Mutations in the carboxyl terminal sec24 binding motif of the serotonin transporter impair folding of the transporter
Submitted by
Thematic program: Molecular Signal Transduction
Supervisor
Professor and Chairman Institute of Pharmacology Center for Physiology and Pharmacology Medical University of Vienna Waehringer Strasse 13a A-1090 Vienna, Austria
Vienna, October, 2010 ACKNOWLEDGMENTS
First of all, I want to express my sincere gratitude to my supervisor, Prof. Dr. Michael Freissmuth for giving me the opportunity to start my doctoral thesis, his great efforts to explain things clearly and simply, and teaching me everything I know about good scientific work. I want to thank all the members of the pharmacology institute, especially, Dr. Edin Ibrisimovic who was a real brother and helpful to me not only in the lab but also during my life in Austria. Also I couldn’t forget my best friends in the lab Dr. Sonja Sucic and Mr. Subhodeep Sarker for the good social atmosphere in the lab, and building up successful, cooperative, and concerted research team. I want to thank my thesis committee members, Prof. Harald H. Sitte (institute of pharmacology, medical university of Vienna) and Prof. Kristina Djinovic (Department of Biomolecular Structural Chemistry, Max F. Perutz Laboratories, University of Vienna) for valuable comments and suggestion of experiments during regular meeting.
I am very grateful to Egyptian Ministry of Higher Education and State for Scientific Research for providing me scholarship and an opportunity to complete my doctoral studies in Austria. I am also gratefully acknowledging the financial support by the Austrian Science Fund (FWF) through the SFB project (SFB3510 to Prof. Dr. Michael Freissmuth).
Last but not the least; I want to thank my family, especially my wife for their continuous support during my studies.
Ali EL-KASABY List of Contents
I ZUSAMMENFASSUNG 1 II SUMMARY 2 1. INTRODUCTION 3 1.1. Neurotransmitters Transporters 3 1.2. Serotonin transporter (SERT) 3 1.2.1. Structure of SERT 4 1.2.2. Physiological role of the SERT 5 1.2.3. Regulation of the SERT 6 1.2.3.1. Regulation of the SERT by protein-protein interaction 7 1.2.3.2. Receptor mediated regulation of SERT 10 1.2.4. Pharmacology of SERT 11 1.3. Protein quality control 12 1.3.1. Protein folding (proximal quality control) 14 1.3.1.1. Calnexin cycle 14 1.3.1.2. Chemical and pharmacological rescue of misfolded 17 proteins 1.3.2. ER-export (secondary quality control) 20 1.3.2.1. ER-export COPII-machinery 20 1.3.2.1.1. Cargo recognition by COPII 21 1.3.2.1.2. COPII assembly and budding 22 1.4. Aim of the thesis 23 2. EXPERIMENTAL PROCEDURES 24 2.1. Materials 24 2.1.1. Reagents 24 2.2.2. Kits 24 2.2.3. Media and buffers 25 2.2.4. cDNA constructs 24
i 2.2. Methods 29 2.2.1. DNA constructs and cloning 29 2.2.2. Cell culture and transfections 29 2.2.3. Fluorescence microscopy 30 2.2.4. Uptake assays 30 2.2.5. Binding assays 28 2.2.6. pWaldo expression 31 2.2.7. Co-immunoprecipitation 33 2.2.8. Protein deglycosylation 34 3. RESULTS 35 3.1. Carboxyl terminus truncations cause ER retention of the apparently 35 incorrectly folded SERT versions 3.2. Scanning the C-terminus of SERTs for motifs that are required for expression 39 of functional transporter 3.3. ER-trapped SERT still binds [3H] imipramine 43 3.4. Bacterial expression of SERT with a C-terminally fused GFP tag 45 3.5. Recovery of SERT-PG601,602AA, SERT-RI607,608AA and of SERT-RII607- 46 609AAA in complex with calnexin 3.6. Rescue of SERT-RI607,608AA and SERT-RII607-609AAA but not of SERT- 48 PG601,602AA, by chemical and pharmacological chaperones 4. DISCUSSION 51 5. REFERANCES 54 6. COPY RIGHT LICENSE AGREEMENT 68 7. CURRICULUM VITAE 74
ii List of Figures
No Content page 1 The predicted topology of mammalian serotonin transporters 4 2 Possible mechanism of serotonin transport 6 3 Schematic illustration of SERT regulation 7 4 Folding of the protein the ER 14 5 The calnexin/calreticulin cycle 16 6 Comparison of and pharmacological and chemical chaperone modes of action 19 7 Schematic diagram of COPII vesicle 21 8 Cloning strategies of SERT in pWado-system bacterial expression 32 9 Subcellular localization of C-terminally truncated versions of SERT 37 10 Truncation of the C-terminus by more than 16 amino acids abrogates transport 38 of 5-HT and binding of the inhibitor [3H] -CIT by SERT 11 Scanning the region between P601 and P614 to identify sites required for export 41 to the cell surface 12 Mutations of SERT in the position PG601,602, RI607,608 and RII607-609 blunt 5-HT 42 uptake and binding of [3H]imipramine 13 Trapping the wild type SERT in endoplasmic reticulum abolishes uptake but 44 does not affect binding of [3H] imipramine 14 Expression of SERT as constructs that were fused on their C-terminus to GFP 45 (pWaldo-system) 15 Complex formation of SERT-PG601,602AA, SERT-RI607,608AA and SERT- 47 RII607-609AAA with calnexin 16 Rescue of SERT mutant by different chemical and pharmacological 49 chaperones 17 Ibogaine-induced change in [3H]imipramine binding by, substrate uptake by 50 and calnexin association with SERT-RII607-609AAA
iii List of Tables
No Content page 1 Primers sequences 27 2 Sequence alignment of the C-terminal region of selected SLC6-family 36 transporters 3 Affinity estimates for substrate uptake by and inhibitor binding to wild type 36 and C-terminally mutated versions of SERT
iv Abbreviations
Bmax Maximal binding GTP Guanosine-5'-triphosphate BSA Bovine serum albumin Hic-5 Hydrogen peroxide-inducible clone-5 Caco-2 Human epithelial colorectal 5-HT 5-hydroxy tryptamine (serotonin) adenocarcinoma cells IP Immunopreciptation
-CIT 2- -carbomethoxy-3- - KD Dissociation constant at equilibrium (4-iodophenyl) –tropane CN-IMI Cyanoimipramine kDa Kilo Dalton
CNX Calnexin Km Michaelis’ constant COPI Coat protein complex I LB Luria-Bertani broth COPII Coat protein complex II MacMARCKS Myristoylated alanine-rich C kinase CRT Calreticulin substrate (MARCKS)-related protein C-terminus Carboxyl terminus MDCK cells Madin-Darby Canine Kidney cells DAT Dopamine transporter NET Norepinephrine transporter DMEM Dulbecco's Modified Eagle Medium nNos Neural Nitric oxide synthase DMSO Dimethyl sulfoxide N-terminus Amine-terminus cDNA Complementary DNA PAGE Polyacrylamide gel electrophoresis ER Endoplasmic reticulum PBS Phosphate buffered saline ERAD Endoplasmic Reticulum Associated PDL Poly-D-lysine Protein Degradation. PKC Protein kinase C ERGIC Endoplasmic Reticulum-Golgi pmol Picomole =10 12 moles. Intermediate Compartment PP2A Protein phosphatase 2 ERp57 Endoplasmic reticulum resident Sar1 Secretion-associated RAS-related protein 57 protein 1 FACS Flow cytometry SDS Sodium dodecyl sulfate. fmol Femtomole = 10 15 moles. SERT Serotonin transporter GAT -aminobutyric acid SLC Solute carrier family GFP Green fluorescent protein Syn1A Syntaxin 1A GLYT Glycine transporter TBS Tris buffered saline
GPCRs G protein-coupled receptors max Maximal uptake rate GPI Glycosylphosphatidylinositol
v Amino acid abbreviation:
Alanine A Glycine G Proline P Arginine R Histidine H Serine S Asparagine N Isoleucine I Threonine T Aspartic acid D Leucine L Tryptophan W Cysteine C Lysine K Tyrosine Y Glutamic acid E Methionine M Valine V Glutamine Q Phenylalanine F
vi I. ZUSAMMENFASSUNG
Der Serotonin-Transporter (SERT) ist ein Mitglied der Familie der solute SLC6 Transporter. Dei Dauer der synaptischen Neurotransmission wird auch durch SERT bestimmt, weil der Transporter freigesetztes Serotonin in das präsynaptische Terminal aufnimmt. Um diese Funktion wahrzunehmen, muss SERT aus dem endoplasmatischen Retikulum (ER, dem Ort seiner Synthese) an die präsynaptische Membran gelangen und dabei durch verschiedene Kompartimente gelangen. Beim Verlassen des ER der intrazellulär gelegene Carboxy-Terminus von SERT eine wichtige Rolle. Hier untersuchte ich die Bedeutung des C-Terminus von SERT für seine Faltung. Serielle Verkürzungen des C-Terminus und gerichtete Mutagenese identifizierten Sequenzspots (PG601, 602, RII607-609) innerhalb der C-Terminus, die für Faltung und/oder Export von SERT aus dem endoplasmatischen Retikulum (ER) entscheidend sind. RI607, 608 ist homolog zu der RL- Motiv, das in anderen Familienmitgliedern SLC6 als Andockstelle für die COPII Komponente Sec24D dient. Die an den Positionen PG601, 602 und RI607, 608 mutierten Transporter konnten den Inhibitor [3H]Imipramin nicht binden; im Gegensatz dazu bindet der Wildtyp-Transporter, der im ER (z. B. durch dominant negatives SAR1a) retiniert wird, [3H]Imipramin mit einer Affinität, die derjenigen an der Zelloberfäche residierenden Transporter vergleichbar ist. Diese Beobachtung weist darauf hin, dass der primäre Defekt eine Beeinträchtigung der Faltung der mutierten Transporter ist. Die Expression von funktionell aktivem SERT-RI607,608AA und SERT-RII607-609AAA wurde teilweise durch Behandlung der Zellen mit dem unspezifischen chemischen Chaperon DMSO (Dimethylsulfoxid) oder durch Ibogain - aber nicht von anderen Klassen von Liganden (Inhibitoren, Substrate, Amphetamine) - wieder hergestellt. Ibogain bindet an die einwärts gerichtete Konformation des SERT. Diese Beobachtungen (i) zeigen eine bisher nicht bekannte Rolle des C-Terminus in der Faltung von SERT, (ii) weisen darauf hin, dass die Faltung von SERT über die nach innen weisende Konformation und (iii) sind mit einem Modell kompatibel, wo die RI-Motiv spielt eine entscheidende Rolle bei der Verhinderung vorzeitiger Sec24-Einstellungs-und Ausfuhr von falsch gefaltete Transporter.
1 II. SUMMARY
The serotonin transporter (SERT) is a member of the SLC6 family of solute carriers. SERT plays a crucial role in synaptic neurotransmission by retrieving released serotonin. The intracellular carboxyl terminus of various neurotransmitter transporters has been shown to be important for the correct delivery of SLC6 family members to the cell surface. Here we studied the importance of the C-terminus in trafficking and folding of human SERT. Serial truncations followed by mutagenesis identified sequence spots (PG601,602, RII 607-609) within the C-terminus relevant for export of SERT from the endoplasmic reticulum (ER). RI607, 608 is homologous to the RL-motif that in other SLC6 family members provides a docking site for the COPII component Sec24D. The primary defect resulting from mutation at PG601, 602 and RI607, 608 was impaired folding, because mutated transporters failed to bind the inhibitor [3H]imipramine. In contrast, when retained in the ER (e.g., by dominant negative Sar1) the wild type transporter bound [3H]imipramine with an affinity comparable to that of the surface expressed transporter. SERT-RI607, 608AA and SERT-RII607-609AAA were partially rescued by treatment of cells with the nonspecific chemical chaperone DMSO or the specific pharmacochaperone ibogaine (which binds to the inward facing conformation of SERT) but not by other classes of ligands (inhibitors, substrates, amphetamines). These observations (i) demonstrate a hitherto unappreciated role of the C-terminus in the folding of SERT, (ii) indicates that the folding trajectory proceeds via an inward facing intermediate and (iii) suggest a model where the RI-motif plays a crucial role in preventing premature Sec24-recruitment and export of incorrectly folded transporters.
2 1. INTRODUCTION
1.1.Neurotransmitters Transporters
Neurotransmitters are responsible for terminating signal transmission between neurons and between neurons and effector cells; in addition, rapid repetitive use of the synapse is contingent on the action of neurotransmitter because the retrieval of the neurotransmitter allows for continuous refilling of synaptic vesicles (Nelson, 1998). These neurotransmitter transporters can be classified according their site of action (Masson et al., 1999) into two superfamilies: (i) the plasma membrane transporters which are further subdivided into the Na+/Cl--dependent SLC6 gene family (including DAT, SERT, NET, GAT1-4, GLYT1& GLYT2) which also called neurotransmitter-sodium symporter (Busch and Saier, 2002), and Na+/H+-dependent SLC1 gene family (glutamate transporters) and (ii) the vesicular intracellular transporters (ion dependence; H+), which are subdivided into three subclasses of intracellular transporter: the vesicular amine transporters [the solute carrier (SLC18) gene family], the vesicular inhibitory amino acid transporter family (SLC32) and the vesicular glutamate transporters (SLC17 gene family). In my thesis, I focused on the SLC6 family member hSERT (the human serotonin transporter), specially the role of carboxyl terminus in folding and trafficking of the serotonin transporter.
1.2. Serotonin transporter (SERT)
The serotonin transporter (SERT, human SERT = hSERT) is the plasma membrane Na+/Cl- dependent transporter which is responsible for the uptake of serotonin from the synaptic cleft (Rudnick, 2006).
3 1.2.1. Structure of SERT
As mentioned above the human serotonin transporter (hSERT) belongs to the SLC6 (solute carrier 6). All members of this family have 12 transmembrane spanning segments (TM). Crystallization of a bacterial homolog (LeutAa (Singh, 2008)) revealed the general topology of the transporters: the transmembrane domains form two bundles composed of 5 transmembrane (TM) helices each: TM 1-5 & TM 6-10 which display an internal pseudosymmetry. The internal pseudosymmetry accounts for the formation of an outer and an inner vestibule and thus provides a structural correlate for the alternate access model (see below, Fig.2). The helices TM11 & TM12 form a dimerization interface in the crystallographic dimer of LeuT. In SERT, a dimerization interface has also been identified that comprises TM11 & TM12 (Just et al., 2004): dimerization is thought to be a prerequisite for trafficking of transporters from the ER to the cell surface (Moss et al., 2009; Scholze et al., 2002). hSERT consists of 630 amino acids with a large extracellular loop between TMs 3 and 4 which have two sites of glycosylation. Both the N- terminus and C-terminus (last 35 amino acid) are located within the cytoplasm (Fig.1.).
Extracellular
Intracellular
Fig.1. The predicted topology of mammalian serotonin transporters.
There are obvious differences between the C-terminus of SERT and those of its closest relatives, the monoamine transporters NET and DAT: mutating the C-terminal amino acids of NET (Bauman and Blakely, 2002) and DAT (Torres et al., 2001) results in their
4 intracellular retention. In contrast, SERT tolerates the addition of large tags to both its N- and C-terminus (Just et al., 2004). The C-terminus of SERT is shorter and its last 22 amino acids diverge from NET and DAT: a conserved aspartate residue - 8 amino acids downstream from the RL-motif required for Sec24D-binding- has, for instance, been identified as an additional contact site with Sec24D for GLYT1 (Fernandez-Sanchez et al., 2008) . This aspartate is present in all mammalian SLC6 family members except for SERT and the taurine transporter (where it is replaced by proline, a non-conservative substitution). The molecular weights of endogenous hSERT from brain is 67 kDa (Rotondo et al., 1996), 68-70 kDa from platelets (Faivre et al., 2001; Launay et al., 1992; Pizzinat et al., 1999), 70 kDa from Caco-2 cells (Iceta et al., 2006), and 100kDa from lymphocytes (Barkan et al., 2004). The molecular weights of hSERT after cDNA transfections were 70 kDa from human dorsal raphe nucleus (Lesch et al., 1993),85 kDa from fibroblast (Wersinger et al., 2006) and ,96 kDa from HEK293 (Ramamoorthy et al., 1998).
1.2.2. Physiological role of the SERT
SERT terminates signal transmission of serotonin by rapid uptake of the previously released neurotransmitter. Thereby, SERT modulates the concentration of 5-HT in the synaptic cleft and minimizes the duration of serotonin - serotonin receptor interaction: Thus the action of SERT determines the shape and the duration of the signal. In addition, rapid clearance of released SERT is important to prevent desensitization of the 5- HT receptor. The candidate mechanism of substrate translocation (Rudnick, 2006) is based on the well-known alternate access model (Tanford, 1983): it assumes that the SERT alternates between its outward and inward facing conformations. The outward-facing conformation exposes the substrate binding site to the external milieu; the inward-facing conformation renders the substrate binding site accessible from the intracellular side. SERT undergo a series of conformational changes start after the binding of 5-HT together with Na+ and Cl ions that expose the binding site to the cytoplasm. After dissociation of 5-HT, Na+ and Cl on the cytoplasmic side of the plasma membrane, a cytoplasmic K+ ion is able to bind. Then SERT undergoes another series of conformational changes that expose the
5 binding site to the extracellular medium. Dissociation of K+ to the medium completes the cycle (Fig. 2.).
