sign in sign up
<<
Home , Serotonin transporter

Molecular Psychiatry (2002) 7, 213–216  2002 Nature Publishing Group All rights reserved 1359-4184/02 $25.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Association between a transporter region and mood response during tryptophan depletion FA Moreno1, DC Rowe2, B Kaiser2, D Chase2, T Michaels1, J Gelernter3 and PL Delgado4

1Department of Psychiatry, College of Medicine, The University of Arizona Health Sciences Center, USA; 2Family Studies Department, The University of Arizona College of Agriculture, USA; 3Department of Psychiatry, Yale University School of Medicine, VA Connecticut Health Care Center, USA; 4Department of Psychiatry, Case Western Reserve University School of Medicine, USA

Keywords: vulnerability to depression; neurotransmitter TRP depletion. Although the effect for group was stat- depletion; depression genetics; 5-HT challenge paradigm istically significant, the degree of mood response 15 This study investigated the relationship between within each group was also varied. Smith et al and depressive symptom response during tryptophan (TRP) Moreno et al5 reported that medication-free remitted depletion and a functional polymorphism of the pro- depressed patients also experience transient depressive moter region of the serotonin (5-HT) transporter changes in response to TRP depletion. In these studies, (SLC6A4).1 Forty-three subjects in remission from a the response was also varied with about two thirds of major depressive episode who underwent TRP the subjects accounting for most of the mood changes depletion were genotyped. DNA was extracted from 16 2 observed. Furthermore, Leyton et al, while studying blood lymphocytes or from cheek cells. The two com- a similar population, reported that only a small portion mon are designated long (l) and short (s). Depressive symptoms were measured with the 25-item of their subjects experienced mood response during Hamilton Depression Rating Scale (HDRS).3 There was TRP depletion. An important and unanswered ques- a significant association between the l homozygous tion remains: What determines which subjects will genotype and the depressive response to TRP experience a mood response to TRP depletion and depletion, with a significant main effect of time (F = which ones will not? 8.763, df = 3, 38, P = Ͻ0.001), and time × l homozygous A number of potential explanations have been pro- interaction (F = 3.676, df = 3, 38, P = 0.02). Individ- posed including the possibility that individuals having uals whose genotype predicted increased 5-HT trans- depressive mood responses to TRP depletion are doing porter activity may be more susceptible to depressive so because their 5-HT has depleted more than for changes in response to transient 5-HT perturbations. those with no mood response. A variable that may The use of endophenotypic markers for affective dis- orders such as the mood response to TRP depletion affect the degree of 5-HT availability in the synaptic may facilitate studies of complex genetic traits such as cleft and neurotransmission is the degree of expression depression by decreasing its heterogeneity. of the 5-HT transporter (SERT), which plays a Molecular Psychiatry (2002) 7, 213–216. DOI: 10.1038/ role in uptake of 5-HT into the presynaptic cell by a sj/mp/4000962 -dependent mechanism. In vitro studies have demonstrated that the l allele of the polymorphism tar- Although the TRP-free amino acid drink utilized in this geted in this study is associated with a two to three project rapidly and consistently depletes plasma levels times higher basal transcriptional activity, and higher of this 5-HT precursor,4,5 reduces 5-HT synthesis,6,7 activity in response to cyclic AMP and protein kinase and lowers cerebrospinal fluid levels of the 5-HT C, than the s allele.17 Similarly, Lesch et al1 found metabolite 5HIAA,8,9 the behavioral responses greater levels of SERT m-RNA in ll cells, than ls cells, observed in subjects with similar clinical and treat- or ss, and uptake of labeled 5-HT in ll cells was 1.9– ment history vary dramatically. Delgado et al10 2.2 times the amount in ls or ss cells. These studies reported that individuals recently achieving remission suggest that the s allele has a dominant effect. from major depression during treatment with a sero- Based on this information, we hypothesize