sign in sign up
<<
Home , Calocedrus decurrens, Fitzroya, Thuja occidentalis, Thujopsis

IAWA Journal, Vol. 32 (2), 2011: 273–284

MOLECULAR IDENTIFICATION OF CUPRESSOIDES, SEMPERVIRENS, AND PLICATA USING TAXON-SPECIFIC RDNA-ITS PRIMERS

Felix Hanssen, NikoWischnewski, Ute Moreth and Elisabeth A. Magel* Institute of Wood Biology, Department of Wood Science, University of Hamburg, Leuschnerstr. 91d, D-21031 Hamburg, Germany *Corresponding author [E-mail: [email protected]]

SUMMARY The nuclear ribosomal DNA internal transcribed spacer (rDNA-ITS) re- gion was PCR amplified and sequenced from the wood of three specimens of Fitzroya cupressoides, nine specimens of , and ten specimens of . The full lengths of the ITS regions are 1110 bp for F. cupressoides, 1096 bp for S. sempervirens, and 1138 bp for T. plicata, and thus in the range of 975 bp to 1125 bp which is reported for members of the . Length variation of ITS regions is due to differences in the length of the spacer region ITS1. Intraspecific variations of the sequences of rDNA-ITS regions were one bp in F. cupressoides, and 18 bp in S. sempervirens and T. plicata. Based on the interspecific sequence divergence of the ITS region, taxon-specific primers were de- signed for the detection of F. cupressoides, S. sempervirens and T. pli- cata. The primer sequences were selected from the highly divergent ITS1 spacer. The specificity of the primers was checked by lengths and se- quence of the amplicons, and the primers detected the target organism, solely, across 40 . Our data establish the molecular basis for DNA-based wood identification in these species. Key words: rDNA, ITS, taxon-specific primer, wood identification,Fitz- roya cupressoides, Sequoia sempervirens, Thuja plicata.

INTRODUCTION

A persistent demand for timber has lead to a substantial decrease of wood resources especially in tropical regions. Of a total of 21,000 wood species worldwide, almost a third have been termed as acutely endangered in 2008 (Hilton-Taylor et al. 2008). A general concern, therefore, is to support sustainable cultivation systems and to main- tain natural diversity. In this context, CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora), an international agreement between governments, tries to ensure this preservation by restraint of trade (CITES 2010). Fitzroya cupressoides and Dalbergia nigra are the only timber species listed in CITES, Appendix I, and thus classified as threatened with extinction or may be affect- ed by trade. While D. nigra has been the topic of a great deal of identification interest (Gasson et al. 2010; Kite et al. 2010), comparatively little research has been done on

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 274 IAWA Journal, Vol. 32 (2), 2011

Fitzroya cupressoides. This conifer is indigenous to the southern parts of the , and its brown to reddish heartwood is highly appreciated for its durabil- ity. Due to a trade prohibition for F. cupressoides, the closely related species Sequoia sempervirens (Californian Redwood), and Thuja plicata (Western Red Cedar) are used as substitutes. The three species are members of the family of the Cupressaceae. While microscopic characters suffice to separate these timbers, they are macroscopically quite similar. The expertise and resources necessary for definitive microscopic identification are not widely available, so alternate means for accurate identification are necessary. Within the last decades, a variety of molecular biological methods have been de- veloped for the identification of organisms, from the generic to the individual level. To make broad use of molecular tools for identification, it is desirable that researchers investigate regions of DNA present in a broad range of organisms. One such region is the ITS (Internal Transcribed Spacer) region. In Eukaryotic organisms, the nuclear ribosomal DNA (rDNA) has two internal transcribed spacers, ITS1 and ITS2. The ITS1 region is located between the small subunit (18S) and the 5.8S rDNA, and the ITS2 region is located between the 5.8S and the large subunit (26S). The two spacers, ITS1 and ITS2 and the included 5.8S subunit constitute the ITS region. It is assumed that rDNA genes (18S, 5.8S, 26S) and ITS1 and ITS2 spacers evolve cohesively within a single species. Thus, sequence divergence between rDNA-ITS copies within individu- als of one species is very low, whereas higher levels of sequence divergence are found between species. The popularity of the rDNA-ITS region for molecular systematic analyses of closely related species can thus be attributed to both rapid evolution of the ITS spacers and PCR-amplification with conserved primers (White et al. 1990). rDNA-ITS is also used as a diagnostic tool in: human pathology (Hahner et al. 2008), food technology (Amicucci et al. 2002), and microbiology (Gardes & Bruns 1993; Schmidt & Moreth 2000; Kendall & Rygiewicz 2005; Horisawa et al. 2009). In the present study, rDNA-ITS sequences of F. cupressoides, S. sempervirens and T. plicata were analyzed. Based on these sequences, taxon-specific ITS primers were developed for wood identification. Validation of the specificity of wood identification was by cross-checking with 37 other softwood species.

