Generic Recircumscriptions of Oncidiinae (Orchidaceae: Cymbidieae) Based on Maximum Likelihood Analysis of Combined DNA Datasets

Botanical Journal of the Linnean Society, 2012, 168, 117–146. With 12 ﬁgures

Generic recircumscriptions of Oncidiinae (Orchidaceae: Cymbidieae) based on maximum likelihood analysis of combined DNA datasets

KURT M. NEUBIG1,2, WILLIAM MARK WHITTEN1*, NORRIS H. WILLIAMS FLS1,2, MARIO A. BLANCO1,2,3, LORENA ENDARA2, JOHN GORDON BURLEIGH2, KATIA SILVERA4,5, JOHN C. CUSHMAN5 and MARK W. CHASE FLS6

1Florida Museum of Natural History, University of Florida, PO Box 117800, Gainesville, FL 32611-7800, USA 2Department of Biology, 220 Bartram Hall, PO Box 118525, University of Florida, Gainesville, FL 32611-8526, USA 3Jardín Botánico Lankester, Universidad de Costa Rica, Apartado 1031-7050, Cartago, Costa Rica 4Center for Conservation Biology, 3168 Batchelor Hall, University of California, Riverside, Riverside, CA 92521, USA 5Department of Biochemistry/ MS 200, University of Nevada Reno, NV 89557-0014, USA 6Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3DS, UK

Received 18 May 2011; revised 28 August 2011; accepted for publication 27 September 2011

Phylogenetic relationships within the orchid subtribe Oncidiinae sensu Chase were inferred using maximum likelihood analyses of single and multilocus DNA sequence data sets. Analyses included both nuclear ribosomal internal transcribed spacer DNA and plastid regions (matK exon, trnH-psbA intergenic spacer and two portions of ycf1 exon) for 736 individuals representing approximately 590 species plus seven outgroup taxa. Based on the well resolved and highly supported results, we recognize 61 genera in Oncidiinae. Mimicry of oil-secreting Malpighi- aceae and other floral syndromes evolved in parallel across the subtribe, and many clades exhibit extensive variation in pollination-related traits. Because previous classifications heavily emphasized these floral features, many genera recognized were not monophyletic. Our classification based on monophyly will facilitate focused monographs and clarifies the evolution of morphological and biochemical traits of interest within this highly diverse subtribe. © 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146.

ADDITIONAL KEYWORDS: elaiophores – euglossine pollination – hummingbird pollination – matK – mimicry – Neotropics – oil-collecting bees – nrITS – trnH-psbA – ycf1.

INTRODUCTION Neotropical flora, ranging from sea level to almost 4000 m a.s.l. in the Andes; several species of Brassia Oncidiinae (Cymbidieae) are one of the most diverse R.Br., Miltoniopsis God.-Leb. and Oncidium Sw. are subtribes of Orchidaceae, with a wide range of floral important ornamental crops. Oncidiinae are members and vegetative morphologies. They include the great- of a Neotropical clade that includes Coeliopsidinae, est diversity of pollination systems and the widest Maxillariinae, Stanhopeinae and Zygopetalinae; these range of chromosome numbers known for Orchi- five subtribes are each clearly monophyletic and daceae (greater than the rest of the orchid family collectively are sister to Eriopsidinae, although rela- combined). They also form major components of the tionships among the five subtribes still lack strong bootstrap support; for an example, see the molecular *Corresponding author. E-mail: whitten@flmnh.ufl.edu trees presented in Cribb (2009).

Previous classifications of Oncidiinae were intu- phylogenetic hypotheses. Our goal is to use combined itively based mainly on floral morphology and, to a plastid and nuclear ribosomal internal transcribed lesser extent, chromosome number, and all were pro- spacer (nrITS) data to produce a densely-sampled duced without cladistic methodology (Garay & Stacy, phylogenetic estimate of relationships within Oncidii- 1974; Dressler, 1993; Senghas, 1997). Recent molecu- nae and to use this to underpin a stable generic lar studies have helped resolve and define Oncidiinae classification (Chase, 2009b) that can be used as a and circumscribe many genera (Chase & Palmer, framework for more focused studies. 1987; Williams et al., 2001a; Williams, Chase & Whitten, 2001b; Sandoval-Zapotitla et al., 2010). Subtribes Ornithocephalinae and Telipogoninae, long POLLINATION AND FLORAL MIMICRY IN ONCIDIINAE held separate on the basis of their four pollinia Historically, many of the difficulties with generic cir- (versus two in Oncidiinae), plus the monopodial Pac- cumscription in Oncidiinae are probably the result of hyphylliinae (two pollinia), were shown to nest within homoplasy and mimicry in flower shape and colour. Oncidiinae. Dressler (1993) emphasized seed charac- Generic boundaries have long been contentious in ters, velamen type and number of nodes per pseudob- both the botanical and horticultural communities ulb in his concepts of Cymbidieae and Maxillarieae. (Garay, 1963; Braem, 2010). As in most orchid groups, However, molecular data (van den Berg et al., 2005) generic concepts have traditionally emphasized floral indicated that Cymbidieae (sensu Dressler, 1993) are characters and neglected vegetative ones. In Oncidii- likely to be paraphyletic to Maxillarieae, and the two nae, floral traits and pollination systems appear to might be regarded as a single tribe (Cymbidieae sensu be especially labile, which has undoubtedly fostered Chase et al., 2003). In the current circumscription, much of the confusion in generic boundaries and Oncidiinae include taxa with both two and four pol- resulted in many polyphyletic genera. Pollen is never linia. Largely in accordance with the generic concepts offered as a reward, and pseudopollen and resin of Chase (2009b), the subtribe includes 61 genera and rewards are unknown in Oncidiinae. Nectar is a approximately 1600 species. Before molecular phylo- reward for bees, Lepidoptera and hummingbirds, and genetic studies, subtribal delimitation varied widely, is usually presented in a nectariferous spur formed by from the relatively broad concept of Dressler (1993) the lip or the adnation of lip and column. However, to the narrow concepts of Szlachetko (1995), with nectar deceit is common, and the presence of a spur the latter splitting out approximately 20 subtribes does not always indicate nectar. Relatively few based largely on column morphology (including their species produce a fragrance reward consisting of complex pollinaria). monoterpenes, sesquiterpenes and simple aromatics. Oncidiinae exhibit an enormous diversity in form These fragrances are collected by male euglossine and function that makes them attractive subjects for bees (Apidae: Euglossini), and they are considered evolutionary studies. Floral size ranges several orders to serve a role in sexual selection by female eug- in magnitude, and flowers evolved to utilize a diverse lossines (Bembe, 2004; Eltz, Roubik & Lunau, 2005; array of pollinators. Floral rewards include nectar, Zimmermann et al., 2009). Most Oncidiinae species oils and fragrances, although deceit flowers are the have flowers that either produce an oil reward or most common pollination strategy (Chase, 2009b). are mimics of oil-producing flowers of Malpighiaceae; Chromosome numbers range from the lowest known Figure 1 (Reis et al., 2000; Silvera, 2002; Sigrist & in orchids (2n = 10) to 2n = 168 (Tanaka & Kamemoto, Sazima, 2004; Damon & Cruz-López, 2006; Reis et al., 1984) and genome size spans at least a seven-fold 2007; Carmona-Díaz & García-Franco, 2009; Vale range (Chase et al., 2005). Vegetatively, plants range et al., 2011). These oil flowers attract a variety of from large, long-lived perennials with pseudobulbs of female bees of various sizes of several different genera 1 kg or more to highly reduced twig epiphytes the size in tribes Centridini, Tapinostapidini and Tetrapediini, of a thumbnail with rapid life cycles (several months). of family Apidae (formerly assigned to a separate Most species are epiphytes, and CAM photosynthesis family, Anthophoridae, and still occasionally referred is considered to have arisen repeatedly (Silvera et al., to as ‘anthophorid’ bees). The female bees collect oil 2009, 2010a, b). Understanding the evolution of this from specialized glands (elaiophores) on the flowers range of form and function depends upon a reliable and use the oils as provisions and/or waterproofing for phylogenetic hypothesis of relationships for hundreds larval cells (Cane et al., 1983; Roubik, 1989; Melo & of species. Generic boundaries and relationships Gaglianone, 2005). Numerous species of Oncidiinae within Oncidiinae have been highly contentious, and that are putative mimics of malpighs exhibit a suite several genera have been viewed as taxa of conve- of characters that include bright yellow or purple nience (non-monophyletic; Garay, 1963). Previous evo- flowers, elaiophores consisting of epidermal pads on lutionary studies have been hampered by the choice lateral lobes of the lip or pads of trichomes on the lip of non-monophyletic groups and by a lack of reliable callus and a tabula infrastigmatica (i.e. a fleshy ridge

Figure 1. Various genera of Oncidiinae displaying putative mimicry of yellow Malpighiaceae and/or Calceolaria ﬂowers. A, Malpighia sp. (model). B, Psychopsiella limminghei (Morren ex Lindl.) Lückel & Braem. C, Grandiphyllum auriculatum (Vell.) Docha Neto. D, Trichocentrum splendidum (A.Rich. ex Duch.) M.W.Chase & N.H.Williams. E, Trichocentrum cebolleta (Jacq.) M.W.Chase & N.H.Williams. F, Trichocentrum ascendens (Lindl.) M.W.Chase & N.H.Williams. G, Rossioglossum ampliatum (Lindl.) M.W.Chase & N.H.Williams. H, Lockhartia lepticaula D.E.Benn. & Christenson. I, Fernandezia ecuadorensis (Dodson) M.W.Chase. J, Vitekorchis excavata (Lindl.) Romowicz & Szlach. K, Oncidium cultratum Lindl. L, Oncidium obryzatum Rchb.f. M, Oncidium sp. N, Oncidium sphacelatum Lindl. O, Oncidium heteranthum Poepp. & Endl. P, Gomesa gardneri (Lindl.) M.W.Chase & N.H.Williams. Q, Gomesa insignis (Rolfe) M.W.Chase & N.H.Williams. R, Gomesa longipes (Lindl. & Paxt.) M.W.Chase & N.H.Williams. S, Otoglossum harlingii (Stacy) N.H.Williams & M.W.Chase. T, Otoglossum scansor (Rchb.f.) Carnevali & I.Ramírez. U, Erycina pusilla (L.) N.H.Williams & M.W.Chase. V, Nohawilliamsia pirarense (Rchb.f.) M.W.Chase & Whitten. W, Zelenkoa onusta (Lindl.) M.W.Chase & N.H.Williams. X, Tolumnia urophylla (Lodd. ex Lindl.) Braem. Y, Tolumnia quadriloba (C.Schweinf.) Braem. Photographs by W. Mark Whitten.

at the base of the column that is grasped by the Stpiczynska & Davies, 2008; Aliscioni et al., 2009; mandibles of the bee, freeing their front and middle Davies & Stpiczynska, 2009; Pansarin, Castro & legs to collect oil). Many Oncidiinae also possess Sazima, 2009). Parra-Tabla et al. (2000) reported prominent elaiophores (Fig. 2F–J): Oncidium cheiro- that Trichocentrum ascendens (Lindl.) M.W.Chase phorum Rchb.f., Oncidium sotoanum R.Jiménez & & N.H.Williams is pollinated primarily by female Hágsater, Trichocentrum cavendishianum (Bateman) Trigona bees collecting the oily ﬂoral secrections for M.W.Chase & N.H.Williams and various species of nest construction. Species with prominent elaiophores Gomesa R.Br. (Stpiczynska, Davies & Gregg, 2007; represent legitimate oil reward ﬂowers (Fig. 2F–O).

Figure 2. Oncidiinae displaying various pollination syndromes. Row 1 (A–E) Putative mimics of purple Malpighiaceae. A, Malpighia glabra L. (model). B, Oncidium sotoanum R.Jiménez & Hágsater. C, Cyrtochilum edwardii (Rchb.f.) Kraenzl. D, Tolumnia hawkesiana (Moir) Braem. E, Cyrtochilum ioplocon (Rchb.f.) Dalström. Rows 2 and 3 (F–O) Oncidiinae that secrete oil from localized elaiophores. F, Lockhartia longifolia (Lindl.) Schltr. G, H, Cyrtochilum serratum (Lindl.) Kraenzl. (arrow denotes elaiophore). I–J, Oncidium cheirophorum Rchb.f. (arrow denotes elaiophore). K, Ornithocephalus cochleariformis C.Schweinf. L. Ornithocephalus dalstroemii (Dodson) Toscano & Dressler. M, Ornithocephalus dressleri (Toscano) Toscano & Dressler. N, Phymatidium falcifolium Lindl. O, Oncidium sp. (Sigmatostalix clade). Row 4 (P–S) Putative hummingbird-pollinated species. P, Fernandezia subbiﬂora Ruiz & Pav. Q, Brassia aurantiaca (Lindl.) M.W.Chase. R, Brassia andina (Rchb.f.) M.W.Chase. S, Oncidium beyrodtioides M.W.Chase & N.H.Williams. Row 4 (T–U) Pseudocopulatory species. T, Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir. U, Trichoceros antennifer Kunth. Row 5 (V–Y) Species pollinated by nectar-foraging insects. V, Trichocentrum longicalcaratum Rolfe. W, Comparettia macroplectron Rchb.f. & Triana. X, Rodriguezia sp. Y, Trichopilia rostrata Rchb.f. Row 5 (Z) Floral fragrance reward ﬂower pollinated by male euglossine bees. Z, Macroclinium dalstroemii Dodson. Photograph (E) courtesy Guido Deburghgraeve; all others by W. Mark Whitten. ᭣

Some oil-secreting taxa with relatively small, green- visual similarity to sympatric species of Calceolaria. ish white flowers (e.g. Ornithocephalus Hook., Phy- This extensive homoplasy in oil flower morphology matidium Lindl.; Fig. 2K–O) attract a subset of oil- has contributed to grossly polyphyletic classifications foraging bees with smaller body sizes and do not of Oncidiinae, especially in clades that contain species appear to be involved in mimicry. Perhaps a larger with bright yellow ‘oncidioid’ flowers. Floral morphol- percentage of Oncidiinae possess flowers with similar ogy, including the detailed structure of the column malpigh-mimicking colour (bee-ultraviolet-green; (Szlachetko, 1995), is clearly unreliable as the sole Powell, 2008), morphology and tabula infrastig- basis for generic circumscription. A robust phy- matica, although they lack clearly demonstrable logenetic framework based on molecular data can elaiophores. These species represent oil deceit flowers help diagnose polyphyletic groups and inform a new that lure oil-collecting bees but fail to produce a clade-based classification. legitimate reward (Fig. 1). The floral morphology of Oncidiinae is probably the MATERIAL AND METHODS result of a complex mixture of Batesian and Mülle- TAXON SAMPLING rian mimicry (Roy & Widmer, 1999). Using spectral reflectance analyses, Powell (2008) demonstrated that Specimens were obtained from wild-collected or cul- many Oncidiinae with yellow flowers closely match tivated plants (see Supporting information, Appen- the colour of yellow malpigh flowers [Byrsonima cras- dix S1); most taxon names follow the generic concepts sifolia (L.) Kunth] and thus satisfy one of the criteria of Chase (2009b), except for genera we have now for Batesian mimicry. By mapping these traits onto lumped (e.g. Brachtia Rchb.f., Ada Lindl. and Mesos- an Oncidiinae phylogenetic tree, he estimated at least pinidium Rchb.f. into Brassia; Pachyphyllum Kunth 14 independent origins of putative malpigh mimicry and Raycadenco Dodson into Fernandezia Ruiz & within Oncidiinae. Carmona-Díaz & García-Franco Pav.) or split (Psychopsiella Lückel & Braem from (2009) demonstrated that the rewardless Trichocen- Psychopsis Raf.). Sampling of Oncidiinae included 736 trum cosymbephorum (C.Morren) R.Jiménez & accessions from a total of 590 ingroup species. We Carnevali is pollinated by the same oil-collecting included seven outgroup taxa from other subtribes Centris bees that pollinate Malpighia glabra L., and of Cymbidieae (Cameron et al., 1999; Cameron, 2004). the orchid has greater reproductive success in the We were unable to obtain DNA of the following presence of the malpigh than in isolated clumps. rare, minor genera: Caluera Dodson & Determann Further, Sazima & Sazima (1988) showed that some (three species), Centroglossa Barb.Rodr. (five species), eglandular Malpighiaceae (lacking sepalar elaio- Cypholoron Dodson & Dressler (two species), Dunster- phores) are possible mimics of glandular forms. There villea Garay (one species), Platyrhiza Barb.Rodr. (one are probably complex mimicry relationships between species), Quekettia Lindl. (five species), Rauhiella Malpighiaceae species, oil-producing Oncidiinae and Pabst & Braga (three species), Sanderella Kuntze oil-deceit Oncidiinae. We also suspect that some Onci- (two species), Suarezia Dodson (one species) and diinae mimic oil-producing Calceolaria L. (Calceolari- Thysanoglossa Porto & Brade (two species). aceae) because they occur at high elevations where malpighs are absent or rare and Calceolaria spp. are EXTRACTION, AMPLIFICATION AND SEQUENCING common. For example, Otoglossum harlingii (Stacy) All freshly-collected material was preserved in N.H.Williams & M.W.Chase (Fig. 1S) bears a striking silica gel (Chase & Hills, 1991). Genomic DNA was

