DOCSLIB.ORG

Molecular Identification of Fitzroya Cupressoides, Sequoia Sempervirens, and Thuja Plicata Wood Using Taxon-Specific Rdna-Its Primers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Identification of Fitzroya Cupressoides, Sequoia Sempervirens, and Thuja Plicata Wood Using Taxon-Specific Rdna-Its Primers IAWA Journal, Vol. 32 (2), 2011: 273–284 MOLECULAR IDENTIFICATION OF FITZROYA CUPRESSOIDES, SEQUOIA SEMPERVIRENS, AND THUJA PLICATA WOOD USING TAXON-SPECIFIC RDNA-ITS PRIMERS Felix Hanssen, NikoWischnewski, Ute Moreth and Elisabeth A. Magel* Institute of Wood Biology, Department of Wood Science, University of Hamburg, Leuschnerstr. 91d, D-21031 Hamburg, Germany *Corresponding author [E-mail: [email protected]] SUMMARY The nuclear ribosomal DNA internal transcribed spacer (rDNA-ITS) re- gion was PCR amplified and sequenced from the wood of three specimens of Fitzroya cupressoides, nine specimens of Sequoia sempervirens, and ten specimens of Thuja plicata. The full lengths of the ITS regions are 1110 bp for F. cupressoides, 1096 bp for S. sempervirens, and 1138 bp for T. plicata, and thus in the range of 975 bp to 1125 bp which is reported for members of the Cupressaceae. Length variation of ITS regions is due to differences in the length of the spacer region ITS1. Intraspecific variations of the sequences of rDNA-ITS regions were one bp in F. cupressoides, and 18 bp in S. sempervirens and T. plicata. Based on the interspecific sequence divergence of the ITS region, taxon-specific primers were de- signed for the detection of F. cupressoides, S. sempervirens and T. pli- cata. The primer sequences were selected from the highly divergent ITS1 spacer. The specificity of the primers was checked by lengths and se- quence of the amplicons, and the primers detected the target organism, solely, across 40 conifer species. Our data establish the molecular basis for DNA-based wood identification in these species. Key words: rDNA, ITS, taxon-specific primer, wood identification,Fitz- roya cupressoides, Sequoia sempervirens, Thuja plicata. INTRODUCTION A persistent demand for timber has lead to a substantial decrease of wood resources especially in tropical regions. Of a total of 21,000 wood species worldwide, almost a third have been termed as acutely endangered in 2008 (Hilton-Taylor et al. 2008). A general concern, therefore, is to support sustainable cultivation systems and to main- tain natural diversity. In this context, CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora), an international agreement between governments, tries to ensure this preservation by restraint of trade (CITES 2010). Fitzroya cupressoides and Dalbergia nigra are the only timber species listed in CITES, Appendix I, and thus classified as threatened with extinction or may be affect- ed by trade. While D. nigra has been the topic of a great deal of identification interest (Gasson et al. 2010; Kite et al. 2010), comparatively little research has been done on Downloaded from Brill.com10/01/2021 05:16:30AM via free access 274 IAWA Journal, Vol. 32 (2), 2011 Fitzroya cupressoides. This evergreen conifer is indigenous to the southern parts of the Andes, and its brown to reddish heartwood is highly appreciated for its durabil- ity. Due to a trade prohibition for F. cupressoides, the closely related species Sequoia sempervirens (Californian Redwood), and Thuja plicata (Western Red Cedar) are used as substitutes. The three species are members of the family of the Cupressaceae. While microscopic characters suffice to separate these timbers, they are macroscopically quite similar. The expertise and resources necessary for definitive microscopic identification are not widely available, so alternate means for accurate identification are necessary. Within the last decades, a variety of molecular biological methods