Fig. 2. Possible mechanism of serotonin transport (Rudnick, 2006). The description of the transport cycle is given in the text.
1.2.3. Regulation of the SERT
Following transcription, transporters are translated and delivered to their specific membrane sites of expression in cells. At the level of the cell surface, the retention and functional expression of transporter proteins are regulated by multiple signaling pathways, in witch different interacting proteins and receptors are involved. Depending on the signals, the transporter may be recycled or enter into lysosomal degradative pathways (Fig. 3.).
6 Plasma Membrane
Endosomal
Fig. 3. Schematic illustration of SERT regulation (Steiner et al., 2008). For additional details see text.
1.2.3.1. Regulation of SERT by protein-protein interaction
Many protein have been identified that bind either to the C-terminus (nNOS, MacMARCKS and Hic-5) or the N-terminus (Syntaxin 1A, SCAMP2 and PP2A) of SERT. They are thought to participate in the regulation of SERT and the pertinent insights can be summarized as follows:
There are three nitric oxide synthases, which are termed endothelial, inducible and neuronal NO-synthases (eNOS, INOS, nNOS); the eponymous designation highlights their principal physiological action: NO produced by these enzymes serves as a diffusible signal that has prominent actions on the vascular tone (eNOS mediates vasodilation via cGMP- dependent signaling mechanisms in smooth muscle cells), immune cells (iNOS is induced to very high levels in activated macrophages) and neurons (nNOS plays a prominent role for instance in memory formation). Coexpression of nNOS inhibits 5-HT uptake, decreases [3H]citalopram binding and decreases plasma membrane SERT density in HEK293 cells.
7 The reduction of the density of plasma membrane SERT in cells coexpressing nNOS did not result from an increase in its internalization rate, but rather from an inhibition of its export to the plasma membrane. The inhibition of export may be due to competition between nNOS with Sec23–Sec24 for binding to the SERT carboxyl terminus (Chanrion et al., 2007). The down regulation effect of the nNOS on the SERT associated with regulation of 5-HT level, this could be explained the aggressive behavior in nNOS knockout mice (Trainor et al., 2007) and mice treated with NOS inhibitors (Demas et al., 1997); a polymorphism in human nNOS (= gene) may also account for behavioral traits in people (Reif et al., 2009).
MacMARCKS may also play role in the regulation of SERT. Reduction in SERT activity (30% decreases in Vmax) was observed when MacMARCKS was co-expressed with SERT in HEK293 cells; this was thought to refelect internalization of the SERT. Confocal analysis of HEK-293 cells coexpressing SERT and MacMARCKS showed colocalization of both proteins at the plasma membrane; MacMARCKS was enriched in areas of high SERT immunoreactivity (Jess et al., 2002). MacMARCKS was also found to be endogenously expressed in MDCK cells (Myat et al., 1998) which express SERT (Gu et al., 1996). Synaptosomes contain SERT protein (Bruns and Jahn, 1995) and MacMARCKS has been detected in synaptic vesicle fractions isolated from rat brain synaptosomes (Chang et al., 1996).
Hic-5 interacts with the C termini of different monoamine transporters including DAT, NET and SERT (Carneiro et al., 2002). The association between the Hic-5 and SERT leads to inactivation of the transporter via endocystosis. This association is significantly increased with incubation with citalopram (Carneiro and Blakely, 2006), which induces internalization of the SERT (Lau et al., 2008).
Syntaxin-1A is one of the SNARE system, which regulates the intracellular trafficking of neurotransmitters. The role of syntaxin-1A in regulation of neurotransmitters has been investigated for DAT(Cervinski et al., 2010; Lee et al., 2004), GAT-1(Quick et al., 2004; Wang et al., 2003), GlyT (Geerlings et al., 2000) and NET (Sung et al., 2003).
8 Reduction in 5-HT uptake was observed after transfection of a plasmid driving the expression of syntaxin-1A into HEK-293 cells that stably expressed rat SERT (Haase et al., 2001). The association with syntaxin 1A also regulates transporter-associated currents: the scheme in Fig. 2 predicts an electroneutral transport cycle. In fact, however, superfusion of cells that heterologously express SERT (or any other neurotransmitter transporter of the SLC6 family) results in inward currents (Mager et al., 1994). This indicates an influx of positive charge that is excess of substrate. These 5-HT-induced inward currents were suppressed in oocytes coexpressing SERT and syntaxin-1A (Quick, 2003) suggesting that the excess current was blocked by the association with syntaxin-1A. The effect is apparently specific because it can be relieved by botulinum C1 toxin. This toxin is an endoprotease that specifically cleaves and functionally inactivates syntaxin-1A (Blasi et al., 1993). If the oocytes were treated with botulinum toxin C1, oocytes that had not shown inward currents at -80 mV exhibited inward currents in response to 5-HT. Botulinum toxin had no significant effect on WT oocytes, suggesting that the toxin was exerting its effects through cleavage of syntaxin 1A.
SCAMP2 (Secretory carrier-associated membrane protein 2) is one of the members of SCAMP family which act as proteins carriers to the plasma membrane in post- Golgi recycling. SCAMP2 found in both granules and plasma membrane, and its E peptide has inhibitory effects on late steps of exocytosis in mast cell (Guo et al., 2002), and PC12 Cells (Liu et al., 2002). Physical interaction between SCAMP2 and the N-terminal domain of SERT and DAT was confirmed (Muller et al., 2006). Coexpression of SCAMP2 with SERT reduced cell surface expression by 80%, however the total levels of transporter molecules remained unchanged. The SCAMP2 was co-localized with SERT that was heterologously expressed in HEK293 cells. This colocalization was also visualized in cells that endogenously express SERT; namley the serotoninergic rat raphe cell line RN46A- B14.
Phosphorylation is though to play a prominent role in the regulation of SERT. It has been appreciated for more then 10 years that protein kinase C (PKC) activation mediates down-regulation in SERT through decreased surface density of SERT and this is
9 accomplished by endocytosis (Jayanthi et al., 2005; Qian et al., 1997). It was therefore likely that a phosphatase must also be involved in the regulation of SERT to reverse the action of PKC. The serine/threonine protein phosphatase PP2A, was found to be enriched in SERT immunoprecipitates from HEK293 cells that heterologously expressed hSERT. This was also recapitulated by immunoprecipitation of SERT form mouse midbrain and from cerebral synaptosomes. This suggests that SERT is subject to continuous phosphorylation and dephosphorylation not in only in transfected cells but also . The SERT/PP2Ac associations were diminished after application of the PP2A inhibitor okadaic acid (Bauman et al., 2000). Treatment of HEK293 cells expressing hSERT cells with okadaic acid or calyculin A (PP1/PP2A inhibitors) results in reduction in 5-HT transport activity and accumulation of SERT in a phosphorylated state. Incubation okadaic acid together with -PMA (PKC activator) had an additive effect on phosphorylation (Ramamoorthy et al., 1998). Anisomycin (a p38 MAPK activator) increased 5-HT uptake. The effect of p38 MAPK on SERT arises through an enhanced affinity for substrate: maximum transport rate did not change. Accordingly, anisomycin also did not affect the level of SERT at the cell surface and this effect required PP2A. This observation is also consistent with the finding that PP2A regulated SERT catalytic activity rather than its rate of membrane insertion (Zhu et al., 2005). PKC inhibitors (Staurosporine) did not have any effect on the increased phosphorylation state of SERT seen in the presence of okadaic acid. This suggests that the PKC activator ( -PMA) and okadaic acid-induced hSERT phosphorylation act through different mechanisms (Ramamoorthy et al., 1998). Thus, based on these observations, it is safe to conclude that there must be several kinases and phosphatases that act on SERT.
1.2.3.2. Receptor-mediated regulation of SERT
The serotonin transporter is regulated by different receptors which either stimulate or inhibit SERT activity. Stimulation of the A3 adenosine receptor (A3AR) was associated with increased SERT surface expression in rat basophilic leukemia 2H3 cell line (Zhu et al., 2004) and in mouse midbrain, hippocampal, and cortical synaptosomes (Zhu et al., 2007).
10 Similarly, stimulation of nicotinic acetylcholine receptors (nAChRs) enhanced SERT activity (Awtry et al., 2006) through increase SERT surface expression (Muneoka et al., 2001). This observation predicted that nAChRs could be targeted for antidepressant therapy; it is for instance conceivable that an appropriate nicotinic ligand may be used in conjunction with established antidepressant drugs to augment the action of the latter and/or to reduce their side effects due to a dose-sparing action. In fact, the antidepressant effect of citalopram was enhanced in combination with nicotine: the same low dose of citalopram did not affect the time of immobility in the forced swim test (Andreasen and Redrobe, 2009).
Activation of the serotonin receptor 1A (5-HT1A) by appropriate agonists inhibits
SERT: the 5-HT1A agonist induced signs of a serotonin syndrome in mice and this effect decreased by antagonist (Fox et al., 2007). Similarly, 5-HT1A receptor antagonist inhibited the clearance of the 5-HT from rat CA3 region of the hippocampus (Daws et al., 1999).
These findings may explain why 5-HT1A agonists elicit antidepressant effects in patients (Benvenga and Leander, 1993; Maurel et al., 2007; Wieland and Lucki, 1990). Serotonin receptor 2B (5-HT2B) receptor stimulation resulted in decrease the SERT Vmax and this may be linked to a receptor-induced change in phosphorylation of the transporter (which promotes internalization, see above) and of the Na+/K+-ATPase by protein kinase C (which affects the driving force) (Launay et al., 2006). This could explain higher serotonin plasma level in 5-HT2BR knockout mice, which further increase upon paroxetine treatment (Callebert et al., 2006). Other members of the serotonin receptors may also have role in the regulation of SERT, but it is not clear how they perform their action on SERT. Superfused rat ventral lateral geniculate nucleus slices with 5-HT1B and 5-HT1D antagonist potentiated the effect of paroxetine on serotonin efflux (Davidson and Stamford, 1997).
1.2.4. Pharmacology of SERT
The serotonin transporter is the principal pharmacological target for most of the antidepressant drugs currently in use. Antidepressant drugs work through different mechanisms to increase the synaptic level of serotonin or noradrenaline. The different types
11 of antidepressants can be classified as (i) tricyclic antidepressants and related compounds (amitriptyline, clomipramine, doxepin, imipramine, desipramine, nortriptyline and maprotiline), (ii) noradrenaline reuptake inhibitors (atomoxetine, reboxetine and viloxazine), (iii) monoamine oxidase inhibitors (moclobemide, brofaromine, befloxatone, tranylcypromine), (iv) melatoninergic agonists (agomelatine), (v) selective serotonin reuptake enhancers (tianeptine), (vi) serotonin-norepinephrine reuptake inhibitors (venlafaxine/des-venlafaxine, duloxetine, milnacipram), (vii) noradrenergic and specific serotonergic antidepressants (mianserine and mirtazapine), and (viii) selective serotonin reuptake inhibitors (citalopram/es-citalopram, fluoxetine, fluvoxamine, paroxetine and sertraline). SRRI are currently considered as the first line agents and the golden standard against which the efficacy and tolerability of the other compounds are compared. Many experiments studied the effect of antidepressants on the function of SERT using different mammalian cell lines, Xenopus laevis oocytes or platelets. The principle effect of antidepressants is mediated via their namesake action, namely by preventing the reuptake of serotonin by the presynaptic neuron. In addition, prolonged exposure to antidepressants can affect SERT by altering serotonin transporter mRNA expression (Baudry et al., 2010; Benmansour et al., 1999; Hansen and Mikkelsen, 1998), SERT cell surface expression (Fisar et al., 2005; Horschitz et al., 2001; Kittler et al., 2010; Lau et al., 2008). The effects of antidepressant treatments on functional and binding properties of the SERT summarized in review by Pineyro and Blier, (1999).
1.3. Protein quality control
The synthesis of membrane proteins is initiated upon engagement of the coding mRNA by cytosolic ribosomes. After the first hydrophobic segment emerges from the ribosomal peptide channel, the signal recognition particle is recruited, translation is halted and the ribosome is to the ER via the signal particle recognition receptor. After insertion of the hydrophobic segment into the SEC61 channel (i.e., the translocon), the translational block is released and the nascent polypeptide chain is cotranslationally fed into the SEC61 channel. This arrangement allows the hydrophobic segments to be inserted into the lipid
12 bilayer. Some transmembrane proteins, which have a large extracellular N-terminal domain, require a cleavable hydrophobic peptide (= signal peptide). SL& family members, however, do not require any signal peptide and the first transmembrane helix (TM1) acts as the docking site for the signal recognition particle. When inserted in to the ER membrane or transferred into the ER lumen, the newly synthesized proteins subsequently undergo several quality control processes. The quality control has been most extensively studied with soluble proteins, which are released into the ER lumen after cleavage of their signal sequence and which subsequently mature along the secretory pathway. However, the available evidence indicates that very similar if not identical mechanisms also operate on the transmembrane proteins, which are exported to the cells surface or other organelles (e.g. Golgi, lysosomes etc.) via the secretory pathway. The quality control has 2 stages, the proximal quality control (primary quality control), which is responsible for folding and maturation of the protein, and distal quality control (secondary quality control) which facilitate the ER export of the protein. Only native proteins (correctly folded) reach their final destinations. Non-native proteins and incompletely assembled oligomers are retained, and, if persistently misfolded, they are degraded (Fig. 4.).
13
Fig. 4. Folding of the protein the ER (Sitia and Braakman, 2003).
1.3.1. Protein folding (proximal quality control):
The ER provides an optimized environment for protein folding and maturation. Nascent secretory proteins enter the crowded environment of the ER lumen and soon begin folding into more stable, lower energy, conformation (Dobson, 2004). ER-resident enzymes catalyze different modifications (such as isomerization, oxidation and reduction), which include disulfide bond formation, -glycosylation and GPI addition (Anelli & Sitia 2008).
1.3.1.1. The calnexin cycle
The ER distinguishes between native and non-native protein conformations, through various sensor molecules (Anelli & Sitia 2008). These sensors include molecular chaperones, which interact specifically with incompletely folded proteins (Ellgaard and Helenius, 2003). The conformation-sensing system also includes enzymes that tag misfolded proteins for recognition by the folding and degradation machinery. The best-
14 known tags are ubiquitin, a small protein that is attached to lysine side chains as a degradation signal (Glickman and Ciechanover, 2002), and glucose, which is added to the N-linked glycans of glycoproteins as a retention signal in the endoplasmic reticulum (Hammond et al., 1994; Parodi, 2000). Calnexin recognizes the newly synthesized glycoproteins after removal of the outer most two of the three glucose by glucosidases I and II (Fig. 5.). The interaction between the monoglucosylated protein and CNX, CRT, or both retains the glycoproteins and facilitates its exposure to ERp57 that assists disulfide bond formation. The remaining glucose residue is trimmed by glucosidase II, and the complex dissociates. If the protein is correctly folded, it can exit the ER. However, if it is not correctly folded, it is recognized by UDP-glucose:glycoprotein glucosyltransferase (UGGT) and reglucosylated, thereby allowing it to reassociate with CNX (and CRT). The cycle is repeated until the protein is either folded or degraded. Binding to CNX and CRT prevents exit from the ER of immature glycoproteins, promotes correct folding, inhibits aggregation, blocks premature oligomerization, and regulates ERAD (Ellgaard et al., 1999). However calnexin is associated mainly with misfolded glycoproteins and it is also found to stably bind misfolded non-glycosylated membrane proteins, ., proteolipid protein (Swanton et al., 2003). The role of foldases in the folding of transporters was studied for DAT (Lenhard and Reilander, 1997); the folding of hDAT was improved in a stable cell line transfected with ninaA (a peptidyl-prolylcis/trans isomerase). This indicates that the formation of prolyl-bonds is rate limiting for folding. Co-expression of calnexin with myc- SERT was associated with a 3-fold increase in the expression of functional SERT (Tate et al., 1999). This observation highlights the importance of calnexin in assisting the folding of SERT. Previous data (Korkhov et al., 2008) argue for a model where calnexin also acts via its transmembrane domain - rather than via its sugar-biding lectin domain - to assist the folding and packing of the nascent transmembrane helices: Enclosure by the transmembrane segment of calnexin may prevent aggregation of partially folded transemmbrane segment of SERT. If the protein is not correctly folded, calnexin traps the protein in OSER (organized smooth ER) structures, which reroute the protein for degradation. Similar model exists for nicotinic receptors (Wanamaker and Green, 2005) .In this model it was shown that calnexin control folding and also could compete with
15 oligomerization of the receptor by preventing assembly of the receptor subunits. Accordingly, overexpression of calnexin reduces cell surface expression of active receptor (Free et al., 2007).
Fig.5. The calnexin/calreticulin cycle (Ellgaard and Frickel, 2003).