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 122 K. M. NEUBIG ET AL. extracted using a modified cetyl trimethylammonium trnH-psbA: This region was amplified with the bromide (CTAB) technique (Doyle & Doyle, 1987), parameters 94 °C for 3 min; 33 ¥ (94 °C for 1 min; scaled to a 1-mL volume reaction. Approximately 58 °C for 1 min; 72 °C for 1 min 20 s); 72 °C for 6 min, 10 mg of dried tissue were ground in 1 mL of CTAB with the primers F and R sensu Xu et al. (2000). 2 ¥ buffer and 2 mL of either b-mercaptoethanol or ycf1: We sequenced two noncontiguous portions of proteinase-K (25 micrograms/mL; Promega, Inc.). ycf1 (Neubig et al., 2009) including approximately Some total DNAs were then cleaned with QIAquick 1200 bp from the 5′ end and approximately 1500 bp PCR (Qiagen) purification columns to remove inhibi- from the 3′ end. Both were amplified using a ‘touch- tory secondary compounds. Amplifications were per- down’ protocol with the parameters 94 °C for 3 min; formed using an Eppendorf Mastercycler EP Gradient 8 ¥ (94 °C for 30 s; 60–51 °C for 1 min; 72 °C for S thermocycler and Sigma brand reagents in 25-mL 3 min); 30 ¥ (94 °C for 30 s; 50 °C for 1 min; 72 °C for volumes with reaction components for ITS: 0.5–1.0 mL 3 min); 72 °C for 3 min. Primers for the 5′ portion are of template DNA (approximately 10–100 ng), 11 mLof 1F (ATGATTTTTAAATCTTTTCTACTAG) and 1200R water, 6.5 mL of 5 M betaine, 2.5 mLof10¥ buffer, (TTGTGACATTTCATTGCGTAAAGCCTT). Primers

3 mL of MgCl2 (25 mM), 0.5 mL of 10 mM dNTPs, for the 3′ portion are 3720F (TACGTATGTAATGAAC- 0.5 mL each of 10 mM primers and 0.5 units of Taq GAATGG) and 5500R (GCTGTTATTGGCATCAAAC- DNA polymerase. For the plastid regions, the reaction CAATAGCG). Additional internal sequencing primers components used were: 0.5–1.0 mL of template DNA are intF (GATCTGGACCAATGCACATATT) and intR (approximately 10–100 ng), 16–18 mL of water, 2.5 mL (TTTGATTGGGATGATCCAAGG). of 10 ¥ buffer, 2–3 mL of MgCl2 (25 mM), 0.5 mLof PCR products were cleaned with Microclean™ (The 10 mM dNTPs, 0.5 mL each of 10 mM primers and 0.5 Gel Company) in accordance with manufacturer’s units (0.2 mL) of Taq polymerase. instructions. Purified PCR products were then cycle- The thermocycler programmes used to amplify each sequenced using the parameters 96 °C for 10 s; region comprised: 25 ¥ (96 °C for 10 s; 50 °C for 5 s; 60 °C for 4 min). nrITS (ITS 1 + 5.8S rDNA+ ITS 2): This region was The cycle sequencing mix consisted of 3 mL of water, amplified with a touchdown protocol using the param- 1 mL of fluorescent Big Dye dideoxy terminator, 2 mL eters 94 °C for 2 min; 15 ¥ (94 °C for 1 min; 76 °C for of Better Buffer™ (The Gel Company), 1 mL of tem- 1 min, reducing 1 °C per cycle; 72 °C for 1 min); plate and 0.5 mL of primer. Cycle sequencing products 21 ¥ (94 °C for 1 min; 59 °C for 1 min; 72 °C for were cleaned using ExoSAP™ (USB Corporation) in 1 min); 72 °C for 3 min with the primers 17SE and accordance with the manufacturer’s instructions. 26SE sensu Sun et al. (1994). Betaine was added to Purified cycle sequencing products were directly eliminate secondary structure typical of the ribosomal sequenced on an ABI 377, 3100 or 3130 automated DNA, so that active ITS copies would predominate in sequencer accordance with the manufacturer’s the PCR product. Except for nrITS, all other regions instructions (Applied Biosystems). Electropherograms sequenced are plastid regions. were edited and assembled using SEQUENCHER, matK-trnK: This region includes the entire matK version 4.9 (GeneCodes). All sequences were gene and the flanking 3′trnK spacer and is approxi- deposited in GenBank (see Supporting information, mately 1800 bp in length. This region was amplified Appendix S1). with the parameters 94 °C for 3 min; 33 ¥ (94 °C for 45 s; 60 °C for 45 s; 72 °C for 2 min); 72 °C for 3 min, with primers -19F (Molvray, Kores & Chase, 2000) DATA ANALYSIS and trnK2R (Johnson & Soltis, 1994). Internal We constructed two data matrices. The first included sequencing primers were matK intF (TGAGCGAACA- seven DNA regions (nrITS, trnH-psbA,3′ycf1,5′ycf1, CATTTCTATGG) and matK intR (ATAAGGT- matK, rbcL and psbA) for 122 taxa. This smaller TGAAACCAAAAGTG). Some samples were amplified restricted data set included several relatively con- using the primers 56F and 1520R (Whitten, Williams served plastid genes (rbcL, psbA) with the goal of & Chase, 2000) that yielded a shorter, although providing increased resolution and support for the almost complete, sequence of the matK exon (missing deeper nodes of the tree. The outgroup for this data set the 3′ spacer). was Eulophia graminea Lindl. The second matrix psaB: This region was amplified with the param- included five DNA regions (nrITS, trnH-psbA,5′ycf1, eters 94 °C for 3 min; 33 ¥ (94 °C for 30 s; 55 °C for 3′ycf1 and matK) for 736 taxa. Outgroup taxa were 30 s; 72 °C for 2 min); 72 °C for 4 min, using the Eriopsis biloba Lindl., Eulophia graminea, Cyr- primers NY159 and NY160 sensu Cameron (2004). tidiorchis stumpflei (Garay) Rauschert, a species of rbcL: This region was amplified with the same Rudolfiella Hoehne, Stanhopea jenishiana F.Kramer parameters as for psaB but with primers NY35 and ex Rchb.f., and Stanhopea tigrina Bateman ex Lindl. NY149 from Cameron (2004). The trnH-psbA matrix contained many gaps of dubious

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 ONCIDIINAE PHYLOGENETICS 123 alignment, and we excluded 1259 positions out of 2027 few cases, samples from putatively the same species aligned positions (62%). Data matrices are available do not fall together (e.g. Erycina pusilla (L.) N.H.Wil- from W. Mark Whitten (whitten@flmnh.ufl.edu) and liams & M.W.Chase, Fig. 10; Cyrtochilum cimiciferum at: ftp://ftp.flmnh.ufl.edu/Public/oncids/ (Rchb.f.) Dalström, Fig. 9). Some of these may be Maximum likelihood (ML) phylogenetic analyses the result of errors in determinations but, usually, were performed on both data sets using RaxML, these represent taxonomically confusing groups with version 7.0.4 (Stamatakis, 2006). For each data set, poorly-defined species boundaries. we ran analyses that included: (1) only ITS; (2) only the plastid loci; and (3) all loci. All ML analyses DISCUSSION used the general time-reversible (GTR; Tavare, 1986) model of evolution with among-site rate varia- We recognize 61 clades in this tree (Figs 5–12) at tion modeled using the ‘CAT’ discrete rate categories generic level (Table 1). All of the clades that we rec- option. For analyses of the plastid loci and all loci, ognize at generic level are strongly supported, and we further partitioned the ML model based on DNA there is also strong support for almost all supra- region. Specifically, we estimated substitution model generic nodes in the tree. Monotypic genera include parameters for each region and for region-specific Zelenkoa M.W.Chase & N.H.Williams, Notyliopsis branch lengths. To find the optimal tree for each P.Ortiz and Nohawilliamsia (Fig. 11). These taxa data set, we performed five runs of the ML heuristic form a poorly supported grade that is sister to Tol- searches and 200 nonparametric bootstrap replicates umnia and the twig epiphyte clade (all taxa in to assess clade support in the tree (Felsenstein, Fig. 12). Other genera with weak support for generic 1985). topology include Schunkea Senghas, Trizeuxis Lindl., Seegeriella Senghas and Warmingia Rchb.f. Genera are discussed in order of appearance in the cladogram RESULTS (Figs 5–12). More detailed information for each genus SEVEN-LOCUS DATA SET (FIGS 3, 4) is provided in Chase (2009b). Both the plastid and the nrITS trees recover the same Psychopsis Raf. (five spp.; Fig. 5) ranges from major clades, although there are some differences in Costa Rica south through the Andes to Peru. Chase the topology along the spines of the trees. Based on (2005) lumped the monotypic Psychopsiella into Psy- visual inspection of the trees, there appears to be chopsis on the basis of their sister relationship in nuclear versus plastid conflict in the relationships unpublished nrITS trees to avoid creation of a mono- of Psychopsis, Psychopsiella and Trichopilia Lindl. typic genus, although analysis of the combined data Psychopsis and Psychopsiella are strongly supported sets place Psychopsiella sister to Trichopilia Lindl. as sister in the nrITS tree, although Psychopsis is Chromosome numbers also differ: 2n = 38 for Psy- strongly supported as sister to Psychopsiella and chopsis (Dodson, 1957) versus 2n = 56 for Psychop- Trichopilia in the plastid tree. Vitekorchis Romowicz siella and Trichopilia (Charanasri & Kamemoto, & Szlach. is isolated in both nuclear and plastid tree. 1975). Both Psychopsiella and Psychopsis have yellow It is weakly supported as sister to Oncidium + all and brown flowers with a tabula infrastigmatica, sug- remaining taxa in the plastid tree but is unresolved gestive of oil-reward flowers, although Dodson (2003) at a deeper node in nrITS trees. Tolumnia reported pollination of Psychopsis by Heliconius but- Raf. is strongly supported as sister to Erycina terflies but his observations have not been replicated. Lindl. + Rhynchostele Rchb.f. in nrITS results, Psychopsiella Lückel & Braem (one sp.; Figs 1B, although plastid data place Tolumnia as a well- 5) is monotypic and vegetatively resembles a dwarf supported member of a derived clade (including Psychopsis, although it lacks the elongate dorsal sepal Nohawilliamsia M.W.Chase & Whitten to Comparet- and petals of the latter. It is restricted to Brazil and tia Poepp. & Endl.). The combined plastid + nrITS has been reported from Venezuela, near Caracas, seven-region analysis (122 taxa; Fig. 4) is largely con- although this may have been an escape from cultiva- sistent with the analysis of the larger five-locus data tion. It shares a chromosome number of 2n = 56 with (736 taxa; Figs 5–12), although the addition of rbcL its sister, Trichopilia. and psbA data provide slightly more support for the Trichopilia Lindl. (approximately 26 spp.; spine of the tree. Figs 2Y, 5) is largely characterized by having a lip that enfolds and is fused basally to the column, in some species forming a deep tubular structure sug- FIVE-LOCUS DATA SET (FIGS 5–12) gestive of nectar reward or deceit, although Dodson Many species are represented by two or more (1962) reported pollination of one species by samples. In most cases, multiple accessions of a single fragrance-collecting male euglossine bees. Some species form a group (e.g. most Erycina; Fig. 10). In a species of Cattleya Lindl. and Sobralia Ruiz & Pav.

53 W1696 Comparettia heterophylla 94 W2688 Comparettia falcata A) PlastidW0869 Comparettia langkastii B) nrITS 85 H8339 Comparettia bennettii * N422 Comparettia barkeri * * 94 N414 Comparettia schaeferi 78 N041 Ionopsis minutiflora 64 * W0881 Ionopsis minutiflora * * W2346 Ionopsis utricularioides * N632 Pterostemma antioquiense * W2734 Pterostemma benzingii 98 74 N542 Warmingia zamorana * 92 RLD6349 Macroclinium sp 76 66 70 W0961 Notylia ecuadorensis N438 Macradenia rubescens 50 N415 Sutrina garayi * * W0830 Polyotidium huebneri * C129 Trizeuxis falcata W1615 Rodriguezia batemanii W0287 Leochilus leiboldii 60 * W0663 Leochilus inconspicuus * 82 * 99 C017 Leochilus carinatus C088 Leochilus leochilinus 59 99 N312 Tolumnia compressicaulis 94 54 88 W3358 Tolumnia gundlachii 98 80 * C655 Tolumnia calochila W1622 Plectrophora cultrifolia 99 W0662 Zelenkoa onusta W2674 Notyliopsis beatricis 89 C026 Capanemia superflua W0898 Solenidium portillae 94 W3637 Nohawilliamsia pirarense C036 Gomesa planifolia 98 68 * 92 * C151 Gomesa gomezoides 98 93 W2988 Gomesa radicans 56 62 W3535 Gomesa flexuosa C058 Gomesa eleutherosepala * 98 * W3001 Gomesa lietzii N089 Erycina cristagalli * W2520 Erycina glossomystax * * C052 Erycina hyalinobulbon * 58 * C019 Rhynchostele bictoniensis C652 Rhynchostele londesboroughiana * 95 52 84 N091 Systeloglossum acuminatum 99 92 * N336 Oliveriana brevilabia W3262 Cischweinfia dasyandra 60 76 N548 Brassia horichii 73 93 93 * W1644 Brassia elegantula 57 78 W2679 Brassia andina 87 * W0083 Brassia arcuigera 99 60 N004 Aspasia lunata 98 W0091 Miltonia regnelii W2966 Miltonia phymatochila 99 N017 Cyrtochilum serratum 98 * 54 90 W1553 Cyrtochilum myanthum 84 W1715 Caucaea phalaenopsis * 80 W99252 Miltoniopsis roezlii * C119 Cyrtochiloides ochmatochila 96 B2856 Otoglossum globuliferum * W2723 Otoglossum coronarium W0905 Otoglossum harlingii * 70 C053 Oncidium harryanum 74 C054 Oncidium strictum 69 94 * W1565 Oncidium epidendroides 81 90 59 96 W1662 Oncidium densiflorum 96 W1670 Oncidium peruvianoides 84 98 99 N287 Oncidium morganii * N625 Oncidium lehmanniana N178 Oncidium aff obryzatum 76 W2343 Oncidium obryzatum 82 96 N268 Oncidium hyphaematicum * W2676 Oncidium andradianum 98 99 93 * C142 Oncidium toachicum 80 86 C031 Oncidium reichenheimii 78 N115 Oncidium ghiesbreghtianum N235 Oncidium altissimum W1735 Oncidium heteranthum * W2518 Oncidium abortivum W2694 Vitekorchis excavatus W2375 Ornithocephalus bicornis * W2593 Ornithocephalus dressleri * 82 * W2374 Ornithocephalus suarezii * 77 W0513 Hintonella mexicana * 89 * W0887 Eloyella thienii 87 W2949 Chytroglossa marileoniae 99 N429 Zygostates alleniana * * W2929 Zygostates apiculata * 98 N530 Phymatidium falcifolium 94 81 W0745 Fernandezia tica 98 * W2524 Fernandezia crystallina 98 W1701 Fernandezia ionanthera 80 * W3285 Fernandezia ecuadorensis * 87 60 N560 Telipogon bombiformis 71 * * N643 Telipogon barbozae N440 Telipogon vargasii * 82 98 * W0868 Telipogon hystrix 57 * W2692 Telipogon obovatus 95 W2353 Trichoceros antennifer * W2690 Hofmeisterella eumicroscopica B2558 Lockhartia micrantha W1704 Lockhartia bennettii * 78 81 89 N093 Cuitlauzina egertonii 80 68 * C169 Cuitlauzina pendula 62 W3558 Cuitlauzina candida 80 66 C003 Rossioglossum ampliatum N096 Rossioglossum oerstedii 85 * C007 Rossioglossum schlieperianum C013 Trichocentrum tigrinum 68 98 * W1776 Trichocentrum lindenii * * W3518 Trichocentrum stipitatum 56 C156 Saundersia paniculata 88 * W0824 Grandiphyllum divaricatum * W0825 Grandiphyllum auricula 96* C074 Trichopilia sanguinolenta 78 * W1643 Trichopilia sanguinolenta 99 * C079 Trichopilia brevis 98 * 98 C150 Trichopilia subulata 96 * W2396 Trichopilia fragrans * W3561 Psychopsiella limminghei 93 C034 Psychopsis sanderae * N052 Psychopsis papilio * W1618 Rudolfiella sp.