have been de- veloped for the identification of organisms, from the generic to the individual level. To make broad use of molecular tools for identification, it is desirable that researchers investigate regions of DNA present in a broad range of organisms. One such region is the ITS (Internal Transcribed Spacer) region. In Eukaryotic organisms, the nuclear ribosomal DNA (rDNA) has two internal transcribed spacers, ITS1 and ITS2. The ITS1 region is located between the small subunit (18S) and the 5.8S rDNA, and the ITS2 region is located between the 5.8S and the large subunit (26S). The two spacers, ITS1 and ITS2 and the included 5.8S subunit constitute the ITS region. It is assumed that rDNA genes (18S, 5.8S, 26S) and ITS1 and ITS2 spacers evolve cohesively within a single species. Thus, sequence divergence between rDNA-ITS copies within individu- als of one species is very low, whereas higher levels of sequence divergence are found between species. The popularity of the rDNA-ITS region for molecular systematic analyses of closely related species can thus be attributed to both rapid evolution of the ITS spacers and PCR-amplification with conserved primers (White et al. 1990). rDNA-ITS is also used as a diagnostic tool in: human pathology (Hahner et al. 2008), food technology (Amicucci et al. 2002), and microbiology (Gardes & Bruns 1993; Schmidt & Moreth 2000; Kendall & Rygiewicz 2005; Horisawa et al. 2009). In the present study, rDNA-ITS sequences of F. cupressoides, S. sempervirens and T. plicata were analyzed. Based on these sequences, taxon-specific ITS primers were developed for wood identification. Validation of the specificity of wood identification was by cross-checking with 37 other softwood species. MATERIALS AND METHODS Materials For determining the species-specific sequence of the rDNA-ITS region, DNA was extracted from air-dried branches of three Fitzroya cupressoides, nine Sequoia sem- pervirens and ten Thuja plicata plants. The specimens were provided by German and Swiss Institutions (Botanical Gardens, Universities, and the Federal Research Institute for Rural Areas, Forestry and Fisheries, vTI). The original provenance is documented at least for one specimen of F. cupressoides (Argentina), for two specimens of S. sem- pervirens (Muir Woods and Humboldt Redwood State Park) and for four specimens of T. plicata (Vancouver, Montana, Canada, and Wenatchee National Forest). Verification of wood identification was by cross-checking with DNA extracted from air-dried sapwood of branches of 37 coniferous species: Abies alba, A. grandis, Picea Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 275 abies, Cedrus atlantica, C. libani, C. deodora, Pinus sylvestris, P. strobus, P. taeda, Agathis dammara, Araucaria angustifolia, A. araucana, A. bidwillii, A. cunninghamii, A. heterophylla, Podocarpus dacrydioides, P. spicatus, P. nivalis, P. totara, P. neriifolius, P. gracilior, P. macrophyllus, P. macrostachyus, Sequoiadendron giganteum, Platycladus (formerly Thuja) orientalis, Thuja occidentalis, Metasequoia glyptostroboides, Cun- ninghamia lanceolata, Cupressus arizonica, C. sempervirens, Juniperus communis, Thujopsis dolabrata, Chamaecyparis lawsoniana, C. pisifera, Taxodium distichum, Calocedrus decurrens, and Cryptomeria japonica. Table 1. Genbank accession numbers for the sequences of the rDNA ITS region, and iden- tification numbers of specimens ofFitzroya cupressoides, Sequoia sempervirens, and Thuja plicata. Scientific name Identification number Genbank accession number Fitzroya cupressoides 88 HQ414213 F. cupressoides 92 HQ414212 F. cupressoides 171 HQ414214 Sequoia sempervirens 90 HQ414195 S. sempervirens 93 HQ414196 S. sempervirens 95 HQ414197 S. sempervirens 97 HQ414198 S. sempervirens 102 HQ414199 S. sempervirens 114 HQ414200 S. sempervirens 115 HQ414201 S. sempervirens 