that when tonin inhibitor experienced a transient return the rapid uptake of 5-HT in ll subjects is combined of depressive symptoms, but not all subjects experi- with decreased brain 5-HT availability during TRP enced a similarly dramatic response. Others have repli- depletion, a greater decrease in 5-HT neurotransmis- cated these findings, also noticing differing rates of sion might occur, resulting in a greater clinical depress- mood response.11,12 Benkelfat et al13 and Klaassen et ive response to this test. This may explain the study al14 showed that healthy subjects with a family history findings, and further suggests that genetic variability of affective disorders were more likely than healthy may help determine who will experience mood controls to experience mood changes in response to response during TRP depletion. Mood response to TRP depletion and SLC6A4 FA Moreno et al 214 Supporting the notion that behavioral syndromes are influenced by polymorphic SLC6A4 variation, McDou- gle et al18 demonstrated evidence for linkage disequi- librium between the l allele and obsessive compulsive disorder (OCD). Du et al19 reported a significantly higher frequency of the l allele in depressive-suicide victims compared to control subjects. Inconsistent with this finding, Ohara et al20 failed to find any association between alleles of SLC6A4 and mood disorders in Japanese patients, however, there are highly significant differences in SLC6A4 allele frequency between Euro- peans and Japanese populations.21 Mann et al22 described a stronger association between ls and major depression history in a postmortem sample. We hypothesized that SLC6A4 genotype would mod- erate the response to TRP depletion. Subjects took the amino acid drink test in the morning and were rated for depression at baseline, 5, 7, and 26 h after ingestion of the drink. For the group as a whole, TRP depletion induced significant depressive symptoms as demon- strated by the increase (between baseline and peak) in HDRS of 6.58 ± 8.04 (Mean ± SD), with a main effect of time (F = 5.422, df = 3, 39, P = 0.003) in ANOVA with repeated measures for all the time points recorded. Repeated measures ANOVA allowed for a test of interaction of genotype with time for each of the three observed genotypes (ll (n = 13), ls (n = 14), and ss (n = 16)). There was an association between the ll genotype and the depressive response to TRP depletion, with a significant main effect of time (F = 8.763, df = 3, 38, P = Ͻ0.001), and a time × ll genotype interaction (F = 3.676, df = 3, 38, P = 0.02). Mean ± SD Figure 1 Depressive response during tryptophan depletion HDRS score increase for subjects with the ll genotype and its relation to allelic variations of the promotor region of SLC6A4. was 11.0 ± 9.75. Subjects with the ls genotype had no association with the changes in depressive symptoms, = = = ␹2 having a main effect of time (F 4.307, df 3, 38, P significantly from Hardy–Weinberg expectations ( (1) 0.01), and time × ls genotype interaction (F = 0.679, df = 3.2, P = 0.074). = 3, 38, P = 0.570). Mean ± SD HDRS score increase for It is important to consider that several environmental subjects with the ls genotype was 5.5 ± 7.96. Similarly, events may have an effect on the mood response to TRP the ss genotype was not significantly associated with depletion. These include the use of pharmacological the changes in depressive symptoms, having a main agents immediately preceding depletion, the type of effect of time (F = 4.289, df = 3, 38, P = 0.011), and medication utilized, the presence of clinically severe time × ss genotype interaction (F = 1.723, df = 3, 38, P depressive symptoms prior to depletion, the subject’s = 0.179). Mean ± SD HDRS score increase for subjects sex, the season of the year, the phase of menstrual with the ss genotype was 3.35 ± 4.43 (see Figure 1). cycle, and the length of remission while on medication. Because of the ethnic variability for allele fre- Subjects participating in this study represent a highly quencies,21 additional testing was conducted selecting heterogeneous population in terms of their age, sex, only subjects of European descent (n = 37). In this sub- treatment history, severity and longevity of their group, the genotype distribution was ll: n = 11, ls: n = depressive syndrome, etc. Although the frequency dis- 13, ss: n = 