibration, joint position sense, C-fiber impairment is challenging; however, the axon reflex and thermal sensation to calculate the Neurological Impair- can be assessed by objective approaches.4,5 The axon reflex is ment Score–Lower Limbs (NIS-LLs).9 ATTR patients were a physiologic phenomenon caused by the excitation of dermal classified according to the Clinical Staging of TTR-FAP, the C-fibers. Nerve impulses invade peripheral branches anti- PolyNeuropathy Disability (PND) score, and the Portuguese dromically causing vascular dilatation, the so-called axon re- severity classification of TTR-FAP.1 flex flare reaction.4 For a long time, this flare reaction was considered unreliable as a clinical tool, making thermotesting Investigation techniques the only recognized biomarker despite its subjectivity.1 The included patients underwent standard electrophysiologic However, recent studies using laser Doppler imaging (LDI) recordings of median, sural, and fibular nerve conduction on have demonstrated a correlation between the reduced flare both sides. Nerve conduction studies were considered ab- size in small fiber neuropathies6 and nerve fiber density in skin normal if either nerve conduction velocity or amplitude of the biopsies, which is also reduced.5,7 sensory nerve action potentials or compound motor action potentials were abnormal (normal values from our de- Our aims were to establish (1) whether the surface area of partment were used). neurogenic flare triggered by a standard stimulus could be reliably and reproducibly measured by LDI in healthy controls Quantitative sensitivity testing and patients with TTR-FAP, (2) whether this method could Thermotesting was performed in a temperature-controlled discriminate between the 2 groups of participants, and (3) room using a warm and cold perception threshold TSA-II whether the surface area of the flare in patients was reduced in NeuroSensory Analyzer (Medoc Advanced Medical Systems, proportion to TTR-FAP disease severity. Durham, NC). The established method of limits algorithm as reported from the German Research Network on Neuro- pathic Pain was also used.10 In short, a thermode of 9 cm2 was Methods attached to the skin over the dorsum of the hand and foot bilaterally, and temperature ramps of 1°C/s were applied Standard protocol approvals, registrations, starting from 32°C. Participants were asked to press a button and patient consents when they felt a cold or warm sensation. The investigator This project was approved by the Swiss Ethics Committee on memorized instructions so that she could present them in research involving humans. All participants provided written a uniform fashion to each participant. informed consent. Laser Doppler imaging Participants The spatial distribution of skin blood flow (SkBF) was Seven patients and 10 healthy controls were recruited pro- recorded with a LDI (software version 5.01; Moor Instru- spectively for this study between spring and fall 2015. All ments, Axminster, United Kingdom) using a scanning laser controls were examined to ascertain their good health status beam at a wavelength of 633 nm, as previously described.11,12 including absence of skin disorders. Histamine induced axon reflex Patients were recruited from our own registry based on 2 LDI was used to quantitate the flare response induced by the inclusion criteria: the presence of neuropathic symptoms iontophoresis of histamine (LDIflare). This response is neu- (small fiber with or without large fiber involvement) and an rologically mediated as it is blocked by surface anesthesia, as

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG previously shown,13 and verified by us in preliminary experi- limbs was randomized. The whole procedure including setup, ments in healthy controls (data not shown). acquisition of baseline, iontophoresis, acquisition of post- iontophoresis images required approximately 30 minutes, Methodological details making for a total visit duration of 4 hours. A 3.5 × 4.5 cm zone of skin devoid of visible superficial veins was chosen on the volar face of the forearm, or on the lateral For each participant, visit 1 protocol was repeated identically side of the calf, from which a baseline LDI scan was obtained. on visit 2, so as to assess the intraindividual variability. In A ring-shaped chamber made of rubber, with an internal di- particular, the recording zones were repositioned as exactly as ameter of 0.8 mm fitted with a copper electrode, was then possible at the same spot (made possible by the aforemen- fixed to the center of the zone (using double-sided tape) and tioned recording on transparent film), with intensity alloca- filled to the rim with 1% histamine in deionized water. A tion and rotation order identical to those of visit 1. reference ECG electrode was placed similarly, nearby. Both electrodes were connected to a current source (MIC-1e Data analysis iontophoresis controller; Moor Instruments). A direct current Histamine flare and local skin temperature data were evaluated of either 20 or 100 μA was applied for 60 seconds. As hista- statistically with mixed-model analysis of variance, using the mine in solution is negatively charged, the iontophoresis xtmixed procedure in Stata version 12 (Stata Corp LP). chamber was on the positive end of the controller. Once Responses obtained at the same iontophoretic current intensity current delivery was terminated, the chamber was removed, at symmetrical locations were considered as replicates, and data the skin dried, and the area directly exposed to the histamine from the upper and lower limbs were analyzed separately. Thus, solution was masked with a circular piece of opaque tape. Five the model comprised participant group (control or patient), consecutive LDI scans of the zone were then acquired at current intensity (20 or 100 μA), visit number (1 or 2), and all a frequency of one every 2 minutes. For each of them, the 2- and 3-way interactions. In a second step, interactions with spatial extension of SkBF increase (flare area) was de- p values > 0.1 were removed. The p values reported in the termined. The maximal flare area expressed in cm2 was con- results are from this more parsimonious model. sidered as quantification of the axon reflex within the probed skin zone. Each recorded image consisted of approximately The same general method was used to evaluate each of the 4 20,000 pixels, each with an attached flux value. Within the outcome measures generated by QST testing (detection and post-iontophoresis scans, any pixel whose value exceeded pain thresholds for warm and cold stimulations). In this case, a specific threshold was considered part of the flare area. The the model was simpler because there was only 1 visit and that chosen threshold was the 99th percentile of all pixel values in stimulus intensity was not a factor. the baseline image. The relationship between histamine flare and clinical severity Because of its potential confounding effect, surface tempera- score (NIS-LL) was assessed with Spearman rank correlation ture within the chosen skin zone was systematically recorded coefficient. Finally, we compared the ability of histamine flare with a thermocouple in the minute before iontophoresis. and QST data to discriminate between groups, using receiver Heat-conducting paste was used to ensure proper thermal operating characteristic (ROC) curve analysis. Logistic re- contact between the skin and the thermocouple. gression was performed with group membership as the outcome variable and either histamine flare at a specific intensity Protocol or specific QST responses as predictors (procedure logistic, Each participant was examined during 3 successive visits followed by the lroc command in Stata). The area under the separated by at least 3 days. Visits 1 and 2 were for recording ROC curve (AUC) was calculated. The AUC can range from fl the histamine are at various locations, whereas quantitative 0.5 to 1, with the former value indicating no, and the latter, sensitivity testing (QST) was performed on visit 3. The same perfect discriminating ability. investigator (the first author, I.C.-R.) performed all examinations between 8 and 12 AM, in a quiet temperature- controlled room (22°C–24°C), with the participant lying Results comfortably on a hospital bed. We recruited 6 patients, all women, with FAP of variable On visit 1, 4 pairs of skin zones were chosen, 1 on each forearm severity (table 1). All had a confirmed mutation in the TTR and 1 on each calf. Zones within each pair were at least 10 cm gene: Val30Met in 5 cases and Glu89Lys in one. As a positive apart and were both allocated to receive histamine iontopho- control (table 1), we included a seventh male patient with resis, with a current intensity of 20 μAon1zoneand100μAon generalized analgesia secondary to lepromatous leprosy. His the other. On the upper and lower limbs, treated zones at both individual data indicated below is excluded from all statistical intensities were placed as symmetrically as possible and their calculations (see Patients’ characteristics). By “patient group” location recorded on transparent film. A total of 8 histamine (or “patients”), we therefore mean only the 6 patients with flares were thus recorded: 2 intensities on each of the 4 limbs. FAP. Of the 10 healthy controls, 5 were women and the The order of rotation between limbs and for intensities on remaining were men. Their median age was 50 years (range

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 20–64). For comparison, the median age of the 6 FAP patients was also 50 years (range 37–58).

Patients’ characteristics — Portuguese classification All underwent extensive blood workup and imaging studies and excluded metabolic, immunologic, or infectious causes of small ﬁber neuropathy, in particular, diabetes, neurodegen- 3 PND score erative diseases, and paraneoplastic syndromes.

Table 1 contains a detailed description of our patients. — FAP staging Patients were overweight with a median body mass index of 29.4 kg/m2 (range 28.5–31.9) corresponding to the range of the controls (mean 29.8 kg/m2: 27.5–31.7). The median duration of FAP was 12 years. Echocardiography was abnormal in P04 and P06 only. Nerve conduction studies revealed carpal tunnel syndrome in 4 patients (P01, P02, P04, and P06) and reduced or absent sural/fibular nerve potentials in 3 (P01, P03, and P04). Four patients had undergone liver transplantation. Among them, the patient with the GLu89Lys mutation (P04) also had a heart transplant, as published previously.14 Clinical manifestations were scored according to NSS, a well-disseminated score used to quantify symptoms in patients with neuropathies of various causes, and all had neuropathic symptoms; neurologic examination was quanti- Lower Limbs; NSS = Neurological Symptom Score (sensory manifestations include neuropathic – fied using scores dedicated to patients with FAP (the so-called NIS-LL). These scores were correlated with clinical FAP severity and with signs of large nerve fiber neuropathy on examination. As it can be deduced from NSS and NIS-LL data, patients P02, P05, and P06 were mildly affected having only a small nerve fiber neuropathy. Patients P01, P03, and P04 had the highest NSS and NIS-LL scores and were the most affected having concomitant small and large nerve fiber neuropathy. These 3 patients had abnormal sensory nerve action potentials. Concerning the clinical staging of the disease, all 6 patients were at stage I of the Clinical Staging of TTR-FAP,

NSS NIS-LL a stage used to start therapeutic options in the clinical setting. Patients were heterogeneously distributed according to the PND score (median 1 of 4) or to the Portuguese severity classiﬁcation of TTR-FAP (median 2 of 6). The patient with TTR mutation leprosy was the most severely aﬀected.

Thermotesting Sural/ Fibular Total Motor Sensory Autonomic Total Weakness Reflexes Sensation Thermotesting results from the hands and feet in the 2 groups are shown in table 2. Patients differed statistically from con- Nerve conduction CTS trols on the hands and on the feet, with respect to detection threshold for both warm and cold. Differences were more marked on the feet, however, indicating length-dependent small fiber impairment in the patients.

Histamine flare Figure 1 shows the area of the ﬂare induced by the 2 ionto- PNP duration (age of transplant) phoretic doses of histamine, measured by LDI on the forearms and legs on visits 1 and 2, for each study participant. Regarding 37 1050 (31) 1051 1455 (40) 937 (49) Yes 1458 (26) AbN 1553 Yes No Val30Met 5 N AbN 4 Yes AbN No Val30Met Val30Met 0 N 5 2 Glu89Lys Yes 2 4 N 2 0 Val30Met Yes AbN 2 0 2 2 Val30Met 2 Leprosy 0 4 2 10 1 0 0 2 6 3 2 4 0 0 12 2 5 6 2 0 0 0 2 0 0 4 0 6 0 12 27 2 0 6 8 2 0 1 4 8 1 1 3 0 1 1 4 2 2 1 16 1 1 3 1 1 0 2 2 1 2

Individual patient characteristics statistical analysis, the only interaction terms that came out marginally significant when fitting the full model was between the group and the iontophoretic dose (p =0.07,belowthe fi pain); PND = polyneuropathy disability; PNP = polyneuropathy; TTR = transthyretin. Abbreviations: CTS = carpal tunnel syndrome; FAP = familial amyloid polyneuropathy; NIS-LL = Neurological Impairment Score P01 P02 P03 P04 P05 P06 Positive control Table 1 Patients Age prede ned level of 0.1, see Methods). Therefore, the statistical

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG not diﬀer, at either dose, between the 2 groups (p = 0.30). By Table 2 Results of QST in the control and patient groups contrast, on the leg, this response was less intense in patients, at

Controls Patients least for the higher dose of histamine, on both visit 1 (controls: p median 13.0 cm2, interquartile range [IQR] 9.7–22.8; patients: Median IQR Median IQR Value median 6.9 cm2, IQR 2.6–10.8; p = 0.011 vs controls) and visit Hand 2 (controls: median 13.3 cm2, IQR 8.3–16.9; patients: median 2 – Detection, 34.4 33.4–36.1 36.1 35.1–40.5 0.053 8.0 cm , IQR 6.4 12.1; p =0.011). warm

Detection, 31.2 30.2–31.3 30.4 28.8–30.7 0.025 The measurements of local skin temperature (T_skin) per- cold formed before each iontophoresis are detailed in table e-1 (links.lww.com/NXG/A61). On average, T_skin appeared Pain, warm 44.9 42.9–47.7 43.5 40.1–48.2 ns slightly but significantly lower in patients compared with Pain, cold 14.2 7.5–20.2 8.6 3.2–10.5 ns controls. Statistical analysis was repeated while adding this Foot possible confounder to the model with essentially identical results: the dose-response effect remained (p < 0.001); the Detection, 37.4 35.3–39.2 43.0 39.0–47.6 0.003 ff fl warm di erence in the are area between patients and controls was still significant on the leg at a current dose of 100 μA(p = Detection, 28.5 27.3–29.8 26.3 4.0–28.3 0.040 cold 0.019), but not on the forearm at either dose (p = 0.47).

– – Pain, warm 45.7 44.6 46.6 48.6 46.5 50.0 ns In patients, the area of histamine flare on the leg was inversely Pain, cold 7.7 2.7–21.9 2.1 0.0–8.8 ns correlated with the clinical status, as shown in figure 2. P01, P03, and P04 were the most affected patients, having con- Abbreviations: IQR = interquartile range; QST = quantitative sensitivity fi testing. comitant small and large nerve ber neuropathy and abnormal Measurements made on the left and right sides were considered as repli- sensory nerve action potentials. This correlation held up cates: averaged at the individual level and then summarized for the 2 groups fl as indicated. All values are absolute temperature in °C. whether values for the histamine are area were taken from p Values refer to the comparison of patients with controls. visit 1 (Spearman R2 0.73, p = 0.09) or visit 2 (R2 0.85, p = 0.03). Indeed, flare areas on both visits were nearly identical in 4 of the 6 patients, although further apart in the other 2. results reported here are from a model comprising simple main effects and this specific interaction. The dose-response effect The intraindividual variation in the histamine flare area from was clearly visible and statistically highly significant on both visit 1 to visit 2 is shown more completely in figure 3 (which visits (p < 0.001). On the forearm, the histamine flare area did for the sake of brevity only displays data obtained from the

Figure 1 Histamine flare in patients and controls

Measurements made on the left and right sides of the same person were considered replicates, averaged and plotted as shown, for each study participant. The box plots indicate the median, interquartile range, and extreme values. *p < 0.05 patients vs controls. **p < 0.01 iontophoretic dose of 100 vs 20 μA. The red line corresponds to the positive control patient (table 1).

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 Figure 2 Relationship between Neurologic Severity Score and the area of histamine flare on the leg

R2: Spearman rank correlation coefficient. Data points labeled according to the patient ID (table 1). NIS-LL = Neurological Impairment Score–Lower Limbs; PC = positive control.

highest iontophoretic current dose) in the form of Bland and findings from a prospective study comparing LDIflare in Altman plots. These plots reveal negligible bias (none of patients with FAP and controls. Our results indicate that axon which reached statistical significance), but relatively wide reflex-mediated neurogenic cutaneous vasodilation in re- limits of agreement. sponse to histamine measured by LDI (1) is easily elicited in both groups of participants, (2) is only moderately re- As evaluated from ROC curve analysis (figure 4), the ability of producible at the intraindividual level, (3) despite this latter histamine flare to discriminate between patients and controls limitation appears clearly reduced in patients according to was similar on visit 1 (AUC 0.81) and visit 2 (0.77). Fur- a length-dependent pattern, and (4) shows an ability similar thermore, the performances of histamine flare and QST to QST testing for discriminating between patients and testing were comparable (AUC for QST testing, 0.78). controls.