121 HQ414202 S. sempervirens 157K4 HQ414215 Thuja plicata 89 HQ414203 T. plicata 91 HQ414204 T. plicata 96 HQ414205 T. plicata 98 HQ414206 T. plicata 99 HQ414207 T. plicata 113 HQ414208 T. plicata 116 HQ414209 T. plicata 118 HQ414210 T. plicata 120 HQ414211 T. plicata 158K9 HQ414216 Methods DNA extraction After air drying the specimens and removing of the bark, the wood was homogenized to a fine powder. Total genomic DNA was extracted from 50 mg wood powder by use of a DNeasy Plant Mini Kit, Qiagen (Hilden, Germany), by following the manufacturer’s instructions. Downloaded from Brill.com10/01/2021 05:16:30AM via free access 276 IAWA Journal, Vol. 32 (2), 2011 Table 2. Primers used for amplification of ITS1 (ITS1.1/ITS2.1) and ITS2 (ITS3.1/ITS4) and taxon-specific primers for Fitzroya cupressoides (Fitzfor, Fitzrev), Sequoia semper- virens (Seqfor, Seqrev), and Thuja plicata (Thujafor, Thujarev), and length of products amplified. Primer Sequence Length of amplified fragment (bp) ITS1.1 GAACCTGCGGAAGGATCAT species dependent ITS2.1 GACTCGATGRTTCACGGG ~ 900 bp ITS3.1 GACTCTCGGCAACGGATATC species dependent ITS4 TCCTCCGCTTATTGATATGC (White et al. 1990) ~400 bp Fitzfor CCCCTTATCCAGGTGAGAC 128 Fitzrev GCACCGTCTTTTTCACCT Seqfor GTTCTGCGTTTGTCGGCTC 353 Seqrev GCAAAACGAGGGGTCCTG Thujafor GGGGGAGTGCTCAGGTTTG 245 Thujarev CAAAGACCACTCCAACCAACAT PCR amplification, purification, and sequencing of the rDNA-ITS region of F. cupressoides, S. sempervirens, and T. plicata In order to avoid amplification of fungal DNA-contaminations (Zhanget al. 1997), the ITS1 and ITS2 regions were separately amplified. For this, primers (ITS1.1, ITS2.1, ITS3.1, Table 2) were designed using conserved coding regions of the 18S and 5.8S ribosomal genes that flank the ITS1 and ITS2 and show conifer specificity (Kendall & Rygiewicz 2005). Amplification of ITS1 and ITS2 was by the primer combinations ITS1.1/ITS2.1 and ITS3.1/ITS4 (Table 2), respectively. PCR was in a total of 12.5 µl, using the Taq PCR Core Kit (Qiagen) by following the manufacturer’s instructions. Amplifications were carried out
Load more

Recommended publications
  • Thuja Plicata Has Many Traditional Uses, from the Manufacture of Rope to Waterproof Hats, Nappies and Other Kinds of Clothing
    photograph © Daniel Mosquin Culturally modified tree. The bark of Thuja plicata has many traditional uses, from the manufacture of rope to waterproof hats, nappies and other kinds of clothing. Careful, modest, bark stripping has little effect on the health or longevity of trees. (see pages 24 to 35) photograph © Douglas Justice 24 Tree of the Year : Thuja plicata Donn ex D. Don In this year’s Tree of the Year article DOUGLAS JUSTICE writes an account of the western red-cedar or giant arborvitae (tree of life), a species of conifers that, for centuries has been central to the lives of people of the Northwest Coast of America. “In a small clearing in the forest, a young woman is in labour. Two women companions urge her to pull hard on the cedar bark rope tied to a nearby tree. The baby, born onto a newly made cedar bark mat, cries its arrival into the Northwest Coast world. Its cradle of firmly woven cedar root, with a mattress and covering of soft-shredded cedar bark, is ready. The young woman’s husband and his uncle are on the sea in a canoe carved from a single red-cedar log and are using paddles made from knot-free yellow cedar. When they reach the fishing ground that belongs to their family, the men set out a net of cedar bark twine weighted along one edge by stones lashed to it with strong, flexible cedar withes. Cedar wood floats support the net’s upper edge. Wearing a cedar bark hat, cape and skirt to protect her from the rain and INTERNATIONAL DENDROLOGY SOCIETY TREES Opposite, A grove of 80- to 100-year-old Thuja plicata in Queen Elizabeth Park, Vancouver.