16 1.3.1.2. Chemical and pharmacological rescue of misfolded proteins
A number of diseases have been linked to protein misfolding. These diseases include bovine spongiform encephalopathy (BSE) and its human equivalent Creutzfeld- Jakob disease (CJD), Alzheimer’s disease, Parkinson's disease, type II (non-insulin dependent) diabetes mellitus, cystic fibrosis (Welch and Brown, 1996), X-linked nephrogenic dibates isipidus, LDL-receptor deficiency etc. (Gregersen, 2006; Leandro and Gomes, 2008). It is therefore also therapeutic interest to target protein misfolding with drug candidates. Several strategies are used to rescue misfolded proteins: these include chemical and pharmacological rescue. Chemical and pharmacological chaperones are compounds, which are able to facilitate the escape of mutant proteins from the ER quality control mechanism, leading to their translocation to the correct subcellular location (Welch and Brown, 1996). The mode of action of chemical and pharmacological chaperones is not well understood, but it is thought that they act through providing the cell with template molecules that channel the folding trajectory of nascent mutant proteins in the direction of a wild type-like conformation (Conn et al., 2002). The action of pharmacological chaperones is more specific because it induces correct folding through binding to selective sites on the target proteins without interfering with the degradation of other misfolded or incompletely folded proteins (Fig. 6a.). Pharmacochaperoning by antagonists has been extensively studied with G protein-coupled receptors, such as V2 vasopressin receptor (Morello et al., 2000) and dopamine D4 receptor (Van Craenenbroeck et al., 2005), or a stabilizing agent for p53 tumor suppressor(Foster et al., 1999). In contrast to molecular proteinaceous chaperones, which dissociate within the ER, pharmacochaperones may be associated with their target throughout the secretory pathway because they presumably saturate all of the transport compartments (Perlmutter, 2002). However, for G protein-coupled receptors their site of action has been defined in the ER (Malaga-Dieguez et al., 2010).
In contrast, the action of chemical chaperones is non specific because they help the folding of various proteins in the cell without selectivity (Fig. 6b.). Chemical chaperones include osmolytes like betain and water buffering agents like glycerol (Brown et al., 1997;
17 Sato et al., 1996; Tamarappoo et al., 1999), dimethyl sulfoxide (Duvernay et al., 2009a; Robben et al., 2006), and trimethyl-amine--oxide (Song and Chuang, 2001; Yang et al., 1999). Osmolytes and water buffering agents are thought to facilitate folding by reducing the availability of solvent water that may compete for hydrogen bond formation. There are compounds that act in a more specific way, but that do not necessarily bind to the misfolded protein. These include inhibitors the sarcoplasmic-endoplasmoreticular Ca2+- ATPase (SERCA, calcium pump), , thapsigargin (Delisle et al., 2003; Egan et al., 2002; Korkhov et al., 2008) and curcumin (Egan et al., 2004), and inhibitors of tubulin, e.g., vinblastine (Loo and Clarke, 1997). If cells are treated with inhibitors of SERCA, this promotes, in some instances, the exit of folding-defective mutants at the cell surface. The mechanism of action is thought to be as follows: Inhibition of SERCA depletes the ER of Ca2+. The function of Ca2+-dependent chaperones is impaired; they can no longer trap folding intermediates in the ER. Because the quality control is overprotective, the escape of slightly abnormally folded proteins suffices to restore the pertinent function. This model is proposed to account for the beneficial action of thapsigragin on cells expressing the F508- variant of CFTR (the cystic fibrosis transmembrane conductance regulator/epithelial Cl- channel). In the presence of thapsigragin, the F508-variant of CFTR can reach the cell surface, where it restores a functional channel (Egan et al., 2002). The mechanism of action of vinblastin is obscure.
18 Pmlailsoma
...... F"f'1clJ:! "'""'ll"nls' • C)<>:G<'II! '""'"'n "'" NooIa.'i1 ~ ~ ProIJ:!C1 clinlellasl • Seorot!!d pl1llo" ~ ~4 Fig. 6. Comparison of and pharmacological and chemical chaperone modes of action (Bernier et al., 2004). 19 1.3.2. ER-export (secondary quality control) When the proteins have adopted their native conformation, they are released from the ER through ER exit sites (Mezzacasa and Helenius, 2002). These represent the entry point into the secretary pathway (see Fig. 8 for overview), which shuttles the protein from the endoplasmic reticulum (ER), to the ER-Golgi intermediate compartment (ERGIC) to the Golgi complex and subsequently to the cell surface. From the -Golgi network, membrane proteins are packed into secretory granules (Palade, 1975). Misfolded proteins are not packed into the secretory granules because they interact with molecular chaperons which prevent their recruitment to the ER exit sites and/or because they are not recognized by the cargo receptors in the ER exit sites. Secretary granules are either sorted constitutively to the plasma membrane (in non-polarized cells) or subject to sorting and targeted delivery to specific membrane compartments (in polarized cells such as neurons and epithelial cells). Obviously, membrane proteins may also be targeted from the trans- Golgi network to other specialized organelles such as lysosomes and endosomes. It is not clear at which point sorting decisions are made, but there is evidence that the components of the final targeting machinery are already recruited to nascent cargo protein containing vesicles at the level of the ER. Over-expression of dominant negative components of the exocyst leads to retention of the GABA-transporter-1 (GAT1) in the ER (Farhan et al., 2004). 1.3.2.1. ER-export COPII-machinery At each individual trafficking step, membrane proteins have to be packed into membrane vesicles. The budding of membrane vesicles is not a trivial issue, because the lipid bilayer has a significant surface tension and this imposes constraints on membrane curvature. This problem is solved by the recruitment of vesicle coat components during the budding process. Vesicle budding from the ER (at ER exit sites, ERES) is supported by coat protein complex II (COPII; reviewed in (Bonifacino and Glick, 2004). The COPII complex consists of SEC23/SEC24, SEC13/SEC31 and Sar1 (Fig. 7.). 20 Fig. 7. Schematic diagram of COPII vesicle (Sato and Nakano, 2007). 1.3.2.1.1. Cargo recognition by COPII The Sec24-subunit of the SEC24/SEC23-dimer is responsible for binding to ER export signals of cargo proteins. Mammalian cells have 4 different isoforms termed Sec24 A (Sec24p in yeast), Sec24 B (Lst1p in yeast), Sec24 C (Iss1p in yeast) and Sec24D (no yeast homologue known). It is still unknown to what extent these isoforms differ with respect to their cargo selectivity (Pagano et al., 1999), but recent experiments provide evidence for specific associations (Wendeler et al., 2007). Three binding sites for cargo were found on the membrane-proximal surface of Sec24 (Miller et al., 2003; Mossessova et al., 2003), termed “A-site”, “B-site”, and “C-site” (Fig.8). The A-site recognizes a sequence YNNSNPF present on the syntaxin protein Sed5. The B-site, recognizes (D/E)x(D/E), and Lxx(L/M)E found on the SNARE, Bet1 and Sed5. The C-site, which includes residue Arg342 on Sec24, recognizes possibly Sec22 (Miller et al., 2003). A number of cargo proteins are not affected by mutations in any of the known bindings sites (A, B, C) of SEC24 (Miller et al., 2003). This suggests additional cargo recognition sites on SEC24; possibly either SAR1 (Aridor et al., 1998; Giraudo and Maccioni, 2003; Quintero et al., 2010) or SEC23. In fact, for the SLC6 family member GAT1 the candidate binding site 21 appears to map to an acidic spot (733DD734) on the surface of SEC24D (Farhan et al., 2007). The corresponding site in Sec24C is required for export of SERT (Sucic and El-Kasaby, unpublished observation). Additional ER-export signals on cargo have been identified (Wendeler et al., 2007): Sec24A shows strong binding to the YY and FF motifs (of human ERGIC-53) and weaker binding to the LL-, II- and V-based motifs. Sec24B shows a binding pattern similar to Sec24A, although it binds more strongly to the V motifs. By contrast, Sec24C preferentially binds to VV and AV, but weakly to FF and YY. The V, YY and FF motifs are recognized by Sec24D. All four Sec24 isoforms bind with modest affinity to II-motifs, but the aff inity of the latter is still substantially higher than a di-alanine motif. The deletion of the C-terminus of SERT (Larsen et al., 2006), GAT-1 (Farhan et al., 2004), GLYT (Fernandez-Sanchez et al., 2008) and DAT (Torres et al., 2003) are associated with ER retention of these transporters, indicating that their C-termini contain ER exit motif. An RL-moiety was of GAT-1 was originally delineated as a candidate Sec24D-binding site (Farhan et al., 2007). Subsequent experiments pointed to an additional aspartate residue in GlyT-1, resulting in the conserved motif R575L576(X8)D585 (Fernandez- Sanchez et al., 2008) and DAT mutants G585A, K590A, and D600A were restricted to the cell soma and did not traffic to dendrites or axonal processes (Miranda et al., 2004). 1.3.2.1.2. COPII assembly and budding COPII vesicle formation is initiated by exchange of GDP prebound to SAR1 for GTP; this nucleotide exchange reaction is catalyzed by the guanine nucleotide exchange factor SEC12. The activated SAR1-GTP binds to the ER membrane and recruits the SEC23/SEC24 complex. The cytoplasmically exposed signal of a transmembrane cargo is captured direct contact with SEC24. This allows for formation of the prebudding complex. Following cargo selection, SEC23/SEC24-cargo complexes concentrate into ERES (ER exit sites), in which SEC23/Sec24 endow the membrane with a curvature that is 22 predetermined by the bow-tie shape of the Sec23/Se24-dimer. The membrane curvature is further stabilized by recruitment of the SEC13/SEC31-dimer, which forms the outer shell of the COPII-coat. The SEC13/SEC31-dimer has two functions: it increases the membrane curvature and thus allow s for budding of the COPII coated vesicles, (i) it triggers the GAP- activity of SEC23 and thus allows for coat disassembly once the vesicle been released (Mancias and Goldberg, 2005). Coat disassembly is a requisite for fusion of the vesicle with the next compartment, i.e. the ERGIC (Farhan et al., 2008). 1.4. Aim of the thesis A previous study showed that deleting the C-terminus of SERT impairs transporter activity and compromised its delivery to the plasma membrane (Larsen et al., 2006), but this study did not offer any mechanistic explanation for these effects. The hypothesis underlying my thesis posits that the C-terminus of SERT is required for folding and trafficking of the serotonin transporter. I employed several approaches to examine this working hypothesis. 1) Serial truncations of the carboxyl terminus. 2) Scanning the C-terminus of SERTs for motifs that are required for expression of functional transporter. 3) Localization by confocal laser scanning microscopy, biochemical characterization (binding studies, uptake studies). 4) Bacterial expression of SERT with a C-terminally fused GFP tag. 5) Co-immunoprecipitation of the misfolded mutant with calnexin. 6) Test for possible chemical and pharmacological chaperones effect of SERT. 23 2. EXPERIMENTAL PROCEDURES 2.1. Materials 2.1.1. Reagents Standard chemical reagents were purchased from Sigma-Aldrich (Missouri, USA). All cell culture reagents were from PAA Laboratories (Pasching, Upper Austria) except fetal bovine serum (Invitrogen, Carlsbad, CA). [3H]Imipramine, [3H]5-HT and [3H] -CIT were purchased from PerkinElmer (Massachusetts, USA). Bovine serum albumine (BSA), complete protease inhibitor cocktail were from Roche (Mannheim, Germany), SDS from BioMol GmbH (Germany), TRIS and scintillation cocktail (Rotiszin® eco plus) from Carl Roth GmbH + Co. KG (Austria). Rabbit polyclonal GFP antibody (ab290) and anti- calnexin antibody (ab13504) were from Abcam Plc (Cambridge, UK). Protein A-sepharose and anti-rabbit IgG1-anitbody linked to horseradish peroxidase were from Amersham Biosciences (Freiburg, Germany). ER Tracker Blue-White DPX was from Molecular Probes (Leiden, The Netherlands). Ibogaine was kindly provided by Mr. Marko Resinovic, Founder and Head of the Sacrament of Transition, Slovenia. 2.1.2. Kits Kits Usage Company QuikChange II XL Site-Directed Mutagenesis Stratagene Europe Site-Directed Mutagenesis Pfu DNA Polymerase Mutagenesis Fermentas Life Science , USA GFXTM PCR DNA and Gel Band DNA purification GE Healthcare UK Limited Purification Kit Neuclospin® Plasmid Quick Pure DNA Mini-Preps MACHEREY-NAGEL EURL, France HiSpeed® Plasmid Maxi Kit DNA Maxi-Preps QIAGEN Science, Maryland,USA High Fidelity PCR Enzyme Mix PCR Fermentas Life Science , USA BIO-RAD PROTEIN ASSAY protein assay Bio-Rad Laboratories GmbH, Germany PPNrotein Deglycosylation Mix rotein deglycosylation ew England Biolabs, Inc 24 2.1.3. Media and buffers: LB broth: Tryptone 10g yeast extract 5g NaCl 10g H2O Up to 1000ml adjust pH to 7.3 and auto cl ave LB media: Agar Agar 15g LB broth Up to 1000ml Adjust pH to 7.3 and autoclave then cool and add antibiotic PBS: ( pH to 7.3) NaCl 137mM KCl 2.7 mM Na HPO x 2H O 4.3 mM 2 4 2 KH PO 1.5 mM 2 4 NaCl 137mM HEBS buffer: ( pH to 7.3) HEBS 25 mM Na HPO 0.75 mM 2 4 NaCl 140 mM KREBS-HEPES buffer: ( pH to 7.3) HEPES 10 mM KCl 3 mM NaCl 120 mM CaCl2.2 H2O 2 mM MgCl2.6H2O 2 mM Glucose monohydrate 2 mM 25 HEM buffer:( pH to 7.3) HEPES 25 mM EDTA 1 mM MgCl2 2 mM Binding assay buffer: Tris-Hcl (1 M pH 7.5) 20 mM EDTA 1 mM MgCl2 2 mM NaCl 120 mM KCl 3 mM Binding wash buffer: Tris-Hcl (1 M pH 7.5) 10 mM MgCl2 1 mM NaCl 120 mM Radioimmunoprecipita tion assay buffer (RIP A): Tris-HCl pH 7.4 50 Mm NaCl 150 mM NP-40 1% Sodium deoxycholate 0.5% SDS 0.1% SDS sample loading buf fer: Tris-HCl pH 6.8 60 m M SDS 2% Glycerol 25% -mercaptoethanol 14.4 mM bromophenol blue 0.1% SDS-PAGE Electrophoresis Runn ing Buffer: Tris 25 mM Glycine 192 mM EDTA.Na2 0.1 mM 26 SDS 0.175 mM Electrophoresis transfer Buffer: Tris 25 mM Glycine 192 mM Tris buffered saline (TBS): ( pH to 8.0) NaCl 150 mM Tris 10 mM 2.1.4. cDNA constructs Restriction enzymes were purchased from Fermentas Life Science. The plasmids encoding hSERT and hamster Sar1a-T39N were available in our laboratory ( described in previous publications by (Just et al., 2004) (Farhan et al., 2007), respectively]. pWaldo- GFPe-YdgR (positive control) , pWaldo-YdgR ( negative control, YdgR in pWaldo without GFP tag) and pCS19-eGFP encoding vectors were kindly provided by Dr. Peggy Stolt- Bergner (IMP, Vienna, Austria). The primers (Table 1) were ordered from Operon Biotechnologies, Inc (USA). Table (1): Primers sequences. Carboxyl terminus truncation (Sequence 5'to 3') SERT-C 3 fw. TCG AGC TCA AGC TTC TAC ACC rv. CGCGCGGTACCTTACAAGCGGATGTCCCCAC SERT-C 7 fw. TCG AGC TCA AGC TTC TAC ACC rv. CGCGCGGTACCTTACCCACAAGGAATTTCTGTT SERT- fw. TCG AGC TCA AGC TTC TAC ACC C 12 rv. CGCGCGGTACCTTATGTTGGTGTTTCTGGGGT SERT- fw. GTATTATTAAAAGTATTACCCCAGAATAACCAACAGAAATTCCTTGTGG C 15 G rv. CCCCACAAGGAATTTCTGTTGGTTATTCTGGGGTAATACTTTTAATAATA C 27 SERT- fw. CGTATTATTAAAAGTATTACCCCATAAACACCAACAGAAATTCCTTGTG C 16 rv. CACAAGGAATTTCTGTTGGTGTTTATGGGGTAATACTTTTAATAATACG SERT- fw. AAAGAGCGTATTATTAAAAGTATTACCTAAGAAACACCAACAGAAATTC C 17 CTTGTG rv. CACAAGGAATTTCTGTTGGTGTTTCTTAGGTAATACTTTTAATAATACGC TCTTT SERT- fw. TCG AGC TCA AGC TTC TAC ACC C 30 rv. CGCGCGATATCAAGTGATGATCAACCGA Alanine scanning mutagenesis (Sequence 5'to 3') SERT- fw. CTTATCGGTTGATCATCACTGCAGCGACATTTAAAGAGCGTATTA PG601,602AA rv. TAATACGCTCTTTAAATGTCGCTGCAGTGATGATCAACCGATAAG SERT- fw. ATCATCACTCCAGGGGCAGCTAAAGAGCGTATTATTAAAAGTATTCC TF603-604AA rv. GGTAATACTTTTAATAATACGCTCTTTAGCTGCCCCTGGAGTGATGT SERT- fw. ATCATCACTCCAGGGACATTTGCAGCGCGTATTATTAAAAGTATTACCC KE605-606AA rv. GGGTAATACTTTTAATAATACGCGCTGCAAATGTCCCTGGAGTGATGAT SERT-RI606- fw. ATCATCACTCCAGGGACTTTAAAGAGGCTGCTATTAAAAGTATTACCCC 607AA AGAAACACC rv. GGTGTTTCTGGGGTAATACTTTTAATAGCAGCCTCTTTAAATGTCCCTGG AGTGATGAT SERT- fw. CCAGGGATTTAAAGAGGCTGCTGCTAAAAGTATTACCCCAGAAACAC RII607- rv. GTGTTTCTGGGGTAATACTTTTAGCAGCAGCCTCTTTAAATGTCCCTGG 609AAA SERT-IK609- fw. GACATTTAAAGAGCGTATTGCTGCAAGTATTACCCCAGAAACACCACAG 610AA rv. CTGTTGGTGTTTCTGGGGTAATACTTGCAGCAATACGCTCTTTAAATGTC SERT-SI611- fw. GAGCGTATTATTAAAGCTGCTACCCCAGAAACACCAACAGAAATTCTTG 612AA rv. CAAGGAATTTCTGTTGGTGTTTCTGGGGTAGCAGCTTTAATAATACGCTC SERT- fw. TTAAAAGTATTGCCGCAGAAACACCAACAGAAATTCCTTGTGC TP613-614AA rv. CCACAAGGAATTTCTGTTGGTGTTTCTG CGGCAATACTTTTAA pWaldo (Sequence 5'to 3') SERT- fw. CTGCTTCTTTGGATCCCT BamH1 rv. GCGCGGATCCCACAGCATTCAAGCGG 28 2.2. Methods 2.2.1. DNA constructs and cloning SERT C3, C7 and C12 were amplified by PCR and cloned into peYFP-vector (Clontech, Mountainview, CA) using HindIII and KpnI, SERT C30 via HindIII and EcoRV. YFP-SERT C15, YFP-SERT C16 and YFP-SERT C17 were cloned by inserting a stop-codon into the open reading frame, using QuikChange II XL Site-Directed Mutagenesis kits (Stratagene Europe). SERT cDNA was cloned into the pWaldo vector in two steps. First the 5’ part of SERT cDNA (1433 bp) was inserted into pWaldo-GFPe vector (Fig. 8A.) using the Xho I and BamHI restriction sites; the 3’ end of the SERT cDNA was then amplified by PCR and cloned via the BamHI site (Fig. 8B.), resulting in an inframe fusion of the full length SERT and the GFP of the pWaldo-GFPe vector (Fig. 8C). All mutations and truncations were confirmed by sequencing. 