Plant Systematics an Integrated Approach

Home , Abutilon indicum, Acacia neriifolia, Acanthus spinosus, Acer griseum, Ageratum houstonianum, Amara ellipsis

Plant Systematics An Integrated Approach

Third edition

Gurcharan Singh University of Delhi Delhi, INDIA CIP data will be provided on request

Science Publishers www.scipub.net 234 May Street Post Office Box 699 Enfield, New Hampshire 03748 United States of America

General enquiries : [email protected] Editorial enquiries : [email protected] Sales enquiries : [email protected]

Published by Science Publishers, Enfield, NH, USA An imprint of Edenbridge Ltd., British Channel Islands Printed in India

ISBN 978-1-57808-668-9

The author and the publisher make no warranty of any kind, expressed or implied, with regard to programs contained in this companion CD. The authors and publisher shall not be liable in any event for incidental or consequential damages in connection with, or arising out of, the furnishing, performance, or use of these programs.

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, without the prior permission of the publishers, in writing. The exception to this is when a reasonable part of the text is quoted for purpose of book review, abstracting etc.

This book is sold subject to the condition that it shall not, by way of trade or otherwise be lent, re-sold, hired out, or otherwise circulated without the publisher’s prior consent in any form of binding or cover other than that in which it is published and without a similar condition including this condition being imposed on the subsequent purchaser. Chapter 6 Preface

This third edition of integrated information on Plant Systematics has largely been influenced by the developments of the first few years of twenty first century. Past two decades have seen development of new tools of biotechnology, vigorous utilization of molecular data in understanding phylogeny, and redefining affinities and arrangements of plant groups. Recent years have also seen disappearance of gaps between numerical and cladistic methodologies, and integration of former into the latter for complete understanding of phylogenetic relationships. These trends have largely influenced the combination of numerical and cladistic methods under one chapter, and enlarged discussion on Molecular Systematics, discussing new concepts, tools and recent achievements. New chapters on Pteridophytes and Gymnosperms have been added for complete understanding of systematics of vascular plants. It is being increasingly realized that actual photographs of plants and plant parts enable better understanding of taxonomic information, the trend usefully exploited by recent publications by Simpson (2006) and Judd et al. (3rd ed., 2008). The present edition incorporates more than 500 colour photographs of plants from diverse families of plants. High-resolution images of these as also the additional plants have been provided in the CD-ROM being supplied along with the book, latter including 772 photographs. This has largely been possible through the kind courtesy of my son Manpreet Singh and daughter- in-law Komal, who sponsored my recent visit to California, and provided me the opportunity to visit and photograph temperate plants in and around California. The book as such contains images of both tropical plants (largely from Delhi), temperate American plants and plants from other parts of the World growing in the Botanical Gardens of University of California and San Francisco Botanical Garden. I wish to record the help rendered by the members of TAXACOM in the identification of some of the American plants. The focus of the present edition has been to further consolidate the information on the principles of plant systematics, include detailed discussion on all major systems of classification, and significantly, also include discussion on the selected families of vascular plants, without sacrificing the discussion on basic principles. The families included for discussion are largely those which have wide representation, as also those that are less iv Plant Systematics known but significant in evaluating the phylogeny of angiosperms. The discussion of the families also has a considerable focus on their phylogenetic relationships, as evidenced by recent cladistic studies, with liberal citation of molecular data. Several additional families have been included for detailed discussion in the present volume. Recent internet revolution has greatly helped in propagating taxonomic information, with numerous searchable databases, online programs for identification and data analysis available for ready reference. The information concerning these has been included at appropriate places in various chapters for easy utilization. In light of this, the separate chapter on web has been omitted. The outputs of computer programs, especially used in molecular studies and construction of phylogenetic trees has been included based on actual or hypothetical data. This will acquaint readers with the handling of raw data and working of computer programs. The author has attempted to strike a balance between classical fundamental information and the recent developments in plant systematics. Special attention has been devoted to the information on botanical nomenclature, identification and phylogeny of angiosperms with numerous relevant examples and detailed explanation of the important nomenclatural problems. An attempt has been made to present a continuity between orthodox and contemporary identification methods by working on a common example. The information on methods of identification using computers has been further enhanced to help better online identification. For providing me inspiration for this book, I am indebted to my undergraduate students, who helped me to improve the material through frequent interactions. I am also indebted to my wife Mrs. K.G. Singh for constant support and bearing with my overindulgence with this book. I also wish to acknowledge the help rendered by my son Kanwarpreet Singh at various stages. I wish to record thanks to all the colleagues whose inputs have helped me to improve the information presented here. I also wish to place on record sincere thanks to Dr. Jef Veldkamp for valuable information on nomenclature, Dr. Gertrud Dahlgren for photographs and literature, Dr. P.F. Stevens for literature on APG II and trees from his APweb, Dr. Robert Thorne for making available his 2007 classification, Dr. James Reveal for his help on nomenclatural problems, Dr. D.L. Dilcher for his photograph, Dr. Julie Barcelona and Harry Wiriadinata for photographs of Rafflesia, the authorities of New York Botanical Garden, Missouri Botanical Garden, USA, Royal Botanic Gardens Kew and University of California, Santa Cruz, for photographs used in the book.

New Delhi Gurcharan Singh November 2009 Chapter 6 Contents

Preface iii

1. PLANTS, TAXONOMY AND SYSTEMATICS 1–14 Plants and Kingdoms of Life 1 Two Kingdom System 1 Two Empires Three Kingdoms 2 Five Kingdom System 2 Six or Seven Kingdoms? 2 The Plant Kingdom 6 Taxonomy and Systematics 7 Basic Components (Principles) of Systematics 8 Aims of Systematics 11 Advancement Levels in Systematics 12 2. BOTANICAL NOMENCLATURE 15–45 Need for Scientific names 15 Why Latin? 16 Development of Botanical Code 16 Contents of Botanical Code 17 Preamble 17 Principles of ICBN 18 Names of Taxa 18 The Type Method 23 Author Citation 25 Publication of Names 26 Rejection of Names 28 Principle of Priority 30 Names of Hybrids 34 Names of Cultivated Plants 35 vi Plant Systematics

Unified Biological Nomenclature 35 Draft BioCode 36 PhyloCode 38 3. HIERARCHICAL CLASSIFICATION 46–55 Taxonomic groups, categories and ranks 46 Utilization of categories 48 Species concept 49 Infraspecific ranks 53 Genus 54 Family 54 4. DESCRIPTIVE TERMINOLOGY 56–90 Habit and life span 56 Habitat 57 Roots 57 Stems 58 Leaves 61 Leaf arrangement 62 Leaf duration 63 Leaf incision 63 Stipules 65 Leaf shape 65 Leaf margin 66 Leaf base 66 Leaf apex 67 Leaf surface 68 Venation 69 Inflorescence 69 Racemose types 69 Cymose types 70 Specialized types 71 Flower 71 Calyx 73 Corolla 74 Perianth 74 Androecium 74 Gynoecium 77 Fruit 79 Simple fruits 80 Aggregate fruits 82 Multiple fruits 83 Floral formula 83 Floral diagram 83 5. PROCESS OF IDENTIFICATION 91–127 Specimen preparation 91 Fieldwork 91 Equipment 92 Collection 93 Pressing 93 Contents vii

Handling special groups 94 Drying 94 Herbarium methods 95 Botanical gardens 95 Herbaria 101 Pest Control 105 Virtual herbarium 106 Identification methods 108 Taxonomic literature 108 Taxonomic keys 113 Cmputers in identification 120 Interactive keys Id. 121 6.VARIATION, BIOSYSTEMATICS, POPULATION GENETICS AND EVOLUTION 128–148 Types of variation 128 Developmental variation 129 Environmental variation 129 Genetic variation 129 Variance analysis 129 Reproductive systems 131 Outbreeding 131 Inbreeding 135 Apomixis 135 Population genetics 135 Allele frequencies 136 Mating systems 136 Hardy-Weinberg law 136 Evolution 139 Mutation 140 Migration 140 Random genetic drift 140 Natural selection 141 Molecular evolution 143 Neutral theory of evolution 143 Speciation 144 7. TAXONOMIC EVIDENCE 149–209 Morphology 149 Habit 149 Underground parts 150 Leaves 150 Flowers 150 Fruits 150 Anatomy 150 Wood anatomy 150 Trichomes 151 Epidermal features 153 Leaf anatomy 153 Floral anatomy 153 viii Plant Systematics

Embryology 154 Families marked out by distinct embryological features 154 Specific examples of the role of embryological data 155 Palynology 156 Pollen aggregation 156 Pollen wall 157 Pollen aperture 157 Micromorphology and Ultrastructure 159 Micromorphology 159 Ultrastructure 161 Chromosomes 164 Chromosomal number 164 Chromosomal structure 167 Chromosomal behaviour 168 Chemotaxonomy 168 Primary metabolites 169 Secondary metabolites 169 Non-semantide Macromolecules 178 Proteins 178 Molecular systematics 184 Molecular evolution 184 Location of molecular data 186 Molecular techniques 187 DNA polymorphism 199 Examples of molecular studies 204 Gene trees 209 8. DEVELOPING CLASSIFICATIONS 210–264 Phenetic methods 210 Principles of taxometrics 211 Cladistic methods 212 Phylogenetic terms 213 Phylogenetic diagrams 221 Phylogeny and classification 225 Phylogenetic data analysis 229 Taxa-Operational Units 229 Characters 229 Measure of similarity 234 Construction of trees 237 The Consensus tree 251 Automated trees 258 Gene trees and species trees 262 Developing classification 263 9. PHYLOGENY OF ANGIOSPERMS 265–296 Origin of Angiosperms 265 What are Angiosperms? 265 What is the age of Angiosperms? 266 What is the place of their origin? 268 Are angiosperms monophyletic or polyphyletic? 270 Contents ix

What are the possible ancestors? 270 Origin of monocotyledons 280 Basal living angiosperms 280 Casuarinaceae 281 Magnoliids 281 Paleoherbs 282 Evolutionary trends 285 Coevolution with animals 285 Basic evolutionary trends 286 Xylem evolution 287 Stamen evolution 289 Pollen grain evolution 292 Carpel evolution 292 Evolution of inferior ovary 296 10. SYSTEMS OF CLASSIFICATION 297–358 Classifications based on gross morphology 297 Preliterate mankind 297 Early literate civilisations 297 Medieval Botany 299 Renaissance 300 Sexual System 302 Carolus Linnaeus 303 Natural Systems 306 Michel Adanson 306 Jean B. P. Lamarck 306 de Jussieu family 306 de Candolle family 307 Robert Brown 308 George Bentham and Sir J. D. Hooker 308 Phylogenetic Systems 312 Transitional Systems 312 Intentional phylogenetic systems 316 Modern phylogenetic systems 324 11. FAMILIES OF PTERIDOPHYTES 359–383 Lycopodiophtes Lycopodiaceae 362 Selaginellaceae 363 Isoetaceae 365 Psilopsida Ophioglossaceae 366 Psilotaceae 368 Equisetopsida Equisetaceae 370 Pteropsida Osmundaceae 371 Marsileaceae 373 Salviniaceae 374 Cyatheaceae 376 Pteridaceae 377 x Plant Systematics

Aspleniaceae 379 Dryopteridaceae 380 Polypodiaceae 382 12. FAMILIES OF GYMNOSPERMS 384–406 Cycadales Cycadaceae 386 Zamiaceae 387 Ginkgoales Ginkgoaceae 389 Coniferales Pinaceae 391 Cupressaceae 393 Podocarpaceae 395 Araucariaceae 396 Taxaceae 398 Gnetales Ephedraceae 399 Gnetaceae 401 13. MAJOR FAMILIES OF ANGIOSPERMS 407–678 Angiosperms roll of honour 408 Chloranthidae 409 Amborellaceae 409 Chloranthaceae 411 Austrobaileyaceae 413 Winteraceae Illiciaceae 415 Cabombaceae 417 Nymphaeaceae 419 Ceratophyllaceae 421 Magnoliidae 423 Magnoliaceae 423 Degeneriaceae 425 Annonaceae 427 Calycanthaceae 429 Lauraceae 431 Winteraceae 433 Saururaceae 435 Piperaceae 437 Alismatidae 439 Acoraceae 439 Araceae 441 Butomaceae 443 Alismataceae 445 Hydrocharitaceae 447 Potamogetonaceae 449 Liliidae 451 Pandanaceae 451 Dioscoreaceae 453 Smilacaceae 455 Contents xi

Liliaceae 473 Orchidaceae 475 Iridaceae 478 Asphodelaceae 480 Alliaceae 482 Subfamily 484 Agavaceae 485 Commelinidae 487 Arecaceae 488 Commelinaceae 490 Musaceae 492 Zingiberaceae 494 Cannaceae 496 Juncaceae 498 Cyperaceae 500 Poaceae 502 Ranunculidae 505 Paeoniaceae 505 Berberidaceae 507 Ranunculaceae 509 Papaveraceae 512 Hamamelididae 514 Saxifragaceae 514 Fagaceae 517 Betulaceae 519 Casuarinaceae 521 Caryophyllidae 523 Portulacaceae 524 Cactaceae 526 Nyctaginaceae 528 Aizoaceae 530 Chenopodiaceae 532 Amaranthaceae 534 Caryophyllaceae 536 Polygonaceae 538 Droseraceae 540 Rosidae 542 Celastraceae 543 Violaceae 545 Salicaceae 547 Cucurbitaceae 550 Clusiaceae 552 Euphorbiaceae 554 Oxalidaceae 557 Zygophyllaceae 559 Geraniaceae 561 Rosaceae 563 Fabaceae 566 Myrtaceae 572 xii Plant Systematics

Lythraceae 574 Onagraceae 577 Malvidae 579 Malvaceae 580 Grewiaceae 583 Dipterocarpaceae 584 Rhamnaceae 586 Ulmaceae 588 Moraceae 590 Urticaceae 592 Rafflesiaceae 595 Capparaceae 597 Cleomaceae 599 Brassicaceae 600 Rutaceae 603 Meliaceae 605 Anacardiaceae 607 Sapindaceae 610 Asteridae 612 Hydrangeaceae 613 Cornaceae 627 Balsaminaceae 629 Polemoniaceae 631 Ebenaceae 633 Sapotaceae 635 Primulaceae 637 Ericaceae 639 Adoxaceae 642 Apiaceae 644 Araliaceae 646 Asteraceae 649 Lamiidae 652 Solanaceae 652 Convolvulaceae 655 Boraginaceae 657 Rubiaceae 659 Apocynaceae 661 Plantaginaceae 664 Lamiaceae 666 Verbenaceae 669 Bignoniaceae 671 Acanthaceae 673 Scrophulariaceae 675

REFERENCES 669–702 INDEX 703–742 Contents xiii Color Plate Section

The page numbers referred below are those of the text pages where the B/W images of the figures appear.

Stems 85 Leaves 86 Inflorescences 87 Fruits 88 Pteridophytes 403 Selaginellaceae, Osmundaceae, Blechnaceae 403 Gymnosperms Cycadaceae, Zamiaceae 404 Ginkgoaceae, Pinaceae, Cupressaceae 405 Angiosperms 457 Chloranthidae 457 Magnoliidae 458 Araceae, Alismataceae, Hydrocharitaceae, Liliaceae 459 Iridaceae, Asphodelaceae, Alliaceae 460 Hyacinthaceae, Agavaceae, Asparagaceae, Nolinaceae 461 Arecaceae, Musaceae, Commelinaceae, Cyperceae, Poaceae 462 Paeoniaceae, Berberidaceae, Papaveraceae 463 Ranunculaceae 464 Grossulariaceae, Fagaceae, Nothofagaceae, Betulaceae 465 Portulacaceae, Cactaceae, Nyctaginaceae, Aizoaceae 466 Chenpodiaceae, Amaranthaceae, Caryophyllaceae, Polygonaceae 467 Celastraceae, Violaceae, Cucurbitaceae, Begoniaceae 468 Clusiaceae, Euphorbiaceae, Oxalidaceae 469 Geraniaceae, Rosaceae 470 Fabaceae 471 Myrtaceae, Lythraceae, Onagraceae 472 Malvaceae, Rhamnaceae, Moraceae 615 Rafflesiaceae, Brassicaceae 616 Rutaceae, Anacardiaceae, Meliaceae 617 Sapindaceae 618 Hydrangeaceae, Polemoniaceae, Cornaceae, Primulaceae 619 Ericaceae, Adoxaceae 620 Apiaceae, Araliaceae 621 Asteraceae 622 Solanaceae, Convolvulaceae, Boraginaceae 623 Rubiaceae, Apocynaceae 624 Plantaginaceae, Lamiaceae 625 Verbenaceae, Bignoniaceae, Acanthaceae, Scrophulariaceae 626 Chapter 1 Plants, Taxonomy and Systematics