    [Show full text]
  • Dying Cedar Hedges —What Is the Cause?
    Points covered in this factsheet Symptoms Planting problems Physiological effects Environmental, Soil and Climate factors Insect, Disease and Vertebrate agents Dying Cedar Hedges —What Is The Cause? Attractive and normally trouble free, cedar trees can be great additions to the landscape. Dieback of cedar hedging in the landscape is a common prob- lem. In most cases, it is not possible to pinpoint one single cause. Death is usually the result of a combination of envi- ronmental stresses, soil factors and problems originating at planting. Disease, insect or animal injury is a less frequent cause. Identifying The Host Certain species of cedar are susceptible to certain problems, so identifying the host plant can help to identify the cause and whether a symptom is an issue of concern or is normal for that plant. The most common columnar hedging cedars are Thuja plicata (Western Red Cedar - native to the West Coast) and Thuja occidentalis (American Arborvitae or Eastern White ICULTURE, PLANT HEALTH UNIT Cedar). Both species are often called arborvitae. Common varieties of Western Red ce- dar are ‘Emerald Giant’, ‘Excelsa’ and Atrovirens’. ‘Smaragd’ and ‘Pyramidalis’ are com- mon varieties of Eastern White cedar hedging. Species of Cupressus (Cypress), Chamaecyparis nootkatensis (Yellow Cedar or False Cypress) and Chamaecyparis law- soniana (Port Orford Cedar or lawsom Cypress) are also used in hedging. Symptoms The pattern of symptom development/distribution can provide a clue to whether the prob- lem is biotic (infectious) or abiotic (non-infectious). Trees often die out in a group, in one section of the hedge, or at random throughout the hedge.
    [Show full text]
  • Thuja Occidentalis) Swamps in Northern New York: Effects and Interactions of Multiple Variables
    SUNY College of Environmental Science and Forestry Digital Commons @ ESF Dissertations and Theses Fall 12-16-2017 Plant Species Richness and Diversity of Northern White-Cedar (Thuja occidentalis) Swamps in Northern New York: Effects and Interactions of Multiple Variables Robert Smith SUNY College of Environmental Science and Forestry, [email protected] Follow this and additional works at: https://digitalcommons.esf.edu/etds Recommended Citation Smith, Robert, "Plant Species Richness and Diversity of Northern White-Cedar (Thuja occidentalis) Swamps in Northern New York: Effects and Interactions of Multiple Variables" (2017). Dissertations and Theses. 7. https://digitalcommons.esf.edu/etds/7 This Open Access Thesis is brought to you for free and open access by Digital Commons @ ESF. It has been accepted for inclusion in Dissertations and Theses by an authorized administrator of Digital Commons @ ESF. For more information, please contact [email protected], [email protected]. PLANT SPECIES RICHNESS AND DIVERSITY OF NORTHERN WHITE-CEDAR (Thuja occidentalis) SWAMPS IN NORTHERN NEW YORK: EFFECTS AND INTERACTIONS OF MULTIPLE VARIABLES by Robert L. Smith II A thesis submitted in partial fulfillment of the requirements for the Master of Science Degree State University of New York College of Environmental Science and Forestry Syracuse, New York November 2017 Department of Environmental and Forest Biology Approved by: Donald J. Leopold, Major Professor René H. Germain, Chair, Examining Committee Donald J. Leopold, Department Chair S. Scott Shannon, Dean, The Graduate School ACKNOWLEDGEMENT I would like to thank my major professor, Dr. Donald J. Leopold, for his great advice during our many meetings and email exchanges. In addition, his visit to my study site and recommended improvements to my thesis were very much appreciated.