2.2.2. Cell culture and transfections HEK293 cell were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with high glucose (4.5 g/l) and L-glutamine (584 mg/l), supplemented with 10% fetal calf serum (FCS) and gentamicin (50 g/ml). Transfections were done using the CaPO 4 precipitation method (for co-localization studies by fluorescence microscopy, uptake and binding assays), in brief, CaCl was mixed H O (1:8.6), then the DNA is added to a pre- 2 2 mixed CaCl + H O ( for 10 cm dish 20 g DNA in 250 mM CaCl in 0.5 ml), then the 2 2 2 DNA+ CaCl + H O mix was pipetted into equal amount (0.5 ml) of 2x HEBS buffer and 2 2 the mixture was left in room temperature for 6 minutes then was dropped into the cell . After 4h of incubation a glycerol shock was performed , culture medium was removed and glycerol shock solution was pipetted onto the cells (approximately 30 seconds), followed by two washing steps (1x PBS). For co-immunoprecipitation experiments Lipofectamine Plus TM 2000 Reagent (Invitrogen, USA) was used. One day before transfection 2.5x106 cell were seeded into 10cm dish, next day 4 g DNA were diluted in serum free medium, 29 then 20 l plus reagent were added ( total volume (0.75 ml) and incubated at room temperature for 15min. Afterward the DNA mix was added to 30 l of Lipofectamine pre- diluted in 0.72 ml of serum free medium. The total mixture was further incubated for 15 min, and then was added to cultured dish containing 5 ml of serum free medium. After 3h the medium was removed and changed with complete serum medium. The transfections efficiencies were about 20 to 60 % (based on FACS analysis and fluorescence microscopy) and about 80 to 90% (based on Fluorescence microscopy) for CaPO precipitation method 4 and Lipofectamine Plus TM 2000 Reagent, respectively. 2.2.3. Fluorescence microscopy HEK293 cells (3 x 105 cells) were seeded on poly-D-lysine (PDL) coated 15 mm- coverslips and were transfected 24 h later by the CaPO4 precipitation method. Forty eight hours after transfection the cells were analyzed by confocal microscopy. The cells were kept in a Krebs-HEPES buffer and images were acquired with a Zeiss Axiovert LSM510 confocal laser scanning microscope. Images were analyzed with a Zeiss LSM Image Browser (version 3, 5, 0, 223; Zeiss AG, Oberkochen, Germany). Membranes of the endoplasmic reticulum were stained with the fluorescent ER Tracker Blue-White DPX as previously described (Farhan et al., 2004); the plasma membrane was visualized by incubating the cells in trypan blue as outlined earlier (Korkhov et al., 2006). 2.2.4. Uptake assays Uptake of [3H]5-HT was determined as described previously (Korkhov et al., 2006): in brief, 24 h after transfection, HEK 293 cells were detached and seeded in 48 well plates (6*105/well) pre-coated with PDL. The next day the medium was removed and cells were washed with 1 ml of Krebs-HEPES buffer. Cells were incubated with the indicated concentration of 5-HT ranging from 0.2 μM to 30 μM; the specific activity of [3H]5-HT was varied between 30 cpm/fmol (0.2 μM) to 200 cpm/pmol (30 μM) by addition of unlabeled 5-HT. The incubation lasted for 1 min and was followed by a rapid rinse with 30 ice-cold Krebs-HEPES buffer. Non specific uptake was determined by preincubation of the cell with 10 μM paroxetine for 5 min. Cells were lysed by 1% SDS, the lysate was transferred to scintillation vials and the radioactivity was determined by liquid scintillation counting. 2.2.5. Binding assays All steps of membrane preparation were done on ice: 48 h after transfection, the medium was removed and the cell layer was washed three times with cold PBS. The cell were mechanically detached in PBS and harvested by centrifugation. The cell pellet was resuspended in hypotonic buffer (20 mM Hepes.NaOH, pH 7.5, 1m M EDTA, 2 mM MgCl2) in the presence of protease inhibitors cocktail, frozen in liquid nitrogen, followed by rapid thawing and sonication (3 times for 10 sec). Membranes were collected by centrifugation at 40,000g for 15 min. These were resuspended in the same buffer at a protein concentration of ~5 mg/ml and frozen in liquid nitrogen. The protein concentration was measured by Coomassie brilliant blue binding. Citalopram, imipramine, paroxetine and protein were diluted in binding assay buffer. Membranes (16-20 μg/assay) were incubated with different concentration of [3H]-CIT or [3H] imipramine at 22 C for 60 min ([3H]-CIT became commercially unavailable for a certain period; hence we resorted to using [3H] imipramine). Non-specific binding was determined in parallel in presence of 3μM paroxetine. These can be summarized as following [3H]CIT or Paroxetine assay diluted total assay [3H]imipramine (10 x) 30 μM (10 x) buffer (μl) protein (μl) volume (μl) Total binding 25 0 25 200 250 Non specific binding 25 25 0 200 250 The binding was terminated by filtration onto GF/B glass microfiber filters presoaked in 0.5% polyethylenimine. The filters were dissolved in scintillation cocktail and the radioactivity was counted. 31 A 6h Ip Ip B Q Yu Ip 6h Ip @p st 1 cloning Q step 8yh !"# Ip 7h Q Yh 6h Th Cv nd @p 2 cloning Q step Yh 6h Th 7h C Extracellular Intracellular Fig. 8. Cloning strategies of SERT in pWado-system bacterial expression. 32 2.2.6. pWaldo expression E. coli BL21 (DE3) pLysS was used to express the pWaldo-GFPe fusion proteins, E. coli BL21 (DE3) was used for the pCS19 construct (positive control encoding GFP). Precultures were incubated over night in 1ml of growth medium (LB) containing the appropriate antibiotic. The next day 2 μl of the overnight culture were diluted into 200 μl of LB (in the presence of the selection antibiotic) in one well of a 96-well plate. The bacteria were incubated at 37°C, shaking (180rpm) for about 2.5 hrs (to reach an OD600 of about 0.6). At this point, the protein expression was induced by adding IPTG. GFP fluorescence was measured using a fluorescence plate reader (excitation 485nm and emission 520 nm). OD600 was measured in parallel to determine cell density. 2.2.7. Co-immunoprecipitation Forty eight hours after transfection, HEK 293 cells (2.5x106/condition) were washed three times by ice-cold PBS buffer, harvested, lysed in 0.5 ml of RIPA buffer and incubated at 4 C for 60 min with gentle rotation. The lysate was collected by centrifugation at 50,000 g for 30 min at 4 C. Equal amounts of protein (~1 mg/sample) were incubated overnight with anti-GFP antibody (4 μl). Subsequently, pre-equilibrated protein A- sepharose (6 mg of protein A-sepharose/sample) was added and incubated at 4 C for 5 h with gentle rotation. The protein A-sepharose beads were collected by centrifugation and then washed 3 times with RIPA buffer (without SDS). Bound proteins were eluted in by denaturation in 0.1 ml loading buffer containing 40 mM dithiothreitol and 1% mercaptoethanol at 45 C for 10 min. Aliquots (15 μl) were loaded onto SDS polyacrylamide gels. After the proteins had been resolved by denaturing electrophoresis, they were transferred to nitrocellulose membranes. Afterwards, transferred proteins on the membranes were stained with Ponceau-red to check on protein loading and transfer efficiency, then the extra stain was removed by washing by molecular water, then 3 times (5 min) wash by TBST-0.1%, then blocking of non-specific binding sites has to be performed for 60 min at room temperature (3% BSA in TBST-0.1%) followed by 3 times 33 (5 min) wash by TBST-0.1%. The first antibody was added and incubated overnight at 4 C (Anti-GFP, 1:5000 in TBST 0.1% and Anti-calnexin 1:2000 in TBST 0.1%). Next day the membrane was washed 3 times (5 min) wash by TBST-0.1% and the 2nd antibody (anti rabbit HRP, 1:5000 in 1 % BSA in TBST 0.1% ) was add and further incubated for 60 min at room temperature. The membrane washed 3 times (15 min) wash by TBST-0.1%, followed 2 times (5 min) wash by TBS. In the end, the substrate for a chemiluminescent signal arises that is visible after exposure of the membrane to an X-ray film. 2.2.8. Protein deglycosylation For each set 3 μl of IP product (from Co-immunoprecipitation with anti-GFP) diluted in molecular water to final volume 45μl. To the previous mix 5μl denaturing buffer buffer were added, then heated at 100°C for 10 min. For EndoH, 5μl of Reaction Buffer (G5 buffer) and 2μl EndoH enzyme were added. For PNGase, 5μl of Reaction Buffer (G7) buffer, 5μl NP-40 and 2μl PNGase were added. After 60 min incubation at 37°C, 12 of SDS loading buffer were added and the tubes were incubated at 45°C for 15 min. Half of the sample was loaded on 8%SDS polyacrylamide gels and bloat against anti- GFP. 34 3. RESULTS ! The sequence of SERT differs substantially from that of its closest relatives in its last 22 amino acids (Table 2). Hence, the carboxyl terminus of SERT was serially truncated to define the portion of the C-terminus that was dispensable for cell surface localization of the transporter and to identify the region that contained candidate motifs for interaction with the trafficking machinery. It is evident from Fig. 9. that truncation of the C-terminus by up to 16 amino acids did not impair the capacity of the resulting mutated transporters to reach the cell surface. Accordingly, [3H]5-HT uptake (shown for SERT- C15 and SERT- C16 in Fig. 10A.) and binding of the inhibitor [3H] -CIT (Fig. 10B.) by the mutated transporters was similar to that of wild type SERT (average KD, Bmax as well as KM and Vmax values are given in Table 3). In contrast, further truncation (shown for SERT- C17 (Fig. 9H. to 9J.) resulted in transporters that were trapped within the cell and co-localized with a fluorescent marker of the endoplasmic reticulum. The same holds true for an even further truncation, , SERT- C30 (Fig. 9J. to 9L.). In intact cells, plasma membrane transporters can only mediate uptake of substrate if they reach the cell surface. It is therefore not surprising that these mutants failed to mediate uptake of substrate (Fig. 10C.). However, SERT- C17 and SERT- C30 also failed to bind the inhibitory radioligand [3H] -CIT (Fig. 10D.). Increasing the amount of transfected DNA did not increase the [3H]5-HT uptake by SERT- C17 (Fig. 10E.), also the cotransfection of the YFP-SERT- TM11/12 SERT- C17 with SERT- C30 failed to bind the inhibitory radioligand [3H] imipramine (Fig. 10F.) 35 Table 2. Sequence alignment of the C-terminal region of selected SLC6-family transporters. Transporter amino acid sequence uT@SU SGDDUQBUAF@SDDFTDUQ@UU@DQ8B9DSGI6W %" T@SU SGDTUQBUGF@SDDFTDUQ@UU@DQ8B9DSHI6W %" uB6U HAGUGFBTGFRSDRWHWRQT@DWSQ@IBQ@RQR6BTTUTF@6`D $(( B6U HAGUGFBTGFRSGRWHDRQT@DWSQ@IBQ@RQR6BTT6TF@6`D $(( uI@U FAGTURBTGX@SG6`BDUQ@ICCGW6RS9DSRARGRCXG6D % & u96U FA8TGQBTAS@FG6`6D6Q@FS@GW9SB@WSRAUGSCXGFW %! uUh U SG8RU@BQAGWSWF`GGUQS@ISX6W@S@B6UQ`ITSUWHIB6GWFQUCDDW@UHH %! hSERT and rSERT are human and rat SERT, respectively; hGAT1 and rGAT1 are the human and rat GAT1, respectively; hTaurT is the human taurine transporter. The Sec24-binding RI-motif is colored grey as are an invariant glycine and proline. The residue in the position +9 from the RI- motif is bold-faced (proline in the serotonin and taurine transporters, an acidic residue in all others including those not shown). Table 3. Affinity estimates for substrate uptake by and inhibitor binding to wild type and C-terminally mutated versions of SERT. SERT-version [3H]5-HT uptake [3H] -CIT binding KM Vmax KD Bmax (μM) (pmol.min-1.10-6 (nM) (pmol/mg) cells) WT 1.6±0.4 40.0±3.1 4.4±1.30 13.0±3.0 C 12 2.9±0.2 46.1±0.7 3.7±1.80 13.6±2.4 C 15 1.3±0.4 39.2±4.3 5.1±1.10 11.0±2.8 C 16 1.2±0.3 37.8±4.6 5.5±0.90 8.9±1.6 C 17 NC NC NC NC C 30 NC NC NC NC [3H]imipramine binding WT 1.5±0.40 56.5±10.9 2.2±0.9 2.6±0.5 PG601,602AA 13.7±2.3 7.9±3.0 NC NC TF603-604AA 1.7±0.1 66.64±7.5 2.3±0.4 1.7±0.1 KE605-606AA 2.3±1.0 47.7±2.6 2.0±0.4 2.5±0.2 RI606-607AA 1.4±0.1 28.9±0.8 2.0±1.5 0.3±0.1 RII607-609AAA 1.6±0.3 8.1±3.4 3.9±1.9 0.2±0.03 IK609-610AA 1.8±0.3 45.2±1.1 2.8±0.6 19±0.1 SI611-612AA 1.4±0.5 48.2±2.3 2.1±0.8 2.4±0.2 TP613-614AA 1.7±0.9 53.7±11.7 2.1±0.5 2.1±0.4 NC: a meaningful number could not be calculated, because of very low binding/activity Note that the experiments with truncated mutants were done with a different batch of HEK293 cells than those with the alanine substitution mutants. This likely accounts for differences in expression levels and maximal uptake velocities; Means ± S.D. (n = 3 - 5). 36 $%&'&(' RLIITPGTFKERIIKSITPETPTEIPCGDIRLNAV B C D YFP-SERT–C 3 YFP-SERT–C 7 YFP-SERT-C 12 E F YFP-SERT–C 15 YFP-SERT-C 16 YFP ER-tracker overlay G H I YFP-SERT-C 17 J K L YFP-SERT-C 30 Fig. 9. Subcellular localization of C-terminally truncated versions of SERT. HEK293 cells (0.7*106 cells) were transiently transfected with plasmids (5μg) encoding YFP–tagged wild type SERT and with truncated versions of the transporter. The sites of truncation are indicated in the carboxyl terminus of hSERT (A). Transfected cells were seeded onto poly-D-lysine coated coverslips 24h after transfection. Confocal images were acquired after an additional 24h by confocal microscopy with a 488 nm excitation wavelength; the emission was captured between 505 and 530 nm (B-F). Cells expressing wild YFP-SERT– C17 (G,H&I) and YFP- SERT–C 30 (J,K&L) were preincubated with an ER-specific dye (fluorescent ER Tracker Blue-White DPX); images were also acquired using excitation wavelength of 485 nm and an emission wavelength window of 475–525 nm to visualize ER Tracker Blue-White DPX. Images were overlaid using the MetaMorph software (I& L). 37 :&% 9% 6 . / &% & $% . (% 9 !"#)# *3# 40 , 2 !"#)# &% !"#*&- 12 !"#*&- $ ( !"#*&. 0 !"#*&. 12-1# 8 5 $ 0 % % % - &% &- (% (- $% % - &% &- (% (- $% -1#032 0$12*3#56 *&9 9% 6 &( . &% &% & $% !"#*&( / !"#*&' (% !"#* . !"#*&( YFP-SERT-C 12 !"#*&' !"#* &( *3# 45 , 6 9 &% *, YFP-SERT-C 17 !"#*&' !"#* 12 $ *, YFP-SERT-C 30 !"#*$% 0 ( 12-1# 8 5 $ 0 % % % &%(%$%% - &% &- (% -1#032 0$12*3#56 YFP-SERT-WT YFP-SERT-WT /%% 2.5 YFP-SERT-C17 YFP-SERT-C17 YFP-SERT-C17+TM11/12 2.0 '%% YFP-SERT-C30 YFP-SERT-C30+TM11/12 1.5 .%% 1.0 -%% 0.5 &% H] 5-HT uptake (pmol/min/well) 3 - [ 123 45 , 6 $ 0.0 0 % 0 1 2 3 4 DNA concentration (g) *&' *$% SERT Versions 10. Truncation of the C-terminus by more than 16 amino acids abrogates transport of 5-HT Fig. !"#)# 3 *&'+#&&,&( *$%+#&&,&( and binding of the inhibitor [ H] -CIT by SERT. HEK293 cells (4 *106 cells) were transiently transfected with plasmids !"