Taxonomy (or systematics) is basically con- a single largest, most inclusive group. Clas- cerned with the classification of organisms. sifying organisms and diverse forms of life Living organisms are placed in groups on the is challenging task before the biologists. basis of similarities and differences at the organismic, cellular, and molecular levels. The United Nations Environment PLANTS AND KINGDOMS OF LIFE Programme’s Global Biodiversity Assessment Plants are man’s prime companions in this estimates the number of described species universe, being the source of food and en- of living organisms as approximately 1.75 ergy, shelter and clothing, drugs and bever- million. The list grows longer every year. Clas- ages, oxygen and aesthetic environment, and sifying these organisms has been a major as such they have been the dominant com- challenge, and the last few decades have seen ponent of his taxonomic activity through the a lot of realignments as additional ultrastruc- ages. Before attempting to explore the diver- tural and molecular information piles up. sity of plant life it is essential to understand These realignments have primarily been the as to what is our understanding of the term result of realization that the branches of the Plant, and the position of plants in the web phylogenetic tree must be based on the con- of life. Traditionally the plants are delimited cept of monophyly, and each taxonomic as organisms possessing cell wall, capable group, kingdoms included, should be mono- of photosynthesis, producing spores and phyletic. having sedentary life. A lot of rethinking has Before attempting to classify the various resulted in several different interpretations organisms, it is necessary to identify and of the term plant. name them. A particular group of individuals, unique in several respects, is given a unique binomial, and is recognized as a spe- Two Kingdom System cies. These species are grouped into taxo- The living organisms were originally grouped nomic groups, which are successively as- into two kingdoms. Aristotle divided all liv- signed the ranks of genera, families, orders, ing things between plants, which generally and the process continues till all the spe- do not move or have sensory organs, and cies have been arranged (classified) under animals. Linnaeus in his Systema naturae 2 Plant Systematics published in 1735 placed them under proposal, however, was not taken up imme- Animalia (Animals) and Vegetabilia (Plants) diately, because another classification was as two distinct kingdoms (Linnaeus placed proposed by Herbert Copeland (1938), who minerals in the third kingdom Mineralia). gave the prokaryotes a separate kingdom, Linnaeus divided each kingdom into classes, originally called Mycota but later referred to later grouped into phyla for animals and di- as Monera or Bacteria. Copeland later on visions for plants. When single-celled organ- (1956) proposed a four-kingdom system isms were first discovered, they were split placing all eukaryotes other than animals between the two kingdoms: mobile forms in and plants in the kingdom Protoctista, thus the animal phylum Protozoa, and colored recognizing four kingdoms Monera, algae and bacteria in the plant division Thal- Protoctista, Plantae and Animalia. The im- lophyta or Protophyta. As a result, Ernst portance of grouping these kingdoms in two Haeckel (1866) suggested creating a third empires, as suggested earlier by Chatton kingdom Protista for them, although this was popularized by Stanier and van Niel was not very popular until relatively recently (1962), and soon became widely accepted. (sometimes also known as Protoctista). Haeckel recognized three kingdoms: Pro- Five Kingdom System tista, Plantae and Animalia. American biologist Robert H. Whittaker (1969) proposed the removal of fungi into a Two Empires Three Kingdoms separate kingdom thus establishing a five The subsequent discovery that bacteria are kingdom system recognizing Monera, Pro- radically different from other organisms in tista, Fungi, Plantae and Animalia as dis- lacking a nucleus, led Chatton (1937) to pro- tinct kingdoms. The fungi like plants have pose a division of life into two empires: or- a distinct cell wall but like animals lack ganisms with a nucleus in Eukaryota and autotrophic mode of nutrition. They, how- organisms without in Prokaryota. Prokary- ever, unlike animals draw nutrition from otes do not have a nucleus, mitochondria or decomposition of organic matter, have cell any other membrane bound organelles. In wall reinforced with chitin, cell membranes other words neither their DNA nor any other containing ergosterol instead of cholesterol of their metabolic functions are collected to- and have a unique biosynthetic pathway for gether in a discrete membrane enclosed area. lysine. The classification was followed widely Instead everything is openly accessible within in textbooks. the cell, though some bacteria have internal membranes as sites of metabolic activity these membranes do not enclose a separate Six or Seven Kingdoms? area of the cytoplasm. Eukaryotes have a Subsequent research concerning the organ- separate membrane bound nucleus, numer- isms previously known as archebacteria has ous mitochondria and other organelles such led to the recognition that these creatures as the Golgi Body within each of their cells. form an entirely distinct kingdom Archaea. These areas are separated off from the main These include anaerobic bacteria found in mass of the cell’s cytoplasm by their own harsh oxygen-free conditions and are geneti- membrane in order to allow them to be more cally and metabolically completely different specialized. The nucleus contains all the from other, oxygen-breathing organisms. Eukaryote cell DNA, which gets organized These bacteria, called Archaebacteria, or into distinct chromosomes during the pro- simply Archaea, are said to be “living fossils” cess of mitosis and meiosis. The energy is that have survived since the planet’s very generated in mitochondria. The exception to early ages, before the Earth’s atmosphere this rule are red blood cells which have no even had free oxygen. This together with the nucleus and do not live very long. Chatton’s emphasis on phylogeny requiring groups to Plants, Taxonomy and Systematics 3 be monophyletic resulted in a six kingdom isms, but they differ in their treatment. Ross system proposed by Carl Woese et al. (1977). (2002, 2005) recognized Archaebacteria and They grouped Archaebacteria and Eubacteria Eubacteria as separate kingdoms, named as under Prokaryotes and rest of the four king- Protomonera and Monera, respectively again doms Protista, Fungi, Plantae and Animalia under separate superkingdoms (domains of under Eukaryotes. They subsequently (1990) earlier authors) Archaebacteriae and grouped these kingdoms into three domains Eubacteria. He added seventh kingdom Bacteria (containing Eubacteria), Archaea Myxomycophyta of slime moulds under (containing Archaebacteria) and Eukarya superkingdom Eukaryotes. Two additional (containing Protista, Fungi, Plantae and superkingdoms of extinct organisms Pro- Animalia). genotes (first cells) and Urkaryotes (prokary- Margulis and Schwartz (1998) proposed otic cells that became eukaryotes) were added: term superkingdom for domains and recognized two superkingdoms: Prokarya Superkingdom Progenotes.... (Prokaryotae) and Eukarya (Eukaryotae). ....first cells now extinct Former included single kingdom Bacteria Superkingdom Archaebacteriae (Monera) divided into two subkingdoms Archaea and Eubacteria. Eukarya was Kingdom Protomonera...archaic bacteria divided into four kingdoms: Protoctista (Pro- Superkingdom Eubacteria tista), Animalia, Plantae and Fungi. Kingdom Monera...... bacteria Several recent authors have attempted to Superkingdom Urkaryotes recognize seventh kingdom of living organ- ...prokaryoti cells that became eukaryotes

Figure 1.1 Seven kingdoms of life and their possible phylogeny (after Patterson & Sogin 1992). 4 Plant Systematics

Superkingdom Eukaryotes ninth kingdom, the Protozoa, are mainly ...cells with nuclei phagotrophic, and have tubular or vesicular Kingdom Protista...... protozoans cristae (or lack mitochondria altogether), and Kingdom Myxomycophyta...slime molds lack tubular mastigonemes on their (primi- Kingdom Plantae...... plants tively anterior) cilia; plastids if present have Kingdom Fungi...... fungi three-envelop membranes, chlorophyll c2, Kingdom Animalia...... animals and no internal starch, and a plastid endoplasmic reticulum is absent. Kingdoms 4-9 Patterson & Sogin (1992; Figure 1.1) rec- are primitively anteriorly biciliate. A simpler ognized seven kingdoms, but included slime system of five kingdoms suitable for very el- moulds under Protozoa (Protista) and instead ementary teaching is possible by grouping the established Chromista (diatoms) as seventh photosynthetic and fungal kingdoms in pairs. kingdom. Interestingly the traditional algae It was suggested that Various compromises now find themselves distributed in three dif- are possible between the nine and five king- ferent kingdoms: eubacterial prokaryotes doms systems; it is suggested that the best (the blue-green cyanobacteria), chromistans one for general scientific use is a system of (diatoms, kelps), and protozoans (green al- seven kingdoms in which the Eufungi and gae, red algae, dinoflagellates, euglenids). Ciliofungi become subkingdoms of the King- Cavalier-Smith (1981) suggested that Eu- dom Fungi, and the Cryptophyta and karyotes can be classified into nine kingdoms Chromophyta subkingdoms of the Kingdom each defined in terms of a unique constella- Chromista; the Fungi, Viridiplantae, tion of cell structures. Five kingdoms have Biliphyta, and Chromista can be subject to plate-like mitochondrial cristae: (1) Eufungi the Botanical Code of Nomenclature, while (the non-ciliated fungi, which unlike the the Zoological Code can govern the Kingdoms other eight kingdoms have unstacked Golgi Animalia, Protozoa and Euglenozoa. cisternae), (2) Ciliofungi (the posteriorly cili- These 9 kingdoms together with two or ated fungi), (3) Animalia (Animals, sponges, one kingdom of prokaryotes total eleven or mesozoa, and choanociliates; phagotrophs ten kingdoms of life. Subsequently, however, with basically posterior ciliation), (4) Cavalier-Smith (1998, 2000, 2004) reverted Biliphyta (Non-phagotrophic, phycobilisome- back to six kingdom classification recogniz- containing, algae; i.e. the Glaucophyceae and ing Bacteria, Protozoa, Animalia, Fungi, Rhodophyceae), (5) Viridiplantae (Non- Plantae and Chromista under two empires phagotrophic green plants, with starch-con- Prokaryota and Eukaryota. Prokaryotes containing plastids). Kingdom (6), the stitute a single kingdom, Bacteria, here di- Euglenozoa, has disc-shaped cristae and an vided into two new subkingdoms: intraciliary dense rod and may be Negibacteria, with a cell envelope of two dis- phagotrophic and/or phototrophic with plas- tinct genetic membranes, and Unibacteria, tids with three-membraned envelopes. King- comprising the phyla Archaebacteria and dom (7), the Cryptophyta, has flattened tu- Posibacteria. Outline of the classification is bular cristae, tubular mastigonemes on both as under: cilia, and starch in the compartment between the plastid endoplasmic reticulum and the Empire Prokaryota plastid envelope; their plastids, if present, Kingdom Bacteria have phycobilins inside the paired thylakoids Subkingdom Negibacteria (phyla and chlorophyll c2. Kingdom (8), the Eobacteria, Sphingobacteria, Chromophyta, has tubular cristae, together Spirochaetae, Proteobacteria, with tubular mastigonemes on one anterior Planctobacteria, Cyanobacteria) cilium and/or a plastid endoplasmic reticu- Subkingdom Unibacteria (phyla lum and chlorophyll c1 + c2. Members of the Posibacteria, Archaebacteria) Plants, Taxonomy and Systematics 5

Empire Eukaryota subunit chaperonin, prefoldin, core histones, Kingdom Protozoa small nucleolar ribonucleoproteins (snoRNPs),

Subkingdom Sarcomastigota (phyla exosomes and similar replication, repair, Amoebozoa, Choanozoa) transcription and translation machinery) Subkingdom Biciliata that gave rise to archaebacteria and eukary- Kingdom Animalia (Myxozoa and 21 otes. It is, as such more appropriate to call other phyla) archaebacteria as metabacteria. The eukaryotic host cell evolved from some- Kingdom Fungi (phyla Archemycota, thing intermediate between posibacteria and Microsporidia, Ascomycota, metabacteria (“archaebacteria”), which had Basidiomycota) evolved many metabacterial features but not Kingdom Plantae yet switched to ether-linked lipid membranes Subkingdom Biliphyta (phyla in a major way. They would no doubt cladis- Glaucophyta, Rhodophyta) tically fall out as primitive metabacteria, but Subkingdom Viridaeplantae (phyla whether such forms are still extant is un- Chlorophyta, Bryophyta, certain. There are lots of metabacteria out Tracheophyta) there which are uncultured (only known from Kingdom Chromista environmental sequences) or just undiscov- Subkingdom Cryptista (phylum ered, so who knows. Cryptista: cryptophytes, goniomonads, The further shift from archaebacteria to katablepharids) Eukaryotes involved the transformation of Subkingdom Chromobiota circular DNA into a linear DNA bound with The name archaebacteria seems to be con- histones, formation of membrane bound fusing. They were so named because they nucleus enclosing chromosomes, develop- were thought to be the most ancient (Greek ment of mitosis, occurrence of meiosis in ‘archaio’ meaning ancient) and sometimes sexually reproducing organisms, appearance labelled as living fossils, since they can sur- of membrane bound organelles such as en- vive in anaerobic conditions (methanogens- doplasmic reticulum, golgi bodies and ly- which use hydrogen gas to reduce carbon di- sosomes, appearance of cytoskeletal ele- oxide to methane gas), high temperatures ments like actin, myosin and tubulin, and (thermophiles, which can survive in tem- the formation of mitochondria through en- peratures of up to 80 degree C), or salty places dosymbiosis. (halophiles). They differ from bacteria in hav- A major shift in this eukaryotic line ing methionine as aminoacid that initiates which excluded animal and fungi, involved protein synthesis as against formyl-methion- the development of chloroplast by an eu- ine in bacteria, presence of introns in some karyotic cell engulfing a photosynthetic bac- genes, having several different RNA poly- terial cell (probably a cyanobacterium). The merases as against one in bacteria, absence bacterial cell continued to live and multiply of peptidoglycan in cell wall, and growth not inside the eukaryotic cell, provided high inhibited by antibiotics like streptomycin and energy products, and in turn received a suit- chloramphenicol. In several of these respects able environment to live in. The two thus archaebacteria are more similar to eukary- shared endosymbiosis. Over a period of time otes. Bacteria are thought to have diverged the bacterial cell lost ability to live indepen- early from the evolutionary line (the clade dently, some of the bacterial genes getting neomura, with many common characters, transferred to eukaryotic host cell, making notably obligately co-translational secretion the two biochemically interdependent. Chlo- of N-linked glycoproteins, signal recognition roplast evolution in Euglenoids and Di- particle with 7S RNA and translation-arrest noflagellates occurred through secondary domain, protein-spliced tRNA introns, eight- endosymbiosis, wherein eukaryotic cell 6 Plant Systematics Archaebacteria Dinoflagellates Glaucophytes Gymnosperms Pteridophytes Angiosperms Euglenoides Brown algae algae Green Bryophytes Red algaeRed Bacteria Animalia Fungi

Carpel, stamen

Seeds Secondary growth

Vascular tissue Sporophyte independent Embryo Chloroplast Chloroplast Gametangia (secondary (secondary Cuticle Endosymbiosis) Endosymbiosis) Green chloroplast

Chloroplast (primary endosymbiosis)

Mitochondria Cytoskeletal elements: actin, myosin, tubulin ER, Golgi, lysosomes Mitosis , Meiosis Membrane bound nucleus Linear DNA, with histones