The reproducibility of our results was assessed by intra- Discussion individual variation in the histamine flare area from visit 1 to visit 2 (figure 3), revealing negligible bias with no statistical Based on our previous experience in quantifying spatial dis- significance, but relatively wide limits of agreement. This re- tribution of SkBF with LDI,12,15,16 we present here the sult is in accordance with what is already known in LDIflare studies.17,18

Figure 3 Bland and Altman plots of histamine flare areas on We showed a length-dependent pattern in our patients with the leg, recorded on visits 1 and 2 FAP: the histamine ﬂare response on the leg was less intense in patients than in controls, at least for the higher dose of histamine, whereas it did not diﬀer, at either dose, between the 2 groups on the forearm. This result is consistent with QST testing: in patients, the detection thresholds for cold and warm were clearly more abnormal in the feet compared with the hands (table 2). This is in line with observations reported by others in patients with FAP despite the subjectivity of QST testing.1

Among the tests for small fiber function,3 QST is considered a gold standard tool.1,19 In terms of ability to discriminate between patients and healthy controls, LDIflare has been variously reported as inferior to QST in diabetic neuropa- thies20 or equivalent in neuropathies of mixed etiologies.21 In Data from flares induced with the 100 μA iontophoretic current on the leg. keeping with this latter study, ROC curve analysis in our case Full horizontal lines: average difference across participants (bias). Dashed showed a similar performance of histamine flare and QST lines: limits of agreement. Numerical values for bias and limits of agreement shown on each plot, expressed in cm2. (figure 4). The discrepancy between studies could reflect methodological differences. Alternatively, it may be related to

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Figure 4 Discrimination of control and patient groups with histamine flare compared with quantitative sensitivity testing (QST)

Receiver operating characteristic (ROC) curves derived from logistic regression analysis, with group membership as the dependent variable. Predictors in the model were those on which the groups differed statistically, i.e., histamine flare area on the legs at a current intensity of 100 μA (figure 2) or detection threshold for warm and cold on the hands and feet (table 2). different sample sizes and case mix. Our patients had pe- epidemiologic surveys and therapeutic trials, even at an early ripheral neuropathies of homogeneous etiology. However, disease stage. their small number precludes any meaningful calculation of cutoff points for estimating the respective sensitivities and Author contributions specificities of LDIflare and QST. A larger study is required to I. Calero-Romero: acquisition of data, analysis or interpretation that effect, keeping in mind that the ultimate clinical useful- of data, and revision of the manuscript. M. R. Suter: analysis of ness of these tests would depend on their negative/positive data and revision of the manuscript. B. Waeber: revision of the predictive values. The latter, in addition to specificity and manuscript and study supervision. F. Feihl: study concept and sensitivity, are in turn determined by the prevalence of the design, acquisition of data, study supervision, analysis and in- condition under investigation. terpretation of data, statistical analysis, and drafting and revision of the manuscript. T. Kuntzer: study concept or design, An important result of our study is the correlation between acquisition of data, study supervision, analysis and in- the LDIflare area and NIS-LL, a score recently found to be terpretation of data, and drafting and revision of the a valid and reliable measure of TTR-FAP severity.17 This manuscript. a new correlation being up to now only demonstrated by nerve biomarkers obtained from skin biopsies.22 This is valid Acknowledgment for our patients independently of clinical small or large nerve The authors are grateful to all patients, relatives, and other fiber involvement or absent/reduced sensory nerve action controls for accepting to participate in the study. They thank potentials on nerve conduction studies. Dr. Melanie Price and Dr. Pinelopi Tsouni for critical reading of the manuscript. The current study has limitations. Considering FAP heterogeneity,1 our small patient sample may not be representative. Study funding However, our data provide a rationale for the use of reflex- No targeted funding reported. mediated neurogenic cutaneous vasodilatation in response to histamine in a larger scale. This reflex measured by LDI is an Disclosure objective and quantitative measure that can potentially serve I. Calero-Romero reports no disclosures. M.R. Suter has as a useful biomarker, assessing TTR-FAP severity in served on the scientific advisory boards of Indivior and Pfizer;

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 serves on the editorial board of Revue Médicale Suisse; and has 8. Dyck PJ, Hughes RAC, O’Brien PC. Quantitating overall neuropathic symptoms, fi impairments, and outcomes. In: Peripheral Neuropathy, 4th ed: Elsevier; 2005: received research support from P zer, IASP, and the Euro- 1031–1051. pean Society of Anaesthesiology. B. Waeber and F. Feihl re- 9. Bril V. NIS-LL: the primary measurement scale for clinical trial endpoints in diabetic fi peripheral neuropathy. Eur Neurol 1999;41(suppl 1):8–13. port no disclosures. T. Kuntzer has served on the scienti c 10. Magerl W, Krumova EK, Baron R, Tolle T, Treede RD, Maier C. Reference data for advisory board of the French Peripheral Society and has re- quantitative sensory testing (QST): refined stratification for age and a novel method ceived funding for travel/speaker honoraria from CSL Behr- for statistical comparison of group data. Pain 2010;151:598–605. 11. Golay S, Haeberli C, Delachaux A, et al. Local heating of human skin causes hyperemia ing. Full disclosure form information provided by the authors without mediation by muscarinic cholinergic receptors or prostanoids. J Appl Physiol is available with the full text of this article at Neurology. 2004;97:1781–1786. 12. Frantz J, Engelberger RP, Liaudet L, Mazzolai L, Waeber B, Feihl F. Desensitization of org/NG. thermal hyperemia in the skin is reproducible. Microcirculation 2012;19:78–85. 13. Harper EI, Beck JS, Spence VA. Effect of topically applied local anaesthesia on his- fl Received December 29, 2017. Accepted in final form May 15, 2018. tamine are in man measured by laser doppler velocimetry. Agents Actions 1989;28: 192–197. 14. Niederhauser J, Lobrinus JA, Ochsner F, et al. Successful heart and liver trans- References plantation in a Swiss patient with Glu89Lys transthyretin amyloidosis. Trans- 1. Ando Y, Coelho T, Berk JL, et al. Guideline of transthyretin-related hereditary am- plantation 2011;91:e40–e42. yloidosis for clinicians. Orphanet J Rare Dis 2013;8:31. 15. Engelberger RP, Pittet YK, Henry H, et al. Acute endotoxemia inhibits microvascular 2. Plante-Bordeneuve V, Said G. Familial amyloid polyneuropathy. Lancet Neurol 2011; nitric oxide-dependent vasodilation in humans. Shock 2011;35:28–34. 10:1086–1097. 16. Ciplak M, Pasche A, Heim A, et al. The vasodilatory response of skin microcirculation 3. Hoeijmakers JG, Faber CG, Lauria G, Merkies IS, Waxman SG. Small-fibre to local heating is subject to desensitization. Microcirculation 2009;16:265–275. neuropathies–advances in diagnosis, pathophysiology and management. Nat Rev 17. Vas PR, Rayman G. The rate of decline in small fibre function assessed using axon Neurol 2012;8:369–379. reflex-mediated neurogenic vasodilatation and the importance of age related centile 4. Chiu IM, von Hehn CA, Woolf CJ. Neurogenic inflammation and the peripheral values to improve the detection of clinical neuropathy. PLoS One 2013;8:e69920. nervous system in host defense and immunopathology. Nat Neurosci 2012;15: 18. Green AQ, Krishnan ST, Rayman G. C-fiber function assessed by the laser doppler 1063–1067. imager flare technique and acetylcholine iontophoresis. Muscle Nerve 2009;40:985–991. 5. Bickel A, Heyer G, Senger C, et al. C-fiber axon reflex flare size correlates with 19. Devigili G, Tugnoli V, Penza P, et al. The diagnostic criteria for small fibre neurop- epidermal nerve fiber density in human skin biopsies. J Peripher Nerv Syst 2009;14: athy: from symptoms to neuropathology. Brain 2008;131:1912–1925. 294–299. 20. Gibbons CH, Freeman R, Veves A. Diabetic neuropathy: a cross-sectional study of the 6. Kubasch ML, Kubasch AS, Torres Pacheco J, et al. Laser doppler assessment of relationships among tests of neurophysiology. Diabetes Care 2010;33:2629–2634. vasomotor axon reflex responsiveness to evaluate neurovascular function. Front 21. Abraham A, Alabdali M, Alsulaiman A, et al. Laser doppler flare imaging and quan- Neurol 2017;8:370. titative thermal thresholds testing performance in small and mixed fiber neuropathies. 7. Namer B, Pfeffer S, Handwerker HO, Schmelz M, Bickel A. Axon reflex flare and PLoS One 2016;11:e0165731. quantitative sudomotor axon reflex contribute in the diagnosis of small fiber neu- 22. Ebenezer GJ, Liu Y, Judge DP, et al. Cutaneous nerve biomarkers in transthyretin ropathy. Muscle Nerve 2013;47:357–363. familial amyloid polyneuropathy. Ann Neurol 2017;82:44–56.

8 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG ARTICLE OPEN ACCESS Association study between multiple system atrophy and TREM2 p.R47H

Kotaro Ogaki, MD, PhD, Michael G. Heckman, MS, Shunsuke Koga, MD, PhD, Yuka A. Martens, PhD, Correspondence Catherine Labb´e, PhD, Oswaldo Lorenzo-Betancor, MD, PhD, Ronald L. Walton, BSc, Alexandra I. Soto, BSc, Dr. Ross [email protected] Emily R. Vargas, MPH, Shinsuke Fujioka, MD, Ryan J. Uitti, MD, Jay A. van Gerpen, MD, William P. Cheshire, MD, Steven G. Younkin, MD, PhD, Zbigniew K. Wszolek, MD, Phillip A. Low, MD, Wolfgang Singer, MD, Guojun Bu, PhD, Dennis W. Dickson, MD, and Owen A. Ross, PhD

Neurol Genet 2018;4:e257. doi:10.1212/NXG.0000000000000257 Abstract Objective The triggering receptor expressed on myeloid cells 2 (TREM2) p.R47H substitution (rs75932628) is a risk factor for Alzheimer disease (AD) but has not been well studied in relation to the risk of multiple system atrophy (MSA); the aim of this study was to evaluate the association between the TREM2 p.R47H variant and the risk of MSA.

Methods A total of 168 patients with pathologically confirmed MSA, 89 patients with clinically diagnosed MSA, and 1,695 controls were included. TREM2 p.R47H was genotyped and assessed for association with MSA. Positive results in the Taqman genotyping assay were confirmed by Sanger sequencing. The primary comparison involved patients with pathologically confirmed MSA and controls due to the definitive MSA diagnosis in the pathologically confirmed series.

Results We identified TREM2 p.R47H in 3 patients with pathologically confirmed MSA (1.79%), 1 patient with clinically diagnosed MSA (1.12%), and 7 controls (0.41%). Minimal AD pathology was observed for the pathologically confirmed MSA p.R47H carriers. For the primary comparison of patients with pathologically confirmed MSA and controls, risk of disease was significantly higher for p.R47H carriers (odds ratio [OR]: 4.39, p = 0.033). When supplementing the 168 pathologically confirmed patients with the 89 clinically diagnosed and examining the combined MSA series, the association with TREM2 p.R47H remained significant (OR: 3.81, p = 0.034).

Conclusions Our preliminary results suggest that the TREM2 p.R47H substitution may be a risk factor for MSA, implying a link to neuroinflammatory processes, especially microglial activation. Vali- dation of this finding will be important, given our relatively small sample size; meta-analytic approaches will be needed to better define the role of this variant in MSA.

From the Department of Neuroscience (K.O., S.K., Y.A.M, C.L., O.L.-B., R.L.W., A.I.S., S.F., S.G.Y., G.B., D.W.D., O.A.R.), Mayo Clinic, Jacksonville, FL; Department of Neurology (K.O.), Juntendo University Shizuoka Hospital, Izunokunishi, Shizuoka, Japan; Division of Biomedical Statistics and Informatics (M.G.H., E.R.V), Mayo Clinic, Jacksonville, FL; Department of Neurology (R.J.U., J.A.v.G., W.P.C., Z.K.W.), Mayo Clinic, Jacksonville, FL; Department of Neurology (P.A.L., W.S.), Mayo Clinic, Rochester, MN; Mayo Graduate School (O.A.R.), Neurobiology of Disease, Jacksonville, FL; and Department of Clinical Genomics (O.A.R.), Jacksonville, FL.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary AD = Alzheimer disease; FTD = frontotemporal dementia; MSA = multiple system atrophy; MSA-C = MSA with predominant olivopontocerebellar involvement; MSA-P = MSA with predominant striatonigral involvement; OR = odds ratio; PD = Parkinson disease; TREM2 = triggering receptor expressed on myeloid cells 2.

Multiple system atrophy (MSA) is a rare, rapidly progressing, olivopontocerebellar systems (MSA-mixed).5 One case was adult-onset neurodegenerative disease that is clinically charac- not assigned pathologic subtype because only the pons was terized by parkinsonism, autonomic failure, pyramidal symp- available for histology. toms, and cerebellar ataxia and pathologically defined by the presence of α-synuclein-positive glial cytoplasmic inclusions.1 The clinically diagnosed patients (N = 81 probable MSA, N = 8 Uncovering genetic risk factors for MSA has proven difficult possible MSA) were seen at the Mayo Clinic in Rochester, MN because of the challenge of accumulating a reasonable sample (N = 35), or Jacksonville, FL (N = 54), where diagnosis was size and potential for clinical misdiagnosis. Nonetheless, studies made according to the criteria of Gilman et al.6 Clinically di- have nominated several genes that may be associated with the agnosed MSA cases were free of notable cognitive symptoms risk of MSA.1,2 The first genome-wide association study of MSA that might suggest the presence of an overlapping dementia or was recently completed, and although no genome-wide signifi- other neurodegenerative conditions. Pathologic assessment cant associations were identified, suggestive associations were and clinical diagnoses were made without the knowledge of the identified involving variants in MAPT, FBXO47, ELOVL7,and TREM2 p.R47H genotype. Controls were also from the Mayo EDN1.3 Clearly, much remains to be understood regarding the Clinic in Rochester, MN (N = 991), or Jacksonville, FL (N = genetics of MSA, and replication of previously nominated MSA 704). Controls were free of neurologic symptoms and without susceptibility loci remains crucial. a family history of movement disorders. All participants were unrelated non-Hispanic Caucasians. The primary comparison A relatively rare substitution p.R47H (rs75932628) in the of TREM2 p.R47H involved the patients with pathologically triggering receptor expressed on myeloid cells 2 (TREM2) confirmed MSA and controls. In secondary analysis, we com- protein is now a well-established risk factor for Alzheimer bined the patients with pathologically confirmed MSA and disease (AD) and has been suggested to play a role in other patients with clinically diagnosed MSA and compared this neurodegenerative disorders such as frontotemporal de- combined MSA series with the controls. Table 1 shows char- mentia (FTD) and Parkinson disease (PD).4 Of interest, acteristics of patients with MSA and controls. mutations in the TREM2 gene were originally reported as a genetic cause of Nasu-Hakola disease, a rare leukodystrophy Standard protocol approvals, registrations, characterized by progressive presenile dementia and bone and patient consents cysts.4 Given the important role of microglia in neuro- The Mayo Clinic IRB approved the use of human participants inflammation, we evaluated the association between the in this study. TREM2 p.R47H variant and the risk of MSA using a predominantly neuropathologically confirmed MSA series. Genetic analysis Genomic DNA was extracted from brain tissue or peripheral blood monocytes using standard protocols. Genotyping of Methods TREM2 exon 2 variant rs75932628 (NM_018965.3: c.140G>A, p.R47H) was performed using a custom TaqMan Study participants Allelic Discrimination Assay on an ABI 7900HT Fast Real- This study included 168 patients with pathologically con- Time PCR system (Applied Bio-systems, Foster City, CA) firmed MSA, 89 patients with clinically diagnosed MSA, and according to the manufacturer’s instructions (sequences 1,695 healthy controls. The pathologically confirmed MSA available upon request). Genotype calls were made using SDS series consisted of all cases obtained from the Mayo Clinic 2.2.2 software. Positive or ambiguous results in the TaqMan brain bank for neurodegenerative disorders in Jacksonville, assay were also confirmed and resolved via Sanger sequencing. FL, between 1998 and 2017. Pathologically confirmed MSA There was no evidence of a departure from Hardy-Weinberg was diagnosed by a single neuropathologist (D.W.D.) as equilibrium in controls (p = 0.93). previously described.5 Immunohistochemistry for α-synuclein (NACP, 1:3,000 rabbit polyclonal) was performed on sec- Statistical analysis tions of the basal forebrain, striatum, midbrain, pons, medulla, We evaluated the association between TREM2 p.R47H and and cerebellum to establish a neuropathologic diagnosis. MSA MSA using logistic regression models. Unadjusted models were cases were pathologically subclassified as MSA with pre- first examined. Subsequently, although it is uncertain whether dominant striatonigral involvement (MSA-P), MSA with adjusting for any variable is reasonable, given the rare nature of predominant olivopontocerebellar involvement (MSA-C), this variant, we did also adjust our logistic regression models for and MSA with equally severe involvement of striatonigral and age and sex in a sensitivity analysis. Odds ratios (ORs) and 95%

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Results Table 1 Characteristics of patients with MSA and controls An evaluation of the association between TREM2 p.R47H and Patients with MSA is shown in table 2. The p.R47H variant was observed in 3 Patients with clinically patients with pathologically confirmed MSA (1.79%). Of these 3 pathologically diagnosed confirmed MSA Controls p.R47H carriers, neuropathologic examination was available for Variable MSA (N = 168) (N = 89) (N = 1,695) 2 and revealed MSA subtypes of MSA-P and MSA-C, Braak fi Age at onset in patients 58 (39, 88) 64 (46, 83) 76 (30, 88) neuro brillary tangle stages of I and III, and Thal amyloid phases with MSA or age at of 0 and 0. For the 89 patients with clinically diagnosed MSA, blood draw in controls (y) there was 1 p.R47H carrier (1.12%, from Mayo Jacksonville), and this patient’sMSAsubtypewasprobableMSA-P.There Age at death (y) 66 (47, 91) NA NA were 7 carriers of p.R47H in the controls (0.41%, N = 4 Mayo Sex Jacksonville, N = 3 Mayo Rochester), corresponding to a minor allele frequency of 0.21%, which is similar to the frequency Male 96 (57.1%) 53 (59.6%) 786 (46.4%) reported in the ExAC database (Cambridge, MA [exac.broadinstitute.org]) for this population (0.26%).7 For the primary Female 72 (42.9%) 36 (40.4%) 909 fi (53.6%) comparison of patients with pathologically con rmed MSA and controls, risk of MSA was significantly higher for p.R47H carriers MSA subtype (OR = 4.39, p = 0.033). When combining the pathologically MSA-P 73 (43.5%) 62 (69.7%) NA confirmed and clinically diagnosed MSA series, the risk of MSA fi MSA-C 27 (16.1%) 26 (29.2%) NA (vs controls) was also signi cantly higher (OR = 3.81, p = 0.034). In a sensitivity analysis adjusting for age and sex, the a Mixed 67 (39.9%) 1 (1.1%) NA findings regarding the patients with pathologically confirmed Unclassifiedb 1 (0.6%) 0 (0.0%) NA MSA (OR = 3.55, p = 0.076) and the combined MSA series (OR = 3.17, p = 0.078) remained relatively consistent though weak- Braak NFT stage ened slightly and were no longer quite significant. 0 29 (17.8%) NA NA

I 61 (37.4%) NA NA

II 49 (30.1%) NA NA Discussion III 16 (9.8%) NA NA TREM2 p.R47H is a well-established risk factor for AD4;how- 4 IV 5 (3.1%) NA NA ever, results have been mixed for FTD and PD, while studies involving amyotrophic lateral sclerosis and dementia with Lewy V 2 (1.2%) NA NA bodies mostly point to a lack of association.4 Of interest, the VI 1 (0.6%) NA NA results of our current study suggest that the TREM2 p.R47H

Thal amyloid phase variant may be associated with an increased risk of MSA. With a notably higher frequency in our combined MSA series (1.6%) 0 88 (55.7%) NA NA compared with controls (0.4%), we observed a nearly 4-fold 1 33 (20.9%) NA NA increased risk of MSA in p.R47H carriers. It is important that this finding was strongest in our pathologically confirmed MSA se- 2 18 (11.4%) NA NA ries. The absence of notable AD pathology in pathologically 3 9 (5.7%) NA NA confirmed MSA p.R47H carriers indicates that the observed

4 8 (5.1%) NA NA association was not driven by such pathology. The association was attenuated slightly when adjusting for age and sex; however, 5 2 (1.3%) NA NA those results should not be overinterpreted because it is un-

Abbreviations: MSA = multiple system atrophy; MSA-C = MSA with pre- certain whether attempting any adjustment is reasonable, given dominant olivopontocerebellar involvement; MSA-P = MSA with predominant the low frequency of p.R47H. These preliminary findings suggest striatonigral involvement; NA = not applicable. The sample median (minimum, maximum) is given for age. Information was that TREM2 p.R47H may play a role in susceptibility to MSA unavailable regarding age at onset (N = 49), Braak NFT stage (N = 5), and Thal and that further study is warranted. amyloid phase (N = 10) for the patients with pathologically confirmed MSA. a MSA with equally severe involvement of striatonigral and olivopontocerebellar systems was classified as MSA-mixed.5 b One patient with MSA was considered to be “unclassified” because only the To the best of our knowledge, only 1 association study be- pons was available for histologic assessment; therefore, we could not di- tween TREM2 p.R47H and MSA has been conducted to date. agnose this patient as MSA-C or MSA-mixed. In a study of 407 Chinese patients with clinically diagnosed MSA and 869 controls, the p.R47H substitution was observed confidence intervals were estimated. p ≤ 0.05 was considered in 1 MSA patient and no controls (p = 0.14).8 This negative statistically significant. All statistical analyses were performed result is not surprising because TREM2 p.R47H is extremely using SAS (version 9.4; SAS Institute, Inc., Cary, NC). rare in East Asians.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 Table 2 Association between TREM2 p.R47H and MSA

Unadjusted analysis Adjusting for age and sex No. (%) with TREM2 Disease group N p.R47H OR (95% CI) p Value OR (95% CI) p Value

Controls 1,695 7 (0.41) 1.00 (reference) NA 1.00 (reference) NA

Patients with 168 3 (1.79) 4.39 (1.12–17.12) 0.033 3.55 (0.88–14.38) 0.076 pathologically confirmed MSA

All patients with 257 4 (1.56) 3.81 (1.11–13.12) 0.034 3.17 (0.88–11.45) 0.078 MSA (pathologically confirmed and clinically diagnosed)

Abbreviations: CI = confidence interval; MSA = multiple system atrophy; NA = not applicable; OR = odds ratio; TREM2 = triggering receptor expressed on myeloid cells. ORs, 95% CIs, and p values result from logistic regression models. For age, the age that was adjusted for was age at death for patients with pathologically confirmed MSA, age at MSA onset for patients with clinically diagnosed MSA, and age at blood draw for controls.