# (20 μg) encoding !"# YFP–tagged wild type SERT or the truncated versions SERT-C 15, SERT-C 16 (A&B), SERT- C12, SERT -C 17 and SERT- C 30 (C&D). The 3 uptake of [ H]5-HT was determined after 48h as outlined under Experimental !"# Procedures !"# (A&C). Membranes (15-30 μg/assay) prepared from the transfected cells 48h after transfection were incubated with the indicated concentrations of [3H] ß-CIT and the binding reaction was carried out as outlined under Experimental Procedures (B&D).E, HEK293 cells were transfected in 6 well plates with increasing amounts of plasmids encoding YFP-SERT-WT, YFP-SERT- 15 or YFP-hSERT- 17 (total DNA amount was kept constant). After 24h the cells were split in 48-wells (one well of the 6 well plate into 8 well of the 48-wells). 24h later the uptake was carried out. Membranes (15-30 μg/assay) prepared from the transfected cells 48h after transfection were incubated with the 2nM of [3H] imipramine and the binding reaction was carried out as outlined under Experimental Procedures (F). Data from different 3 experiments (mean +SE) 38 " ! # The findings summarized above suggested that residues to the last 16 amino acids were required for ER export of SERT and/or possibly for folding of the protein. We scanned the region between Pro601 and Pro614 (which covers the amino acids between the 17 and 30 truncation, Fig. 11A.) by pair-wise substitutions with alanines. RI607,608 is the homologous position to the RL-motif required for binding of Sec24D to GAT1 (Farhan et al., 2007) and to GlyT1 (Fernandez-Sanchez et al., 2008); in SERT it is followed by a second isoleucine, which is unique to SERT (all other SLC6 family members have a hydrophilic residue or alanine in this position). Accordingly, also a triple mutation SERT- RII607-609AAA was created. The mutated transporters were heterologously expressed in HEK293 cells and examined by confocal microscopy for subcellular localization of the transporter. Apart from SERT-PG601,602AA (Fig. 11C.), SERT-RI607,608AA (Fig. 11F.) and SERT-RII607-609AAA (Fig. 11G.) all other mutated versions were predominantly visualized at the cell surface. Interestingly, SERT-TP613-614AA was also inserted into the cell membrane (Fig. 11J.), although this mutation affects Pro614, , the first amino acid deleted in the 17 truncation. The substrate uptake by cells transiently expressing mutated transporters was compared with that of cells that expressed wild type SERT (Fig. 12A.). This recapitulated the findings obtained by fluorescence microscopy: most substitutions did not significantly affect uptake (see also Table 3). This suggested that the transporters reached the cell surface and their function was not affected. In contrast, uptake of [3H]5- HT was essentially undetectable in cells expressing SERT-PG601,602AA and was greatly reduced in cells expressing SERT-RI607,608AA and SERT-RII607-609AAA. In GAT1, mutation of the RL-motif results in intracellular retention of the transporter, which eventually reaches the cell surface by bulk flow rather than by concentrative COPII- dependent export (Farhan et al., 2007). It was therefore not surprising that the corresponding mutation also impaired cell surface delivery of SERT. The PG-motif may also play a similar role in ER-export. However, when membranes were prepared from cells expressing SERT-PG601,602AA, SERT-RI607,608AA or SERT-RII607-609AAA and used for binding assays, binding of the tricyclic antidepressant [3H]imipramine was greatly reduced 39 in SERT-RI607,608AA (Fig. 12B, open circle in Fig. 12C.) or SERT-RII607-609AAA (Fig. 12B, open square in Fig. 12C.) and essentially undetectable in SERT-PG601,602AA (Fig. 4B., open triangle in Fig. 12C.). The other mutants were found at levels comparable to wild type SERT (Fig. 12B.) and their affinity was similar (shown for in Fig. 4C. for SERT- TP613-614AA and SERT-KE605-606AA; summarized for all other mutants in Table 3). Two forms were resolved by denaturing gel electrophoresis, when the expression level of the transporters in transiently transfected cells was determined Fig. 12D.). In all mutants but SERT-PG601,602AA, -RI607,608AA and -RII607-609AAA, the level of the upper band was comparable to that observed with wild type SERT. In the three affected mutants the upper band was reduced with levels of SERT-RI607,608AA > SERT-RII607-609AAA >> SERT- PG601,602AA. This order was consistent with the reduction in uptake (Fig. 12A.) and in binding (Fig. 12B.). I surmised that the upper band corresponded to the mature fully glycosylated form and the lower band to the core glycosylated (ER-resident) form. This conjecture was verified by immunoprecipitating wild type SERT and a representative mutated version (SERT-RI607,608AA) and subjecting these proteins to deglycosylation by endoglycosidase H and PNGase F (Fig. 12E.). Endoglycosidase H cannot cleave complex type glycans that are attached while the protein traffics through the Golgi. Accordingly, the upper band (marked by an asterisk in Fig. 12E.) was not affected by endoglycosidase H- treatment. In contrast, endoglycosidase H reduced the mobility of the lower band (marked by a cross in Fig. 12E.) to an extent that was consistent with removal of the core glycan (product marked with a white line in Fig. 12E.). As expected PNGase F deglycosylated both forms. Hence both, wild type and mutant SERT migrated as a single species (Fig. 12E.). 40 A SERT-WT RLIITPGTFKERIIKSITPETPTEIPCGDIRLNAV SERT-PG601,602AA RLIITAATFKERIIKSITPETPTEIPCGDIRLNAV SERT-TF603-604AARLIITPGAAKERII KSITPETPTEIPCGDIRLNAV SERT-KE605-606AA RLIITPGTFAARIIKSITPETPTEIPCGDIRLNAV SERT-RI606-607AA RLIITPGTFKEAAIKSITPETPTEIPCGDIRLNAV SERT-RII607-609AAA RLIITPGTFKEAAAKSITPETPTEIPCGDIRLNAV SERT-IK609-610AA RLIITPGTFKERIAASITPETPTEIPCGDIRLNAV SERT-SI611-612AA RLIITPGTFKERIIKAATPETPTEIPCGDIRLNAV SERT-TP613-614AA RLIITPGTFKERIIKSIAAETPTEIPCGDIRLNAV B C D YFP-SERT -WT YFP-SERT–PG-AA YFP-SERT-TF-AA E F G YFP-SERT-KE-AA YFP-SERT-RI-AA YFP-SERT–RII-AAA H I J YFP-SERT-IK-AA YFP-SERT-SI-AA YFP-SERT-TP-AA Fig. 11. Scanning the region between P601 and P614 to identify sites required for export to the cell surface. $ Representation of the (pair-wise) substitution of amino acids by alanine.%: confocal imaging of the mutated transporters. Transient expression and confocal microscopy was performed as outlined in the legend to Fig. 9. 41 &(- &(- : &%% &%% '- '- -% -% (- (- 12-1# 8 5<)#6 $ 0 123 45<)#6 $ % 0 % # ) )# # 3 # 3 !3 ! " ; # " 3 # 3 # # # ; # "3 # 3 # # # # "3 " # "33 " ! " " "# " " ! !" !"# "# ! !" ! ! !"# ! ! !"# !"# ! !" !"# !"# ! * (% &- YFP-SERTRI-AA YFP-SERTTP-AA &% YFP-SERTWT YFP-SERTKE-AA YFP-SERTPG-AA %- 12 45 , 6 $ 0 %% % - &% &- 0$123 56 Fig. 12. Mutations of SERT in the position PG601,602, RI607,608 and RII607-609 blunt 5-HT uptake and binding of [3H]imipramine. HEK293 cells were transiently transfected with plasmids encoding the indicated mutants. $ Cellular uptake of [3H]5-HT was determined at 3 μM [3H]5-HT; assay conditions were otherwise as outlined in the legend to Fig. 2. All transfections and determinations were done in parallel. In order to account for interassay variation in transfection efficiency, data were normalized to uptake determined in wild type SERT expressing cells; this 100% uptake corresponded to 27.5±1.9 pmol/106 cells/min. %$ Binding of [3H]imipramine (3.6 nM) to membranes prepared from cells transiently expressing different versions of SERT; this 100% binding corresponded to 1.34±0.03 pmol/mg. Data in panels A & B are means from 5 independent experiments carried out in duplicate; error bars indicate S.E. C$ Binding of [3H]imipramine to membranes (15-30 μg/ assay) prepared from cells transiently expressing wild type SERT, SERT-PG601,602AA, SERT-KE605-606AA, SERT-RI607,608AA, and SERT-TP613-614AA. Data are from a representative experiment done in duplicate which is representative for at least two additional experiments (see also supplementary Table 2). D: Membranes were prepared from transiently transfected cells; the YFP-tagged versions of SERT were visualized with an anti-GFP antibody. E: Wild type SERT and SERT-RI607,608AA were enriched by immunoprecipitation, denatured and subjected to deglycosylation by incubation (for 1 h at 37°C) in the absence (control) and presence of endoglycosidase H (Endo H) or PNGase F. * denotes the mature glycosylated upper band, which is resistant to Endo H, + the lower band , which is cleaved by Endo H to generate a smaller product (marked with white line). Note that the immunoglobulin heavy chain is also visible (IgG Hc) and that this is deglycosylated by PNGase F. Numbers indicate the position of molecular mass markers (in kDa). 42 " ! &'() There are mechanisms that preclude the premature activation of membrane proteins: for instance rhodopsin is stabilized in the inactive conformation by the high cholesterol content of the membranes, while trafficking in the secretary pathway (Albert and Boesze-Battaglia, 2005). SERT is also exquisitely sensitive to the cholesterol content of membranes (Magnani et al., 2004; Tate et al., 2003). It is therefore conceivable that SERT is inactive when retained in the ER and this suffices to explain reduced capacity of SERT-PG601,602AA, SERT-RI607,608AA and of SERT-RII607-609AAA to bind [3H]imipramine. This possibility was explored by co-expressing wild type SERT with a dominant negative version of SAR1a (SAR1a-T39N) in HEK293 cells (Farhan et al., 2007). SAR1a-T39N is an established dominant negative (it is a GDP-trapped version, because it fails to undergo the Mg2+ dependent conformational switch to the active species SAR1a.GTP.Mg2+). As expected, co-expression of Sar1-T39N resulted in intracellular retention of SERT (Fig.13A-C.) and reduced cellular uptake to less than 1% of that observed in cells transfected with a control vector (Fig.13D.). Nevertheless membranes prepared from SAR1a-overexpressing cells contained abundant amounts SERT that bound [3H]imipramine (Fig 13E). The affinity of the ER-trapped SERT was comparable to that of transporter residing in the plasma membrane (Fig. 13F; KD 2.7± 0.6 nM and 3.7± 1.0 nM for SERT and SERT+ SAR1a-T39N, respectively). Retention of SERT was also achieved by overexpression of Sec24D-VN, a mutated version that disrupts ER-export of SLC6 family members in a dominant negative manner (Farhan et al., 2007). 43 !"# WT:SAR1-T39N &%% (1:6) '- -% : (- #: %-% 12-1# 8 5<)#6 $ 0 %(- %%% % . > * &= &=$ &= DNA ratio (WT:SAR1-T39N ) YFP-SERT WT &%% YFP-SERT WT+SAR1- T39N (1:6) &- '- &% -% (- %- 123 45 , 6 $ 123 45<)#6 0 $ 0 %% %% (- -% '- &%% &(- &-% &'- &=% &=$ &=. 0$123 56 DNA ratio (WT:SARI-T39N ) Fig. 13. Trapping the wild type SERT in endoplasmic reticulum abolishes uptake but does not affect binding of [3H] imipramine. HEK293 cells (0.7*106 cells) were transfected with a combination of plasmids encoding YFP-SERT (1 μg) + empty control plasmid or of the dominant negative version of SAR1a (SAR1 T39N) (6 μg in Panel A; 3- or 6-fold excess over YFP- SERT encoding plasmid in B-D). $ The cellular distribution of YFP-tagged SERT was visualized by confocal microscopy as outlined in the legend to Fig. 9. Cell surface was visualized by staining with trypan blue (Excitation wavelength: 543nm and long path filter: 585nm , B). *$ Uptake of [3H]5-HT was determined 3 at 2 μM [ H]serotonin as outlined in the legends to Fig. 12. The data were normalized to uptake determined in wild type SERT expressing cells; this 100% uptake corresponded to 17.8±1.3 pmol/106 cells/min. +,$ Binding of [3H]imipramine to membranes (15-30 μg/assay) prepared from cells transiently expressing wild type SERT in the absence and presence of the indicated ratios of 3 plasmid encoding SAR1a-T39N. The reaction contained 2.5 nM [ H]imipramine (E) or the indicated concentrations of radioligand and was carried out as outlined under - s. In Panel F, binding determined in the absence of co-expressed SAR1a-T39N was set 100% to normalize for interassay variation in transient transfections; this 100% value corresponds to 0.35±0.12 pmol pmol/mg. Data are means from 4 independent experiments carried out in duplicate; error bars indicate SE. 44 % ! . " /,- To obtain more direct evidence for defective folding I used the bacterial expression of SERT and of mutated versions tagged on its C-terminus with tagged GFP. This approach relies on the assumption that the C-terminal GFP can only undergo correct folding if the preceding polypeptide chain adopts a stable conformation (Waldo et al., 1999). However, this strategy failed, because expression of GFP-tagged wild type SERT did not give rise to fluorescent bacteria, while the positive (the GFP tagged E. coli dipeptide transporter YdgR) and negative controls (an untagged version of YdgR) gave the expected results (data are summarized in Fig. 14.) &-% YdgR-GFP (Non induced) eGFP (Non induced) $%%% YdgR-GFP (0.01 mM IPTG) eGFP (0.01 mM IPTG) &(- &%% (%%% '- -% &%%% 3 (- 3 % % % & ( $ 9 - . % & ( $ 9 - . # 4 5 6 # 4 5 6 &-% YdgR (Non induced) &-% hSERT - GFP (Non induced) YdgR (0.01 mM IPTG) hSERT - GFP (0.01 mM IPTG) &(- &(- &%% &%% '- '- -% -% (- 3 (- 3 % % % & ( $ 9 - . % & ( $ 9 - . # 4 5 6 # 4 5 6 Fig. 14. Expression of SERT as constructs that were fused on their C-terminus to GFP (pWaldo-system). Proteins were expressed as described in the Materials and Methods section, the fluorescence which indicates protein expression can be measured in the positive control (A&B) in time dependent manner. In contrast protein expression could not be detected in the negative control and SERT(C&D). 45 !"-/ 01 20132 !"40152016 !"44 015"017 . Since the bacterial expression did not produce reliable results, I exploited the ER- resident chaperone calnexin as folding sensor (Ou et al., 1993). Lysates were prepared from cells expressing wild type SERT and the three mutants suspected of defective folding. These lysates were used as a starting material for immunoprecipitation. When applied onto a denaturing polyacrylamide gel with a low monomer concentration, it was possible to resolve two species (Fig. 15A.): the band migrating with a larger apparent mass was diffuse in appearance and hence consistent with extensive glycosylation. The lower sharp band presumably represented the core glycosylated species. This assignment is consistent with the observation that the diffuse band was prominent in wild type SERT, present to a lesser extent in SERT-RI607,608AA (which does reach the cell surface to some extent) and essentially undetectable in SERT-RII607-609AAA and SERT-PG601,602AA (Fig. 15A.). Endogenous calnexin levels were reasonably similar, regardless of the SERT version expressed (Fig. 15A.). Wild type SERT and the mutants were recovered from the lysate by immunoprecipitation using the antibody directed against GFP (Fig. 15B). It is evident from Fig. 15B. and the quantiftation in Fig. 15C. that substantial amounts of calnexin were co- immunprecipitated with the three mutated versions of SERT. In contrast, only trace amounts of calnexin were present in the material immunoprecipitated from wild type SERT containing lysates (left hand lane in the lower blot Fig. 15B.), although these immunoprecipitates contained abundant amount of SERT ( . left hand lane in the upper blot of Fig. 15B). Comparable results were observed, if the immunoprecipitation was done with calnexin and the level of co-immunoprecipitated SERT was assessed by blotting for GFP (Fig. 15D.). It is worth noting that, as expected, only the lower (core glycoysylated) band was recovered in complex with calnexin (Fig. 15D.). 