Molecular, Osteological and Morphological evolution in freshwater bagrid catfish (Siluriformes: Bagridae) from Northern Western Ghats of India

5th year BS-MS Thesis

By Aniket Mokashi

Under the guidance of Dr. Neelesh Dahanukar Department of Biology, IISER, PUNE

Department of Biology Indian Institute of Science Education and Research, Pune Certificate

This is to certify that this dissertation entitled “Molecular, Osteological and Morphological evolution in fresh water Bagrid catfish (Siluriformes: Bagridae) from Northern Western Ghats of India” towards the partial fulfilment of the BS-MS dual degree programme at the Indian Institute of Science Education and Research, Pune represents original research carried out by “Aniket Mokashi at Indian Institute of Science Education and Research (IISER), Pune” under the supervision of “Neelesh Dahanukar, INSPIRE Faculty Fellow, Department of Biology, IISER Pune” during the academic year 2013-2014.

------(Supervisor) Dean Neelesh Dahanukar, Biology Department IISER Pune IISER Pune

2 Declaration

I hereby declare that the matter embodied in the report entitled “Molecular, Osteological and Morphological evolution in fresh water Bagrid catfish (Siluriformes: Bagridae) from Northern Western Ghats of India” are the results of the investigations carried out by me at the Department of Biology, Indian Institute of Science Education and Research (IISER), Pune, under the supervision of Neelesh Dahanukar and the same has not been submitted elsewhere for any other degree.

------(Student) Aniket Mokashi (Reg No. 20091049) IISER Pune

3 Abstract Freshwater catfishes are major group of aquatic organisms. Lack of comprehensive work on Indian catfishes of family Bagridae has rendered the true diversity being obscure. Further, for the species which are already know, there is relatively less studies on the systematics and evolution. In this study we have tried to understand the diversity of bagrid catfishes and their evolutionary relationships using fish barcode gene cytochrome oxidase subunit I (Cox1) and cytochrome b (Cytb) along with the morphometric and osteological analysis. The Phylogenetic analysis was done using Maximum likelihood for cox 1 and cyt b gene and phylogenetic tree was constructed and the reliability of clustering was checked for 1000 bootstrap iterations. The morphometric study for 121 samples of bagridae was done and the morphometric data was used for multivariate statistical analysis. Further clearing and staining procedure was used to understand the osteology of selected species of bagrids with respect to their head structure, gill rakers and number of vertebra. Our result show a presence of several species complexes among the known species of bagrids, indicating that there are many new species which are yet to be discovered and described from Western Ghats. Further we show based on molecular, osteological and morphological studies that the two nominal species Mystus cavasius and M. seengtee are one and the same and the species M. cavasius is distributed throughout India. Our results have implications in understanding the bio geographical patterns in species distribution.

Key words: Molecular phylogeny, Morphometry, Osteology, Bagridae, Mystus, Sperata, Rita, Hemibagrus, Western Ghats of India.

4 List of Figures

Figure 1: Bagrids used in the present study. Figure 2: Map of peninsular India showing the places of collection of Specimen. Figure 3: Maximum likelihood tree for cox1 gene of Bagrid fishes. Figure 4: Sub cluster of Mystus malabaricus species complex. Figure 5: Sub cluster of Mystus bleekeri species complex. Figure 6: Sub cluster of Mystus cavasius and M. sengtee. Figure 7: Sub cluster of Mystus gulio species complex. Figure 8: Sub cluster of species belonging to genus Sperata. Figure 9: Sub cluster of species belonging to genus Rita. Figure 10: Maximum likelihood tree for cytb gene of Bagrid fishes. Figure 11: Maximum likelihood tree for cytb gene of Bagrid fishes under genus Mystus. Figure 12: Principle component analysis of the specimens studied for morphometric analysis. Figure 13: Principle component analysis of the three clusters of Mystus malabaricus Figure 14: Principle component analysis of Mystus bleekeri and M. cf. bleekeri. Figure 15: Principle component analysis Mystus seengtee and M. cavasius. Figure 16: Cleared and stained specimens used for osteological studies. Figure 17: Osteological details of the head. Figure 18: Gill rakers on the first gill arch.

5 List of tables

Table 1: Bagrid fish species collected from various locations. Table 2: Primers used for the study. Table 3: Descriptive statistics and factor loading for the first six PCA factors.

6 Acknowledgements I am thankful to Neelesh Dahanukar, Mandar Paingankar, Unmesh katwate, Ashwini Keskar, Pradeep Kumkar, S.S.Jadhav, Rajeev Raghavan and Anvar Ali for their support in our project for the collection of samples from areas other than northern Western Ghats without which this study was not possible as we can’t build a brick without clay. I am thankful to all my lab mates for technical help. I thank Indian Institute of Science Education and Research (IISER), Pune for providing infrastructural facilities. This research was partially funded by DST-INSPIRE Research Grant to Neelesh Dahanukar.

7 INTRODUCTION The Western Ghats of India or the great Escarpment of India which runs along a range of total 1600 Km Starting from the border of Gujarat and Maharashtra down the way till southern coast of Kerala. Western Ghats is one of the 34 bio diversity hotspots in the world (Mittermeier et al., 2005) and only one among 2 in south Asia. (Mayers et al., 2000). The Western Ghats is rich in its freshwater fish diversity with 290 species out of which 189 species are endemic to this region (Dahanukar et al., 2011).The Western Ghats of India is so much rich in its diversity but a major part of this diversity is threatened by a various anthropogenic activities (Dahanukar et al., 2004). From Western Ghats of India 38 east-flowing and 27 west-flowing major rivers originates. The West flowing rivers originates in Western Ghats and drain in Arabian Sea and East flowing rivers merge into one of 3 rivers system Krishna Cauvery or Godavari before they drain into Bay of Bengal (Dahanukar et al., 2004). Catfishes belong to order Siluriformes. The catfishes group consist of an approximately 35 families, 437 genera and 2734 species across the globe starting from South America, Africa, Europe and Asia to Japan. Globally, the population of catfishes makes up to the 1/3 of freshwater fish fauna (Jayaram 2009). Evolution of catfishes date as back as Eocene times. Indian catfishes come under 13 families, 52genera and 197species. About 50 species of order Siluriformes are found in the Western Ghats of India and associated river system, out of which 21 species come under family bagridae. Catfishes are mostly consumed all over the world and hence they hold a pretty important market value. Catfishes of the family Bagridae are highly threaten because of variety of threats including pollution, biological resources use and habitat modification and it is suggested that more than 50% of the species are threatened with extinction (Dahanukar et al., 2011). Catfishes of the family Bagridae are extensively studies all over the world however in Indian context they are relatively less studies. Even though some taxonomic literature is available (Jayram 2009) osteology and molecular phylogeny is very less studied in India and much of the classification were based on morphometric analysis. Due to adherent impediments with traditional taxonomy (Dahanukar et al., 2011) a few species claimed to be new are not valid. Instead there have been cases of synonym species so there is need for taxonomical revision. This is especially true for the Western Ghats of India. Recently Identification and Re-evolution of fresh water catfishes

8 through DNA barcoding (Bhattacarjee et al., 2012) of North east India was done but catfishes from Western Ghats of India is not that clearly understood. Our attempt through this study is to have look at Molecular, Osteological and Morphological evolution in fresh water Bagrid catfish (Siluriformes: Bagridae) of Western Ghats of India. Currently we have done an extensive studies on the catfishes of Western Ghats of India at osteology, morphometric, and molecular level. The cytochrome oxidase 1 (Cox1) and cytochrome b (Cytb) gene were used to draw an evolutionary tree of the Catfishes. The 26 morphometric character were used to study the morphometry of catfishes. Principle component analysis was used on the size corrected values to understand the morphological patterns in various species of bagrids. The clearing and staining method was used for osteological study of bagrid. Therefore, in the current study we attempt to study the molecular, osteological and morphological characters of bagrid catfishes focusing mainly on genus Mystus, followed by Sperata, Rita and Hemibagrus.

9 MATERIALS AND METHODS Study site and sample collection Four genera in family Bagridae were collected during the present study including Mystus, Hemibagrus, Rita and Sperata. The species included Mystus cavasius, M. seengtee, M. cf. gulio, M. bleekeri, M. cf. bleekeri, M. malabaricus, Sperata aor, S. seenghala, Hemibagrus punctata and Rita gogra. A list of all the samples used in the study is provided in Table 1, while photographs of some of the bagrids are provided in Figure 1.

Figure 1: Bagrids used in the present study. (a) Mystus seengtee from Yerawada,(b) Mystus cavasius from Godavari river (c) Mystus malabaricus from Satara (d) Mystus cf. malabaricus from Amboli Azara (e) Mystus bleekeri from Bhima (f) Mystus Guilo from Amboli azara (g)Rita gogra from Bhima (h)Sperata seenghala from Koyna.

10 Table 1: Bagrid fish species collected from various locations. Location Species No of specimen used for Morphometic Molecular analysis analysis Gangapur dam Mystus cavasius 6 0 Solapur Sperata seenghala 1 1 Mystus seengtee 3 2 Ghod taleghar Mystus malabaricus 1 0 Veer Mystus seengtee 2 2 Sperata seenghala 1 0 Kerala Mystus seengtee 3 2 Bhor Mystus seengtee 3 1 Neera Mystus bleekeri 1 0 Karjat Mystus malabaricus 3 1 Lonavala Mystus malabaricus 1 1 Bhigwan Mystus seengtee 2 2 Ujjani dam Mystus seengtee 4 2 Yerwada Mystus seengtee 9 5 Mystus bleekeri 2 2 Ganga Mystus cavasius 1 1 Wai Mystus malabaricus 3 3 Mystus cf. bleekeri 3 2 Satara Mystus malabaricus 4 4 Chiplun Mytus cf. gulio 1 1 Aundh Mystus seengtee 17 0 Mangaon Mystus malabaricus 3 3 Mystus seengtee 1 0 Ratanagiri Mystus malabaricus 3 3 Mystus cf. gulio 3 3 Raigad Mystus seengtee 3 0 Mystus malabaricus 3 0 Patan Mystus malabaricus 6 0 Mystus seengtee 1 0 Kudal Mystus malabaricus 1 0 Amboli-azara Mystus malabaricus 1 2 Mystus cf. bleekeri 0 1 Panvel Mystus seengtee 1 1 Hali village Mytus cf. gulio 1 0 Orissa Mystus cavasius 1 1 Panjim Goa Mystus cf. gulio 3 3 Kudal Mystus malabaricus 1 0 Paud market Mystus seengtee 1 0 Bhavani River Hemibagrus punctatus 0 1 Phansad Mystus malabaricus 1 0 Bhima Mystus seengtee 13 8 Rita gogra 1 2 Mystus bleekeri 4 2 Mystus malabaricus 2 2

11

Samples were collected mainly from the northern Western Ghats of India except for some which were collected from Kerala and northeast India for comparison (Figure 2). The sample collection were directly from the rivers with the help of net while others were brought from the local fish market. The samples collected were stored in 4% formalin and some part of the samples were kept in absolute alcohol for DNA extraction.