Figure 3. Comparison of maximum likelihood bootstrap (BS) consensus trees resulting from analyses of the separate [(A) plastid versus (B) nuclear ribosomal internal transcribed spacer (nrITS)] data sets for the seven-region data set for 122 taxa. Asterisks indicate 100% BS support. ᭣ have similar gullet flowers, and they also are visited clinandrial hood and similar pollinarium morphology by nectar-seeking euglossine bees. Vegetatively, (Sosa et al., 2001). plants of Trichopilia are similar to Psychopsis and Grandiphyllum Docha Neto (ten spp.; Figs 1C, Psychopsiella. We include Helcia Lindl., Leucohyle 5) (‘Brazilian mule-ears’) is restricted to Brazil and Klotzch and Neoescobaria Garay, which are embedded northern Argentina, and the species were formerly within Trichopilia. These differ primarily in the lack placed as members of two sections of Oncidium. They of lip/column fusion and have previously been recog- have large leathery leaves and floral morphology nized as members of Trichopilia. typical of Oncidium with an oil-bearing callus or Rossioglossum (Schltr.) Garay & G.C.Kenn. dense pad of trichomes and a tabula infrastigmatica, (ten spp.; Fig. 5), as circumscribed here, includes although they lack the complex tubularized polli- Ticoglossum Lucas Rodr. ex Halb. and Chelyorchis narium stipe (Chase, 1986b) typical of Oncidium s.s., Dressler & N.H.Williams. This genus also includes Grandiphyllum and Saundersia Rchb.f. could be considerable floral diversity, suggestive of pollination lumped into Trichocentrum, although doing so would by a variety of bees, although pollination data are create a genus that is even more difficult to diagnose mostly lacking. Rossioglossum ampliatum (Lindl.) morphologically. M.W.Chase & N.H.Williams (Fig. 1G) has numerous Saundersia Rchb.f. (two spp.; Fig. 5) is restricted bright yellow (bee-ultraviolet-green; Powell, 2008) to Brazil. These small plants have relatively leathery Oncidium-like flowers that are malpigh mimics, ‘mule-ear’ leaves and small flowers borne in a dense whereas other Rossioglossum [e.g. R. insleayi (Baker pendent raceme with a short column that lacks a ex Lindl.) Garay & G.C.Kenn. and Rossioglossum tabula infrastigmatica. The roots, ovary and sepals grande (Lindl.) Garay & G.C.Kenn.] bear relatively bear dense indumentum, a feature unique within this few, large flowers barred with yellow and brown. All clade and rare in the entire subtribe (but found in species share vegetative similarities of rounded, some species of Ornithocephalus, which is not closely ancipitous pseudobulbs topped by a pair of leathery related; Fig. 6). leaves. Van der Pijl & Dodson (1966) reported Trichocentrum Poepp. & Endl. (70 spp.; Figs 1D, pollination of R. grande by Centris bees. Their E, F, 2V, 5), as broadly circumscribed by Chase floral features, particularly the presence of a tabula (2009b), also includes Lophiaris Raf. (‘mule-ear’ infrastigmatica, indicates oil-bee pollination, oncidiums), Cohniella Pfitzer (‘rat-tail’ oncidiums) although their floral absorbance has not been inves- and Lophiarella Szlach., Mytnik & Romowicz [Tricho- tigated. Recognition of Chelyorchis, as a result of its centrum microchilum (Bateman ex Lindl.) M.W.Chase floral distinctiveness within this clade, would result & N.H.Williams and Trichocentrum pumilum (Lindl.) in a paraphyletic Rossioglossum. The genus ranges M.W.Chase & N.H.Williams]. This clade also includes mostly from Mexico to Central America, with Chely- great floral diversity but the species are linked by orchis pardoi Carnevali & G.A.Romero extending vegetative succulence. The leaves are thick and leath- further south to Trinidad and Tobago, Colombia ery and, in one clade, the leaves are terete (‘rat-tail’ and Venezuela (Fernandez-Concha et al., 2009). oncidiums). Most species have yellow to brown This species currently lacks a combination in flowers that are either true oil- or resin-rewarding Rossioglossum. species: Trichocentrum stipitatum (Lindl. ex Benth.) Cuitlauzina Lex. (ten spp.; Fig. 5), as circum- M.W.Chase & N.H.Williams, visited by Centris and scribed here, includes Dignathe Lindl., Osmoglossum Paratetrapedia bees (Silvera, 2002); T. ascendens (Schltr.) Schltr. and Palumbina Rchb.f and ranges (Lindl.) M.W.Chase & N.H.Williams, pollinated by from Mexico to Panama in Central America. Because Trigona and Centris (Parra-Tabla et al., 2000), and floral morphology is so divergent within this genus, some are oil deceit-flowers. Species of Trichocentrum the close relationships between Cuitlauzina s.s., s.s. typically have a spur (Fig. 2V), although nectar Palumbina, Dignathe and Osmoglossum were previ- has never been observed. At least one species, Tricho- ously unsuspected. All four genera were segregated by centrum tigrinum Linden & Rchb.f., has a strong various workers from Odontoglossum. Cuitlauzina fragrance and attracts fragrance-collecting male pendula Lex. has a tabula infrastigmatica, although euglossines (van der Pijl & Dodson, 1966). Most Tri- its pollinator is unknown; its colour (white or pink) chocentrum s.s. with spurs might be deceit flowers, makes it unlikely to be an oil-bee flower. Despite attracting nectar-foraging euglossine or other long- their gross floral disparity, they share a prominent tongued bees. Chromosome number varies greatly

62 W1696 Comparettia heterophylla 90 W2688 Comparettia falcata W0869 Comparettia langkastii H8339 Comparettia bennettii * * N422 Comparettia barkeri N414 Comparettia schaeferi * N041 Ionopsis minutiflora 54 * W0881 Ionopsis minutiflora * W2346 Ionopsis utricularioides N632 Pterostemma antioquiense * W2734 Pterostemma benzingii 80 RLD6349 Macroclinium sp W0961 Notylia ecuadorensis * 94 * N542 Warmingia zamorana N438 Macradenia rubescens C129 Trizeuxis falcata W1615 Rodriguezia batemanii * * N415 Sutrina garayi 67 W0830 Polyotidium huebneri C017 Leochilus carinatus * * C088 Leochilus leochilinus * W0287 Leochilus leiboldii * W0663 Leochilus inconspicuus W1622 Plectrophora cultrifolia 50 C655 Tolumnia calochila W3358 Tolumnia gundlachii 50 * N312 Tolumnia compressicaulis W0662 Zelenkoa onusta W2674 Notyliopsis beatricis W3637 Nohawilliamsia pirarense * 89 C026 Capanemia superflua W0898 Solenidium portillae C036 Gomesa planifolia * 94 * C151 Gomesa gomezoides W2988 Gomesa radicans * * W3535 Gomesa flexuosa C058 Gomesa eleutherosepala * * W3001 Gomesa lietzii N089 Erycina cristagalli * W2520 Erycina glossomystax * C052 Erycina hyalinobulbon * C019 Rhynchostele bictoniensis * C652 Rhynchostele londesboroughiana 76 N548 Brassia horichii 74 * W1644 Brassia elegantula W2679 Brassia andina * W0083 Brassia arcuigera N091 Systeloglossum acuminatum 84 * N336 Oliveriana brevilabia * W3262 Cischweinfia dasyandra N004 Aspasia lunata * W0091 Miltonia regnelii * W2966 Miltonia phymatochila N017 Cyrtochilum serratum 92 * W1553 Cyrtochilum myanthum W1715 Caucaea phalaenopsis * W99252 Miltoniopsis roezlii * C119 Cyrtochiloides ochmatochila 86 B2856 Otoglossum globuliferum 90 * W2723 Otoglossum coronarium * W0905 Otoglossum harlingii C053 Oncidium harryanum * C054 Oncidium strictum * W1565 Oncidium epidendroides 84* W1662 Oncidium densiflorum 92 * W1670 Oncidium peruvianoides N178 Oncidium aff obryzatum W2343 Oncidium obryzatum 94 * N287 Oncidium morganii * N625 Oncidium lehmanniana * N268 Oncidium hyphaematicum * W2676 Oncidium andradianum * * C142 Oncidium toachicum 84 C031 Oncidium reichenheimii N115 Oncidium ghiesbreghtianum * * N235 Oncidium altissimum W1735 Oncidium heteranthum * W2518 Oncidium abortivum W2694 Vitekorchis excavatus W2375 Ornithocephalus bicornis 88 * W2593 Ornithocephalus dressleri 78 * W2374 Ornithocephalus suarezii W0513 Hintonella mexicana * W0887 Eloyella thienii W2949 Chytroglossa marileoniae * N429 Zygostates alleniana * * W2929 Zygostates apiculata N530 Phymatidium falcifolium * 63 W0745 Fernandezia tica 94 W1701 Fernandezia ionanthera * W2524 Fernandezia crystallina * W3285 Fernandezia ecuadorensis N560 Telipogon bombiformis * 52 * N643 Telipogon barbozae N440 Telipogon vargasii * W0868 Telipogon hystrix * W2692 Telipogon obovatus * W2353 Trichoceros antennifer * W2690 Hofmeisterella eumicroscopica * B2558 Lockhartia micrantha * W1704 Lockhartia bennettii C003 Rossioglossum ampliatum N096 Rossioglossum oerstedii * C007 Rossioglossum schlieperianum * 88 C169 Cuitlauzina pendula N093 Cuitlauzina egertonii * W3558 Cuitlauzina candida C013 Trichocentrum tigrinum 60 * W1776 Trichocentrum lindenii * W3518 Trichocentrum stipitatum * C156 Saundersia paniculata * W0824 Grandiphyllum divaricatum * W0825 Grandiphyllum auricula C074 Trichopilia sanguinolenta * W1643 Trichopilia sanguinolenta * C079 Trichopilia brevis = 95-100% bootstrap support * C150 Trichopilia subulata * W2396 Trichopilia fragrans * * C034 Psychopsis sanderae * N052 Psychopsis papilio W3561 Psychopsiella limminghei W1618 Rudolfiella sp. 0.005 substitutions/site

Figure 4. Single maximum likelihood tree resulting from analysis of the combined [plastid + nuclear ribosomal internal transcribed spacer (nrITS)] seven-region data set for 122 taxa. Asterisks indicate 100% bootstrap support (BS); values above lines are BS percentages. ᭣

to Fig. 6 to Fig. 6 B1803 Lockhartia aff. grandibracteata B2559 Lockhartia grandibractea * 73 94 B2558 Lockhartia micrantha 67 87 B2574 Lockhartia serra B2488 Lockhartia aff. chocoensis 61 B2653 Lockhartia parthenglossa * * B2567 Lockhartia acuta B2286 Lockhartia hercodonta 68 B2572 Lockhartia obtusata * B2563 Lockhartia oerstedii B2667 Lockhartia verrucosa * B2554 Lockhartia bennettii * W1704 Lockhartia bennettii * 81 B2570 Lockhartia aff. parthenocomos N350 Trichocentrum undulatum 84 W3252 Trichocentrum carthaginense 53 N447 Trichocentrum lindenii 59 W1776 Trichocentrum lindenii N446 Trichocentrum x teaboanum 65 W0916 Trichocentrum sp. 73 * N445 Trichocentrum oerstedii 80 N444 Trichocentrum cosymbephorum Lophiaris (in part) W0915 Trichocentrum cosymbephorum * C080 Trichocentrum bicallosum 85 W3553 Trichocentrum margalefii * 65 N443 Trichocentrum straminium N026 Trichocentrum lanceanum W3229 Trichocentrum nanum * * W0282 Trichocentrum morenoi W3554 Trichocentrum pumilum Lophiarella * 94 N033 Trichocentrum pfavii W2663 Trichocentrum cymbiglossum * C082 Trichocentrum panduratum * Fig. 5 C013 Trichocentrum tigrinum Trichocentrum s.s. * W0886 Trichocentrum pulchrum * * * W1695 Trichocentrum longicalcaratum * C025 Trichocentrum flavovirens N031 Trichocentrum splendidum Lophiaris (in part) * N025 Trichocentrum stipitatum * W3518 Trichocentrum stipitatum * W3602 Trichocentrum cepula Cohniella * W3619 Trichocentrum cepula * * C090 Trichocentrum jonesianum * C156 Saundersia paniculata W0825 Grandiphyllum auriculum 59 W3567 Grandiphyllum auriculum Oncidium * N285 Grandiphyllum hians sect. C048 Grandiphyllum hians Oncidium * W0823 Grandiphyllum pulvinatum Paucituberculata sect. Pulvinatum 71 W0824 Grandiphyllum divaricatum * W0826 Grandiphyllum robustissimum * 75 C018 Cuitlauzina pulchella N141 Cuitlauzina pulchella Osmoglossum * N093 Cuitlauzina egertonii * 87 C169 Cuitlauzina pendula W3545 Cuitlauzina pendula Cuitlauzina s.s. * C148 Cuitlauzina candida * W3558 Cuitlauzina candida Palumbina * C003 Rossioglossum ampliatum Chelyorchis * N024 Rossioglossum ampliatum * C075 Rossioglossum krameri N096 Rossioglossum oerstedii Ticoglossum * * C007 Rossioglossum schlieperianum N187 Rossioglossum insleayi Rossioglossum s.s. * N034 Trichopilia turialvae W2947 Trichopilia turialvae * W2396 Trichopilia fragrans C001 Trichopilia suavis 84 W2957 Trichopilia leucoxantha * C150 Trichopilia subulata W1892 Trichopilia subulata Leucohyle * * C399 Trichopilia laxa C074 Trichopilia sanguinolenta * W1643 Trichopilia sanguinolenta Helcia * 73 C079 Trichopilia brevis Neoescobaria * W0867 Psychopsiella limminghei W3561 Psychopsiella limminghei * * C034 Psychopsis sanderae Psychopsis s.l. N052 Psychopsis papilio * C267 Stanhopea tigrina W3297 Stanhopea jenischiana * DT297 Cyrtidiorchis stumpflei W1618 Rudolfiella sp W0129 Zygopetalum maxillare Outgroups W0472 Eriopsis biloba W3609 Eulophia graminea

0.001 substitutions/site

Figure 5. Portion (outgroups to Lockhartia) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names. within this clade, forming a continuum from condensation and does not involve polyploidy. Some 2n = 24–72 that does not correlate well with sub- reports (Braem, 1993; Christenson, 1999; Fernandez- clades. Chase & Olmstead (1988) hypothesized that Concha et al., 2010) have favoured a narrow circum- the range of numbers is the result of chromosomal scription of Trichocentrum (restricted to those species

to Fig. 7 N560 Telipogon bombiformis 74 N576 Telipogon ampliflorus to Fig. 7 N556 Telipogon chiriquensis B2984 Telipogon glicensteinii N579 Telipogon sp. N557 Telipogon panamensis 91 N587 Telipogon personatus N561 Telipogon maduroi 66 N583 Telipogon monticola N553 Telipogon caulescens 60 N692 Telipogon caulescens N578 Telipogon biolleyi N585 Telipogon sp. * 84 N559 Telipogon medusae N554 Teliopgon griesbeckii 74 N582 Telipogon griesbeckii N584 Telipogon olmosii N589 Telipogon sp. * 67 * N586 Telipogon parvulus W0140 Telipogon parvulus * N558 Telipogon butcheri * N643 Telipogon barbozae N645 Telipogon monteverdensis * N644 Telipogon bullpenensis 63 N344 Telipogon acicularis * W2155 Telipogon smaragdinus * W2531 Telipogon sp. W2703 Telipogon sp. * C123 Telipogon pogonostalix Stellilabium 84 * * 79 W0868 Telipogon hystrix N440 Telipogon vargasii 94 Fig. 6 N442 Telipogon nervosus N694 Telipogon klotzscheanus * N413 Telipogon pulcher * W2413 Telipogon sp. 76 N577 Telipogon ariasii N588 Telipogon sp. B2982 Telipogon urceolatus 54 * W2412 Telipogon hartwegii * W2692 Telipogon obovatus * B2977 Telipogon venustus * W0882 Trichoceros antennifer 94 W2353 Trichoceros antennifer C138 Trichoceros parviflorus * N286 Trichoceros muralis * * DT340 Trichoceros antennifer * W0883 Trichoceros muralis * DT375 Trichoceros sp. C112 Hofmeisterella eumicroscopica W2690 Hofmeisterella eumicroscopica * W2592 Ornithocephalus dalstroemii 89 W2693 Ornithocephalus dalstroemii * B2980 Ornithocephalus dalstroemii N309 Ornithocephalus ecuadorensis Sphyrastylis * N337 Ornithocephalus dalstroemii * B2979 Ornithocephalus escobarianus * W2593 Ornithocephalus dressleri * W2375 Ornithocephalus bicornis * W3264 Ornithocephalus bicornis * W3242 Ornithocephalus cochleariformis * * B2545 Ornithocephalus inflexus N426 Ornithocephalus iridifolius * W2370 Ornithocephalus kruegeri * W2376 Ornithocephalus polyodon * N428 Ornithocephalus myrticola * 52 W2369 Ornithocephalus suarezii * * W2374 Ornithocephalus suarezii * 85 N290 Hintonella mexicana W0513 Hintonella mexicana * W0887 Eloyella thienii * GG135 Chytroglossa aurata W2949 Chytroglossa marileoniae * N437 Zygostates obliqua 94 W2929 Zygostates apiculata * * N429 Zygostates alleniana 56 N430 Zygostates lunata * W2792 Zygostates pellucida * * C103 Zygostates grandiflora Dipteranthus N530 Phymatidium falcifolium W0860 Phymatidium falcifolium * C113 Fernandezia sp. W2537 Fernandezia cuencae * DT359 Fernandezia sp. 65 88 W0880 Fernandezia sp. W2403 Fernandezia sp. Pachyphyllum (in part) 84 W2524 Fernandezia crystallina * W0879 Fernandezia hartwegii * W2313 Fernandezia sp. * * H7178 Fernandezia sp. DT366 Fernandezia ionanthera 73 W1701 Fernandezia ionanthera * W1700 Fernandezia sanguinea * DT350 Fernandezia breviconnata Pachyphyllum (in part) * N568 Fernandezia tica * W0745 Fernandezia tica * * C217 Fernandezia sp. to Fig. 5 to Fig. 5 W3285 Fernandezia ecuadorensis Raycadenco 0.001 substitutions/site