Figure 1.2 Cladogram showing the evolution of major groups of organisms and the associated apomorphies. Chloroplast evolution has occurred twice, once (primary endosymbiosis) eukaryote cell engulfing a photosynthetic bacterial cell, and elewhere (secondary endosymbiosis) eukaryotic cell engulfing an eukaryotic cell containing chloroplast. engulfed an eukaryotic cell containing a curred, along with the thylakoid structure chloroplast. This common evolutionary se- and a variety of storage products quence is shared by green plants (including green algae; green chloroplast), red al- The Plant Kingdom gae (red chloroplast) and brown algae and their relatives (commonly known as It is now universally agreed that members stramenopiles; brown chloroplast), in which of the plant kingdom include, without doubt diversification of chloroplast pigments oc- the green algae, liverworts and mosses, pteri- Plants, Taxonomy and Systematics 7 dophytes, gymnosperms and finally the an- TAXONOMY AND SYSTEMATICS giosperms, the largest group of plants. All these plants share a green chloroplast. Red There are slightly more than one third of a algae, Brown algae and Glaucophytes, latter million species of plants known to man to- two together known as stramenophiles, also day, the information having been accumu- belong to this kingdom. All these groups lated through efforts of several millenniums. share the presence of a chloroplast. All green Although man has been classifying plants plants share a green chloroplast with chlo- since the advent of civilization, taxonomy rophyll b, chlorophyll a, thylakoids and was recognized as a formal subject only in grana, and starch as storage food. Evolution 1813 by A. P. de Candolle as a combination of cuticle combined with gametangia and of Greek words taxis (arrangement) and no- embryo characterizes embryophytes, includ- mos (rules or laws) in his famous work ing bryophytes, pteridophytes and seed Theorie elementaire de la botanique. For a plants. The development of vascular tissue long time plant taxonomy was considered as of phloem and xylem, and independent sporo- ‘the science of identifying, naming, and clas- phyte characterize tracheophytes including sifying plants’ (Lawrence, 1951). Since iden- pteridophytes and seed plants. Secondary tification and nomenclature are important growth resulting in the formation of wood prerequisites for any classification, taxonomy and seed habit differentiates seed plants. The is often defined as the ‘science dealing with final evolution of a distinct flower, carpels the study of classification, including its and stamens, together with vessels and sieve bases, principles, rules and procedures’ tubes set apart the angiosperms, the most (Davis and Heywood, 1963). highly evolved group of plants. Although Systematics was recognized as The species of living organisms on this a formal major field of study only during the planet include Monera-10,000; Protista- latter half of twentieth century, the term 250,000; Fungi-100,000; Plantae-279,000; had been in use for a considerable period. Animalia-1,130,000. Nearly three fourth of Derived from the Latin word systema (orga- animals are insects (800,0000) and of these nized whole), forming the title of the famous more than one third beetles (300,000). work of Linnaeus Systema naturae (1735), the Amongst plants nearly 15,000 species be- term Systematics first appeared in his Gen- long to usually overlooked mosses and liv- era Plantarum (1737), though Huxley (1888) erworts, 10,000 ferns and their allies, 820 is often credited to have made the first use to gymnosperms and 253,000 to an- of the term in his article in Nature on the giosperms (belonging to about 485 families systematics of birds. Simpson (1961) defined and 13,372 genera), considered to be the systematics as a ‘scientific study of the most recent and vigorous group of plants kinds and diversity of organisms, and of that have occurred on earth. Angiosperms any and all relationships between them’. occupy the majority of the terrestrial space It was recognized as a more inclusive field on earth, and are the major components of of study concerned with the study of diver- the world’s vegetation. sity of plants and their naming, classifica- Brazil and Colombia, both located in the tion and evolution. The scope of taxonomy tropics, are considered to be countries with has, however, been enlarged in recent years the most diverse angiosperms floras and to make taxonomy and systematics synony- which rank first and second. China, even mous. A broader definition (Stace, 1980) of though the main part of her land is not lo- taxonomy, to coincide with systematics rec- cated in the tropics, the number of her an- ognized it as ‘the study and description of giosperms still occupies the third place in variation in organisms, the investigation the world, and has approximately 300 fami- of causes and consequences of this varia- lies, 3, 100 genera and 30,000 species. tion, and the manipulation of the data 8 Plant Systematics obtained to produce a system of classifi- with never-ending duties. The continuous cation’. flow of data necessitates rendering descrip- Realization of the fact that a good number tive information, revising schemes of iden- of authors still consider taxonomy to be a tification, revaluating and improving sys- more restricted term and systematics a more tems of classification and perceiving new inclusive one has led recent authors to pre- relationships for a better understanding of fer the term systematics to include discus- the plants. The discipline as such includes sion about all recent developments in their all activities that are a part of the effort to works. Modern approach to systematics aims organize and record the diversity of plants at reconstructing the entire chronicle of and appreciate the fascinating differences evolutionary events, including the formation among the species of plants. Systematic ac- of separate lineages and evolutionary modi- tivities are basic to all other biological sci- fications in characteristics of the organisms. ences, but also depend, in turn, on other dis- It ultimately aims at discovering all the ciplines for data and information useful in branches of the evolutionary tree of life; and constructing classification. Certain disci- to document all the changes and to describe plines of biology such as cytology, genetics, all the species which form the tips of these ecology, palynology, paleobotany and phyto- branches. This won’t be possible unless in- geography are so closely tied up with sys- formation is consolidated in the form of an tematics that they can not be practiced with- unambiguous system of classification. This, out basic systematic information. Experi- however, is again impossible without a clear ments cannot be carried out unless the or- understanding of the basic identification and ganisms are correctly identified and some nomenclatural methods. Equally important information regarding their relationship is is the understanding of the recent tools of available. The understanding of relation- data handling, newer concepts of ships is particularly useful in the applied phylogenetics, expertise in the judicious uti- fields of plant breeding, horticulture, forestry lization of fast accumulating molecular data and pharmacology for exploring the useful- in understanding of affinities between taxa. ness of related species. Knowledge of sys- Prior to the evolutionary theory of Darwin, tematics often guides the search for plants relationships were expressed as natural af- of potential commercial importance. finities on the basis of an overall similarity in morphological features. Darwin ushered Basic Components (Principles) in an era of assessing phylogenetic relationships based on the course of evolution- of Systematics ary descent. With the introduction of com- Various systematic activities are directed puters and refined statistical procedures, towards the singular goal of constructing an overall similarity is represented as phenetic ideal system of classification that necessi- relationship, which takes into account ev- tates the procedures of identification, de- ery available feature, derived from such di- scription, nomenclature and constructing af- verse fields as anatomy, embryology, mor- finities. This enables a better management phology, palynology, cytology, phytochemis- of information to be utilized by different try, physiology, ecology, phytogeography and workers, investigating different aspects, ultrastructure. structure and functioning of different spe- With the advancement of biological fields, cies of plant. new information flows continuously and the taxonomists are faced with the challenge of Identification integrating and providing a synthesis of all the available data. Systematics now is, thus, Identification or determination is recognizing an unending synthesis, a dynamic science an unknown specimen with an already Plants, Taxonomy and Systematics 9 known taxon, and assigning a correct rank Whereas the fresh specimens can be de- and position in an extant classification. In scribed conveniently, the dry specimens need practice, it involves finding a name for an to be softened in boiling water or in a wet- unknown specimen. This may be achieved by ting agent before these could be described. visiting a herbarium and comparing unknown Softening is often essential for dissection of specimen with duly identified specimens flowers in order to study their details. stored in the herbarium. Alternately, the specimen may also be sent to an expert in Nomenclature the field who can help in the identification. Nomenclature deals with the determination Identification can also be achieved using of a correct name for a taxon. There are various types of literature such as Floras, different sets of rules for different groups of Monographs or Manuals and making use of living organisms. Nomenclature of plants identification keys provided in these sources (including fungi) is governed by the Inter- of literature. After the unknown specimen national Code of Botanical Nomenclature has been provisionally identified with the (ICBN) through its rules and recommenda- help of a key, the identification can be fur- tions. Updated every six years or so, the ther confirmed by comparison with the de- Botanical Code helps in picking up a single tailed description of the taxon provided in the correct name out of numerous scientific literature source. names available for a taxon, with a particu- A method that is becoming popular over lar circumscription, position and rank. To the recent years involves taking a photo- avoid inconvenient name changes for cer- graph of the plant and its parts, uploading tain taxa, a list of conserved names is this picture on the website and informing provided in the Code. Cultivated plants are the members of appropriate electronic Lists governed by the International Code of No- or Newsgroups, who can see the photograph menclature for Cultivated Plants (ICNCP), at the website and send their comments to slightly modified from and largely based on the enquirer. Members of the fraternity could the Botanical Code. thus help each other in identification in a Names of animals are governed by the In- much efficient manner. ternational Code of Zoological Nomenclature (ICZN); those of bacteria by International Description Code for the Nomenclature of Bacteria The description of a taxon involves listing (ICNB), now called Bacteriological Code (BC). its features by recording the appropriate A separate Code exists for viruses, named character states. A shortened description the International Code of Virus Classifica- consisting of only those taxonomic charac- tion and Nomenclature (ICVCN). ters which help in separating a taxon from With the onset of electronic revolution and other closely related taxa, forms the diag- the need to have a common database for liv- nosis, and the characters are termed as di- ing organisms for global communication a agnostic characters. The diagnostic char- common uniform code is being attempted. acters for a taxon determine its circumscrip- The Draft BioCode is the first public expres- tion. The description is recorded in a set pat- sion of these objectives. The first draft was tern (habit, stem, leaves, flower, sepals, pet- prepared in 1995. After successive reviews als, stamens, carpels, fruit, etc.). For each the fourth draft, named Draft BioCode (1997) character, an appropriate character-state is prepared by the International Committee for listed. Flower colour (character) may thus be Bionomenclature was published by Greuter red, yellow, white, etc. (states). The descrip- et al., (1998) and is now available on the web. tion is recorded in semi-technical language The last decade of twentieth century also saw using specific terms for each character state the development of rankless PhyloCode to enable a proper documentation of data. based on the concepts of phylogenetic 10 Plant Systematics systematics. It omits all ranks except spe- (a taxonomic group assigned to any rank; pl. cies and ‘clades’ based on the concept of rec- taxa), dividing a taxon into smaller units, ognition of monophyletic groups. The latest uniting two or more taxa into one, transfer- version of PhyloCode (PhyloCode4b, 2007) is ring its position from one group to another also available on the web. and altering its rank. Once established, a classification provides an important mecha- Phylogeny nism of information storage, retrieval and Phylogeny is the study of the genealogy and usage. This ranked system of classification evolutionary history of a taxonomic group. is popularly known as the Linnaean sys- Genealogy is the study of ancestral relation- tem. Taxonomic entities are classified in ships and lineages. Relationships are de- different fashions: picted through a diagram better known as a 1. Artificial classification is utilitarian, phylogram (Stace, 1989), since the com- based on arbitrary, easily observable monly used term cladogram is more appro- characters such as habit, colour, num- priately used for a diagram constructed ber, form or similar features. The through cladistic methodology. A phylogram sexual system of Linnaeus, which fits is a branching diagram based on the degree in this category, utilized the number of advancement (apomorphy) in the descen- of stamens for primary classification dants, the longest branch representing the of the flowering plants. most advanced group. This is distinct from a 2. Natural classification uses overall phylogenetic tree in which the vertical scale similarity in grouping taxa, a concept represents a geological time-scale and all liv- initiated by M. Adanson and culminating groups reach the top, with primitive ones ing in the extensively used classifi- near the centre and advanced ones near the cation of Bentham and Hooker. Natu- periphery. Monophyletic groups, including all ral systems of the eighteenth and the descendants of a common ancestor, are nineteenth centuries used morphol- recognized and form entities in a classifica- ogy in delimiting the overall similar- tion system. Paraphyletic groups, wherein ity. The concept of overall similarity some descendants of a common ancestor are has undergone considerable refine- left out, are reunited. Polyphyletic groups, with ment in recent years. As against the more than one common ancestor, are split sole morphological features as indica- to form monophyletic groups. Phenetic infor- tors of similarity in natural systems, mation may often help in determining a phy- overall similarity is now judged on the logenetic relationship. basis of features derived from all the available fields of taxonomic informa- Classification tion (phenetic relationship). Classification is an arrangement of organ- 3. Phenetic Classification makes the isms into groups on the basis of similari- use of overall similarity in terms of a ties. The groups are, in turn, assembled into phenetic relationship based on data more inclusive groups, until all the organ- from all available sources such as mor- isms have been assembled into a single phology, anatomy, embryology, phy- most inclusive group. In sequence of in- tochemistry, ultrastructure and, in creasing inclusiveness, the groups are as- fact, all other fields of study. Phenetic signed to a fixed hierarchy of categories classifications were strongly advo- such as species, genus, family, order, class cated by Sneath and Sokal (1973) but and division, the final arrangement consti- did not find much favour with major tuting a system of classification. The pro- systems of classification of higher cess of classification includes assigning ap- plants. Phenetic relationship has, propriate position and rank to a new taxon however, been very prominently used Plants, Taxonomy and Systematics 11

in modern phylogenetic systems to Cronquist, Thorne and Dahlgren, are largely decide the realignments within the based on decisions in which phenetic infor- system of classification. mation is liberally used in deciding the phy- 4. Phylogenetic classification is based logenetic relationship between groups, dif- on the evolutionary descent of a group fering largely on the weightage given to the of organisms, the relationship de- cladistic or phenetic relationship. picted either through a phylogram, There have been suggestions to abandon phylogenetic tree or a cladogram. the hierarchical contemporary classifica- Classification is constructed with this tions based on the Linnaean system, which premise in mind, that all the descen- employs various fixed ranks in an estab- dants of a common ancestor should be lished conventional sequence with a ‘phy- placed in the same group (i.e., group logenetic taxonomy’ in which monophyletic should be monophyletic). If some de- groups would be unranked names, defined scendents have been left out, render- in terms of a common ancestry, and diag- ing the group paraphyletic, these are nosed by reference to synapomorphies (de brought back into the group to make Queiroz and Gauthier, 1990; Hibbett and it monophyletic (merger of Donoghue, 1998). Asclepiadaceae with Apocynaceae, Classification not only helps in the place- and the merger of Capparaceae with ment of an entity in a logically organized Brassicaceae in recent classifica- scheme of relationships, it also has a great tions). Similarly, if the group is poly- predictive value. The presence of a valuable phyletic (with members from more chemical component in one species of a par- than one phyletic lines, it is split to ticular genus may prompt its search in other create monophyletic taxa (Genus related species. The more a classification Arenaria split into Arenaria and reflects phylogenetic relationships, the more Minuartia). This approach, known as predictive it is supposed to be. The meaning cladistics, is practiced by cladists. of a natural classification is gradually los- 5. Evolutionary taxonomic classifica- ing its traditional sense. A ‘natural classifi- tion differs from a phylogenetic clas- cation’ today is one visualized as truly phy- sification in that the gaps in the varia- logenetic, establishing monophyletic groups tion pattern of phylogenetically adja- making fair use of the phenetic information cent groups are regarded as more im- so that such groups also reflect a phenetic portant in recognizing groups. It ac- relationship (overall similarity) and the clas- cepts leaving out certain descendants sification represents a reconstruction of the of a common ancestor (i.e. recogniz- evolutionary descent. ing paraphyletic groups) if the gaps are not significant, thus failing to provide a true picture of the genealogical Aims of Systematics history. The characters considered to The activities of plant systematics are ba- be of significance in the evolution (and sic to all other biological sciences and, in the classification based on these) are turn, depend on the same for any additional dependent on expertise, authority and information that might prove useful in con- intuition of systematists. Such clas- structing a classification. These activities sifications have been advocated by are directed towards achieving the Simpson (1961), Ashlock (1979), Mayr undermentioned aims: and Ashlock (1991) and Stuessy (1990). 1. To provide a convenient method of The approach, known as eclecticism, identification and communication. A is practiced by eclecticists. workable classification having the taxa The contemporary phylogenetic systems of arranged in hierarchy, detailed and classification, including those of Takhtajan, diagnostic descriptions are essential 12 Plant Systematics

for identification. Properly identified primitive groups towards the centre and arranged herbarium specimens, and the advanced ones towards the dichotomous keys, polyclaves and com- periphery. puter-aided identification are impor- 5. To provide an integration of all availa- tant aids for identification. The Code ble information. To gather information (ICBN), written and documented from all the fields of study, analysing through the efforts of IAPT (Interna- this information using statistical pro- tional Association of Plant Taxonomy), cedures with the help of computers, helps in deciding the single correct providing a synthesis of this informa- name acceptable to the whole botani- tion and developing a classification cal community. based on overall similarity. This 2. To provide an inventory of the world’s synthesis is unending, however, flora. Although a single world Flora is since scientific progress will continue difficult to come by, floristic records of and new information will continue to continents (Continental Floras; cf. pour and pose new challenges for Flora Europaea by Tutin et al.), regions taxonomists. or countries (Regional Floras; cf. Flora 6. To provide an information reference, of British India by J. D. Hooker) and supplying the methodology for informa- states or even counties (Local Floras; tion storage, retrieval, exchange and cf. Flora of Delhi by J. K. Maheshwari) utilization. To provide significantly are well documented. In addition, World valuable information concerning en- Monographs for selected genera (e.g., dangered species, unique elements, The genus Crepis by Babcock) and fami- genetic and ecological diversity. lies (e.g., Das pflanzenreich ed. by 7. To provide new concepts, reinterpret A. Engler) are also available. the old, and develop new procedures for 3. To detect evolution at work; to recon- correct determination of taxonomic struct the evolutionary history of the affinities, in terms of phylogeny and plant kingdom, determining the se- phenetics. quence of evolutionary change and 8. To provide integrated databases includ- character modification. ing all species of plants (and possibly 4. To provide a system of classification all organisms) across the globe. Sev- which depicts the evolution within the eral big organizations have come to- group. The phylogenetic relationship gether to establish online searchable between the groups is commonly de- databases of taxon names, images, depicted with the help of a phylogram, scriptions, synonyms and molecular wherein the longest branches repre- information. sent more advanced groups and the shorter, nearer the base, primitive Advancement Levels in ones. In addition, the groups are represented by balloons of different sizes Systematics that are proportional to the number of Plant systematics has made considerable species in the respective groups. Such strides from herbarium records to data- a phylogram is popularly known as a banks, recording information on every bubble diagram. The phylogenetic re- possible attribute of a plant. Because of ex- lationship could also be presented in treme climatic diversity, floristic variabil- the form of a phylogenetic tree (with ity, inaccessibility of certain regions and vertical axis representing the geologi- economic disparity of different regions, the cal time scale), where existing species present-day systematics finds itself in reach the top and the bubble diagram different stages of advancement in different may be a cross-section of the top with parts of the world. Tropical Asia and tropical Plants, Taxonomy and Systematics 13

Africa are amongst the richest areas of the This development is helpful in the prepa- world in terms of floristic diversity but ration of Floras and Monographs. It also aids amongst the poorest as far as the economic in better understanding of the degree of resources to pursue complete documenta- variation within a species. Two or more her- tion of systematic information. The whole barium specimens may appear to be suffi- of Europe, with more than 30 m square ciently different and regarded as belonging kilometres of landscape and numerous rich to different species on the basis of a few nations with their vast economic resources, available herbarium records, but only a field have to account for slightly more than 6 thou- study of populations involving thousands of sand species of vascular plants. India, on the specimens can help in reaching at a better other hand, with meager resources, less understanding of their status. If there are than one tenth of landscape, has to account enough field specimens to fill in the gaps for the study of at least four times more of in variation pattern, there is no justifica- the vascular plants. A small country like tion in regarding them as separate species. Colombia, similarly, has estimated 4,5000 On the other hand, if there are distinct gaps different species, with only a few botanists in the variation pattern, it strengthens to study the flora. Great Britain, on the other their separate identity. In fact, many plants, hand, has approximately 1370 taxa (Wood- described as species on the basis of limited land, 1991), with thousands of professional material in the pioneer phase, are found to and amateur botanists available to document be variants of other species in the consoli- the information. It is not strange, as such, dation phase. Most parts of central Europe, that there is lot of disparity in the level of North America and Japan are experienc- advancement concerning knowledge about ing this phase. respective floras. Taxonomic advancement today can be conveniently divided into four Experimental or distinct phases encountered in different parts of the world: Biosystematic Phase During this phase, the herbarium records Exploratory or Pioneer Phase and variation studies are complete. In addi- This phase marks the beginning of plant tax- tion, information on biosystematics (stud- onomy, collecting specimens and building ies on transplant experiments, breeding herbarium records. The few specimens of a behaviour and chromosomes) is also avail- species in the herbarium are the only record able. Transplant experiments involve col- of its variation. These specimens are, how- lecting seeds, saplings or other propagules ever, useful in a preliminary inventory of from morphologically distinct populations flora through discovery, description, naming from different habitats and growing them and identification of plants. Here, morphol- under common environmental conditions. If ogy and distribution provide the data on the differences between the original popu- which the systematists must rely. Taxo- lations were purely ecological, the differ- nomic experience and judgement are par- ences would disappear under a common en- ticularly important in this phase. Most ar- vironment, and there is no justification in eas of tropical Africa and tropical Asia are regarding them as distinct taxonomic enti- passing through this phase. ties. On the other hand, if the differences still persist, these are evidently genetically Consolidation or Systematic fixed. If these populations are allowed to grow together for several years, their breeding Phase behaviours would further establish their sta- During this phase, herbarium records are tus. If there are complete reproductive bar- ample and enough information is available riers between the populations, they will fail concerning variation from field studies. to interbreed, and maintain their separate 14 Plant Systematics identity. These evidently belong to different is assembled, analyzed, and a meaningful species. On the other hand, if there is no synthesis of analysis is provided for under- reproductive isolation between them, over standing phylogeny. Collection of data, the years, they would interbreed, form in- analysis and synthesis are the jobs of an intermediate hybrids, which will soon fill the dependent discipline of systematics, referred gaps in their variation. Such populations to as numerical taxonomy. evidently belong to the same species and The first two phases of systematics are better distinguished as ecotypes, subspecies often considered under alpha-taxonomy and or varieties. Further chromosomal studies the last phase under omega-taxonomy. At can throw more light on their affinities and present, only a few persons are involved in status. Central Europe has reached this encyclopaedic work and that too, in a few iso- phase of plant systematics. lated taxa. It may thus be safe to conclude that though in a few groups omega-taxonomy Encyclopaedic or is within reach, for the great majority of plants, mainly in the tropics, even the ‘al- Holotaxonomic Phase pha’ stage has not been crossed. The total Here, not only the previous three phases are integration of available information for the attained, but information on all the botani- plant kingdom is, thus, only a distant dream cal fields is also available. This information at present. Chapter 2 Botanical Nomenclature