Figure 2: Map of peninsular India showing the places of collection of Specimen.

The samples were collected from the different places such as: Ujjani dam, Lonavala, Bhigwan, Chiplun, Karjat, Satara, Yerwada, Wai, Mangaon, Kerala, Shirur, Amboli-Ajara, Solapur, Paud, Patan, Godavari, Bhor, Paingin (Goa), Mula-Mutha, Raigad, Ghod at Taleghar, Ratnagiri, Veer, Panvel, Indrayani, Phansad, Koyna, Kudal, Hali Village and Neera river (Figure 2). Samples were also obtained from Ganga and Orissa for comparision. Some of the samples were collected by myself but for better comparision samples collected by Neelesh Dahanukar, Mandar

12 Paingankar, Unmesh katwate, Ashwini Keskar, Pradeep Kumkar, S.S.Jadhav, Rajeev Raghavan and Anvar Ali were also considered.

Genetic analysis A total of 121 samples were brought out of which 64 samples were used for DNA extraction, cytochrome b and cox1 gene were amplified and sequenced. The DNA was extracted from the gills which were kept in 100% ethanol following protocols by Ali et al. (2013) and Dahanukar et al. (2011). The tissue was digested at 60°C for 2 hours using STE buffer (0.1M Nacl, 0.05 M Tris-HCL, 0.01M EDTA, 1% SDS) with 15l Proteinase K(20mg/ml) per 500l of STE buffer. DNA was extracted using conventional phenol-chloroform method and re-suspended in nuclease free water. Extracted DNA was checked with 1% Agarose gel electrophoresis and nanodrop. The DNA was stored at -20°C. The PCR were done for Cytochrome b and Cytochrome Oxidase subunit 1 gene (Table 2) and the PCR product was checked for its purity and length in 1% Agarose Gel and the gel was observed under UV Tran illuminator EP-04. The PCR product was purified using ‘Promega Wizard Gel and PCR clean up’ and then sent for sequencing.

Table 2: Primers used for the study. Approximate size of Gene Primer Sequence(5’3’) Tm Reference Amplification (bp) L14724 GACTTGAAAAACCACCGTTG 50 Chen et al. Cyt b 1118 H15915 CTCCGATCTCCGGATTACAAGAC 57 (2007) FishF1 TCAACCAACCACAAAGACATTGGCAC 58 Sharina and Cox1 58 655 Kartavtsev FishR1 TAGACTTCTGGGTGGCCAAAGAATCA (2010)

The sequences received were analyzed using BLAST (Altschul et al. 1990) and DAMBE (Xia 2013) and the phylogenetic Trees were generated using MEGA 6 (Tamura et al. 2013). Additional 273 sequences of species under family Bagridae were downloaded from NCBI GenBank. Sequences were aligned using MUSCLE (Edgar 2004). The sequences then analyzed and the phylogenetic tree were constructed. For cox 1 gene a Maximum Likelihood (ML) tree was constructed using HKY+G+I model (AICc=13070.017, lnL=-5946.481, +G=0.99, +I=0.44). For cytb gene ML tree was constructed using GTR+G+I model (AICc=32089.087, lnL=-

13 15754.698, +G=1.00, +I=0.45). Reliability of clustering was checked for 1000 bootstrap iterations. Glyptothorax poonaensis (Family: Sisoridae) was used as out group for both the genes.

Morphological analysis Morphometry was done using a digital vernier caliper (Mitutoyo: 500-197) with the least count of 0.01mm. Morphometric analysis was done for a total of 26 Morphometric characters and 4 meristematic characters following Ng and Kottelat (2013). Morphometrical characters includes: 1, Standard length; 2, Predorsal length; 3, Preanal length; 4, Prepelvic length; 5, Prepectorial length; 6, Dorsal-spine length; 7, Dorsal-fin length; 8, Length of dorsal fin base; 9, Length of anal-fin base; 10, Pelvic-fin length;11, Pectorial –fin length; 12, Pectorial-spine length; 13, Caudal-fin length; 14, Length of adipose-fin base; 15, Maximum height of adipose fin; 16 Dorsal to adipose distance; 17, Post-adipose distance; 18, Length of caudal peduncle; 19, Depth of caudal peduncle; 20, Body depth at anus; 21, Head length; 22, Head width; 23, head depth; 24, Snout length; 25, Interorbital distance; 26, Eye diameter. Meristematic characters include: 1, Dorsal fin ray count; 2, Pectoral fin ray count; 3, Pelvic fin ray count; 4, anal fin ray count. The predorsal, preanal, prepelvic and pectorial lengths were measured from the snout till the anterior base of dorsal, anal, pelvic and pectorial fins. Pelvic and pectorial fins were measured from base till tip of the longest fin. The dorsal fin is measured from base of dorsal spine to longest fin. The length of adipose fin base is measured from the anterior most point of origin to the posterior most point of adipose fin base. Dorsal and pectorial spine were measured from the tip base of spine till the tip. The dorsal to adipose distance is measured from the base of last dorsal-fin ray to the origin of adipose fin. The maximum height of adipose fin is the maximum vertical distance between the base and upper edge of fin. The length of the caudal-fin length is the length of longest ray of lower lobe measured from the middle of the base of caudal fin. The length of caudal peduncle is measured from the base of the last anal- fin ray to the start of caudal fin. The post adipose distance is measured from the posterior most point of the adipose-fin base to the middle of the base of the caudal fin. The depth of the caudal peduncle is the least vertical distance from the midline of the dorsal surface to the midline of the ventral surface. The depth of the body at anus is measured as vertical distance from the midline of the dorsal surface to the

14 midline of ventral surface at anus. The length of head is measured from the tip of the snout to hard bony flap covering the gills. The width of the head is measured at its widest point. The Interorbital distance is measured as the longest distance between two eyes from the center. The diameter of eye is measured as the longest horizontal distance of the eye. The meristematic characters were measured under a microscope manually. The fin rays were measured under light microscope. Morphometric data was used for statistical analysis. The subunits of body were considered as percentage of standard length and subunits of head as percentage of head length to remove the size effect. Principle component analysis was used on the size corrected values. Statistical analysis was done in the freeware PAST (Hammer et al. 2001).

Osteological analysis The clearing of the tissue and staining of cartilage and bone (Potthoff 1984) were done in our osteological study. The specimen were preserved in 10% formalin for 2-3 days after that the specimen were transferred to Absolute ethanol for dehydration so even small amount of water will be removed so that water should not interfere with the staining of cartilage. The specimen were kept for week in the alcohol followed by staining the cartilage. The specimen were kept in an acidified alcohol solution of alcian blue stain (60 ml absolute ethanol, 40ml acetic acid, and 30 mg alcian blue.) the cartilage is permanently stained such as stain cannot be removed by any solution in the process of osteology, the specimen were kept in staining solution for two days. The next step neutralization the specimen is kept in saturated sodium borate solution for 2 days to increase the pH within the specimen because higher the pH there is less calcium loss from the bone so the staining will be better. The next step is Bleaching in this step the specimen is kept in bleaching solution which contains (15ml of 3% H₂O₂, 85 ml 1% KOH), the specimen is kept in the bleaching solution for 2 hours and later the specimen were transferred to trypsin digestion stage. In trypsin digestion the specimen were kept in the trypsin digestion solution which contains (100 ml solution: 35ml saturated sodium borate, 65 ml distilled H₂O and 0.2 g trypsin powder) till the specimen is 60% cleared. The specimen were kept at 37°C and the trypsin solution were changed after 7-10 days. After the specimen were cleared the staining of bone were done using the Staining solution 1% KOH

15 with alizarin red stain until the solution turns deep purple. The specimen were kept in the staining solution for overnight. Staining of the specimen were followed by the destaining, the solution were kept in destaining solution (100 ml solution: 35 ml saturated sodium borate, 65 ml distilled H₂O, 0.2 g) until the specimen were cleared and the stained bone were clearly visible and then the photograph were taken and analysis was done. Osteology was done with the help of drawing the fish head structure and fish pectoral spine. The head and spine were observed under a microscope and the drawing of different specimen were drawn. The specimen head and spine was observed under a Leica S8AP0 microscope and the images were taken under the microscope. c. The terminology of osteological structures follow Anganthoibi (2012).

16 RESULTS AND DISCUSSION

Molecular analysis Maximum Likely hood analysis of cytochrome oxidase 1 (cox1) sequenced in the present study and downloaded from NCBI is shown in Figure 3.

) )

a 2 ) 2 ) ) H 1 2 ) H 1

P M S P M ) M

M M P 1 M M ) M

M ( M M H ( B M ( M a ( ( P a l B n M n ( A a o M m M ) o d i v a ( s M a M B s a s h I a ) s g ( a ) u l g s

u u n A s u A B H n a c a S n

c c i n c u o

i i A i a M r B d s a B ) r a m r c L ( r i i s a n u h 4 M a M a r a a h M u s M s ( b r c a ( F b P b a i j b s c u B u a a r i s e

a r l a b m ) a l A M l c u s c j l r ) ) l I a i u s i i ( a a a c o r l a r u 2 a a l a A a b i c u a C i g p a r c a o i 2 a b m i l P a r c g

m m a m l i a M b a r b b

a o P a r P ( l r n s m h ) i a b a a s s a s s s l b P l b a a m u S a u 2 d a b B u u

u u s t u a t m a l a b T S ) t t B A t m a t S l a M s m n u a l s 1 e

s a s ( s s t s a m s A w m l s M S e y c a u i y u n ( P i y s y s u ) u m a u t c s s h t m c a n M m y s M u i c P 1 s m c i t (

M M i c u M t r u a s s m i r a s u y l r s t a t a S i t r c e M s 2 y a u s a i r s f 3 s ) 0 a 9 s t u s a a d ) m y r P M ) 1 t u b y b a 4 1 b s 1 1 ( m 0 M y s t u b a P t n 3 3 s 1 s t a a s ( s u 1 1 M 1 y s l l a n 1 a M l b a a w s S u r 9 y a M s l u s t 1 9 a 9 y a a h r s g 9 a a S t 1 y c u S s 8 M a l m 9 2

