First Assessment of Mitochondrial DNA Diversity in the Endangered

222 CHELONIAN CONSERVATION AND BIOLOGY, Volume 8, Number 2 – 2009

most closely related to other ‘‘giant’’ softshells that persist in eastern Asia (Engstrom et al. 2004). Giant softshells are all endangered (Praschag and Gemel 2002; Moll and Moll 2004) because they require large rivers and estuaries, fragile habitats that also happen to be heavily occupied and fished by humans. Trionyx triunguis is heavily exploited because of its meat, and its habitats have been degraded by pollution and dam construction. Accidental capture and intentional killing also affect the survival of most populations (Gramentz 2005; Tu¨rkozan 2007). In fact, T. triunguis has been eradicated from the Nile Delta as well as the rest of Egypt (Schleich et al. 1996; Nada 2002; Baha el Din 2006). The Mediterranean population of T. triunguis has been listed by IUCN as critically endangered (European Reptile and Amphibian Specialist Group 1996) (category CR C2A) and estimated at fewer than 1000 adults (Kasparek 2001; Venizelos and Kasparek 2006). Around the eastern Mediterranean, this species persists in Egypt, Israel, Lebanon, Syria, and especially Turkey, where the Chelonian Conservation and Biology, 2009, 8(2): 222–226 g 2009 Chelonian Research Foundation largest populations are found. Important nesting populations have been recorded along the Mediterranean coast First Assessment of Mitochondrial DNA between Dalyan and Samandag˘ (Atatu¨r 1979; Gramentz Diversity in the Endangered Nile Softshell 1993; Kasparek 1994; Tu¨rkozan 2009). Studies on T. triunguis are very limited and restricted Turtle, Trionyx triunguis,in mainly to distribution, ecology, ethology, and reproduc- the Mediterranean tive ecology studies (Leshem and D’miel 1986; Kasparek and Kinzelbach 1991; Gramentz 1993, 1994; van der 1 1 O¨ ZGU¨ R GU¨ C¸LU¨ ,CELAL ULGER , Winden et al. 1994; Gidis¸ and Kaska 2004; Tu¨rkozan et 1 2 OG˘ UZ TU¨ RKOZAN ,RICHARD GEMEL , al. 2006). However, the need for improved knowledge of 3 4 the conservation biology of the declining populations MICHAEL REIMANN ,YANIV LEVY , 5 6 prompted us to initiate applied studies that can help guide SERAP ERGENE ,AS¸KIN HASAN UC¸AR , AND the management and survival of the species. The aim of 5 CEMIL AYMAK this study is to provide a preliminary assessment of the genetic variation in mitochondrial DNA (mtDNA) of T. 1 Adnan Menderes University, Faculty of Science and Arts, triunguis in order to guide conservation strategies. Department of Biology, 09010 Aydın, Turkey [[email protected]]; Methods. — Tissue samples were collected either 2Naturhistorisches Museum Wien, Herpetologische Sammlung, Burgring 7, A-1010 Wien, Austria; from dead hatchlings or live adults between 2005 and 3Neuweg 1, D-55595 Braunweiler, Germany; 2008. A total of 26 samples were studied from 6 different 4Sea Turtle Rescue Center, Israel National Nature and Parks populations (Fig. 1). Of these sampling localities, 4 were Authority, Mevoot Yam, Mikhmoret 40297 Israel; 5 from Turkey, namely Dalyan (DL) (3 specimens), Dala- Mersin University, Faculty of Science and Arts, Department of man (DM) (6 specimens), Anamur (AN) (4 specimens), Biology, 33342 Mersin, Turkey; 6Osmaniye Korkut Ata University, Faculty of Science and Arts, and Kazanlı (KZ) (3 specimens). Furthermore, we Department of Biology, Osmaniye, 80010 Turkey collected tissues from Israel (IS-Alexander river) (6 specimens) and were provided tissue samples from adult ABSTRACT. – We assessed mitochondrial DNA diversity captive animals that apparently originated from the sub- in Trionyx triunguis from the Mediterranean basin (22 Saharan African continent (AF) (4 specimens). The samples) and continental Africa (4 samples). The precise localities of the African samples were unknown; continental African group comprised 4 different and however, the partial cytochorome b (cyt b) gene newly described haplotypes, while the Mediterranean sequences of museum materials (Paris Natural History group consisted of only 1 previously known haplotype, Museum, France) originating from Gabon and Congo with the nucleotide divergence between the 2 groups confirmed that our African samples were apparently from being 1.5% ± 0.7%. sub-Saharan Africa rather than the Nile drainage. We did not use these Gabon and Congo specimens in our study Trionyx triunguis is the only species of Trionyx, the because of problems with degraded DNA; we were not genus from which the Linnaean family name Trionychi- able to obtain whole gene sequences for these samples as dae is formed. Molecular studies show that T. triunguis is we did for the rest of our specimens. NOTES AND FIELD REPORTS 223

Figure 1. Map of Mediterranean basin showing sampling sites, mtDNA haplotypes, and observed number of haplotypes.