46 Fig. 15. Complex formation of SERT-PG601,602AA, SERT-RI607,608AA and SERT- RII607-609AAA with calnexin. HEK293 cells (2.5 * 106 cells) were transiently transfected with plasmids driving the expression of wild type SERT, SERT-PG601,602AA, SERT-RI607,608AA and SERT-RII607- 609AAA. 48h after transfection, detergent lysates were prepared from cells subjected to immunoprecipitation with an antibody directed against GFP or calnexin as outlined under - . A: Lysate were blotted for GFP and calnexin. The Ponceaus S- stained nitrocellulose is shown to document equivalent loading. B: Aliquots of the immunoprecipitate by anti-GFP (corresponding to 2.5x105 cells) were applied onto a SDS polyacrylamide gel (10% monomer concentration in the resolving gel) and blotted for the YFP-tag of SERT and calnexin. C: The integrated density was quantified using ImageJ 1.43 and used to calculate the ratio of calnexin- (CNX) over SERT (=GFP)- immunoreavtivity. *: Calnexin was immunoprecipitated from cell lysates and the levels of associated SERT was visualized by blotting with the anti-GFP antibody. For comparison, the level of SERT in the lysate was also visualized. Note that the immunoprecipitate only contains the lower band. Data are from a representative experiment that was reproduced three more times in independent transfections. 47 !"4 0152016 !"44 015"017 !"-/ 01 20132 In many instances folding deficiencies can be corrected by chemical and pharmacological chaperones. Chaperones are small molecules that assist in folding of a protein either in a non-specific manner (, DMSO) or by virtue of a specific interaction with their cognate target (Welch and Brown, 1996). We therefore tested if the non-specific chemical chaperone DMSO rescued SERT mutants by incubating transiently transfected cells for 24 h in the presence of 2% DMSO (Fig 16A). This resulted in a substantial increase in the level of SERT-RI607,608AA and SERT-RII607-609AAA that bound [3H]imipramine. In contrast, the level of wild type SERT was not increased by DMSO treatment. We searched for specific pharmacochaperones by examining the effect of the inhibitor imipramine (which binds to the outward facing conformation), the substrate serotonin (which induces an occluded state) and ibogaine (which preferentially binds to the inward facing conformation; see (Jacobs et al., 2007)). Neither imipramine (Fig. 16C) nor serotonin (Fig. 16C) nor -chloroamphetamine (Fig. 16E) nor incubation at low temperature (Fig. 8F) affected the functional (i.e., binding competent) level of any of the SERT versions tested, but ibogaine effectively increased the amount of active SERT-RI607,608AA and SERT-RII607-609AAA (Fig. 16D). SERT-PG601,602 did not respond to any of these ligands. Similarly, the expression levels of wild type SERT were not enhanced by any manipulation. Half-maximum stimulation was seen at 6.7 ± 3.5 μM ibogaine (Fig. (17A), ., in the range of affinity (6.3 ± 1.3 M) previously determined (Jacobs et al., 2007). The maximum effect was achieved within a 24 h incubation time (Fig. 17B). Incubation of cells expressing SERT-RII607-609AAA with ibogaine or DMSO also increased the level of substrate uptake indicating that the pharmacochaperoned mutant transporter eventually reached the cell surface (Fig. 17C). The pharmacochaperoning effect of ibogaine or of DMSO ought to result in a decline in association of SERT-RII607-609AAA with the folding sensor calnexin. Immunoprecipitates of SERT-RII607-609AAA retrieved from ibogaine- and DMSO-treated cells contained on average lower amounts of calnexin (Fig. 17D). However, this difference was not statistically significant. We ascribe this failure to the low sensitivity of the method employed, which cannot reliably detect a decline of complexes by some 25%. 48 &(- A ns Control &(- D ns Control DMSO (2%) * Ibogaine (100M) &%% &%% *** '- '- * *** -% -% (- (- ns ns 12 4 5<)#6 12 4 5<)#6 $ $ 0 0 % % )# ; "3 "33 )# ; "3 "33 &(- B ns Control &(- E ns Control 5-HT 100M) &%% &%% PCA (100 M) '- '- ns ns -% ns -% ns (- ns (- ns 12 4 5<)#6 12 4 5<)#6 $ $ 0 0 % % )# ; "3 "33 )# ; "3 "33 &(- C ns Control &(- F ns Control Imipramine (10M) &%% &%% 31 C '- '- ns ns -% ns -% ns (- (- ns ns 12 4 5<)#6 12 4 5<)#6 $ $ 0 % 0 % )# ; "3 "33 )# ; "3 "33 Fig. 16. Rescue of SERT mutant by different chemical and pharmacological chaperones. HEK293 cells were transfected with cDNAs encoding wild type SERT, SERT- PG601,602AA, SERT-RI607,608AA and SERT-RII607-609AAA. 24h after transfection 2% DMSO (A), 100 M 5-HT (B), 10 M imipramine (C), 100 M ibogaine (D) o or 100 M -chloroamphetamine (E) and incubated at 37 C or incubated at 31oC (F). After an incubation for another 24 h, membranes were prepared; the binding was carried out with these membranes (100 μg/assay) in the presence of 1 nM of [3H]imipramine as outlined in the legend to Fig. 5. Binding to membranes prepared from untreated control cells expressing wild type SERT was set 100% to normalize for interassay variation in transient transfections; this 100% value corresponds to 0.32±0.11 pmol/mg. Note that all assays were done in parallel such that the control conditions are the same in each panel; the separation in individual panels is to render the data more accessible. Data are means from 3-5 independent experiments carried out in duplicate; error bars represent S.E. Differences were tested for statistical significance by paired t-test (*, p<0.05; ***, p<0.001). 49 Y FP- hSERT : %$% RII-AAA %$% Y FP- hSERT RII-AAA %(- %(- %(% %(% %&- %&- %&% %&% %%- %%- 12 45 , 6 $ 0 12 45 , 6 %%% %%% $ 0 % (-% -%% '-% &%%% % &% (% $% 5 6 ? &%% 5 6 * Control Control &(- &-% Ibogaine (100M) Ibogaine (100M) DMSO (2%) &%% &(- DMSO (2%) &%% '- %'- -% @@ @ %-% (- 12-1# 8 5<)#6 %(- $ 0 % 3 44 5*AB,; 6 %%% !"#)# !"#"33 !"#)# Fig. 17. Ibogaine-induced change in [3H]imipramine binding by, substrate uptake by and calnexin association with SERT-RII607-609AAA . Transiently transfected cells were treated 24 h after transfection for another 24 h with the indicated concentrations of ibogaine (A) or for the indicated incubation times with 100 μM ibogaine (B). Membranes were prepared from the cells and binding of 2.5 3 nM [ H]imipramine binding was determined as outlined for Fig. 7. : The pretreatment schedule was similar as in Panel A; the incubation was done in the presence of 100 μM ibogaine and 2% DMSO. Uptake was determined in the 3 presence of 3 μM [ H] serotonin. Data are means from 3 (A-B) and 4 (C) independent experiments carried out in duplicate; error bars represent s.e.m. Differences were tested for statistical significance by ANOVA (*, p<0.05; **, 607-609 p<0.01). D: Transiently transfected HEK 293 cells expressing SERT-RII AAA were treated with ibogaine and DMSO as in panel A. The cells were subsequently lysed, SERT was recovered by immunoprecitpation and the level of SERT and of calnexin were determined by immunoblotting as outlined in the legend to Fig. 6B and Fig. 6C. Shown are the ratios of calnexin (CNX) immunoreactivity over SERT (GFP)-immunoreactivity. The differences were not statistically significant (Kruskal- Wallis test, means ± S.E..; n = 5). 50 4. DISCUSSION Delivery of SLC6 family members to the cell surface is contingent on motifs in their carboxyl termini (Farhan et al., 2004; Farhan et al., 2007; Farhan et al., 2008; Fernandez- Sanchez et al., 2008; Jacobs et al., 2007; Reiterer et al., 2008)). The C-terminus of SERT has not yet been scrutinized for its role in trafficking but it has been noted previously that truncations lead to transporters that fail to translocate substrate and to reach the cell surface (Larsen et al., 2006). It was also observed that substitutions of alanines for amino acids N- terminal to the last 16 residues reduced activity, but mechanistic details were not provided (Larsen et al., 2006). Results from truncation experiments are consistent with these experiments and showed, in addition, that the retained proteins were inactive. By following up on these earlier observations, we discovered that the C-terminus was required to assist the folding process in the endoplasmic reticulum. Specifically, there are two sites; PG601,602 and RI607,608 that are indispensable for producing a functional transporter. R607 was also identified as a critical residue by Larsen and co-workers while PG601,602 was not examined (Larsen et al., 2006). My experiments provide several arguments to support this interpretation: (i) serial truncation and the pertinent point mutations did not only result in loss of surface expression, but also in binding. (ii) Forced retention of SERT in the ER does not abolish binding. Thus loss of inhibitor binding cannot be attributed to possible alternative explanations, i.e., a lipid composition in the ER that is not conducive to a binding competent state or the presence of an inhibitory protein that precludes premature activation of the transporter. (iii) The fact that abundant amounts of the pertinent mutants (SERT-PG601,602AA, SERT-RI607,608AA) were recovered in complex with calnexin proves that these proteins did not achieve a folded state. It is worth noting that when heterologously expressed in HEK293 (and other) cells, wild type SERT is not prone to associate with calnexin (Korkhov et al., 2008), indicating that these cells contain the machinery to efficiently support its folding. (iv) The folding deficiency of SERT-RI607,608AA was remedied by chemical chaperoning with DMSO and by pharmacochaperoning with ibogaine. Little is known about the role of C-terminus in the folding of SLC6 family members, but it is well appreciated that C-terminus supports folding of G protein-coupled receptors (GPCR's) (Bermak et al., 2001; Carrel et al., 2006; Duvernay et al., 2009b; Pankevych et al., 2003) . Truncation made in the proline-rich part of A1-receptor C-terminus precludes folding of the protein (Pankevych et al., 2003). This is reminiscent of the phenotype of SERT-C 17, 51 which severs the following proline-rich segment. We note that the alanine substitution of TP 613,614 did not phenocopy the effect of the truncation on folding and ER-export. This discrepancy can be rationalized by assuming that, in the point mutant, the replacement of P614 can be compensated for by the presence of the other C-terminal residues. More recently, a hydrophobic tetrad (ILLV) has been shown to be essential for folding of an SLC2 transporter family member, the Na+-K+-2Cl--cotransporter-1 (NKCC1) (Nezu et al., 2009). Mechanistically, the mutations, in both GPCR's and in NKCC1, have been proposed to affect the capacity of the C-terminus to recruit cytoplasmic chaperones and to interact with residues in intracellular loops. The latter interaction is thought to be crucial to assist in stabilizing the assembly of the hydrophobic helical core. Pharmacochaperoning has been extensively studied in certain mutated GPCR's, because ligand-assisted folding may remedy diseases resulting from the mutation (Conn et al., 2007). To the best of our knowledge, there has been no report that investigated pharmacochaperoning of SLC6 transporters. Pharmacochaperoning of SERT has the following salient features: (i) expression of wild type SERT is neither enhanced by the (universal) chemical chaperone DMSO nor by typical ligands regardless of their conformational preference. This is consistent with the interpretation that the folding machinery present in HEK293 cells efficiently supports the maturation of SERT. (ii) Defective folding of SERT-RI607,608AA (and its relative SERT-RII607-609AAA) can be partially remedied but only by DMSO or ibogaine, which binds to the inward facing conformation (Jacobs et al., 2007). In contrast, folding of SERT-RI607,608AA was not rescued by imipramine (which binds to the outward facing conformation) the substrate serotonin (which prefers the occluded state) or -chloro-amphetamine (which induces transporter- mediated efflux (Sitte and Freissmuth, 2010)). All compounds selected can readily permeate into cells Thus, their inability to act as pharmacochaperones cannot be attributed to a diffusion barrier that shielded their target, i.e., the mutant SERT residing in the ER. (iii) The observation that ibogaine was the only compound that acted as a pharmacochaperone suggests that the folding trajectory proceeds via the inward facing conformation. This is also consistent with the ionic gradient that exists over the membrane of the endoplasmic reticulum: the lumen of the ER corresponds to the extracellular milieu but is devoid of Na+. These conditions favor accumulation of the inward facing conformation (Sitte et al., 2001). Accordingly, folding intermediates of SERT will eventually pass through this state. It is 52 therefore readily rationalized why ibogaine is the only compound capable of pharmacochaperoning a folding defective transporter mutant. The second amino acid mutated in SERT-PG601,602AA mutant is G602, which corresponds to G585 in DAT. Mutation to alanine resulted in a complete retention of the resulting DAT- G585A in the ER (Miranda et al., 2004). In their work, Miranda et al. did not directly determine whether DAT- G585A was functional (i.e., bound inhibitory radioligands) but proposed that it was correctly folded because it formed complexes with and retained wild type DAT in the ER. It may be argued that SERT-PG601,602AA was correctly folded but did not bind [3H]imipramine because it is in the inward facing conformation. This considers action is unlikely. Mutated versions of SERT, which are trapped in the inward facing conformation and thus have very low affinity for inhibitory radioligands, are nevertheless readily exported to the cell surface (Korkhov et al., 2006; Sucic et al., 2010). I therefore propose an alternative explanation for the phenotype of DAT-G602A, namely that the protein is poorly folded and co-aggregates with the wild type transporter. This interpretation is supported by the finding that the C-terminally mutated Na+-K+-2Cl--cotransporter-1 (NKCC1) is trapped in large aggregates of non-functional protein rather than dimers (Nezu et al., 2009). Folding of transmembrane proteins is thought to be assisted by chaperones (2 GRP78, calnexin) within the ER lumen. Based on the observations, I propose that folding of SERT is also assisted by a chaperone that binds to its intracellular C-terminal portion. In fact, there is precedent in support for this conjecture: folding of CFTR (the cystic fibrosis transmembrane conductance regulator), for instance, is assisted by several chaperones that bind to the cytoplasmic surface of CFTR (Farinha et al., 2002). Similarly, the DnaJ/Hsp 40 chaperone DRIP78 binds to C-terminus of the D1-dopamine receptor (Bermak et al., 2001). In my hypothetical model we propose that the spots relevant for the interaction with this putative chaperone include the (conserved) R607I608- the P601G602-motif. Both motifs are conserved in all SLC6 family members. The R607I608-motif is the conserved motif for interaction with Sec24 (Farhan et al., 2007). This model posits that the putative chaperone binds to this region and thus samples the folding state of the transporter. This would lead to an attractive proof reading mechanism: binding of Sec24 is contingent on prior release of the chaperone, which precludes premature recruitment of Sec24 and export of a partially unfolded transporter. This model is currently being explored. 53 5. REFERENCES: Albert AD and Boesze-Battaglia K (2005) The role of cholesterol in rod outer segment membranes. - 8 44(2-3):99-124. Andreasen JT and Redrobe JP (2009) Nicotine, but not mecamylamine, enhances antidepressant-like effects of citalopram and reboxetine in the mouse forced swim and tail suspension tests. % % 197(1):150-156. Aridor M, Weissman J, Bannykh S, Nuoffer C and Balch WE (1998) Cargo selection by the COPII budding machinery during export from the ER. 9 % 141(1):61-70. Awtry TL, Frank JG and Werling LL (2006) In vitro regulation of serotonin transporter activity by protein kinase A and nicotinic acetylcholine receptors in the prefrontal cortex of rats. 59(6):342-349. Barkan T, Gurwitz D, Levy G, Weizman A and Rehavi M (2004) Biochemical and pharmacological characterization of the serotonin transporter in human peripheral blood lymphocytes. 