1 i 1 M a a 1 C a ( y 1 m r c t M 4 M m 2 9 m a i s M 1 b

2 2 M m ( a 2 5 a ( i a r u s P i M 7 0 r 2 s s Q s m a a Q b a Q 9 s c u S a m Q 8 i s r u u u t 5 s Q b s H t u t t s a r c u a e H 0 l s u H i W a 4 H t s a t t u s s u l a r c H t s H u 1 s 5 t a i s S a a y y y b a r c 9 t a u y s a i 7 t t t 9 u Q m a b a r s S i t s 0 8 M M y l 4 i a 5 M m c v M a b i u s t u 0 D s a l a r 2 1 v t t M a c s i 1 u u s a l b a i Q 9 s v ta s 0.05 t m a r c u t u 0 u a l b i J 8 t u i t s 5 s t m a r s t s v 5 3 s a a 2 s a u 9 y s m l b a y tu t t 7 u s y s t y t a a b Q s i a M u s m l J M u v t s t a a M y t it H M u s m l s i J y s t 4 M s v H u m a 3 y u a s F Q 1 9 y s t s 8 t s r u H M 9 5 2 t Q 8 6 y s u m 3 M s u o 5 H M t s 9 9 5 t a s H Q 2 y 3 y h t 1 2 M s u s 8 9 7 s t u Q Q 1 t 8 2 M s i t J 0 2 y u 8 8 y v a s 1 9 J M s t 9 2 8 tu t J X 5 2 2 1 N y s 2 6 M s it u 9 1 M X N 2 8 s t X 8 0 1 1 9 3 y 2 y u v a s J 1 3 0 M J J 2 3 t t 8 1 9 9 7 N 4 s s t u J X 8 1 3 2 M 6 2 9 M i t 9 1 1 9 J 0 y u v a X 8 8 A 2 1 N 4 t t s J 6 3 M 2 8 1 s s t u 8 8 9 u 2 8 J 7 9 M i t X 6 0 9 0 M 3 0 y tu v a J 8 9 c y F 5 7 9 t X 8 0 5 M 9 5 4 M s s it s J 9 6 h M M y s 0 K 0 u 8 4 7 6 Q 7 9 0 y tu v t X 8 6 0 R e y s t 5 a J 8 9 y y u D 1 8 5 M s s t s 8 0 3 R n s t G J 2 y it X 9 6 it s s u s 9 1 tu tu J 8 2 a o t F 2 8 v 8 5 0 R i t t u s l 5 M s a X 9 t g u y 2 y s t s J 8 9 0 R i a u s m 9 N 9 8 it u 8 5 t s l s m p 9 J 2 8 tu v t X 9 9 R i a p a s 8 M a J 8 5 9 t s m o t N 2 8 s s t 8 a p n m m o o J 2 5 y it X 9 9 8 R it s n 8 5 tu v J 8 5 p i o n t N 2 M 8 7 R i a s s o o t h 9 8 s X 9 9 t n t a J 6 0 y s 8 5 a p n n a 3 3 u J 8 9 6 R it s b t n o 0 N 1 2 M t X 9 a p t a n 8 9 s 8 5 i s i a t u r J 7 y J 8 5 R t p s a n a 0 1 9 9 a s c n u s 6 Q 6 2 X 8 5 i n u x J 9 M 4 R t p u u s 4 2 J 8 9 9 a s u s 0 5 X 8 5 R i p t p X 6 8 3 ta s a s s J 3 J 8 9 9 i o 2 s X 8 5 2 R t p t 8 X 3 i J a s u o 8 t n tu J 8 9 9 i p 5 J 9 r a a X X R t s n u g 8 5 1 a s 1 X o e 2 2 9 9 i p a i in n s J 6 6 5 0 R ta s 0 J c rt r li tu X 0 p 0 e o a o 2 0 9 8 R it s b ou g lb ea s JX 6 9 6 9 a p n s c in a in tu 0 6 it 9 s 7 u o s l 2 6 7 R a s 8 1 t s o a J 6 9 p i s b s u b e X 6 R R it s s y s u t l in 2 0 5 i a p u st ys a ol 6 96 R ita ta s M st y M s lb J 0 4 p 3 y M tu a X 9 ita g ri 6 M 10 ys s us 8 63 R og ta 08 46 8 M tu at J 8 ita g r 9 29 1 4 1 ys e X 9 R og a 4 1 9 82 1 M lin JX 8 60 ita go r 1 U 0 28 F 8 o 8 a 2 K 4 2 lb 88 9 6 g g E 4 Q 82 81 a 2) 9 60 R o ra Q J F 4 s w ) 6 7 ita g J 5 K 82 tu s a) 1 01 R ra 7 F ys i(M 2 A J R it sp 5 K M a W MS X i a 8 W S a( 1 ta s 99 0 ri i(M jr JN 05 s p 48 ke a li A 6 4 p 58 82 e i W bo FJ 28 69 F ble er m 45 91 R K s ek i A FJ 9 8 it tu le er eri 4 39 R a ys s b ek ek EU 59 7 ita rit 9 M tu le le ri 4 3 R r a 6 2 ys s b b ke E 90 96 ita ita 8 M tu tus ee R U4 8 R r 94 ys ys bl ri ita E 17 72 it ita M M s eke go U 7 R a r 2 stu le i R gr E 41 94 ita ita 37 My s b ker ita a U 77 R r 7 83 3 tu ee g Bh 41 93 ita ita 8 23 9 37 ys bl i og im 77 R r JX 83 M us ker ra B a(R 92 ita ita 9 71 yst lee J h G R ri JX 33 M s b eri X9 ima B2 ita ta 38 98 70 stu ek 463 (R ) ri JX 33 My ble ri JX 59 GB 98 ta 98 8 tus ke 1) 946 R 1 JX 091 ys lee MM J 36 ita ) 26 7 M s b SM X94 0 R gog JX 91 ystu A(M ) 636 ita ra 260 6 M UL C1 JX9 1 R gog JX 91 ri M MBM 463 ita ra 7 76 260 eke or( 1) JX 62 go 3 JX ble ri Bh MSS 946 Rita gra stus eke rus( J 363 go My ble Shi 1) X94 Rita gra stus keri (MBS 6364 go My blee hirur ) JX94 Rit gra tus eri S BB1 6365 a go Mys leek ima(M JX Rit gra 95 us b ri Bh 9463 a go Myst eeke ekeri J 66 R gra 31 us bl s ble X946 ita go 1 Myst ystu keri 368 R gra 6 375 M s blee JX94 ita g X983 Mystu ri HM 6367 ogra 13 J 3374 bleeke 88302 Rita 8 JX98 stus 4 Chry gogra 8 376 My eri HM8830 sichth JX983 s bleek 23 Chry ys aur 3 Mystu HM8 sichthys atus 8 22894 ekeri 83021 Ch auratus 2 JN ystus ble rysi 92 44 M HM4 HM88 chthys au JN2289 eekeri 18186 Chrys 3022 Chry ratus Mystus bl ichthys helico sichthys a JN228945 ri HM phagus uratus ystus bleeke 882780 Chrysich JN628898 M thys nigrodigitatu tus bleekeri HM882 s JN628899 Mys 782 Chrysichthys nig 91 ekeri rodigitatus JN628901 Mystus ble HM882781 Chrysichthys nig rodigitatus 35 JN628904 Mystus bleekeri 69 HM882776 Chrysichthys nigrodigitatus JN628928 Mystus bleekeri HM882783 Chrysichthys nigrodigitatus KF824794 Mystus bleekeri 95 KF824795 Mystus b 882777 Chrysichthys nigrodigitatus leekeri HM KF8247 tatus 96 Mystus bleekeri M882778 Chrysichthys nigrodigi KF H itatus 824797 Mystus sichthys nigrodig bleekeri HM882779 Chry 8 igrodigitatus KF82 hrysichthys n 4801 Mystus HM882784 C igitatus 82 atrifasciatus thys nigrod KF824802 Chrysich s 9 Mystus a M882788 rodigitatu 8 KF8 trifasciatus H hthys nig 33 24800 M 9 Chrysic itatus ystus atri M88278 nigrodig 98 KF824 fasciatus H ichthys us 799 Mys 0 Chrys digitat 4 JQ tus atrif M88279 ys nigro tus 7 98 289144 asciatus H rysichth digita oma Mystus 05 Ch s nigro chys KF824 atrifas F5105 hthy itatus bra ma 4 798 ciatus J hrysic rodig agrus hyso 8 Mystu 507 C ys nig orab brac ma JX1 s atrifa JF510 ichth 68 H grus yso 8 JX 7767 sciat hrys 4609 aba rach ma 9 8 99 177 7 My us 506 C JX Hor us b yso a HQ 678 M stus m F510 0967 agr rach om 0094 ystu ultir J X46 orab us b hys a H 92 M s rhe adiatu J 63 H agr rac om 4 Q00 ystu gma s 798 rab s b ys s 19 949 s o M5 Ho gru ach lari 7 11 8 KF8 3 M cula H 9502 raba s br col s 8 248 ystu tus 00 Ho gru igri lari 7 09 M s oc HQ 1 a n ol JN y ula 950 rab rus ric 17 62 stus tus Q00 Ho bag nig 2 7 K 890 alb H 864 ora rus 6 3 8 F7 5 M oline 490 3 H ag us 424 ystu atu EU 50 rab ter 3 JN 35 s c s 009 Ho lop s 18 228 Mys ava HQ 61 ci s ru JN 94 tus sius 798 oe thu te 22 8 M ca 5 is p an rop J 89 yst vas HM ss ac ac 6 J N2 47 us ius ca cr m X9 28 My cav eio ma ys 9 83 946 stu asi 7 L s th co 9 9 JX 37 M s c us 86 thy ich ra 9 98 9 M ys ava 90 ich gr is id co kii 35 J 33 y tus siu 4 gr Ba s lv a c ii 44 X 83 stu ca s EU a 6 en fu idr y ck 5 98 M s va 1 B 85 m us lv s w y ii 6 M 33 ys cav siu 15 90 sia ur fu ru w ck ys 78 tu as s 89 4 s ys s g us y 4 tu M s c ius 2 U u h ru a r w M s y a Q E st c u ib ag s 5 31 ys se st va J y a s m u M t e u s m T y e ib r 2 y u n s iu do 10 ch H m ag M st s s gt ca s u 8 Ta 9 e ib y us ee ee va sio se 96 9 14 H m s s n B si ata P 6 0 9 78 e M tu ee gt hi us B 50 AB 68 28 1 H ys s s n ee ma 91 69 Q 81 9 9 M tu e gte K (M 8 B J 7 17 ys s en e er B Q2 A JF 81 or JX tu se gt B ala S1 J 7 a 9 s e ee him (D a F a r M 83 s ng B a a ) J at ao y 3 ee te h (M da er a r JX st 82 ng e im B r m p at ao 9 us t U a S a S r r 1 J 8 M ee jja (M 2) rk 6 e ta o 6 X 3 se y n B e 1 p a a J 9 3 e st Ye i( S tM 2 S er a or X 83 80 n us rw M 5 sk 83 5 p t a r 9 J 9 3 g c su ) a a 9 t a 9 97 S r a o 3 X 8 8 M e a d 2 2) X 0 0 e t a M 2 3 1 ys e va a ) J 6 3 p ra r 7 6 3 M t P s (M 2 9 S e ta o 8 7 y 0 7 u a iu S X 8 9 p a a r 8 M s 9 7 ys s nv s Y J 2 2 S r ta o y tu 1 M t c e ) 6 9 e a a r M s s 9 y u av l( N 8 0 p r a o y tu s M s s a M J 2 2 S e t a r M s s e tu c s S 6 89 0 p ra o t e y s a iu P N 9 S ta 1 y u s n s v s J 2 7 e a a ) M s s e g tu c a S 6 0 9 p r a T r y tu s e t s a si ) N 7 8 S e t S o M s s e n e c va u J 1 7 8 p ra a r y t e g e a s s 7 M u J 0 S e M o 4 s s n te B v i 8 ( a r 9 s u F 7 t a 1 t e a 1 7 7 p a a o M u u s e g e h s s J 0 8 S g r ta a s s e n te S im iu F 7 7 n e M y tu e g e o s 1 0 6 u p ra a s s s t l a J 7 8 T e t M y tu e n e K a (M F 7 S a 3 s e g e p 1 r p r y s s t e B J 0 o 8 e 1 0 M tu e n e B r u F 7 S 9 s s e g e a r( S a 1 p 1 M y t s h l 1 2 7 8 s u e n te a D 7 J a S 2 c e Y im ( ) F t 3 1 2 7 M y t s a g e e M a a 8 2 5 ) 9 s u n te a d r 1 9 M y t s s v g B rw ( S a e 9 3 1 ) 9 s u e a t e h M K r p X 8 2 V a d M y t s c e s e a a m J 9 3 a a s u a e b ig d B S S S l j d M y s n iu h 1 a X 8 S S a s tu s v g Y i w a S ) rk 9 ( a a 7 y e s s g ( J r h 0 j t s c t e a M 6 e a b 3 s u e i e G w ) X M g a l a 8 a u r n t J e t l 7 t s s n e w a ( s M e e n a a s b 9 8 u v s a M y a l e g a n S k e h 9 9 6 s a M n 2 V h a u 9 c t K s S r a l r s 6 e d ( 8 i e g ) e g c 7 5 a m g 7 u u 9 8 s e a a a a h 0 n a l s n a la g a u s 4 v e a 1 n 0 3 s 3 r 3 e n s