MATERIALS AND METHODS Materials For determining the species-specific sequence of the rDNA-ITS region, DNA was extracted from air-dried branches of three Fitzroya cupressoides, nine Sequoia sem- pervirens and ten Thuja plicata . The specimens were provided by German and Swiss Institutions (Botanical Gardens, Universities, and the Federal Research Institute for Rural Areas, Forestry and Fisheries, vTI). The original provenance is documented at least for one specimen of F. cupressoides (), for two specimens of S. sem- pervirens (Muir and Humboldt Redwood State Park) and for four specimens of T. plicata (Vancouver, Montana, Canada, and Wenatchee National Forest). Verification of wood identification was by cross-checking with DNA extracted from air-dried sapwood of branches of 37 coniferous species: Abies alba, A. grandis, Picea

Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 275 abies, atlantica, C. libani, C. deodora, Pinus sylvestris, P. strobus, P. taeda, Agathis dammara, Araucaria angustifolia, A. araucana, A. bidwillii, A. cunninghamii, A. heterophylla, Podocarpus dacrydioides, P. spicatus, P. nivalis, P. totara, P. neriifolius, P. gracilior, P. macrophyllus, P. macrostachyus, giganteum, (formerly Thuja) orientalis, , glyptostroboides, Cun- ninghamia lanceolata, arizonica, C. sempervirens, Juniperus communis, dolabrata, lawsoniana, C. pisifera, distichum, decurrens, and japonica.

Table 1. Genbank accession numbers for the sequences of the rDNA ITS region, and iden- tification numbers of specimens ofFitzroya cupressoides, Sequoia sempervirens, and Thuja plicata.

Scientific name Identification number Genbank accession number Fitzroya cupressoides 88 HQ414213 F. cupressoides 92 HQ414212 F. cupressoides 171 HQ414214 Sequoia sempervirens 90 HQ414195 S. sempervirens 93 HQ414196 S. sempervirens 95 HQ414197 S. sempervirens 97 HQ414198 S. sempervirens 102 HQ414199 S. sempervirens 114 HQ414200 S. sempervirens 115 HQ414201 S. sempervirens 121 HQ414202 S. sempervirens 157K4 HQ414215 Thuja plicata 89 HQ414203 T. plicata 91 HQ414204 T. plicata 96 HQ414205 T. plicata 98 HQ414206 T. plicata 99 HQ414207 T. plicata 113 HQ414208 T. plicata 116 HQ414209 T. plicata 118 HQ414210 T. plicata 120 HQ414211 T. plicata 158K9 HQ414216

Methods DNA extraction After air drying the specimens and removing of the bark, the wood was homogenized to a fine powder. Total genomic DNA was extracted from 50 mg wood powder by use of a DNeasy Mini Kit, Qiagen (Hilden, Germany), by following the manufacturer’s instructions.