Nomenclature deals with the application of a are allowed across the codes. The generic correct name to a plant or a taxonomic group. name Cecropia applies to showy moths as also In practice, nomenclature is often combined to tropical trees. Genus Pieris, similarly, re- with identification, since while identifying an fers to some butterflies and shrubs. unknown plant specimen, the author chooses During the last decade, there have been and applies the correct name. The favourite attempts at developing unified code for all liv- temperate plant is correctly identified ing organisms, for convenient handling of whether you call it ‘Seb‘ (vernacular Hindi combined database for all organisms. Draft name), Apple, Pyrus malus or Malus malus, but BioCode and PhyloCode, have been con- only by using the correct scientific name certed efforts in this direction, but it will take Malus domestica does one combine identifi- a long time before acceptability of these cation with nomenclature. The current ac- endeavours can be determined. tivity of botanical nomenclature is governed by the International Code of Botanical Nomen- clature (ICBN) published by the International NEED FOR SCIENTIFIC NAMES Association of Plant Taxonomy (IAPT). The Scientific names formulated in Latin are pre- Code is revised after changes at each Inter- ferred over vernacular or common names national Botanical Congress. The naming of since the latter pose a number of problems: the animals is governed by the International 1. Vernacular names are not available for Code of Zoological Nomenclature (ICZN) and all the species known to man. that of bacteria by the International Code for 2. Vernacular names are restricted in the Nomenclature of Bacteria (ICNB; now their usage and are applicable in a known as Bacteriological Code-BC). Virus single or a few languages only. They nomenclature is governed by International are not universal in their application. Code of Virus Classification and Nomencla- 3. Common names usually do not provide ture (ICVCN). Naming of cultivated plants is information indicating family or ge- governed by the International Code of Nomen- neric relationship. Roses belong to the clature for Cultivated Plants (ICNCP), which genus Rosa; woodrose is a member of is largely based on ICBN with a few additional the genus Ipomoea and primrose be- provisions. Whereas within the provisions of longs to the genus Primula. The three a particular code no two taxa can bear the genera, in turn, belong to three differ- same correct scientific name, same names ent families—Rosaceae, Convolvu- 16 Plant Systematics

laceae and Primulaceae, respectively. DEVELOPMENT OF BOTANICAL Oak is similarly common name for the CODE species of genus Quercus, but Tanbark For several centuries, the names of plants oak is Lithocarpus, poison oak a Rhus, appeared as polynomials—long descriptive silver oak a Grevillea and Jerusalem phrases, often difficult to remember. A spe- oak a Chenopodium. cies of willow, for example, was named Salix 4. Frequently, especially in widely distrib- pumila angustifolia altera by Clusius in his uted plants, many common names herbal (1583). Casper Bauhin (1623) intro- may exist for the same species in the duced the concept of Binomial nomenclature same language in the same or differ- under which the name of a species consists ent localities. Cornflower, bluebottle, of two parts, the first the name of the genus bachelor‘s button and ragged robin all to which it belongs and the second the spe- refer to the same species Centaurea cific epithet. Onion is thus appropriately cyanus. named Allium cepa, Allium being the generic 5. Often, two or more unrelated species name and cepa the specific epithet. Bauhin, are known by the same common name. however, did not use binomial nomenclature Bachelor‘s button, may thus be for all the species and it was left to Carolus Tanacetum vulgare, Knautia arvensis or Linnaeus to firmly establish this system of Centaurea cyanus. Cockscomb, is simi- naming in his Species plantarum (1753). The larly, a common name for Celosia early rules of nomenclature were set forth by cristata but is also applied to a seaweed Linnaeus in his Critica botanica (1737) and Ploca-mium coccinium or to Rhinanthus further amplified in Philosophica botanica minor. (1751). A. P. de Candolle, in his Theorie elementaire de la botanique (1813), gave ex- Why Latin? plicit instructions on nomenclatural proce- Scientific names are treated as Latin regard- dures, many taken from Linnaeus. Steudel, less of their origin. It is also mandatory to in Nomenclator botanicus (1821), provided have a Latin diagnosis for any new taxon Latin names for all flowering plants known published 1 January 1935 onwards. The cus- to the author together with their synonyms. tom of Latinized names and texts originates The first organized effort towards the de- from medieval scholarship and custom con- velopment of uniform botanical nomencla- tinued in most botanical publications until ture was made by Alphonse de Candolle, who the middle of nineteenth century. Descrip- circulated a copy of his manuscript Lois de la tions of plants are not written in classical nomenclature botanique. After deliberations of Latin of Cicero or of Horace, but in the ‘lin- the First International Botanical Congress at gua franca’ spoken and written by scholars Paris (1867), the Paris Code, also known as during middle ages, based on popular Latin ‘de Candolle rules‘ was adopted. Linnaeus spoken by ordinary people in the classical (1753) was made the starting point for plant times. The selection has several advantages nomenclature and the rule of priority was over modern languages: i) Latin is a dead lan- made fundamental. Not satisfied with the guage and as such meanings and interpre- Paris Code, the American botanists adopted tation are not subject to changes unlike, En- a separate Rochester Code (1892), which in- glish and other languages; ii) Latin is spe- troduced the concept of types, strict applica- cific and exact in meaning; iii) grammatical tion of rules of priority even if the name was sense of the word is commonly obvious (white a tautonym (specific epithet repeating the translated as album-neuter, alba-feminine generic name, e.g. Malus malus). or albus- masculine); and iv) Latin language The Paris Code was replaced by the Vienna employs the Roman alphabet, which fits well Code (1905), which established Species in the text of most languages. plantarum (1753) of Linnaeus as the starting Botanical Nomenclature 17 point; tautonym was not accepted, and Latin IIB. Nomina familiarum bryophytorum et diagnosis was made essential for new spe- spermatophytorum conservanda cies. In addition, a list of conserved generic IIIA. Nomina generica conservanda et names (Nomina generic conservanda) was rejicienda approved. Not satisfied with the Vienna Code IIIB. Nomina specifica conservanda et also, adherents of the Rochester Code adopted rejicienda the American Code (1907), which did not ac- IV. Nomina utique rejicienda (A. Algae, cept the list of conserved names and the re- B. Fungi, C.Bryophyta, D. Pterido- quirement for Latin diagnosis. phyta, E. Spermatophyta) It was not until the 5th International Bo- V. Opera utique oppressa tanical Congress (IBC) at Cambridge (1930) The last three useful appendices were in- that the differences were finally resolved and cluded for the first time in the Tokyo Code. a truly International Code evolved, accept- The first (IIIB) includes the names of con- ing the concept of type method, rejecting the served and rejected specific names; the sec- tautonyms, making Latin diagnosis manda- ond (IV) lists the names and all combinations tory for new groups and approving conserved based on these names, which are ruled as generic names. The Code has since been rejected under Art. 56, and none is to be used; constantly amended at each International and the last (V) the list of publications (and Botanical Congress. The 15th IBC was held the category of taxa therein) which are not th at Tokyo in 1993, 16 at St Louis in 1999 validly published according to the Code. (published by Greuter et al., 2000). The Code Principles form the basis of the system of discussed in the following pages is based on botanical nomenclature. There are 62 main th the 17 International Botanical Congress rules (set out as articles) and associated rec- held at Vienna in 2005 (Published by McNeill ommendations. The object of the rules is to et al., 2006- Code is generally published one put the nomenclature of the past into order th year after the Congress). The 18 Interna- and provide for that of the future; names con- tional Botanical Congress would be held in trary to the rules cannot be maintained. Rec- Melbourne, Australia in 2011. ommendations deal with subsidiary points, and are meant for uniformity and clarity. CONTENTS OF BOTANICAL CODE Names contrary to the recommendations Publication of the Code is based on the real- cannot, on that account, be rejected, but they ization that botany requires a precise and are not examples to be followed. Conserved simple system of nomenclature used by bota- names include those that do not satisfy the nists in all countries. The Code aims at pro- principle of priority but are sanctioned for use. vision of a stable method of naming taxonomic The various rules and recommendations are groups, avoiding and rejecting the use of discussed here under relevant headings. names which may cause error or ambiguity or throw science into confusion. Preamble Preamble highlights the philosophy of the botanical 1. Botany requires a precise and simple Code. The Code is divided into 3 divisions: system of nomenclature used by bota- I. Principles nists in all countries, dealing on the II. Rules and recommendations one hand with the terms which denote III. Provisions for the governance of the Code the ranks of taxonomic groups or units, In addition, the Code includes the follow- and on the other hand with the scien- ing appendices: tific names which are applied to the I. Names of hybrids individual taxonomic groups of plants. IIA. Nomina familiarum algarum, The purpose of giving a name to a fungorum, pteridophytorum et taxonomic group is not to indicate its fossilium conservanda et rejicienda characters or history, but to supply a 18 Plant Systematics

means of referring to it and to indicate and formation of names for special its taxonomic rank. This Code aims at plant categories in agricultural, for- the provision of a stable method of nam- estry, and horticultural nomenclature. ing taxonomic groups, avoiding and 9. The only proper reasons for changing rejecting the use of names which may a name are either a more profound cause error or ambiguity or throw knowledge of the facts resulting from science into confusion. Next in impor- adequate taxonomic study or the ne- tance is the avoidance of the useless cessity of giving up a nomenclature creation of names. Other consider- that is contrary to the rules. ations, such as absolute grammatical 10. In the absence of a relevant rule or correctness, regularity or euphony of where the consequences of rules are names, more or less prevailing custom, doubtful, established custom is fol- regard for persons, etc., notwithstand- lowed. ing their undeniable importance, are 11. This edition of the Code supersedes all relatively accessory. previous editions. 2. The Principles form the basis of the system of botanical nomenclature. Principles of ICBN 3. The detailed Provisions are divided into Rules, set out in the Articles, and Rec- The International Code of Botanical Nomen- ommendations. Examples (Ex.) are clature is based on the following set of six added to the rules and recommenda- principles, which are the philosophical basis tions to illustrate them. of the Code and provide guidelines for the tax- 4. The object of the Rules is to put the onomists who propose amendments or delib- nomenclature of the past into order and erate on the suggestions for modification of to provide for that of the future; names the Code: contrary to a rule cannot be main- 1. Botanical Nomenclature is independ- tained. ent of Zoological Nomenclature. The 5. The Recommendations deal with sub- Code applies equally to the names of sidiary points, their object being to taxonomic groups treated as plants bring about greater uniformity and clar- whether or not these groups were ity, especially in future nomenclature; originally so treated. names contrary to a recommendation 2. The application of names of taxonomic cannot, on that account, be rejected, groups is determined by means of but they are not examples to be followed. nomenclatural types. 6. The provisions regulating the gover- 3. Nomenclature of a taxonomic group is nance of this Code form its last divi- based upon priority of publication. sion. 4. Each taxonomic group with a particu- 7. The rules and recommendations apply lar circumscription, position and rank to all organisms traditionally treated as can bear only one correct name, the plants, whether fossil or non-fossil, earliest that is in accordance with the e.g., blue-green algae, Cyanobacteria, rules. fungi, including chytrids, oomycetes, 5. Scientific names of taxonomic groups and slime moulds, photosynthetic pro- are treated as Latin, regardless of deri- tists and taxonomically related non- vation. photosynthetic groups. 6. The rules of nomenclature are retro- 8. The International code of nomenclature active, unless expressly limited. for cultivated plants is prepared under the authority of the International Com- Names of Taxa mission for the Nomenclature of Cul- tivated Plants and deals with the use Taxon (pl. taxa) refers to a taxonomic group Botanical Nomenclature 19 belonging to any rank. The system of nomen- division, -opsida a class, -opsidae or -idae a clature provides a hierarchical arrangement subclass, -ales an order, -ineae a suborder of ranks. Every plant is treated as belonging and -aceae a family. The detailed hierarchy to a number of taxa, each assigned a particu- of ranks and endings with examples is given lar rank. Onion thus belongs to Allium cepa in Table 2.1. Stevens (2005) describes this (species rank), Allium (genus rank), Alliaceae system of naming where endings determine (family rank) and so on. The seven principal ranks of taxa and suggest relative positions obligatory ranks of taxa in descending se- of groups in local hierarchy as flagged hier- quence are: kingdom (regnum), division or archy. phylum (divisio, phylum), class (classis), or- The names of the groups belonging to ranks der (ordo), family (familia), genus (genus), and above the level of genus are uninomials in species (species). The ending of the name the plural case. Thus, it is appropriate to say indicates its rank: ending -bionta denotes a ‘Winteraceae are primitive’ and inappropri- kingdom, -phyta a division, -phytina a sub- ate when we say ‘Winteraceae is primitive’.

Table 2.1 Ranks and endings provided by the ICBN Rank Ending Example Kingdom -bionta Chlorobionta Division -phyta Magnoliophyta -mycota (Fungi) Eumycota Subdivision -phytina Pterophytina -mycotina (Fungi) Eumycotina Class -opsida Magnoliopsida -phyceae (Algae) Chlorophyceae -mycetes (Fungi) Basidiomycetes Subclass -opsidae Pteropsidae -idae (Seed plants) Rosidae -physidae (Algae) Cyanophysidae -mycetidae (Fungi) Basidiomycetidae Order -ales Rosales Suborder -ineae Rosineae Family -aceae Rosaceae Subfamily -oideae Rosoideae Tribe -eae Roseae Subtribe -inae Rosinae Genus -us, -um, -is, -a, -on Pyrus, Allium, Arabis, Rosa, Polypogon Subgenus Cuscuta subgenus Eucuscuta Section Scrophularia section Anastomosanthes Subsection Scrophularia subsection Vernales Series Scrophularia series Lateriflorae Species Rosa canina Subspecies Crepis sancta subsp. bifida Varietas Lantana camara var. varia Forma Tectona grandis f. punctata 20 Plant Systematics

The focus changes when we are mentioning Traditional Alternate Type the rank with it. Thus, ‘the family Winter- name name mm genus aceae is primitive’ is a logically correct Cruciferae Brassicaceae Brassica statement. Guttiferae Clusiaceae Clusia The name of a taxon above the rank of fam- Leguminosae Fabaceae Faba ily may be formed by replacing the termina- Umbelliferae Apiaceae Apium tion -aceae in the name of an included fam- Compositae Asteraceae Aster ily by the termination denoting their rank Labiatae Lamiaceae Lamium (order Rosales from family Rosaceae, class Palmae Arecaceae Areca Magnoliopsida from family Magnoliaceae). Gramineae Poaceae Poa The name of a family is a plural adjective used as a noun. It is formed from the name The alternate names of these families of the type genus by replacing the genitive which are in accordance with the ICBN rules singular (gender) ending with the termina- need to be encouraged. tion -aceae in the genera of classical Latin Under a unique exception to article 18 of or Greek origin (Family Rosaceae from the Code, the name Leguminosae is sanc- genus Rosa, Potamogetonaceae from tioned as alternate name for Fabaceae only Potamogeton). For generic names of non- as long as it includes all the three subfami- classical origin, when analogy with classical lies: Faboideae (Papilionoideae), Caesalpin- names is insufficient to determine the ioideae and Mimosoideae. In case these are genitive singular, -aceae is added to the full upgraded as families, then the name Papil- word (Ginkgoaceae from Ginkgo). For generic ionaceae is conserved against Leguminosae names with alternative genitives the one for the first of these getting the name implicitly used by the original author must Fabaceae. The two alternate names allowed be maintained (Nelumbonaceae from then are Papilionaceae and Fabaceae. Nelumbo—Nelumbonis declined by analogy Fossil taxa may be treated as morphotaxa. with umbo and umbonis). A morphotaxon is defined as a fossil taxon, The endings for ranks, subclass and above which for nomenclatural purposes, comprises are recommendations, whereas for order and only the parts, life-history stages, or below these are mandatory rules. It is, thus, preservational states represented by the nothing strange that group names such as corresponding nomenclatural type. Gymnosperms, Angiosperms, Bryophytes, Pteridophytes, Lignosae, Herbaceae, Genus Dicotyledoneae, Monocotyledoneae, etc. have been used as valid group names for The generic name is a uninomial singular supraordinal taxa. Recently developed ver- word treated as a noun. The examples of the sions of the APG classification recognize only shortest generic name Aa as well as the long- informal group names such as Paleoherbs, est name Brassosophrolaeliocattleya (26 char- Tricolpates (Eudicots), Asterids, Rosids, acters), both belong to the family Orchidaceae. Euasterids, Eurosids above the order level as The genus may have a masculine, neuter or monophyletic clades. No formal taxonomic feminine form as indicated by the ending: names are used above the level of the order. -us , -pogon commonly stand for masculine The name of a family ends in -aceae. The genera, -um for neuter and -a, -is for femi- following eight families of angiosperms, how- nine genera. The first letter of the generic ever, whose original names are not in accor- name is always capitalised. The name may dance with the rules but the use of these be based on any source, but the common names has been sanctioned because of old sources for generic names are as under: traditional usage. The type genus of each 1. Commemoration of a person com- family is listed: monly an author such as Bauhinia for Botanical Nomenclature 21

Bauhin, Benthamia and Benthamida for The generic name of a tree, whatever be Bentham, Darwinia for Darwin, the ending, takes a feminine form, since Hutchinsonia for Hutchinson, Lamarckia trees are generally feminine in classical for Lamarck and Linnaea for Linnaeus. Latin. Pinus, Quercus and Prunus are, thus, It may also be used for head of a state all feminine genera. If two words are used to such as Victoria for Queen Victoria of form a generic name, these have to be joined England, Washingtonia for King George by a hyphen (generic name Uva-ursi). In case, Washington, and Zinobia for Queen however, the two words were combined into Zinobia of Palmyra. The names com- one word by the original author, the use of memorating a person, man or woman hyphen is not needed (generic name always take the feminine form. The Quisqualis). The name of a genus may not name of a genus is constructed by add- coincide with a technical term currently used ing -ia if name of a person ends in a in morphology unless it was published before consonant (Fuchsia after Fuchs), -a if 1 January 1912 and was accompanied by a it ends in a vowel (Ottoa after Otto), but specific name published in accordance with -ea is added if it ends in -a (Collaea af- the binary system of Linnaeus. The generic ter Colla). If the name ends in -er both name Tuber (published in 1780 was accom- are permitted (Kernera for Kerner; panied by a binary specific name Tuber Sesleria for Seslar). For Latinized per- gulosorum F. H. Wigg.) and is, therefore, val- sonal names ending with -us, this ter- idly published. On the other hand the intended mination is dropped before adding ap- generic names ‘Lanceolatus’ (Plumstead, propriate ending (Linnaea after 1952) is, therefore, not validly published. Linnaeus, Dillenia after Dillenius). The Words such as ‘radix’, ‘caulis’, ‘folium’, ‘spina’, name may also be formed directly as etc., cannot now be validly published as ge- in case of Victoria and Zinobia, as indi- neric names. cated above. 2. Based on a place such as Araucaria Species after Arauco a province of Chile, The name of a species is a binomial: con- Caucasia for Caucasus in Russia, sisting of two words, a generic name followed Salvadora for EL Salvadore, Arabis for by a specific epithet. The Code recommends Arabia and Sibiraea for Siberia. The that all specific epithets should begin with a name could also be based on names of lower case initial letter. An upper case ini- two places such as Austroamericium tial letter is sometimes used, however, for (Australia and America) or place and specific epithets derived from a person’s author such as Austrobaileya (Austra- name, former generic name or a common lia and Bailey) name. The Code discourages such usage for 3. Based on an important charac- specific epithets. A specific epithet may be ter such as yellow wood in Zanthoxy- derived from any source or composed arbi- lum, liver-like leaves in Hepatica, trarily. The following sources are commonly marshy habit of Hygrophila, trifoliate used: leaves of Trifolium, and spiny fruit of 1. Name of a person. The specific epithet Acanthospermum. named after a person may take geni- 4. Aboriginal names taken directly tive (possessive) or an adjectival form: from a language other than Latin with- (i) When used in the genitive form the out alteration of ending. Narcissus is epithet takes its form depending on the Greek name for daffodils named the ending of the person’s name. For after the famous Greek god Narcissus, names ending in a vowel or -er the Ginkgo a Chinese, Vanda a Sanskrit letter -i is added for a male person and Sasa a Japanese aboriginal name. (roylei after Royle, hookeri after 22 Plant Systematics