g s 5 1 g r ( h ) ( a m a e e a a a u e a B a g M M b ) )

r t n g l m g s u 9 4 K t S h s

e a 9 s e l

h B P 2

e 5 a a a a l a n h s

g a s e n c a o s i o C

4 3 e ) a u C

s a a

d r g t r g u i ( o y

h a a e a

o H

r

n e 1 o 8 r g

B r l g s 6 s 9 M

s K n 3 e n r K s a t a

e a a a s g h n 7 d 5 K 9 t B )

e 9 d 9 d 9 w t a u )

a e

t e (

p u p

e 5 e x 3 C a n M

5 g F

e D s n g e o K F 9 S h M

a 7 r F

a o e a g a (

( g M u

S e s d

s r t 6 d e o

9 g 1

r e s i

s n i s n n

m r i 8 5 K

2 i F 8 o

l

u 8 m n S

a s n r

m 4 9 n M

u e e a t e u 7 9 n B )

e n ( 4 n

a e

u y u 9 u e

e 2 8 r o l (

r m o 8 2 2 F

s e M M

t 7 9 e a D a i t e

p e

r i a M

p 1 p a a s 2 r r h

e l m s K e y

a 8

g s t 4 t a e 8 n 4 M 4 8

r t i a u v 2 K p

k

a t ( s a

k

S 1 m

5 l r S s u

8 u

f u t i

l y s

e

s

r v s s m

p a a i u s s 8 8 F 2 m M

e a 4 8 u 8 F u

9 c d )

s s t

e M s

u c K

o r 8 f r s y s t b

5 s s s u n s

6 S a u e u u a 1 8 4

p B s r s u s 0 r

m 1 a

p 5 s m m

a y 8 8 B

t

s a

t y u s u M s

e t r u t 1

S 1 H e r r u F ( s

7 r s u u u s u 8 h 2

u t

t 3 u 3

4 S M t e r u 4 s d r

S u e r 2

e e s 1 (

6 s t S )

r p r u

5 p a 7 r e s e t e r u t g 8 m 9 w

u r

a J e u w u 0 M r s 4

r t u s y s a

p t t e r r

4

l B

1 y g

H n 5

n n

e s 3

o r

0 9 9 S 5 r e g u M g u M

g u p t r 2

p M 4 F g y s s 8 y

t

a e p r e d a

t r 8

5 r o p p e s g B

s ) a 6 5 1 8 y g i

g t e u a a 4

p t e

r o s t 0 M r s a l S s M h 0 p p s y a

9 o c p t y 0

g M

o t a

4 e o u y u g o

2 2 r S k u b u 0 a M

p M i 8

B r t c b 6

g o u

p s r

2 r i r r l u b M o

5 u

a u s r 5 S i

J o p s s e

3 2 a s u o t

c p b

i m X 9 r 7 y i

c r 0 y 8 r

n r r

B o s t

a c i P

4 2 p c r o t l g 8 F 9 t

J 8 2 4 r o u g t i o u M

4 a c b o

a s s )

1 e c m u 7 M M 1 a r

m 9

g u m l

J g 3 g g

c u i P A a

o a a r r t

r m a 1

9 2 1 o s

9 3 m c a t t

e m

2 r a c r s a 5 e

F 8 U 2 s u C y u r

e c a

a a a u A y S

m u c n M

s c

s 3 m e 5 b

X 7 9 5 k

a b

c m m 2 e

m u s a d

9

9 i 7 s

s i 4 l s

E a b

b b s g S n

J 8 m u m H h i j e

a 2 7 H g i 9

i 9

a 3 a s i i i y t H

s m e n

m o i t

r 5 X

t u 9 m

s m H b u a

9 s u d t

u i u

8 2 m m 8 m u s

5

8 5 m g

r p j M

u s u s m J 4

e a 4

g m

1 s

5 i 2

m u s m H r i

m m l s u 9

X r r p t

r 8 e

8 l m (

9 e b 4 4

s u i 0

u g r u e l u u J

r s 7 i 2

a n o u M S ) 9 J 4

u s e

e g r e e o

8 g r 9 d s r n J

X s u J l d

a 5 g 0 s

M g r s 0 H

g u 0 ( b F u p H J i n S

a g i r u 0 i

a s 5

g o i

J u M B

u r H

H H F

b F a b

7

a 6 b

M g r u 1 g a s

S 0 ( d

H i r

r a

b a g 8 F

b u 7 a 2 r r

i g 0 m M r r 0 i 7 0 a

m b a g B b u i r 2 4

g H g 8 e u

b i i a 0 9 0 b u

b 9 m r 6 g

i a 3 r

0 (

e i b 9 ) a 0 u M g m a g M n

a 2 g

2 3 e

m i b 5 M r

6 e b g 8 a

m i 1 u 2 m 6 a e m b H i b c s a a n

b 2

e 2 2

i m i N B

b M 0

i a

e Q 0 g

m N G H e 0 ) i r

e i r s

b 1 N s

1 1

H e m J e e

7 m i

H 9 2

b a 2 J i

m H e m B

i D

m J O

H N s 8

H 5 e 8 8 n n

4 e m ) r

H 4 0 4 e e

m 1

1 H e J e s

7

4 7 7 s 3 9 e ) 4 9 2 H m H

U ) n i

H 4 e i 4 Q

3 H s F 2 4 H F F s e 3 3 4 6

3 H s 8 J

2 4 E J 2 3 9 3 0 H J J 3 3 4 2 i 9 2 3 4 1 H s 2 2 5 9 2 4 2 3 5 9 5 5 2 9 2 3 2 9 3 F 9 3 8 2 3 2 3 9 J F 2 9 2 F 2 2 2 9 2 4 2 J 9 J F 2 9 2 0 F F 2 9 1 F 9 J 9 6 F 2 J 2 J 2 J 9 F 2 F J F 2 4 J F 8 F 6 J J F J 2 J J

N

Q

J

J

Figure 3: Maximum likelihood tree for cox1 gene of Bagrid fishes. The sequences highlighted in red were generated in the current study. Values along the nodes are percent bootstrap values.

17 The 8 species were studied are highlighted in grey areas. The grey area labelled as “1” consists of Mystus malabaricus sp complex which shows presence of at least 4 clusters along the stretch of entire Western Ghats of India. The grey area “2” comprises if Mystus bleekeri and a new species which is similar to Mystus bleekeri from satara and amboli area. The grey area “3” comprises of Mystus cavasius and Mystus seengtee from all over the peninsular India which consists of Krishna, Godavari, Ganges and Mahanadi river system. The grey area “4” comprises of M.cf guilo which is likely to be a new species from Konkan region. The grey area “5” states the phylogenetic position of Hemibagrus punctatus collected from Bhavani River. The grey area “6” comprises of sperata.seenghala collected from its type locality in Bhima River as compared to sequences from NCBI submitted from north east India. Grey area “7” shows the phylogenetic position of Sperata aor from Tunga River. Grey area “8” shows the Rita gogra collected from its type locality from Bhima River and compared with the sequences from NCBI which were uploaded from North east India. Separate result and discussion for Important Sub clusters are provided below. Figure 4 depicts the Sub cluster containing Mystus Malabaricus Species complex. We could identify 4 major cluster separated by high bootstrap values. 4 Clusters which were separated from each other with difference of more than 3% M1, M2, M3, and M4. The average distance within cluster M1 is 0.1%, M2 is 0.6%, M3 is 1% and M4 is 0.2%. The difference between Cluster M1 and M2 was 14.6% while difference between clusters M2 and M4 = 4.7%, M3 and M4 = 2.8%, M1 and M4 = 13.3%, M1 and M3 = 12.9% M3 and M2 = 5%. Because cox1 gene is a barcoding gene 3% variation has been suggested as a cut off for a designated species (Hebert et.al 2003). We therefore suggest that Mystus malabaricus is likely to be a species complex with around 4 Putative species distinct throughout the Western Ghats of India however further genetic analysis and morphological analysis is essential to identify this species. The original Mystus malabaricus is from Malabar region of Kerala. Cluster M1 could only be true Mystus malabaricus.

18

HQ219113 Mystus malabaricus

59 HQ219110 Mystus malabaricus HQ219112 Mystus malabaricus M1 100 HQ219109 Mystus malabaricus HQ219111 Mystus malabaricus

48 Mystus malabaricus Bhima(MMPH2) 51 Mystus malabaricus BHIMA(MMPH2a) Mystus malabaricus Lonavala(MM1) Mystus malabaricus Mangaon(MMM1) 97 M2 Mystus malabaricus Mangaon(MMM2) Mystus malabaricus Phansad(MMPS) 50 Mystus malabaricus Bhima(MMPH1) Mystus malabaricus Bhagamandala(MBB) Mystus malabaricus Barapole(MBS) 65 DQ508092 Mystus malabaricus 73 M3 Mystus malabaricus Amboli Ajra(MAB) Mystus malabaricus Tunga(MF4) 81 95 Mystus malabaricus Amboli Ajra(MAA) 0.05 69 Mystus malabaricus Patan(MSPP2) Mystus malabaricus Patan(MSPP2a) Mystus malabaricus Satara(MSS2) Mystus malabaricus Chandechiwadi(MCI) 50 Mystus malabaricus Patan(MSPP1) 73 M4 Mystus malabaricus Satara(mss1) Mystus malabaricus Wai(Msw3) Mystus malabaricus Satara(mss4) 39 Mystus malabaricus Satara(MSS3) JQ289145 Mystus mysticetus 99 JQ289147 Hemibagrus filamentus

Mystus vittatus 46 Figure 4: Subcluster of Mystus malabaricus species complex based on cox1 gene analysis depicting four clusters M1 to M4.

