IAWA Journal, Vol. 32 (2), 2011: 273–284 MOLECULAR IDENTIFICATION OF FITZROYA CUPRESSOIDES, SEQUOIA SEMPERVIRENS, AND THUJA PLICATA WOOD USING TAXON-SPECIFIC RDNA-ITS PRIMERS Felix Hanssen, NikoWischnewski, Ute Moreth and Elisabeth A. Magel* Institute of Wood Biology, Department of Wood Science, University of Hamburg, Leuschnerstr. 91d, D-21031 Hamburg, Germany *Corresponding author [E-mail: [email protected]] SUMMARY The nuclear ribosomal DNA internal transcribed spacer (rDNA-ITS) re- gion was PCR amplified and sequenced from the wood of three specimens of Fitzroya cupressoides, nine specimens of Sequoia sempervirens, and ten specimens of Thuja plicata. The full lengths of the ITS regions are 1110 bp for F. cupressoides, 1096 bp for S. sempervirens, and 1138 bp for T. plicata, and thus in the range of 975 bp to 1125 bp which is reported for members of the Cupressaceae. Length variation of ITS regions is due to differences in the length of the spacer region ITS1. Intraspecific variations of the sequences of rDNA-ITS regions were one bp in F. cupressoides, and 18 bp in S. sempervirens and T. plicata. Based on the interspecific sequence divergence of the ITS region, taxon-specific primers were de- signed for the detection of F. cupressoides, S. sempervirens and T. pli- cata. The primer sequences were selected from the highly divergent ITS1 spacer. The specificity of the primers was checked by lengths and se- quence of the amplicons, and the primers detected the target organism, solely, across 40 conifer species. Our data establish the molecular basis for DNA-based wood identification in these species. Key words: rDNA, ITS, taxon-specific primer, wood identification,Fitz- roya cupressoides, Sequoia sempervirens, Thuja plicata. INTRODUCTION A persistent demand for timber has lead to a substantial decrease of wood resources especially in tropical regions. Of a total of 21,000 wood species worldwide, almost a third have been termed as acutely endangered in 2008 (Hilton-Taylor et al. 2008). A general concern, therefore, is to support sustainable cultivation systems and to main- tain natural diversity. In this context, CITES (the Convention on International Trade in Endangered Species of Wild Fauna and Flora), an international agreement between governments, tries to ensure this preservation by restraint of trade (CITES 2010). Fitzroya cupressoides and Dalbergia nigra are the only timber species listed in CITES, Appendix I, and thus classified as threatened with extinction or may be affect- ed by trade. While D. nigra has been the topic of a great deal of identification interest (Gasson et al. 2010; Kite et al. 2010), comparatively little research has been done on Downloaded from Brill.com10/01/2021 05:16:30AM via free access 274 IAWA Journal, Vol. 32 (2), 2011 Fitzroya cupressoides. This evergreen conifer is indigenous to the southern parts of the Andes, and its brown to reddish heartwood is highly appreciated for its durabil- ity. Due to a trade prohibition for F. cupressoides, the closely related species Sequoia sempervirens (Californian Redwood), and Thuja plicata (Western Red Cedar) are used as substitutes. The three species are members of the family of the Cupressaceae. While microscopic characters suffice to separate these timbers, they are macroscopically quite similar. The expertise and resources necessary for definitive microscopic identification are not widely available, so alternate means for accurate identification are necessary. Within the last decades, a variety of molecular biological methods have been de- veloped for the identification of organisms, from the generic to the individual level. To make broad use of molecular tools for identification, it is desirable that researchers investigate regions of DNA present in a broad range of organisms. One such region is the ITS (Internal Transcribed Spacer) region. In Eukaryotic organisms, the nuclear ribosomal DNA (rDNA) has two internal transcribed spacers, ITS1 and ITS2. The ITS1 region is located between the small subunit (18S) and the 5.8S rDNA, and the ITS2 region is located between the 5.8S and the large subunit (26S). The two spacers, ITS1 and ITS2 and the included 5.8S subunit constitute the ITS region. It is assumed that rDNA genes (18S, 5.8S, 26S) and ITS1 and ITS2 spacers evolve cohesively within a single species. Thus, sequence divergence between rDNA-ITS copies within individu- als of one species is very low, whereas higher levels of sequence divergence are found between species. The popularity of the rDNA-ITS region for molecular systematic analyses of closely related species can thus be attributed to both rapid evolution of the ITS spacers and PCR-amplification with conserved primers (White et al. 1990). rDNA-ITS is also used as a diagnostic