How the TREM2 p.R47H variant could increase risk of MSA the manuscript and providing material for this study. G. Bu: is an important topic for further study. MSA is regarded as an revising the manuscript. D.W. Dickson: drafting/revising oligodendrogliopathy, but the mechanism of demyelination the manuscript, providing material and funding for this study, remains unclear. While demyelination depends primarily on and IRB committee approval. O.A. Ross: drafting/revising the oligodendrocytes, microglia also contribute to myelination manuscript; study concept and design; and interpretation and myelin homeostasis.9 In the CNS, TREM2 is pre- of data. dominantly expressed in microglia, and it has been shown to play critical roles in phagocytic clearance of apoptotic cells Acknowledgment and disease-associated molecules and modulating microglial The authors thank all those who have contributed to our immune response.10 A recent study showed that TREM2 is research, particularly the patients and families who donated required for myelin debris removal and remyelination after Brain and DNA samples for this work. cuprizone-induced demyelination.11 We hypothesize that TREM2 p.R47H, a loss-of-function mutation, leads to im- Study funding paired clearance of myelin debris and aberrant microglial ac- K. Ogaki is supported by a research grant from the NAITO tivation, which result in increased risk of MSA. Foundation, JSPS KAKENHI Grant Number JP17K14966 and a grant from Institute for Environmental and Gender- Our results provide evidence that the TREM2 p.R47H sub- Specific Medicine, Juntendo University. R.J. Uitti, O.A. Ross, stitution may be a genetic susceptibility factor for MSA. Our Z.K. Wszolek, and D.W. Dickson are partially supported by the study is limited by the relatively small number of patients with NIH/NINDS P50 NS072187. O.A. Ross is supported by the pathologically confirmed MSA, and therefore, validation will be NINDS R01# NS078086, U54 NS100693, DOD W81XWH- crucial. Recently, the clinical diagnostic accuracy of MSA was 17-1-0249, and in part by the Michael J. Fox Foundation for reported to be 62%, further underscoring the importance of Parkinson’s Research. C. Labbé is the recipient of a F.R.S.Q. using neuropathologically confirmed MSA cases in research fellowship. Z.K. Wszolek receives research support from studies.12 We hope that these initial promising results will form NIH/NIA (primary), and NIH/NINDS (secondary) the basis for future examinations of TREM2 p.R47H in MSA. 1U01AG045390-01A1, Mayo Clinic Center for Regenerative Medicine, Mayo Clinic Neuroscience Focused Research Team Author contributions (Cecilia and Dan Carmichael Family Foundation, and the K. Ogaki: drafting/revising the manuscript; study concept and James C. and Sarah K. Kennedy Fund for Neurodegenerative design; and interpretation of data. M. G. Heckman and Disease Research at Mayo Clinic in Florida), and is also partially S. Koga: drafting/revising the manuscript and interpretation supported by a gift from Carl Edward Bolch, Jr, and Susan Bass of data. Y.A. Martens: drafting/revising the manuscript. Bolch, The Sol Goldman Charitable Trust, and Donald G. and C. Labbé and O. Lorenzo-Betancor: revising the manuscript. Jodi P. Heeringa. P.A. Low receives research support from the R.L. Walton, A.I. Soto, and E.R. Vargas: revising the manu- Cure MSA Foundation. Samples included in this study were script and interpretation of data. S. Fujioka: revising the clinical patients or brain donors to the brain bank at Mayo Clinic manuscript. R.J. Uitti, J. Van Gerpen, and W.P. Cheshire: re- in Jacksonville, which is supported by the CurePSP Society for vising the manuscript and providing material for this study. Progressive Supranuclear Palsy and Udall Center for Excellence S.G. Younkin: revising the manuscript. Z.K. Wszolek: revising in Parkinson Research (P50 NS072187), APDA Center for the manuscript, providing material and funding for this study, Advanced Research, an Alzheimer’s disease Research Center and IRB committee approval. P.A. Low and W. Singer: revising grant (NIA P50 AG16574), and NINDS R01 NS078086.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Disclosure serves as a clinical editor of Autonomic Neuroscience.W.Singer K. Ogaki receives JSPS KAKENHI Grant Number reports no disclosures. G. Bu received support from JP17K14966 and a grant from Institute for Environmental & P50AG016574, RF1AG051504, R01AG027924, R01AG035355, Gender-Specific Medicine, Juntendo University. M.G. R01AG046205, and P01NS074969 and a grant from the Cure Heckman serves as the editorial board member of Parkin- Alzheimer’s fund. D.W. Dickson receives support from P50- sonism & Related Disorders. S. Koga and Y.A. Martens report AG016574, P50-NS072187, P01-AG003949, and CurePSP: no disclosures. C. Labbé receives a Fonds de recherche du Foundation for PSP|CBD and Related Disorders. D.W. Dickson Quebec-Sante postdoctoral fellowship. O. Lorenzo- is an editorial board member of Acta Neuropathologica, Annals Betancor, R.L. Walton, A.I. Soto, and E. Vargas report no of Neurology, Brain, Brain Pathology,andNeuropathology and disclosures. S. Fujioka receives JSPS KAKENHI Grant is editor-in-chief of the American Journal of Neurodegenerative Number JP15K19501 and is an editorial board member of Disease and International Journal of Clinical and Experimental Parkinsonism & Related Disorders.R.J.Uittiservesasanas- Pathology. O.A. Ross received support from R01 NS078086, sociate editor of Neurology. J.Van Gerpen report no dis- P50-NS072187, and U54 NS100693 and the Michael J. closures. W.P. Cheshire serves in the editorial boards of Fox Foundation. O.A. Ross is an editorial board member of Parkinsonism & Related Disorders and Autonomic Neuroscience the American Journal of Neurodegenerative Disease, Neurologia i and as an associate editor of Clinical Autonomic Research. Neurochirurgia Polska, and Molecular Neurodegeneration. Full S.G. Younkin reports no disclosures. Z.K. Wszolek receives disclosure form information provided by the authors is research support from P50 NS072187, NIH/NIA (primary), available with the full text of this article at Neurology.org/NG. and NIH/NINDS (secondary) 1U01AG045390-01A1, Mayo Clinic Center for Regenerative Medicine, Mayo Clinic Neu- Received January 23, 2018. Accepted in final form May 23, 2018. roscience Focused Research Team (Cecilia and Dan Carmi- chael Family Foundation, and the James C. and Sarah K. References Kennedy Fund for Neurodegenerative Disease Research at 1. Ahmed Z, Asi YT, Sailer A, et al. The neuropathology, pathophysiology and genetics of multiple system atrophy. Neuropathol Appl Neurobiol 2012;38:4–24. Mayo Clinic in Florida), the gift from Carl Edward Bolch, Jr., 2. Scholz SW, Bras J. Genetics underlying atypical parkinsonism and related neurode- and Susan Bass Bolch, The Sol Goldman Charitable Trust, and generative disorders. Int J Mol Sci 2015;16:24629–24655. 3. Sailer A, Scholz SW, Nalls MA, et al. A genome-wide association study in multiple Donald G. and Jodi P. Heeringa; serves as coeditor-in-chief of system atrophy. Neurology 2016;87:1591–1598. Parkinsonism & Related Disorders and an associate editor of the 4. Jay TR, von Saucken VE, Landreth GE. TREM2 in neurodegenerative diseases. Mol Neurodegener 2017;12:56. European Journal of Neurology; is on the editorial boards of 5. Koga S, Parks A, Uitti RJ, et al. Profile of cognitive impairment and underlying Neurologia i Neurochirurgia Polska, European Journal of Clinical pathology in multiple system atrophy. Mov Disord 2017;32:405–413. 6. Gilman S, Wenning GK, Low PA, et al. Second consensus statement on the diagnosis and Experimental Medicine, Clinical and Experimental Medical of multiple system atrophy. Neurology 2008;71:670–676. Letters,andWiadomosci Lekarskie; holds and has contractual 7. Lek M, Karczewski KJ, Minikel EV, et al. Analysis of protein-coding genetic variation “ in 60,706 humans. Nature 2016;536:285–291. rights for receipt of future royalty payments from patents for A 8. Chen Y, Chen X, Guo X, et al. Assessment of TREM2 rs75932628 association with Novel Polynucleotide Involved in Heritable Parkinson’sDis- Parkinson’s disease and multiple system atrophy in a Chinese population. Neurol Sci ” 2015;36:1903–1906. ease ; and receives royalties from publishing Parkinsonism & 9. Simons M, Lyons DA. Axonal selection and myelin sheath generation in the central Related Disorders (Elsevier, 2016, 2017) and the European nervous system. Curr Opin Cel Biol 2013;25:512–519. 10. Painter MM, Atagi Y, Liu CC, et al. TREM2 in CNS homeostasis and neurodegen- Journal of Neurology (Wiley Blackwell, 2016, 2017). P.A. Low erative disease. Mol Neurodegener 2015;10:43. receives research support from the NIH (P01 NS44233, U54 11. Poliani PL, Wang Y, Fontana E, et al. TREM2 sustains microglial expansion during aging and response to demyelination. J Clin Invest 2015;125:2161–2170. NS065736, R01 NS092625, and UL1 TR000135), FDA (R01 12. Koga S, Aoki N, Uitti RJ, et al. When DLB, PD, and PSP masquerade as MSA: an FD004789), Cure MSA Foundation, and Mayo Funds and autopsy study of 134 patients. Neurology 2015;85:404–412.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 ARTICLE OPEN ACCESS Conﬁrming TDP2 mutation in spinocerebellar ataxia autosomal recessive 23 (SCAR23)

Guido Zagnoli-Vieira, BSc, Francesco Bruni, PhD,* Kyle Thompson, PhD, Langping He, MD, PhD, Correspondence Sarah Walker, PhD, Arjan P.M. de Brouwer, PhD, Robert Taylor, PhD, FRCPath, Dmitriy Niyazov, MD, Dr. Caldecott [email protected] and Keith W. Caldecott, PhD

Neurol Genet 2018;4:e262. doi:10.1212/NXG.0000000000000262 Abstract Objective To address the relationship between mutations in the DNA strand break repair protein tyrosyl DNA phosphodiesterase 2 (TDP2) and spinocerebellar ataxia autosomal recessive 23 (SCAR23) and to characterize the cellular phenotype of primary ﬁbroblasts from this disease.

Methods We have used exome sequencing, Sanger sequencing, gene editing and cell biology, biochemistry, and subcellular mitochondrial analyses for this study.

Results We have identified a patient in the United States with SCAR23 harboring the same homozygous TDP2 mutation as previously reported in 3 Irish siblings (c.425+1G>A). The current and Irish patients share the same disease haplotype, but the current patient lacks a homozygous variant present in the Irish siblings in the closely linked gene ZNF193, eliminating this as a contributor to the disease. The current patient also displays symptoms consistent with mitochondrial dysfunction, although levels of mitochondrial function in patient primary skin fibroblasts are normal. However, we demonstrate an inability in patient primary fibroblasts to rapidly repair topoisomerase-induced DNA double-strand breaks (DSBs) in the nucleus and profound hypersensitivity to this type of DNA damage.

Conclusions These data conﬁrm the TDP2 mutation as causative for SCAR23 and highlight the link between defects in nuclear DNA DSB repair, developmental delay, epilepsy, and ataxia.

*Current address: Department of Biosciences Biotechnologies and Biopharmaceutics, University of Bari Aldo Moro, Bari, Italy. From the Genome Damage and Stability Centre (G.Z-V., K.W.C.), University of Sussex, Falmer, Brighton, United Kingdom; Wellcome Centre for Mitochondrial Research (F.B., K.T., L.H., R.T.), Institute of Neuroscience, Newcastle University, Tyne, United Kingdom; Sussex Drug Discovery Centre (S.W.), University of Sussex, Falmer, Brighton, United Kingdom; Department of Human Genetics (A.P.M.d.B.), Donders Institute for Brain, Cognition and Behaviour, Radboud University Medical Center, Nijmegen, The Netherlands; and Medical Genetics (A.P.M.d.B., D.N.), Ochsner Health Center for Children, New Orleans, LA.

The Article Processing Charge was funded by the authors. This is an open access article distributed under the terms of the Creative Commons Attribution License 4.0 (CC BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Glossary DSB = double-strand break; ETC = electron transport chain; FCS = fetal calf serum; NHEJ = nonhomologous end joining; SCAR23 = spinocerebellar ataxia, autosomal recessive 23; TDP2 = tyrosyl DNA phosphodiesterase 2; WCE = whole-cell extract; WES = Whole-exome sequencing.

DNA is under constant threat from attack by endogenous and also easily fatigued and a 14-year-old maternal half-sister exogenous electrophilic molecules,1 and DNA topoisomerase with attention deficit hyperactivity disorder (ADHD). enzymes can introduce DNA breaks as abortive intermediates – of their activity.2 4 Topoisomerase “poisons” such as etopo- The patient has difficulty keeping balance and has an ataxic side inhibit the ligation activity of topoisomerase 2 (TOP2), gait. He has been tested several times for abnormalities in thereby promoting the formation of abortive DNA double- blood, urine, and CSF, and by MRI and EEG, and only the strand break (DSB) intermediates that require DSB repair. latter is abnormal. Seizures began at the age of 5 months, and DSBs are repaired in cells by either homologous his EEGs show increased slowing and occasional spikes in the recombination–mediated repair or by nonhomologous end right posterior quadrant, and during drowsiness, he had 2 joining (NHEJ).2 The repair of TOP2-induced DSBs by generalized bursts of polyspike and slow-wave activity at NHEJ involves the enzyme tyrosyl DNA phosphodiesterase 2 a frequency of 4–5 Hz. The patient’s 180K oligoarray, very (TDP2), which removes trapped topoisomerase peptide from long chain fatty acids, carbohydrate-deficient transferrin, CSF the 59-termini at the DSB and thereby allows the DNA ends to lactate, and neurotransmitters and plasma amino acids were – be ligated.3 5 The loss of TDP2 in mouse results in reduced normal. expression of >100 genes in the brain,6 and TDP2 mutation in humans has been associated with intellectual disability, seiz- The patient exhibited several phenotypes consistent with mi- ures, and ataxia,6 a disease now denoted as spinocerebellar tochondrial dysfunction such as hypotonia, low energy, fati- ataxia, autosomal recessive 23 (SCAR23). To date, our un- gability, hypersomnia, failure to thrive, short stature, derstanding of SCAR23 has been limited by the availability of constipation, neutropenia, hyponatremia, cardiac arrhythmia, only 3 Irish siblings with a mutation in TDP2 and by the lack and gastrointestinal dysmotility. Consistent with this, electron of availability of fibroblast cell lines from these patients for transport chain (ETC) studies on muscle biopsy at age 1 year molecular and cellular characterization. Here, we have showed a severe reduction of complex I + III and II + III addressed these limitations and identified an SCAR23 patient activity, which satisfied the major Walker criteria after cor- in the United States with the same homozygous TDP2 mu- rection for increased citrate synthase activity. CoQ10 de- tation as present in the Irish siblings, confirming the associ- ficiency was suggested based on the complex I + III and II + III ation of this disease with mutated TDP2. In addition, we have deficiency, and his metabolic tests were abnormal with the characterized at the molecular and cellular level primary pa- high lactate and high lactate/pyruvate ratio. The patient was tient fibroblasts from the current SCAR23 patient. placed on ubiquinol, carnitine, and leucovorin, and anecdot- ally, he responded well (particularly to liposomal ubiquinol, the active or reduced form of CoQ10) in terms of energy and Methods developmental progress. He is reportedly no longer sleepy and lethargic and has a stable gait, but is “still behind” in language Patient case report and cognitive skills and is in special education. He still has The patient is currently a 6-year-old caucasian boy from idiopathic fevers but has not been admitted to the hospital for the United States presenting with developmental delay, 15 months. He does not have as many infections but still has microcephaly, and failure to thrive. His mother and father gastric dysmotility. His seizures have reduced in frequency. are aged 29 years and 32 years, respectively, and there is no previous family history of related disease, but there is Standard protocol approvals, registrations, and possible consanguinity (3rd cousins). The patient started patient consents walking at the age of 14 months and talking at 3 years, his We confirm that we have received approval from an in- hearing was reportedly normal, but he did not have audi- stitutional ethics standards committee for this work, and we tory brainstem response. The patient is easily fatigued, and have written informed consent for research from the guardian his parents reported that he eats excessively, becomes ir- of the patient for participation in this study. ritable, and falls asleep sometimes for days or up to 2 weeks. He is now below the fifth percentile for weight and Exome sequencing and haplotype analysis 5% for height, with a body mass index at <5%. He has Whole-exome sequencing (WES) (trio study) of the patient was a G-tube and is followed by a dietitian and receives nutri- performed by GeneDx using the Agilent Clinical Research tional liquid supplements (PediaSure; Abbott, Lake Forest, Exome kit to target the exonic regions and flanking splice IL). He has a history of constipation and is followed up by junctions of the genome. These targeted regions were sequenced a gastroenterologist. He has a 12-year-old brother who is simultaneously by massively parallel (NextGen, Irvine, CA)