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 276 IAWA Journal, Vol. 32 (2), 2011

Table 2. Primers used for amplification of ITS1 (ITS1.1/ITS2.1) and ITS2 (ITS3.1/ITS4) and taxon-specific primers for Fitzroya cupressoides (Fitzfor, Fitzrev), Sequoia semper- virens (Seqfor, Seqrev), and Thuja plicata (Thujafor, Thujarev), and length of products amplified.

Primer Sequence Length of amplified fragment (bp)

ITS1.1 GAACCTGCGGAAGGATCAT species dependent ITS2.1 GACTCGATGRTTCACGGG ~ 900 bp

ITS3.1 GACTCTCGGCAACGGATATC species dependent ITS4 TCCTCCGCTTATTGATATGC (White et al. 1990) ~400 bp Fitzfor CCCCTTATCCAGGTGAGAC 128 Fitzrev GCACCGTCTTTTTCACCT Seqfor GTTCTGCGTTTGTCGGCTC 353 Seqrev GCAAAACGAGGGGTCCTG Thujafor GGGGGAGTGCTCAGGTTTG 245 Thujarev CAAAGACCACTCCAACCAACAT

PCR amplification, purification, and sequencing of the rDNA-ITS region of F. cupressoides, S. sempervirens, and T. plicata In order to avoid amplification of fungal DNA-contaminations (Zhanget al. 1997), the ITS1 and ITS2 regions were separately amplified. For this, primers (ITS1.1, ITS2.1, ITS3.1, Table 2) were designed using conserved coding regions of the 18S and 5.8S ribosomal genes that flank the ITS1 and ITS2 and show conifer specificity (Kendall & Rygiewicz 2005). Amplification of ITS1 and ITS2 was by the primer combinations ITS1.1/ITS2.1 and ITS3.1/ITS4 (Table 2), respectively. PCR was in a total of 12.5 µl, using the Taq PCR Core Kit (Qiagen) by following the manufacturer’s instructions. Amplifications were carried out in a Tpersonal cycler (Biometra, Göttingen, Germany) with the following conditions: an initial denaturing for 4 min at 94 °C, 35 cycles of 30 sec at 94°C, 30 sec at 60 °C for annealing, 60 sec at 72 °C for elongation, and a final extension for 7 min at 72 °C. Aliquots of 2.5 µl were submitted to gel electrophoresis on 1.5% agarose and PCR products were visualized with ethidium bromide. PCR conditions were checked by using a negative control, lacking template DNA. Purifica- tion of the PCR products was by the use of a QIAquickPCR Purification Kit (Qiagen). Sequencing of both strands of the purified PCR products was done by MWG-Biotech, Ebersberg, Germany (http://www.mwg-biotech.com).

Taxon-specific primer design Based on the primer design, amplification of ITS1 and ITS2 by ITS1.1/ITS2.1 and ITS3.1/ITS4, respectively, revealed products containing partial sequences of 5.8S (about

Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 277 (T.p.). Coding regions (18S, 5.8S, and 26S) Thuja plicata (S.s), and Sequoia sempervirens Sequoia sempervirens (F.c.), Fitzroya cupressoides cupressoides Fitzroya Figure 1. Alignment Alignment of rDNA-ITS sequences of Figure 1. are marked in black, PCR primers in the coding regions (ITS1.1, ITS2.1, ITS3.1, ITS4) are given in dark grey and taxon-specific primers (Fitzfor, Fitzrev, Seqfor, Seqrev, Seqrev, Seqfor, Fitzrev, (Fitzfor, primers taxon-specific and grey dark in given are ITS4) ITS3.1, ITS2.1, (ITS1.1, regions coding the in primers PCR black, in marked are Thujarev) are highlighted in light grey. Thujafor,

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 278 IAWA Journal, Vol. 32 (2), 2011