Figure 6. Continuation (Fernandezia to Telipogon) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

with a spur) and recognition of Lophiaris and etic. Chase (2009b) argued for lumping all these into Cohniella. These generic segregates are monophyletic a broader Trichocentrum on the basis of pollinarium with respect to our molecular data if one species of and vegetative characters (Sandoval-Zapotitla & Ter- Lophiarella (T. pumilum) is included in Lophiaris, razas, 2001), which also avoids recognition of a large although Lophiarella should also include Trichocen- number of genera. trum ﬂavovirens (L.O.Williams) M.W.Chase & Lockhartia Hook. (35 spp.; Figs 1H, 2F, 5) has N.H.Williams and T. splendidum (A.Rich. ex Duch.) confused orchidologists for decades and has been M.W.Chase & N.H.Williams if it is to be monophyl- placed in a number of suprageneric taxa. The genus

to Fig. 8 to Fig. 8 C089 Oncidium wydleri N235 Oncidium altissimum * N240 Oncidium baueri 67 N242 Oncidium volvox 77 * N238 Oncidium reichenbachii W3464 Oncidium panamense W3243 Oncidium polycladium * W2797 Oncidium dichromaticum N030 Oncidium sphacelatum N237 Oncidium isthmi * W1773 Oncidium isthmii * N241 Oncidium ensatum N499 Oncidium leucochilum 87 53 W2961 Oncidium leucochilum C030 Oncidium leucochilum * 92 N239 Oncidium maculatum 87 W1779 Oncidium lindleyi N642 Oncidium sp. 89 W0516 Oncidium incurvum * W2919 Oncidium incurvum * N500 Oncidium leleui B2976 Oncidium imitans 88 C135 Oncidium warscewiczii N640 Oncidium storkii * Fig. 7 N637 Oncidium exalatum * W2622 Oncidium exauriculatum * * N088 Oncidium bracteatum * N186 Oncidium schroderianum W0309 Oncidium schroederianum Miltonioides (in part) * * C041 Oncidium hastilabium * N158 Oncidium cariniferum Miltonioides (in part) * N208 Oncidium hastatum 79 C656 Oncidium endocharis 91 N634 Oncidium endocharis * C016 Oncidium oliganthum 52 C173 Oncidium reflexum W0660 Oncidium durangense * W0895 Oncidium unguiculatum * C099 Oncidium gheisbreghtianum 76 Mexicoa W3440 Oncidium ghiesbreghtianum 54 86 N115 Oncidium ghiesbreghtianum * N636 Oncidium iricolor 70 * W2903 Oncidium iricolor Vitekorchis (in part) * N220 Oncidium oblongatum C031 Oncidium reichenheimii 80 N142 Oncidium reichenheimii C046 Oncidium laeve Miltonioides (in part) * * C047 Oncidium stenoglossum * * H7292 Oncidium dactyliferum W1691 Oncidium dactyliferum * N097 Oncidium cheirophorum N502 Oncidium cheirophorum * * N027 Oncidium sotoanum 86 93 N212 Oncidium aloisii W2676 Oncidium andradianum C121 Oncidium pardothyrsus * 70 N263 Oncidium estradae 66 W2331 Oncidium cf. abruptum W0517 Oncidium hyphaematicum 73 * W2507 Oncidium hyphaematicum N268 Oncidium hyphaematicum * C073 Oncidium fuscatum 93 Chamaelorchis * N261 Oncidium fuscatum 84 W0725 Oncidium anthocrene * C004 Oncidium powellii * W1731 Oncidium sp. * 55 C142 Oncidium toachicum C020 Oncidium retusum * W2427 Oncidium retusum 86 W2446 Oncidium retusum * N547 Oncidium aff. echinops W2539 Oncidium sp. * W1656 Oncidium echinops * W2518 Oncidium echinops * * W2711 Oncidium echinops Heteranthocidium * W2426 Oncidium ariasii (in part) W1679 Oncidium heterodactylum * W1734 Oncidium heterodactylum * W1735 Oncidium heteranthum * W1727 Oncidium cultratum * W2420 Oncidium lancifolium * * N218 Oncidium retusum W1736 Oncidium heterodactylum * N635 Vitekorchis excavatus 92 W2694 Vitekorchis excavatus Vitekorchis s.s. DT373 Vitekorchis excavatus * W2428 Vitekorchis lucasianus * to Fig. 6 to Fig. 6 0.001 substitutions/site

Figure 7. Continuation (Vitekorchis to Oncidium) of single maximum likelihood tree resulting from analysis of the combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names. ranges throughout much of the Neotropics. The linaria have elongate caudicles that partially replace flowers are mostly bright yellow and bear oil- a stipe (similar to Pachyphyllum Kunth), and all but secreting trichomes, similar to many Oncidiinae, one species have a ‘braided’ vegetative habit with although they lack a tabula infrastigmatica. The pol- pseudomonopodial stems lacking pseudobulbs and

to Fig. 9 to Fig. 9 B2529 Oncidium hallii W1565 Oncidium epidendroides N295 Oncidium epidendroides * 81 N190 Oncidium epidendroides N152 Oncidium tripudians 69 76 N156 Oncidium spectatissimum N149 Oncidium nobile 70 N132 Oncidium alexandrae 91 N164 Oncidium alexandrae C1488 Oncidium luteopurpureum * 70 N140 Oncidium aff. epidendroides 93 N215 Oncidium hauensteinii N223 Oncidium sceptrum 59 62 W1766 Oncidium luteopurpureum W1551 Oncidium lehmannii 72 65 N327 Oncidium lehmannii W1767 Oncidium lehmannii 58 N136 Oncidium armatum N176 Oncidium armatum * 90 W1723 Oncidium kegekjani N122 Oncidium hallii N216 Oncidium cristatum * N117 Oncidium blandum C060 Oncidium cirrhosum 80 Fig. 8 N150 Oncidium cirrhosum * N157 Oncidium reversoides N217 Oncidium mirandum Odontoglossum * 78 C1357 Oncidium lindleyoides * N081 Oncidium crocidipterum 57 78 N135 Oncidium cinnamomeum 63 N145 Oncidium constrictum N214 Oncidium gloriosum * W1765 Oncidium odoratum 53 C661 Oncidium nevadense N104 Oncidium nevadense * C062 Oncidium wallisii 51 C1490 Oncidium rhynchanthum * N329 Oncidium portilloides N198 Oncidium aspidorhinum 85 * * N328 Oncidium aspidorhinum 94 N175 Oncidium tenuoides W1722 Oncidium tenuoides * 59 W2391 Oncidium tenuoides 60 * N213 Oncidium crinitum N130 Oncidium portmannii N139 Oncidium portmannii * W1612 Oncidium portmannii * C054 Oncidium strictum 77 W1638 Oncidium strictum Symphyglossum * N323 Oncidium praestanoides 93 N155 Oncidium velleum 52 N173 Oncidium wyattianum * C053 Oncidium harryanum N131 Oncidium harryanum * 75 N079 Oncidium roseoides 77 N116 Oncidium vulcanicum * N305 Oncidium vulcanicum * W1680 Oncidium roseoides Cochlioda C065 Oncidium noezlianum * W1662 Oncidium densiflorum * * W2455 Oncidium beyrodtioides W0877 Oncidium peruvianoides W1670 Oncidium peruvianoides * 86 Solenidiopsis * W1798 Oncidium tigroides * W2392 Oncidium tigroides 78 C172 Oncidium multistellare 93 N129 Oncidium digitoides * N191 Oncidium astranthum Collare-stuartense * 93 N602 Oncidium manuelariasii N599 Oncidium tenuifolium N448 Oncidium povedanum Odontoglossum (in part) N165 Oncidium chrysomorphum 62 W1671 Oncidium chrysomorphum W1676 Oncidium cf schmidtianum 69 * 73 W2421 Oncidium cf schmidtianum * 90 N335 Oncidium trinasutum N178 Oncidium sp. N294 Oncidium tipuloides * W2505 Oncidium boothianum 94 W2506 Oncidium boothianum W2447 Oncidium boothianum Vitekorchis (in part) * W1732 Oncidium boothianum * N552 Oncidium zelenkoanum * N639 Oncidium obryzatoides * W2343 Oncidium obryzatum Vitekorchis (in part) * N287 Oncidium morganii W1631 Oncidium sp. * 67 W1632 Oncidium minaxoides * 91 N303 Oncidium sp. * W1577 Oncidium brevicornis N432 Oncidium ibis * N434 Oncidium aristulliferum * 78 N431 Oncidium cuculligerum * W1633 Oncidium gramineum W2706 Oncidium gramineum * * * N292 Oncidium gramineum Sigmatostalix W2328 Oncidium weinmannianum N435 Oncidium buchtienoides * C056 Oncidium poikilostalix W1627 Oncidium sp. * W3520 Oncidium poikilostalix * * N161 Oncidium unguiculoides W2583 Oncidium auriculatoides * W1624 Oncidium oxyceras * W2340 Oncidium picturatissimum * N621 Oncidium sp. * N625 Oncidium lehmannianum

to Fig. 7 0.001 substitutions/site to Fig. 7

Figure 8. Continuation (Oncidium) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

to Fig. 10 to Fig. 10 H7586 Cyrtochilum cumandae 90 W2908 Cyrtochilum gargantua 81 DT311 Cyrtochilum cordatum N118 Cyrtochilum halteratum 89 * W1650 Cyrtochilum trifurcatum H7245 Cyrtochilum trifurcatum * 56 N017 Cyrtochilum serratum W3563 Cyrtochilum trilingue * 85 C032 Cyrtochilum serratum 79 N206 Cyrtochilum macranthum * N076 Cyrtochilum ioplocon 68 N128 Cyrtochilum ioplocon * C063 Cyrtochilum revolutum W3565 Cyrtochilum villenaorum * Fig. 9 W1545 Cyrtochilum ramosissimum C120 Cyrtochilum pardinum N137 Cyrtochilum pardinum * 87 C665 Cyrtochilum pardinum N339 Cyrtochilum angustatum * * C140 Cyrtochilum angustatum N184 Cyrtochilum sp. 69 N433 Cyrtochilum graminoides 51 W1661 Cyrtochilum gracile 51 W2454 Cyrtochilum gracile * N144 Cyrtochilum fractum Dasyglossum + W1553 Cyrtochilum myanthum Trigonochilum 90 N527 Cyrtochilum hoeijeri in various W0788 Cyrtochilum hoeijeri combinations * 62 N601 Cyrtochilum longipes W1678 Cyrtochilum viminale N539 Cyrtochilum fidicularium 65 * W2352 Cyrtochilum funis C663 Cyrtochilum edwardii * W3556 Cyrtochilum edwardii * N018 Cyrtochilum flexuosum N536 Cyrtochilum cf. porrigens W3599 Cyrtochilum macasense N293 Cyrtochilum cimiciferum N299 Cyrtochilum tricostatum * 89 N304 Cyrtochilum tricostatum 69 W1559 Cyrtochilum tricostatum 68 W1560 Cyrtochilum cocciferum 70 W3550 Cyrtochilum cocciferum * 64 H7239 Cyrtochilum midas C008 Cyrtochilum cimiciferum DT370 Cyrtochilum ovatilabium * * W1682 Cyrtochilum cimiciferum * W0822 Cyrtochilum meirax 86 W2686 Cyrtochilum meirax * N106 Cyrtochilum murinum * W0878 Cyrtochilum murinum C654 Cyrtochilum murinum * W2727 Cyrtochilum flexuosum N418 Cyrtochilum aurantiacum 58 N419 Cyrtochilum caespitosum Rusbyella * N053 Cyrtochilum rhodoneurum Neodryas N540 Cyrtochilum ornatum * W1667 Cyrtochilum ornatum Buesiella * 79 DT337 Cyrtochilum aureum W2354 Cyrtochilum aureum Siederella * N138 Cyrtochilum aff. aureum * * * N163 Cyrtochilum loxense N421 Caucaea radiata 61 W2448 Caucaea radiata * W0897 Caucaea rhodosticta N143 Caucaea kennedyi 61 * W1716 Caucaea cucullata * N179 Caucaea cucullata 92 77 C022 Caucaea phalenopsis 58 W1715 Caucaea phalaenopsis W1659 Caucaea nubigena * * W1683 Caucaea andigena N569 Miltoniopsis vexillaria 58 W0896 Miltoniopsis bismarkii W2722 Miltoniopsis bismarkii C1320 Miltoniopsis vexillaria * * C014 Miltoniopsis warscewiczii * W99252 Miltoniopsis roezlii * * N174 Miltoniopsis phalaneopsis C119 Cyrtochiloides ochmatochila 70 C653 Cyrtochiloides cardiochila C136 Cyrtochiloides panduriformis * 86 N593 Cyrtochiloides riopalenqueana * C059 Otoglossum globuliferum W3174 Otoglossum scansor * N550 Otoglossum globuliferum Brevilongium * B2856 Otoglossum globuliferum 76 * W3155 Otoglossum globuliferum H8090 Otoglossum sp. * W2723 Otoglossum coronarium Otoglossum s.s. * 79 DT356 Otoglossum sp. * C061 Otoglossum chiriquense * W0905 Otoglossum harlingii Ecuadorella, to Fig. 8 Brevilongium (in part) to Fig. 8 0.001 substitutions/site

Figure 9. Continuation (Otoglossum to Cyrtochilum) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

to Fig. 11 to Fig. 11 N121 Rhynchostele cordata W3551 Rhynchostele cordata * N134 Rhynchostele maculata 73 * N205 Rhynchostele madrensis * 91 N207 Rhynchostele candidula N126 Rhynchostele rossii N189 Rhynchostele ehrenbergii * * N127 Rhynchostele cervantesii 58 N204 Rhynchostele galeottiana * C918 Rhynchostele beloglossa 81 Fig. 10 N036a Rhynchostele beloglossa Amparoa * N119 Rhynchostele stellata N120 Rhynchostele pygmaea * N177 Rhynchostele majalis * * C019 Rhynchostele bictoniensis N203 Rhynchostele uroskinneri * * C652 Rhynchostele londesboroughiana Mesoglossum W2512 Erycina glossomystax W2515 Erycina glossomystax * W2520 Erycina glossomystax * N099 Erycina pumilio 89 * * W2341 Erycina pumilio C042 Erycina pusilla * W0872 Erycina zamorensis * * W1771 Erycina pusilla Psygmorchis * N089 Erycina cristagalli Stacyella W0530 Erycina cristagalli * * C052 Erycina hyalinobulbon * W0512 Erycina hyalinobulbon Erycina s.s. C1350 Erycina echinata * W0511 Erycina echinata W1685 Brassia sp. W2695 Brassia ocanensis 71 * N537 Brassia sp. 92 N549 Brassia sp. 68 W1644 Brassia elegantula Ada (in part) * W0085 Brassia sp. W0093 Brassia aurantiaca 72 * W1837 Brassia pozoi N300 Brassia garayana 84 W1666 Brassia garayana * N541 Brassia sp. Mesospinidium * 78 W1663 Brassia sp. * W0084 Brassia panamensis * * N548 Brassia horichii N528 Brassia allenii Ada (in part) H8089 Brassia sp. W3415 Brassia forgetiana * 91 W3287 Brassia villosa * 66 W0082 Brassia signata W0086 Brassia aurorae Brassia s.s. * W0083 Brassia arcuigera 92 N006 Brassia caudata * 85 N010 Brassia jipijapensis 82 N009 Brassia gireoudiana * C213 Brassia andina Brachtia W2679 Brassia andina * N003 Aspasia epidendroides W0092 Aspasia principissa * N004 Aspasia lunata * N264 Aspasia silvana * N529 Cischweinfia suarezii N535 Cischweinfia sp. * 67 N524 Cischweinfia popowiana * W3607 Cischweinfia popowiana * W2458 Cischweinfia sp. N036 Cischweinfia dasyandra 93 * W3262 Cischweinfia dasyandra * W0876 Cischweinfia colombiana N016 Cischweinfia pusilla * W3300 Cischweinfia pusilla * W2824 Cischweinfia platychila * * W2461 Cischweinfia pygmaea * N336 Oliveriana brevilabia * N534 Oliveriana ecuadorensis * N653 Oliveriana sp. C134 Systeloglossum bennettii * N091 Systeloglossum acuminatum * C027 Miltonia candida Anneliesia W0091 Miltonia regnelii * N022 Miltonia flavescens * C208 Miltonia phymatochila * W2966 Miltonia phymatochila Phymatochilum * to Fig. 9 to Fig. 9 0.001 substitutions/site