We used partial sequences of both cyt b and NAD 4 purified using the PCR Purification Kit (Invitrogen). (also commonly abbreviated ND4) genes of mtDNA that Amplicons were analyzed on an AB3700 or 3730xl have been used in other phylogenetic studies of automatic sequencer (Macrogen, Applied Biosystems) trionychids (Weisrock and Janzen 2000; Engstrom et al. using the same primers mentioned previously. 2004). These relatively rapidly evolving markers have Sequence analyses were aligned using BioEdit 7.0.9 been used in order to determine the genetic diversity (Hall 1999). Multiple-sequence alignments were done within and among populations. with CLUSTALW (Thompson et al. 1994) using the Genomic DNA was extracted by standard phenol/ default parameters. The computer-generated alignment chloroform techniques (Sambrook and Russell 2001) was further adjusted manually. Genealogical relationships using a commercial DNA extraction kit (Invitrogen among haplotypes were constructed using TCS (Clement Inc.). Two mitochondrial genes (ND4 and cyt b) were et al. 2000), with statistical parsimony algorithm de- amplified via the polymerase chain reaction (PCR) using scribed by Templeton et al. (1992) to estimate the number the following primers: ND4—ND4 4672 (F) (59-TGAC- of differences among haplotypes as a result of a single TACCAAAAGCTCATGTAGAAGC-39) (Engstrom et al. substitution with a 90% statistical confidence as the 2002), Hist (R) (59-CCTATTTTTAGAGCCACAGTC- parsimony connection limit and also the most probable TAATG -39) (Arevalo et al. 1994), and cyt b—DW 2000 ancestral haplotype. For this analysis, combined mtDNA (F) (59-ACAGGCGTAATCCTACTAA-39) (Weisrock cyt b and ND4 genes were used to construct an unrooted and Janzen 2000), DW 1594 (R) (59-TCATCTTCGGTT- parsimony network. TACAAGAC-39) (Shaffer et al. 1997). PCR amplifica- We estimated net nucleotide divergence (Da) and tions were performed in 50-mL volumes containing 1X standard deviations between phylogroups (Nei 1987) with KCl PCR buffer (Fermantas), 1.5 mM MgCl2 (Ferman- the Jukes–Cantor correction (Jukes and Cantor 1969) in tas), 2.5 mM each dNTP, 0.5 mM each primer (1 mM for the Dnasp program (Rozas et al. 2003). cyt b), 1.0 units of Taq polymerase (Fermantas), and 1– Results. — The cyt b and ND4 fragments amplified in 2 mL (50 ng DNA) of template DNA. Amplicons were 26 T. triunguis samples had nucleotide lengths of 805 and 224 CHELONIAN CONSERVATION AND BIOLOGY, Volume 8, Number 2 – 2009

Table 1. Variable sites of combined ND4 and cyt b mtDNA genes sequences in 26 individuals of Trionyx triunguis. DL: Dalyan, DM: Dalaman, AN: Anamur, KZ: Kazanlı, IS: Israel, AF: Africa.