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG sequencing on an Illumina HiSeq sequencing system with 37°C. TDP2-mutated patient primary human fibroblasts were 100bp paired-end reads. Bidirectional sequence was assembled, established from a patient’s skin biopsy and were denoted 850- aligned to reference gene sequences based on human genome BR. The control human fibroblast cell line 1-BR.3 (denoted build GRCh37/UCSC hg19, and analyzed for sequence var- here for simplicity as 1-BR) was previously derived from an iants in the selected genes or regions of interest using a custom- unrelated normal individual and has been described pre- developed analysis tool (Xome Analyzer). Capillary sequencing viously.8 For complementation experiments, we used 1-BR was used to confirm all potentially pathogenic variants identi- cells that were immortalized previously with hTERT (denoted fied in this individual. Sequence alterations were reported as 1-BR hTERT) and a derivative of 850-BR immortalized in according to the nomenclature guidelines of the Human the current study by retroviral-mediated hTERT expression Genome Variation Society. The WES identified a homozygous and selected in a medium containing 1 μg/ml puromycin splice site mutation (c.425+1G>A) in the TDP2 gene. For (denoted as 850-BR hTERT). For complementation with comparison of the current patient with the Irish pedigree human TDP2, 850-BR hTERT cells were transfected with ei- previously reported,6 we conducted haplotype analysis. Var- ther empty eGFP-N1 vector or eGFP-N1 construct encoding iants were considered for homozygosity if they were (1) cov- GFP-tagged human TDP2 (denoted as TDP2-GFP-N1) and ered by at least 4 reads or more, (2) present in 80% of all reads stable transfectants selected for 21 days by growth in a medium or more, (3) designated as a substitution, (4) uniquely posi- containing 0.5 mg/mL G418 (Gibco, ThermoFisher, Waltham, tioned in the human genome, and (5) present in the exome MA). TDP2-GFP-N1 was generated by PCR amplification data of both individuals. Homozygous regions were de- of the human TDP2 ORF using the primers TDP2_FW termined using a sliding window, accepting 2 or less homozy- (59-AAAGAATTCATGGAGTTGGGGAGTTGCCTG-39) gous variants per 10 variants assessed. and TDP2_RV (59-AAAGGATCCAATATTATATCT AAGTTGCACAGAAGACC-39) and subcloning the PCR Mitochondrial preparation and subcellular product into the EcoRI/BamHI sites of eGFP-N1. fractionation 7 Mitochondria were prepared as described previously, with few CRISPR/Cas9 gene editing − − modifications. HeLa cells and fibroblasts (control and patient) A549 TDP2 / cells were created as previously reported.9 In were harvested, resuspended in homogenization buffer (HB brief, we used a 17-bp (minus the PAM) RNA sequence [0.6 M mannitol, 10 mM Tris-HCl pH 7.4, 1 mM (ethylene targeting TDP2 exon 4 (59-GTAGAAATATCACATCT-39), glycol-bis(β-aminoethyl ether)-N,N,N9,N9-tetraacetic acid) which was selected using the tool E-CRISP (e-crisp.org/ (EGTA), 0.1% bovine serum albumin (BSA) (wt/vol]), and E-CRISP/) and cloned into the guide RNA vector #41824 subjectedtodifferential centrifugation. Mitochondria were pel- (AddGene). The TDP2 guide construct was cotransfected leted at 11.000g for 10 minutes at 4°C and resuspended in HB; with hCas9 expressed from plasmid #41815 (AddGene) using the postmitochondrial supernatant was retained after centrifu- Amaxa Nucleofector plataform (Lonza, Basel, Switzerland) gation (“post-mito spin”). For submitochondrial fraction prepa- Kit T program X-001. Transfected cells were enriched by ration, HeLa cell mitochondria (300 μg) were treated with 1.6 μg selection in 1 mg/mL G418 (Thermofisher) for 5 days before of proteinase K on ice for 30 minutes, followed by the addition of isolation of single clones and screening for loss of TDP2 5 mM phenylmethanesulfonyl fluoride (PMSF). This fraction expression by Western blotting. was pelleted at 11.000g for 10 minutes at 4°C and resuspended in HB. Mitoplasts were obtained by resuspending PK-treated mi- Sanger sequencing tochondria in 9 volumes of 10 mM Tris-HCl (pH 7.4) and DNA was extracted from 850-BR cells using the DNeasy treated with PK, as described earlier. Inner mitochondrial Blood & Tissue kit (Qiagen, Manchester, UK). PCR membrane proteins were extracted in the presence of 100 mM reactions used Phusion HF-DNA Polymerase (NEB) and Na2CO3, followed by centrifugation at 100.000g for 15 minutes the following primers: TDP2_FW GCCAGTGTT- at 4°C. Proteins (30 μg) from each fraction were loaded onto GACCTAACCAATGAAGA; TDP2_RV CTGTAGAAA- 12% SDS-PAGE gel, transferred to the polyvinylidene difluoride TATCACATCTGGGCTGTACC; ZSCAN9_FW ATGAAGT (PVDF) membrane, and analyzed by immunoblotting using AACCAAGACTGAGGACAGAGAG; and ZSCAN9_RV primary antibodies to apoptosis inducing factor (AIF) (NEB), AGACCAGCTCAGCCACTGTGTGGATCT. PCR products eIF4E (Cell Signalling), EF-Tu (custom made), NDUFB8 were purified before sequencing using a QIAquick PCR purifi- (Mitosciences), and TDP2 (see Western Blotting, below). cation kit (Qiagen).

Cell culture and vectors Western blotting Human A549 cells were grown in Dulbecco Modified Eagle Anti-TDP2 antibody was used at 1:5000 in Western blotting Medium (Gibco, ThermoFisher, Waltham, MA) containing and has been described previously.10 Anti-Actin (Sigma 10% fetal calf serum (FCS), 2 mM glutamine, penicillin (100 A4700) was used at 1:2000. Western blot assessment of units/mL), and streptomycin (100 μg/mL). Human fibroblasts OXPHOS components in patient primary fibroblasts was were grown in Minimum Essential Media (Gibco) containing conducted as described previously,11 using antibodies against 15% FCS, 2 mM glutamine, penicillin (100 units/mL), and NDUFB8 (Abcam cat# ab110242), SDHA (Abcam cat# μ streptomycin (100 g/mL). All cells were grown at 5% CO2 at ab14715), UQCRC2 (Abcam cat# ab14745), COXI (Abcam

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 cat# ab14705), ATP5A (Abcam cat# ab14748), SDHB colonies (>50 cells) in treated dishes by the average number in (Abcam cat# ab14714), COX II (Abcam cat# 110258), and untreated dishes. For feeder layers, 1-BR cells were irradiated (35 VDAC1 (Abcam cat# ab14734). Gy) and plated 24 hours before use at 5 × 104 cells/10 cm dish.

Clonogenic survival assays Tyrosyl DNA phosphodiesterase assays 1-BR and 850-BR primary fibroblasts cells were plated onto Whole-cell extract (WCE) was prepared by resuspension of feeder layers (see below) and 3 hours later treated with indicated 1-BR or 850-BR primary fibroblast cell pellets (1×106cells) in concentrations of etoposide for 21 days to allow the formation of 100μL lysis buffer (40 mM Tris/HCl pH 7.5, 100 mM NaCl, macroscopic colonies, which were rinsed in phosphate buffered 0.1% Tween-20, 1 mM DTT, 1 mM PMSF, 1x EDTA free saline (PBS) and fixed/stained in 70% ethanol/1% methylene protease cocktail inhibitor), followed by 30 minutes of in- − − blue. A549 and TDP2 / A549 were plated 4 hours before cubation on ice and mild sonication. The WCE was clarified treatment with the indicated concentrations of etoposide for 12 by centrifugation for 10 minutes at 4°C at 16000g in days and stained as described earlier. The surviving fraction at a microfuge and the protein concentration quantified using each dose was calculated by dividing the average number of the bicinchoninic acid (BCA) assay reagent (ThermoFisher).

Figure 1 TDP2 splice site mutation in an individual from the United States with SCAR23

(A) Pedigree analysis. White symbols: wild-type TDP2. Black symbols: homozygosity for the TDP2 splice site mutation c.425+1G>A (IVS3+1G>A) in the proband (“1”). Dotted symbols, heterozygosity for c.425+1G>A (IVS3+ 1G>A). (B) Sanger sequencing of the proband, demonstrating (left) the homozygous TDP2 mutation c.425+ 1G>A (IVS3+1G>A) and (right) the absence of the ZSCAN9 variant c914A>G. Patient sequences are shown at the bottom, and reference sequences are shown at the top. The 2 nucleotides relevant to the mutations are underlined. (C) Pathologic features of the Irish and US patients. (D) Haplotypes of Irish patients (51670; Irish pedigree) and the current patient from the United States (1583786) carrying the homozygous c.425+1G>A variant in TDP2. Only the variants bordering and directly within the homozygous regions and with a minor allele frequency of 5% are shown. Variants are indicated by their accession number in the dbSNP database, and the position of c.425+ 1G>A is in bold. The minimal overlapping region is delimited by rs9396886 and rs749338 and is 15.1 Mb in size. Black bars represent the homozygous haplotype as inferred from exome sequencing data. TDP2 = tyrosyl DNA phosphodiesterase 2.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Clarified WCE (15μg total protein) was incubated with 40 blocked(1hourinPBS-5%BSA),andincubatedwithanti- 9 γ nM TDP2 substrate (Cy5-5 Tyrosine-ssDNA19-BHQ) or H2AX (Millipore, 05-636, 1:2500) and anti-CENP-F 9 TDP1 substrate (BHQ-ssDNA13-3 Tyrosine-Cy5) in re- (Abcam, ab5, 1:2500) antibodies for 3 hours in PBS con- ff action bu er (50 mM Tris/HCl pH8.0, 10 mM MgCl2, taining 5% BSA. Cells were then washed (3 × 5 minutes in 80 mM KCl, and 1 mM DTT, 0.05% Tween-20) in a total PBS containing 0.1%Tween-20), incubated for 1h with the volume of 6μL at room temperature, and Cy5 fluorescence corresponding Alexa Fluor conjugated secondary antibody was measured at 640 nm at the indicated time intervals on (1:1000, 5% BSA), and washed again as described earlier. a BMG PHERAstar plate reader. Finally, cells were counterstained with DAPI (Sigma, Gillingham, UK) and mounted in VECTASHIELD (Vector DSB repair assays Labs, Peterborough, UK). Images were acquired on an Cells were grown on coverslips until confluent and then automated wide-field microscopy Olympus ScanR system treated for 30 minutes with 25μM etoposide or irradiated (motorized IX83 microscope) with ScanR Image Acquisi- with x-rays (2 Gy). After treatment, cells were rinsed and tion and Analysis Software, 20×/0.45 (LUCPLFLN fixed for 10 minutes in PBS containing 4% para- 20×PH) dry objectives, and Hamamatsu ORCA-R2 digital formaldehyde at the indicated time points. Cells were CCD camera C10600. For the analysis of G0/G1 cells in permeabilized (20 minutes in PBS-0.2% Triton X-100), patient primary fibroblasts, only CENP-F-negative cells

Figure 2 Greatly reduced TDP2 protein and activity in 850-BR patient fibroblasts

(A) TDP2 and actin protein levels in WCE (20 μg total protein) from 1-BR normal and 850-BR patient primary fibroblasts, as measured by immunoblotting. (B) TDP1 and TDP2 biochemical assay. Hydrolysis of a 39-phosphotyrosyl (TDP1 assay) or 59-phosphotyrosyl (TDP2 assay) bond releases the associated Cy5 fluorophore and alleviates quenching by the BHQ located on the opposite oligonucleotide terminus, resulting in elevated fluorescence at 640 nm. (C) Real- time (0–30 minutes) measurements of 59-tyrosyl DNA phosphodiesterase activity (TDP2 assay) in reaction buffer (as a negative control) or WCE (15 μg protein) from 1-BR normal or 850-BR patient primary fibroblasts, using the single-stranded oligonucleotide (40 nM) with a 59-phosphotyrosyl-linked Cy5 fluorophore and 39-BHQ. (D) Real-time measurements (0–30 minutes) of 39-tyrosyl DNA phosphodiesterase (TDP1 assay) conducted as above but using a 39-phosphotyrosyl-linked Cy5 fluorophore and 59-BHQ. Data are mean of 3 independent experiments ±SEM. Statistical significance was determined by two way analysis of variance (ANOVA). ***p < 0.001. BHQ = black hole quencher; TDP2 = tyrosyl DNA phosphodiesterase 2; WCE = whole-cell extract.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 5 − − were scored. For A549 and A549 TDP2 / ,cellsweregated disease causing in the Irish patients,6 and the absence of this to the G1 population according to the DAPI profile of variant in the current patient confirms that this and also that ScanR Image Analysis Software. For patient fibroblast TDP2 mutation is the cause of SCAR23. complementation experiments, cells were gated accord- ingly to eGFP expression on ScanR Analysis Software, in To enable additional molecular and cellular analyses of addition to the G1 population according to the DAPI SCAR23, we generated primary fibroblasts (denoted 850-BR) content. from a skin biopsy kindly provided by the current patient. Western blotting failed to detect TDP2 protein in the 850-BR Results patient fibroblasts (figure 2A), consistent with the lack of detectable TDP2 protein previously reported in lympho- We recently described mutations in TDP2 in three Irish blastoid cells from the Irish patients.6 The absence of de- patients from the same family with intellectual disability, tectable TDP2 protein in the lymphoblastoid cell lines was seizures, and ataxia, a disease now denoted as spinocerebellar explained by the impact of the TDP2 mutation on splicing, ataxia 23 (SCAR23)6. Here, we describe a 6-year-old patient which resulted in nonsense-mediated decay and greatly re- in the United States with very similar pathology including duced (<20%) levels of TDP2 mRNA.6 To confirm the im- developmental delay, epilepsy, and ataxia and in whom we pact of the splice site mutation on TDP2 activity, we used identified by whole-exome and Sanger sequencing possesses a highly sensitive tyrosyl DNA phosphodiesterase bio- the same homozygous splice site mutation in TDP2 (c.425+ chemical assay. This assay uses a single-stranded oligonucle- 1G>A) (figure 1, A–C). Whether there is a connection be- otide substrate in which hydrolytic release of a Cy5-labeled tween the current patient and the Irish family is not clear, but tyrosine moiety present on one terminus of the oligonucle- a comparison of the WES data from the two families revealed otide results in increased fluorescence due to evasion of that the two apparently unrelated affected individuals of a black hole quencher present on the opposite terminus whom their exome was sequenced share the same homozy- (figure 2B). By situating the fluorescent-labeled tyrosine on gous haplotype of ;15.1 Mb (figure 1D). It is important to either the 39 or 59 terminus, this assay can detect TDP1 or note that in contrast to the Irish patients, however, the current TDP2 activity, respectively. Although whole-cell extract from patient lacks the mutation c.914A>G (p.His305Arg) in normal 1-BR human fibroblasts exhibited robust 59-tyrosyl ZNF193, a zinc finger protein of unknown function (figure DNA phosphodiesterase activity, 850-BR patient fibroblasts 1B, right). We previously concluded that this variant was not did not (figure 2C). The small amount of activity observed in

Figure 3 Reduced DSB repair in TDP2-mutated patient fibroblasts and A549 cells after topoisomerase 2-induced DNA damage

(A) DSBs were measured by γH2AX immunostaining in normal 1-BR and patient 850-BR primary fibroblasts before and after treatment for 30 minutes with DMSO vehicle or 25 μM etoposide (“0”), followed by subsequent incubation in a drug-free medium for the indicated repair periods. (B) DSBs were measured as above, in wild-type A549 cells and in A549 cells in which TDP2 was deleted by CRISPR/Cas9 gene editing − − (TDP2 / A549). The level of TDP2 and actin (loading control) in the cell lines used for these experiments is shown by Western blotting on the right. (C) DSBs were measured as above in hTERT-immortalized 1-BR fibroblasts and 850-BR fibroblasts and in the latter cells after transfection with the empty GFP vector or vector encoding recombinant human TDP2-GFP. The level of TDP2 and actin (loading control) in the cell lines used for these experiments is shown by Western blotting on the right. Data are mean ± SEM of 3 independent experiments, and statistically significant differences were determined by the t test (ns = not significant, *p < 0.05; **p < 0.01; ***p < 0.001). DSB = double-strand break; GFP = green fluorescent protein; TDP2 = tyrosyl DNA phosphodiesterase 2.