Figure 10. Continuation (Miltonia to Rhynchostele) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

tightly overlapping, unifacial, non-articulate leaves. phic traits common to many seedlings of Oncidiinae The capsules have apical dehiscence instead of (Chase, 1986b). One species (Lockhartia genegeorgei lateral. These unusual features led some workers to D.E.Benn. & Christenson) has prominent pseudob- place Lockhartia in a separate subtribe, Lockhartii- ulbs with articulated, bifacial leaves; the lack of pae- nae Schltr., although the molecular data strongly domorphic traits in this species led Senghas (2001) to support its position within Oncidiinae. The unusual describe a new genus, Neobennettia Senghas. We vegetative features are best explained as paedomor- were unable to obtain a DNA sample of this taxon

to Fig. 12 to Fig. 12 N373 Tolumnia tetrapetala N386 Tolumnia sp. * N351 Tolumnia pulchella * N376 Tolumnia triquetra 90 * Olgasis N514 Tolumnia gauntlettii 61 N234 Tolumnia prionochila 79 * Fig. 11 N314 Tolumnia prionochila N232 Tolumnia urophylla * N608 Tolumnia haitiensis 93 W0995 Tolumnia quadriloba * N049 Tolumnia henekenii Hispaniella * N233 Tolumnia guianensis N272 Tolumnia guianensis * * W2839 Tolumnia lemoniana * 94 N312 Tolumnia compressicaulis 86 N318 Tolumnia arizajuliana Braasiella N712 Tolumnia guibertiana N310 Tolumnia sylvestris N395 Tolumnia leiboldii * N348 Tolumnia caymanensis * 91 N406 Tolumnia sasseri * * 92 N274 Tolumnia scandens 57 92 N409 Tolumnia hawkesiana * W0991 Tolumnia variegata 88 W0981 Tolumnia aff. variegata 87 * W3358 Tolumnia gundlachii Antillanorchis C655 Tolumnia calochila N269 Tolumnia calochila * N050 Tolumnia tuerckheimii Gudrunia C067 Zelenkoa onusta W0662 Zelenkoa onusta * W2674 Notyliopsis beatricis N638 Nohawilliamsia pirarense W0898 Solenidium portillae W2460 Solenidium portillae * 90 N523 Solenidium lunatum * C026 Capanemia superflua N671 Gomesa montana 75 N681 Gomesa sp. 65 N672 Gomesa warmingii 77 N699 Gomesa spiloptera 54 N682 Gomesa hydrophila N683 Gomesa barbaceniae 77 C660 Gomesa warmingii Coppensia N702 Gomesa warmingii N688 Gomesa sp. * N441 Gomesa viperina 63 C098 Gomesa flexuosa 78 * N662 Gomesa flexuosa W1778 Gomesa flexuosa * W3535 Gomesa flexuosa C037 Gomesa macronyx Rhinocerotidium * N678 Gomesa welteri * 93 N704 Gomesa varicosa Coppensia * 69 W3611 Gomesa varicosa * * C038 Gomesa ranifera Menezesiella N698 Gomesa hookeri * W2988 Gomesa radicans Ornithophora N341 Gomesa concolor * W3544 Gomesa concolor Carenidium (in part) * C210 Gomesa dasytyle * N701 Gomesa forbesii 56 * W3610 Gomesa forbesii W3620 Gomesa gardneri Brasilidium * * C076 Gomesa imperatorismaximiliani 88 N669 Gomesa praetexta * N676 Gomesa crispa 67 N710 Gomesa recurva C036 Gomesa planifolia * N706 Gomesa sessilis * 89 W3534 Gomesa sp. * * N665 Gomesa chrysostoma Rodrigueziella (in part) * C151 Gomesa gomezoides 84 N705 Gomesa glaziovii * N708 Gomesa handroi Rodrigueziella (in part) C058 Gomesa eleutherosepala Rodrigueziopsis N684 Gomesa amicta 76 88 N686 Gomesa kautskyi N685 Gomesa sarcodes N667 Gomesa cornigera N697 Gomesa sp. * W3559 Gomesa widgrenii Baptistonia 74 W3560 Gomesa silvana * W3001 Gomesa lietzei * N661 Gomesa echinata * * C006 Gomesa pubes * N522 Gomesa venusta Campaccia GG154 Gomesa colorata Carriella C137 Gomesa ciliata N703 Gomesa barbata Alatiglossum * N687 Gomesa macropetala * * 64 N604 Gomesa longipes Kleberiella N680 Gomesa longipes * N666 Gomesa cogniauxiana Neoruschia * N668 Gomesa gracilis Nitidocidium

to Fig. 10 0.001 substitutions/site to Fig. 10

Figure 11. Continuation (Gomesa to Tolumnia) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

DT427 Notylia sp. 52 N424 Notylia buchtienii 54 B2972 Notylia pittieri W1530 Notylia sp. Fig. 12 W0961 Notylia ecuadorensis * C012 Notylia barkeri N570 Notylia sp. 71 * W2823 Notylia albida * N265 Notylia barkeri * W1544 Notylia sp. W2509 Macroclinium dalestromii * W3005 Macroclinium aurorae * * RLD6349 Macroclinium lineare * 57 C024 Macroclinium bicolor * N425 Macroclinium robustum N192 Warmingia eugenii 69 N542 Warmingia zamorana * C028 Warmingia eugenii * N438 Macradenia rubescens N654 Macradenia tridentata * C166 Macradenia brassavolae * N416 Seegeriella pinifolia C129 Trizeuxis falcata W3351 Trizeuxis falcata * N417 Schunkea vierlingii W0475 Rodriguezia delcastilloi 81 W0476 Rodriguezia satipoana W1616 Rodriguezia sp. 79 * W1615 Rodriguezia batemanii N384 Rodriguezia arevaloi * C039 Rodriguezia lanceolata 67 N320 Rodriguezia venusta 83 W0889 Rodriguezia chasei W0919 Rodriguezia pulchra * W2342 Rodriguezia lehmannii * W1775 Rodriguezia leeana * N415 Sutrina garayi Polyotidium W0830 Polyotidium huebneri 52 W1694 Comparettia tungurahuae W2691 Comparettia tungurahuae N302 Comparettia jamiesonii * W0873 Comparettia hirtzii 89 * W1696 Comparettia heterophylla * N533 Comparettia luerae 78 * N297 Comparettia aff. gentryi W1689 Comparettia sp. 79 * N623 Comparettia sp. W0918 Comparettia ottonis Scelochilus * H8381 Comparettia portillae 54 * N420 Comparettia corydaloides N616 Comparettia corydaloides * N619 Comparettia sp. * N620 Comparettia sp. * N651 Comparettia sp. * * N617 Comparettia sp. 69 W0869 Comparettia langkastii * 58 N083 Comparettia speciosa 93 W2688 Comparettia falcata N084 Comparettia falcata Comparettia s.s. * C110 Comparettia macroplectron 58 W3425 Comparettia macroplectron * * H8339 Comparettia bennettii Stigmatorthos N622 Comparettia bennettii * N422 Comparettia barkeri Diadenium, * W0871 Comparettia micrantha Chaenanthe * * N414 Comparettia schaeferi Pfitzeria 82 * N041 Ionopsis minutiflora W2371 Ionopsis minutiflora Konantzia W0881 Ionopsis minutiflora * N037 Ionopsis satyrioides * N352 Ionopsis satyrioides * * * C043 Ionopsis utricularioides Ionopsis s.s. W2346 Ionopsis utricularioides * N632 Pterostemma antioquiense W2734 Pterostemma benzingii Hirtzia * N051 Leochilus leiboldii * W0287 Leochilus leiboldii Papperitzia * W0318 Leochilus inconspicuus * W0663 Leochilus inconspicuus Hybochilus (in part) * * N398 Leochilus labiatus C017 Leochilus carinatus * W3363 Leochilus tricuspidatus * * C083 Leochilus oncidioides * C088 Leochilus leochilinus Goniochilus N439 Plectrophora sp. W1621 Plectrophora triquetra * N531 Plectrophora alata * W1622 Plectrophora cultrifolia to Fig. 11 0.001 substitutions/site to Fig. 11

Figure 12. Continuation (Plectrophora to Notylia) of single maximum likelihood tree resulting from analysis of the combined ﬁve-region data set for 736 individuals. The tree on the right side of the ﬁgure displays bootstrap (BS) support > 50%; asterisks indicate 95–100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees to the right of the accepted names.

Table 1. Genera of Oncidiinae recognized in the present for inclusion in our analyses, although we feel its study segregation into a monotypic genus is unwarranted. It may be a natural intergeneric hybrid between Figure number Lockhartia (probably Lockhartia lepticaula D.E.Benn. (of Fig. 5–12) where & Christenson) and a species of Oncidium or Viteko- Genera recognized in this paper genus occurs in tree rchis; the elongate, nonbifid pollinarium stipe of Aspasia Lindl. 10 L. genegeorgei is very different from that of other Brassia R.Br. 10 Lockhartia spp. Caluera Dodson & Determann Not sampled The following seven genera include taxa formerly Capanemia Barb.Rodr. 11 placed in the monopopodial subtribes Pachyphyllinae Caucaea Schltr. 9 Chytroglossa Rchb.f. 6 (pollinia with two long stipes/caudicles) and Ornitho- Cischweinfia Dressler & N.H.Williams 10 cephalinae (four pollinia). Comparettia Poepp. & Endl. 12 Fernandezia Lindl. (approximately 50 spp.; Cuitlauzina La Llave & Lex. 5 Figs 1I, 2P, 6) has recently been re-circumscribed to Cyrtochiloides N.H. Williams & M.W.Chase 9 Cyrtochilum Kunth 9 include both Pachyphyllum and Raycadenco (Chase Eloyella P.Ortiz 6 & Whitten, 2011). The monotypic Raycadenco has Erycina Lindl. 10 yellow and brown flowers with a tabula infrastig- Fernandezia Lindl. 6 matica typical of many oil-bee pollinated species of Gomesa R.Br. 11 Grandiphyllum Docha Neto 5 Oncidium, although the plants are monopodial (and Hintonella Ames 6 therefore lack pseudobulbs), a habit shared with Hofmeisterella Rchb.f. 6 others in this clade. Raycadenco is sister to Fernan- Ionopsis Kunth 12 dezia and Pachyphyllum. These latter two genera Leochilus Knowles & Westc. 12 Lockhartia Hook. 5 were previously distinguished on the basis of flower Macradenia R.Br. 12 size and colour. Pachyphyllum has tiny white or Macroclinium Barb.Rodr. 12 yellow flowers for which pollinators are unknown, Miltonia Lindl. 10 whereas Fernandezia s.s. has larger flowers that are Miltoniopsis God.-Leb. 9 Nohawilliamsia M.W.Chase & Whitten 11 bright red or orange and are hummingbird pollinated. Notylia Lindl. 12 The two genera are not reciprocally monophyletic in Notyliopsis P.Ortiz 11 our trees, lending support to our decision to lump Oliveriana Rchb.f. 10 them into Fernandezia. Given the rampant parallel- Oncidium Sw. 7,8 ism in floral morphology and, in particular, the fre- Ornithocephalus Hook. 6 Otoglossum (Schltr.) Garay & Dunst. 9 quent occurrence of oil-bee flowers in Oncidiinae, it Phymatidium Lindl. 6 makes no sense to keep Raycadenco just because it Platyrhiza Barb.Rodr. Not sampled has oil-bee flowers when we disregard different polli- Plectrophora H.Focke 12 nation syndromes in other genera (e.g. Cyrtochilum Polyotidium Garay 12 Psychopsiella Lückel & Braem 5 Kunth, Gomesa R.Br., Oncidium, etc.). Psychopsis Raf. 5 The genera that we sampled comprising the former Pterostemma Kraenzl. 12 Ornithocephalinae are monophyletic in our trees, Rauhiella Pabst & Braga Not sampled although several are represented by only a single Rhynchostele Rchb.f. 10 Rodriguezia Ruiz & Pav. 12 sample (Figs 2K–N, 6): Phymatidium Lindl. (ten Rossioglossum (Schltr.) Garay & G.C.Kenn. 5 spp.), Zygostates Lindl. (20 spp.), Chytroglossa Saundersia Rchb.f. 5 Rchb.f. (three spp.), Eloyella P.Ortiz (seven spp.), Schunkea Senghas 12 Hintonella Ames (one sp.) and Ornithocephalus Seegeriella Senghas 12 Solenidium Lindl. 11 Hook. (50 spp.). These genera possess tiny green to Suarezia Dodson Not sampled white or yellow flowers that secrete oil via labellar Sutrina Lindl. Not sampled elaiophores and are pollinated by smaller genera of Systeloglossum Schltr. 10 oil-collecting bees (Buchmann, 1987). Toscano de Telipogon Kunth 6 Thysanoglossa Porto & Brade Not sampled Brito & Dressler (2000) transferred all species of Tolumnia Raf. 11 Sphyrastylis Schltr. into Ornithocephalus, and Dipter- Trichocentrum Poepp. & Endl. 5 anthus Barb. Rodr. is not separable from Zygostates Trichoceros Kunth 6 (Chase, 2009b). Genera of the former Ornithocepha- Trichopilia Lindl. 5 Trizeuxis Lindl. 12 linae not sampled in our study include Centroglossa Vitekorchis Romowicz & Szlach. 7 Barb.Rodr. (five spp.), Caluera Dodson & Deter- Warmingia Rchb.f. 12 mann (three spp.), Rauhiella Pabst & Braga (three Zelenkoa M.W. Chase & N.H.Williams 11 spp.), Platyrhiza Barb.Rodr. (one sp.) and Thys- Zygostates Lindl. 6 anoglossa Porto & Brade (two spp.). An unpub-

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 136 K. M. NEUBIG ET AL. lished analysis of nrITS data (Toscano de Brito, pers. baueri Lindl.). There are many chromosome counts of comm.) shows that Centroglossa is embedded within 2n = 56 (Tanaka & Kamemoto, 1984). Zygostates, and thus these two should be merged. His The circumscription of Oncidium has been highly results also confirm the monophyly and inclusion in contentious, especially among horticulturalists. For this clade of the other four genera. Although we do many years, the angle of attachment of the lip to not recognize Centroglossa in this treatment, several column was used to distinguish Oncidium from Mil- of the species still need to be transferred to tonia Lindl. and Odontoglossum Kunth, although Zygostates. such angles form a continuum and use of this single- Hofmeisterella Rchb.f. (one sp.; Fig. 6), Trichoc- character to define genera resulted in highly artificial eros Kunth (nine spp.; Figs 2U, 6) and Telipogon classifications, as shown by Dressler & Williams Kunth (170 spp.; Fig. 6) include species formerly (1975). Oncidium is perhaps the best example of our placed in subtribe Telipogoninae on the basis of four contention that floral morphology must be foregone in pollinia (versus two in Oncidiinae) and pseudocopu- Oncidiinae as a basis for generic characters. Floral latory flowers with furry columns and lip calli that traits in Oncidiinae are highly plastic and reflect are pollinated by male tachinid flies. Within this evolutionary shifts in pollinators. The traditional clade, monotypic Hofmeisterella is sister to Trichoc- emphasis on floral features has resulted in many eros (high elevation species with thick, succulent polyphyletic genera. Almost 50 years ago, Garay leaves and pseudobulbs) and Telipogon (intermediate (1963) admitted the artificiality of many generic to high elevation species with thin leaves with boundaries within Oncidiinae: ‘To the taxonomist as reduced or absent pseudobulbs). Previous molecular well as the horticulturalist, it appears to be a serious studies of this clade showed that Stellilabium Schltr. and unpleasant thought to unite all these genera with is biphyletic and embedded within Telipogon. One Oncidium, although this course seems to be inevi- Central American clade of Stellilabium is sister to a table, since the information gained from experiments Central American clade of Telipogon, and these are in hybridization and from cytological studies strongly embedded in a South American grade (Williams, points in that direction’. We feel that it is better to use Whitten & Dressler, 2005). vegetative features in combination with a few floral Vitekorchis Romowicz & Szlach. (six spp.; traits to define broader genera. The molecular analy- Figs 1J, 7) is an Andean genus that is sister to ses demonstrate the high levels of homoplasy in Oncidium in our trees but without strong bootstrap pollinator-related traits. Most members of Oncidium support. The floral similarity to Oncidium and chro- s.s. are characterized by flowers adapted for pollina- mosome counts of 2n = 56 are evidence supporting tion by relatively large oil-collecting bees (e.g. their lumping into Oncidium but, without stronger Centris), and many species possess prominent elaio- molecular support, we prefer to maintain generic phores on the side lobes of the lip together with a status for this clade at present. Their most distin- tabula infrastigmatica (Fig. 2I, J). Cochlioda and guishing features are relatively large, sharply ridged Symphyglossum represent adaptations for humming- pseudobulbs with numerous subtending leaves, bird pollination, with bright red/pink/purple tubular massive inflorescences and small stipes relative to the flowers (Fig. 2S). The lumping of Sigmatostalix within pollinia. Our circumscription of Vitekorchis differs Oncidium seems initially inappropriate, although the greatly from that of Szlachetko. His circumscription vegetative habit of the two taxa differs only in size, includes several species that should be retained in and the flowers of Sigmatostalix are diminutive rela- Oncidium (Oncidium boothianum Rchb.f., Oncidium tive to most Oncidium species (Fig. 2O), reflecting iricolor Rchb.f., Oncidium obryzatum Rchb.f.) adaptations to different groups of smaller oil- Oncidium Sw. (520 spp.; Figs 1K–O, 2I, J, O, S, 7, collecting bees. Although many of the traditionally 8), as circumscribed broadly here, includes many pre- recognized segregate genera are monophyletic in our viously recognized genera, including Odontoglossum trees (e.g. Sigmatostalix, one clade of Odontoglos- Kunth, Sigmatostalix Rchb.f., Cochlioda Lindl., Sym- sum), they are embedded within a larger clade of phyglossum Schltr., Mexicoa Garay, Miltonioides Oncidium species with diverse floral morphologies Brieger & Lückel and Solenidiopsis Senghas, and a and pollination systems. Recognition of these segre- number of recent, minor segregates such as Cha- gate genera would require creation of many new maeleorchis Senghas & Lückel, Collare-stuartense genera to maintain monophyly, and these new genera Senghas & Bockemühl and Heteranthocidium Szlach., would be difficult to diagnose using floral or vegeta- Mytnik & Romowicz. With this broad circumscription, tive traits. it is the largest genus of the subtribe. Oncidium A few species of Oncidium (e.g. Oncidium echinops species range from Mexico and Florida through the Königer, Oncidium heteranthum Poepp. & Endl.; Caribbean, Central America south to Bolivia and Fig. 7) produce branched inflorescences with terminal Peru, with only one species in Brazil (Oncidium normal flowers on the branches, although the proxi-