Hooker), -ae for female person (laceae adding the appropriate genitive end- after Lace), and -orum for more than ing. The specific epithets in one persons with the same surname genitive form are not related to the (hookerorum after Hooker & Hooker). gender of the genus. Illustrative ex- If the name, however, ends in -a amples are listed in Table a. then -e is added (paulae after Paula). (ii) When used in adjectival form, the If the name ends in a consonant -ii epithet takes its ending from the is added male person (wallichii after gender of the genus after adding - Wallich), -iae for a female person ian if name of the person ends in a (wilsoniae after Wilson), and -iorum consonant, adding -an if the name for more than one persons with same ends in a vowel except when it ends surname and at least one male in -a, wherein -n is added. Illustra- (verlotiorum after Verlot brothers), and tive examples are given in Table b. -iarum if both are female (brauniarum 2. Place. The specific epithet may, simi- for Braun sisters). For names of the larly, be formed by using the place persons already in Latin (e.g. name as an adjective, when again the Linnaeus), the Latin ending (-us in genus determines the ending after the this case) has to be dropped before addition of -ian or -ic and then the rel- Table a

Person Sex Specific epithet Binomial

Royle M roylei Impatiens roylei Hooker M hookeri Iris hookeri Sengupta M senguptae Euphorbia senguptae Wallich M wallichii Euphorbia wallichii Todd F toddiae Rosa toddiae Gepp & Gepp M geppiorum Codiaeum geppiorum Linnaeus M linnaei Indigofera linnaei Table b

Author Genus Gender Specific epithet Binomial

Webb Rosa Feminine webbiana Rosa webbiana Webb Delphinium Neuter webbianum Rheum webbianum Webb Astragalus Masculine webbianus Astragalus webbianus Kotschy Hieracium Neuter kotschyanum Hieracium kotschyanum Lagasca Centaurea Feminine lagascana Centaurea lagascana

Table c Place Genus Gender Specific epithet Binomial

Kashmir Iris Feminine kashmiriana Iris kashmiriana Delphinium Neuter kashmirianum Delphinium kashmirianum Tragopogon Masculine kashmirianus Tragopogon kashmirianus India Rosa Feminine indica Rosa indica Solanum Neuter indicum Solanum indicum Euonymus Masculine indicus Euonymus indicus Botanical Nomenclature 23

evant gender ending as determined by adjectival form in species of the same ge- the genus. The specific epithet is also nus is to be avoided, e.g. Iris hookeri and formed by adding -ensis (for masculine I. Hookeriana; Lysimachia hemsleyana Oliv. and feminine genera, e.g. Hedera and L. hemsleyi Franch. nepalensis, Rubus canadensis) or -ense (for neuter genera, e.g. Ligustrum Infraspecific taxa nepalense) to the place name. Different The names of subspecies are trinomials and situations are illustrated in Table c. are formed by adding a subspecific epithet 3. Character. Specific epithets based on to the name of a species, e.g. Angelica a character of the species are always archangelica ssp. himalaica. A variety in adjectival form and derive their (varieta) within a subspecies may accord- gender from the genus. A name based ingly be quadrinomial as in Bupleurum on a white plant part may take the falcatum ssp. eufalcatum var. hoffmeisteri, or form alba (Rosa alba), album (Chenopo- it may just be a trinomial when no subspe- dium album) or albus (Mallotus albus). cies is recognized within a species as in A common epithet used for cultivated Brassica oleracea var. capitata. A forma may plants may similarly take the form also be assigned a name in a similar man- sativa (Oryza sativa), sativum (Allium ner, e.g. Prunus cornuta forma villosa. The sativum) or sativus (Lathyrus sativus) formation of the infraspecific epithet follows depending on the gender of the genus the same rules as the specific epithet. In- to which the epithet is assigned. Some fraspecific name may sometimes be a poly- epithets, however, such as bicolor (two- nomial as Saxifraga aizoon var. aizoon coloured) and repens (creeping) remain subvar. brevifolia f. multicaulis subf. surculosa unchanged, e.g. Ranunculus repens, Engl. & Irmsch. Ludwigia repens and Trifolium repens. 4. Noun in apposition. A specific epithet may sometimes be a noun in apposi- The Type Method tion carrying its own gender, and usu- The names of different taxonomic groups are ally in the nominative case. Binomial based on the type method, by which a cer- Pyrus malus is based on the Greek tain representative of the group is the source name malus for common apple. In Al- of the name for the group. This representa- lium cepa, similarly, cepa is the Latin tive is called the nomenclatural type or sim- name for onion. ply the type, and methodology as typifica- Both the generic name and the spe- tion. The type need not be the most typical cific epithet are underlined when writ- member of the group, it only fixes the name ten or typed. When printed, they are of a particular taxon and the two are perma- in Italics or boldface. After the generic nently associated. Type may be correct name name in a species has been spelled or even a synonym. Thus the tea family name out at least once, if used for other spe- (Theaceae) is derived from synonym Thea cies, it may be abbreviated using the although the correct name for the genus is initial capital, e.g. Quercus dilatata, Camellia. Mimosa is the type for family Q. suber, Q. Ilex, etc. A specific epithet Mimosaceae, but unlike most representatives is usually one word but when consist- of the family that have pentamerous flow- ing of two words, these must be hy- ers, the genus Mimosa has tetramerous flow- phenated as in Capsella bursa-pastoris ers. The family Urticaceae, similarly, has and Rhamnus vitis-idaea, or else the Urtica as its type. When the originally large two words may be combined into one family was split into a number of smaller as in Narcissus pseudonarcissus natural families, the name Urticaceae was Although not leading to rejection, the use retained for the group containing the genus of same name in genitive form as well as Urtica, since the two cannot be separated. 24 Plant Systematics

The other splitter groups with family rank the same person. Often the collection got the names Moraceae, Ulmaceae and number is also the same, differenti- Cannabaceae with type genera Morus, Ulmus ated as a, b, c, etc. and Cannabis, respectively. The family 3. Syntype: Any one of the two or more Malvaceae has seen a lot of realignments, specimens cited by the author when with Tiliaceae sometimes merged with no holotype was designated, or any one Malvaceae. Thorne (2003) shifts Tilia to of the two or more specimens simulta- Malvaceae, but retains rest of the genera. neously designated as types. Duplicate This necessitates name change for former of a syntype is an isosyntype. Tiliaceae (excluding genus Tilia) to 4. Paratype: A paratype is a specimen Grewiaceae, with Grewia as the type genus. cited in the protologue that is neither The type of a family and the higher groups the holotype nor an isotype, nor one of is ultimately a genus, as indicated above. A the syntypes if two or more specimens type of a particular genus is a species, e.g. were simultaneously designated as Poa pratensis for Poa. The type of name of a types. species or infraspecific taxon, where it ex- 5. Lectotype: A specimen or any other el- ists, is a single type specimen, preserved in ement selected from the original ma- a known herbarium and identified by the terial cited by the author when no place of collection, name of the collector and holotype was originally selected or his collection number. It may also be an il- when it no longer exists. A lectotype is lustration of the plant. The Code recognizes selected from isotypes or syntypes. In several kinds of type, depending upon the lectotype designation, an isotype must way in which a type specimen is selected. be chosen if such exists, or otherwise These include: a syntype if such exists. If no isotype, 1. Holotype: A particular specimen or il- syntype or isosyntype (duplicate of lustration designated by the author of syntype) is extant, the lectotype must the species to represent type of a spe- be chosen from among the paratypes if cies. For the purpose of typification, a such exist. If no cited specimens ex- specimen is a gathering, or part of a ist, the lectotype must be chosen from gathering, of a single species or among the uncited specimens and infraspecific taxon made at one time, cited and uncited illustrations which disregarding admixtures. It may con- comprise the remaining original ma- sist of a single plant, parts of one or terial, if such exist. several plants, or of multiple small 6. Neotype: A specimen or illustration se- plants. A specimen is usually mounted lected to serve as nomenclatural type either on a single herbarium sheet or as long as all of the material on which in an equivalent preparation, such as the name of the taxon was based is a box, packet, jar or microscope slide. missing; a specimen or an illustration Type specimens of names of taxa must selected when no holotype, isotype, be preserved permanently and may not paratype or syntype exists. be living plants or cultures. However, 7. Epitype: A specimen or illustration se- cultures of fungi and algae, if preserved lected to serve as an interpretative type in a metabolically inactive state (e.g. when the holotype, lectotype or previ- by lyophilization or deep-freezing), are ously designated neotype, or all origi- acceptable as types. It is now essen- nal material associated with a validly tial to designate a holotype when pub- published name, is demonstrably am- lishing a new species. biguous and cannot be critically iden- 2. Isotype: A specimen which is a dupli- tified for purposes of the precise appli- cate of the holotype, collected from the cation of the name of a taxon. When same place, at the same time and by an epitype is designated, the holotype, Botanical Nomenclature 25

lectotype or neotype that the epitype G. Bentham, Hook. for William Hooker, supports must be explicitly cited. Hook.f. for Sir J. D. Hooker (f. stands for fil- In most cases in which no holotype was ius, the son; J. D. Hooker was son of Will- designated there will also be no paratypes, iam Hooker), R.Br. for Robert Brown, Lam. since all the cited specimens will be for J. P. Lamarck, DC. for A. P. de Candolle, syntypes. However, when an author has des- Wall. for Wallich, A. DC. for Alphonse de ignated two or more specimens as types, any Candolle, Scop. for G. A. Scopoli and Pers. remaining cited specimens are paratypes for C. H. Persoon. and not syntypes. Topotype is often the name given to a Single author specimen collected from the same locality The name of a single author follows the name from which the holotype was originally col- of a species (or any other taxon) when a lected. single author proposed a new name, e.g. In cases where the type of a name is a Solanum nigrum L. culture permanently preserved in a metabolically inactive state, any living isolates obtained from that should be referred to as Multiple authors ‘ex-type’ (ex typo), ‘ex-holotype’ (ex holotypo), The names of two or more authors may be as- ‘ex-isotype’ (ex isotypo), etc., in order to make sociated with a name for a variety of reasons. it clear they are derived from the type but These different situations are exhibited by are not themselves the nomenclatural type. citing the name of the authors differently: When an infraspecific variant is recog- 1. Use of et: When two or more authors nized within a species for the first time, it publish a new species or propose a new automatically establishes two infraspecific name, their names are linked by et, taxa. The one, which includes the type e.g. Delphinium viscosum Hook.f. et specimen of the species, must have the Thomson. same epithet as that of the species, e.g. Aca- 2. Use of parentheses: The rules of bo- cia nilotica ssp. nilotica. Such a name is called tanical nomenclature specify that an autonym, and the specimen an whenever the name of a taxon is autotype. The variant taxon would have its changed by the transfer from one ge- own holotype and is differentiated by an epi- nus to another, or by upgrading or down- thet different from the specific epithet, e.g. grading the level of the taxon, the origi- Acacia nilotica ssp. indica. nal epithet should be retained. The It must be borne in mind that the applica- name of the taxon providing the epithet tion of the type method or typification is a is termed a basionym. The name of the methodology different from typology, which original author or authors whose epi- is a concept based on the idea that does not thet is being used in the changed name recognize variation within the taxa, and be- is placed within parentheses, and the lieves that an idealized specimen or pattern author or authors who made the name can represent a natural taxon. This concept change outside the parentheses, e.g. of typology was very much in vogue before Dar- Cynodon dactylon (Linn.) Pers., based on win put forward his ideas about variations. the basionym Panicum dactylon Linn., the original name for the species. Author Citation 3. Use of ex: The names of two authors For a name to be complete, accurate and are linked by ex when the first author readily verifiable, it should be accompanied had proposed a name but was validly by the name of the author or authors who published only by the second author, first published the name validly. The names the first author failing to satisfy all or of the authors are commonly abbreviated, some of the requirements of the Code, e.g. L. for Carolus Linnaeus, Benth. for e.g. Cerasus cornuta Wall. ex Royle. 26 Plant Systematics

4. Use of in: The names of authors are 1. sp. nov. for species nova, a species new linked using in when the first author to science; Tragopogon kashmirianus published a new species or a name in G. Singh, sp. nov. (published in 1976). a publication of another author, e.g. 2. comb. nov. for combinatio nova, a Carex kashmirensis Clarke in Hook.f. name change involving the epithet of Clarke published this new species in the basionym, name of the original au- the Flora of British India whose author thor being kept within parentheses; was Sir J. D. Hooker. Vallisneria natans (Lour.) Hara comb. 5. Use of emend: The names of two au- nov. (published in 1974 based on thors are linked using emend. Physkium natans Lour., 1790). (emendavit: person making the correc- 3. comb. et stat. nov. for combinatio et tion) when the second author makes status nova, when a new combination some change in the diagnosis or in cir- also involves the change of status. Epi- cumscription of a taxon without alter- thet of the basionym will accordingly ing the type, e.g. Phyllanthus Linn. be used in the combination intended; emend. Mull. Caragana opulens Kom. var. licentiana 6. Use of square brackets: Square (Hand.-Mazz.) Yakovl. comb. et stat. brackets are used to indicate nov. (published in 1988 based on C. prestarting point author. The generic licentiana Hand.-Mazz., 1933; new com- name Lupinus was effectively published bination also involved change of sta- by Tournefort in 1719, but as it hap- tus from a species C. licentiana to a pens to be earlier than 1753, the start- variety of Caragana opulens Kom.). ing date for botanical nomenclature 4. nom. nov. for nomen novum, when the based on Species plantarum of original name is replaced and its epi- Linnaeus, the appropriate citation for thet cannot be used in the new name; the genus is Lupinus [Tourne.] L. Myrcia lucida McVaugh nom. nov. (pub- When naming an infraspecific taxon, the lished in 1969 to replace M. laevis O. authority is cited both for the specific Berg, 1862, an illegitimate homonym epithet and the infraspecific epithet, e.g. of M. laevis G. Don, 1832). Acacia nilotica (L.) Del. ssp. indica (Benth.) These abbreviations are, however, used Brenan. In the case of an autonym, how- only when first published. In future refer- ever, the infraspecific epithet does not bear ences, these are replaced by the name of the author’s name since it is based on the the publication, page number and the year same type as the species, e.g. Acacia nilotica of publication for full citation, or at least the (L.) Del. ssp. nilotica. year of publication. Thus when first published in 1976 as a new species, Tragopogon Publication of Names kashmirianus G. Singh sp. nov. appeared in a book titled Forest Flora of Srinagar on page The name of a taxon, when first published, 123, figure 4, any successive reference to should meet certain requirements so as to this species would appear as: Tragopogon become a legitimate name for consideration kashmirianus G. Singh, Forest Flora of when deciding on a correct name. A valid Srinagar, p 123, f. 4, 1976 or Tragopogon publication should satisfy the following kashmirianus G. Singh, 1976. The other requirements: names would be cited as Vallisneria natans (Lour.) Hara, 1974, Caragana opulens Kom. Formulation var. licentiana (Hand.-Mazz.) Yakovl., 1988 A name should be properly formulated and and Myrcia lucida McVaugh, 1969, specify- its nature indicated by a proper abbreviation ing the year of publication. A new combina- after the name of the author: tion, or an avowed substitute (replacement Botanical Nomenclature 27 name, nomen novum), published on or after tion, the herbarium or institution in which 1 January 1953 based on a previously and the type is conserved must be specified. validly published name is not validly pub- Names published on or after 1 January 2007 lished unless its basionym (name-bringing would require a specimen (and not a mere or epithet-bringing synonym) or the replaced illustration) as type, except only for micro- synonym (when a new name is proposed) is scopic algae or microfungi for which preser- clearly indicated and a full and direct refer- vation of a type was technically difficult, and ence given to its author and place of valid where illustration is accepted as type. On or publication, with page or plate reference and after 1 January 2001, lectotypification or date. Authors should cite themselves by neotypification of a name of a species or in- name after each new name they publish fraspecific taxon is not affected unless indi- rather than refer to themselves by expres- cated by use of the term ‘lectotypus’ or sions such as ‘nobis’ (nob.) or ‘mihi’ (m.). ‘neotypus’, its abbreviation, or its equivalent in a modern language. The specimen selected Latin diagnosis as type should belong to a single gathering. ‘Echinocereus sanpedroensis’ (Raudonat & Names of all new species (or other taxa new Rischer, 1995) was based on a ‘holotype’ con- to science) published 1 January 1935 on- sisting of a complete plant with roots, a de- wards should have a Latin diagnosis (Latin tached branch, an entire flower, a flower cut translation of diagnostic features). Full de- in halves, and two fruits, which according to scription of the species in any language can the label were taken from the same cultivated accompany the Latin diagnosis. A descrip- individual at different times and preserved, tion in any language, not accompanied by a in alcohol, in a single jar. This material be- Latin diagnosis is allowed for publications longs to more than one gathering and can- before 1 January 1935. For publications be- not be accepted as a type. Raudonat & fore 1 January 1908, an illustration with Rischer’s name is thus not validly published. analysis without any accompanying description is valid. Thus description in any lan- Effective publication guage is essential from 1 January 1908 onwards and this accompanied by a Latin di- The publication becomes effective by distri- agnosis from 1 January 1935. For name bution in printed form, through sale, ex- changes or new names of already known spe- change or gift to the general public or at least cies, a full reference to the original publica- the botanical institutions with libraries action should be made. cessible to botanists generally. It is not affected by communication of new names at a public meeting, by the placing of names in Typification collections or gardens open to the public; by A holotype should be designated. Publica- the issue of microfilm made from manu- tion on or after 1 January 1958 of the name scripts, typescripts or other unpublished ma- of a new taxon of the rank of genus or below terial, by publication on-line, or by dissemi- is valid only when the type of the name is nation of distributable electronic media. The indicated. For the name of a new taxon of publication in newspapers and catalogues (1 the rank of genus or below published on or January 1953 onwards) and seed exchange after 1 January 1990, an indication of the lists (1 January 1977 onwards) is not an ef- type must include one of the words ‘typus’ fective publication. A theses submitted for a or ‘holotypus’, or its abbreviation, or even its higher degree on or after 1 January, 1953 is equivalent in a modern language. For the considered effectively published, only if it car- name of a new species or infraspecific taxon ries a statement of its publication or an in- published on or after 1 January 1990 whose ternal evidence (e.g. an ISBN, or a commer- type is a specimen or unpublished illustra- cial publisher). Publication of handwritten 28 Plant Systematics material, reproduced by some mechanical algae, but Vienna Code extended this provi- or graphic process (indelible autograph) sion also to organisms subsequently recog- such as lithography, offset, or metallic etch- nized as fungi. The provision has benefitted ing before 1 January 1953 is effective. Salvia the recognition of Microsporidia, long con- oxyodon Webb & Heldr. was effectively pub- sidered protozoa and now recognized as fungi. lished in an indelible autograph catalogue Similarly the species of Pneumocystis, not placed on sale (Webb & Heldreich, Catalogus validly published because of lack of Latin plantarum hispanicarum ... ab A. Blanco diagnosis or description, are now treated as lectarum, Paris, Jul 1850, folio). The Journal validly published, since Latin requirement of the International Conifer Preservation Soci- is not mandatory under Zoological Code, ety, Vol. 5[1]. 1997 (‘1998’), consists of du- which originally covered these mammalian plicated sheets of typewritten text with hand- pathogens, now treated as fungi. written additions and corrections in several The Tokyo Code included a rule (Art. 32. places. The handwritten portions, being in- 1-2), subject to ratification by the XVI Inter- delible autograph published after 1 January national Botanical Congress (St Louis, 1999) 1953, are not effectively published. Intended according to which new names of plants and new combinations (‘Abies koreana var. fungi would have to be registered in order to yuanbaoshanensis’, p. 53), for which the be validly published after the 1st of January basionym reference is handwritten are not 2000. A trial registration had already begun, validly published. The entirely handwritten on a non-mandatory basis, for a two-year pe- account of a new taxon (p. 61: name, Latin riod starting 1 January 1998. The proposal description, statement of type) is treated as was, however, voted out at St. Louis and all unpublished. references to the registration deleted from The date of a name is that of its valid pub- the Code. lication. When the various conditions for A correction of the original spelling of a valid publication are not simultaneously ful- name does not affect its date of valid publi- filled, the date is that on which the last con- cation. dition was fulfilled. However, the name must always be explicitly accepted in the place of Rejection of Names its validation. A name published on or after 1 January 1973 for which the various con- The process of selection of correct name for ditions for valid publication are not simulta- a taxon involves the identification of illegiti- neously fulfilled is not validly published un- mate names, those which do not satisfy the less a full and direct reference is given to rules of botanical nomenclature. A legitimate the places where these requirements were name must not be rejected merely because previously fulfilled. it, or its epithet, is inappropriate or disagree- In order to be accepted, a name of a new able, or because another is preferable or bet- taxon of fossil plants published on or after 1 ter known or because it has lost its original January 1996 must be accompanied by a meaning. The name Scilla peruviana L. (1753) Latin or English description or diagnosis or is not to be rejected merely because the spe- by a reference to a previously and effectively cies does not grow in Peru. Any one or more published Latin or English description or di- of the following situations leads to the rejec- agnosis. tion of a name: For groups originally not covered by ICBN, 1. Nomen nudum (abbreviated nom. the Code accepts them as validly published nud.): A name with no accompanying if they meet the requirements of the perti- description. Many names published by nent non-botanical Code, but are now Wallich in his Catalogue (abbreviated recognized as organisms covered under bo- Wall. Cat.) published in 1812 were no- tanical Code. This provision earlier covered men nudum. These were either vali- organisms subsequently recognized as dated by another author at a later date Botanical Nomenclature 29