6 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG 850-BR cell extract, compared with reactions supplemented mechanisms for repair of TOP2-induced DSBs in human with reaction buffer alone, reflects nucleases in the cell extract cells.4,13,14 Similar results were observed in human A549 cells rather than residual TDP2 activity because similar results were in which TDP2 was mutated by CRISPR/Cas9 gene editing, observed when we used cell extract from human cells in which confirming the importance of TDP2 for repair of TOP2- TDP2 was deleted by CRISPR/Cas9 (unpublished observa- induced DSBs (figure 3B). More importantly, complemen- tions). The lack of TDP2 activity in patient cells did not tation of 850-BR cells with expression construct encoding reflect differences in the technical quality of cell extracts be- recombinant human TDP2 restored normal rates of nuclear cause the level of TDP1 activity in these extracts was similar to DSB repair, confirming that the DNA repair defect in the that in normal human 1-BR fibroblasts (figure 2D). We patient fibroblasts was the result of the TDP2 mutation (figure conclude from these data that the TDP2 splice site mutation 3C). This defect in DSB repair was accompanied by cellular greatly reduces and most likely ablates both TDP2 protein hypersensitivity to TOP2-induced DSBs because both 850- − − and activity in 850-BR patient fibroblasts. BR patient fibroblasts and TDP2 / A549 cells were hypersensitive to etoposide in clonogenic survival assays (figure 4, A Next, we addressed the impact of the TDP2 splice site mu- and B). In contrast to etoposide-induced DSBs, both DSB tation on nuclear DSB repair rates in 850-BR patient fibro- repair rates and levels of cell survival were normal in 850-BR blasts using immunofluorescent detection of γH2AX as an patient fibroblasts after treatment with ionizing radiation indirect measure of DSBs.12 Although similar levels of nuclear (figure 4, C and D), confirming the specificity of the DNA γH2AX foci were present in normal and patient fibroblasts repair defect in the patient’s cells for DNA breaks induced by immediately after treatment with etoposide for 30 minutes, TOP2. the levels of these γH2AX foci decreased far more slowly in the patient fibroblasts during subsequent incubation in a drug- Finally, because analyses of muscle biopsy from the patient free medium (figure 3A). However, DSB repair was com- (seethecasereport)suggestedthepresenceofpossible pleted in patient cells within 8–24 hours, consistent with the defects in the ETC, we examined 850-BR patient fibroblasts established existence of alternative, nuclease-dependent for defects in mitochondrial function. However, the patient

Figure 4 Hypersensitivity of TDP2-mutated patient fibroblasts and A549 cells to DNA damage induced by etoposide but not γ-rays

(A) Clonogenic survival of 1-BR normal and 850-BR patient primary fibroblasts in a medium containing the indicated concentrations of etoposide. (B) Clonogenic survival of wild-type − − A549 and TDP2 / A549 cells in a medium containing the indicated concentrations of etoposide. (C) Clonogenic survival of 1-BR normal and 850-BR patient primary fibroblasts as above, following γ-irradiation. (D), DSBs were measured by γH2AX immunostaining in normal 1- BR and patient 850-BR primary fibroblasts before and after the indicated periods after γ-irradiation (2 Gy). Data are mean ± SEM of 3 independent experiments, and statistically significant differences were determined by two-way ANOVA (ns = not significant, ***p < 0.001). TDP2 = tyrosyl DNA phosphodiesterase 2.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 7 fibroblasts failed to exhibit significant defects in respiratory TDP2 was mutated by gene editing (figure 5A.b). We also chain complexes in biochemical assays compared with failed to identify any impact of the TDP2 mutation or de- a range of different normal (control) human fibroblasts letion in 850-BR fibroblasts and A549 cells, respectively, in (figure 5A.a). Similar results were observed when we the level of respiratory chain proteins as measured by im- compared wild-type A549 cells with A549 cells in which munoblotting (figure 5B).

Figure 5 Mitochondrial functionality in normal and TDP2-mutated cells

(A) Activity of mitochondrial respiratory complexes in normal (red bars) and patient 850-BR (blue bars) primary human fibroblasts (A.a) and in wild- type human A549 (red bars) and − − TDP2 / A549 cells (blue bars) (A.b) was determined as previously described.15 The mean enzyme activities in control cells (n = 8) are set to 100%, and error bars represent SD. (B) Levels of mitochondrial respiratory complex proteins in age-matched control fibroblasts (C1 and C2) and patient 850- BR fibroblasts (B.a) and in wild-type − − A549 cells and TDP2 / A549 cells (B.b), as measured by immunoblotting for subunits of CI (NDUFB8), CII (SDHA), CIII (UQCRC2), CIV (COXI), and CV (ATP5A) and using VDAC1 as a mitochondrial loading control. (C) Subcellular localization of TDP2 in HeLa cells (C.a) and in normal (1-BR) and patient (850-BR) primary human fibroblasts (C.b). Left, cell-equivalent amounts of HeLa total cell lysate (30 g total protein; lane 1), cell lysate depleted of mitochondria (“post-mito spin”; lane 2), mitochondria treated with proteinase K (to remove proteins associated with the outer membrane; lane 3), mitoplasts (mitochondrial matrix plus inner membrane proteins; lane 4), mitoplasts treated with proteinase K (lane 5), and inner membrane mitochondrial proteins (extracted with sodium carbonate; lane 6) were immunoblotted for TDP2 and for protein markers of the cytosol (eIF4E) and each of the mitochondrial compartments, intermembrane space (AIF), mitochondrial matrix (EF-Tu), and inner mitochondrial membrane (NDUFB8). Right, cell-equivalent amounts of 1-BR or 850-BR fibroblast total cell lysates (30μg protein) depleted of mitochondria (“post-mito spin”) and of mitoplasts were immunoblotted for TDP2 as above. The position of full-length TDP2 (arrow) and a nonspecific band detected by the antibody (asterisk; *) are indicated. TDP2 = tyrosyl DNA phosphodiesterase 2.

8 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG We next fractionated HeLa cells and both 1-BR and 850-BR fibroblasts and gene-edited A549 cells than what we have seen fibroblasts into subcellular components, including intact mi- previously with our previous gene-edited cell lines.9 We believe tochondria and mitoplasts, to examine whether TDP2 is lo- that this is because the cell lines reported here are effectively cated within the mitochondria and thus in the correct location TDP2 null, whereas our previously generated TDP2 gene- to repair mitochondrial DNA (figure 5C). Most of the ma- edited human cells retained a minor isoform of TDP2 that is terial detected by the anti-TDP2 antibody and which migrated expressed at low levels and is primarily cytoplasmic. to the position expected for TDP2 was present, as expected, in the cellular fractions containing cytosolic and nuclear proteins It is notable that TOP2 poisons are used widely in the clinic to (figure 5C.a, lanes 1 and 2). However, a very small amount of treat a variety of cancers, and we point out that the use of these this material was detected in intact mitochondria and mito- agents in patients with TDP2 mutations should be avoided or plasts (figure 5C.a, lanes 3–5). In 1-BR normal human at the very least treated with extreme caution. Although fibroblasts, most of the material detected by anti-TDP2 an- TDP2-defective cancer cells will be hypersensitive to this type tibody was again present in the cytosolic/nuclear fraction, and of chemotherapy, normal cells will also be hypersensitive, as this material was TDP2 because it was absent from parallel illustrated in the current work by the etoposide sensitivity − − preparations from patient 850-BR fibroblasts (figure 5C.b). observed in both TDP2 / A549 lung cancer cells and However, if TDP2 was present in mitoplasts prepared from SCAR23 primary fibroblasts. 1-BR cells, it was below the level of detection in our experiments (figure 5C.b, arrow). We did note the presence of The presence of mitochondrial dysfunction in the SCAR23 a slower migrating band that was detected by the TDP2 an- patient described here is suggested by ETC studies and the high tibody in both HeLa and 1-BR mitoplasts, but this band was lactate and lactate/pyruvate ratio in muscle (see the Patient also present in parallel preparations from 850-BR patient Case Study in the Methods section). In addition, the current fibroblasts, indicating that it was not TDP2 (figure 5C.b, patient exhibits phenotypes consistent with mitochondrial asterisk). Collectively, although we cannot rule out the pres- dysfunction such as hypotonia, low energy, and fatigability. It is ence of a small amount of endogenous TDP2 in mitochon- unclear whether phenotypes consistent with mitochondrial dria, we cannot detect defects in mitochondrial function in defects are also present in the Irish patients, although none SCAR23 patient fibroblasts. Consequently, we suggest that were originally noted.6 Unfortunately, neither fibroblasts nor the neurologic disease pathology in SCAR23 is most likely the muscle biopsy are available from these patients to address this result of a defect in nuclear DSB repair. possibility. The lack of detectable mitochondrial defect in primary skin fibroblasts from the current patient and in gene- edited A549 cells does not support a major role for TDP2 in the Discussion repair of mitochondrial DNA. However, the absence of mitochondrial defects in skin fibroblasts from patients with mito- We recently identified TDP2 mutations in a recessive hered- chondrial defects in muscle is not uncommon.15 Nevertheless, itary genetic disorder associated with intellectual disability, given the dramatic impact of the TDP2 mutation on nuclear seizures, and ataxia, now denoted as spinocerebellar ataxia DNA repair, we suggest that any association of SCAR23 with autosomal recessive 23 (SCAR23)6. In the three Irish siblings mitochondrial disease is most likely an indirect or secondary originally described, we also identified the mutation c.914AG dysfunction resulting from a nuclear disorder.16 (p.His305Arg) in ZNF193, a zinc finger protein of unknown function, which we concluded was not disease causing but Author contributions which we could not exclude as a contributor to the disease.6 G. Zagnoli-Vieira, F. Bruni, K. Thompson, and L. He designed However, in contrast to the Irish patients, the new patient and conducted mitochondrial experiments. S. Walker identified in the United States and reported here harbors the designed TDP assay. R. Taylor supervised mitochondrial same TDP2-associated haplotype but lacks the mutation in experiments. A.P.M. de Brouwer conducted haplotype anal- ZNF193, ruling out a contribution of the latter and confirming ysis. D. Niyazov identified and assessed the patient and the TDP2 mutation as the cause of SCAR23. identified the TDP2 mutation. K.W. Caldecott designed, di- rected, and coordinated the project and wrote the manuscript. The TDP2-mutated patient fibroblasts established here are the first such reported and have provided valuable information Acknowledgment concerning the molecular and cellular defect in SCAR23. The authors thank the patient and the patient’s family, and Consistent with TDP2 defects in other cell types, we observed Limei Ju/Elena Korneeva for generation of primary 850-BR reduced rates of DSB repair and elevated cellular sensitivity patient fibroblasts and hTERT-immortalized derivatives. after treatment with the TOP2 poison etoposide. These phenotypes were the result of the TDP2 mutation in the patient Study funding − − fibroblasts because they were phenocopied in TDP2 / A549 This study was funded by Programme grants to KWC from cells created by gene editing and were complemented by the the MRC (MR/P010121/1), CRUK (C6563/A16771), ERC reintroduction of the wild-type human TDP2 transgene. Of (SIDSCA Advanced Grant, 694996), and by an MRC PhD interest, the magnitude of these phenotypes is greater in patient Studentship for GZV (MRN/N50189X/1).

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 9 Disclosure 3. Cortes Ledesma F, El-Khamisy SF, Zuma MC, Osborn K, Caldecott KW. A human 59- fi tyrosyl DNA phosphodiesterase that repairs topoisomerase-mediated DNA damage. G. Zagnoli-Vieira has no nancial disclosures to report. Nature 2009;461:674–678. F. Bruni serves on the editorial boards of Biomarkers 4. Gómez-Herreros F, Romero-Granados R, Zeng Z, et al. TDP2-Dependent nonhomologous end-joining protects against topoisomerase II-induced DNA breaks and journal and Brain and Nervous System Current Research and genome instability in cells and. Vivo Plos Genet 2013;9:e1003226. receives research support from ANVUR. K. Thompson, 5. Zeng Z, Cortes Ledesma F, El-Khamisy SF, Caldecott KW. TDP2/TTRAP is the major 59- tyrosyl DNA phosphodiesterase activity in vertebrate cells and is critical for cellular re- L.He,S.Walker,R.Taylor,and A.P.M de Brouwer report sistance to topoisomerase II-induced DNA damage. J Biol Chem 2011;286:403–409. no disclosures. D. Niyazov has served on the scientific 6. Gómez-Herreros F, Schuurs-Hoeijmakers JHM, McCormack M, et al. TDP2 protects transcription from abortive topoisomerase activity and is required for normal neural advisory boards of Alexion Pharmaceuticals and Mal- function. Nat Genet 2014;46:516–521. linckrodt ARD Inc.; has received funding for travel/ 7. Bruni F, Gramegna P, Oliveira JMA, Lightowlers RN, Chrzanowska-Lightowlers fi ZMA. REXO2 is an oligoribonuclease active in human mitochondria. PLoS One speaker honoraria from Sano Genzyme Corporation; 2013;8:e64670. serves on the editorial board of Molecular Syndromology; 8. Hoch NC, Hanzlikova H, Rulten SL, et al. XRCC1 mutation is associated with PARP1 has consulted with the Phase II clinical trial of Elamipre- hyperactivation and cerebellar ataxia. Nature 2016;541:87–91. 9. Gómez-Herreros F, Zagnoli-Vieira G, Ntai I, et al. TDP2 suppresses chromosomal tide in Mitochondrial Myopathy; is a current member of translocations induced by DNA topoisomerase II during gene transcription. Nat the Sanofi Genzyme Corporation Speakers’ Bureau; and Commun 2017;8:233. 10. Thomson G, Watson A, Caldecott K, et al. Generation of assays and antibodies to has served as an expert witness for a legal case regarding facilitate the study of human 59-tyrosyl DNA phosphodiesterase. Anal Biochem 2013; vaccine injury in a child with mitochondrial disease. 436:145–150. 11. Thompson K, Majd H, Dallabona C, et al. Recurrent de novo dominant mutations in K.W. Caldecott reports no disclosures. Full disclosure SLC25A4 cause severe early-onset mitochondrial disease and loss of mitochondrial form information provided by the authors is available with DNA copy number. Am J Hum Genet 2016;99:860–876. 12. Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM. DNA double-stranded breaks the full text of this article at Neurology.org/NG. induce histone H2AX phosphorylation on serine 139. J Biol Chem 1998;273:5858–5868. 13. Hoa NN, Shimizu T, Zhou Z-W, et al. Mre11 Is Essential for the Removal of Lethal Received December 20, 2017. Accepted in final form May 24, 2018. Topoisomerase 2 Covalent Cleavage Complexes. Mol Cell 2016;64:580–592. 14. Zagnoli-Vieira G, Caldecott KW. TDP2, TOP2, and SUMO: what is ZATT about? Cell Res 2017;17:182–1406. References 15. Kirby DM, Thorburn DR, Turnbull DM, Taylor RW. Biochemical assays of re- 1. Lindahl T. Instability and decay of the primary structure of DNA. Nature 1993;362: spiratory chain complex activity. Methods Cell Biol 2007;80:93–119. 709–715. 16. Niyazov DM, Kahler SG, Frye RE. Primary mitochondrial disease and secondary 2. Goodarzi AA, Jeggo PA. The repair and signaling responses to DNA double-strand mitochondrial dysfunction: importance of distinction for diagnosis and treatment. breaks. Adv Genet. Elsevier 2013;82:1–45. Mol Syndromol 2016;7:122–137.

10 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Atypical Alexander disease with dystonia, retinopathy, and a brain mass mimicking astrocytoma

Keren Machol, MD, PhD, Joseph Jankovic, MD, Dhanya Vijayakumar, MD, Lindsay C. Burrage, MD, PhD, Correspondence Mahim Jain, MD, PhD, Richard A. Lewis, MD, Gregory N. Fuller, MD, PhD, Mingchu Xu, PhD, Dr. Dhar [email protected] Marta Penas-Prado, MD, Maria K. Gule-Monroe, MD, Jill A. Rosenfeld, MS, CGC, Rui Chen, PhD, Christine M. Eng, MD, Yaping Yang, PhD, Brendan H. Lee, MD, PhD, Paolo M. Moretti, MD, Undiagnosed Diseases Network, and Shweta U. Dhar, MD, MS

Neurol Genet 2018;4:e248. doi:10.1212/NXG.0000000000000248

Alexander disease (AD) is an autosomal dominant progressive astrogliopathy caused by pathogenic variants in glial ﬁbrillary acidic protein (GFAP).1 Clinical presentation of AD includes infantile AD, characterized by psychomotor retardation, seizures, pyramidal signs, and megalencephaly; juvenile AD, characterized by bulbar/pseudobulbar signs, hyperreﬂexia, lower limb spasticity, ataxia, loss of intellectual function, and macrocephaly; and adult-onset AD, characterized by progressive bulbar symptoms, ataxia, palatal myoclonus, bladder dysfunction, and spastic paraparesis.1

Clinical report The patient is a 35-year-old woman with progressive left hemidystonia, retinitis pigmentosa (RP), and history of brain tumor. At age 8 years, she developed vision loss, limp, afferent pupillary defect, and optic disc edema. A pilocytic astrocytoma, World Health Organization grade I, was diagnosed and resected. At age 14 years, she developed gait abnormality and progressive left hemidystonia that responded well to botulinum toxin injections. She then developed bilateral optic disc fibrosis, bitemporal hemianopia, and bilateral posterior sub- capsular cataracts and was diagnosed with RP at 22 years (figure, A–D). She also reported chronic constipation, functional megacolon, uterine leiomyomas, and dysphagia.

Family history includes nonconsanguineous unaffected parents. Physical examination showed relative macrocephaly, absent ocular horizontal and vertical pursuit, dysarthria, circumduction gait and left-sided arm dystonia, muscle atrophy, hyperreflexia, and ankle clonus. Brain MRI demonstrated a frontal resection cavity, cystic encephalomalacia, and fluctuating enhancement of the hypothalamus. At age 29 years, a new left middle cerebellar peduncle lesion was identified (figure, E and F).

The patient was enrolled in the NIH Undiagnosed Diseases Network (UDN). Whole-exome sequencing (WES) for her and her mother was completed. Her father was deceased at the time of evaluation.

From the Department of Molecular and Human Genetics (K.M., L.C.B., M.J., R.A.L., M.X., J.A.R., R.C., C.M.E., Y.Y., B.H.L., P.M.M., S.U.D.), Department of Neurology (J.J., D.V., P.M.M), and Department of Ophthalmology (R.A.L.), Baylor College of Medicine; Department of Pathology (G.N.F.), Department of Neuro-Oncology (M.P.-P.), and Department of Diagnostic Imaging (M.K.G.-M.), The University of Texas MD Anderson Cancer Center; Michael E. DeBakey VA Medical Center (P.M.M.); Baylor Genetics (C.M.E., Y.Y.); and Department of Medicine (S.U.D.), Baylor College of Medicine, Houston, TX.

The Article Processing charge was funded by NIH.

Coinvestigators are listed at links.lww.com/NXG/A59. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

A 35-year-old woman with juvenile- onset Alexander disease (AD) (A and B). Note relative macrocephaly (FOC 56 cm, 94th centile) and esotropia. The photomontage of the right (C) and left (D) eyes shows the atrophic gliosis from prior optic disc edema and the marked retinal atrophy and secondary pigmentary degeneration. The retinal vasculature appears to show glial sheathing and peripheral vaso-obliter- ation in each eye. Brain MRI with contrast at 29 years (E and F). (E) Axial T2 image demonstrates a T2 hyperintense lesion centered in the left middle cerebellar peduncle (yellow arrow). (F) Axial T1 image with contrast shows an area of central enhancement within the lesion (yellow arrow). Partially im- aged is cystic encephalomalacia within the frontal lobes bilaterally (yellow asterisk) with surgical changes in the right frontal lobe not included. Slides from patient’s brain lesion (G and H) demonstrating AD histologic features. The prototypical histologic feature of AD is prominent Rosenthal fiber formation (G, solid arrows). An additional feature unique to AD is the presence of Rosenthal fiber-like eosinophilic cytoplasmic inclusions in astrocyte cell bodies (G, open arrows). The cell body inclusions are generally not seen in other Rosenthal fiber–rich conditions such as low-grade primary brain tumors. Astrocytes with markedly atypical nuclei (H, solid arrow) are also a characteristic morphologic feature of AD and can mimic the neoplastic cells of astrocytoma or ganglioglioma. FOC = fronto-occipital circumference.