13. The depressive response was very similar tribution of SLC6A4 alleles is also influenced by vari- with Mean ± SD HDRS score increase of 10.8 ± 9.88 for ables such as ethnicity,21 the sample size in this study subjects with the ll, 5.92 ± 8.12 for subjects with the does not allow for independent testing of these vari- ls, and 4.3 ± 5.42 for subjects with the ss genotype. ables and represents a limitation to the interpretation There was an association between the ll genotype and of the proposed findings. the depressive response to TRP depletion, with a sig- There have been several clinical observations that nificant main effect of time (F = 6.828, df = 3, 32, P = support the notion that SLC6A4 variability may help Ͻ0.001), and a trend for time × ll genotype interaction to explain depression-related clinical events. Smeraldi (F = 2.644, df = 3, 32, P = 0.066). The genotype fre- et al,23 and Zanardi et al24 reported that individuals quencies in this sub-sample were ll = 0.030, ls = 0.35, with the ll genotype have better and ss = 0.35, yielding allele frequencies of l = 0.475 response to serotonin reuptake inhibitors than those and s = 0.525. The genotype frequencies did not depart with the ss variant. Similarly, Benedetti et al25 reported

Molecular Psychiatry Mood response to TRP depletion and SLC6A4 FA Moreno et al 215 that ll subjects demonstrate a greater antidepressant Arizona Subjects Committee and for which response to total sleep deprivation than subjects with written informed consent had been obtained, agreed to the ls or ss genotype. An important argument against be genotyped. All subjects were outpatients currently the value of ll as a depression marker is the consist- in remission from at least one prior Unipolar MDE ently reported decrease in SERT binding sites in post- according to DSM-III-R based on SCID interviews. mortem of depressed patients.22,26 To further Twelve of them were treatment-free for at least 3 confound this issue, Mann et al22 failed to find a corre- months, 19 were receiving selective serotonin reuptake lation between SLC6A4 variation and SERT binding. inhibitors (SSRIs), three were receiving non-SSRIs, and Although these inconsistencies cannot be explained nine were receiving cognitive behavioral psycho- with the present data, it is possible that SERT therapy treatment. They were free of comorbid AXIS-I expression may be influenced by environmental factors diagnosis or significant medical conditions that would (ie pharmacological agents) or molecular events related compromise their safety during the study. to SERT’s synthesis or feedback regulation among TRP depletion was accomplished by ingestion of a others. 102-g, TRP-free, 15-amino acid drink as described in These and other methodological limitations, such as prior studies.4,5 Behavioral ratings (HDRS and SC) were the lack of a control population or a control test, mean obtained in the morning 15 min prior to 5, 7, and 26 h there is clear need for replication of these findings in after ingestion of the drink. a larger, better characterized sample. However, these DNA was extracted directly from blood lymphocytes findings remain highly suggestive and may contribute or from cheek cells collected in 4% sucrose using a to our understanding of the pathophysiology of modified diatom-binding procedure.2 The target depressive disorders, and the potential identification sequence was in the promoter region of the serotonin of subjects at risk for depressive episodes, or relapse transporter gene.1 PCR amplification of a 484- or 528- after treatment. bp fragment was obtained using oligonucleotide pri- For years, researchers have looked at a variety of dis- mers to the nucleotide positions from −1416 to −1397 tinctive clinical features and laboratory findings that (stpr5, 5Ј GGCGTTGCCGCTCTGAATGC 3Ј) and from have been proposed as potential predictors of MDEs, −910 to −888 (stpr3, 5Ј GAGGGACTGAGCTGGACAAC- but their clinical application has been limited. CAC 3Ј). The ‘long’ allele containing a 44-bp insert was Depressive response to TRP depletion has been designated l. The ‘short’ allele without the insert was recently proposed as a predictor of MDEs,27 and sea- designated s. Amplification of this region was carried sonal affective disorder relapse.28 Depression is a out in a reaction volume of 30 ␮l made up of 30 ng highly