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 ONCIDIINAE PHYLOGENETICS 137 mal flowers are abortive and sterile, consisting of rhizomes as a local synapomorphy for the genus (this only a cluster of yellow tepals that function as osmo- trait occurs elsewhere in Oncidiinae, e.g. some species phores (W. M. Whitten, pers. observ.). In other species of Cyrtochilum, to which Otoglossum is close). (Oncidium pentadactylon Lindl.), abortive flowers Cyrtochiloides N.H.Williams & M.W.Chase (four are terminal, with all other proximal flowers being spp.; Figs 1J, 9) flowers have typical Oncidium-like normal. Szlachetko, Mytnik-Ejsmont & Romowicz morphology and were considered members of (2006) described Heteranthocidium to accommodate Oncidium until molecular data revealed their distinc- these species, although their genus is not monophyl- tiveness (Williams et al., 2001b). Florally, they are etic in our trees. Moreover, several of the 15 species only divergent from Oncidium in their pollinaria with they placed in the genus do not possess dimorphic smaller stipes, larger pollinia and well developed, flowers and are widely scattered in our trees (e.g. stalked caudicles. The generic names alludes to the Oncidium boothianum, Oncidium exalatum Hágsater, vegetative similarity of the plants to Cyrtochilum; Oncidium fuscans Rchb.f., Oncidium pollardii Dodson both have ovoid pseudobulbs rounded in cross-section & Hágsater). All heteranthous species sampled here (not angled) with two to six leaf-bearing subtending form a clade of 16 accessions (Oncidium retusum sheaths. Lindl. to Oncidium heterodactylum Kraenzl., Fig. 7), Miltoniopsis God.-Leb. (six spp.; Fig. 9) was split although not all the species in this clade bear dimor- from Miltonia, and the name reflects their similar phic flowers consistently (O. retusum, Oncidium floral shapes. The species of Miltoniopsis are distrib- cultratum Lindl., Oncidium lancifolium Lindl. ex uted from Central America, Venezuela south to Peru, Benth.). Species delimitation is difficult within this although they are absent from Brazil, whereas Mil- clade, and there appears to have been multiple loss or tonia spp. are predominately Brazilian (and all are gains of the heteranthous trait, coupled with its non-Andean). The flowers have broad, flat lips, and at erratic phenotypic expression. least one species is reported to be pollinated by night- Otoglossum (Schltr.) Garay & Dunst. (15 spp.; flying ptiloglossine bees (Ptiloglossa ducalis; Dodson, Fig. 1S, T, 9) was originally regarded as a subgenus of 1965), rather than by oil-collecting anthophorid bees. Odontoglossum by Schlechter, although the floral Caucaea Schltr. (five to 20 spp.; Fig. 9) was pre- characters agree most closely with Oncidium. Distri- viously known as the Oncidium cucullatum Lindl. bution is primarily Andean, extending north to Costa group, a set of poorly defined, high-elevation Andean Rica, with one species on tepuis of the Guyanan species with showy flowers. Their phylogenetic dis- shield. It was probably their large, bright reddish tance from Oncidium and their relationships to brown flowers and occurrence at higher elevations the small-flowered, monotypic Caucaea radiata that caused them to be placed in Odontoglossum.As (Lindl.) Mansf. were unsuspected until molecular broadly circumscribed here, Otoglossum includes data revealed their close relationship (Williams et al., Oncidium sections Serpentia (Kraenzl.) Garay, 2001b), and they were lumped into Caucaea. Despite Brevilongium Christenson and Ecuadorella Dodson & the floral similarity to Oncidium, they are not closely- G.A.Romero. Before molecular data, a close relation- related. Caucaea is sister to Cyrtochilum, a relationship between Otoglossum s.s and Oncidium section ship that was unexpected on the basis of gross floral Serpentia was totally unsuspected. Otoglossum s.s. shape. The two genera do share subtle traits, includ- bear many-flowered inflorescences arising laterally ing pseudobulbs that are rounded (not strongly from pseudobulbs widely spaced on woody rhizomes ancipitous or two-sided) and pollinaria with relatively (Jenny, 2010), whereas Oncidium section Serpentia short stipes and large caudicles. Both genera also exhibits a unique vining habit (many meters long) occur in cool, high-elevation Andean cloud forests. that was interpreted by Christenson (2006) as an Cyrtochilum Kunth (120 spp.; Figs 2C, E, G, H, 9) indeterminate inflorescence that periodically pro- is restricted to the high Andes of Colombia and Ven- duces flowering plantlets at the nodes. We regard ezuela south to Peru, with a single species, Cyrtochi- these elongate, vining structures as stems, not inflo- lum meirax (Rchb.f.) Dalström, occurring in the rescences, making their habit that same as in Oto- Caribbean (Dalström, 2001). Many species have glossum s.s. The molecular data strongly support long (3–4 m), vining inflorescences and large showy Oncidium section Serpentia and Otoglossum s.s. as flowers (some with prominent elaiophores; Fig. 2G, sister taxa, and together they are sister to Otoglos- H), although a few species have diminutive plants sum harlingii (Stacy) N.H.Williams & M.W.Chase, an and flowers. Vegetatively, Cyrtochilum are distin- unusual former Oncidium with an odd upright habit guished by dull pseudobulbs that are round or ovoid with long internodes and dichotomously forking in cross section with two to four apical leaves and two woody rhizomes. Dodson & Romero created the mono- to six leaf-bearing sheaths and relatively thick roots; typic genus Ecuadorella for this taxon. The inclusion in contrast, Oncidium spp. have glossy, ancipitous of all these clades in Otoglossum reveals elongate (two-edged) pseudobulbs and thin roots (Dalström,

2001). Dalström (2001) and Chase (2009b) discussed Williams et al. (2001b) and subsequently transferred the tangled taxonomic history of the genus. Previous to a monotypic genus, Phymatochilum Christenson workers relied almost exclusively on floral traits, (Christenson, 2005), who cited it as an aberrant resulting in confusion with concepts of Odontoglos- member of Miltonia (a virtual ‘round peg in a square sum and Oncidium. Lindley, in a series of transfers hole’; E. A. Christenson, pers. comm.) but, in our view, over a period of years (1837–1842) in Sertum Orchi- it is no more or less aberrant than the other species daceum, eventually sank both Odontoglossum and with unusual floral traits found in Miltonia. Cyrtochilum into Oncidium, and Kraenzlin resur- Sister to Miltonia is a clade of the following three rected the genus in 1922. Dasyglossum Königer genera with relatively small flowers that have a & Schildhauer and Trigonochilum Königer & prominent clinandrial hood on the column and Schildhauer were created to accommodate some of the strongly ancipitous pseudobulbs: smaller flowered Cyrtochilum spp., although the Systeloglossum Schltr. (five spp.; Fig. 10) has authors repeatedly transferred taxa between the two small, yellow–green or brownish–purple flowers with genera because they could not decide where they fit a prominent column foot and a simple hinged lip; on the basis of floral morphology. Senghas (1997) pollination is presumably by nectar-foraging insects. transferred all Dasyglossum into Trigonochilum Szlachetko (2006) created the monotypic Diadeniopsis because he could not reliably distinguish them. Szlach. for Systeloglossum bennetii (Garay) Dressler Neither genus is monophyletic in our DNA trees. & N.H.Williams. His emphasis on and interpretation Similarly, Buesiella C.Schweinf., Neodryas Rchb.f., of gynostemial structure mistakenly placed it in the Rusbyella Rolfe ex Rusby and Siederella Mytnik, twig epiphyte clade as a relative of Comparettia. Górniak & Romowicz are simply diminutive and/or Oliveriana Rchb.f. (six spp.; Fig. 10) is a high- brightly coloured taxa embedded within Cyrtochilum elevation, Andean genus with relatively flat, open (Dalström, 2001), probably reflecting a shift in polli- flowers, and Chase (2009b) suggested the flowers are nators, although there are few observations of pollinated by hummingbirds on the basis of polli- pollination. narium morphology (two, widely spaced pollinia with Miltonia Lindl. (ten spp.; Fig. 10) occurs in Argen- a wedge-shaped viscidium and a bilobed stigma, tina, Brazil, Paraguay and Venezuela and is sister to which are otherwise features found in hummingbird- a clade that includes Systeloglossum Schltr., Oliveri- pollinated species of Oncidiinae). Plants are scandent, ana Rchb.f., Cischweinfia Dressler & N.H.Williams, in contrast to the mostly caespitose habit of other Aspasia Lindl. and Brassia. Some Miltonia species genera in this clade. (e.g. Miltonia regnellii Rchb.f and Miltonia spectabilis Cischweinfia Dressler & N.H.Williams (11 spp.; Lindl.) have a short column and a broad, flat lip with Fig. 10) grows in middle-elevation forests (up to a simple, reduced callus, although the floral morphol- 1500 m) from Costa Rica to Bolivia. Flowers have a ogy varies a great deal among the species. Miltonia tubular lip enfolding the column and are reportedly clowesii (Lindl.) Lindl. has typical Oncidium-like oil- pollinated by nectar-seeking euglossine bees (Will- bee flowers, whereas Miltonia candida Lindl. and iams, 1982). Cischweinfia pygmaea (Pupulin, J.Valle Miltonia russelliana (Lindl.) Lindl. have the lip partly & G.Merino) M.W.Chase has diminutive plants with or completely encircling the column, giving them the small flowers and a simple lip. It was originally appearance of a Cischweinfia (suggestive of pollina- described as an Ada, although the molecular data tion by nectar-foraging bees). They also have the from this study clarified its generic placement (Chase clinandrial and column arms found in many species of & Whitten, 2011). Cischweinfia (see below). Miltonia flavescens (Lindl.) Aspasia Lindl. (seven spp.; Fig. 10) ranges from Lindl. on the other hand resembles a species of Central America, northern South America and the Brassia in its floral traits, with a similar bilobed lip Andes to coastal Brazil. It is vegetatively similar to callus forming a nectar-cavity like chamber on the Brassia, although the flowers have a flat lip partially lip base and elongate, spidery tepals. The above- adnate to a relatively long column and bent at a right mentioned species with the author combination angle, forming a false nectary. Several species are ‘(Lindl.) Lindl.’ are the result of Lindley considering pollinated by euglossine bees, although there may be these to be species of Cyrtochilum or Odontoglossum a mixture of nectar deceit and fragrance reward when he first described them, again an indication of involved, depending upon the species (Zimmerman & the floral diversity present in a small set of species Aide, 1987). Aspasia represents the only known occur- that forms a clade in our analyses. Like M. clowesii, rence of fragrance-reward male euglossine pollination M. phymatochila (Lindl.) N.H.Williams & M.W.Chase in this clade (Miltonia to Brassia, Fig. 10). also has typical oncidioid oil-bee flowers with a large Brassia R.Br. (74 spp.; Figs 2Q, R, 10) includes complex callus and tabula infrastigmatica. The latter Brachtia, Ada and Mesospinidium. Chase (2009b) species was transferred from Oncidium to Miltonia by treated these separately but indicated this to be

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 ONCIDIINAE PHYLOGENETICS 139 unsatisfactory. These genera have been difficult to They transferred all these taxa into Rhynchostele,a separate on the basis of floral and vegetative charac- move that is supported by our molecular data. ters. Brachtia (seven spp., Andean) is sister to Gomesa R.Br. (125 spp.; Figs 1P–R, 11) as circum- Brassia s.s. (c. 35 spp., Mexico through Central scribed here is relatively broad and includes at least America, Caribbean, to tropical South America). The 23 other generic concepts (Chase et al., 2009a; Chase, two genera are vegetatively similar and basic polli- 2009b) with a great diversity of floral morphology and narium and floral structures are similar. They share size. Gomesa has a centre of distribution in Brazil, a simple lip with a pair of small basal keels. They especially the Mata Atlântica, where these species differ mainly in the relative size of the flowers and largely replace Oncidium (the genus in which most of floral bracts; Brachtia (Fig. 2R) has relatively small them were once included), although it extends to flowers with large bracts partially enclosing the northern Argentina and Amazonian Peru. Almost all flowers. These two genera are sister to Ada (approxi- species have fused lateral sepals, a trait that makes mately 35 spp.) and Mesospinidium (approximately them easy to recognize despite their floral diversity. seven spp.), both ranging from Central America south By contrast, Oncidium is largely absent from Brazil through the Andes to Bolivia. Ada was originally (O. baueri is the sole representative), and their lateral monotypic and composed of a single hummingbird- sepals are usually free. The two genera rarely pollinated species with bright orange to red flowers produce hybrids in horticulture. Based on the enor- (Fig. 2Q), although Williams (1972) realized that it mous floral diversity within Gomesa, Brazilian and was morphologically similar to a clade of Brassia (the French workers have proposed a number of segre- ‘glumaceous’ brassias). He transferred this group into gates (Docha Neto, Baptista & Campacci, 2006), Ada, greatly enlarging the genus. Ada is not mono- although several of these are not monophyletic phyletic, with Ada allenii (L.O.Williams ex C.Sch- (e.g. Alatiglossum Baptista, Carenidium Baptista, weinf.) N.H.Williams sister to Mesospinidium and Coppensia Dumort.). Several recent segregates are remaining Ada. Florally, Mesospinidium are small monotypic: Campaccia venusta (Drapiez) Baptista, versions of Ada. Given the shared suite of floral P.A.Harding & V.P.Castro; Hardingia paranaensis morphologies and habits and aberrant phylogenetic (Kraenzl.) Docha Neto & Baptista (not included in our position of Ada allenii, lumping them all into Brassia analyses); and Nitidocidium gracile (Lindl.) F.Barros seems the simplest solution. & V.T.Rodriguez. To make matters worse, Szlachetko The sister relationship between the following two and colleagues also segregated a number of genera morphologically divergent genera was unsuspected from this same set of species, often using the same prior to molecular studies. These genera are remark- type species but including different sets of species ably different in size, habit and floral morphology. than the Brazilian workers (e.g. Concocidium Romow- Erycina Lindl. (ten spp.; Figs 1U, 10), as broadly icz & Szlach. and Carenidium, both based on defined by Williams et al. (2001a), includes Psyg- Oncidium concolor Hook.). Also, Szlachetko (2006) morchis Dodson & Dressler and monotypic Stacyella segregated three species of Oncidium as the genus Szlach. [= Erycina crista-galli (Rchb.f.) N.H.Williams Rhinocerotidium Szlach. (Oncidium longicornu & M.W.Chase]. All three genera have bright yellow oil Mutel, Oncidium macronyx Rchb.f and Oncidium rhi- reward/deceit flowers (Pérez-Hérnandez et al., 2011) noceros Rchb.f.; most workers lump these into a single and were at one time considered members of species). He based the genus mostly upon the large, Oncidium. Although these three genera could be horn-like lip callus, although the callus is perhaps the maintained, we favour lumping them to emphasize most variable floral feature within Oncidiinae. These their similar floral morphology and modified habit species are closely related to G. varicosa (Lindl.) (absence of an apical leaf on pseudobulbs, if pseudob- M.W.Chase & N.H.Williams, a species with a ulbs are present). relatively large lip and small callus. Rhynchostele Rchb.f. (13 spp.; Fig. 10), as circum- Capanemia Barb. Rodr. (seven spp.; Fig. 11) is scribed here is primarily Mexican and includes represented in our analyses by only a single species, Amparoa Schltr. and Mesoglossum Halb.; Cymbiglos- Capanemia superflua (Rchb.f.) Garay that is sister to sum Halb. and Lemboglossum Halb. are later syn- Solenidium Lindl. Recent studies have reduced the onyms of Rhynchostele. Lumping of these genera is number of species in the genus, although molecular also supported by anatomical similarities (Rojas Leal, data are needed to confirm whether the seven recog- 1993). Most of these species were treated as members nized species form a monophyletic group (Buzatto, of Odontoglossum until split out by Halbinger, first as Singer & van den Berg, 2010; Buzatto et al., 2011). Cymbiglossum and later as Lemboglossum. Morpho- The genus is centred in south-eastern Brazil, extend- logical analyses by Soto, Salazar & Rojas Leal (1993) ing to Argentina and Uruguay. Florally, the genus is revealed a close relationship between these species similar to unrelated Leochilus Knowles & Westc., and the much reduced Rhynchostele pygmaea Rchb.f. although most species do not produce nectar, except