Polymorphic sites 11111111111 1244445556788911222344445 179003350225725367168801491 DDAKI A 232252600257657638487522641 L M N Z S F Haplotypes (TT-A1) AATGGATTAAGGGGGGGAAGGAATCGT 36436 (TT-A2) GCCAA.CC.GAAAAAAAGGAAGCCTAC 1 (TT-A3) GCCAAGCC..AAAAAAA.G.AGCCTAC 1 (TT-A4) GCCAAGCC..AAAAAAAGG.AGCCTAC 1 (TT-A5) GCCAA.CCG.AAAAAAAGG.AGCCTAC 1

732 base pairs, respectively. Five mitochondrial DNA populations, may reflect nest site fidelity, as is seen in haplotypes were found, 4 of which are reported here for various species of sea turtles (Bowen and Karl 1996). the first time (TT-A2-GU003980 for ND4, GU003977 for In sea turtles, females show strong philopatry (as cyt b; TT-A3-GU003981 for ND4, GU003978 for cyt b; evidenced by mtDNA), but this is not reflected in TT-A4-GU003981 for ND4, GU003979 for cyt b; TT-A5- bisexually inherited nuclear markers. Additional studies GU003982 for ND4, GU003979 for cyt b), while using nuclear markers as well as known-provenance haplotype TT-A1 was identical with one previously specimens from the sub-Saharan African continent are reported by Engstrom et al. (2004). The identified new sorely needed. The recognition of distinct mitochondrial haplotypes have been deposited in GenBank. Nucleotide and haplotype diversity was 0.004 and 0.29, respectively. Twenty-seven polymorphic sites were detected, consist- ing of 25 transitions and 2 transversions (Table 1). According to the network analysis (Fig. 2) of 5 haplotypes (Posada and Crandall 2001), 2 highly divergent groups of haplotypes were supported. Of these, the African group (AF) comprised 4 different and newly described haplotypes, while the Mediterranean group (DL, DM, AN, KZ, IS) consisted of only 1 haplotype, TT- A1. Apparently, haplotype TT-A1 is fixed to the Mediterranean region. Haplotype TT-A3 was identified as ancestral based on root probability density criterion (Templeton 1998). The nucleotide divergence between populations from the Mediterranean basin and continental Africa was 1.5% ± 0.7%. Discussion. — Our study represents the first assessment of genetic variation within T. triunguis. The existence of a single haplotype in the Mediterranean likely reflects migration among river systems through the sea, with gene flow among the populations studied. In fact, there are many records of T. triunguis being found well out to sea from the coasts of Africa and Turkey, in the Aegean and Mediterranean (Pritchard 1979; Tas¸kavak et al. 1999; Oruç 2001; Tas¸kavak and Akçınar 2008). The apparent interconnectedness of Turkish populations of T. triunguis may benefit regional conservation efforts since the translocation of individuals in headstarting or other release efforts may not suffer from inadvertent genetic pollution. Nevertheless, future studies using rapidly evolving markers from the nuclear genome (microsatel- lites) will be necessary to clarify this pattern. Maternally inherited markers showed strong population structure, Figure 2. Genealogical relationships among 5 haplotypes of T. triunguis estimated by TCS (Clement et al. 2000). Small, white suggesting isolation between Africa and the Mediterra- circles represent hypothetical haplotypes not found in the nean. This differentiation, as well as that among African sample. NOTES AND FIELD REPORTS 225 haplotypes from African specimens suggests that, with (Trionyx triunguis) around thermal Ku¨ku¨rtlu¨ lake, Mug˘la- known locality material, it may be possible to genetically Turkey. Fresenius Environmental Bulletin 13(5):405–412. identify the provenance of trade specimens. GRAMENTZ, D. 1993. Beobachtungen und Untersuchungen zur Ethologie und O¨ kologie von Trionyx triunguis in West- In conclusion, all Mediterranean individuals of T. Anatolien. Salamandra 29:16–43. triunguis belong to same population, and these specimens GRAMENTZ, D. 1994. Zur thermoregulation von Trionyx triunguis are clearly different from those of ‘‘continental Africa’’ am Ku¨ku¨rt Go¨lu¨ in West Anatolien. Salamandra 30:143–154. of unknown origin. Considering the widespread distribu- GRAMENTZ, D. 2005. Die Nilweichschildkro¨te Trionyx triunguis. tion of T. triunguis in large parts of Africa and the Chimaira Vol. 24, Frankfurt am Main Edition. 