150 bp in length). Thus the complete rDNA-ITS sequence is assembled by overlapping of the 5.8S partial sequences of ITS1- and ITS2-amplicons. The sequence of the ITS region of F. cupressoides, S. sempervirens and T. plicata and sequence information for these species in the NCBI/EMBL database were aligned using the ClustalW (Thomp- son et al. 1994; www.clustal.org, 26.06.2010) and MEGA4 (Molecular Evolutionary Genetics Analysis, Arizona State University, Tamura et al. 2007; www.megasoftware. net, 26.06.2010) multiple alignment programs. Taxon-specific primers were designed from the sequence differences in ITS1 be- tween F. cupressoides, S. sempervirens, and T. plicata (Fig. 1) and a quality check was performed in the primer-designing software Primer Premier5 (Lalitha 2000; www. premierbiosoft.com/primerdesign/index.html, 10.02.2010). The primer sequences and prospective lengths of the amplicons are shown in Table 2. PCR amplifications with taxon-specific primers were carried out in a Tpersonal cycler (Biometra) with the fol- lowing conditions: an initial denaturing for 4 min at 94 °C, 35 cycles of 30 sec at 94 °C, 30 sec at 53 °C, 55 °C and 56 °C for annealing of F. cupressoides, S. sempervirens, and T. plicata specific primers, respectively, 30 sec at 72 °C for elongation, and a final extension for 7 min at 72 °C. Aliquots of 2.5 µl were submitted to gel electrophoresis on 2.5% agarose and PCR products ranging from 128 to 353 bp were visualized with ethidium bromide.

RESULTS AND DISCUSSION

DNA identification of plant tissues depends on several factors, including the quality and source of the DNA analyzed, the DNA variation within and between species, and the specificity of a given set of molecular tools (e.g. primers) for the target organism. All these factors should be addressed when demonstrating the validity of an identifica- tion technique. The ITS region is a popular nuclear locus for molecular systematic analyses of fungi as well as flowering and non-flowering higher plants (Baldwinet al. 1995; Zhang et al. 1997; Nieto-Feliner & Rosselló 2007). In the last decade, the ITS region has been used with increasing frequency as a diagnostic tool for the identification of organisms.

Extraction of genomic DNA Extraction of genomic DNA from plant tissues and amplification of the rDNA-ITS region by the universal primers ITS1 and ITS4 (White et al. 1990) often results in iso- lation of contaminating fungal rDNA sequences such as from bamboos (Zhang et al. 1997) or wood specimens (data not shown). This problem was overcome by using PCR primers in PCR assays with a high specificity for fungal or plant DNA (Gardes & Bruns 1993; Zhang et al. 1997; Takamatsu & Kano 2001; Kendall & Rygiewicz 2005). In our studies, modified ITS primers (ITS1.1, ITS2.1, ITS3.1) for the 18S and 5.8S se- quences, respectively, were developed. Additionally, these wide-range gymnosperm- specific primers permit the separate amplifications of ITS1 (ITS1.1/ITS2.1; data not shown), and ITS2 (ITS3.1/ITS4; Fig. 2a, e).

Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 279

Figure 2. Taxon-specific priming for the identification of wood ofFitzroya cupressoides, Sequoia sempervirens, and Thuja plicata. – a, e: Determination of DNA-amount and -quality used for PCRs was by amplification of the ITS2 region by the primer combination ITS3.1/ITS4, revealing a 400 bp PCR-product. – b, f: The primer pair Fitzfor/Fitzrev detects a 128 bp fragment exclusively in DNA from F. cupressoides. – c, g: The primer combination Seqfor, Seqrev amplifies a 353 bp fragment only from DNA extracted from S. sempervirens wood. – d, h: The primers Thujafor and Thujarev for PCR yield amplicons of 245 bp for T. plicata and T. occidentalis. – M = 100 bp Marker, 1 Abies alba, 2 A. grandis, 3 Picea abies, 4 Cedrus atlantica, 5 C. libani, 6 C. deodora, 7 Pinus sylvestris, 8 P. strobus, 9 P. taeda, 10 Agathis dammara, 11 Araucaria angustifolia, 12 A. araucana, 13 A. bidwillii, 14 A. cunninghamii,15 A. heterophylla, 16 Podocarpus dacrydioides, 17 P. spicatus, 18 P. nivalis, 19 P. totara, 20 P. nerifolius, 21 P. gracilior, 22 P. macrophyllus, 23 P. macrostachyus, 24 Fitzroya cupressoides, 25 Sequoia sempervirens, 26 Sequoiadendron giganteum, 27 Platycladus orientalis, 28 Thuja plicata, 29 T. occidentalis, 30 Metasequoia glyp- tostroboides, 31 lanceolata, 32 , 33 Juniperus communis, 34 Thujopsis dolobrata, 35 , 36 , 37 , 38 Cryptomeria japonica, 39 , 40 .