    [Show full text]
  • Behavioral Responses of American Black Bears to Reduced Natural Foods: Home Range Size and Seasonal Migrations
    BEHAVIORAL RESPONSES OF AMERICAN BLACK BEARS TO REDUCED NATURAL FOODS: HOME RANGE SIZE AND SEASONAL MIGRATIONS Spencer J. Rettler1, David L. Garshelis, Andrew N. Tri, John Fieberg1, Mark A. Ditmer2 and James Forester1 SUMMARY OF FINDINGS American black bears (Ursus americanus) in the Chippewa National Forest demonstrated appreciable fat reserves and stable reproduction despite a substantial decline in natural food availability over a 30-year period. Here we investigated potential strategies that bears may have employed to adapt to this reduction in food. We hypothesized that bears increased their home range sizes to encompass more food and/or increased the frequency, duration and distance of large seasonal migrations to seek out more abundant food resources. We estimated home range sizes using both Minimum Convex Polygon and Kernel Density Estimate approaches and developed a method to identify seasonal migrations. Male home range sizes in the 2010s were approximately twice the size of those in the 1980s; whereas, female home ranges tripled in size from the 1980s to the 2010s. We found little difference in migration patterns with only slight changes to duration. Our results supported our hypothesis that home range size increased in response to declining foods, which may explain why body condition and reproduction has not changed. However, these increased movements, in conjunction with bears potentially consuming more human-related foods in the fall, may alter harvest vulnerability, and should be considered when managing the bear hunt. INTRODUCTION As a large generalist omnivore, American black bears (Ursus americanus; henceforth black bear or bear) demonstrate exceptional plasticity in response to changes in food availability.
    [Show full text]
  • Biggest Trees of the World Pub 13-2
    Dendrology Series WSFNR13-2 January 2013 Tallest, Biggest, & Oldest Trees by Dr. Kim D. Coder, Professor of Tree Biology & Health Care Warnell School of Forestry & Natural Resources, University of Georgia Trees have a long relationship with people. They are both utility and amenity. Trees can evoke awe, mysticism, and reverence. Trees represent great public and private values. Trees most noticed and celebrated by people and communities are the one-tenth of one-percent of trees which approach the limits of their maximum size, reach, extent, and age. These singular, historical, culturally significant, and massive trees become symbols and icons of life on Earth, and our role in environmental stewardship and sustainability. What Is A Tree? Figure 1 is a conglomeration of definitions and concepts about trees from legal and word defini- tions in North America. For example, 20 percent of all definitions specifically state a tree is a plant. Concentrated in 63% of all descriptors for trees are four terms: plant, woody, single stem, and tall. If broad stem diameter, branching, and perennial growth habit concepts are added, 87% of all the descrip- tors are represented. At its most basic level, defining a tree is not species based, but is a structural definition. A tree is represented by a type of plant architecture recognizable by non-technical people. The most basic con- cepts for defining a tree are -- a large, tall, woody, perennial plant with a single, unbranched, erect, self- supporting stem holding an elevated and distinct crown of branches greater than 10 feet in height and greater than 3 inches in diameter.