Results Pathology slides from the initial brain mass were re-examined. Histologic examination showed features of AD, including WES revealed a novel heterozygous variant of uncertain profuse Rosenthal fiber formation, Rosenthal fiber-like eosin- significance (VUS) in GFAP (MIM_137780) c.989G>C ophilic cytoplasmic inclusions in astrocyte cell bodies, and (p.R330P, NM_002055) and a heterozygous VUS c.6196G>A scattered cells with markedly atypical nuclei (figure, G and H). (p.D2066N, NM_006269) in RP1 (MIM_603937), both absent in the mother. The parental origin of the GFAP mutated Discussion allele could not be concluded based on WES data and available DNA samples. The variant in RP1 was reported in 127 Radiologic findings in AD vary with age at onset, and typical heterozygotes among 138,396 unrelated, unaffected individuals characteristics have been described for the various forms of in gnomAD database (gnomad.broadinstitute.org). Both var- AD. Serial radiologic imaging of our patient showed sequelae iants are predicted as damaging in SIFT (sorting intolerant of right frontal lobe resection, development of periventricular from tolerant; sift.jcvi.org/) and Polyphen-2 (genetics.bwh. white matter changes, and fluctuating brainstem and hypo- harvard.edu/pph2). No other contributory variants were thalamic lesions. Waxing and waning imaging findings, in the detected in 256 known retinal disease genes. absence of treatment, were inconsistent with a brain tumor.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Therefore, despite her previous diagnosis of a brain tumor, and critical revision of the manuscript. M. K. Gule-Monroe: these new findings were interpreted as non-neoplastic, and radiology interpretation and drafting the manuscript. the working diagnosis was non-MS demyelinating lesions. J. A. Rosenfeld: coordination of patient evaluation and critical Similar atypical MRI findings had been described before in revision of the manuscript. R. Chen: review of RP-related patients with molecularly proven AD.2 Dystonia and retinal genes in whole-exome sequence. Y. Yang and C.M. Eng: abnormalities have never been previously reported with AD. analysis of whole-exome sequencing. B.H. Lee: critical re- Left hemidystonia in our patient may be secondary to AD- vision of the manuscript. P.M. Moretti: neurologic evaluation related encephalomalacia or a possible delayed consequence of the patient and drafting the manuscript. S.U. Dhar: drafting of right frontal brain resection.3 The RP1 VUS in our patient is the manuscript, critical revision of the manuscript, and patient less likely to be pathogenic, given the presence of multiple management. heterozygous carriers in population databases. It is unclear whether RP is a phenotypic expansion of AD or an unrelated Acknowledgment finding (i.e., dual genetic diagnosis).4 The authors thank the patient and her family for participating in this research. They thank Alyssa Tran, Deanna Erwin, Several histologic features of AD can mimic brain tumors. and Alex Espana in the Molecular and Human Genetics Rosenthal fiber formation in astrocytes of the brain and spinal Department, Baylor College of Medicine for administrative cord, a pathologic hallmark of AD, is also seen in several assistance. low-grade primary brain tumors (e.g., pilocytic astrocytoma, ganglioglioma, and pleomorphic xanthoastrocytoma). Cytolog- Study funding ically atypical astrocytes, a recognized feature of AD,5 can also This work was supported by the BCM Intellectual and De- lead to misdiagnosis of pilocytic astrocytoma/ganglioglioma and velopmental Disabilities Research Center (HD024064) from unnecessary invasive interventions. The presence of the NICHD and NIH/NHGRI U01 HG007709 Clinical Site Rosenthal fiber–like eosinophilic cytoplasmic inclusions in for a UDN. The content is solely the responsibility of the astrocyte cell bodies serves as a “red flag,” raising the index of authors and does not necessarily represent the official views of suspicion of AD. the NIH. The Department of Molecular and Human Genetics at Baylor College of Medicine receives revenue from clinical Over 120 pathogenic variants in GFAP have been reported with genetic testing offered by Baylor Genetics. a possible dominant gain-of-function mechanism.6 GFAP p.R330P substitutes arginine, located in the evolutionarily well- Disclosure conserved structure of GFAP, with proline. Another change in K. Machol reports no disclosures. J. Jankovic has served on the the same amino acid, p.R330G, was associated previously with scientific advisory boards of, received gifts from, and received adult AD.7 The potential functional significance of the p.R330P funding for travel or speaker honoraria from Adamas Phar- substitution, our patient’s phenotype, and the histologic find- maceuticals Inc., Allergan Inc., and Teva Pharmaceutical In- ings all strongly support GFAP p.R330P being a disease-causing dustries; has served on the editorial boards of Acta Neurologica variant. Scandinavica, the Journal of Neurological Sciences, Neurology Medlink, Neurotherapeutics, Journal of Parkinson’s Disease, Although relative macrocephaly, spasticity, ocular movement and Toxins; receives publishing royalties from Cambridge, abnormalities, and autonomic disturbance (functional mega- Elsevier, Future Science Group, Hodder Arnold, Lippincott colon), as seen in our patient, have been described in juvenile Williams and Wilkins, and Wiley-Blackwell; and has received AD,1 the diagnosis of AD was delayed because of an atypical research support from Allergan Inc., CHDI Foundation, presentation, including RP, left hemidystonia, atypical MRI Civitas/Acorda Therapeutics, Dystonia Medical Research findings, and histologic features confounding the diagnosis. This Foundation, Huntington Study Group, Ipsen Limited, Kyowa case emphasizes the clinical, histologic, and radiologic challenges Haako Kirin Pharma Inc., Lundbeck Inc., Medtronic, Merz in diagnosing AD and demonstrates the importance of consid- Pharmaceuticals, Michael J. Fox Foundation for Parkinson eringADinthedifferential diagnosis of specificRosenthal Research, NIH, National Parkinson Foundation, Parkinson fiber–rich brain lesions such as pilocytic astrocytoma. Study Group, Pfizer, Prothena Biosicneces Inc., Psyadon Pharmaceuticals Inc., St. Jude Medical, and Teva Pharma- Author contributions ceutical Industries Ltd.; D. Vijayakumar reports no dis- K. Machol: drafting the manuscript and analysis of whole- closures. L.C. Burrage has received funding for travel or exome sequencing. J. Jankovic: neurologic management of the speaker honoraria from the Burroughs Welcome, the NIH, patient. D. Vijayakumar: drafting the manuscript. L.C. Bur- and the Society for Inherited Metabolic Disorders and has rage and M. Jain: analysis of whole-exome sequencing. R.A. received research support from the NIH/NIDDK, the NIH Lewis: ophthalmologic evaluation of the patient and review RDCRN, the Burroughs Welcome Fund, and the Ligums and editing of the manuscript. G.N. Fuller: revision of histo- Family. M. Jain, R.A. Lewis, G.N. Fuller, and M. Xu report no pathology and drafting the manuscript. M. Xu: review of disclosures. M. Penas-Prado has received funding for travel RP-related genes in whole-exome sequence. M. Penas-Prado: from AGIOS and LILLY and serves on the editorial board oncologic management of the patient, drafting the manuscript, of Neuro-Oncology Practice. M.K. Gule-Monroe reports no

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 disclosures. J.A. Rosenfeld serves on the editorial board of information provided by the authors is available with the full Prenatal Diagnosis and Molecular Syndromology and receives text of this article at Neurology.org/NG. research support from the NIH/National Human Genome ﬁ Research Institute. R. Chen has received research support Received February 20, 2018. Accepted in nal form May 14, 2018. from the NIH. C.M. Eng is employed by Baylor College of References Medicine, which has a joint venture with Miraca Genetics Lab. 1. Prust M, Wang J, Morizono H, et al. GFAP mutations, age at onset, and clinical Y. Yang reports no disclosures. B.H. Lee serves on the edi- subtypes in Alexander disease. Neurology 2011;77:1287–1294. 2. Barreau P, Prust MJ, Crane J, et al. Focal central white matter lesions in Alexander torial advisory boards of the Journal of Clinical Investigation, disease. J Child Neurol 2011;26:1422–1424. Human Molecular Genetics, and the Journal of Bone Mineral 3. Wijemanne S, Jankovic J. Hemidystonia-hemiatrophy syndrome. Mov Disord 2009; 24:583–589. Research and holds a patent license for helper dependent 4. Posey J, Harel T, Liu P, et al. Resolution of disease phenotypes resulting from adenoviral gene therapy for osteoarthritis and phenylbutyrate multilocus genomic variation. N Engl J Med 2017;376:21–31. 5. Borrett D, Becker L. Alexander’s disease: a disease of astrocytes. Brain 1985;108: use in Maple Syrup Urine Disease. P.M. Moretti received 367–385. research support from the NHGRI/NIH. S.U. Dhar is 6. Quinlan R, Brenner M, Goldman J, Messing A. GFAP and its role in Alexander disease. Exp Cell Res 2007;313:2077–2087. employed by the Baylor College of Medicine, which has 7. Balbi P, Seri M, Ceccherini I, et al. Adult-onset Alexander disease. J Neurol 2007;255: a joint venture with Miraca Life Services. Full disclosure form 24–30.

4 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG CLINICAL/SCIENTIFIC NOTES OPEN ACCESS De novo DNM1L mutation associated with mitochondrial epilepsy syndrome with fever sensitivity

Emma Ladds, MBBCh, Andrea Whitney, MB, BS, Eszter Dombi, BSc, Monika Hofer, BMSc, MBChB, Correspondence Geetha Anand, MRCPCH, MD, Victoria Harrison, MBChB, Carl Fratter, MPhil, MChem, Janet Carver, MSc, Dr. Poulton [email protected] Ines A. Barbosa, DPhil, Michael Simpson, PhD, Sandeep Jayawant, MD, FRCPCH, and Joanna Poulton, DM, FRCP

Neurol Genet 2018;4:e258. doi:10.1212/NXG.0000000000000258

Catastrophic epileptic encephalopathy of unclear etiology following a mild metabolic insult generally has a poor outcome. Here, we present 2 such unrelated individuals in whom whole- exome sequencing identiﬁed the same de novo recurrent mutation (c.1207C>T p.Arg403Cys) in the gene encoding the guanosine triphosphatase (GTPase) Dynamin-1 like Protein (DNM1L) (reference sequence NM_012062.4).

The dynamic fission and fusion of the intracellular mitochondrial network are essential to facilitate mitophagy and thus mitochondrial quality and function.1 During mitochondrial division, the GTPase DNM1L forms multimeric collars at specific fission sites, constricting portions of the mitochondrial reticulum and generating fragments for engulfment and degradation.2

DNM1L has been implicated in several presentations of refractory epilepsy.3 Both of our patients exhibited signs of preexisting developmental delay and presented with epilepsy during, or recently following, a febrile illness or exercise. Elevated lactate levels, epilepsia partialis continua, nonspeciﬁc imaging, and evidence of lipid storage myopathy all support mitochondrial dysfunction (See table for presentation summary and e-case report for details, links.lww. com/NXG/A63). This evidence supports an etiological role for DNM1L in mitochondrial epilepsy syndrome with fever sensitivity (MEFS).

Methods We used IN Cell Analyzer 1000 (IN Cell 1000), a previously validated high-throughput imaging method for quantifying mitophagy and mitochondrial DNA (mtDNA) in cultured ﬁbroblasts from patients compared with cultures derived from karyotypically normal controls. Cells were immunostained for the autophagy marker Light Chain 3 (LC3) and the mitochondrial import receptor, translocase of outer membrane 20 (TOM20) and analyzed with IN Cell1000. The readout for mitophagy was colocalization of LC3 puncta with TOM20-positive mitochondria.

Results We showed that the mitochondria in fibroblasts from both patients are lengthened and hyperpolarized (figure e-1, A and B, links.lww.com/NXG/A62). Total mitophagic flux was increased, showing that mitophagy is activated (figure e-1C, i). This is consistent with the

From the Harvard Chan School of Public Health (E.L.), Harvard University, Boston, MA; Department of Paediatrics (A.W.), University Hospital Southampton NHS Foundation Trust; Nuffield Department Women’s + Reproductive Health (E.D., J.C., J.P.), University of Oxford, The Women’s Centre; Department of Neuropathology (M.H.), Oxford University Hospitals NHS Foundation Trust; Oxford Children’s Hospital (G.A., S.J.), Oxford University Hospitals NHS Foundation Trust; Wessex Clinical Genetics Service (V.H.), University Hospital South- ampton NHS Foundation Trust; and Department of Medical and Molecular Genetics (C.F., I.A.B., M.S.), King’s College London School of Basic and Medical Biosciences, London, United Kingdom.

Case 1 Case 2

Prepresentation development Moderate language delay Mild general developmental delay

Seizure features Age 3: focal status epilepticus; continuous partial Age 5: asymmetric generalized tonic-clonic seizures and a right hemiparesis seizures provoked by febrile illness.

Age 6: focal and convulsive status epilepticus

Persistent right-sided clonic and occasional non- or generalized convulsive status epilepticus

Etiological insult 5 days after influenza vaccination; concurrent Shortly after febrile illness or exercise mild febrile illness

Biochemical findings Increased lactate level (2.7 mmol/L) Increased lactate level (2.5 mmol/L)

EEG findings Left frontotemporal eliptogenic focus Focal right-sided clonic seizures associated with left frontal ictal onset; nonconvulsive status epilepticus with bilateral slow spike waves

MRI findings Transient left thalamic lesion with progression of Normal morphology and myelination; global T2 white matter hyperintensity bilateral cerebral volume loss

Muscle biopsy Variable muscle fiber size and type II atrophy Type II atrophy and cytochrome oxidase negative (COX-negative) succinate dehydrogenase- positive (SDH-positive) fibers

Muscle lipid Increased Prominent in type I fibers

Muscle mtDNA 33% of expected (borderline low) 71% of expected (normal)

Mitochondrial appearance Prominent—consistent with long mitochondria Prominent—consistent with long mitochondria in fibroblasts in fibroblasts

Mitochondrial activity Borderline low complex IV Normal

Whole mitochondrial genome sequencing No pathologic variants No pathologic variants

Genes implicated in autosomal mitochondrial No abnormalities in 17 genes Normal NPC1, NPC2, and POLG disorders

Whole-exome sequencing c.1207C>T p.Arg403Cys in DNML1 c.1207C>T p.Arg403Cys in DNML1

Treatment Moderate response to carbamazepine, Moderate response to levetiracetam, clobazam, and coenzyme Q carbamazepine, and clobazam

mtDNA depletion documented in fibroblasts (figure e-1C, iii) a milder phenotype, both in terms of mitochondrial structural and the borderline low mtDNA content in skeletal muscle and functional abnormalities and symptom severity. from patient 1 (table). Previously described cases similarly display several years of Discussion relatively normal development followed by severe, refractory epilepsy following a mild metabolic insult, vaccinations, or low- In 2 patients, we identified a de novo dominant mutation in grade fever, resulting in profound global developmental delay.3 DMN1L, the same mutation having now been identified in 4 As in case 1, nonspecific thalamic hyperintensities were seen on unrelated patients with refractory epilepsy.3 Presentation MRI scans on the 2 previously reported probands with the features and investigation findings supported an underlying p.Arg403Cys mutation.3 Case 2 demonstrated diffuse cerebral mitochondrial pathology. Altered mitochondrial dynamics are volume atrophy. These changes are in keeping with previously now a well-established cause of disease (see supplementary reported nonspecific T2 MRI hyperintensities and cerebral or information for reference, links.lww.com/NXG/A63), and cerebellar atrophy seen in other mitochondrial disorders. It defective mitochondrial fission may both cause synaptic dys- remains to be seen whether MEFS is part of the same clinical function1 and impair responses to infection.4 spectrum of other conditions associated with status epilepticus related to febrile illnesses, i.e., new-onset refractory status epi- In mice, constitutive homozygous knockouts of Drp1 (the lepticus or febrile illness–related epilepsy syndrome.6 murine homolog of DNM1L) do not survive embryogenesis, while conditional ablation leads to developmental defects, DNM1L is required for division of mitochondria and perox- both associated with abnormal mitochondrial fission.5 Indi- isomes, interacting with receptor Mff and endoplasmic re- viduals heterozygous for DNM1L p.Arg403Cys display ticulum (ER) components. The missense mutation shared in