C. therezae Barb. Rodr. (Buzatto et al., 2011). Singer based on floral oddities; these include Olgasis Raf., & Cocucci (1999) reported visits by halictid bees and Antillanorchis (Wright ex Griesb.) Garay, Hispaniella vespid wasps. Sanderella also falls here (C. van den Braem, Jamaiciella Braem, Braasiella Braem, Lückel Berg, pers. comm.). Morphologically, Sanderella is & Russmann and Gudrunia Braem. Recognition of all similar to Capanemia (the oldest name) and should these segregates would require at least a dozen probably be combined with it. The exact status of genera to be carved from Tolumnia to maintain mono- Sanderella cannot be determined until it and more phyly. We feel this is unwarranted. Tolumnia is sister species of Capanemia are sampled. to all others in the remainder of the tree (twig epi- Solenidium Lindl. (three spp.; Fig. 11) is an Ama- phytes), although this relationship is only weakly zonian genus similar florally to its sister, Capanemia, supported. In contrast to most twig epiphytes, Tolum- bearing small flowers with prominent column wings nia spp. occur on the larger axes of trees and live for and an upturned tip of the anther cap; more detailed many years, rather than being restricted to terminal studies of both may support their combination. twigs with extremely rapid life cycles, although they Nohawilliamsia M.W.Chase & Whitten (one sp.; also have seeds with pronounced hooks or knob-like Figs 1V, 11) was created to accommodate a single odd extensions (Chase, 1988). species with no close or clear relatives based on our analyses thus far. It was formerly known as Oncidium pirarense Rchb.f. (synonym Oncidium THE TWIG EPIPHYTES orthostates Ridl.) from southern Venezuela, Guyana, The clade comprising the remainder of the tree (Plec- Suriname and Brazil (Whitten, 2009; Chase, 2009a; trophora H.Focke to Notylia; Fig. 12) has been infor- Chase et al., 2009a). Although the flowers are similar mally referred to as the ‘twig epiphyte’ clade. Chase to many yellow species of Oncidium, they lack a (1988) first discussed the morphological and life- tabula infrastigmatica. The leaves have a minutely history features that unite these taxa. Twig epiphytes dentate margin, and plantlets (keikis) are produced often grow on the smallest branches (Յ 2.5 cm) in on old inflorescences and on top of old pseudobulbs; exposed, high-light zones, have rapid life cycles (often all these traits are unusual within Oncidiinae. reaching maturity in one season), produce hooks or Notyliopsis P.Ortiz (one sp.; Fig. 11) from the wet projections on the seed testa (most likely for attach- Colombian Chocó has diminutive flowers that super- ment to small twigs and rapid uptake of water) and ficially resemble those of Notylia Lindl., although the exhibit psygmoid (paedomorphic) habits and velamen pseudobulbs are reminiscent of Zelenkoa. (root epidermis) cells much longer than wide with Zelenkoa M.W.Chase & N.H.Williams (one sp.; evenly spaced secondary thickenings. Not all taxa in Figs 1W, 11) was long considered an oddity when it this clade are extreme twig epiphytes restricted to was included in Oncidium (often in its own monotypic terminal twig habitats, although the majority display section), although molecular data revealed its distinc- many of these features. Twig epiphytes occur in other tiveness. Like Nohawilliamsia, it has bright yellow clades of Oncidiinae (e.g. Erycina; Fig. 10), and in flowers that lack a tabula infrastigmatica. Often epi- other subtribes (e.g. Dendrophylax porrectus (Rchb.f.) phytic on cacti in dry coastal forests of Ecuador and Carlsward & Whitten, Angraecinae). None of the Peru, the plants have mottled ovoid pseudobulbs that genera of the twig epiphyte clade (all genera in resemble those of Notyliopsis, which is also a member Fig. 12) is known to secrete oil or mimic oil flowers. of this grade relative to Tolumnia and other twig Instead, they attract either nectar-seeking animals or epiphytes. are pollinated by fragrance-collecting male euglossine Tolumnia Raf. (40 spp.; Figs 1X, Y, 2D, 11) has bees. Suarezia Dodson (one sp.) was not sampled, long been recognized as a distinct group (‘equitant’ although it is presumed to be a member of this clade oncidiums) based on their psygmoid fan of succulent on the basis of its morphology. leaves and usual absence of pseudobulbs. There is Plectrophora H.Focke (nine spp.; Fig. 12) is a extensive polyploidy within the genus (Braem, 1986), genus of diminutive plants with relatively large resulting in some conflict between nuclear and plastid flowers with a funnel-shaped lip and a sepaline spur phylogenetic trees (N. Williams, unpubl. data). Most without nectar horns. The presence of nectar has not species have oil-bee flowers that do not secrete oil; been confirmed, although the flowers are probably pollination by Centris bees is reported for several pollinated by long-tongued insects seeking nectar. species (Nierenberg, 1972; Ackerman, Meléndez- Leochilus Knowles & Westc. (12 spp.; Fig. 12) is Ackerman & Salguero Faria, 1997; Vale et al., 2011). a genus of true twig epiphytes, occurring only on Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir has a small branches and twigs. The small flowers of most furry, insect-like lip and is reportedly pseudocopula- species have a simple lip with a shallow nectar cavity tory (Dod, 1976). Braem and Garay have published or at the base. Chase (1986a) reported pollination of two resurrected several (often monotypic) segregates species by nectar-foraging, short-tongued Stelopolybia

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 ONCIDIINAE PHYLOGENETICS 141 wasps and Lasioglossum bees. Three other monotypic terminal clade that includes Rodriguezia Ruiz & Pav., genera are now included in Leochilus on the basis of Macroclinium Barb. Rodr. and Notylia. their position in phylogenetic studies: Goniochilus Sutrina Lindl. (two spp.; Fig. 12) consists of Chase, Hybochilus Schltr. and Papperitzia Rchb.f. poorly known species from Amazonian Peru and The floral structure of the first two is similar to that Bolivia. The yellow–green flowers have simple, linear of the other species of Leochilus, although that of tepals and lip that do not open widely, forming a Papperitzia is highly divergent. Despite this, the tube-like structure. Nothing is known of pollination, single species of Papperitzia was originally included although morphology suggests pollination by nectar- in Leochilus. foraging insects. Pterostemma Kraenzl. (two spp.; Fig. 12) is a Rodriguezia Ruiz & Pav. (48 spp.; Figs 2X, 12) genus of diminutive, extreme Andean twig epiphytes ranges from Mexico south to Argentina, with one with tiny flowers that are probably bee-pollinated. species (Rodriguezia lanceolata Ruiz & Pav.) found Their habits are monopodial tufted plants or psymoid on many islands in the Caribbean. The flowers are fans 1–2 cm in size. The flowers have a dorsal anther relatively large, brightly coloured and showy for with long stipe and long, forward-sweeping column members of the twig epiphyte clade. The lip is often arms. Both sequence data and morphology confirmed relatively large and flat, and the lateral sepals are a close relationship of Hirtzia Dodson to Pterostemma, fused along one or both lateral margins to form a so the two were lumped (Chase, Williams & Whitten, curved nectar spur. A projection from the column 2009b). base secretes nectar into this spur. Reported polli- Ionopsis Kunth (three spp.; Fig. 12) ranges widely nators include hummingbirds, butterflies and nectar- throughout the Neotropics. The white to pink flowers foraging bees (Dodson, 1965). There are two strongly have a simple lip with a short sepalar spur without supported clades within Rodriguezia, and Chase any obvious reward and are probably pollinated by (2009b) noted the non-monophyletic placement of nectar-seeking bees. Rodriguezia decora Rchb.f. in nrITS trees published Comparettia Poepp. & Endl. (60 spp.; Figs 2W, in Genera Orchidacearum. This unusual Brazilian 12) is broadly circumscribed here to include all species was not included our sampling, although it species with sepalar nectar spur(s) furnished by a may warrant generic status. It has long, wiry rhi- horn or pair of horns on the column base that secrete zomes between sympodia and lacks the spur found nectar. Generic segregates lumped here include Dia- in other species. denium Poepp. & Endl., Chaenanthe Lindl., Scelochi- Schunkea Senghas (one sp.; Fig. 12) is known lus Klotzsch, Neokoehleria Schltr., Scelochiloides only from south-eastern Brazil; the small cream Dodson & M.W.Chase, Stigmatorthos M.W.Chase & flowers have an open lip and an unusual pair of D.E.Bennett, Pfitzeria Senghas and Scelochilopsis downward-pointing arms on the column apex. Dodson & M.W.Chase. As more species in this clade Nothing is known of pollination. Its placement within were discovered in recent years, generic limits this clade is unresolved, and Chase (2009b) hypoth- became more obscure, and the amalgamation of all esized that it might be related to the monotypic taxa with nectar horns into a single genus appears to Suarezia from eastern Ecuador. The latter was not be the best solution. Scelochilus does not appear to be included in our sampling. monophyletic. There is variation in vegetative habit Trizeuxis Lindl. (one sp.; Fig. 12) is wide ranging within this clade from psygmoid fans to caespitose from Costa Rica south to Peru and also in eastern plants with bifacial leaves and pseudobulbs. Some Brazil. Its flowers are perhaps the smallest of any species can begin flowering as juvenile psygmoid Oncidiinae, only 2–3 mm across, yet they are outcross- plants before transformation into adult plants with ing and often found growing on twigs of cultivated pseudobulbs, and damage can cause a reversal to Citrus L and Psidium L. Pollinators are unknown, psygmoid seedling habit. Pollination by humming- although presumed to be small nectar-foraging birds (Amazalia sp., Chlorostilbon maugaeus)is insects. documented for Comparettia falcata (Dodson, 1965; Seegeriella Senghas (two spp.; Fig. 12) is Salguero-Faria & Ackerman, 1999). Pollination by restricted to Argentina and Brazil. Like Trizeuxis, butterflies and long-tongued bees appears likely for the yellow–green flowers are diminutive with a some taxa. simple lip and sepals that do not open widely. Pol- Polyotidium Garay (one sp.; Fig. 12) is reported linators are presumed to be nectar-seeking insects. only from Ecuador, Venezuela, Brazil and the Orinoco The remaining four genera are all pollinated by drainage of Colombia. The 5 mm, fleshy bright orange fragrance-collecting male euglossine bees, and all but flowers have a simple lip and a dorsal anther, sug- Warmingia Rchb.f. have a narrow, slit-like stigma, gestive of hummingbird pollination. Its phylogenetic pollinaria with a button-like viscidium and a long, position is unresolved within a strongly supported narrow stipe and pollinia that are dorsiventrally

flattened and thin to match the opening of the CONCLUSION slit-like stigmatic cavity. The narrow pollinia and The present study presents well supported and highly stigmatic slit probably act to reduce self-pollination. resolved phylogenetic hypotheses of relationships of all When first removed by a bee, the pollinia are too major clades within Oncidiinae based on dense taxon wide to fit easily into the stigmatic slit, and the sampling. The deeper topology of this tree strongly stigma is too narrow (W. M. Whitten, pers. observ.). reflects the emphasis on plastid data. Additional The stigma widens after pollinarium removal. Several nuclear data sets such as Xdh (Górniak, Paun & minutes to hours of drying are required to shrink the Chase, 2010) would be useful to increase support for pollinia before they will slip into the stigma, during the topology and improve resolution of the spine of the which time the bee is likely to have flown to another tree. Our translation of this tree into a generic classi- plant. fication results in the first classification of Oncidiinae Macradenia R.Br. (ten spp.; Fig. 12) ranges from in which the genera are demonstrably monophyletic. Mexico south throughout most of lowland South Comparison of our trees with previous classifications America. The pendent, unbranched inflorescence reveals that most of the taxonomic disputes involve bears numerous flowers that attract fragrance- clades that contain large numbers of species with collecting male euglossine bees. The anther is termi- yellow ‘oncidioid’ floral morphology. We hypothesize nal and beaked, and the column and lip are twisted, that widespread mimicry involving Malpighiaceae, giving the flower a distinct asymmetry unique within Oncidiinae and perhaps Calceolaria (Calceolariaceae) Oncidiinae. This asymmetry may be related to polli- has resulted in extensive homoplasy in gross floral narium deposition on the side of the head or eye of features within Oncidiinae. Previous noncladistic clas- the bee. sifications of Oncidiinae were largely based on floral Warmingia Rchb.f. (three spp.; Fig. 12) has an characters, and the homoplasy in oil flower-related oddly disjunct distribution, including Costa Rica, floral traits resulted in non-monophyletic generic con- southern Ecuador and Brazil. Pollination has not cepts. Clades with other pollination syndromes (e.g. been reported, although their floral fragrance is nectar reward/deceit or male euglossine fragrance similar to some Macroclinium and is produced abun- rewards) generally display fewer taxonomic disagree- dantly during the morning, suggestive of pollination ments. The generic scheme presented here paves the by male euglossine bees. way for monographic work and studies of character Macroclinium Barb. Rodr. (40 spp.; Figs 2Z, 12) evolution. Orchid taxonomists may still disagree on ranges throughout much of the Neotropics from which clades to recognize at generic level (e.g. within Mexico south to Peru and Brazil. The plants are Trichocentrum s.l.), although the phylogenetic hypoth- diminutive extreme twig epiphytes, and are often eses from the present study will be useful for framing found on cultivated Citrus and Psidium. The flowers such debates. are similar in morphology and function to its sister genus Notylia, although the two differ in inflorescence and vegetative habit. Macroclinium species are often ACKNOWLEDGEMENTS monopodial, with small psygmoid fans generally lacking pseudobulbs. The inflorescence is pendent, The authors thank the herbaria of the Pontificia pseudo-umbellate, with clusters of numerous delicate Universidad Católica de Quito (QCA), the Univer- flowers with narrow sepals, petals and lip. Despite sidad de Panamá (PMA), the Universidad de Costa their small size, the fragrant flowers attract relatively Rica (USJ), the Ministerio del Ambiente of Ecuador, large male euglossine bees. Pollinaria are deposited and the Autoridad Nacional del Ambiente of Panama on the face (frons) of the bee during fragrance collec- for facilitating our research and issuing collecting and tion (Dodson, 1967). CITES permits. We are especially grateful to the Notylia Lindl. (60 spp.; Fig. 12) also range Portilla family and their staff at Ecuagenera Ltd. throughout much of the Neotropics, similar to its (Ecuador), Andrés Maduro and staff at Finca Dracula sister, Macroclinium. In contrast to the paedomorphic (Panama), Jardín Botánico Lankester (Costa Rica), fans of Macroclinium, plants of Notylia mature to Marie Selby Botanical Gardens (Sarasota, FL, USA), bear a pseudobulb and relatively large conduplicate Atlanta Botanical Garden (Atlanta, GA, USA), Steve leaves. The flowers are similar to those of Macro- Beckendorf (Berkeley, CA, USA), Harry and Andy clinium, although they are presented evenly spaced Phillips (Encinitas, CA, USA) and Günter Gerlach on a pendent, usually unbranched raceme. Pollination (Munich Botanical Garden, Munich, Germany) for is also by fragrance-collecting male euglossine bees, allowing us generous access to their orchid collec- with pollinarium deposition on the labrum or frons of tions. Delsy Trujillo contributed Peruvian specimens. the bee (Warford, 1992; Singer & Koehler, 2003; Samantha Koehler, Universidade Federal de São Pérez-Hérnandez et al., 2011). Paulo, SP, Brazil and Aparacida de Faria, Univer-

© 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117–146 ONCIDIINAE PHYLOGENETICS 143 sidade Estadual de Maringá, PR, Brazil contributed A comparative survey of floral characters in Capanemia data for Brazilian taxa. Robert L. Dressler and Barb. Rodr. (Orchidaceae:Oncidiinae). Annals of Botany doi: Calaway H. Dodson helped to initiate this project 10.1093/aob/mcr241. and provided access to specimens, taxonomic advice Buzatto CR, Singer RB, Romero-González GA, van den and assistance with field work. Stig Dalström pro- Berg C. 2011. Typifications and new synonymies in Capa- vided invaluable determinations of many specimens nemia (Orchidaceae: Oncidiinae). Novon 21: 28–33. and stimulating discussions. Kent Perkins (FLAS) Buzatto CR, Singer RB, van den Berg C. 2010. O gênero provided specimen curation and image databasing. Capanemia Barb. Rodr. (Oncidiinae: Orchidaceae) na Região Sul do Brasil. Revista Brasileira de Biociências 8: 309– DNA sequencing was performed by the ICBR core 323. facility at University of Florida. This work was Cameron KM. 2004. Utility of plastid psaB gene sequences supported by NSF grants DEB-9815821 to N.H.W., for investigating intrafamilial relationships within Orchi- DEB-9509071 to W.M.W., DEB-0234064 to N.H.W. daceae. Molecular Phylogenetics and Evolution 31: 1157– and W.M.W., and IOB-0543659 to J.C.C., N.H.W. and 1180. W.M.W., by grants from the American Orchid Society Cameron KM, Chase MW, Whitten WM, Kores PJ, Fund for Education and Research, the Florida Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman Museum of Natural History, and the Royal Botanic DH. 1999. A phylogenetic analysis of the Orchidaceae: evi- Gardens, Kew. Additional funding was provided by dence from rbcL nucleotide sequences. American Journal of Furniss Foundation graduate student fellowships Botany 86: 208–224. from the American Orchid Society to M. A. Blanco Cane JH, Eickwort GC, Wesley FR, Spielholz J. 1983. and L. Endara and by a RBG Kew Latin American Foraging, grooming and mate-seeking behaviors of Macropis Research Fellowship to M. A. Blanco (to study speci- nuda (Hymenoptera, Melittidae) and use of Lysimachia mens in European herbaria). ciliata (Primulaceae) oils in larval provisions and cell linings. American Midland Naturalist 110: 257–264. REFERENCES Carmona-Díaz G, García-Franco JG. 2009. Reproductive success in the Mexican rewardless Oncidium cosymbepho- Ackerman JD, Meléndez-Ackerman EJ, Salguero Faria rum (Orchidaceae) facilitated by the oil-rewarding Mal- J. 1997. Variation in pollinator abundance and selection on pighia glabra (Malpighiaceae). Plant Ecology 203: 253–261. fragrance phenotypes in an epiphytic orchid. American Charanasri U, Kamemoto H. 1975. Additional chromosome Journal of Botany 84: 1383–1390. numbers in Oncidium and allied genera. American Orchid Aliscioni SS, Torretta JP, Bello ME, Galati BG. 2009. Society Bulletin 44: 686–691. Elaiophores in Gomesa bifolia (Sims) MW Chase & NH Chase MW. 1986a. Pollination biology of two sympatric, Williams (Oncidiinae: Cymbidieae: Orchidaceae): structure synchonously flowering species of Leochilus in Costa Rica. and oil secretion. Annals of Botany 104: 1141–1149. Lindleyana 1: 141–147. Bembe B. 2004. Functional morphology in male euglossine Chase MW. 1986b. A reappraisal of the oncidioid orchids. bees and their ability to spray fragrances (Hymenoptera, Systematic Botany 11: 477–491. Apidae, Euglossini). Apidologie 35: 283–291. Chase MW. 1988. Obligate twig epiphytes: a distinct subset van den Berg C, Goldman DH, Freudenstein JV, Prid- of Neotropical orchidaceous epiphytes. Selbyana 10: 24–30. geon AM, Cameron KM, Chase MW. 2005. An overview Chase MW. 2005. Psychopsis limminghei. Curtis’s Botanical of the phylogenetic relationships within Epidendroideae Magazine 22: 53–55. inferred from multiple DNA regions and recircumscription Chase MW. 2009a. A new name for the single species of of Epidendreae and Arethuseae (Orchidaceae). American Nohawilliamsia and corrections in Gomesa (Orchidaceae). Journal of Botany 92: 613–624. Phytotaxa 1: 57–59. Braem G. 1986. The taxonomy of plants formerly referred to Chase MW. 2009b. Subtribe Oncidiinae. In: Pridgeon AM, Oncidium section Oncidium (Orchidaceae) in the Caribbean Chase MW, Cribb PJ, Rasmussen FN, eds. Genera Orchi- islands. PhD dissertation, University of Newcastle Upon dacearum, Vol. 5. Epidendroideae (part two). Oxford: Oxford Tyne. University Press, 211–394. Braem G. 1993. Studies in the Oncidiinae, discussion of some Chase MW, Cameron KM, Barrett RL, Freudenstein JV. taxonomic problems with description of Gudrunia Braem, 2003. DNA data and Orchidaceae systematics: a new phy- gen. nov., and the reinstatement of the genus Lophiaris logenetic classification. In: Dixon KW, Kell SP, Barrett RL, Rafinesque. Schlecteriana 4: 8–29. Cribb PJ, eds. Orchid conservation. Kota Kinabalu: Natural Braem G. 2010. Comments on plant taxonomy with special History Publications, 69–89. reference to Orchidaceae and monospecific genera. Richar- Chase MW, Hanson L, Albert VA, Whitten WM, Williams diana 10: 101–117. NH. 2005. Life history evolution and genome size in subtribe Buchmann SL. 1987. The ecology of oil flowers and their Oncidiinae (Orchidaceae). Annals of Botany 95: 191–199. bees. Annual Review of Ecology and Systematics 18: 343– Chase MW, Hills HH. 1991. Silica gel: an ideal material for 396. field preservation of leaf samples for DNA studies. Taxon 40: Buzatto CR, Davies KL, Singer RB, dos Santos RP. 2011. 215–220.