    [Show full text]
  • 2014 Display Garden Plant List
    2014 Display Garden Plant List Taxon Common Name Quantity Size Price Acacia cognata 'Mini Cog' Cousin Itt Wattle 11 1g $8.00 Acer japonicum 'Taki-no-gawa' Taki-no-gawa Full Moon Maple 1 15g $200.00 Acer japonicum 'Vitifolium' Grape-leaf Full Moon Maple 2 1.75" cal $200.00 Acer palmatum 'Twombly's Red Sentinel' Twombly’s Red Sentinel Maple 1 2.25" cal $300.00 Asplenium nidus Bird's Nest Fern 5 1g $10.00 Azara microphylla Boxleaf Azara 1 15g $75.00 Azara microphylla Boxleaf Azara 3 5 $40.00 Azara microphylla 'Variegata' Variegated Boxleaf Azara 6 5g $45.00 Brachyglottis greyi Daisy Bush 15 1g $5.00 Chamaecyparis lawsoniana 'Wissel’s Saguaro' Wissel’s Saguaro Cypress 3 5g $60.00 Chamaecyparis obtusa 'Pygmaea Aurescens' Bronze Pygmy Hinoki Cypress 1 15 $60.00 Chamaecyparis pisifera 'Mops' Mops Sawara Cypress 20 2g $14.00 Clematis x cartmanii 'Avalanche' Avalanche Evergreen Clematis 5 5g $25.00 Clematis x cartmanii 'Early Sensation' Early Sensation Evergreen Clematis 10 5g $25.00 Cordyline australis 'Red Star' Red Star Grass Palm 12 1g $7.00 Corydalis 'Berry Exciting' Berry Exciting Corydalis 7 q $5.00 Corylopsis pauciflora Buttercup Winter Hazel 5 2g $26.00 Corylopsis spicata Spike Winter Hazel 4 5g $40.00 Crinodendron hookerianum Chilean Lantern Tree 2 10g $50.00 Cryptomeria japonica 'Black Dragon' Black Dragon Japanese Cedar 1 2g $20.00 Cryptomeria japonica 'Cristata' Cockscomb Japanese Cedar 1 15 $200.00 Daphne odora 'Zuiko Nishiki' Zuiko Nishiki Winter Daphne 7 2 $25.00 hanging Davaillia fejeensis Rabbit’s Foot Fern 3 $25.00 basket Dicksonia
    [Show full text]
  • Downloaded from Brill.Com10/02/2021 07:21:54PM Via Free Access 126 IAWA Journal, Vol
    IAWA Journal, Vol. 28 (2), 2007: 125-137 WOOD ULTRASTRUCTURE OF ANCIENT BURIED LOGS OF FITZROYA CUPRESSOlDES Maria A. Castro1 and Fidel A. Roig2 SUMMARY The anatomy and ultrastructure of subfossil wood of Fitzroya cup res­ soides from the late Pleistocene (>50,000 14C years before present) were compared with those of extant F. cupressoides trees from southern Chile, using light microscopy (polarized light and ftuorescence), scanning elec­ tron microscopy coupled with an energy dispersive X-ray spectroscopy system, and transmission electron microscopy. The ancient wood showed an unchanged gross wood structure, loss of cell wall birefringence, loss of lignin autoftuorescence, and a loss of the original microfibrillar pat­ tern. The energy dispersive X-ray spectroscopy analysis indicated higher than normal contents of S, Cl, and Na in subfossil wood. Ultrastructural modifications in the cell wall of the subfossil wood could have important implications for further studies involving isotopic and wood anatomical measurements of ancient wood. Key words: Fitzroya cupressoides, Pleistocene subfossil wood, cell wall ultrastructure, TEM, SEM-EDXA analysis, wood anatomy. INTRODUCTION The temperate rain forest of South America has a very rich tree species assemblage with a high level of endemism (Arroyo et al. 1993). One of the natural endemies is Fitzroya cupressoides (Molina) I.M.lohnston (alerce, Cupressaceae), a tree species that grows under a relatively low annual mean temperature and high precipitation in areas ofthe southernAndes ofChile and southwesternArgentina. Tree-ring analysis revealed that Fitzroya is a slow-growing tree and is one of the longest-lived tree species in the world, known to reach up to around 3,500 years of age (Lara & Villalba 1993).