166 pp. biogeographical circumstances there, the species may HALL, T.A. 1999. BioEdit: a user-friendly biological sequence have more isolated populations, some possibly more alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symposium Series 41:95–98. isolated than the Mediterranean sample presented in this JUKES, T.H. AND CANTOR, C.R. 1969. Evolution of protein study, such as the Lake Turkana population. molecules. In: Munro, H.N. (Ed.). Mammalian Protein Metabolism. New York: Academic Press, pp. 21–132. ACKNOWLEDGMENTS KASPAREK, M. 1994. Die Nil-Weichschildkro¨te-eine stark bed- rohte Reptilienart im Mittelmeergebiet. Herpetofauna 16:8– This study was supported by Adnan Menderes 13. University, Institute of Natural Sciences Research Grant KASPAREK, M. 2001. Towards an action plan for the conservation (FBE-08032). This research was approved by Adnan of the Nile soft-shelled turtle, Trionyx triunguis in the Menderes University Animal Experiments Ethic Com- Mediterranean. Unpublished report to Council of Europe, mittee. Specimens were collected with permission from Bern Convention, commissioned by MEDASSET. KASPAREK,M.AND KINZELBACH, R. 1991. Distribution and the Republic of Turkey Ministry of Environment and bionomics of the Nile soft-shelled turtle, Trionyx triunguis, Forestry. We would like to thank Paris Natural History in the eastern Mediterranean. Zeitschrift fu¨r angewandte Museum, France, especially Roger Bour, for providing us Zoologie 78:137–159. with T. triunguis specimens from Africa. The authors LESHEM,A.AND D’mIEL, R. 1986. Water loss from Trionyx would like to thank James Parham for his valuable triunguis eggs incubating in natural nests. Herpetological comments on an earlier version of the manuscript. Journal 1:115–117. MOLL,D.AND MOLL, E.O. 2004. The Ecology, Exploitation, and Conservation of River Turtles. Oxford: Oxford Univ. Press, LITERATURE CITED 393 pp. NADA, M. 2002. An assessment of the Nile soft-shelled turtle, AREVALO, E., DAVIS, S.K., AND SITES, J.W. 1994. Mitochondrial Trionyx triunguis, in the Nile Delta and its lagoons, Egypt. DNA sequence divergence and phylogenetic relationships Commissioned by The Mediterranean Association to Save the among eight chromosome races of the Sceloporus grammicus Sea Turtles and supported by the British Chelonian Group. complex (Phrynosomatidae) in central Mexico. Systematic Final Report, 13 pp. Biology 43:387–418. NEI, M. 1987. Molecular Evolutionary Genetics. New York: ATATU¨ R, M.K. 1979. Investigations on the morphology and Columbia Univ. Press. osteology, biotope and distribution in Anatolia of Trionyx ORUÇ , A. 2001. Trawl fisheries in the eastern Mediterranean and triunguis (Reptilia, Testudines) with some observations on its their impact on marine turtles. Zoology in the Middle East 24: biology. Ege University Faculty of Science Monographs, 119–125. Izmir, Turkey 18:1–75. POSADA,D.AND CRANDALL, K.A. 2001. Intraspecific gene BAHA ELDIN, S. 2006. A guide to the reptiles and amphibians of genealogies: trees grafting into networks. Trends in Ecology Egypt. American University in Cairo Press, 359 pp. and Evolution 16:37–44. BOWEN, B.W. AND KARL, S.A. 1996. Population structure, PRASCHAG,P.AND GEMEL, R. 2002. Identity of the black soft-shell phylogeography, and molecular evolution. In: Lutz, P.L. turtle Aspideretes nigricans (Anderson, 1875), with remarks and Musick, J.A. (Eds.). The Biology of Sea Turtles. Boca on related species. Faunistische Abhandlungen 23:87–116. Raton, FL: CRC Press, pp. 29–50. PRITCHARD, P.C.H. 1979. Encyclopedia of