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 280 IAWA Journal, Vol. 32 (2), 2011

Table 3. Length (bp) of ITS1, 5.8S and ITS2 in Fitzroya cupressoides, Sequoia semper- virens, and Thuja plicata determined from sequencing data.

ITS1 (bp) 5.8S (bp) ITS2 (bp)

Fitzroya cupressoides 712 162 236 Sequoia sempervirens 701 162 233 Thuja plicata 742 162 234

Size of the ITS regions of F. cupressoides, S. sempervirens, and T. plicata The primer combinations ITS1.1/ITS2.1 and ITS3.1/ITS4 successfully amplified the rDNA regions of F. cupressoides, S. sempervirens and T. plicata. Sequences were obtained for the entire rDNA-ITS region of the 22 samples and have been submitted to GenBank (Table 1). The full lengths of the ITS regions (Table 3) were 1110 bp for F. cupressoides, 1096 bp for S. sempervirens, and 1138 bp for T. plicata, and thus in the range reported for members of the Cupressaceae, including the genera listed formerly as Taxodiaceae (975 bp to 1125 bp; Liston et al. 1996; Stefanovic et al. 1998).

Length variation of ITS regions of F. cupressoides, S. sempervirens, and T. plicata Size variation of ITSs of F. cupressoides, S. sempervirens, and T. plicata is due to variation in length of ITS1. Based on sequence alignments with published sequences of rDNA-ITS from other and angiosperms, lengths of ITS1, 5.8S, and ITS2 were determined. Lengths of ITS1 are 712, 701, and 742 bp for F. cupressoides, S. sem- pervirens, and T. plicata, respectively (Table 3). Sizes of ITS2 are less variable and F. cupressoides, S. sempervirens, and T. plicata have ITS2 regions of 236, 233 and 234 bp, respectively (Table 3). The 5.8S region of all species investigated consists of 162 bp (Table 3). Thus, the reported lengths of ITS1, 5.8S and ITS2 of F. cupressoides, S. sem- pervirens and T. plicata are in accordance with literature data for the Cupressaceae (Liston et al. 1996; Maggini et al. 1998; Cheng et al. 2000; Pye et al. 2003; Little et al. 2004; Li & Xiang 2005; Peng & Wang 2008) as well as with data directly submitted to databases, such as AF387521 (Li & Yang 2001) and AY836777 (Li & Xiang 2004).

Intraspecific variations of the rDNA-ITS region of F. cupressoides, S. sempervirens, and T. plicata Intraspecific variations of the rDNA-ITS region are reported for many organisms such as building-rot fungi (Schmidt & Moreth 2002), plant pathogenic fungi (Ko & Jung 2002), the mycorrhizal fungus Hebeloma veluptis (Aanen et al. 2001), angiosperms (Bailey et al. 2003), and conifers (Karvonen & Savolainen 1993). To consider intraspe- cific variations, rDNA-ITS sequences of three F. cupressoides, nine S. sempervirens, and ten T. plicata specimens were analyzed and aligned with sequences deposited in databases (alignments are not shown). The rDNA-ITS of F. cupressoides reveals one variable position in ITS1. For S. sempervirens and T. plicata 5bp, 2bp, and 11bp of sequence variations were found in the ITS1, 5.8S, and ITS2 regions, respectively. From our data it cannot be determined whether these intraspecific sequence variations

Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 281 of rDNA-ITS region are due to phylogeographical and/or ecogeographical variations or the existence of non-functional rDNA copies (pseudogenes, Bailey et al. 2003). Regardless of the reason for the variation, the variation observed does not interfere with interspecific identifications.