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG our cases lies in the middle domain of DNM1L,3 impairing conceptualization of the study and analysis of the data and oligomerization and recruitment to mitochondria3 consistent revised the manuscript. with our findings of elongated mitochondria in fibroblasts from both patients (figure e-1A, links.lww.com/NXG/A62). Study funding Furthermore, knockdown of the DNM1L ortholog Drp1 in The authors acknowledge Kate Sergeant and Charu Desh- mouse cells and its ligand Mff can each cause mtDNA de- pande for their involvement in whole-exome sequencing and pletion and mitochondrial dysfunction,7 consistent with the parental testing of case 1, which was supported by the Lily borderline low mtDNA content and COX activity in skeletal Foundation. muscle we demonstrated in case 1. This is likely due to increased mitophagic flux (figure e-1C, i). Disclosure E. Ladds reports no disclosures. A Whitney has served on the Our findings suggest that DNM1L is implicated as a genetic scientific advisory board of Zogenix and has received funding contributor to MEFS. DNM1L p.Arg403Cys mutation for speaker honoraria from Zogenix. E. Dombi, M. Hofer, G. screening could therefore be useful in patients with similar Anand, V. Harrison, C. Fratter, and J. Carver report no dis- presentations and in identifying impaired mitochondrial fis- closures. I.A. Barbosa has received research funding from the 1 sion causing synaptic dysfunction and defective response to Lily Foundation. M. Simpson is employed by Genomics Plc. infection. S. Jayawant reports no disclosures. J. Poulton receives research support from the Lily Foundation, the Wellcome Author contributions Trust, and the UK Medical Research Council. Full disclosure E. Ladds wrote the initial case reports and manuscript draft, form information provided by the authors is available with the was part of the editing and submissions process, and prepared full text of this article at Neurology.org/NG. the cases for presentation at the British Paediatric Neurology Association Conference 2018. A. Whitney was the pediatri- Received February 5, 2018. Accepted in final form May 23, 2018. cian responsible for identifying SP and summarizing his case. E. Dombi and M. Hofer performed the laboratory tests and References 1. Itoh K, Nakamura K, Iijima M, Sesaki H. Mitochondrial dynamics in neuro- analysis of the data. G. Anand was the pediatrician responsible degeneration. Trends Cell Biol 2013;23:64–71. for initially summarizing MN’s clinical presentation with the 2. Smirnova E, Griparic L, Shurland DL, van der Bliek AM. Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 2001; key learning points, bringing together the coauthors, and 12:2245–2256. initiating and supervising case presentation at the National 3. Fahrner JA, Liu R, Perry MS, Klein J, Chan DC. A novel de novo dominant negative mutation in DNM1L impairs mitochondrial fission and presents as childhood epi- British Paediatric Neurology Association Conference 2018. leptic encephalopathy. Am J Med Genet A 2016;170:2002–2011. He also contributed to the final editing process. V. Harrison 4. Shahni R, Cale CM, Anderson G, et al. Signal transducer and activator of transcription 2deficiency is a novel disorder of mitochondrial fission. Brain 2015;138:2834–2846. initiated the laboratory tests and analysis of the data. C. 5. Cahill TJ, Leo V, Kelly M, et al. Resistance of dynamin-related protein 1 oligomers to Fratter, J. Carver, and I.A. Barbosa performed the laboratory disassembly impairs mitophagy, resulting in myocardial inflammation and heart failure. J Biol Chem 2015;290:25907–25919. tests and analysis of the data. M. Simpson performed the 6. Gaspard N, Hirsch LJ, Sculier C, et al. New-onset refractory status epilepticus whole-exome sequencing. S. Jayawant was the pediatric neu- (NORSE) and febrile infection-related epilepsy syndrome (FIRES): state of the art ’ and perspectives. Epilepsia 2018;59:745–752. rology consultant responsible for MN s clinical care and 7. Parone PA, Da Cruz S, Tondera D, et al. Preventing mitochondrial fission impairs mito- identifying the case for publication. J. Poulton performed chondrial function and leads to loss of mitochondrial DNA. PLoS One 2008;3:e3257.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 CLINICAL/SCIENTIFIC NOTES OPEN ACCESS GLRA1 mutation and long-term follow-up of the ﬁrst hyperekplexia family

Martin Paucar, PhD, MD, Josefine Waldthaler, MD, and Per Svenningsson, PhD, MD Correspondence Dr. Svenningsson Neurol Genet 2018;4:e259. doi:10.1212/NXG.0000000000000259 [email protected]

Hyperekplexia (HPX) is a rare familial disorder characterized by an exaggerated startle reflex and stiffness at birth. In 1958, Boris P. Silfverskiöld published a report on a Swedish family affected by “emotionally precipitated drop seizures.”1 This first description of HPX became seminal, but it would take 35 years before mutations in the glycine receptor subunit alpha-1 (GLRA1) gene were discovered as the cause of this disease.2 Subsequently, SLC6A5 and GLRB mutations were discovered as causes of HPX.3 Here, we present a 60-year follow-up of the Silfverskiöld family found to harbor the R271Q mutation in the GLRA1 gene. Some affected patients in this family display unreported features for HPX.

Methods This report was made within the frame of a study approved by the local ethics committee (Etikprövningsnämnden 2016/1661-31). The family consisted of 4 affected patients (figure). Phenotype details are provided in the original article and summarized in table e-1 (links.lww.com/ NXG/A64). Briefly, 3 patients had early-onset violent and injurious falls triggered by unexpected stimuli (II-1, II-2, and III-1) causing a skull fracture in 2 (II-1 and II-2). Three patients had hypnagogic myoclonus and a good response to phenobarbital. At times, symptoms receded spontaneously in patient II-1. Reported onset in I-1 (J.E.) was at age 40 years; he had startle with falls once or twice per year. Siblings II-1 (A.W.) and II-2 (B.E.) lost consciousness sometimes after startle-related falls.1 Patient II-1 was diagnosed with late-onset dementia and died at age 87 years; patient II-2 was found drowned in a bathtub at age 76 years. Patient III-1 was aged 10 years at the time of the publication; at present, she is a 66-year-old retired school teacher. She was diagnosed with stiff baby syndrome. Patient III-1 had symptoms until age 13 years. At that point, symptoms receded spontaneously until age 27 years. When her symptoms reappeared, beneficial treatment with clonazepam was started and continued since then. Patient IV-1, born in 1976, presented with insidious clumsiness starting in childhood and later startle reactions. She underwent surgery for umbilical hernia at age 1 year. Stiffness became gradually persistent between startle reactions during adolescence; treatment with clonazepam was started at age 22 years. She has also been on continuous antidepressant treatment; Gabapentin was added later because of diffuse pain. She works part time as a preschool teacher. At age 32 years, she developed anxiety, weight loss, and gait difficulties. On examination, an exaggerated head-retraction reflex, hesitant gait, tremulous jerks in all extremities, and tremor of variable frequency were evident; the latter indicates a functional overlay. EMG displayed 80 ms polymorph bursts with a constant frequency of 7 Hz; there was no evidence of neuropathy; MRI of her brain was normal. The heterozygous mutation c.896G>A (R271Q) in GLRA1 was found in patients III-1 and IV-1.

Discussion The R271Q mutation in GLRA1 found in the Silfverski¨old family is consistent with a phenotype previously described in association with GLAR1 mutations. HPX phenotype was variable in this

From the Section of Neurology, Department of Clinical Neuroscience, Karolinska Institutet, Stockholm, Sweden.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 delay, learning disabilities, or sudden death.3 These features are Figure Updated pedigree of the Silfverskiold¨ hyperekplexia more likely to occur in patients with biallelic GLRA1 mutations family described originally in 1958 or in HPX associated with mutations in SLC6A5 and GLRB.3 Less often are heterozygous GLAR1 mutations associated with mild developmental delay.3 R271Q is the most common dominant GLRA1 mutation identified in families of different ethnicities; a founder effect among Caucasian patients has been proposed.3,5 R271Q is located in the second membrane- spanning domain of the receptor, which is expressed on the cell surface but displays reduced current and channel opening.6

HPX occurs also as part of severe neurodevelopmental syndromes associated with mutations in ARHGEF9 and GPHN, the latter is a lethal condition, which illustrates the importance of etiologic diagnosis. A variety of animal models and in vitro studies have provided valuable knowledge on HPX associated with GLRA1 mutations,3,6,7 but questions about pathophysiology and variable expressivity still await answers.

Author contributions M. Paucar, J. Waldthaler, and P. Svenningsson: study concept, data collection, and writing of the manuscript. P. Svennings- son: editing of the manuscript.

Acknowledgment The authors are grateful to the patients for consenting to this report and to Dr. Ruth H. Walker for review of the draft.

Study funding This study was supported by the Stockholm County Council.

Disclosure M. Paucar and J. Waldthaler have received research support from the Stockholm County Council. P. Svenningsson serves Phenotype details on patients III-1 and IV-1 are provided in the text, both fi patients harbor the recurrent R271Q mutation in GLRA1. or has served on the scienti c advisory board of CBD sol- utions AB; serves or has served on the editorial boards of PLoS One and Neuropharmacology; and has received research support from the Swedish Research Council, ALF Stockholm, family, but there are some novel features. For instance, the and Wallenberg. Full disclosure form information provided by waxing and waning course (patient II-1) and adult onset (I-1) the authors is available with the full text of this article at have not been described in other GLRA1 mutations. In addi- Neurology.org/NG. tion, another patient (III-1) had a spontaneous remission for 14 years. Anxiety is unreported in HPX; in the index case, this Received March 23, 2018. Accepted in final form June 6, 2018. feature could be related to fears of fall. Also unusual is the absence of perinatal stiffness, considered as one of the di- References 1. Kirstein L, Silfverskiold BP. A family with emotionally precipitated drop seizures. Acta agnostic criteria for HPX, and the functional overlay in the Psychiatr Neurol Scand 1958;33:471–476. index case. Incongruence and variable frequency of tremor in 2. Shiang R, Ryan SG, Zhu YZ, et al. Mutations in the alpha 1 subunit of the inhibitory glycine receptor cause the dominant neurologic disorder, hyperekplexia. Nat Genet the index case are compatible with a psychogenic movement 1993;5:351–358. disorder. Reports on the occurrence of psychogenic movement 3. Thomas RH, Chung SK, Wood SE, et al. Genotype-phenotype correlations in hyperekplexia: apnoeas, learning difficulties and speech delay. Brain 2013;136: disorders in the context of a positive family history of hyper- 3085–3095. kinesias are scarce.4 HPX is responsive to clonazepam, and the 4. Bentivoglio AR, Loi M, Valente EM, Ialongo T, Tonali P, Albanese A. Phenotypic ff 3 variability of DYT1-PTD: does the clinical spectrum include psychogenic dystonia? Vigevano maneuver is e ective during the neonatal period. Mov Disord 2002;17:1058–1063. HPX associated with GLRA1 mutations is in most cases an 5. Thomas RH, Drew CJG, Wood SE, et al. Ethnicity can predict GLRA1 genotypes in 2,3 hyperekplexia. J Neurol Neurosurg Psychiatry 2015;86:341–343. autosomal recessive disease. Hypnagogic myoclonus and 6. Chung SK, Vanbellinghen JF, Mullins JG, et al. Pathophysiological mechanisms of umbilical hernia have been described in association with dominant and recessive GLRA1 mutations in hyperekplexia. J Neurosci 2010;30: fi 9612–9620. GLRA1 mutations. We did not nd any of the other features 7. Harvey RJ, Topf M, Harvey K, Rees MI. The genetics of hyperekplexia: more than associated with HPX such as apnea, seizures, developmental startle! Trends Genet 2008;24:439–447.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Case of late-onset Sandhoﬀ disease due to a novel mutation in the HEXB gene

Angela R. Sung, MD, Paolo Moretti, MD, and Aziz Shaibani, MD Correspondence Dr. Shaibani Neurol Genet 2018;4:e260. doi:10.1212/NXG.0000000000000260 [email protected]

Sandhoﬀ disease is one of a group of autosomal recessive conditions known as the GM2 gangliosidoses. Normal breakdown of GM2 gangliosides is performed by the enzyme β-hexosaminidase A. This enzyme consists of 2 subunits (α and β), which are encoded by the HEXA and HEXB genes, respectively. Mutations in either of these genes result in buildup of the GM2 gangliosides, with HEXA mutations producing a phenotype of Tay-Sachs disease and HEXB mutations causing Sandhoﬀ disease.

The classic form of Sandhoff disease presents in infancy with symptom onset between ages 2 and 9 months. Symptoms include progressive weakness, intellectual disability, vision and hearing impairment, exaggerated startle response, seizures, and death usually before age 3. Late- onset forms of Sandhoff disease have been described but are much rarer. Adult-onset cases can present with a wide spectrum of symptoms, including spinocerebellar ataxia, motor neuron disease, sensorimotor neuropathy, tremor, dystonia, and psychosis.1 Specifically, in reviewing cases with the motor neuron disease phenotype, most reports describe predominant lower motor neuron features, with few cases showing both upper and lower motor neuron findings similar to amyotrophic lateral sclerosis.2,3 More recent reports have identified an increasing number of novel sequence variants (often compound heterozygous point mutations) that are associated with the motor neuron disease phenotype,4,5 although the mechanism by which these variants produce this specific phenotype is not well understood.

Case presentation A 40-year-old woman was referred for evaluation of slowly progressive weakness of the lower extremities over the course of 3 years. She reported weakness affecting both legs, difficulty standing from a chair, poor balance, and twitching in her thigh muscles. Additional symptoms included anxiety, mood fluctuations, decreased concentration, generalized fatigue, and poor sleep. She denied numbness, pain, arm weakness, difficulty with breathing, speaking, or swallowing.

On physical examination, she had mild weakness in the hip flexors, knee flexors, and knee extensors, with full strength in all other muscle groups. There was mild atrophy of the knee extensors with rare fasciculations. Deep tendon reflexes were reduced at the knees, but intact elsewhere. Tandem gait was slightly impaired. The rest of the neurologic examination was within normal limits.

Brain MRI revealed mild cerebral and cerebellar atrophy with preferential involvement of the superior vermis. Lumbar spine MRI was signiﬁcant for mild degenerative changes at the L3-L4 levels and bilateral neural foraminal stenosis at the L5-S1 levels. EMG and nerve conduction

From the Department of Neurology (A.R.S.), Baylor College of Medicine; Neurology Care Line (P.M.), Michael E. DeBakey Veterans Affairs Medical Center; and Nerve and Muscle Center of Texas (A.S.), Houston, TX.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 and Drosophila melanogaster to various species of vertebrates Figure G473S conservation across species (ﬁgure).7 The presence of these 2 sequence variants in the compound heterozygous state, combined with the enzymatic assay showing decreased hexosaminidase activity, implies that these sequence variants are pathogenic and are responsible for the loss of enzymatic activity.

Late-onset Sandhoff disease is rare but should remain a diagnostic consideration in adults presenting with slowly progressive lower motor neuron disease, and discovery of new pathogenic sequence variants such as the ones discussed in this case will help further understanding of this disease and Multiple protein alignment highlighting the evolutionary conservation of glycine 473 in the human hexosaminidase subunit beta (HEXB) amino acid facilitate diagnosis in future patients. sequence. Labels: Hs = Homo sapiens;Mm=Mus musculus;Dr=Danio rerio; Dm = Drosophila melanogaster;Ce=Caenorhabditis elegans. The numbers on the right side of each sequence correspond to the last amino acid depicted. Author contributions A.R. Sung reviewed the literature, drafted the initial manuscript, and made multiple subsequent revisions. P. Moretti studies was normal except for neurogenic units in the knee investigated the 2 sequence variants discussed in this manu- extensors and hip flexors. The creatine kinase level was normal. script in genetic databases and interpreted the data. A. Shai- bani collected clinical data during clinical consultation with The pure motor nature of the findings and the EMG results the patient and performed testing that led to the discovery of suggested a chronic form of lower motor neuron disease, and the discussed sequence variants; he also made multiple revi- the MRI findings did not adequately explain her symptoms. sions to the manuscript. The picture was not typical of any of the common lower motor neuron diseases. Because there is no inclusive panel for Study funding ff genetic motor neuron diseases and the a ected gene could not No targeted funding reported. be pinpointed clinically, whole-exome sequencing (WES) was performed for further evaluation. WES revealed a compound Disclosure heterozygous mutation in the HEXB gene on chromosome 5 A.R. Sung reports no disclosures. P. Moretti has received re- (c.298delC pathogenic variant and G473S likely pathogenic search support from the New Jersey Commission on Brain variant). Subsequent hexosaminidase enzymatic testing Injury Research and the Department of Veterans Affairs. A. revealed reduced total hexosaminidase activity in leukocytes Shaibani receives publishing royalties from Oxford University (14% that of normal controls), consistent with a GM2 gan- Press. Full disclosure form information provided by the authors gliosidosis. In addition, there was a high ratio of hexosamin- is available with the full text of this article at Neurology.org/NG. idase A to B activity (79%), supporting a diagnosis of Sandhoff disease. Received February 28, 2018. Accepted in final form May 8, 2018.

References Discussion 1. Johnson WG. The clinical spectrum of hexosaminidase deficiency diseases. Neurology 1981;31:1453–1456. This case describes 2 new sequence variants found in a patient 2. Delnooz CCS, Lefeber DJ, Langemeijer SMC, et al. New cases of adult-onset Sandhoff with clinical symptoms of Sandhoff disease. The population disease with a cerebellar or lower motor neuron phenotype. J Neurol Neurosurg Psychiatry 2010;81:968–972. frequency of these 2 sequence variants was investigated using 3. Scarpelli M, Tomelleri G, Bertolasi L, Salviati A. Natural history of motor neuron the Genome Aggregation Database (gnomAD), which disease in adult onset GM2-gangiosidosis: a case report with 25 years of follow up. Mol Genet Metab Rep 2014;1:269–272. aggregates data on 123,136 exomes and 15,495 genomes from 4. Yoshizawa T, Kohno Y, Nissato S, Shoji S. Compound heterozygosity with two novel unrelated individuals.6 The c.298delC variant in HEXB is mutations in the HEXB gene produces adult Sandhoff disease presenting as a motor neuron disease phenotype. J Neurol Sci 2002;195:129–138. predicted to result in loss of protein function and is absent 5. Banerjee P, Boyers MJ, Berry-Kravis E, Dawson G. Preferential beta-hexosaminidase from the gnomAD, indicating a very rare, likely pathogenic (Hex) A (alpha beta) formation in the absence of beta-Hex B (beta beta) due to heterozygous point mutations present in beta-Hex beta-chain alleles of a motor variant. The G473S variant in HEXB has been observed only neuron disease patient. J Biol Chem 1994;269:4819–4826. once in the heterozygous state in the gnomAD. The amino 6. Lek M, Karczewski KJ, Minikel EV, et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 2016;536:285–291. acid position 473 is highly conserved across evolution, with an 7. MARRVEL [Database online]. Houston: Baylor College of Medicine; 2017. Available invariant glycine residue present from Caenorhabditis elegans at: marrvel.org/. Accessed May 9, 2007.

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Independent NF1 mutations underlie caf´e-au-lait macule development in a woman with segmental NF1

Morgan E. Freret, PhD, Corina Anastasaki, PhD, and David H. Gutmann, MD, PhD Correspondence Dr. Gutmann Neurol Genet 2018;4:e261. doi:10.1212/NXG.0000000000000261 [email protected]

Segmental neurofibromatosis type 1 (NF1) is an under-recognized form of NF1 caused by postzygotic somatic loss-of-function NF1 gene mutations that affect a subset of cells in the body.1 This is in contrast to classic or generalized NF1, in which a germline NF1 gene mutation affects all diploid cells in the body. In the segmental NF1 variant, individuals typically exhibit clinical features characteristic of generalized NF1, such as café-au-lait macules (CALMs), skinfold freckling, and neurofibromas, restricted to one segment of the body. For this reason, establishing the diagnosis can be challenging because the underlying NF1 gene mutation is often not detected in the blood. Underscoring the challenges of caring for individuals with this variant of NF1, we describe a woman with segmental NF1 referred to us at 22 years of age for evaluation.