    [Show full text]
  • Cupressaceae Calocedrus Decurrens Incense Cedar
    Cupressaceae Calocedrus decurrens incense cedar Sight ID characteristics • scale leaves lustrous, decurrent, much longer than wide • laterals nearly enclosing facials • seed cone with 3 pairs of scale/bract and one central 11 NOTES AND SKETCHES 12 Cupressaceae Chamaecyparis lawsoniana Port Orford cedar Sight ID characteristics • scale leaves with glaucous bloom • tips of laterals on older stems diverging from branch (not always too obvious) • prominent white “x” pattern on underside of branchlets • globose seed cones with 6-8 peltate cone scales – no boss on apophysis 13 NOTES AND SKETCHES 14 Cupressaceae Chamaecyparis thyoides Atlantic white cedar Sight ID characteristics • branchlets slender, irregularly arranged (not in flattened sprays). • scale leaves blue-green with white margins, glandular on back • laterals with pointed, spreading tips, facials closely appressed • bark fibrous, ash-gray • globose seed cones 1/4, 4-5 scales, apophysis armed with central boss, blue/purple and glaucous when young, maturing in fall to red-brown 15 NOTES AND SKETCHES 16 Cupressaceae Callitropsis nootkatensis Alaska yellow cedar Sight ID characteristics • branchlets very droopy • scale leaves more or less glabrous – little glaucescence • globose seed cones with 6-8 peltate cone scales – prominent boss on apophysis • tips of laterals tightly appressed to stem (mostly) – even on older foliage (not always the best character!) 15 NOTES AND SKETCHES 16 Cupressaceae Taxodium distichum bald cypress Sight ID characteristics • buttressed trunks and knees • leaves
    [Show full text]
  • Guideline 410 Prohibited Plant List
    VENTURA COUNTY FIRE PROTECTION DISTRICT FIRE PREVENTION BUREAU 165 DURLEY AVENUE CAMARILLO, CA 93010 www.vcfd.org Office: 805-389-9738 Fax: 805-388-4356 GUIDELINE 410 PROHIBITED PLANT LIST This list was first published by the VCFD in 2014. It has been updated as of April 2019. It is intended to provide a list of plants and trees that are not allowed within a new required defensible space (DS) or fuel modification zone (FMZ). It is highly recommended that these plants and trees be thinned and or removed from existing DS and FMZs. In certain instances, the Fire Department may require the thinning and or removal. This list was prepared by Hunt Research Corporation and Dudek & Associates, and reviewed by Scott Franklin Consulting Co, VCFD has added some plants and has removed plants only listed due to freezing hazard. Please see notes after the list of plants. For questions regarding this list, please contact the Fire Hazard reduction Program (FHRP) Unit at 085-389-9759 or [email protected] Prohibited plant list:Botanical Name Common Name Comment* Trees Abies species Fir F Acacia species (numerous) Acacia F, I Agonis juniperina Juniper Myrtle F Araucaria species (A. heterophylla, A. Araucaria (Norfolk Island Pine, Monkey F araucana, A. bidwillii) Puzzle Tree, Bunya Bunya) Callistemon species (C. citrinus, C. rosea, C. Bottlebrush (Lemon, Rose, Weeping) F viminalis) Calocedrus decurrens Incense Cedar F Casuarina cunninghamiana River She-Oak F Cedrus species (C. atlantica, C. deodara) Cedar (Atlas, Deodar) F Chamaecyparis species (numerous) False Cypress F Cinnamomum camphora Camphor F Cryptomeria japonica Japanese Cryptomeria F Cupressocyparis leylandii Leyland Cypress F Cupressus species (C.
    [Show full text]
  • Morphology and Morphogenesis of the Seed Cones of the Cupressaceae - Part II Cupressoideae
    1 2 Bull. CCP 4 (2): 51-78. (10.2015) A. Jagel & V.M. Dörken Morphology and morphogenesis of the seed cones of the Cupressaceae - part II Cupressoideae Summary The cone morphology of the Cupressoideae genera Calocedrus, Thuja, Thujopsis, Chamaecyparis, Fokienia, Platycladus, Microbiota, Tetraclinis, Cupressus and Juniperus are presented in young stages, at pollination time as well as at maturity. Typical cone diagrams were drawn for each genus. In contrast to the taxodiaceous Cupressaceae, in Cupressoideae outgrowths of the seed-scale do not exist; the seed scale is completely reduced to the ovules, inserted in the axil of the cone scale. The cone scale represents the bract scale and is not a bract- /seed scale complex as is often postulated. Especially within the strongly derived groups of the Cupressoideae an increased number of ovules and the appearance of more than one row of ovules occurs. The ovules in a row develop centripetally. Each row represents one of ascending accessory shoots. Within a cone the ovules develop from proximal to distal. Within the Cupressoideae a distinct tendency can be observed shifting the fertile zone in distal parts of the cone by reducing sterile elements. In some of the most derived taxa the ovules are no longer (only) inserted axillary, but (additionally) terminal at the end of the cone axis or they alternate to the terminal cone scales (Microbiota, Tetraclinis, Juniperus). Such non-axillary ovules could be regarded as derived from axillary ones (Microbiota) or they develop directly from the apical meristem and represent elements of a terminal short-shoot (Tetraclinis, Juniperus).