Turtles. Neptune, NJ: CLEMENT, M., POSADA, D., AND CRANDALL K.A. 2000. TCS: a TFH Publications. computer program to estimate gene genealogies. Molecular ROZAS, J., SA´ NCHEZ-DELBARRIO, J.C., MESSEGUER, X., AND ROZAS, Ecology, 9:1657–1659. R. 2003. DnaSP, DNA polymorphism analyses by the ENGSTROM, T.N., SHAFFER, H.B., AND MCCORD, W.P. 2002. coalescent and other methods. Bioinformatics 19:2496–2497. Phylogenetic diversity of endangered and critically endan- SAMBROOK,J.AND RUSSELL, D.W. 2001. Molecular Cloning: A gered southeast Asian softshell turtles (Trionychidae: Chitra). Laboratory Manual. Third edition. Cold Spring Harbor, NY: Biological Conservation, 104:173–179. Cold Spring Harbor Laboratory Press. ENGSTROM, T.N., SHAFFER, H.B., AND MCCORD, W.P. 2004. SCHLEICH, H.H., KA¨ STLE, W., AND KABISCH, K. 1996. Amphibians Multiple datasets, high homoplasy and the phylogeny of and Reptiles of North Africa. Koenigstein: Koeltz, 627 pp. softshell turtles. Systematic Biology 53(5):693–710. SHAFFER, H.B., MEYLAN, P., AND MCKNIGHT, M.L. 1997. Tests of EUROPEAN REPTILE AND AMPHIBIAN SPECIALIST GROUP. 1996. turtle phylogeny: Molecular, morphological, and paleonto- Trionyx triunguis. In: IUCN. 2008 IUCN Red List of logical approaches. Systematic Biology 46:235–268. Threatened Species. www.iucnredlist.org (24 November TAS¸KAVAK,E.AND AKÇ INAR, S.C. 2008. Marine records of the 2008). Nile soft-shelled turtle, Trionyx triunguis from Turkey. GIDIS¸,M.AND KASKA, Y. 2004. Population size, reproductive JMBA2-Biodiversity Records (Published online, www.mba. ecology and heavy metals in the nile soft-shelled turtle ac.uk/jmba/pdf/6027.pdf). 226 CHELONIAN CONSERVATION AND BIOLOGY, Volume 8, Number 2 – 2009

TAS¸KAVAK, E., REIMANN, M.J., AND POLDER, W.N. 1999. First TU¨ RKOZAN, O., ILGAZ,C¸., AND YILMAZ, C. 2006. Reproductive record of Trionyx triunguis from Kos Island, Greece, with ecology and hatchling morphology of the Nile soft shell comments on its occurrence in the eastern Mediterranean. turtle, Trionyx triunguis (Forsska˚l 1775), at Dalyan beach, Chelonian Conservation and Biology 3(3):510–512. Turkey. Russian Journal of Herpetology 13(1):47–52. TEMPLETON, A.R. 1998. Nested clade analyses of phylogeo- VAN DER WINDEN, J., BOGAERTS, S., STRIJBOSCH, H., AND VAN DEN graphic data: testing methods about gene flow and population BERK, V. 1994. The Nile soft-shelled turtle, Trionyx triunguis, history. Molecular Ecology 7:381–397. in the Go¨ksu Delta, Turkey. Zoology in the Middle East 10: TEMPLETON,A.R.,CRANDALL, K.A., AND SING, C.F. 1992. A cladistic 57–62. analysis of phenotypic associations with haplotypes inferred VENIZELOS,L.AND KASPAREK, M. 2006. Trionyx triunguis: the from restriction endonuclease mapping and DNA sequence data brackish water turtle that also lives in the Mediterranean Sea. III. Cladogram estimation. Genetics 132:619–633. In: Frick, M., Panagopoulou, A., Rees, A., and Williams, K. THOMPSON, J.D., HIGGINS, D.G. AND GIBSON, T.J. 1994. CLUS- (Eds). Book of Abstracts—26th Annual Symposium on Sea TAL W: improving the sensitivity of progressive multiple Turtle Biology and Conservation, p. 168. sequence alignment through sequence weighting, position- WEISROCK, D.W. AND JANZEN, F.J. 2000. Comparative molecular specific gap penalties and weight matrix choice. Nucleic phylogeography of North American softshell turtles (Apa- Acids Research 22:4673–4680. lone): implications for regional and wide-scale historical TU¨ RKOZAN, O. 2007. Trionyx triunguis, the Nile softshell turtle. evolutionary forces. Molecular Phylogenetics and Evolution Reptilia 55:17–23. 14(1):152–164. TU¨ RKOZAN, O. 2009. Status and conservation of the soft-shell turtle, Trionyx triunguis, in Turkey. Seventh Annual Sympo- sium on Conservation and Biology of Tortoises and Received: 10 August 2009 Freshwater Turtles, 5–8 August 2009, St. Louis, MO. Revised and Accepted: 28 September 2009