Interspecific variations of the rDNA-ITS region of F. cupressoides, S. sempervirens, and T. plicata, and taxon-specific primers In addition to its use in molecular systematics, the ITS region is also used as a diagnostic tool for the identification of: human pathogens (Hahner et al. 2008), truf- fle species in processed food products (Amicucci et al. 2002), ectomycorrhizal fungi (Kendall & Rygiewicz 2005), and wood decay fungi (Gardes & Bruns 1993; Schmidt & Moreth 2000; Schmidt & Moreth 2002; Prewitt et al. 2008; Horisawa et al. 2009). These findings encouraged us to set up a method for the identification of wood by using taxon-specific primers. The rDNA-ITS regions of F. cupressoides, S. sempervirens, and T. plicata differ in length (Table 3) and, more prominently, show sequence differences in the non-coding ITS1 and ITS2 spacers (Fig. 1). From the sequence differences, especially within the ITS1 region, the taxon-specific primers Fitzfor, Fitzrev, Seqfor, Seqrev, Thujafor and Thujarev were designed to detect only the target organisms. As the primers were based on ITS sequences of two monotypic taxa (F. cupressoides and S. sempervirens), the term taxon-specific instead of species-specific was chosen. Primer specificity is demonstrated by appropriate amplicon length, only when DNA of the target taxon was provided. Figure 2 shows taxon-specificity for the primers across a total of 40 conifers. The quality and quantity of the template-DNA in the PCRs was checked by amplification of the ITS2 region with the primer combination ITS3.1/ITS4 (Table 2). The ITS2 region (including partial sequences of the 5.8S rDNA) of about 400 bp was successfully amplified from all 40 DNA extracts (Fig. 2a, e). Using Fitzfor and Fitzrev as PCR primers, DNA extracted from F. cupressoides wood revealed an amplicon of 128 bp (sample 24, Fig. 2b, f). The primer combination Seqfor and Seqrev detected a 353 bp fragment only when DNA deriving from S. sempervirens wood was added as template (sample 25, Fig. 2c, g). The primer pair Thujafor and Thujarev amplified a 245 bp DNA fragment from the closely related species Thuja plicata and T. occidentalis (samples 28, 29, Fig. 2d, h). Thus the taxon-specificity of the primers used, was proven. It is important to note that within Thuja, there is not species-specificity, but the failure of our Thujafor and Thujarev primers to amplify DNA from Platycladus orientalis agrees with that species being moved out of Thuja. Alignments of ITS1 sequences of fiveThuja species (data not shown) showed up to 97% of sequence homology. In order to design species-specific primers, ITS sequence divergences between allThuja species have to be taken into consideration.

CONCLUSIONS Our data clearly show the use of taxon-specific PCR primers to be a powerful potential tool for wood identification. Our aim, to establish a method which separates the wood

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 282 IAWA Journal, Vol. 32 (2), 2011 of Fitzroya cupressoides, a species fully protected under Appendix I of CITES and thus trade prohibited, and wood of the similar, non-protected species Sequoia semper- virens and Thuja plicata, was achieved. DNA-based identification of wood depends on the quality and quantity of DNA extracted and the specificity of the molecular tools; these conditions were satisfied in the three species studied here. A central limiting fac- tor for DNA-based wood identification is DNA extraction, especially when processed, heat-treated, ancient, or heartwood must be identified. One goal of our ongoing research is to elaborate DNA extraction protocols which yield high-quality DNA in sufficient quantity, independent of the age and condition of the wood.