Mystus bleekeri showed 2 distinct cluster comprises of specimen from Bhima river system [Mula, Bhor, Bhima and Shirur] which sowed genetic similarities with true Mystus bleekeri from gangetic samples sequences (Figure 5) which were downloaded from NCBI however specimen from Wai and Amboli which superficial resembled bleekeri from a distinct cluster supported by high bootstrap value (94%) we suspect this is a distinct species which is different from Mystus bleekeri.

19 82 Mystus bleekeri Wai(Msw2) 94 Mystus bleekeri Wai(MSW2a)

Mystus bleekeri Amboli Ajra(MSA1)

JX983372 Mystus bleekeri

JX983373 Mystus bleekeri

JX983371 Mystus bleekeri

JX983370 Mystus bleekeri

JX260918 Mystus bleekeri 76 JX260917 Mystus bleekeri

JX260916 Mystus bleekeri

0.05 Mystus bleekeri MULA(MSMMM1) Mystus bleekeri Bhor(MBMC1)

Mystus bleekeri Shirus(MSS1)

Mystus bleekeri Shirur(MBS1) 61 Mystus bleekeri Bhima(MBB1)

JX983375 Mystus bleekeri

88 JX983374 Mystus bleekeri JX983376 Mystus bleekeri

JN228943 Mystus bleekeri

JN228944 Mystus bleekeri

JN228945 Mystus bleekeri

JN628898 Mystus bleekeri

JN628899 Mystus bleekeri

35 JN628901 Mystus bleekeri JN628904 Mystus bleekeri

JN628928 Mystus bleekeri

KF824794 Mystus bleekeri

KF824795 Mystus bleekeri

KF824796 Mystus bleekeri KF824797 Mystus bleekeri Figure 5: Subcluster of Mystus bleekeri species complex based on cox1 gene analysis.

Chakrabarty and NG [2005] suggested that Mystus cavasius and Mystus seengtee are 2 different species. They limited the Mystus cavasius to Godavari, Ganges and other river system between these 2 species and suggested that Species in Krishna river and rest of peninsular India as Mystus seengtee. Our genetic analysis [Figure 6] suggested that Mystus cavasius and Mystus seengtee are not genetically distinct. We considered samples of Mystus seengtee from its type locality in pune and from a variety of river system in entire peninsular India. Similarly we sampled Mystus cavasius from Godavari, Mahanadi and Ganges. 100% similarity in Cytochrome Oxidase 1 gene of both seengtee and cavasius. Suggested that both are same species.

20 JN628905 Mystus cavasius KF742435 Mystus cavasius 78 JN228948 Mystus cavasius JN228947 Mystus cavasius 18 JN228946 Mystus cavasius JX983379 Mystus cavasius JX983383 Mystus cavasius JX983378 Mystus cavasius

44 Mystus seengtee Bhima(MBS1a) 56 Mystus cavasius Kerala(Dadar marketMska2) Mystus seengtee Bhima(MBS2) 31 Mystus seengtee Bhima(MBS5) Mystus seengtee Ujjani(Msu2) Mystus seengtee Yerwada(MSY) JX983382 Mystus cavasius Mystus seengtee Panvel(MSPS) JX983380 Mystus cavasius JX983381 Mystus cavasius JX983377 Mystus cavasius JX260919 Mystus cavasius 93 Mystus seengtee Bhima(MBS7) Mystus cavasius Solapur(DadarmarketMSSa3) Mystus cavasius Kerala(MSKa1) Mystus seengtee Bhima(MBS6) Mystus seengtee Yerwada(Msy2) Mystus seengtee Bhigwan(Msu1) Mustus seengtee Bhigwan(msb2) Mystus seengtee Yerwada(Msy3) Mystus cavasius Ganga(MCg) Mystus seengtee Mangaon(MSM1) Mystus cavcious Kerala(MC1) Mystus seengtee Bhigwan(Msb1) Mystus cavasius Solapur(DadarmarketMSSa2) Mystus seengtee Bhima(MBS3) 0.05 Mystus cavasius Solapur(dadarmarketMSSa4) Mystus seengtee Bhima(MBS8) Figure 6: Subcluster of Mystus cavasius and M. sengtee based on cox1 gene analysis suggesting that both the species are one and the same.

Mystus guilo Collected from west flowing river of Western Ghats of India. The difference between Mystus guilo from Ganges and M.cf guilo from Western Ghats is 5.4% which suggest that M.cf guilo is likely to be a distinctly different species (Figure 7).

Mystus guilo PAnjim(MBMMB2)

99 Mystus guilo PAinjim(MBMMB1) Mystus cf guilo Mystus guilo Chiplun(muc)

88 Mystus guilo 7 8 2010(MGO)

KF824815 Mystus gulio 45 KF824814 Mystus gulio Mystus gulio KF824813 Mystus gulio 0.05 41 KC595988 Mystus gulio Figure 7: Subcluster of Mystus gulio species complex based on cox1 gene analysis.

21

Sperata Aor, Sperata seenghala, Rita gogra showed very high similarities with available sequences [Figure 8] from Ganges and north east India indicating Sperata Aor, Sperata seenghala, Rita gogra are wide spread in entire peninsular India.

JX983221 Sperata seenghala

JX983222 Sperata seenghala

JX983220 Sperata seenghala

70 JX983219 Sperata seenghala FJ459516 Sperata seenghala Sperata seenghala FJ459515 Sperata seenghala 99 JX260976 Sperata seenghala

FJ459514 Sperata seenghala

Sperata seenghala Solapur(DadarmarketMSSa)

91 Sperata Seenghala Veer(SSV1)

JX983215 Sperata aor 77 JX983217 Sperata aor

JX983218 Sperata aor

Sperata aor Tunga(MST)

FJ170786 Sperata aor 88 FJ170787 Sperata aor

FJ170788 Sperata aor Sperata aor FJ170789 Sperata aor

FJ170790 Sperata aor 61 JN628920 Sperata aor

JN628929 Sperata aor

JN628930 Sperata aor 0.05 JX260975 Sperata aor JX983216 Sperata aor

Figure 8: Subcluster of species belonging to genus Sperata based on cox1 gene analysis.

22 JX946367 Rita gogra JX946368 Rita gogra JX946366 Rita gogra JX946365 Rita gogra JX946364 Rita gogra 95 JX946363 Rita gogra JX946362 Rita gogra JX946361 Rita gogra JX946360 Rita gogra JX946359 Rita gogra 73 Rita gogra Bhima(RGB1) 98 Rita gogra Bhima(RGB2) EU417792 Rita rita EU417793 Rita rita EU417794 Rita rita EU490872 Rita rita 78 FJ459396 Rita rita FJ459397 Rita rita JN628918 Rita rita JX105469 Rita rita JX889601 Rita sp 96 JX889607 Rita sp JX889606 Rita sp JX260963 Rita gogra JX260964 Rita gogra JX260965 Rita gogra JX260966 Rita gogra JX260967 Rita rita JX889589 Rita sp 0.05 JX889590 Rita sp JX889591 Rita sp JX889592 Rita sp 98 JX889593 Rita sp JX889594 Rita sp JX889595 Rita sp JX889596 Rita sp JX889597 Rita sp JX889598 Rita sp JX889599 Rita sp JX889600 Rita sp JX889602 Rita sp JX889603 Rita sp JX889604 Rita sp JX889605 Rita sp Figure 9: Subcluster of species belonging to genus Rita based on cox1 gene analysis.

Cytochrome b sequences of bagrid are represented by very less species as compared to cox1 gene in NCBI data base. Because of logistic reason we could not sequence all the sequences from Cytb however the sequences that we could generate from various species of Mystus. Showed similar clustering patterns as that of cox 1 (Figure 10).

23 s

e

s s

a e

s s

s b s

e e

e a

s s 2 s s b a

a 9 s a e

b b s 0 8 e b s s E e s 1 3

8 2 a e

U 2 s a 1 b s 3 9 s 9 i a b 4 1 a 1 0 b 9 0 s 2 b

1 8 1 s

1 n 9 0 i 2 3 s u 2 s i e 0 9 t i l i 9 s 1 e l 9 r 1 0 a 1 s u 0 s u e 0 7 u c i a e n s 1 d i 1 h i i s l s n b

e l B t r s c s i s a t u i e o a b e a r r 2 b n u c t

s h s t a s v s a H l b 9 a i c 8 a s s u r e s s a 0 e Q r s s l a 3 s b u u d s i u i 1 i r r g s 1 o u v a 2 r s v a 8 r 1 g g s b a a l 5 g s i b 3 s t r s g u s i a a

b 1 g 7 a a u s 0 e A c u f 0 e a r 1 b b r s 2 o u 4 A F r b n 4 s i b c s a o s g o d 7 s n 8 d o i e i a F 4 t u 7 b o a t u e d b u 2 u s s i 4 3 d r s t t i s i e b s l u s s 2 e g n a 1 t u 2 0 B s u s l o 9 e e s a u d 9 A 6 3 e a 1 a s r s d n 0 e e i 0 Y 8 1 s c b u 7 P s e t P a t g u t i 1 l i 1 A r a 9 9 3 3 a P o o r P P i c a i n c s Y 6 e 0 7 g 0 7 s e u i t e o t s H 2 b t u 3 i v 9 7 5 a s i 9 l H 5 P s t a M b o L e 0 7 e o s e r 6 e 0 b 3 e u a 5 9 r s y 7 e a 6 d r u p 0 m 3 c h 4 L o a 2 s 9 8 5 P b 6 3 m s 9 u u n b a 2 e s t 2 s i 1 2 u 6 e 9 6 7 t s i i b 8 e 2 l s u u H v 1 1 1 r s E b 9 4 s r M 7 s 4 1 3 y u s a m 6 s 2 e t 6 9 s r g s m U e a 9 2 h e y 4