The patient first came to medical attention at four months of age when her pediatrician noted that she had more than six CALMs localized to her right abdomen, back, and hip. Over the next five years, she developed additional hyperpigmented macules in this region, followed by freckling in the right inguinal region. Collectively, these findings met the criteria for a diagnosis of segmental NF1. On examination, the CALMs and skinfold freckling in the affected region did not cross either the anterior or posterior midlines, and there were no neurofibromas, other hyperpigmented lesions, or Lisch nodules detected. Because the affected body segment could potentially include her right ovary, at 28 years of age, she underwent genetic testing (direct Sanger sequencing, mixed ligation-dependent probe amplification, and interphase fluorescence in situ hybridization [FISH]), which failed to identify an NF1 gene mutation in her blood. She subsequently underwent biopsy of three of her CALMs (right lower back, hip, and abdomen), followed by primary culture of these skin melanocytes for genetic testing as above.2 As shown in the figure, sequencing and FISH revealed that all three CALM-derived melanocyte cultures shared a common 1.4 megabase deletion of the NF1 gene (type 1 total gene deletion [TGD]). Furthermore, in each of the three CALMs, a different second-hit mutation was identified that affected the remaining (non-deleted) NF1 gene copy.

This case report is instructive for several reasons. First, it underscores the utility of analyzing the affected tissues (e.g., melanocytes from multiple CALMs), rather than the blood, in establishing a diagnosis of segmental NF1. Although this patient met the diagnostic criteria for segmental NF1 on clinical grounds (regional distribution of CALMs and inguinal freckling), the genetic findings provide a reference for future prenatal genetic counseling and diagnostic testing.3 Second, genetic testing of affected tissue suggests that this patient sustained a total NF1 gene deletion during post-zygotic development and thus affected only a subset of her cells. Indi- viduals with the generalized form of NF1 who harbor this type of mutation (type 1 TGD) frequently have a more severe phenotype, with greater numbers of neurofibromas and an increased risk of cancer, compared with individuals with generalized NF1 caused by other NF1 gene mutations.4 By contrast, this patient with segmental NF1 has no visible neurofibromas and is otherwise healthy, which is different from a previous report of several patients with segmental

From the Department of Neurology (M.E.F., C.A., D.H.G.), Washington University School of Medicine, Saint Louis, MO; and Harvard Medical School (M.E.F.), Boston, MA.

The Article Processing Charge was funded by NIH. This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND), which permits downloading and sharing the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 Figure Unique second neurofibromatosis type 1 (NF1) gene mutations in multiple caf´e-au-lait macules (CALMs) from an individual with segmental NF1

(A) Segmental or mosaic NF1 is caused by de novo NF1 gene mutations that occur during postzygotic development and affect only a subset of cells in the body. Genetic testing of melanocytes derived from three different CALMs in the patient’s affected body segment (denoted by the diagonal stripes) revealed a common 1.4 megabase (MB) deletion, resulting in total loss of one copy of the NF1 gene, and three unique second-hit mutations affecting the remaining NF1 allele. The insets depict both NF1 gene copies in the indicated cell types. (B) Locations (colored pinheads) and predicted messenger RNA (mRNA) and protein changes resulting from the second NF1 gene mutations in melanocytes derived from three different CALMs. Two intronic mutations were located within splice sites, and one exonic mutation resulted in a premature stop codon (nonsense mutation). Short black boxes denote introns; tall gray boxes denote exons.

NF1andtype1TGDs.5 In that series, four of the five cases neoplasms (i.e., neurofibromas) that arise in this population had either numerous dermal neurofibromas or a plexiform of tumor-prone individuals. neurofibroma. The less severe phenotype in the current subject suggests that, compared with previously reported Author contributions cases, (1) her total NF1 gene deletion may have arisen at M.E. Freret contributed to manuscript preparation and made a later developmental stage, (2) it is restricted to a different the figure. C. Anastasaki contributed to manuscript prepara- population of cells, or (3) modifier genes additionally in- tion. D.H. Gutmann wrote the first draft of the manuscript. fluence clinical expression. Third, each of the CALMs in this patient contained melanocytes harboring a unique second Study funding NF1 gene mutation that presumably resulted in loss of or This work was supported by the NIH (1-R35-NS07211-01, impaired function of the NF1-encoded protein (neuro- D.H. Gutmann). fibromin) in those cells. This finding is consistent with previous reports demonstrating biallelic NF1 gene in- Disclosure activation in CALMs,6,7 similar to that observed in benign M.E. Freret and C. Anastasaki report no disclosures. D.H. tumors from patients with NF1.2 The finding that the Gutmann holds patents for the identification of the ND1 gene second-hit mutations were distinct in each CALM argues and mTOR regulator; has received research support from the that each macule arose independently, similar to benign US Army Department of Defense, the Giorgio Foundation,

2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG the Children’s Tumor Foundation, and the Neurofibroma- 2. Maertens O, De Schepper S, Vandesompele J, et al. Molecular dissection of isolated disease features in mosaic neurofibromatosis type 1. Am J Hum Genet 2007;81: tosis Acceleration Therapeutics Program; receives license fee 243–251. payments for the TSC1 knockout mouse; and receives royalty 3. Ko Y, Lee C, Lee H, Lee M, Lee JS. Clinical application of next-generation sequencing for the diagnosis of segmental neurofibromatosis. J Dermatol Sci 2017;88:370–372. payments for the NF1 gene patent. Full disclosure form in- 4. Kehrer-Sawatzki H, Mautner VF, Cooper DN. Emerging genotype-phenotype rela- formation provided by the authors is available with the full tionships in patients with large NF1 deletions. Hum Genet 2017;136:349–376. 5. Messiaen L, Vogt J, Bengesser K, et al. Mosaic type-1 NF1 microdeletions as a cause of text of this article at Neurology.org/NG. both generalized and segmental neurofibromatosis type-1 (NF1). Hum Mutat 2011; 32:213–219. Received March 20, 2018. Accepted in final form April 24, 2018. 6. Eisenbarth I, Assum G, Kaufmann D, Krone W. Evidence for the presence of the second allele of the neurofibromatosis type 1 gene in melanocytes derived from cafe au laitmacules of NF1 patients. Biochem Biophys Res Commun 1997;237:138–141. References 7. De Schepper S, Maertens O, Callens T, Naeyaert JM, Lambert J, Messiaen L. Somatic 1. Listernick R, Mancini AJ, Charrow J. Segmental neurofibromatosis in childhood. Am J mutation analysis in NF1 cafe au lait spots reveals two NF1 hits in the melanocytes. Med Genet A 2003;121A:132–135. J Invest Dermatol 2008;128:1050–1053.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3 CLINICAL/SCIENTIFIC NOTES OPEN ACCESS Novel ELOVL4 mutation associated with erythrokeratodermia and spinocerebellar ataxia (SCA 34)

Pierre R. Bourque, MD, Jodi Warman-Chardon, MD, Daniel A. Lelli, MD, Lauren LaBerge, MD, Correspondence Carly Kirshen, MD, Scott H. Bradshaw, MD, Taila Hartley, MSc, and Kym M. Boycott, PhD, MD Dr. Bourque [email protected] Neurol Genet 2018;4:e263. doi:10.1212/NXG.0000000000000263

Erythrokeratodermia (EK) is a rare skin disorder, likely genetic and usually present from infancy.1 There is patchy symmetrical involvement over the body surface, manifested in progressive ﬁgurate plaques of hyperkeratosis and more transient areas of erythema. There is signiﬁcant overlap in the clinical and genetic features of the “variabilis” and “progressiva” forms of EK. Restricted cutaneous syndromes of EK have been described associated with mutations in the connexin (GJB3, GJB4,andGJA1) and loricrin (LOR) genes. The majority of patients with EK, however, have no pathogenic mutations in the GJB genes or LOR.

Three diﬀerent mutations in the ELOVL4 gene have so far been described in patients pre- – senting with a combination of EK and spinocerebellar ataxia (SCA34).2 4 We describe here a novel variant in ELOVL4 associated with this syndrome. This case draws attention to the importance of assessing subtle chronic neurologic dysfunction in patients presenting with EK and, conversely, being aware of the occurrence of characteristic cutaneous lesions in this newly described syndrome of spinocerebellar ataxia.

Case description and genetic results A 60-year-old woman was referred for assessment of visual blurring and diplopia. Her cutaneous disorder manifested around age 4 years, with widespread variable itchy areas of erythema and progressive localized skin thickening. She had no success with topical Tazorac and compounded creams. Oral acitretin (25 mg) was helpful but discontinued because of alopecia. Although her visual symptoms had only gradually appeared at age 50 years, she reported noticing ataxia of gait as far back as teenage years. Her parents who were deceased at age 73 years and age 84 years had reported no symptoms of rash or ataxia. Her 5 siblings, similarly, were asymptomatic from the dermatologic and neurologic standpoint. Two children were biologically unrelated (adopted).

On examination, there were widespread demarcated brown erythematous keratotic plaques typical of EK over her wrists, hands, inner thighs, knees, and ankles (figure, A and B). Neuro- ophthalmic deficits included square wave jerks, saccadic pursuit, and alternating skew deviation with superimposed periodic alternating skew deviation in primary position (period 2.5 minutes). Myotatic reflexes were diffusely reduced (1+) and absent at the ankles. There was moderate rombergism and marked tandem gait ataxia, but no appendicular dysmetria. A skin biopsy showed irregular acanthosis, papillomatosis, and hyperkeratosis, in keeping with EK.

From the Department of Medicine (Neurology) (P.R.B., J.W-C., D.A.L.), University of Ottawa; Ottawa Hospital Research Institute (P.R.B., J.W-C.); Department of Medicine (Dermatology) (L.L., C.K.), University of Ottawa; Department of Anatomical Pathology (S.H.B.), University of Ottawa; and Department of Genetics (J.W-C., T.H., K.M.B.), Children’s Hospital of Eastern Ontario, Ottawa, Canada.

Copyright © 2018 The Author(s). Published by Wolters Kluwer Health, Inc. on behalf of the American Academy of Neurology. 1 (1.0), and MutationTaster (1.0) predict the variant to be dam- Figure Erythrokeratodermia (lower limbs) aging, and the Sorting Intolerant From Tolerant (SIFT) program predicts it to be tolerated (table). It was not possible to test parents, but 2 clinically unaffected siblings were tested and did not carry this variant. The patient was started on baclofen, starting at 5 mg tid and titrating up to 15 mg tid over 1 month. She reported significant improvement in the perception of oscillopsia and the duration and frequency of bouts of diplopia. She also elected to try application of beeswax cream (reported to contain 30-32 carbon very long chain fatty acids) on her legs for 2months,whichwasofnobenefit.

Discussion This case broadens the genetic mutation proﬁle of EK by reporting a patient withafourthvariantintheELOVL4 gene associated with SCA34 (table). The ELOVL4 gene catalyzes the

Photographs of symmetrical brownish-red hyperkeratosis, most prominent rate-limiting reaction in elongation of fatty acids with a chain over the knees, lower anterior legs and dorsal foot region. There were similar length greater than C26. It is ubiquitously expressed, but par- symmetrical lesions over the inner thigh and more subtle involvement of the dorsal forearm and wrist region. ticularly enriched in the retina. It is critical in the development of the outer layer of the epidermis, the stratum corneum.5 Rare diseases associated with dysregulation of ELOVL4 in addition to MRI of the brain showed only subtle ﬂattening of the ventral SCA34 include 2 autosomal recessive conditions: hereditary pons and mild global cerebellar atrophy. Nerve conduction macular degeneration (Stargardt disease) and a syndrome of studies and needle EMG studies were normal. ichthyosis, spastic quadriplegia, and mental retardation.6

The clinical presentation suggested the possibility of SCA34. The clinical presentation of our patient is quite similar to what ELOVL4 gene sequencing (Prevention Genetics, Marshﬁeld, was reported in a large French Canadian family with 32 af- WI) identiﬁed a variant (c.698C>T; p.Thr233Met), which has fected members.2 In this large SCA34 family, cutaneous in- not been reported in the literature or public databases. The volvement began in infancy, with a preponderance of amino acid substitution programs CADD (27.9), PolyPhen-2 hyperkeratosis over erythema. Gait ataxia was noted to start

Table Clinical and MRI features of patients with ELOVL4 mutations associated with clinical features of SCA34

Present case Ozaki et al.4 Bourassa et al.3 Cadieux-Dion et al.2

Mutation ELOVL4; c.698C>T, ELOVL4; c.736T>G, p.W246G; ELOVL4; c.539A>C, ELOVL4; c.504 G>C, p.L168F; p.Thr233Met; heterozygous heterozygous p.Gln180Pro; heterozygous heterozygous

Ethnicity English Canadian Japanese South American French Canadian

Number affected 1 clinically affected mutation 9 clinically affected from 2 1 clinically affected mutation 19 mutation carriers, 4 carrier separated families carrier clinically unaffected

Age or mean age, 15 34 Mid 20s 51 onset of gait ataxia, y

Type of ataxia Gait (no dysarthria or limb Gait, speech, and limb Speech, gait > limbs Gait (12/19), limb (9/19), and dysmetria) speech (6/19)

Progression of ataxia Independent ambulation Slow, ambulatory aid after Only 10-y follow-up Slow: use of cane after 10 y, without aid at age 60 y age 60 y use of walker by age 70 y

Oculomotor signs Saccadic pursuit, square Horizontal nystagmus (78%), Horizontal nystagmus and Horizontal nystagmus in 7/19 wave jerks, and periodic supranuclear palsy (33%), mild bilateral and slow ocular pursuit in 5/ alternating skew deviation and impaired smooth pursuit ophthalmoparesis 19 (56%)

Myotatic reflexes Hyporeflexia Hyperreflexia and Babinski Normal Hyporeflexia in 7/19 signs in 89%

Erythrokeratodermia Infantile onset and None EK of forearms and legs EK of infantile onset but persistent, though showing mostly resolving after age 25 cyclical exacerbations. y, noted in 14/19

Continued 2 Neurology: Genetics | Volume 4, Number 4 | August 2018 Neurology.org/NG Table Clinical and MRI features of patients with ELOVL4 mutations associated with clinical features of SCA34 (continued)

Present case Ozaki et al.4 Bourassa et al.3 Cadieux-Dion et al.2

Brain MRI Mild cerebellar and pontine Pontine and cerebellar Moderate cerebellar and Cerebellar and pontine basal atrophy atrophy in 100%, hot cross pontine atrophy atrophy in 6/9 carriers tested bun sing in 67%

Support for Two asymptomatic siblings Segregation with affected Variant continues to be Segregation with disease pathogenicity did not carry the mutation. members of 2 different absent from public haplotype in 19 individuals. Variant not previously families. A third family has databases (gnomAD, EVS, Variant continues to be reported in public databases been reported in ClinVar and 1000Genomes). CADD absent from public (gnomAD, EVS, and (RCV000522609.1). Variant (26.5), PolyPhen-2 (0.99), and databases (gnomAD, EVS, 1000Genomes). CADD (27.9), continues to be absent from MutationTaster (1) predict and 1000Genomes). CADD PolyPhen-2 (1.0), and public databases (gnomAD, damaging. SIFT predicts (24), PolyPhen-2 (0.99), and MutationTaster (1.0) predict EVS, and 1000Genomes). tolerated. No segregation MutationTaster (0.87) predict damaging. SIFT predicts CADD (23.5), PolyPhen-2 data. damaging. SIFT predicts tolerated. (0.99), and MutationTaster (1) tolerated. predict damaging. SIFT predicts tolerated.

ACMG variant VUS (PM2+PP3+PP4) Likely pathogenic VUS (PM2+PP3+PP4) VUS (PM2+PP1+PP3+PP4) classification (PS1+PM2+PP1+PP3+PP4)

Abbreviations: ACMG = American College of Medical Genetics and Genomics; EK = erythrokeratodermia; EVS = Exome Variant Server database; SIFT = Sorting Intolerant From Tolerant program; VUS = Variant of Unknown Significance. usually around age 50 years. Our patient may be unique in revision of the manuscript, and overview of genetic data ac- reporting prominent oculomotor symptoms. A periodic al- quisition and interpretation. ternating skew deviation was significantly improved when treated with baclofen. Study funding No targeted funding reported. The possibility of SCA34 should be considered in patients with EK, and clinicians should be aware that cerebellar Disclosure manifestations are relatively late and variable, whereas cuta- All authors have no financial disclosures relevant to this re- neous involvement has an onset early in childhood. SCA34 search and publication. Full disclosure form information should thus be considered in the differential diagnosis of ge- provided by the authors is available with the full text of this netic neurocutaneous disorders. Oculomotor manifestations article at Neurology.org/NG. should be specifically assessed because they may be improved with treatment. Received February 21, 2018. Accepted in final form May 7, 2018.

Author contributions References 1. Ishida-Yamamoto A. Erythrokeratodermia variabilis et progressiva. J Dermatol 2016; P.R. Bourque: analysis and interpretation and production and 43:280–285. revision of the manuscript. J. Warman Chardon: analysis and 2. Cadieux-Dion M, Turcotte-Gauthier M, Noreau A, et al. Expanding the clinical phenotype associated with ELOVL4 mutation: study of a large French-Canadian interpretation and critical revision of the manuscript. D.A. family with autosomal dominant spinocerebellar ataxia and erythrokeratodermia. Lelli: acquisition and interpretation of neuro-ophthalmology JAMA Neurol 2014;71:470–475. 3. Bourassa C, Raskin S, Seraﬁni S, Teive HA, Dion PA, Rouleau GA. A new ELOVL4 data and critical revision of the manuscript. L. LaBerge: ac- mutation in a case of spinocerebellar ataxia with erythrokeratodermia. JAMA Neurol quisition and revision of dermatology data and critical revision 2015;72:942–943. 4. Ozaki K, Doi H, Misui J, et al. A novel mutation in ELOVL4 leading to spinocerebellar of the manuscript. C. Kirshen: acquisition and revision of ataxia (SCA) with the hot cross bun sign but lacking erythrokeratodermia: a broad- clinical dermatology data and critical revision of the manu- ened spectrum of SCA34. JAMA Neurol 2015;72:797–805. 5. Cameron DJ, Tong Z, Yang Z, et al. Essential role of ELOVL4 in very long chain fatty script. S.H. Bradshaw: acquisition and interpretation of acid synthesis, skin permeability barrier function, and neonatal survival. Int J Biol Sci dermatopathology data and critical revision of the manuscript. 2007;3:111–119. 6. Aldahmesh MA, Mohamed JY, Alkuraya HS, et al. Recessive mutations in ELOVL4 T. Hartley: preparation of the table and assessment of ge- cause ichthyosis, intellectual disability, and spastic quadriplegia. Am J Hum Genet netic classiﬁcation. K.M. Boycott: study supervision, critical 2011;89:745–750.

Neurology.org/NG Neurology: Genetics | Volume 4, Number 4 | August 2018 3