14(3):237-243. Baudry A, Mouillet-Richard S, Schneider B, Launay JM and Kellermann O (2010) miR-16 targets the serotonin transporter: a new facet for adaptive responses to antidepressants. 329(5998):1537-1541. Bauman AL, Apparsundaram S, Ramamoorthy S, Wadzinski BE, Vaughan RA and Blakely RD (2000) Cocaine and antidepressant-sensitive biogenic amine transporters exist in regulated complexes with protein phosphatase 2A. 9 20(20):7571-7578. Bauman PA and Blakely RD (2002) Determinants within the C-terminus of the human norepinephrine transporter dictate transporter trafficking, stability, and activity. % % 404(1):80-91. Benmansour S, Cecchi M, Morilak DA, Gerhardt GA, Javors MA, Gould GG and Frazer A (1999) Effects of chronic antidepressant treatments on serotonin transporter function, density, and mRNA level. 9 19(23):10494-10501. Benvenga MJ and Leander JD (1993) Antidepressant-like effect of LY228729 as measured in the rodent forced swim paradigm. 9 - 239(1-3):249-252. 54 Bermak JC, Li M, Bullock C and Zhou QY (2001) Regulation of transport of the dopamine D1 receptor by a new membrane-associated ER protein. % 3(5):492-498. Bernier V, Lagace M, Bichet DG and Bouvier M (2004) Pharmacological chaperones: potential treatment for conformational diseases. ! : 15(5):222-228. Blasi J, Chapman ER, Yamasaki S, Binz T, Niemann H and Jahn R (1993) Botulinum neurotoxin C1 blocks neurotransmitter release by means of cleaving HPC- 1/syntaxin. :%; 9 12(12):4821-4828. Bonifacino JS and Glick BS (2004) The mechanisms of vesicle budding and fusion. 116(2):153-166. Brown CR, Hong-Brown LQ and Welch WJ (1997) Correcting temperature-sensitive protein folding defects. 9 4 99(6):1432-1444. Bruns D and Jahn R (1995) Real-time measurement of transmitter release from single synaptic vesicles. 377(6544):62-65. Busch W and Saier MH, Jr. (2002) The transporter classification (TC) system, 2002. % : % 37(5):287-337. Callebert J, Esteve JM, Herve P, Peoc'h K, Tournois C, Drouet L, Launay JM and Maroteaux L (2006) Evidence for a control of plasma serotonin levels by 5- hydroxytryptamine(2B) receptors in mice. 9 - ! 317(2):724-731. Carneiro AM and Blakely RD (2006) Serotonin-, protein kinase C-, and Hic-5-associated redistribution of the platelet serotonin transporter. 9 % 281(34):24769- 24780. Carneiro AM, Ingram SL, Beaulieu JM, Sweeney A, Amara SG, Thomas SM, Caron MG and Torres GE (2002) The multiple LIM domain-containing adaptor protein Hic-5 synaptically colocalizes and interacts with the dopamine transporter. 9 22(16):7045-7054. Carrel D, Hamon M and Darmon M (2006) Role of the C-terminal di-leucine motif of 5- HT1A and 5-HT1B serotonin receptors in plasma membrane targeting. 9 119(Pt 20):4276-4284. 55 Cervinski MA, Foster JD and Vaughan RA (2010) Syntaxin 1A regulates dopamine transporter activity, phosphorylation and surface expression. 170(2):408-416. Chang S, Hemmings HC, Jr. and Aderem A (1996) Stimulus-dependent phosphorylation of MacMARCKS, a protein kinase C substrate, in nerve termini and PC12 cells. 9 % 271(2):1174-1178. Chanrion B, la Cour CM, Bertaso F, Lerner-Natoli M, Freissmuth M, Millan MJ, Bockaert J and Marin P (2007) Physical interaction between the serotonin transporter and neuronal nitric oxide synthase underlies reciprocal modulation of their activity. - < 104(19):8119-8124. Conn PM, Leanos-Miranda A and Janovick JA (2002) Protein origami: therapeutic rescue of misfolded gene products. : 4 2(5):308-316. Conn PM, Ulloa-Aguirre A, Ito J and Janovick JA (2007) G protein-coupled receptor trafficking in health and disease: lessons learned to prepare for therapeutic mutant rescue in vivo. - 59(3):225-250. Davidson C and Stamford JA (1997) Synergism of 5-HT 1B/D antagonists with paroxetine on serotonin efflux in rat ventral lateral geniculate nucleus slices. % % 43(4):405-409. Daws LC, Gerhardt GA and Frazer A (1999) 5-HT1B antagonists modulate clearance of extracellular serotonin in rat hippocampus. 8 266(3):165-168. Delisle BP, Anderson CL, Balijepalli RC, Anson BD, Kamp TJ and January CT (2003) Thapsigargin selectively rescues the trafficking defective LQT2 channels G601S and F805C. 9 % 278(37):35749-35754. Demas GE, Eliasson MJ, Dawson TM, Dawson VL, Kriegsfeld LJ, Nelson RJ and Snyder SH (1997) Inhibition of neuronal nitric oxide synthase increases aggressive behavior in mice. : : 3(9):610-616. Dobson CM (2004) Principles of protein folding, misfolding and aggregation. * % 15(1):3-16. 56 Duvernay MT, Dong C, Zhang X, Zhou F, Nichols CD and Wu G (2009a) Anterograde trafficking of G protein-coupled receptors: function of the C-terminal F(X)6LL motif in export from the endoplasmic reticulum. : - 75(4):751-761. Duvernay MT, Dong C, Zhang X, Zhou F, Nichols CD and Wu G (2009b) Anterograde trafficking of G protein-coupled receptors: function of the C-terminal F(X)6LL motif in export from the endoplasmic reticulum. : - 75(4):751-761. Egan ME, Glockner-Pagel J, Ambrose C, Cahill PA, Pappoe L, Balamuth N, Cho E, Canny S, Wagner CA, Geibel J and Caplan MJ (2002) Calcium-pump inhibitors induce functional surface expression of Delta F508-CFTR protein in cystic fibrosis epithelial cells. : 8(5):485-492. Egan ME, Pearson M, Weiner SA, Rajendran V, Rubin D, Glockner-Pagel J, Canny S, Du K, Lukacs GL and Caplan MJ (2004) Curcumin, a major constituent of turmeric, corrects cystic fibrosis defects. 304(5670):600-602. Ellgaard L and Frickel EM (2003) Calnexin, calreticulin, and ERp57: teammates in glycoprotein folding. % % 39(3):223-247. Ellgaard L and Helenius A (2003) Quality control in the endoplasmic reticulum. : % 4(3):181-191. Ellgaard L, Molinari M and Helenius A (1999) Setting the standards: quality control in the secretory pathway. 286(5446):1882-1888. Faivre V, Rosilio V, Manivet P, Langevin D, Launay JM and Baszkin A (2001) Molecular organization of the human serotonin transporter at the air/water interface. ,% 8 492(1-2):14-19. Farhan H, Korkhov VM, Paulitschke V, Dorostkar MM, Scholze P, Kudlacek O, Freissmuth M and Sitte HH (2004) Two discontinuous segments in the carboxyl terminus are required for membrane targeting of the rat gamma-aminobutyric acid transporter-1 (GAT1). 9 % 279(27):28553-28563. Farhan H, Reiterer V, Korkhov VM, Schmid JA, Freissmuth M and Sitte HH (2007) Concentrative export from the endoplasmic reticulum of the gamma-aminobutyric acid transporter 1 requires binding to SEC24D. 9 % 282(10):7679-7689. 57 Farhan H, Reiterer V, Kriz A, Hauri HP, Pavelka M, Sitte HH and Freissmuth M (2008) Signal-dependent export of GABA transporter 1 from the ER-Golgi intermediate compartment is specified by a C-terminal motif. 9 121(6):753-761. Farinha CM, Nogueira P, Mendes F, Penque D and Amaral MD (2002) The human DnaJ homologue (Hdj)-1/heat-shock protein (Hsp) 40 co-chaperone is required for the in vivo stabilization of the cystic fibrosis transmembrane conductance regulator by Hsp70. % 9 366(Pt 3):797-806. Fernandez-Sanchez E, Diez-Guerra FJ, Cubelos B, Gimenez C and Zafra F (2008) Mechanisms of endoplasmic-reticulum export of glycine transporter-1 (GLYT1). % 9 409(3):669-681. Fisar Z, Anders M and Kalisova L (2005) Effect of pharmacologically selective antidepressants on serotonin uptake in rat platelets. / - % 24(1):113- 128. Foster BA, Coffey HA, Morin MJ and Rastinejad F (1999) Pharmacological rescue of mutant p53 conformation and function. 286(5449):2507-2510. Fox MA, Jensen CL, Gallagher PS and Murphy DL (2007) Receptor mediation of exaggerated responses to serotonin-enhancing drugs in serotonin transporter (SERT)-deficient mice. 53(5):643-656. Free RB, Hazelwood LA, Cabrera DM, Spalding HN, Namkung Y, Rankin ML and Sibley DR (2007) D1 and D2 dopamine receptor expression is regulated by direct interaction with the chaperone protein calnexin. 9 % 282(29):21285-21300. Geerlings A, Lopez-Corcuera B and Aragon C (2000) Characterization of the interactions between the glycine transporters GLYT1 and GLYT2 and the SNARE protein syntaxin 1A. ,% 8 470(1):51-54. Giraudo CG and Maccioni HJ (2003) Endoplasmic reticulum export of glycosyltransferases depends on interaction of a cytoplasmic dibasic motif with Sar1. : % 14(9):3753-3766. Glickman MH and Ciechanover A (2002) The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. - 82(2):373-428. 58 Gregersen N (2006) Protein misfolding disorders: pathogenesis and intervention. 9 4 : * 29(2-3):456-470. Gu HH, Ahn J, Caplan MJ, Blakely RD, Levey AI and Rudnick G (1996) Cell-specific sorting of biogenic amine transporters expressed in epithelial cells. 9 % 271(30):18100-18106. Guo Z, Liu L, Cafiso D and Castle D (2002) Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. 9 % 277(38):35357-35363. Haase J, Killian AM, Magnani F and Williams C (2001) Regulation of the serotonin transporter by interacting proteins. % ! 29(Pt 6):722-728. Hammond C, Braakman I and Helenius A (1994) Role of N-linked oligosaccharide recognition, glucose trimming, and calnexin in glycoprotein folding and quality control. - < 91(3):913-917. Hansen HH and Mikkelsen JD (1998) Long-term effects on serotonin transporter mRNA expression of chronic neonatal exposure to a serotonin reuptake inhibitor. 9 - 352(2-3):307-315. Horschitz S, Hummerich R and Schloss P (2001) Structure, function and regulation of the 5-hydroxytryptamine (serotonin) transporter. % ! 29(Pt 6):728-732. Iceta R, Mesonero JE, Aramayona JJ and Alcalde AI (2006) Molecular characterization and intracellular regulation of the human serotonin transporter in Caco-2 cells. 9 - - 57(1):119-130. Jacobs MT, Zhang YW, Campbell SD and Rudnick G (2007) Ibogaine, a noncompetitive inhibitor of serotonin transport, acts by stabilizing the cytoplasm-facing state of the transporter. 9 % 282(40):29441-29447. Jayanthi LD, Samuvel DJ, Blakely RD and Ramamoorthy S (2005) Evidence for biphasic effects of protein kinase C on serotonin transporter function, endocytosis, and phosphorylation. : - 67(6):2077-2087. Jess U, El Far O, Kirsch J and Betz H (2002) Interaction of the C-terminal region of the rat serotonin transporter with MacMARCKS modulates 5-HT uptake regulation by protein kinase C. % % 294(2):272-279. 59 Just H, Sitte HH, Schmid JA, Freissmuth M and Kudlacek O (2004) Identification of an additional interaction domain in transmembrane domains 11 and 12 that supports oligomer formation in the human serotonin transporter. 9 % 279(8):6650- 6657. Kittler K, Lau T and Schloss P (2010) Antagonists and substrates differentially regulate serotonin transporter cell surface expression in serotonergic neurons. 9 - 629(1-3):63-67. Korkhov VM, Holy M, Freissmuth M and Sitte HH (2006) The conserved glutamate (Glu136) in transmembrane domain 2 of the serotonin transporter is required for the conformational switch in the transport cycle. 9 % 281(19):13439-13448. Korkhov VM, Milan-Lobo L, Zuber B, Farhan H, Schmid JA, Freissmuth M and Sitte HH (2008) Peptide-based interactions with calnexin target misassembled membrane proteins into endoplasmic reticulum-derived multilamellar bodies. 9 : % 378(2):337-352. Larsen MB, Fjorback AW and Wiborg O (2006) The C-terminus is critical for the functional expression of the human serotonin transporter. % 45(4):1331- 1337. Lau T, Horschitz S, Berger S, Bartsch D and Schloss P (2008) Antidepressant-induced internalization of the serotonin transporter in serotonergic neurons. , % 9 22(6):1702-1714. Launay JM, Geoffroy C, Mutel V, Buckle M, Cesura A, Alouf JE and Daprada M (1992) One-Step Purification of the Serotonin Transporter Located at the Human Platelet Plasma-Membrane. 9 % 267(16):11344-11351. Launay JM, Schneider B, Loric S, Da Prada M and Kellermann O (2006) Serotonin transport and serotonin transporter-mediated antidepressant recognition are controlled by 5-HT2B receptor signaling in serotonergic neuronal cells. , % 9 20(11):1843-1854. Leandro P and Gomes CM (2008) Protein misfolding in conformational disorders: rescue of folding defects and chemical chaperoning. : : 8(9):901-911. 60 Lee KH, Kim MY, Kim DH and Lee YS (2004) Syntaxin 1A and receptor for activated C kinase interact with the N-terminal region of human dopamine transporter. 29(7):1405-1409. Lenhard T and Reilander H (1997) Engineering the folding pathway of insect cells: generation of a stably transformed insect cell line showing improved folding of a recombinant membrane protein. % % 238(3):823-830. Lesch KP, Wolozin BL, Estler HC, Murphy DL and Riederer P (1993) Isolation of a cDNA encoding the human brain serotonin transporter. 9 ! / 91(1):67-72. Liu L, Guo Z, Tieu Q, Castle A and Castle D (2002) Role of secretory carrier membrane protein SCAMP2 in granule exocytosis. : % 13(12):4266-4278. Loo TW and Clarke DM (1997) Correction of defective protein kinesis of human P- glycoprotein mutants by substrates and modulators. 9 % 272(2):709-712. Mager S, Min C, Henry DJ, Chavkin C, Hoffman BJ, Davidson N and Lester HA (1994) Conducting states of a mammalian serotonin transporter. 12(4):845-859. Magnani F, Tate CG, Wynne S, Williams C and Haase J (2004) Partitioning of the serotonin transporter into lipid microdomains modulates transport of serotonin. 9 % 279(37):38770-38778. Malaga-Dieguez L, Yang Q, Bauer J, Pankevych H, Freissmuth M and Nanoff C (2010) Pharmacochaperoning of the A1 adenosine receptor is contingent on the endoplasmic reticulum. : - 77(6):940-952. Mancias JD and Goldberg J (2005) Exiting the endoplasmic reticulum. ! 6(4):278- 285. Masson J, Sagne C, Hamon M and El Mestikawy S (1999) Neurotransmitter transporters in the central nervous system. - 51(3):439-464. Maurel JL, Autin JM, Funes P, Newman-Tancredi A, Colpaert F and Vacher B (2007) High-efficacy 5-HT1A agonists for antidepressant treatment: a renewed opportunity. 9 : 50(20):5024-5033. Mezzacasa A and Helenius A (2002) The transitional ER defines a boundary for quality control in the secretion of tsO45 VSV glycoprotein. ! 3(11):833-849. 61 Miller EA, Beilharz TH, Malkus PN, Lee MCS, Hamamoto S, Orci L and Schekman R (2003) Multiple cargo binding sites on the COPII subunit Sec24p ensure capture of diverse membrane proteins into transport vesicles. 114(4):497-509. Miranda M, Sorkina T, Grammatopoulos TN, Zawada WM and Sorkin A (2004) Multiple molecular determinants in the carboxyl terminus regulate dopamine transporter export from endoplasmic reticulum. 9 % 279(29):30760-30770. Morello JP, Salahpour A, Laperriere A, Bernier V, Arthus MF, Lonergan M, Petaja-Repo U, Angers S, Morin D, Bichet DG and Bouvier M (2000) Pharmacological chaperones rescue cell-surface expression and function of misfolded V2 vasopressin receptor mutants. 9 4 105(7):887-895. Moss FJ, Imoukhuede PI, Scott K, Hu J, Jankowsky JL, Quick MW and Lester HA (2009) GABA transporter function, oligomerization state, and anchoring: correlates with subcellularly resolved FRET. 9 / - 134(6):489-521. Mossessova E, Bickford LC and Goldberg J (2003) SNARE selectivity of the COPII coat. 114(4):483-495. Muller HK, Wiborg O and Haase J (2006) Subcellular redistribution of the serotonin transporter by secretory carrier membrane protein 2. 9 % 281(39):28901- 28909. Muneoka K, Ogawa T, Kamei K, Mimura Y, Kato H and Takigawa M (2001) Nicotine exposure during pregnancy is a factor which influences serotonin transporter density in the rat brain. 9 - 411(3):279-282. Myat MM, Chang S, Rodriguez-Boulan E and Aderem A (1998) Identification of the basolateral targeting determinant of a peripheral membrane protein, MacMARCKS, in polarized cells. % 8(12):677-683. Nelson N (1998) The family of Na+/Cl- neurotransmitter transporters. 9 71(5):1785-1803. Nezu A, Parvin MN and Turner RJ (2009) A Conserved Hydrophobic Tetrad near the C Terminus of the Secretory Na+-K+-2Cl(-) Cotransporter (NKCC1) Is Required for Its Correct Intracellular Processing. 9 % 284(11):6869- 6876. 62 Ou WJ, Cameron PH, Thomas DY and Bergeron JJ (1993) Association of folding intermediates of glycoproteins with calnexin during protein maturation. 364(6440):771-776. Pagano A, Letourneur F, Garcia-Estefania D, Carpentier JL, Orci L and Paccaud JP (1999) Sec24 proteins and sorting at the endoplasmic reticulum. 