g F 4 H Y s s m g 1 P 3 P c a g s a 1 s e 4 o Y 1 e a r Y 1 s F 2 t A 2 u A E e A 4 c a b a s u l 3 r u l 1 3 a r a a i A 9 m u l J A 1 1 o b o s b a s Y U 9 b s e A F T i g b b s n 9 9 d u b m 9 4 4 i a Y 9 9 o 0 2 M a b m r A 3 8 3 e a u h 1 0 5 d 4 r 3 7 g m i A Y 0 9 s a 2 Y L b y i 2 a 2 6 9 e p 7 l c 9 0 r a 1 9 9 u 4 0 e 5 o s a u 4 g u a A A 1 9 s y i 7 1 s t b 4 c 1 2 7 1 4 e k 7 d a u s 4 6 H r s c 0.05 4 5 s P a s a u r 0 3 9 9 9 u o n b 9 s r M 6 9 e m r o 1 s w c o s 2 9 F 9 P e 3 0 e m ic H m o p Y u a a g s a H p A 0 5 s 1 r k r o 4 a u n m a t b 6 9 A 0 g i 7 a M l s e e i t e B 1 P 4 id p b a g m b c 9 8 a h y b M m a r e a G 0 2 c v u s 8 s a a c o r r A 8 8 1 b i l e u t a o ib g u u s B u p 3 M u r a ib r p e l 6 1 9 o s f s r 1 s i n n a r o s s y A 1 d 1 y c ( a u t s 9 4 Y u s u o s s m u g M g p e 1 p 7 4 4 u r r c s e t s a g s 1 7 4 2 A u g i s u a r t r 1 t 6 9 9 e g r v u s o M u r e u 1 o 9 F 1 a a l L u g 5 9 s a u e rp b s a n s r 3 t A 9 s b r e m o M s u s 3 8 b o b n ( m u 7 h P y o b 0 s a a M 2 g t s 1 8 Y o e ic 4 a M l r a t o A 2 d h t s v 7 b a i v M ) a u a 1 b b c l u y b c a c t 1 r 2 u e r e s 0 a u M 1 t 0 a a a r i 4 st r s la 1 r ta u 1 a 6 e T P g b s 7 u i 1 1 o s 0 3 s s x 5 s a n s c K (M p t e 9 2 3 b s e s M u ) 7 u 1 3 b e 8 P u i u m s a 1 t p 9 9 3 o r k c s y a r M b e s 1 b a s s 0 7 9 3 d g o a e s S ja 1 1 r o B 2 t i s tu lb a t 1 a u 1 0 a s 7 8 5 u a t a s a t ( ) 7 s 1 3 e o A 9 1 1 e b s n b m r a M 1 e s 0 s 9 5 9 s o ru ra ic ra S 1 b s 1 b e s 5 n 0 Y P d g u 92 a u 1 a 3 0 a 1 B u a la s (M K 7 s 0 a s 9 0 A 0 e ba 0 s b ) 9 b s 9 e A s 1 H a W S 1 b e a B 9 s o ru n se r a S 1 a s 6 2 e 9 n 9 P d o a Q iu i( 1 s 9 s s A 5 u g d b 25 s M 1) 7 e b e 9 s 1 9 e ba n 0 7 S S s a s i 0 2 s o o 4 2 a W 11 b s s B 2 P d s 7 9 t 1 a 9 e 9 6 u ru s H 8 a 3 s 9 1 A 9 p M r 7 e s 7 8 e g e s Q a ) 0 2 1 9 s a c e 2 y (M 1 b s 9 5 7 9 Q 5 P b di s 5 st 1 a 6 9 1 o a 72 u S 1 s 9 9 H 0 9 d nu b H 9 s S 7 e 7 9 9 6 8 u 0 7 m 4 b s 8 B 9 e s 4 Q M y ) a 9 A 5 s ru 7 es 25 y s 1 s b 1 P g us as es 7 s ti 1 e a 6 0 8 a n b s 2 tu c 2 s 9 B 7 b a 5 a 9 s e 6 s 3 o e b 6 M m tu b 99 A 2 d or 17 02 H y y s a e 1 eu k s 1 11 Q s s 1 s s 9 s s 25 tus tic 10 e 9 Y P ru nu us 72 m e 2 s 9 9 9 A 8 ag ea nth s 95 u tus ba 9 9 98 b kor ca ase M ltira 1 s 5 5 do s eia 2 b yst di 10 es 4 01 eu gru s l 10 us atu 2 7 B Ps a stu s 1 H mu s 1 ba 9 A 1 dob my thu Q2 lti 10 se 99 99 u do can 572 rad 2 s 15 se eu leia 94 iatu bas B0 4 P Ps us My s 1 es 7 A 75 03 yst es stu 10 2 6 21 73 om bas s m 2 b 3 Q3 25 ud 37 AB icr as D HQ Pse s 11 822 aca es 9 04 eru 537 nth 9 99 573 ropt Mys us 99 6 Q2 ac KF8 tus 110 9 6 H ys m 6295 atrif 2 b 5 hth 7 M asci ase 6 gric ases ystus atus s 8 5 Ba 02 b ases K atrif 113 090 ys 11 102 b F8629 ascia 8 ba U49 ichth ulus 1 56 My tus 1 ses E Bagr ajusc stus a 128 99 7281 hys m trifasc base Q25 gricht ases KF862 iatus 1 s H 80 Ba 1137 b 950 M 128 b 9 572 pterus ystus d ases 9 88 HQ2 poecilo ibruga 82 cassis s rensis 1 99 16 Leio 102 base KF862951 128 bas EU4909 lopterus 1 Mystus di es 32 57 99 sis poeci brugarensis 99 Leiocas 1128 base Q257289 s H 1102 bases KF8629 99 18 85 siamensis 52 Mystus gulio seudomystus 1128 bases HQ257305 P 61 s KF862953 My udomystus siamensis 1102 base stus gulio 1128 bases 97 99 HQ257306 Pse 99 HQ257307 Rita sacerdotum 1102 bases Mystus guilo Panjim(MBMMB2) 1118 bases 98 99 29 22 HQ257 308 Rita sacerdotum 1102 bases guilo Chiplun(MUC) 904 bases 87 EU490921 Rita Mystus rita 1137 bases 102 bases 99 E ystus gulio 1 U781895 HQ257293 M 78 99 Aucheno 89 glanis 97 36 HG80 3 bases 8 bases 3403 A ekeri 112 bases 54 ucheno stus ble i 1128 7 glanis 958 My eeker 92 1 occide KF862 stus bl H ntalis 7 959 My 99 G803 73 base KF862 ases 88 392 A s 102 b HG uchen gan 1 803 oglan garin es 35 330 is o s sin bas 8 4 HG8 Par ccide Mystu 102 9 8 034 auch ntalis 301 an 1 es 35 90 04 eno 108 Q257 ring bas Par glan 1 bas H inga 102 99 HG auch is ng es tus s rti 1 803 eno amen Mys cou es 408 glan sis 1 00 bo bas 7 P is m 066 573 stus 37 8 90 ara on bas HQ2 My i 11 H uch kei 6 es 290 ourt 89 G8 eno 25 b 257 oc ses 033 gla ase HQ s b a 9 8 4 nis s tu b es 9 5 6 HG 5 C m ys 28 as 99 6 8 h o 2 M i 11 b 3 03 rys nke 1 r 9 s 5 3 ic i 8 909 ke 11 se 46 hth 04 4 lee ) 1 a 8 C y b EU b 1 b 7 h s as us M 2 8 ry bo es yst MM 12 s 4 sic cag M S ) 1 se 3 H HG ht ii 5 60 (M 1 ba 9 9 9 G 8 hy 18 29 tha BS 9 es 9 9 8 03 s a ba 86 u M 11 s s 5 03 32 ns se F aM r( 1 e a s 7 H 4 9 or s K ul iru ) s b e 9 G 06 C gi M h 1 ba 2 s 9 8 hr i 1 ri i S C 7 0 s a 0 Ch ys 13 e M s 2 k er B 1 1 e b e 3 ry ic 8 e 9 4 4 le k M 11 1 s s 8 H 0 s ht ba e ( i a 2 s 9 2 ic h s b le r ) 9 fi a 9 3 G 2 h y e s b o 1 f b 0 e s 4 C s s tu s h S 9 l 1 b s 5 8 th o ys u B S s o 2 1 e 2 0 hr y rn t ri e w 0 2 a s 7 5 3 y s a M ys e M s s 1 s 0 b s 9 H 4 s s tu M k r( a se s 1 u 1 a 9 9 G 10 ic p s e u b a tu i 1 8 b e s h 1 1 le ir 8 b s a s 2 s 9 8 C th 13 0 b h 2 y a s 8 a e 5 0 h y 8 1 s S 0 7 m v u 1 2 s s H 3 r s 8 tu ri 1 1 M g a i 1 1 b e s 3 G 4 y a ba ba s e ) 1 e s a 7 0 s u s s 2 c s s e 9 i y k 2 1 rh a 1 8 b s 8 7 ch ra e es M e ) 0 s u 1 a s 9 9 0 s e W 1 3 s v t s e A 3 C th tu l u 1 6 b a s 9 b S A 7 u t a a u s 9 F 4 l y s s 9 a 5 t s c t 1 1 b e 2 s 1 s M S e 7 a 6 9 1 0 r s 1 0 1 u i( 2 y a ) s e 8 9 o 1 t y s n 0 2 3 a M i e 1 1 9 b s 9 t 1 s ( Q M tu l S 1 a 6 C e 3 8 y W a H M o n ) 9 9 8 s 8 b M i r 2 s li P 1 7 b a 2 la l a a b 1 0 H H r j 9 9 y l b E r a b s e 9 o S ) 1 1 1 o t a e 8 J A J i k i 2 a M M c s M b 1 U M t s l 2 l M 3 2 C e e e 7 ) 1 X e o 7 1 s X e 5 1 s a ( S Y l s p s l b l 1 2 4 a 5 u 1 e 5 5 ) 4 s b 2 9 4 l m 2 t s e M S 1 1 s 9 r a . 2 U s 9 7 7 9 o 1 f s v ( 2 6 t c A Q Q u ) 1 e 6 9 t i 1 7 y 0 9 c i t n n M S a 9 8 H e 3 r B s 0 H 0 s H 5 s ( 1 ) s e 8 e a o s 9 8 u M b 8 G p 2 y S a 9 a 9 t k a M g la s b s P e 1 5 e 3 ( O b 5 8 Q d i 6 a y 2 6 t e M g M s 0 i 1 l C 3 7 s 6 e a n S 6 H c 1 M H ( 2 e 9 3 b 9 2 n 2 a 0 e 3 e G . w a n M 3 s a p 8 f t 1 H H 2 6 r j M 0 b H c ( H 6 H 8 s a 9 g 9 6 9 M 1 1 3 b s e U a o o 9 0 M o a n 9 5 8 9 2 w 2 o u 1 o 9 3 Y ( s H P 8 s t e g s r r F 6 e e r 9 e s g 2 r a 3 a r a 5 h 2 8 e e i n u e a G s y K e e s a 9 t 1 t a 7 7 y s t s b b 9 b h s b M F e a u s s 4 8 3 l b g 1 b l a t g s r n a 9 H o s a 4 0 K s B i s a s a e e P s n G a g r a n u n u s e g G 3 e g e b e g t e s e s H h e n e g 3 s