by providing a description (e.g. Cerasus Archangeli 1882 for almond became a cornuta Wall. ex Royle) or if by that time later homonym of Prunus communis the name has already been used for Huds., 1762 which is a species of another species by some other author, plums. P. communis (L.) Archangeli was the nomen nudum even if validated is as such replaced by P. dulcis (Mill.) rejected and a new name has to be Webb, 1967 as the name for almonds. found (e.g. Quercus dilatata Wall., a When two or more generic or specific nom. nud. rejected and replaced by Q. names based on different types are so himalayana Bahadur, 1972). similar that they are likely to be 2. Name not effectively published, not confused (because they are applied to properly formulated, lacking typifica- related taxa or for any other reason) tion or without a Latin diagnosis. they are to be treated as homonyms. 3. Tautonym: Whereas the Zoological Names treated as homonyms include: Code allows binomials with identical Asterostemma Decne. (1838) and generic name and specific epithet (e.g. Astrostemma Benth. (1880); Bison bison), such names in Botanical Pleuropetalum Hook. f. (1846) and nomenclature constitute tautonyms Pleuripetalum T. Durand (1888); (e.g. Malus malus) and are rejected. The Eschweilera DC. (1828) and words in the tautonym are exactly iden- Eschweileria Boerl. (1887); Skytanthus tical, and evidently names such as Meyen (1834) and Scytanthus Hook. Cajanus cajan or Sesbania sesban are (1844). The three generic names not tautonyms and thus legitimate. Bradlea Adans. (1763), Bradleja Banks Repetition of a specific epithet in an ex Gaertn. (1790), and Braddleya Vell. infraspecific epithet does not consti- (1827), all commemorating Richard tute a tautonym but a legitimate Bradley, are treated as homonyms autonym (e.g. Acacia nilotica ssp. because only one can be used without nilotica). serious risk of confusion. The follow- 4. Later homonym: Just as a taxon ing specific epithets under the same should have one correct name, the genus would also form homonyms Code similarly does not allow the same chinensis and sinensis; ceylanica and name to be used for two different spe- zeylanica; napaulensis, nepalensis, and cies (or taxa). Such, if existing, consti- nipalensis. tute homonyms. The one published at 5. Later isonym: When the same name, an earlier date is termed the earlier based on the same type, has been pub- homonym and that at a later date as lished independently at different times the later homonym. The Code rejects by different authors, then only the ear- later homonyms even if the earlier liest of these so-called ‘isonyms’ has homonym is illegitimate. Ziziphus nomenclatural status. The name is jujuba Lam., 1789 had long been used always to be cited from its original place as the correct name for the cultivated of valid publication, and later ‘isonyms’ fruit jujube. This, however, was ascer- may be disregarded. Baker (1892) and tained to be a later homonym of a re- Christensen (1905) independently lated species Z. jujuba Mill., 1768. The published the name Alsophila kalbreyeri binomial Z. jujuba Lam., 1789 is thus as a substitute for A. podophylla Baker rejected and jujube correctly named as (1891) non Hook. (1857). As published Z. mauritiana Lam., 1789. Similarly, by Christensen, Alsophila kalbreyeri is although the earliest name for al- a later ‘isonym’ of A. kalbreyeri Baker, monds is Amygdalus communis L., 1753 without nomenclatural status. when transferred to the genus Prunus 6. Nomen superfluum (abbreviated as the name Prunus communis (L.) nom. superfl.): A name is illegitimate 30 Plant Systematics

and must be rejected when it was Rhinanthus crista-galli to a group of sev- nomenclaturally superfluous when eral varieties, which he later described published, i.e., if the taxon to which it under separate names, rejecting the was applied—as circumscribed by its name R. crista-galli L. Several later author—included the type of a name authors, however, continued to use or epithet which ought to have been this name for diverse occasions until adopted under the rules. Physkium Schwarz (1939) finally listed this as natans Lour., 1790 thus when trans- Nomen dubium, and the name was fi- ferred to the genus Vallisneria, the epi- nally rejected. thet natans should have been retained 10. Name based on monstrosity: A name but de Jussieu used the name must be rejected if it is based on a Vallisneria physkium Juss., 1826 a monstrosity. The generic name name which becomes superfluous. The Uropedium Lindl., 1846 was based on a species has accordingly been named monstrosity of the species now referred correctly as Vallisneria natans (Lour.) to as Phragmidium caudatum (Lindl.) Hara, 1974. A combination based on a Royle, 1896. The generic name superfluous name is also illegitimate. Uropedium Lindl. must, therefore, be Picea excelsa (Lam.) Link is illegitimate rejected. The name Ornithogallum since it is based on a superfluous name fragiferum Vill., 1787, is likewise, Pinus excelsa Lam., 1778 for Pinus abies based on a monstrosity and thus Linn., 1753. The legitimate combina- should be rejected. tion under Picea is thus Picea abies (Linn.) Karst., 1880. Principle of Priority Nomen ambiguum 7. (abbreviated as The principle of priority is concerned with nom. ambig. : ) A name is rejected if it the selection of a single correct name for a is used in a different sense by differ- taxonomic group. After identifying legitimate ent authors and has become a source and illegitimate names, and rejecting the Rosa of persistent error. The name latter, a correct name has to be selected from villosa L. is rejected because it has among the legitimate ones. If more than one been applied to several different spe- legitimate names are available for a taxon, cies and has become a source of error. the correct name is the earliest legitimate Nomen confusum nom. 8. (abbreviated as name in the same rank. For taxa at the confus. : ) A name is rejected if it is species level and below the correct name is based on a type consisting of two or either the earliest legitimate name or a com- more entirely discordant elements, so bination based on the earliest legitimate that it is difficult to select a satisfac- basionym, unless the combination becomes tory lectotype. The characters of the a tautonym or later homonym, rendering it Actinotinus, genus for example, were illegitimate. The following examples illustrate Viburnum and derived from two genera the principle of priority: Aesculus, owing to the insertion of the inflorescence of Viburnum in the ter- 1. The three commonly known binomials minal bud of an Aesculus by a collector. for the same species of Nymphaea are The name Actinotinus must, therefore, N. nouchali Burm.f., 1768, N. acutiloba be abandoned. DC., 1824, N. stellata Willd., 1799 and 9. Nomen dubium (abbreviated as nom. N. malabarica Poir., 1798. Using the dub.): A name is rejected if it is dubi- priority criterion, N. nouchali Burm.f. is ous, i.e. it is of uncertain application selected as the correct name as it bears because it is impossible to establish the earliest date of publication. The the taxon to which it should be referred. other three names are regarded as Linnaeus (1753) attributed the name synonyms. The citation is written as: Botanical Nomenclature 31

Nymphaea nouchali Burm.f., 1768 Vallisneria physkium are based on the N. malabarica Poir., 1798 same type as the correct name N. stellata Willd., 1799 V. natans and are thus known as N. acutiloba DC., 1824 nomenclatural synonyms or homo- The following binomials for common typic synonyms. These three would maize plant exist: Zea mays Linn., 1753, remain together in all citations. The Z. curagua Molina, 1782, Z. indurata other two names V. gigantea and Sturtev., 1885 and Z. japonica Von V. asiatica are based on separate types Houtte, 1867. Zea mays being the ear- and may or may not be regarded as syno- liest validly published binomial is cho- nyms of V. natans depending on taxo- sen as correct name, and others cited nomic judgement. Such a synonym, as its synonyms as under: which is based on a type different from Zea mays L., 1753 the correct name, is known as a taxo- Z. curagua Molina, 1782 nomic synonym or heterotypic syno- Z. japonica Von Houtte, 1867 nym. V. spiralis auct. (auctorum- Z. indurata Sturtev., 1885 authors) is misplaced identification of 2. Loureiro described a species under the Asian specimens with V. Spiralis L. name Physkium natans in 1790. It was 3. The common apple was first described subsequently transferred to the genus by Linnaeus under the name Pyrus Vallisneria by A. L. de Jussieu in 1826, malus in 1753. The species was sub- but unfortunately, he ignored the sequently transferred to the genus epithet natans and instead used a Malus but the combination Malus malus binomial Vallisneria physkium, a super- (Linn.) Britt., 1888 cannot be taken as fluous name. Two Asiatic species with the correct name since it becomes a independent typification were de- tautonym. The other binomial under scribed subsequently under the names Malus available for apple is M. domestica V. gigantea Graebner, 1912 and Borkh, 1803 which is accepted as cor- V. asiatica Miki, 1934. Hara on mak- rect name and citation written as: ing a detailed study of Asiatic speci- Malus domestica Borkh mens concluded that all these names Pyrus malus Linn., 1753 are synonymous, and also that M. malus (Linn.) Britt., 1888— V. spiralis Linn. with which most of the Tautonym Asiatic specimens were identified does M. pumila auct. (non Mill.) not grow in Asia. As no legitimate com- M. communis Desf., 1798— Nom. bination based on Physkium natans superfl. Lour. existed, he made one—V. natans M. communis Desf. is based on same (Lour.) Hara—in 1974. The synonymy type as Pyrus malus, and is as such a would be cited as under: nomen superfluum. Apple has been Vallisneria natans (Lour.) Hara, 1974 assigned by some authors to M. pumila Physkium natans Lour.,1790— Mill., 1768, which however is small Basionym fruited Paradise apple. V. physkium Juss., 1826— nom. 4. Almond was first described by Linnaeus superfl. under the name Amygdalus communis V. gigantea Graebner, 1912 in 1753. Miller described another spe- V. asiatica Miki, 1934 cies under the name A. dulcis in 1768. V. spiralis auct. (non L., 1753) The two are now regarded as synony- The correct name of the species in mous. The genus Amygdalus was sub- this case, is the most recent name, but sequently merged with the genus it is based on the earliest basionym. It Prunus and the combination Prunus must be noted that Physkium natans and communis (L.) Archangeli made in 1882 32 Plant Systematics