ACKNOWLEDGEMENTS The authors thank A. Kampe, J. Behrens, A. von der Heiden for technical support and R. Hampp for critical reading of the manuscript. We are grateful to the staff of the Botanical Gardens of Berlin, Darmstadt, Dresden, Erlangen, Frankfurt, Hamburg, Greifswald, Osnabrück, and ETH Zürich, Swit- zerland, the Palmengarten Frankfurt, and the Arboretum of the Federal Research Institute for Rural Areas, Forestry and Fisheries, the Johann Heinrich von Thünen Institute (vTI), Hamburg, for kindly providing plant material. Financial support for this study was provided by a fund from the Bund für Naturschutz (BfN, Germany) and by GFF.

REFERENCES

Aanen, D.K., T.W. Kuyper & R. Hoekstra. 2001. A widely distributed ITS polymorphism within a biological species of the ectomycorrhizal fungus Hebeloma velutipes. Mycol. Res. 105: 284–290. Amicucci, A., C. Guidi, A. Zambonelli, L. Potenza & V. Stocchi. 2002. Molecular approaches for the detection of truffle species in processed food products. J. Sci. Food Agr. 82: 1391– 1397. Bailey, C.D., T.G. Carr, S.A. Harris & C.E. Hughes. 2003. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Mol. Phylogen. Evol. 29: 435–455. Baldwin, G.C., M.J. Sanderson, J.M. Porter, M.F. Wojciechowski, C.S. Campbell & M.J. Donoghue. 1995. The ITS region of nuclear ribosomal DNA: A valuable source of evidence on angiosperm phylogeny. Ann. Missouri Bot. Gard. 82: 247–277. Cheng, Y., R.G. Nicolson, K. Tripp & S.-M. Chaw. 2000. Phylogeny of Taxaceae and Cephalo- taxaceae genera inferred from chloroplast matK gene and nuclear rDNA ITS region. Mol. Phylogen. Evol. 14: 353–365. CITES on the World Wide Web: UNEP-WCMC Species Database: CITES-listed species. www. .org (20.06.2010). Gardes, M. & T.D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes – application to the identification of mycorrhizae and rusts. Mol. Ecol 2: 13–118.1 Gasson, P., R. Miller, D.J. Stekel, F. Whinder & K. Ziemińska. 2010. Wood identification of Dalbergia nigra (CITES Appendix I) using quantitative wood anatomy, principal components analysis and naïve Bayes classification. Ann. Bot. 105: 45–56. Hahner, D., R. Kirschner, M. Piepenbring & H. Schöferin. 2008. First isolation of the anamorphic basidiomycetous yeast Trichosporon faecale in Germany, from the skin of a patient with Tinea pedis. Mycopathologia 165: 149–153. Hilton-Taylor, C., C.M. Pollock, J.S. Chanson, S.H.M. Butchart, T.E.E. Oldfield & V. Katariya. 2008. State of the world’s species. In: J.-C. Vié, C. Hilton-Taylor & S.N. Stuart (eds.), Wildlife in a changing world. IUCN, Gland, Switzerland.

Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 283

Horisawa, S., Y. Sakuma & D. Doi. 2009. Qualitative and quantitative PCR methods using species-specific primer for detection and identification of wood rot fungi. J. Wood Sci. 55: 133–138. Karvonen, P. & O. Savolainen. 1993. Variation and inheritance of ribosomal DNA in Pinus syl- vestris L. (Scots pine). Heredity 71: 614–622. Kendall, J.M. & P.T. Rygiewicz. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC Microbiology 5: 28. doi:10.1186/1471- 2180-5-28. Kite, G.C., P.W.C. Green, N.C. Veitch, M.C. Groves, P.E Gasson & M.S.J. Simmonds. 2010. Dalnigrin, a neoflavonoid marker for the identification of Brazilian rosewood (Dalbergia nigra) in CITES enforcement. Phytochemistry 71: 1122–1131. Ko, K.S. & H.S. Jung. 2002. Three nonorthologous ITS1 types are present in a polypore fungus Trichaptum abietinum. Mol. Phylogen. Evol. 23: 112–122. Lalitha, S. 2000. PrimerPremier 5. Biotech Software & Internet Rep. 1: 270–272. Li, J.H. & Q.P. Xiang. 2005. Phylogeny and biogeography of Thuja L. (Cupressaceae), an eastern Asian and North American disjunct . J. Integr. Plant Biol. 47: 651–659. Liston, A., W.A. Robinson, J.M. Oliphant & E.R. Alvarez-Buylla. 1996. Length variation in the nuclear ribosomal DNA internal transcribed spacer region of non-flowering plants. Systematic Botany 21: 109–120. Little, D.P., A.E. Schwarzbach, R.P. Adams & C.-F. Hsieh. 2004. The circumscription and phylogenetic relationships of Callitropsis and the newly described genus (Cupressaceae). Amer. J. Bot. 91 (11): 1872–1881. Maggini, F., R. Marrocco, M.T. Gelati & R.I. De Dominicis. 1998. Lengths and nucleotide sequences of the internal spacers of nuclear ribosomal DNA in gymnosperms and pterido- phytes. Pl. Syst. Evol. 213: 199–205. Nieto-Feliner, G. & J.A. Rosselló. 2007. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mol. Phylogen. Evol. 44: 911–919. Peng, D. & W.Q. Wang. 2008. Reticulate evolution in Thuja inferred from multiple gene se- quences: implications for the study of biogeographical disjunction between eastern Asia and North America. Mol. Phylogen. Evol. 47: 1190–1202. Prewitt, L.M., S.V. Diehl, T.C. McElroy & W.J. Diehl. 2008. Comparison of general fungal and basidiomycete-specific ITS primers for identification of wood decay fungi. For. Prod. 58 (4): 66–71. Pye, M.G., P.A. Gadek & K.J. Edwards. 2003. Divergence, diversity and species of the Aus- tralasian (Cupressaceae) and allied genera: evidence from ITS sequence data. Aust. Syst. Bot. 16: 505–514. Schmidt, O. & U. Moreth. 2000. Species-specific PCR primers in the rDNA-ITS region as a diagnostic tool for Serpula lacrymans. Mycol. Res. 14: 69–72. Schmidt, O. & U. Moreth. 2002. Data bank of rDNA-ITS sequences from building-rot fungi for their identification. Wood Sci. Technol. 36: 429–433. Stefanovic, S., M. Jager, J. Deutsch, J. Broutin & M. Masselot. 1998. Phylogenetic relationship of conifers inferred from partial 28S rRNA gene sequences. Amer. J. Bot. 85 (5): 688–697. Takamatsu, S. & Y. Kano. 2001. PCR primers useful for nucleotide sequencing of rDNA of the powdery mildew fungi. Mycoscience 42: 135–139. Tamura, K., J. Dudley, M. Nei & S. Kumar. 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evo. 24: 1596–1599. Thompson, J.D., D.G. Higgins & T.J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 11: 4673–4680.

Downloaded from Brill.com10/01/2021 05:16:30AM via free access 284 IAWA Journal, Vol. 32 (2), 2011

White, T.I., T. Bruns, S. Lee & J. Taylor. 1990. Amplification and direct sequencing of fungal ribo-somal RNA genes for phylogenetics. In: M.A. Innis, D.H. Gelfand, J.J. Sninsky & T.J. White (eds.), PCR protocols: A guide to methods and applications. Academic Press, San Diego. Zhang, W., J.F. Wendel & L.G. Clark. 1997. Bamboozled again! Inadvertent isolation of fun- gal rDNA sequences from bamboos (Poaceae: Bambusoideae). Mol. Phylogen. Evol. 8: 205–217.

Downloaded from Brill.com10/01/2021 05:16:30AM via free access