e g s r 8 O u s s s r y m s r e e m m a a G 7 e e r r u 2 u 0 y t u r u l s a l a a 5 u u

e i a b b s u o s e u s H 8 3 l 3 s g s s s b n i b M s u s n b s 5 0 3 P s i f G s 2 1 u n m 8 n 9 e f a b 7 3 h i b t s s m l u 2 1 7 b e s 0 2 i b t v e s 3 i 8 3 1 y n s u r r t a g e u 0 3 r l u 0 e 1 a 0 7 r a y s a n u 1 P l c s v r a r H o s m s r a H 3 0 y 1 1 1 1 c f 1 c c i h n y a g a M c c G 3 f f c u 1 1 g 1 5 M s h h 3 G B y e i c s l s a h s s o 7 M a i h 2 l m i a m 9 8 u y n y a l s 9 t u b r s s 8 9 o 1 y s i u l y e i b c 0 t s s l 9 t u 1

s r n s i r 0 a e a h u e s m s l s 3 B s 0 y t u o o o H 3 e u y m a 9 d o r d 3 4 y o u r l a i m m u i t s d m m b e i 9 G 3 y s M m s 8 t b g m 8 H e c u m a y o o p M i 7 h u i a s i 9 a 8 1 a 9 H a c g u e 9 G 8 y s a H s H c i 0 M k k a u 0 r b H C b s e n 6 u b 6 6 a c r 1 9 i c c G 8 C 3 s a 3 1 r 1 3 1 s 8 1 5 G h a g y 6 y H 0 3 i 1 s 8 h g c m 8 a 0 r 0 b 2 3 t 3 t a 5 H 8 3 6 r y r h u e w b w G 0 a e 2 a 9 y u 8 9 7 7 r a t 3 4 s t a B 0 s a G 3 s r 7 9 b s r i r 5 H s s 9 8 b e a g 7 c a s 3 3 L i d 5 b a e r c t a s 6 u 8 0 2 u 4 h n a e i 9 b e 3 9 o b s a 2 p e r r s h e 1 0 0 3 t t b e Q 2 a s 6 3 L p h r i a t 1 g g s e m p 3 Q S 9 3 h y a s s 5 o h 3 5 e H s a a s L y n a S 0 3 8 s m i 8 2 H e p 0 e s o b e b L o s 9 8 2 i i 1 e h 2 s b p b s m 1 9 o p 1 4 8 s a 8 L i a l 3 0 H o a m m p h 3 i a s g a U L o t 8 B 7 3 h i b e e e o y 0 r n 1 o p i a c s A 5 7 E b u e 1 b H o H 0 p h g e a 2 5 b a s n 3 6 h i r p 8 s 2 8 1 o g u n Q a b e 9 h 1 i 8 a o b g r s r b s Q a H 9 u e 9 2 a a b r b 1 l

4 u H u s v s 0 7 g 1 a r i s e F s 9 r b e s 3 5 g s u v p 8 1 4 A r 2 r a s e i i 0 u q s n b U v 6 Q s c p u i is a 4 E y s H i i s c l n c u p 1 e b y i i 1 a l s n s s c u 3 s i 1 l r 1 s 8 e u u 1 1 s r s 1 3 b u 3 1 8 a s 1 8 3 s 0 b 1 b 8 e 8 a 1 a s 5 b s 3 s a e 8 b e s s a s b e s a s e s s e s Figure 10: Maximum likelihood tree for cytb gene of Bagrid fishes. The sequences highlighted in red were generated in the current study. Values along the nodes are percent bootstrap values.

Analysis of cytb also suggested that Mystus malabaricus from Lonavala, Karjat, Mangaon is genetically different from Satara and Wai [Figure 11]. Because no information is available on Mystus malabaricus from Kerala we cannot comment on the affinity of Mystus from Northern Western Ghats with true Mystus malbaricus similar to cox 1. Cyt b also suggest that Mystus bleekeri from Bhima River [Mula mutha, Shirur, bhor] is genetically different from Mystus cf bleekeri from wai and azara. Mystus cavasius and Mystus seengtee were genetically similar in cyt b further supporting our claim both species are one and same. Mystus cf guilo from Western Ghats shows high genetic distance from Mystus guilo of Gangetic provinces.

24 Pseudobagrus/Leiocassis/Tachysurus/ Pelteobagrus/Pseudomystus/Bagrichthys/ 35 Rita/Auchenoglanis/Parauchenoglanis/ Chrysichthys/Clarotes/Phyllonemus/ Bathybagrus/Lophiobagrus/Horabagrus

42 Sperata/Hemibagrus/Bagrus 35 73 Mystus cavasius Ganga(MCg) 1122 bases Mystus cavasius Orissa(MMSO1) 1118 bases 59 Mystus seengtee Bhigwan(MSB2) 1117 bases Mystus seengtee Ujani(MSU1) 1099 bases Mystus cavasius/seengtee 95 72 Mystus seengtee Yerwada(MSY3) 1117 bases 99 Mystus seengtee Mangaon(MSM1) 1116 bases 66 98 Mystus seengtee Panvel(MSPS) 1118 bases 78 Mystus albolineatus 75 Mystus cavasius 99 58 HQ257299 Mystus rhegma 1102 bases HQ257302 Mystus wolffii 1102 bases Mystus bleekeri MulaMutha(MSMMM1) 1119 bases 35 99 Mystus bleekeri Shirur(MBS1) 1122 bases Mystus bleekeri Bhor(MBMC1) 1119 bases 93 Mystus bleekeri Shirur(MSS1) 1117 bases Mystus bleekeri 99 Mystus cf. bleekeri Wai(MSW2) 1028 bases 99 Mystus cf. bleekeri AmboliAjara(MSA1) 1117 bases 17 98 KF862960 Mystus bleekeri 1128 bases 99 Mystus bocourti 92 Mystus singaringan 54 99 KF862958 Mystus bleekeri 1128 bases 87 HQ257293 Mystus gulio 1102 bases

78 Mystus cf. guilo Chiplun(MUC) 904 bases 22 Mystus cf guilo 98 Mystus cf. guilo Panjim(MBMMB2) 1118 bases 29 KF862959 Mystus bleekeri 1128 bases 99 Mystus dibrugarensis KF862952 Mystus gulio 1128 bases 99 Mystus gulio 97 KF862953 Mystus gulio 1128 bases 32 82 99 Mystus atrifasciatus HQ257294 Mystus micracanthus 1102 bases 99 95 Mystus multiradiatus 68 Mystus mysticetus 99 Mystus malabarius Satara(MSS4) 1126 bases 99 72 Mystus malbaricus Wai(MSW3) 1117 bases Mystus malabaricus Satara(MSS1) 1117 bases 99 Mystus malabaricus Karjat(MSK) 1117 bases Mystus malabaricus Mystus malabaricus Lonavala(MM1) 1117 bases 99 Mystus malabaricus Mangaon(MMM1) 1117 bases 69 Mystus malabaricus Mangaon(MMM2) 1117 bases Hemibagrus 99 Batasio 98 JN092396 Glyptothorax poonaensis 1066 bases

0.05 Figure 11: Maximum likelihood tree for cytb gene of Bagrid fishes under genus Mystus. The sequences highlighted in red were generated in the current study. Values along the nodes are percent bootstrap values.

25 Morphological analysis In all 121 specimen were used for morphometric study. Principle component analysis (PCA) of different species used for morphometric analysis is shown in (Figure 12). Size corrected morphometric data and correlation matrix were used for analysis. PCA analysis extracted 6 axis with eigenvalues more than unity (Table 3) however because it was difficult for us to plot graph in multidimensional space we plotted the graph in 2 axis. First axis explained around 34% of total variation, second axis explained 15 % of remaining variance. All different species of Mystus and Rita Gogra were separated on first axis while Sperata seenghala were separated on second principle axis. Separation on first axis is based on character such as pre pelvic length, pre pectoral length, length of anal fin base, Pelvic fin length, length of adipose fin base, dorsal to adipose distance, post adipose distance, length of caudal peduncle, depth of caudal peduncle, head length and eye diameter. While separation on second axis was based on head width, head depth, snout length and interorbital distances.

4 M. bleekeri M. gulio

2

0 M. malabaricus

) M. cavasius

% Rita gogra

5

2

. -2

5

1

( M. seengtee

2

s

i

x a -4

A

C

P

-6

-8

Sperata seenghala -10

-3 -2 -1 0 1 2 3 4 5 6 7 8 PCA axis 1 (33.79%) Figure 12: Principle component analysis of the specimens studied for morphometric analysis.

26 Table 3: Descriptive statistics and factor loading for the first six PCA factors. Axis 1 Axis 2 Axis 3 Axis 4 Axis 5 Axis 6 Eigenvalue 7.10 3.20 2.35 1.50 1.09 1.01 % variance 33.79 15.25 11.17 7.14 5.21 4.82 pre_dorsal_length 0.16 -0.07 0.08 0.24 -0.37 0.70 pre_anal_length -0.04 0.00 0.29 0.43 -0.52 -0.28 pre_pelvic_length 0.26 0.02 0.20 0.14 0.04 -0.47 pre_pectorial_length 0.23 -0.02 0.23 0.08 0.22 -0.22 dorsal_fin_lenth -0.16 0.03 0.38 -0.35 0.15 0.11 length_of_dorsal_fin_base -0.07 -0.02 -0.20 0.55 0.47 0.11 length_of_anal_fin_base 0.29 0.07 -0.20 -0.01 0.26 0.17 pelvic_fin_length -0.24 0.11 0.23 0.06 0.09 0.19 length_of_adipose_fin_base_ -0.36 0.01 -0.06 0.13 0.05 -0.06 MAX_height_of_adipose_fin 0.03 0.24 0.42 0.16 0.25 0.08 dorsal_to_adipose_distance_ 0.34 0.08 0.09 -0.16 -0.12 0.05 post_adipose_distance 0.29 0.04 0.09 -0.35 0.05 0.08 length_of_caudal_pendancle -0.24 0.19 -0.09 -0.12 0.07 0.05 depth_of_caudal_pendancle 0.25 0.25 -0.26 0.20 0.05 0.05 body_depth_and_anus -0.01 0.42 0.22 0.12 0.01 0.14 head_length 0.23 -0.12 0.40 0.14 0.21 0.12 head_width 0.10 0.42 -0.18 0.10 -0.02 -0.09 head_depth -0.12 0.44 0.07 -0.11 0.00 0.01 snout_length -0.13 0.35 -0.01 0.01 -0.25 -0.01 inter_orbital_distance 0.21 0.35 -0.14 -0.09 -0.08 -0.09 eye_diameter -0.31 0.08 0.08 -0.01 0.13 -0.04

Morphometric analysis of Mystus malabaricus clusters identified in genetic analysis showed high overlap (Figure 13) suggesting that if Mystus malabaricus is a species complex then the species are likely to be cryptic in nature with very less morphological differences. Principle component analysis (PCA) of Mystus bleekeri and Mystus cf bleekeri (Figure 14). Showed 2 clusters separated on first principle axis Mystus cf bleekeri differed from Mystus bleekeri in having higher head length and pre pectorial length, And lesser head depth, length of anal fin base, body depth at anus, depth of caudal peduncle and length of caudal peduncle.