based on the earlier name Amygdalus 1-5-1753. The starting dates for different communis Linn. It was discovered by groups include: Webb that the binomial Prunus commu- Seed plants, Pteridophytes, Sphagnaceae nis had already been used by Hudson Hepaticae, most Algae, slime moulds in 1762 for a different species render- and lichens...... 1-5-1753 ing P. communis (L.) Archangeli a later Mosses (excluding Sphagnaceae) homonym which had to be conse- ...... 1-1-1801 quently rejected. Webb accordingly Fungi ...... 31-12-1801 used the next available basionym Fossils ...... 31-12-1820 Amygdalus dulcis Mill., 1768 and made Algae (Nostocaceae)...... 1-1-1886 a combination Prunus dulcis (Mill.) Algae (Oedogoniaceae)...... 1-1-1900 Webb, 1967 as the correct name for The publications before these dates for re- almond. Another binomial, Prunus spective groups are ignored while deciding amygdalus Batsch, 1801, cannot be the priority. taken up as it ignores the earlier epi- Starting date for suprageneric names was thets. The citation for almond would set at Vienna Congress as 4 August, 1789, thus be: the date of publication of de Jussieu’s Gen- Prunus dulcis (Mill.) Webb, 1967 era Plantarum. Double author citation is not Amygdalus dulcis Mill., 1768— justified or permitted at suprageneric ranks. basionym A. communis L., 1753 Not above family rank P. communis (L.) Arch., The principle of priority is applicable only up 1882 (non Huds., 1762) to the family rank, and not above. P. amygdalus Batsch, 1801 When two or more names simultaneously Not outside the rank published are united, the first author to In choosing a correct name for a taxon, make such a merger has the right of choos- names or epithets available at that rank need ing the correct name from these. Brown, to be considered. Only when a correct name 1818 was the first to unite Waltheria at that rank is not available, can a combina- americana L., 1753 and W. indica L., 1753. tion be made using the epithet from another He adopted the name W. indica for the com- rank. Thus at the level of section the correct bined species, and this name is accordingly name is Campanula sect. Campanopsis R. treated as having priority over W. americana. Br., 1810 but when upgraded as a genus the The generic names Thea L. and Camellia L. correct name is Wahlenbergia Roth, 1821 and are treated as having been published simul- not Campanopsis (R. Br.) Kuntze, 1891. The taneously on 1 May 1753. The combined ge- following names are synonyms: nus bears the name Camellia, since Sweet, Lespedza eriocarpa DC. var. falconeri 1818, who was the first to unite the two gen- ...... Prain, 1897 era, chose that name, and cited Thea as a L. meeboldii ...... Schindler, 1911 synonym. Campylotropis eriocarpa var. falconeri (Prain) ...... Nair, 1977 Limitations to the principle C. meeboldii (Schindler) . Schindler, 1912 of priority The correct name at the species level un- Application of the principle of priority has der the genus Campylotropis would be C. the following limitations: meeboldii, ignoring the earlier epithet at the varietal level. If treated as a variety, the cor- Starting dates rect name would be C. eriocarpa var. falconeri, The principle of priority starts with the Spe- based on the earliest epithet at that rank. cies plantarum of Linnaeus published on Under the genus Lespedza, at the species Botanical Nomenclature 33 level the correct name would be L. meeboldii, same date of publication are united, the au- whereas at the varietal level, it would be thor who unites them first has the choice of L. eriocarpa var. falconeri. selecting the correct binomial. For a long Magnolia virginiana var. foetida L., 1753 time it was known that the first persons to when raised to specific rank is called M. gran- unite the two species were Fiori and Paoletti diflora L., 1759, not M. foetida (L.) Sarg., 1889. in 1896 who selected T. aestivum L. as the correct name. It was pointed out by Nomina Conservanda Kerguélen (1980), however, that the first per- Nomina conservanda (abbreviated as nom. son to unite these two species was actually cons.): Strict application of the principle of Mérat (1821) and he had selected priority has resulted in numerous name T. hybernum L. and not T. aestivum. This changes. To avoid name changes of well- discovery led to the danger of T. aestivum L. known families or genera—especially those being dropped in favour of T. hybernum L. containing many species—a list of conserved A proposal for conserving the name generic and family names has been prepared T. aestivum L. was thus made by Hanelt and and published in the Code with relevant Schultze-Motel (1983), and being the num- changes. Such nomina conservanda are to ber one economic plant this was accepted at be used as correct names replacing the ear- the Berlin Congress, removing any further lier legitimate names, which are rejected danger to the name Triticum aestivum L. and constitute nomina rejicienda (abbrevi- In 1768 P. Miller proposed a new name, ated nom. rejic.). The family name Theaceae Lycopersicon esculentum for tomato, a species D. Don, 1825 is thus conserved against described earlier by Linnaeus (1753) as Ternstroemiaceae Mirbe, 1813. The genus Solanum lycopersicum. Karsten (1882) made Sesbania Scop., 1777 is conserved against the name change Lycopersicum lycopersicum Sesban Adans., 1763 and Agati Adans., 1763. (L.) Karst., retaining the epithet used by Linnaeus, but since the name became a Conservation of names of species tautonym it was not considered the correct In spite of several protests from agricultural name for tomato. Nicolson (1974) suggested botanists and horticulturists, who were dis- an orthographic correction Lycopersicon gusted with frequent name changes due to lycopersicum (L.) Karst., suggesting that the strict application of the principle of pri- Lycopersicon and lycopersicum are ortho- ority, taxonomists for a long period did not graphic variants. Since the name agree upon conserving names at the species Lycopersicon lycopersicum was no longer a level. The mounting pressure and the dis- tautonym, it was accepted as the correct covery that Triticum aestivum was not the cor- name. But since Lycopersicon esculentum rect name of common wheat, compelled tax- Mill., 1768 was a more widely known name, onomists to agree at the Sydney Congress a proposal for its conservation was made by in 1981 upon the provision to conserve Terrel (1983) and accepted at the Berlin Con- names of species of major economic impor- gress along with that of Triticum aestivum L. tance. As a result, Triticum aestivum Linn. A list from a mere 5 in Tokyo Code has grown was the first species name conserved at Ber- to nearly 60 for Spermatophyta alone. Names lin Congress in 1987 and published in sub- listed in this Appendix fall under the special sequent Code in 1988. Another species name provisions of Art. 14.4. Neither a rejected also conserved along with was Lycopersicon name, nor any combination based on a re- esculentum Mill. jected name may be used for a taxon that Linnaeus described two species, Triticum includes the type of the corresponding con- aestivum and T. hybernum in his Species served name (Art. 14.7; see also Art. 14 Note plantarum, both bearing the same date of 2). Combinations based on a conserved name publication in 1753. According to the rules are, therefore, in effect, similarly conserved. of nomenclature when two species with the Given below are the major examples of 34 Plant Systematics species names which have been declared cated by including the sexual symbols nomina conservanda (each name followed by ( : female; : male) in the formula, or by the (=) sign, indicating taxonomic synonym placing the female parent first. If a non-al- or a (= =) sign, indicating nomenclatural syn- phabetical sequence is used, its basis should onym and then the binomial against which be clearly indicated. it has been conserved). Some names listed A hybrid may either be interspecific (be- as conserved have no corresponding nomina tween two species belonging to the same ge- rejicienda because they were conserved solely nus) or intergeneric (between two species to maintain a particular type: belonging to two different genera). A binary name may be given to the interspecific hy- Allium ampeloprasum L., 1753 brid or nothospecies (if it is self-perpetuat- (=) Allium porrum L., 1753 ing and/or reproductively isolated) by plac- Amaryllis belladonna L. ing the cross sign (if mathematical sign is available it should be placed immediately Bombax ceiba L. before the specific epithet, otherwise ‘x’ in Carex filicina Nees, 1834 lower case may be used with a gap) before (=) Cyperus caricinus D. Don, 1825 the specific epithet as in the following cases Hedysarum cornutum L., 1763 (hybrid formula may be added within the (= =) Hedysarum spinosum L., 1759 parentheses if the parents are established): 1. Salix x capreola (S. aurita ´ S. caprea) Lycopersicon esculentum Mill., 1768 or Salix ´capreola (S. aurita ´ S. caprea) (= =) Lycopersicon lycopersicum (L.) 2. Rosa x odorata (R. chinensis ´ R. H. Karsen, 1882 gigantea) or Rosa ´odorata (R. chinensis Magnolia kobus DC., 1817 ´ R. gigantea) Silene gallica L., 1753 The variants of interspecific hybrids are (=) Silene anglica L., 1753 named nothosubspecies and nothovarieties, (=) Silene lusitanica L., 1753 e.g. Salix rubens nothovar. basfordiana. (=) Silene quinquevulnera L., 1753 For an intergeneric hybrid, if given a dis- Triticum aestivum L., 1753 tinct generic name, the name is formed as (=) Triticum hybernum L.,1753. a condensed formula by using the first part (or whole) of one parental genus and last part (or whole) of another genus (but not the whole Names of Hybrids of both genera). A cross sign is placed before Hybridity is indicated by the use of the mul- the generic name of the hybrid, e.g. tiplication sign, or by the addition of the pre- ´Triticosecale (or x Triticosecale) from Triticum fix ‘notho-’ to the term denoting the rank of and Secale, ´Pyronia (or x Pyronia) from Pyrus the taxon, the principal ranks being and Cydonia, and Agropogon from Agrostis and nothogenus and nothospecies. A hybrid Polypogon. The names may be written as un- between named taxa may be indicated by der: placing the multiplication sign between the 1. ´Triticosecale (Triticum ´ Secale) names of the taxa; the whole expression is 2. ´Pyronia (Pyrus ´ Cydonia) then called a hybrid formula: The nothogeneric name of an interge- 1. Agrostis × Polypogon neric hybrid derived from four or more gen- 2. Agrostis stolonifera × Polypogon era is formed from the name of a person to monspeliensis which is added the termination -ara; no such 3. Salix aurita × S. caprea name may exceed eight syllables. Such a It is usually preferable to place the names name is regarded as a condensed formula: or epithets in a formula in alphabetical or- ´Potinara (Brassavola ´ Cattleya ´ Laelia der. The direction of a cross may be indi- ´ Sophronitis) Botanical Nomenclature 35

The nothogeneric name of a trigeneric hy- tal letter, and is not a Latin but rather a com- brid is either: (a) a condensed formula in mon name. It is either preceded by cv. as in which the three names adopted for the pa- Rosa floribunda cv. Blessings or simply within rental genera are combined into a single single quotation marks, e.g. Rosa floribunda word not exceeding eight syllables, using the ‘Blessings’. Cultivars may also be named whole or first part of one, followed by the directly under a genus (e.g. Hosta ‘Decorata’), whole or any part of another, followed by the under a hybrid (e.g. Rosa ´ paulii ‘Rosea’) or whole or last part of the third (but not the directly under a common name (e.g. Hybrid whole of all three) and, optionally, one or two Tea Rose ‘Red Lion’). The correct nothogeneric connecting vowels; or (b) a name formed like name for plants derived from the Triticum ´ that of a nothogenus derived from four or Secale crosses is ´ Triticosecale Wittmack more genera, i.e., from a personal name to ex A. Camus. As no correct name at the spe- which is added the termination -ara: cies level is available for the common crop ´Sophrolaeliocattleya (Sophronitis ´ triticales, it is recommended that crop triti- Laelia ´ Cattleya) cales be named by appending the cultivar When a nothogeneric name is formed name to the nothogeneric name, e.g. ´ from the name of a person by adding the ter- Triticosecale ‘Newton’. Since 1 January 1959 mination -ara, that person should preferably new cultivar names should have a descrip- be a collector, grower, or student of the group. tion published in any language and these A binomial for the intergeneric hybrid may names must not be the same as the botani- similarly be written as under: cal or common name of a genus or a species. Thus, cultivar names ‘Rose’, ‘Onion’, etc., are ´Agropogon lutosus (Agrostis stolonifera not permitted as the name of a cultivar. It is ´ Polypogon monspeliensis) recommended that cultivar names be regis- It is important to note that a binomial for tered with proper registering authorities an interspecific hybrid has a cross before the to prevent duplication or misuse of cultivar specific epithet, whereas in an intergeneric names. Registering authorities exist sepa- hybrid, it is before the generic name. Since rately for roses, orchids and several other the names of nothogenera and nothotaxa groups or genera. with the rank of a subdivision of a genus are condensed formulae or treated as such, they do not have types. UNIFIED BIOLOGICAL NOMEN- Since the name of a nothotaxon at the CLATURE rank of species or below has a type, state- Biology as a science is unusual in the sense ments of parentage play a secondary part in that the objects of its study can be named determining the application of the name. according to five different Codes of nomen- The grafts between two species are indi- clature: International Code of Zoological cated by a plus sign between two grafted spe- Nomenclature (ICZN) for animals, Interna- cies as, for example, Rosa webbiana + R. flo- tional Code of Botanical Nomenclature ribunda. (ICBN) for plants, International Code for the Nomenclature of Bacteria (ICNB) now called Names of Cultivated Plants Bacteriological Code (BC) for bacteria, The names of cultivated plants are governed International Code of Nomenclature for Cul- by the International Code of Nomenclature tivated Plants (ICNCP) for plants under for Cultivated Plants (ICNCP), last published cultivation, and International Code of Virus in 1995 (Trehane et al.). Most of the rules Classification and Nomenclature (ICVCN) for are taken from ICBN with additional recog- viruses. For the general user of scientific nition of a rank cultivar (abbreviated cv.) for names of organisms, there is thus inher- cultivated varieties. The name of a cultivar ent confusion in many aspects of this situa- is not written in Italics, it starts with a capi- tion: different sets of rules have different con- 36 Plant Systematics ventions for citing names, provide for differ- Salient Features ent forms for names at the same rank, and, although primarily each is based on priority Largely on the pattern of the Botanical Code of publication, differ somewhat in how they the salient features of this Draft BioCode in- determine the choice of the correct name. clude: This diversity of Codes can also create 1. General points: No examples are listed, more serious problems as, for example, in the Notes omitted at the present stage, al- determination of which Code to follow for though some will no doubt be needed. A those organisms that are not clearly plants, considerable number of articles and animals or bacteria, the so-called ambiregnal paragraphs have been dropped; the Draft organisms, or those whose current genetic BioCode has only 41 Articles, whereas affinity may be well established but whose the St. Louis Code has 62. traditional treatment has been in a different 2. Taxa and Ranks: The present ranks group (e.g. the cyanobacteria). Moreover, the of the Botanical Code are maintained development of electronic information re- in the Draft BioCode, and a few tenta- trieval, by often using scientific names with- tively added: domain (above kingdom), out clear taxonomic context, accentuates the in use for the pro-/eukaryotes, problem of divergent methods of citation and superfamily (in widespread use in zo- makes homonymy between, for example, ology), and the option of adding the pre- plants and animals a source of trouble and fix super- to rank designations that are frequently confusion. BioCode and not already prefixed. The phrase ‘fam- PhyloCode are two efforts towards a unified ily group’ refers to the ranks of code, the former retaining the ranked hier- superfamily, family and subfamily; archy of Linnaean system, whereas the lat- ‘subdivision of a family’ only to taxa ter developing a rankless system based on of a rank between family group and the concepts of phylogenetic systematics. genus group; ‘genus group’ refers to the ranks of genus and subgenus; ‘subdi- Draft BioCode vision of a genus’ only to taxa of a rank The desirability of seeking some harmoni- between genus group and species zation of all biological Codes has been ap- group; ‘species group’ to the ranks of preciated for some time (see Hawksworth, species and subspecies; and the term 1995) and an exploratory meeting on the ‘infra-subspecfic’ refers to ranks be- subject was held at Egham, UK in March low the species group. 1994. Recognizing the crucial importance of 3. Status: For the purposes of this Code scientific names of organisms in global com- Established names are those that are munication, these decisions included not published in accordance with relevant only agreement to take steps to harmonize articles of this Code or that, prior to 1 the existing terminology and procedures, but January 200n, were validly published also the desirability of working towards a or became available under the relevant unified system of biological nomenclature. Special Code. Acceptable names are The Draft BioCode is the first public expres- those that are in accordance with the sion of these objectives. The first draft was rules and are not unacceptable under prepared in 1995. After successive reviews homonymy rule, and, for names pub- the fourth draft, named Draft BioCode (1997) lished before 1 January 200n, are nei- prepared by the International Committee for ther illegitimate nor junior homonyms Bionomenclature (ICB) and published by under the relevant Special Code. In the Greuter et al., (1998) is now available on the family group, genus group, or species web: (http://www.rom.on.ca/biodiversity/ group, the accepted name of a taxon biocode/biocode97.html) from the Royal with a particular circumscription, po- Ontario Museum. sition, and rank is the acceptable Botanical Nomenclature 37

name which must be adopted for it after fulfillment of the present require- under the rules. In ranks not belong- ments for valid publication. ing to the family group, genus group, 5. Typification: The type of a nominal or species group, any established name taxon in the rank of genus or subdivi- of a taxon adopted by a particular au- sion of a genus is a nominal species. thor is an accepted name. In this Code, The type of a nominal taxon of the fam- unless otherwise indicated, the word ily group, or of a nominal taxon of a ‘name’ means an established name, higher rank whose name is ultimately whether it be acceptable or unaccept- based on a generic name, is the nomi- able. The name of a taxon consisting nal genus. For the names of of the name of a genus combined with superspecies, species or infraspecific one epithet is termed a binomen; the taxon is a specimen in a museum jar, name of a species combined with an herbarium sheet, slide preparation, or infraspecific epithet is termed a mounted set of freeze-dried ampoules. trinomen; binomina or trinomina are It should be in metabolically inactive also termed combinations. state. Type designations must be pub- 4. Establishment of names: In order to lished and registered. The typeless be established on or after 1 January (‘descriptive’) names do not have a 200n, a name of a taxon must be pub- representative type and are formed lished as provided for by the rules for based on some character/s, apply to publication, which are essentially taxa defined by circumscription, and similar to the Effective publication in may be used unchanged at different botany. The rules for establishment ranks above the rank of a family. (valid publication of Botanical Code) are 6. Registration: Registration is affected generally similar to the Botanical Code by submitting the published matter with certain changes. The new taxon that includes the protologue(s) or may have a Latin or English descrip- nomenclatural acts to a registering tion or diagnosis (thus Latin diagnosis office designated by the relevant inter- is not mandatory). Change of rank national body. It is pertinent to men- within the family group or genus group, tion that this requirement was based or elevation of rank within the species on the Botanical Code (Tokyo Code, group do not require the formal estab- 1994) where it has already been aban- lishment of a new name or combina- doned (St. Louis Code, 2000), removing tion. In order to be established, a name all references to registration in the of a new fossil botanical taxon of spe- Botanical Code. The date of a name is cific or lower rank must be accompa- that of its registration, which is the nied by an illustration or figure show- date of receipt of the relevant matter ing diagnostic characters, in addition at the registering office. When alter- to the description or diagnosis, or by a native (homotypic) names are proposed bibliographic reference to a previously simultaneously for registration for one published illustration or figure. This re- and the same taxon (same rank and quirement also applies to the names same position) neither is considered of new non-fossil algal taxa at these to be submitted. When one or more of ranks. Only if the corresponding genus the other conditions for establishment or species name is established can the have not been met prior to registration, name of a subordinate taxon. Establish- the name must be resubmitted for reg- ment (valid publication) under the istration after these conditions have BioCode includes registration of been fulfilled. names in the family group, genus 7. Precedence (priority): For purposes group and species group as a last step of precedence, the date of a name is 38 Plant Systematics