tool in: human pathology (Hahner et al. 2008), food technology (Amicucci et al. 2002), and microbiology (Gardes & Bruns 1993; Schmidt & Moreth 2000; Kendall & Rygiewicz 2005; Horisawa et al. 2009). In the present study, rDNA-ITS sequences of F. cupressoides, S. sempervirens and T. plicata were analyzed. Based on these sequences, taxon-specific ITS primers were developed for wood identification. Validation of the specificity of wood identification was by cross-checking with 37 other softwood species. MATERIALS AND METHODS Materials For determining the species-specific sequence of the rDNA-ITS region, DNA was extracted from air-dried branches of three Fitzroya cupressoides, nine Sequoia sem- pervirens and ten Thuja plicata plants. The specimens were provided by German and Swiss Institutions (Botanical Gardens, Universities, and the Federal Research Institute for Rural Areas, Forestry and Fisheries, vTI). The original provenance is documented at least for one specimen of F. cupressoides (Argentina), for two specimens of S. sem- pervirens (Muir Woods and Humboldt Redwood State Park) and for four specimens of T. plicata (Vancouver, Montana, Canada, and Wenatchee National Forest). Verification of wood identification was by cross-checking with DNA extracted from air-dried sapwood of branches of 37 coniferous species: Abies alba, A. grandis, Picea Downloaded from Brill.com10/01/2021 05:16:30AM via free access Hanssen et al. — DNA identification of Fitzroya, Sequoia, and Thuja 275 abies, Cedrus atlantica, C. libani, C. deodora, Pinus sylvestris, P. strobus, P. taeda, Agathis dammara, Araucaria angustifolia, A. araucana, A. bidwillii, A. cunninghamii, A. heterophylla, Podocarpus dacrydioides, P. spicatus, P. nivalis, P. totara, P. neriifolius, P. gracilior, P. macrophyllus, P. macrostachyus, Sequoiadendron giganteum, Platycladus (formerly Thuja) orientalis, Thuja occidentalis, Metasequoia glyptostroboides, Cun- ninghamia lanceolata, Cupressus arizonica, C. sempervirens, Juniperus communis, Thujopsis dolabrata, Chamaecyparis lawsoniana, C. pisifera, Taxodium distichum, Calocedrus decurrens, and Cryptomeria japonica. Table 1. Genbank accession numbers for the sequences of the rDNA ITS region, and iden- tification numbers of specimens ofFitzroya cupressoides, Sequoia sempervirens, and Thuja plicata. Scientific name Identification number Genbank accession number Fitzroya cupressoides 88 HQ414213 F. cupressoides 92 HQ414212 F. cupressoides 171 HQ414214 Sequoia sempervirens 90 HQ414195 S. sempervirens 93 HQ414196 S. sempervirens 95 HQ414197 S. sempervirens 97 HQ414198 S. sempervirens 102 HQ414199 S. sempervirens 114 HQ414200 S. sempervirens 115 HQ414201 S. sempervirens 121 HQ414202 S. sempervirens 157K4 HQ414215 Thuja plicata 89 HQ414203 T. plicata 91 HQ414204 T. plicata 96 HQ414205 T. plicata 98 HQ414206 T. plicata 99 HQ414207 T. plicata 113 HQ414208 T. plicata 116 HQ414209 T. plicata 118 HQ414210 T. plicata 120 HQ414211 T. plicata 158K9 HQ414216 Methods DNA extraction After air drying the specimens and removing of the bark, the wood was homogenized to a fine powder. Total genomic DNA was extracted from 50 mg wood powder by use of a DNeasy Plant Mini Kit, Qiagen (Hilden, Germany), by following the manufacturer’s instructions. Downloaded from Brill.com10/01/2021 05:16:30AM via free access 276 IAWA Journal, Vol. 32 (2), 2011 Table 2. Primers used for amplification of ITS1 (ITS1.1/ITS2.1) and ITS2 (ITS3.1/ITS4) and taxon-specific primers for Fitzroya cupressoides (Fitzfor, Fitzrev), Sequoia semper- virens (Seqfor, Seqrev), and Thuja plicata (Thujafor, Thujarev), and length of products amplified. Primer Sequence Length of amplified fragment (bp) ITS1.1 GAACCTGCGGAAGGATCAT species dependent ITS2.1 GACTCGATGRTTCACGGG ~ 900 bp ITS3.1 GACTCTCGGCAACGGATATC species dependent ITS4 TCCTCCGCTTATTGATATGC (White et al. 1990) ~400 bp Fitzfor CCCCTTATCCAGGTGAGAC 128 Fitzrev GCACCGTCTTTTTCACCT Seqfor GTTCTGCGTTTGTCGGCTC 353 Seqrev GCAAAACGAGGGGTCCTG Thujafor GGGGGAGTGCTCAGGTTTG 245 Thujarev CAAAGACCACTCCAACCAACAT PCR amplification, purification, and sequencing of the rDNA-ITS region of F. cupressoides, S. sempervirens, and T. plicata In order to avoid amplification of fungal DNA-contaminations (Zhanget al. 1997), the ITS1 and ITS2 regions were separately amplified. For this, primers (ITS1.1, ITS2.1, ITS3.1, Table 2) were designed using conserved coding regions of the 18S and 5.8S ribosomal genes that flank the ITS1 and ITS2 and show conifer specificity (Kendall & Rygiewicz 2005). Amplification of ITS1 and ITS2 was by the primer combinations ITS1.1/ITS2.1 and ITS3.1/ITS4 (Table 2), respectively. PCR was in a total of 12.5 µl, using the Taq PCR Core Kit (Qiagen) by following the manufacturer’s instructions. Amplifications were carried out