heterogeneous condition, with complex biologi- genomic DNA, 0.26 mM dITP/dNTPs, 0.6 ␮M sense cal pathophysiology, influenced by genetic and and antisense primers, 10 mM KCl, 10 mM (NH4)2SO4, environmental factors that may predispose, trigger, and 20 mM TrisFHCl (pH 8.8), 2 mM MgSO4, 0.1% Triton maintain symptoms. Therefore, the predictive value of X-100, and 5 U Taq DNA polymerase. PCR amplifi- SLC6A4 might not be sufficient to be clinically appli- cation was performed in an MJ 100 Research Thermo- cable. cycler located in the laboratory of Molecular and Sys- Genetic markers have the potential to more accu- tematic Evolution of the University of Arizona. After rately identify individuals with biological vulnerability an initial hot start of 95°C for 30 s, the PCR program for a specific phenotype. Despite current advances in was 30 cycles of the following: 95°C for 30 s, 64°C for characterization and nosology, major depression 30 s, and a smaller two-step loop alternating between remains a syndromal construct for which a genetic 62°C for 30 s and 64°C for 30 s, a total of five times. A approach remains very complex and problematic. final extension was 68°C for 3 min. Because of limitations in phenotypic definitions that represent a rate limiting step in the identification of susceptibility , psychiatric geneticists have pro- Acknowledgements posed an evolution from traditional syndromal diag- Supported by The University of Arizona College of nosis to the study of discrete entities such as consistent Medicine Dean’s Physician Scientist Career Develop- clinical or laboratory findings that would be more sup- ment Award to Dr Moreno, and National Institute of portive of an etiological approach to classifications.29,30 Mental Health Grant R01 MH48977 to Dr Delgado. The use of trait markers such as TRP depletion in com- We acknowledge Laurie Deurloo, Candace Fogel, bination with genetic approaches may help identify Charlotte L Powell, and Penny Palmer for their contri- genetic markers by reducing the heterogeneity of the bution to this manuscript. condition, ultimately facilitating our understanding, prediction and treatment of an important subgroup of depressives. References 1 Lesch K, Bengel D, Heils A, Sabol SZ, Greenberg BD, Petri S et al. Association of -related traits with a polymorphism in the Methods gene regulatory region. Science 1996; 274: Forty-three (32 female, 11 male) subjects aged 25–72 1527–1531. ± 2 Gunther S, Herold J, Dieter P. Extraction of high quality DNA from years (45.4 10.88), who participated in a variety of bloodstains using diatoms. Int Legal Med 1995; 108:154–156. TRP depletion studies approved by the University of 3 Mazure CM, Nelson JC, Price LH. Reliability and validity of the

Molecular Psychiatry Mood response to TRP depletion and SLC6A4 FA Moreno et al 216 symptoms of major depressive illness. Arch Gen Psychiatry 1986; 18 McDougle CJ, Epperson CN, Price LH, Gelernter J. Evidence for 43:451–456. linkage disequilibrium between the serotonin transporter protein 4 Young SN, Smith SE, Pihl R, Ervin FR. Tryptophan depletion and obsessive compulsive disorder. Mol Psychiatry 1998; 3: 270– causes a rapid lowering of mood in normal males. Psychopharma- 274. cology 1985; 87: 173–177. 19 Du L, Faludi G, Palkovits M, Demeter E, Bakish D, Lapierre YD et 5 Moreno FA, Gelenberg AJ, Heninger GR, Potter RL, McKnight K, al. Frequency of lond allele in serotonin transporter gene is Allen J et al. Tryptophan depletion and depressive vulnerability. increased in depressed suicide victims. Biol Psychiatry 1999; 46: Biol Psychiatry 1999; 46:498–505. 196–201. 6 Biggio G, Fadda F, Fani P, Tagliamonte A, Gessa GL. Rapid 20 Ohara K, Nagai M, Tsukamoto T, Tani K, Susuki Y, Ohara K. Func- depletion of serum tryptophan, brain tryptophan, serotonin, and 5- tional polymorphism in the serotonin transporter promoter at the hydroxyindoleacetic acid by a tryptophan-free diet. Life Sci 1974; SLC6A4 and mood disorders. Biol Psychiatry 1998; 44: 14: 1321–1329. 550–554. 7 Nishizawa S, Benkelfat C, Young SN, Leyton M, Mzengeza S, de 21 Gelernter J, Kranzler H, Cubells JF. Serotonin transporter protein Montigny C et al. Differences between males and females in rates (SLC6A4) allele and haplotype frequencies and linkage desequilib- of serotonin synthesis in human brain. Proc Natl Acad Sci USA ria in African and European American and in Japanese populations, 1997; 94: 5308–5313. and in alcohol dependent subjects. Hum Genet 1997; 10:243–246. 