    [Show full text]
  • Bovedas Encamonadas: Origen, Evolucion, Geometria Y Construccion Entre Los Siglos Xvii Y Xviii En El Virreinato De Peru
    UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TECNICA SUPERIOR DE ARQUITECTURA DEPARTAMENTO DE ESTRUCTURAS DE EDIFICACION PROGRAMA: MECANICA DE LAS ESTRUCTURAS ANTIGUAS Tesis Doctoral: BOVEDAS ENCAMONADAS: ORIGEN, EVOLUCION, GEOMETRIA Y CONSTRUCCION ENTRE LOS SIGLOS XVII Y XVIII EN EL VIRREINATO DE PERU Doctorando: Arq. PEDRO AUGUSTO HURTADO VALDEZ Directores: Dr. Arq. ENRIQUE NUERE MATAUCO Dr. Arq. JOSE LUIS FERNANDEZ CABO MADRID – 2011 Tribunal nombrado por el Mgfco. y Excmo. Sr. Rector de la Universidad Politécnica de Madrid, el día _____ de _______________ de 20_____ . Presidente D. _____________________________________________________ Vocal D. _____________________________________________________ Vocal D. _____________________________________________________ Vocal D. _____________________________________________________ Secretario D. _____________________________________________________ Realizado el acto de defensa y lectura de la Tesis el día _____ de _______________ de 20_____ . En ________________________ . Calificación: _________________________ EL PRESIDENTE LOS VOCALES EL SECRETARIO II RESUMEN Desde la creación del Virreinato del Perú, en el siglo XVI, los arcos, bóvedas y cúpulas se acostumbraban a levantar con piedra y fábrica. Sin embargo estas tierras eran sacudidas periodicamente por terremotos, produciendo el colapso de la mayoría de estas edificaciones. Para el siglo XVII los alarifes ya habían experimentado diversas maneras de levantar bóvedas, sin haberse encontrado una respuesta razonable en términos de tiempo, economía
    [Show full text]
  • Plant Palette - Trees 50’-0”
    50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Zelkova Serrata “Greenvase” Metasequoia glyptostroboides Cladrastis kentukea Chamaecyparis obtusa ‘Gracilis’ Ulmus parvifolia “Emer I” Green Vase Zelkova Dawn Redwood American Yellowwood Slender Hinoki Falsecypress Athena Classic Elm • Vase shape with upright arching branches • Narrow, conical shape • Horizontally layered, spreading form • Narrow conical shape • Broadly rounded, pendulous branches • Green foliage • Medium green, deciduous conifer foliage • Dark green foliage • Evergreen, light green foliage • Medium green, toothed leaves • Orange Fall foliage • Rusty orange Fall foliage • Orange to red Fall foliage • Evergreen, no Fall foliage change • Yellowish fall foliage Plant Palette - Trees 50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Quercus coccinea Acer freemanii Cercidiphyllum japonicum Taxodium distichum Thuja plicata Scarlet Oak Autumn Blaze Maple Katsura Tree Bald Cyprus Western Red Cedar • Pyramidal, horizontal branches • Upright, broad oval shape • Pyramidal shape • Pyramidal shape, develops large flares at base • Pyramidal, buttressed base with lower branches • Long glossy green leaves • Medium green fall foliage • Bluish-green, heart-shaped foliage • Leaves are needle-like, green • Leaves green and scale-like • Scarlet red Fall foliage • Brilliant orange-red, long lasting Fall foliage • Soft apricot Fall foliage • Rich brown Fall foliage • Sharp-pointed cone scales Plant Palette - Trees 50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Thuja plicata “Fastigiata” Sequoia sempervirens Davidia involucrata Hogan
    [Show full text]