9 % 274(12):7833-7840. Palade G (1975) Intracellular aspects of the process of protein synthesis. 189(4200):347-358. Pankevych H, Korkhov V, Freissmuth M and Nanoff C (2003) Truncation of the A1 adenosine receptor reveals distinct roles of the membrane-proximal carboxyl terminus in receptor folding and G protein coupling. 9 % 278(32):30283- 30293. Parodi AJ (2000) Protein glucosylation and its role in protein folding. % 69:69-93. Perlmutter DH (2002) Chemical chaperones: a pharmacological strategy for disorders of protein folding and trafficking. - 52(6):832-836. Pineyro G and Blier P (1999) Autoregulation of serotonin neurons: role in antidepressant drug action. - 51(3):533-591. Pizzinat N, Girolami JP, Parini A, Pecher C and Ordener C (1999) Serotonin metabolism in rat mesangial cells: involvement of a serotonin transporter and monoamine oxidase A. = 4 56(4):1391-1399. Qian Y, Galli A, Ramamoorthy S, Risso S, DeFelice LJ and Blakely RD (1997) Protein kinase C activation regulates human serotonin transporters in HEK-293 cells via altered cell surface expression. 9 17(1):45-57. Quick MW (2003) Regulating the conducting states of a mammalian serotonin transporter. 40(3):537-549. Quick MW, Hu J, Wang D and Zhang HY (2004) Regulation of a gamma-aminobutyric acid transporter by reciprocal tyrosine and serine phosphorylation. 9 % 279(16):15961-15967. 63 Quintero CA, Giraudo CG, Villarreal M, Montich G and Maccioni HJ (2010) Identification of a site in Sar1 involved in the interaction with the cytoplasmic tail of glycolipid glycosyltransferases. 9 % 285(39):30340-30346. Ramamoorthy S, Giovanetti E, Qian Y and Blakely RD (1998) Phosphorylation and regulation of antidepressant-sensitive serotonin transporters. 9 % 273(4):2458-2466. Reif A, Jacob CP, Rujescu D, Herterich S, Lang S, Gutknecht L, Baehne CG, Strobel A, Freitag CM, Giegling I, Romanos M, Hartmann A, Rosler M, Renner TJ, Fallgatter AJ, Retz W, Ehlis AC and Lesch KP (2009) Influence of functional variant of neuronal nitric oxide synthase on impulsive behaviors in humans. / - 66(1):41-50. Reiterer V, Maier S, Sitte HH, Kriz A, Ruegg MA, Hauri HP, Freissmuth M and Farhan H (2008) Sec24-and ARFGAP1-Dependent Trafficking of GABA Transporter-1 Is a Prerequisite for Correct Axonal Targeting. 9 28(47):12453- 12464. Robben JH, Sze M, Knoers NV and Deen PM (2006) Rescue of vasopressin V2 receptor mutants by chemical chaperones: specificity and mechanism. : % 17(1):379-386. Rotondo A, Giannaccini G, Betti L, Chiellini G, Marazziti D, Martin C, Lucacchini A and Cassano GB (1996) The serotonin transporter from human brain: purification and partial characterization. 4 28(3):299-307. Rudnick G (2006) Serotonin transporters--structure and function. 9 : % 213(2):101-110. Sato K and Nakano A (2007) Mechanisms of COPII vesicle formation and protein sorting. ,% 8 581(11):2076-2082. Sato S, Ward CL, Krouse ME, Wine JJ and Kopito RR (1996) Glycerol reverses the misfolding phenotype of the most common cystic fibrosis mutation. 9 % 271(2):635-638. 64 Scholze P, Freissmuth M and Sitte HH (2002) Mutations within an intramembrane leucine heptad repeat disrupt oligomer formation of the rat GABA transporter 1. 9 % 277(46):43682-43690. Singh SK (2008) LeuT: A prokaryotic stepping stone on the way to a eukaryotic neurotransmitter transporter structure. > ? 2(5):380-389. Sitia R and Braakman I (2003) Quality control in the endoplasmic reticulum protein factory. 426(6968):891-894. Sitte HH and Freissmuth M (2010) The reverse operation of Na(+)/Cl(-)-coupled neurotransmitter transporters--why amphetamines take two to tango. 9 112(2):340-355. Sitte HH, Hiptmair B, Zwach J, Pifl C, Singer EA and Scholze P (2001) Quantitative analysis of inward and outward transport rates in cells stably expressing the cloned human serotonin transporter: inconsistencies with the hypothesis of facilitated exchange diffusion. : - 59(5):1129-1137. Song JL and Chuang DT (2001) Natural osmolyte trimethylamine N-oxide corrects assembly defects of mutant branched-chain alpha-ketoacid decarboxylase in maple syrup urine disease. 9 % 276(43):40241-40246. Steiner JA, Carneiro AM and Blakely RD (2008) Going with the flow: trafficking- dependent and -independent regulation of serotonin transport. ! 9(9):1393- 1402. Sucic S, Dallinger S, Zdrazil B, Weissensteiner R, Jorgensen TN, Holy M, Kudlacek O, Seidel S, Cha JH, Gether U, Newman AH, Ecker GF, Freissmuth M and Sitte HH (2010) The N terminus of monoamine transporters is a lever required for the action of amphetamines. 9 % 285(14):10924-10938. Sung U, Apparsundaram S, Galli A, Kahlig KM, Savchenko V, Schroeter S, Quick MW and Blakely RD (2003) A regulated interaction of syntaxin 1A with the antidepressant-sensitive norepinephrine transporter establishes catecholamine clearance capacity. 9 23(5):1697-1709. Swanton E, High S and Woodman P (2003) Role of calnexin in the glycan-independent quality control of proteolipid protein. :%; 9 22(12):2948-2958. 65 Tamarappoo BK, Yang B and Verkman AS (1999) Misfolding of mutant aquaporin-2 water channels in nephrogenic diabetes insipidus. 9 % 274(49):34825-34831. Tanford C (1983) Translocation pathway in the catalysis of active transport. - < 80(12):3701-3705. Tate CG, Haase J, Baker C, Boorsma M, Magnani F, Vallis Y and Williams DC (2003) Comparison of seven different heterologous protein expression systems for the production of the serotonin transporter. % % 1610(1):141-153. Tate CG, Whiteley E and Betenbaugh MJ (1999) Molecular chaperones stimulate the functional expression of the cocaine-sensitive serotonin transporter. 9 % 274(25):17551-17558. Torres GE, Carneiro A, Seamans K, Fiorentini C, Sweeney A, Yao WD and Caron MG (2003) Oligomerization and trafficking of the human dopamine transporter. Mutational analysis identifies critical domains important for the functional expression of the transporter. 9 % 278(4):2731-2739. Torres GE, Yao WD, Mohn AR, Quan H, Kim KM, Levey AI, Staudinger J and Caron MG (2001) Functional interaction between monoamine plasma membrane transporters and the synaptic PDZ domain-containing protein PICK1. 30(1):121-134. Trainor BC, Workman JL, Jessen R and Nelson RJ (2007) Impaired nitric oxide synthase signaling dissociates social investigation and aggression. % 121(2):362-369. Van Craenenbroeck K, Clark SD, Cox MJ, Oak JN, Liu F and Van Tol HHM (2005) Folding efficiency is rate-limiting in dopamine D4 receptor biogenesis. 9 % 280(19):19350-19357. Waldo GS, Standish BM, Berendzen J and Terwilliger TC (1999) Rapid protein-folding assay using green fluorescent protein. % 17(7):691-695. Wanamaker CP and Green WN (2005) N-linked glycosylation is required for nicotinic receptor assembly but not for subunit associations with calnexin. 9 % 280(40):33800-33810. 66 Wang D, Deken SL, Whitworth TL and Quick MW (2003) Syntaxin 1A inhibits GABA flux, efflux, and exchange mediated by the rat brain GABA transporter GAT1. : - 64(4):905-913. Welch WJ and Brown CR (1996) Influence of molecular and chemical chaperones on protein folding. 1(2):109-115. Wendeler MW, Paccaud JP and Hauri HP (2007) Role of Sec24 isoforms in selective export of membrane proteins from the endoplasmic reticulum. :%; 8(3):258- 264. Wersinger C, Rusnak M and Sidhu A (2006) Modulation of the trafficking of the human serotonin transporter by human alpha-synuclein. 9 24(1):55-64. Wieland S and Lucki I (1990) Antidepressant-like activity of 5-HT1A agonists measured with the forced swim test. - >%? 101(4):497-504. Yang DS, Yip CM, Huang TH, Chakrabartty A and Fraser PE (1999) Manipulating the amyloid-beta aggregation pathway with chemical chaperones. 9 % 274(46):32970-32974. Zhu CB, Carneiro AM, Dostmann WR, Hewlett WA and Blakely RD (2005) p38 MAPK activation elevates serotonin transport activity via a trafficking-independent, protein phosphatase 2A-dependent process. 9 % 280(16):15649-15658. Zhu CB, Hewlett WA, Feoktistov I, Biaggioni I and Blakely RD (2004) Adenosine receptor, protein kinase G and p38 mitogen-activated protein kinase-dependent up- regulation of serotonin transporters involves both transporter trafficking and activation. : - 65(6):1462-1474. Zhu CB, Steiner JA, Munn JL, Daws LC, Hewlett WA and Blakely RD (2007) Rapid stimulation of presynaptic serotonin transport by A(3) adenosine receptors. 9 - ! 322(1):332-340. 67 6. COPY RIGHT LICENSE AGREEMENT: Fig.2. !"#$ %& ' ( )* *+ %% )* %%*+, - . % %% / %& %0 '. %%/ .& %& , 1 % ' , 2 &'% 3$34 5 "#"3" 6 !3/ 3 ! %% '% 7 % - 8&'% . ' % %% % M % % % 1%. : 7 !/ 3 " ; & &'% 3! < &'% 3 . - = >?% % % % - %% 2 % - . % > 8 %'@. %& 3A ' & - - % %% % &% - - % %% % @ & ' 3 !! & B)+ , = C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C && E F ( : % -% & . , & &%%G.% ,& 68 Fig.3. !"#$ %& ' ( )* *+ 7 F. )*7 F. *+, - . % %% / %& %0 '. 7 F. / .& %& , 1 % ' , 2 &'% 3$34A !" ! 6 !3/ 3 ! 7 F. '% %-- ' 1 ( ( %--:? < - % %% % 7-% , %/ 8% ?, C%%/ . ?, :. !/ 3 # % ! 5 !A 3 . - ?% > H % . =0% .>& %& % % % %> ' 2 &'% - - %> ' ! 6% F . - %> ' &'%)+ F . ' % E 2 6%% %-% &'% , = ? C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C && E F ( : % -% & . , & &%%G.% ,& 69 Fig.4. !"#$ %& ' ( )* *+ 2 % ' 1% )*2 % ' 1% *+, - . % %% / %& %0 '. 2 % ' 1% / .& %& , 1 % ' , 2 &'% 3$34AA $AA! $ 6 !3/ 3 ! '% 2 % ' 1% ' 2 % I . % & % & % - %. % '% <: %:& ; & &'% A34 < &'% 454# #5!#5A % - ' 3 % % > ' 2 &'% - - % > ' ! H % . . - = > ?% . <0 C&. % (%% % 0/ % ! 5 % C &% %-% - , = ? C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C && E F ( : % -% & . , & &%%G.% ,& 70 Fig.5. !"#$ %& ' ( )* *+ %% )* %%*+, - . % %% / %& %0 '. %%/ .& %& , 1 % ' , 2 &'% 3$34AA 5!#A4$ 6 !3/ 3 ! %% '% C & %. . ' C@/ % / $" % % % ? !/ 3 ; & &'% 5 < &'% . - = >?% % % % - %% 2 % - . % > 8 %'@. %& 3A ' & - - % %% % &% - - % %% % @ & ' 3 !! & B)+ , = C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C&& E F ( : % -%& . , & &%%G.% ,& 71 Fig.6. !"#$ %& ' ( )* *+ 0% )*0%*+, - . % %% / %& %0 '. 0%/ .& %& , 1 % ' , 2 &'% 3$34AA!A44 "# 6 !3/ 3 ! '% 0% ' % % . J 8 ' & %& % % & -% -%& % ;% %%/ 8H / ? 1 / 8 0% 7 . 3 A 0 & !$ &'% &'% $ 2 &'% - " . - = % >% % - %> '> % 2 &'% - - %> ' ! > % %& ' % % % . % - 2 0% % E F . ' % E 2 6%% %-% &'% - . % >% 8 %'@. %& 3A ' & - - % %% % &% - - %% % @ & ' 3 !! 0% ; &'% 1 A5A 43"3 !3 %& % , = ; @ !",$L , = ? > , 1 , = C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C&& E F ( : % -%& . , & &%%G.% ,& 72 Fig.7. !"#$ %& ' ( )* *+ 0% )*0%*+, - . % %% / %& %0 '. 0%/ .& %& , 1 % ' , 2 &'% 3$34A$ #!A#" 6 !3/ 3 ! '% 0% ' % 8& - C6<< 0 -%& % % % / :: 2: 33 8. 3 " 0 & $#! &'% &'% !! 2 &'% - " . - = % >% % - %> '> % 2 &'% - - %> ' ! > % %& ' % % % . % - 2 0% % E F . ' % E 2 6%% %-% &'% - . % >% 8 %'@. %& 3A ' & - - % %% % &% - - %% % @ & ' 3 !! 0% ; &'% 1 A5A 43"3 !3 %& % , = ; @ !",$L , = ? > , 1 , = C.% ' 3 ! C.% C% C %/ <, %0, %0. & , C&& E F ( : % -%& . , & &%%G.% ,& 73 7. CURRICULUM VITAE: personal data: Date of birth: 1ST January 1980. Place of birth: Mansoura, Egypt. Nationality: Egyptian. Marital status: Married. Languages: Arabic (Mother tongue) and English. Education: 1986-1996: Preliminary, elementary and secondary school, Egypt. 1996-2001: Faculty of Veterinary Medicine, Mansoura university, Egypt. 2002-2005: Master thesis at the department of pharmacology, Faculty of Veterinary, Mansoura university, Egypt. With Prof. Dr. Magdy Amer and Prof. Dr. Mohamed Gabr. Thesis title: Pharmacokinetics of enrofloxacin in febrile goat. 2007-till now: PhD Thesis at the Institute of Pharmacology, Medical University Vienna with Prof. Dr. Michael Freissmuth. a) 15.03.2007-31.12.2007: working on the project structural studies on C-terminal domains of neurotransmitter (Generation of individual C-terminal moieties of SERT & GAT1). b) Jan 2008- till now: working on my thesis project under the title: Mutations in the carboxyl terminal sec24 binding motif of the serotonin transporter impair folding of the transporter. work experience: 18.10.2001-30.11.2002: work as veterinarian at the 6th of October Army Diary Farm, Egypt 01.12.2002-30.09.2005: Demonstrator of pharmacology at the department of pharmacology, Faculty of Veterinary, Mansoura university, Egypt. 01.10.2005-14.3.2007: Associate lecture of pharmacology at the department of pharmacology, Faculty of Veterinary, Mansoura university, Egypt. 15.03.2007-till now: Research fellow at the Institute of Pharmacology, Medical University Vienna. 74 Teaching experiences: 01.12.2002-14.3-2007: Teaching and helping in exams preparation for the practical courses of veterinary pharmacology for the undergraduate students at the department of pharmacology, Faculty of Veterinary, Mansoura university, Egypt. Scholarships, Grants and Awards: 2007: Received scholarship from the Egyptian Ministry of Higher Education and State for Scientific to study the Ph.D. 2008: Student travel grant from Austrian Pharmacological Society (APHAR). 2009: Student travel grant from Austrian Pharmacological Society (APHAR). 2009: Award for best poster presentation at the 15th Scientific Symposium of the Austrian Pharmacological Society (APHAR). Training sessions: Training sessions organized by the University Development Center at the Mansoura University, Egypt. 1-Ethics and professional ethics. 5-Thinking skills. 2-Effective teaching. 6-Using technology in teaching. 3-Teaching for large and limited numbers. 7-Recent trends in teaching. 4-Methods of scientific research. 8- Effective communication skills. Poster, oral presentation and publications: 1-Ali El-Kasaby & Herwig Just: C-terminal truncation induces a folding defect in the serotonin transporter. Poster presentation at 4th MUW PhD Symposium May 28 – 29th, 2008; Vienna, Austria. 2-Ali El-Kasaby, Herwig Just, Harald Sitte, Michael Freissmuth & Oliver Kudlacek: The carboxyl terminus of the serotonin transporter as independent folding domain. Poster presentation at 1st SFB Symposium September 26 – 27th, 2008; Vienna, Austria. 3-Ali El-kasaby, Subhodeep Sarker &Herwig Just: C-terminal mutation induces a folding defect in the serotonin transporter. Oral presentation at 14th Scientific Symposium of the Austrian Pharmacological Society (APHAR). November 21st –22nd 2008; Innsbruck, Austria. Published as abstract in BMC Pharmacology 2008, 8(Suppl 1):A7 75 4-Ali El-Kasaby, Herwig Just, Harald Sitte, Michael Freissmuth & Oliver Kudlacek: The role of the carboxyl terminus in folding and trafficking of the serotonin transporter. Poster presentation at 2nd SFB Symposium September 4 - 5th, 2008; Vienna, Austria. 5-Ali El-Kasaby & Oliver Kudlacek: Importance of the carboxyl terminus for folding and trafficking of the serotonin transporter. Poster presentation at 15th Scientific Symposium of the Austrian Pharmacological Society (APHAR) Joint meeting with the Hungarian Society of Experimental and Clinical Pharmacology (MFT) and the Slovenian Pharmacological Society (SDF) November 19th –21st 2009; Graz, Austria. Published as abstract in BMC Pharmacology 2009, 9(Suppl 2):A27. 6- Ali El-Kasaby, Herwig Just, Elisabeth Malle, Peggy C. Stolt-Bergner, Harald H. Sitte, Michael Freissmuth and Oliver Kudlacek. Mutations in the carboxyl terminal sec24 binding motif of the serotonin transporter impair folding of the transporter. J Biol Chem. 2010 Oct 2. [Epub ahead of print] 7- Sonja Sucic, Ali El-Kasaby, Subhodeep Sarker, Harald H. Sitte, Philippe Marin and Michael Freissmuth. ER export of the serotonin transporter relies exclusively on an interaction with sec24C. Manuscript in preparation. Scientific meeting and congresses: 3rd MUW PhD Symposium June 21rst - 22nd, 2007; Vienna, Austria. 32nd FEBS Congress “Molecular Machines” July 7- 12th, 2007; Vienna, Austria. 13th APHAR meeting (joint meeting of the Austrian Pharmacological Society APHAR and the Hungarian Pharmacological Society, MDF), November 22nd -24th, 2007; Vienna, Austria. Membership: 1-Egyptian Society of Pharmacology and Experimental Therapeutics. 2-Austrian Pharmacological Society (APHAR). 76