Chase MW, Olmstead RG. 1988. Isozyme number in sub- Dodson CH. 2003. Native ecuadorian orchids, Vol. 5. tribe Oncidiinae (Orchidaceae) – an evaluation of polyp- Sarasota: The Dodson Trust. loidy. American Journal of Botany 75: 1080–1085. Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure Chase MW, Palmer JD. 1987. Chloroplast DNA systematics for small quantities of fresh leaf tissue. Phytochemical of the subtribe Oncidiinae (Orchidaceae). American Journal Bulletin, Botanical Society of America 19: 11–15. of Botany 74: 728–728. Dressler RL. 1993. Phylogeny and classification of the orchid Chase MW, Whitten WM. 2011. Further taxonomic transfers family. Portland, OR: Dioscorides Press. in Oncidiinae (Orchidaceae). Phytotaxa 20: 26–32. Dressler RL, Williams NH. 1975. El Complejo Oncidoglos- Chase MW, Williams NH, de Faria AD, Neubig KM, sum Confusum. Orquídea (México) 4: 332–352. Amaral MDCE, Whitten WM. 2009a. Floral convergence Eltz T, Roubik D, Lunau K. 2005. Experience-dependent in Oncidiinae (Cymbidieae; Orchidaceae): an expanded choices ensure species-specific fragrance accumulation in concept of Gomesa and a new genus Nohawilliamsia. male orchid bees. Behavioral Ecology and Sociobiology 59: Annals of Botany 104: 387–402. 149–156. Chase MW, Williams NH, Whitten WM. 2009b. Oncidiinae Felsenstein J. 1985. Confidence limits on phylogenies – an nomenclature: generic changes in Genera Orchidacearum, approach using the bootstrap. Evolution 39: 783–791. Vol. 5. Orchids 78: 228–238. Fernandez-Concha GC, de Stefano RD, Romero- Christenson EA. 1999. The return of Cohniella (Orchi- González GA, Balam R, Cetzal W, Tapia-Munoz JL, daceae: Oncidiinae). Lindleyana 14: 176–177. Ramirez IM. 2009. A reappraisal of the turtle-orchids, Christenson EA. 2005. Phymatochilum, un nouveau genre genus Chelyorchis (Oncidiinae: Orchidaceae): molecular, monotypique du Brésil (Orchidaceae: Oncidiinae). Richardi- phylogenetic, and morphometric approaches. Journal of the ana 5: 194–196. Torrey Botanical Society 136: 164–185. Christenson EA. 2006. Brevilongium, un nouveau genre Fernandez-Concha GC, Ix WRC, Narvaez R, Romero- néotropical (Orchidaceae: Oncidiinae). Richardiana 6: González GA. 2010. A synopsis of Cohniella (Orchidaceae, 45–49. Oncidiinae). Brittonia 62: 153–177. Cribb PJ. 2009. Tribe Cymbidieae. In: Pridgeon AM, Chase Garay LA. 1963. Oliveriana and its position in the Oncidieae. MW, Cribb PJ, Rasmussen FN, eds. Genera Orchidacearum, American Orchid Society Bulletin 32: 19–24. Vol. 5. Epidendroideae (part two). Oxford: Oxford University Garay LA, Stacy JE. 1974. Synopsis of the genus Oncidium. Press, 3–11. Bradea 1: 393–429. Dalström S. 2001. A synopsis of the genus Cyrtochilum Górniak M, Paun O, Chase MW. 2010. Phylogenetic rela- (Orchidaceae: Oncidiinae): taxonomic reevaluation and new tionships within Orchidaceae based on a low-copy nuclear combinations. Lindleyana 16: 56–80. coding gene, Xdh: congruence with organellar and nuclear Damon AA, Cruz-López L. 2006. Fragrance in relation to ribosomal DNA results. Molecular Phylogenetics and pollination of Oncidium sphacelatum and Trichocentrum Evolution 56: 784–795. oerstedii (Orchidaceae) in the Soconusco region of Chiapas, Jenny R. 2010. Otoglossum, una revisión taxonómica. Mexico. Selbyana 27: 186–194. Orquideologia 27: 63–90. Davies KL, Stpiczynska M. 2009. Comparative histology of Johnson LA, Soltis DE. 1994. matK DNA sequences and floral elaiophores in the orchids Rudolfiella picta (Schltr.) phylogenetic reconstruction in Saxifragaceae s.st. System- Hoehne (Maxillariinae sensu lato) and Oncidium ornitho- atic Botany 19: 143–156. rhynchum HBK (Oncidiinae sensu lato). Annals of Botany Melo GAR, Gaglianone MC. 2005. Females of Tapinota- 104: 221–234. spoides, a genus in the oil-collecting bee tribe Tapinota- Docha Neto A, Baptista DH, Campacci MA. 2006. Novos spidini, collect secretions from non-floral trichomes generos baseadas nos Oncidium brasileiros. Coletâna de (Hymenoptera, Apidae). Revista Brasileira De Entomologia Orquideas Brasileiras 3: 20–95. 49: 167–168. Dod DD. 1976. Oncidium henekenii – bee orchid pollinated by Molvray M, Kores PJ, Chase MW. 2000. Polyphyly of bee. American Orchid Society Bulletin 45: 792–794. mycoheterotrophic orchids and functional influences of Dodson CH. 1957. Chromosome number in Oncidium and floral and molecular characters. In: Wilson KL, Morrison allied genera. American Orchid Society Bulletin 26: 323– DA, eds. Monocots: systematics and evolution. Collingswood: 330. CSIRO Publishing, 441–448. Dodson CH. 1962. The importance of pollination in the Neubig KM, Whitten WM, Carlsward BS, Blanco MA, evolution of the orchids of tropical America. American Endara L, Williams NH, Moore M. 2009. Phylogenetic Orchid Society Bulletin 31: 525–534 641–649,731–735. utility of ycf1 in orchids: a plastid gene more variable than Dodson CH. 1965. Agentes de polinización y su influencia matK. Plant Systematics and Evolution 277: 75–84. sobre la evolución de la familia Orquidacea. Universidad Nierenberg L. 1972. The mechanism of the maintenance of Nacional de la Amazonía Peruana, Instituto General de the species integrity in sympatrically occurring equitant Investigación. oncidiums in the Caribbean. American Orchid Society Bul- Dodson CH. 1967. Studies in orchid pollination: the letin 41: 873–881. genus Notylia. American Orchid Society Bulletin 36: Pansarin LM, Castro MD, Sazima M. 2009. Osmophore 209–214. and elaiophores of Grobya amherstiae (Catasetinae, Orchi-

daceae) and their relation to pollination. Botanical Journal Silvera K, Neubig KM, Whitten WM, Williams NH, of the Linnean Society 159: 408–415. Winter K, Cushman JC. 2010a. Evolution along the cras- Parra-Tabla V, Vargas CF, Magana-Rueda S, Navarro J. sulacean acid metabolism continuum. Functional Plant 2000. Female and male pollination success of Oncidium Biology 37: 995–1010. ascendens Lindey (Orchidaceae) in two contrasting habitat Silvera K, Santiago LS, Cushman JC, Winter K. 2010b. patches: forest vs agricultural field. Biological Conservation The incidence of crassulacean acid metabolism in Orchi- 94: 335–340. daceae derived from carbon isotope ratios: a checklist of the Pérez-Hérnandez H, Damon A, Valle-Mora J, Sánches- flora of Panama and Costa Rica. Botanical Journal of the Guillen D. 2011. Orchid polllination: specialization in Linnean Society 163: 194–222. chance? Botanical Journal of the Linnean Society 165: 251– Silvera K, Santiago LS, Cushman JC, Winter K. 2009. 266. Crassulacean acid metabolism and epiphytism linked to van der Pijl L, Dodson CH. 1966. Orchid flowers: their adaptive radiations in the Orchidaceae. Plant Physiology pollination and evolution. Coral Gables, FL: University of 149: 1838–1847. Miami Press. Singer RB, Cocucci AA. 1999. Pollination mechanisms in Powell MP. 2008. Evolutionary ecology of Neotropical four sympatric southern Brazilian Epidendroideae orchids. orchids, with an emphasis on Oncidiinae. PhD dissertation, Lindleyana 14: 47–56. University of Reading. Singer RB, Koehler S. 2003. Notes on the pollination of Reis MG, de Faria AD, Bittrich V, Amaral MDE, Mar- Notylia nemorosa (Orchidaceae): do pollinators necessarily saioli AJ. 2000. The chemistry of flower rewards – promote cross-pollination? Journal of Plant Research 116: Oncidium (Orchidaceae). Journal of the Brazilian Chemical 19–25. Society 11: 600–608. Sosa V, Chase MW, Salazar GE, Whitten WM, Williams Reis MG, de Faria AD, dos Santos IA, Amaral MDE, NH. 2001. Phylogenetic position of Dignathe (Orchidaceae: Marsaioli AJ. 2007. Byrsonic acid – the clue to floral Oncidiinae): evidence from nuclear ITS ribosomal DNA mimicry involving oil-producing flowers and oil-collecting sequences. Lindleyana 16: 94–101. bees. Journal of Chemical Ecology 33: 1421–1429. Soto M, Salazar GA, Rojas Leal A. 1993. Nomenclatural Rojas Leal A. 1993. Anatomía foliar comparada de Lembo- changes in Rhynchostele, Mesoglossum, and Lemboglossum glossum (Orchidaceae: Oncidiinae) y generos relacionados. (Orchidaceae, Oncidiinae). Orquídea (México) 13: 145–152. Biólogo thesis, Universidad Nacional Autonoma de Mexico. Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood- Roubik DW. 1989. Ecology and natural history of tropical based phylogenetic analyses with thousands of taxa and bees. New York, NY: Cambridge University Press. mixed models. Bioinformatics 22: 2688–2690. Roy BA, Widmer A. 1999. Floral mimicry: a fascinating yet Stpiczynska M, Davies KL. 2008. Elaiophore structure and poorly understood phenomenon. Trends in Plant Science 4: oil secretion in flowers of Oncidium trulliferum Lindl. and 325–330. Ornithophora radicans (Rchb.f.) Garay & Pabst (Oncidiinae Salguero-Faria JA, Ackerman JD. 1999. A nectar reward: : Orchidaceae). Annals of Botany 101: 375–384. is more better? Biotropica 31: 303–311. Stpiczynska M, Davies KL, Gregg A. 2007. Elaiophore Sandoval-Zapotitla E, García-Cruz J, Terrazas T, diversity in three contrasting members of Oncidiinae Villasenor JL. 2010. Phylogenetic relationships of the (Orchidaceae). Botanical Journal of the Linnean Society subtribe Oncidiinae (Orchidaceae) inferred from structural 155: 135–148. and DNA sequences (matK, ITS): a combined approach. Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994. Phylo- Revista Mexicana De Biodiversidad 81: 263–279. genetic analysis of Sorghum and related taxa using internal Sandoval-Zapotitla E, Terrazas T. 2001. Leaf anatomy of transcribed spacers of nuclear ribosomal DNA. Theoretical 16 taxa of the Trichocentrum clade (Orchidaceae: Oncidii- and Applied Genetics 89: 26–32. nae). Lindleyana 16: 81–93. Szlachetko DL. 1995. Systema orchidalium, fragmenta flo- Sazima M, Sazima I. 1988. Oil-gathering bees visit flowers of ristica et geobotanica. Supplementum 3. Kraków: W. Szafer eglandular morphs of the oil-producing Malpighiaceae. Institute of Botany, Polish Academy of Sciences. Botanica Acta 102: 106–111. Szlachetko DL. 2006. Genera et species orchidalium. 11. Senghas K. 1997. Rudolf schlecter’s die orchideen, band i/c, Oncidieae. Polish Botanical Journal 51: 39–41. 33-36. Berlin: Paul Parey. Szlachetko DL, Mytnik-Ejsmont J, Romowicz A. 2006. Senghas K. 2001. Neobennettia, eine neue Gattung aus den Genera et species orchidalium. 14. Oncidieae. Polish Botani- peruanischen Anden – mit einem Uberblick zur Gattung cal Journal 51: 53–55. Lockhartia. Journal für den Orchideenfreund 8: 354–364. Tanaka R, Kamemoto H. 1984. Chromosomes in orchids: Sigrist MR, Sazima M. 2004. Pollination and reproductive counting and numbers. In: Arditti J, ed. Orchid biology: biology of twelve species of neotropical Malpighiaceae: reviews and perspectives, III. Ithaca, NY: Cornell University stigma morphology and its implications for the breeding Press, 324–410. system. Annals of Botany 94: 33–41. Tavare S. 1986. Some probabilistic and statistical problems Silvera K. 2002. Adaptive radiation of oil-reward compounds in the analysis of DNA sequences. Lectures on Mathematics among neotropical orchid species (Oncidiinae). MS Thesis, in the Life Sciences 17: 56–86. University of Florida. Toscano de Brito ALV, Dressler RL. 2000. New combina-

tions in Ornithocephalus (Ornithocephalinae: Orchidaceae) from four DNA sequence regions: expanded circumscriptions and description of a new species from Mesoamerica. Lind- of Cyrtochilum, Erycina, Otoglossum, and Trichocentrum leyana 15: 252–256. and a new genus (Orchidaceae). Lindleyana 16: 113– Vale A, Navarro L, Rojas D, Álvarez JC. 2011. Breeding 139. system and pollination by mimicry of the orchid Tolumnia Williams NH, Chase MW, Whitten WM. 2001b. Phyloge- guibertiana in Western Cuba. Plant Species Biology 26: netic positions of Miltoniopsis, Caucaea, a new genus, 163–173. Cyrtochiloides, and Oncidium phymatochilum (Orchidaceae: Warford N. 1992. Pollination biology: the reciprocal agree- Oncidiinae). Lindleyana 16: 272–285. ment between Notylia and Euglossa viridissima. American Williams NH, Whitten WM, Dressler RL. 2005. Molecular Orchid Society Bulletin 61: 885–889. systematics of Telipogon (Orchidaceae: Oncidiinae) and its Whitten MW, Williams NH, Chase MW. 2000. Subtribal allies: nuclear and plastid DNA sequence data. Lankesteri- and generic relationships of Maxillarieae (Orchidaceae) ana 5: 163–184. with emphasis on Stanhopeinae: combined molecular evi- Xu DH, Abe J, Sakai M, Kanazawa A, Shimamoto Y. dence. American Journal of Botany 87: 1842–1856. 2000. Sequence variation of non-coding regions of chloro- Whitten WM. 2009. Nohawilliamsia: a new genus honors plast DNA of soybean and related wild species and its Norris H. Williams, PhD. Orchids 78: 552–555. implications for the evolution of different chloroplast Williams NH. 1972. A reconsideration of Ada and the haplotypes. Theoretical and Applied Genetics 101: 724– glumaceous brassias (Orchidaceae). Brittonia 24: 732. 93–110. Zimmerman JK, Aide TM. 1987. Patterns of ﬂower and Williams NH. 1982. The biology of orchids and euglos- fruit production in the orchid Aspasia principissa Rchb.f. sine bees. In: Arditti J, ed. Orchid biology: reviews and American Journal of Botany 74: 661–661. perspectives II. Ithaca, NY: Cornell University Press, 119– Zimmermann Y, Roubik DW, Quezada-Euan JJG, 171. Paxton RJ, Eltz T. 2009. Single mating in orchid bees Williams NH, Chase MW, Fulcher T, Whitten WM. 2001a. (Euglossa, Apinae): implications for mate choice and social Molecular systematics of the Oncidiinae based on evidence evolution. Insectes Sociaux 56: 241–249.

SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article: Appendix S1. List of voucher specimens and GenBank numbers. The DNA numbers correspond to individuals sequenced in Figs 3–12. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.