27 4

3.2

2.4 M3 M4

1.6

)

%

0

8

.

2 0.8

1

(

2

s

i

x

a

A

C 0

P

-0.8

-1.6 M2

-2.4

-4 -3 -2 -1 0 1 2 3 4 5 6 PCA axis 1 (23.79%)

Figure 13: Principle component analysis of the three clusters of Mystus malabaricus as identified in genetic analysis (Figure 3).

4.8

4

M. bleekeri 3.2

2.4

)

%

5 1.6

6

.

8

1

(

2

s

i

x 0.8

a

A

C

P 0

-0.8

-1.6

-2.4 M. cf. bleekeri

-4 -3.2 -2.4 -1.6 -0.8 0 0.8 1.6 2.4 3.2 4 PCA axis 1 (31.67%) Figure 14: Principle component analysis of Mystus bleekeri and M. cf. bleekeri.

28

Principle component analysis (PCA) of Mystus seengtee and Mystus cacasius showed overlap (Figure 15) bolstering overview that both the species are one and the same based on Cox1 and Cytb gene sequence.

5

4

3 M. seengtee

2

) 1

%

6

8

.

3

1

(

2 0

s

i

x

a

A

C

P -1

-2

-3

M. cavasius -4

-5 -4 -3 -2 -1 0 1 2 3 4 5 6 PCA axis 1 (18.43%) Figure 15: Principle component analysis Mystus seengtee and M. cavasius.

Our morphological analysis is still incomplete because even though we could download genetic information of comparative material from Ganges and Kerala we could not get more sequences of the specimen for morphological analysis.

29 Osteological analysis The clearing and staining protocol was used for 6 species of bagride however despite of 7 month of incubation the clearing is not yet complete. Nevertheless based on partial clearing of 3 species we provide the basic analysis. Partially cleared whole specimen of Mystus seengtee, Mystus cavasius and mystus malabaricus are shown in Figure 16. Mystus seengtee has 19 preanal and 18 postanal vertebra with a single supraneural spine. Mystus cavasius from Godavari has 20 preanal and 18 postanal vertebra with single supra neural spine. Mystus malabaricus has 21 preanal and 15 postanal vertebra with single supraneural spine.

Figure 16: Cleared and stained specimens used for osteological studies. (a) Mystus seengtee, (b) M. cavasius and M. malabaricus.

30 Osteology of head structure of three species is given in Figure 16. Even though there were minor differences in anterior frontanelle and posterior frontanelle structure of Mystus seengtee and Mystus cavasius (Figure 17 b and d) the difference was not sufficient to suggest that two species are different. The structure of supra occipital was also remarkably similar. For the two nominal species where supra occipital process almost reached basal bone of dorsal fin, on the contrary osteology of Mystus malabaricus showed a remarkable difference (Figure 17f) the differences include much reduced anterior and posterior frontanelle and supra occipital process. The supra occipital process did not reach the basal bone of dorsal fin and both the structure were separated by a very large distance. Unfortunately because osteological study are relatively rare in India and our analysis is only preliminary it is difficult to trace the evolution in variation of head osteology further studies with more specimen and different species of bagrid will be able to shed more better light on the osteology of Bagrid.

Figure 17: Osteological details of the head. (a, b) M. seengtee, (c, d) M. cavasius and (e, f) M. malabaricus. Key: e = mesoethmoid, af = anterior frontanelle, fr = frontal, lfr = lateral frontal, pf = posterior frontal, sph = phenotic, pt = pterotic, so = supra occipital, sop = supra occipital process, bbd = basal bone of dorsal fin base, dn = dorsal notch.

31

Figure 18: Gill rakers on the first gill arch. (a) M. seengtee, (b) M. cavasius, (c) M. malabaricus, (d) M. bleekeri and (e) M. cf. gulio.

Gill rakers on the first gill arch has been considered as an important taxonomical characters for Mystus Species. Gill rakers on the first gill arch of five Mystus species is shown of Figure 18 both Mystus seengtee and Mystus cavasius had around (20-21) gill rakers suggesting that this character used by chakrabarty and NG (2005) for separating the two nominal species is invalid. Mystus malabaricus also has around (19-20) gill rakers around first arch while Mystus bleekeri had the least number of gill rakers (13-14) and Mystus guilo has highest number of gill rakers (28-30) Both the structure and number of gill raker did not show fixed pattern that could co-inside with evolutionary tree (Figure 3). Gill raker is likely to be a complex phenomenon.

32 CONCLUSIONS Following conclusions can be drawn from our analysis. 1. There is a hidden diversity in the Western Ghats of India. From our experiment we found that there are several species complex of Mystus is present in Western Ghats of India. 2. Mystus malabaricus is likely to be a species complex based on our Cox1 and Cytb gene sequence. Mystus malabaricus consists of 2 distinct species in Kerala and two other distinct species in northern Western Ghats of Maharashtra. However Morphometric analysis of Mystus malabaricus clusters identified in genetic analysis showed high overlap (Figure 13) suggesting that if Mystus malabaricus is a species complex then the species are likely to be cryptic in nature. 3. Mystus bleekeri Both Cox1 and Cyt b showed the presence of undescribed species of Mystus bleekeri supported by morphometric analysis. 4. Mystus seengtee and Mystus cavasius which are considered as two different species, which are likely to be the same species distributed throughout India. 5. Mystus guilo from Western Ghats of India have a distinctly different evolutionary linage different from Gangetic M. guilo. 6. Sperata seenghala from its type locality in Pune is different from sequence deposited from northeast India, indicating presence of a different species from northeast India. 7. Rita gogra which is thought to be distributed all over the India is likely to be comprises of 3 distinct species. 8. We have provided osteological details for Mystus species from Western Ghats for the first time. We show that the osteological structures of the head region, gill rakers on the first gill arch and number of vertebra could be used in combination as differentiating characters for separating the species of Mystus but with caution. For instance, the gill rakers was used as separating character for M. seengtee and M. cavasius, but we show that both of them have overlapping ranges. The number of gill rakers of M. malabaricus are also similar to the gill rakers of M. seengtee and M. cavasius but the head structure, especially the supraoscipital process differed substantiated between these species.

33 9. Our analysis also suggests that there are some widespread species present throughout India, such as Mystus cavasius (as M. seengtee is likely to be the synonym of M. cavasius), while certain widespread species such as M. bleekeri also has some undescribed species. Further the presumably widespread species such as M. gulio is actually made up of different species in Ganges and Western Ghats. Our study therefore sheds light on the biogeography of bagrid species of the Western Ghats. 10. In our future studies we will try to tie up all 3 molecular, morphometric, osteological analysis and look at their evolutionary pattern.

34 References Ali, A., N. Dahanukar, A. Kanagavel, S. Philip & R. Raghavan (2013). Records of the endemic and threatened catfish, Hemibagrus punctatus from the southern Western Ghats with notes on its distribution, ecology and conservation status. Journal of Threatened Taxa 5(11): 4569–4578. Altschul, S.F., W. Gish, W. Miller, E.W. Myers & D.J. Lipman (1990). Basic local alignment search tool. Journal of Molecular Biology 215 (3): 403-410. Anganthoibi, N. (2012) Inventory and systematic studies of some catfishes of north east India. Ph.D. Thesis submitted to Department of Life Science, Manipur University. Chakrabarty, P., & Ng, H. H. (2005). The identity of catfishes identified as Mystus cavasius (Hamilton, 1822)(Teleostei: Bagridae), with a description of a new species from Myanmar. Zootaxa, 1093, 1-24. Chen, X.L., T.Y. Chiang, H.D. Lin, H.S. Zheng, K.T. Shao, Q. Zhang & K.C. Hsu (2007). Mitochondrial DNA phylogeography of Glyptothorax fokiensis and Glyptothorax hainanensis in Asia. Journal of Fish Biology 70: 75-93. Dahanukar, N., Raut, R. and Bhat, A. (2004) Distribution, endemism and threat status of freshwater fishes in the Western Ghats of India. Journal of Biogeography, 31 (1): 123-136. Dahanukar, N., Diwekar, M. & Paingankar, M. (2011), J. Threatened Taxa 3: 1885- 1898. Dahanukar, N., R. Raghavan, A. Ali, R. Abraham & C.P. Shaji (2011), The status and distribution of freshwater fishes of the Western Ghats. In: Molur et al. (compilers). The Status of Freshwater Biodiversity in the Western Ghats. IUCN, Switzerland & ZOO, Coimbatore. Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792-1797. Hammer, Ø., D.A.T. Harper & P.D. Ryan (2001). PAST: paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4(1): 1–9. Hebert, PDN, Cywinska A, Ball SL, and deWaard JR (2003) Biological identifications through DNA barcodes. Proceedings of Biological Sciences 270(1512): 313– 321.

35 Jayaram, K.C. & A. Sanyal (2003) A taxonomical revision of the species of the Genus Mystus Scopoli(Family : BAGRIDAE) Rec Zool Surv India, Occ. Paper 207: 1-136. Jayaram, K.C. (2009). Catfishes of India. Narendra Publishing House, New Delhi, 383pp. Ng, H.H. & M. Kottelat (2013). Revision of the Asian catfish genus Hemibagrus Bleeker 1862 (Teleostei: Siluriformes: Bagridae). The Raffles Bulletin of Zoology 61(1): 205–291. Norman Myers, Russell A. Mittermeier, Cristina G. Mittermeier, Gustavo A. B. da Fonseca and Jennifer Kent. Biodiversity hotspots for conservation prioities Nature 403: 853-858 Potthoff, T. (1984). Clearing and staining techniques, p 35-37. In Moser, H.G., W.J. Richards, D.M. Cohen, M.P. Fahay, A.W. Kendall, Jr. & S.L. Richardson (editors), Ontogeny and systematics of fishes, American Society for Ichthyology and Herpetology, Special Publication No. 1. pp. 760. Sharina, S.N. & Yu. P. Kartavtsev (2010). Phylogenetic and taxonomic analysis of flatfish species (Teleostei, Pleuronectiformes) Inferred from the primary nucleotide sequence of cytochrome oxidase 1 gene (Co-1). Russian Journal of Genetics 46 (3): 356–361. Tamura K, Stecher G, Peterson D, Filipski A, and Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution:30 2725-2729. Xia, X. 2013. DAMBE5: A comprehensive software package for data analysis in molecular biology and evolution. Molecular Biology and Evolution 30:1720- 1728.

36