8 Carpenter LL, Anderson GM, Pelton GH, Gudin JA, Kirwin PD, 22 Mann JJ, Huang Y, Underwood MD, Kassir MS, Oppenheim S, Price LH et al. Tryptophan depletion during continuous CSF sam- Kelly TM et al. A serotonin transporter gene promoter polymor- pling in healthy human subjects. 1998; phism (5-HTTLPR) and prefrontal cortical binding in major 19:26–35. depression and suicide. Arch Gen Psychiatry 2000; 57:729–738. 9 Moreno FA, McGavin C, Malan TP, Gelenberg AJ, Heninger GR, 23 Smeraldi E, Zanardi R, Benedetti F, di Bella D, Perez J, Catalano Mathe´ AA et al. Tryptophan depletion selectively reduces CSF 5- M. Polymorphism within the promoter of the serotonin transporter HT metabolites in healthy young men: results from single lumbar gene and antidepressant efficacy of fluvoxamine. Mol Psychiatry puncture sampling technique. Int J Neuropsychopharm 2000; 3: 1998; 3:508–511. 277–283. 24 Zanardi R, Benedetti F, di Bella D, Catalano M, Smeraldi E. Efficacy 10 Delgado PL, Charney DS, Price LH, Aghajanian GK, Landis H, Hen- of in depression is influenced by a functional polymor- inger GR. Serotonin function and the mechanism of antidepressant phism within the promoter of the serotonin transporter gene. J Clin action: reversal of antidepressant induced remission by rapid Psychopharmacol 2000; 20:105–107. depletion of plasma tryptophan. Arch Gen Psychiatry 1990; 47: 25 Benedetti F, Serreti A, Colombo C, Campori E, Barbini B, di Bella 411–418. D et al.Influence of a functional polymorphism within the pro- 11 Bremner JD, Innis RB, Solomon RM, Stain LH, Nn CK, Miller HL moter of the serotonin transporter gene on the effects of total sleep et al. Positron emission tomography measurement of cerebral meta- bolic correlates of tryptophan depletion-induced depressive deprivation in bipolar depression. Am J Psychiatry 1999; 156: relapse. Arch Gen Psychiatry 1997; 54: 364–374. 1450–1452. 12 Delgado PL, Miller HM, Salomon RM, Licinio J, Krystal JH, Moreno 26 Owens MJ, Nemeroff CB. Role of serotonin in the pathophysiology FM et al. Tryptophan depletion challenge in depressed patients of depression: focus on the serotonin transporter. Clin Chem 1994; treated with or fluoxetine: implications for the role of 40: 288–295. serotonin in the mechanism of antidepressant action. Biol Psy- 27 Moreno FA, Heninger GR, McGahuey CA, Delgado PL. Tryptophan chiatry 1999; 96: 212–220. depletion and risk of depression relapse: a prospective study of 13 Benkelfat C, Seletti E, Mark A, Dean P, Palmour RM, Young SN. TRP depletion as a potential predictor of depressive episodes. Biol Mood-lowering effects of tryptophan depletion: enhanced suscepti- Psychiatry 2000; 48:327–329. bility in young men at genetic risk for major affective disorders. 28 Neumeister A, Habeler A, Praschak-Rieder N, Willeit M, Kasper S. Arch Gen Psychiatry 1994; 51:687–697. Tryptophan depletion: a predictor of future depressive episodes in 14 Klaassen T, Riedel WJ, van Someren A, Deutz NEP, Honig A, van seasonal affective disorder? Int Clin Psychopharmacol 1999; 14: Praag HM. Mood effects of 24-hour tryptophan depletion in healthy 313–315. first degree relatives of patients with affective disorders. Biol Psy- 29 Smoller JW, Tsuang MT. Panic and phobic anxiety: defining pheno- chiatry 1999; 46: 489–497. types for genetic studies. Am J Psychiatry 1999; 155: 1152–1162. 15 Smith KA, Fairburn CG, Cowen PJ. Relapse of depression after 30 Tsuang MT, Stone WS, Faraone SV. Toward reformulating the diag- rapid tryptophan depletion. Lancet 1997; 349:915–919. nosis of . Am J Psychiatry 2000; 157: 1041–1050. 16 Leyton M, Young SN, Blier P, Ellenbogen MA, Palmour RM, Ghadirian AM et al. The effect of tryptophan depletion on mood in medication-free, former patients with major affective disorder. Correspondence: FA Moreno, Dept of Psychiatry, College of Medicine, Neuropsychopharmacology 1997; 16: 292–297. The University of Arizona Health Sciences Center, 1501 N Campbell 17 Heils A, Teufel A, Petri S, Stober G, Riederer P, Bengel D et al. Ave, 7-OPC Tucson, Arizona 85724, USA. E-mail: fmorenoȰu.ari- Allelic variation of human serotonin transporter . zona.edu J Neurochem 1996; 66: 2621–2624. Received 29 December 2000; accepted 15 June 2001

Molecular Psychiatry