either the date attributed to it in an contexts where such citations are nei- adopted List of Protected Names or, for ther informative nor really appropriate. unlisted names, the date on which it This may be a timely change, since the was validly published under the botani- current attitude is showing signs of cal or bacteriological Code, or became cracking (Garnock-Jones and Webb, available under the zoological Code, or 1996). Art. 40.1 is so worded as to re- was established under the present flect this new attitude. Code. Limitations of priority that un- 10. Hybrids: The Appendix for Hybrids in der previous Codes affected names in the Botanical Code is replaced by a certain groups or of certain catego- single Article in the Draft BioCode. ries—even if not provided for in the This extreme simplification should in present Code—still apply to such no way disrupt the present and future names if they were published before 1 usage of hybrid designations, but has January 200n The limitations to prec- some philosophical changes as its edence are largely similar to botany. basis. Most importantly, taxonomy and Conservation and rejection procedures nomenclature are disentangled, in would remain largely the same as at conformity with Principle I. Cultivated present. The botanical process of sanc- plants are not covered under the tioning concerns old names only and BioCode. need be provided for in a future BioCode. PhyloCode 8. Homonymy: The major change with respect to the homonymy rule would The PhyloCode is being developed by Inter- be that in future, it would operate national Committee on Phylogenetic Nomen- across the kingdoms. In order that this clature on the philosophy of Phylogenetic provision be applicable, it is necessary taxonomy replacing the multirank Linnaean that lists of established generic names system with a rankless system recognizing of all organisms be publicly available, only species and ‘clades. It is intended to ideally in electronic format; most such, cover all biological entities, living as well as apparently, already exist, but are not fossil. Underlying principle of the PhyloCode yet generally accessible. A list of is that the primary purpose of a taxon name across-kingdom generic homonyms in is to provide a means of referring unambigu- current use is being prepared, and, as ously to a taxon, not to indicate its relation- a next step, a list of binomina in the ships. The PhyloCode grew out of recogni- corresponding genera is planned, so tion that the current Linnaean system of no- that future workers may avoid the crea- menclature—as embodied in the pre-exist- tion of new (illegal) homonymous ing botanical, zoological, and bacteriological binomina. Existing across-kingdom Codes—is not well suited to govern the nam- homonyms would not lose their status ing of clades and species, the entities that of acceptable names, but would be compose the tree of life and are the most sig- flagged for the benefit of biological in- nificant entities above the organism level. dexers and users of indexes. Existing Rank assignment is subjective and biologi- names are not affected by the proposed cally meaningless. The PhyloCode will pro- rules. The practice of ‘Secondary vide rules for the express purpose of naming Homonymy’ in ICZN is not followed in the parts of the tree of life—both species and BioCode. clades—by explicit reference to phylogeny. 9. Author citation: The Draft BioCode In doing so, the PhyloCode extends ‘tree- signals a departure from the botanical thinking’ to nomenclature. The PhyloCode tradition of laying great emphasis on is designed so that it can be used concur- the use of author citations, even in rently with the pre-existing Codes or (after Botanical Nomenclature 39 rules governing species names are added) well, by removing the linkage to a genus as the sole code governing the names of taxa, name. Under the PhyloCode, phylogenetic if the scientific community ultimately deposition can easily be indicated by associat- cides that it should. ing the species name with the names of one The starting date of the PhyloCode has not or more clades to which it belongs. Another yet been determined and is cited as 1 Janu- benefit of phylogenetic nomenclature is that ary 200n in the draft Code. Rules are pro- abandonment of ranks eliminates the most vided for naming clades and will eventually subjective aspect of taxonomy. The arbitrary be provided also for naming species. In this nature of ranking is not widely appreciated system, the categories ‘species’ and ‘clade’ by non-taxonomists. are not ranks but different kinds of biologi- The PhyloCode is designed so that it can cal entities. A species is a segment of a popu- be used concurrently with the rank-based lation lineage, while a clade is a monophyl- codes or (after rules governing species etic group of species. Fundamental differ- names are added) as the sole code govern- ences between the phylogenetic and tradi- ing the names of taxa, if the scientific com- tional systems in how supraspecific names munity ultimately decides that it should. are defined lead to operational differences The intent is not to replace existing names in the determination of synonymy and hom- but to provide an alternative system for gov- onymy. For example, under the PhyloCode, erning the application of both existing and synonyms are names whose phylogenetic newly proposed names. In developing the definitions specify the same clade, regard- PhyloCode, much thought has been given to less of prior associations with particular minimizing the disruption of the existing ranks; in contrast, under the pre-existing nomenclature. Thus, rules and recommen- Codes, synonyms are names of the same dations have been included to ensure that rank based on types within the group of con- most names will be applied in ways that ap- cern, regardless of prior associations with proximate their current and/or historical particular clades. The requirement that all use. However, names that apply to clades established names be registered will reduce will be redefined in terms of phylogenetic the frequency of accidental homonyms. relationships rather than taxonomic rank Phylogenetic nomenclature was pre- and therefore will not be subject to the sub- sumed to have several advantages over the sequent changes that occur under the rank- traditional system. In the case of clade based systems due to changes in rank. Be- names, it eliminates a major source of in- cause the taxon membership associated stability under the pre-existing Codes— with particular names will sometimes dif- name changes due solely to shifts in rank. fer between rank-based and phylogenetic It also facilitates the naming of new clades systems, suggestions are provided for indi- as they are discovered and not waiting till a cating which code governs a name when full classification is developed as in the case there is a possibility of confusion. of existing Codes. This is a particularly sig- The concept of PhyloCode was first intro- nificant when new advances in molecular duced by de Queiroz and Gauthier (1992). The biology and computer technology have led to theoretical development of PhyloCode re- a burst of new information about phylogeny, sulted from a series of papers from 1990 on- much of which is not being translated into wards and three symposia first in 1995, the taxonomy at present. The availability of the second in 1996 at the Rancho Santa Ana PhyloCode will permit researchers to name Botanic Garden in Claremont, California, newly discovered clades much more easily U.S.A., organized by J. Mark Porter and en- than they can under the pre-existing Codes. titled “The Linnean Hierarch: Past Present At present PhyloCode has rules only for and Future,” and the third at the XVI Inter- clades but when extended to species, it will national Botanical Congress in St. Louis, improve nomenclatural stability here as Missouri, U.S.A. (1999), entitled ‘Overview 40 Plant Systematics and Practical Implications of Phylogenetic Preamble Nomenclature’. Practical shape to the PhyloCode was 1. Biology requires a precise, coherent, given at the first workshop held in 1998 at international system for naming clades the Harvard University Herbaria, Cam- and species of organisms. Species bridge, Massachusetts, U.S.A. The initial names have long been governed by philosophy of unification of biological world the traditional codes (listed in Pream- was based on draft BioCode. The first public ble item 4), but those codes do not draft of the PhyloCode was posted on the provide a means to give stable, unam- internet in April 2000. A second workshop biguous names to clades. This code was held at Yale University in July 2002 satisfies that need by providing rules wherein it was decided to publish separate for naming clades and describing documents governing clade names and spe- the nomenclatural principles that form cies names. Modified versions of PhyloCode the basis for those rules. were posted in October 2003 (PhyloCode2), 2. This code is applicable to the names of December 2003 (Phylocode2a) and 2004 all clades of organisms, whether extant (PhyloCode2b), June 2006 (PhyloCode3), July or extinct. 2007 (PhyloCode 4a) and September 2007 3. This code may be used concurrently (PhyloCode4b). The efforts crystallized into with the rank-based codes. the establishment of the International So- 4. Although this code relies on the ciety for Phylogenetic Nomenclature rank-based codes (i.e., International (ISPN) at the First International Phyloge- Code of Botanical Nomenclature netic Nomenclature Meeting, which took (ICBN), International Code of Zoologi- place in July 2004 in Paris, attended by about cal Nomenclature (ICZN), International 70 systematic and evolutionary biologists Code of Nomenclature of Bacteria: Bac- from 11 nations. The Second International teriological Code (BC), International Phylogenetic Nomenclature Meeting was Code of Virus Classification and No- held btween June 28 - July 2, 2006 at Yale menclature (ICVCN)) to determine the University (New Haven, Connecticut, acceptability of preexisting names, U.S.A.), and the Third July 21–23, 2008 at it governs the application of those Dalhousie University, Halifax. names independently from the rank- The latest version of the PhyloCode based codes. (PhyloCode4b) was posted in September 2007 5. This code includes rules, recommen- and includes many substantive modifica- dations, notes and examples. Rules are tions. The version is available at http:// mandatory in that names contrary to www.ohiou.edu/phylocode/. The latest them have no official standing under changes concern the name of species (Ar- this code. Recommendations are not ticle 21-Regulation of species names is left mandatory in that names contrary to to rank-based Codes; The genus portion of them cannot be rejected on that basis. the binomen, called the “prenomen” is Systematists are encouraged to follow treated as simply the first part of the spe- them in the interest of promoting cies name and need not be established un- nomenclatural uniformity and clarity, der this code), Crown and total clade names but editors and reviewers should not (Art. 10-To have integrated system of clade require that they be followed. Notes names and providing more nomenclatural and examples are intended solely for freedom) and emendation of definitions(Art. clarification. 15- Unrestricted emendations can be pub- 6. This code will take effect on the lished without CPN (Committee on Phylo- publication of Phylonyms: a Companion genetic Nomenclature) whereas a re- to the PhyloCode, and it is not retroac- stricted emendation needs CPN approval). tive. Botanical Nomenclature 41 Principles Every individual organism (on Earth) belongs to at least one clade (i.e., the 1. Reference. The primary purpose of clade comprising all extant and extinct taxon names is to provide a means of organisms, assuming that they share referring to taxa, as opposed to indicat- a single origin). Each organism also ing their characters, relationships, or belongs to a number of nested clades membership. (though the ancestor of the clade com- 2. Clarity. Taxon names should be un- prising all life—again assuming a sin- ambiguous in their designation of par- gle origin—does not belong to any other ticular taxa. Nomenclatural clarity is clade). It is not necessary that all achieved through explicit definitions, clades be named. Clades are often ei- which describe the concept of the taxon ther nested or mutually exclusive; how- designated by the defined name. ever, phenomena such as speciation 3. Uniqueness. To promote clarity, each via hybridization, species fusion, and taxon should have only one accepted symbiogenesis can result in clades name, and each accepted name should that are partially overlapping. This code refer to only one taxon. does not prohibit, discourage, encour- 4. Stability. The names of taxa should not age, or require the use of taxonomic change over time. As a corollary, it ranks. In this code, the terms ‘species’ must be possible to name newly dis- and ‘clade’ refer to different kinds of bio- covered taxa without changing the logical entities, not ranks. The con- names of previously discovered taxa. cepts of synonymy, homonymy, and 5. Phylogenetic context. This code is precedence adopted in this code are, concerned with the naming of taxa and in contrast to the pre-existing codes, the application of taxon names in the independent of categorical rank. context of phylogenetic concepts of taxa. 2. Publication: The provisions of the Code 6. Taxonomic freedom. This code per- apply not only to the publication of mits freedom of taxonomic opinion with names, but also to the publication of regard to hypotheses about relation- any nomenclatural act (e.g. a proposal ships; it only concerns how names are to conserve a name). Publication, un- to be applied within the context of a der this code, is defined as distribution given phylogenetic hypothesis. of text (but not sound), with or without 7. There is no “case law” under this images, in a peer-reviewed book or code. Nomenclatural problems are re- periodical. To qualify as published, solved by the Committee on works must consist of at least 50, si- Phylogenetic Nomenclature (CPN) by multaneously obtainable, identical, direct application of the code; previ- durable, and unalterable copies, some ous decisions will be considered, but of which are distributed to major insti- the CPN is not obligated by precedents tutional libraries (in at least five coun- set in those decisions. tries on three continents) so that the work is generally accessible as a per- Salient Features manent public record to the scientific At present the Phylocode has rules only for community, be it through sale or ex- clades. Rules for species will be added later change or gift, and subject to the re- on. strictions and qualifications in the 1. Taxa: Taxa may be clades or species, present article. but only clade names are governed by 3. Names-status and establishment: Es- the PhyloCode. In this code, a clade is tablished names are those that are an ancestor (an organism, population, published in accordance with rules of or species) and all of its descendants. PhyloCode. In order to indicate which 42 Plant Systematics

names are established under this of preexisting names or introduction of Code and therefore have explicit new names. In order to be established, phylogenetic definitions (and whose the name of a clade must consist of a endings are not reflective of rank), it single word and begin with a capital may be desirable to distinguish these letter. In order to be established, con- names from the supraspecific names verted clade names must be clearly governed by pre-existing codes, particu- identified as such in the protologue by larly when both are used in the same the designation ‘converted clade publication. The letter ‘P’ (bracketed or name’ or ‘nomen cladi conversum’. in superscript) might be used to desig- New clade names must be identified nate names governed by the as such by the designation ‘new clade PhyloCode, and the letter ‘L’ to desig- name’ or ‘nomen cladi novum’. In or- nate names governed by the pre-exist- der to be established, a clade name ing Linnaean codes. Using this con- must be provided with a phylogenetic vention, the name ‘Ajugoideae[L]’ would definition, written in English or Latin, apply to a plant subfamily which may linking it explicitly with a particular or may not be a clade, whereas clade. The name applies to whatever ‘Teucrioideae[P]’ would apply to a clade clade fits the definition. Examples of which may or may not be a subfamily. phylogenetic definitions are node- Establishment of a name can only oc- based, stem-based, and apomorphy- cur on or after 1 January 200n, the based definitions. A node-based defini- starting date for this code. In order to tion may take the form ‘the clade stem- be established, a name of a taxon must ming from the most recent common be properly published, be adopted by the ancestor of A and B’ (and C, D, etc., as author(s), be registered, and the regis- needed) or ‘the least inclusive clade tration number must be cited in the containing A and B’ (and C, D, etc.), protologue. The accepted name of a where A-D are specifiers. A node-based taxon is the name that must be definition may be abbreviated as Clade adopted for it under this code. It must; (A+B). A stem-based definition may (1) be established; (2) have precedence take the form ‘the clade consisting of over alternative uses of the same name Y and all organisms that share a more (homonyms) and alternative names for recent common ancestor with Y than the same taxon (synonyms); and (3) not with W’ (or V or U, etc., as needed) or be rendered inapplicable by a qualify- ‘the most inclusive clade containing Y ing clause in the context of a particu- but not W’ (or V or U, etc.). A stem-based lar phylogenetic hypothesis. definition may be abbreviated as Clade 4. Registration: In order for a name to (Y<—W). An apomorphy-based defini- be established under the PhyloCode, tion may take the form ‘the clade stem- the name and other required informa- ming from the first species to possess tion must be submitted to the character M synapomorphic with that PhyloCode registration database. A in H’. An apomorphy-based definition name may be submitted to the data- may be abbreviated as Clade (M in H). base prior to acceptance for publication, When giving a new name for total but it is not registered (i.e. given a reg- clade, prefix Pan- must be used to the istration number) until the author no- name of crown clade (separated by hy- tifies the database that the paper or phen) and designated as panclade. book in which the name will appear 6. Specifiers and Qualifying Clauses: has been accepted for publication. Specifiers are species, specimens, or 5. Clade Names: The names of clades synapomorphies cited in a phylogenetic may be established through conversion definition of a name as reference points Botanical Nomenclature 43

Table 2.2 Equivalence table of nomenclatural terms used in the Draft PhyloCode, the Draft BioCode and the current biological codes (excluding Code for Viruses).

PhyloCode BioCode Bacteriological Code Botanical Code Zoological Code Publication and pre][][ oircedence of names published published effectively published effectively published published precedence precedence priority priority precedence earlier earlier senior earlier senior later later junior later junior

Nomenclatural status established established validly published validly published available converted —————— —————— —————— —————— acceptable acceptable legitimate legitimate potentially valid registration registration validation ——————- ——————

Taxonomic status accepted accepted correct correct valid

Synonymy and homonymy homodefinitional homotypic objective nomenclatural objective heterodefinitonal heterotypic subjective taxonomic subjective replacement name replacement name —— avowed substitute new replacement name

Conservation and suppression conserved conserved conserved conserved conserved suppressed suppressed/ rejected rejected suppressed rejected

that serve to specify the clade to which one that is explicitly excluded from it. the name applies. All specifiers used All specifiers in node-based and in node-based and stem-based defini- apomorphy-based definitions are inter- tions of clade names, and one of the nal, but stem-based definitions must specifiers used in apomorphy-based always have at least one specifier of definitions of clade names, are species each type. When a species is used as a or specimens. The other specifier used specifier, the author and publication in an apomorphy-based definition of a year of the species name must be cited. clade name is a synapomorphy. If sub- When a type specimen is used as a ordinate clades are cited in a specifier, the species name that it typi- phylogenetic definition of a more inclu- fies and the author and publication year sive clade, their specifiers must also of that species name must be cited. be explicitly cited within the definition 7. Precedence: Although the entity to of the more inclusive clade. An inter- which precedence applies in this code nal specifier is one that is explicitly is referred to as a name, it is really included in the clade whose name is the combination of a name and its defi- being defined; an external specifier is nition. In different cases, one or the 44 Plant Systematics

other of these components is more stances and requires approval of the important. Specifically, in the case of CPN. Once a name has been con- synonyms, precedence refers primarily served, the entry for the affected name to the name, whereas in the case of in the registration database is to be homonyms, precedence refers prima- annotated to indicate its conserved sta- rily to the definition. Precedence is tus relative to other names that are based on the date of establishment, simultaneously suppressed. An emen- with earlier-established names having dation is a formal change in a precedence over later ones, except that phylogenetic definition. A restricted later-established names may be con- emendation (changes in definitional served over earlier ones. In the case type, clade category, specifiers, and/or of homonymy involving names gov- qualifying clauses) requires approval by erned by two or more preexisting codes the CPN, while an unrestricted emen- (e.g. the application of the same name dation (changes in specifiers or quali- to a group of animals and a group of fying clauses) may be published with- plants), precedence is based on the date out CPN approval. of establishment under the PhyloCode. 10. Provisions for hybrids: Hybrid origin However, the International Committee of a clade may be indicated by placing on Phylogenetic Nomenclature has the the multiplication sign (×) in front of power to conserve a later-established the name. The names of clades of hy- homonym over an earlier-established brid origin otherwise follow the same homonym. This might be done if the rules as for other clades. An organism later homonym is much more widely that is a hybrid between named clades known than the earlier one. For the may be indicated by placing the multi- determination of precedence, the date plication sign between the names of of establishment is considered to be the the clades; the whole expression is date of publication, and not the date of then called a hybrid formula. registration. 11. Authorship of Names: A taxon name 8. Synonymy: Synonyms are names that is to be attributed to the author(s) of are spelled differently but refer to the the protologue, even though authorship same taxon. In this code, synonyms of the publication as a whole may be must be established and may be different. In some cases, it may be de- homodefinitional (based on the same sirable to cite the author(s) who estab- definition) or heterodefinitional (based lished a name. If the author of a con- on different definitions). Homodefini- verted name is cited, the author of the tional synonyms are synonyms regard- pre-existing name on which it is based less of the phylogenetic context in must also be cited, but in square brack- which the names are applied. However, ets[]. If the author of a replacement in the case of names with different name is cited, the author of the defi- definitions, the phylogenetic context nition of the replaced name must also determines whether the names are be cited, but in braces{}. If the author heterodefinitional synonyms or not of a homonym that has been conserved synonymous. When two or more syno- for the purpose of emending a defini- nyms have the same publication date, tion is cited, the author of the original the one that was registered first (and definition must also be cited, but by therefore has the lowest registration using ‘<’ and ‘>’ symbols (e.g., number) takes precedence. Hypotheticus Maki). Phylocode 9. Conservation, supression and emen- follows the use of in but not ex. dation: Conservation of names is pos- 12. Species names: This code does not gov- sible only under extraordinary circum- ern the establishment or precedence Botanical Nomenclature 45

of species names. To be considered stated goals can’t be met by proposals in available (ICZN) or validly published current draft, which also fails to uphold its (ICBN, BC), a species name must sat- stated Principles. The internal contradic- isfy the provisions of the appropriate tions include a cumbersome reinvention rank-based code. Because this code is of the very aspect of the current Linnaean independent of categorical ranks, the System that the advocates of PhyloCode first part of a species binomen is not most often decry. The incompleteness is interpreted as a genus name but in- due to the fact that the drafters cannot stead as simply a prenomen, first part agree on what form the species names of the species name, and the second should take. Keller et al. (2003) pointed part of a species binomen is associated out inherent instabilities, fundamental with the species as a kind of biological flaws in its very foundation by exposing entity, not as a rank. A prenomen has unsubstantiated philosophical assump- no necessary tie to any categorical tions preceding and subtending it. rank under this code. This code also A strong opposition to the PhyloCode was does not govern the establishment of offered by Nixon et al. (2003) who concluded names associated with ranks below that ‘The PhyloCode is fatally flawed, and that of species under the rank-based the Linnaean System can be easily fixed. codes (“infraspecific names”); however, They argued that the proponents of the such names may be used in conjunc- PhyloCode have offered nothing real to tion with phylogenetic nomenclature. back up claims of greater stability for their 13. Governance: The PhyloCode will be new system. A rank free system of nam- managed by The Society for Phylogenetic Nomenclature (SPN) ing would be confusing at the best and through its two committees: Interna- would cripple our ability to teach, learn and tional Committee on Phylogenetic No- use taxonomic names in the field or pub- menclature (ICPN) and the Registra- lications. They assured that the separate tion Committee. issue of stability in reference to rules of The desirability of PhyloCode has been priority and rank can be easily addressed reviewed in several papers published over within the current Codes, by implemen- last few years. Nixon and Carpenter (2000) tation of some simple changes. Thus there showed that Phylogenetic nomenclature is no need to ‘scrap’ the current Linnaean would be less stable than existing systems. Codes for a poorly reasoned, logically in- A critique of draft PhyloCode is presented consistent and fatally flawed new Code that by Carpenter (2003), pointing out that its will only bring chaos. Chapter 3 Hierarchical Classification

It would be total chaos to study and document the groups have been assigned categories information about more than a quarter mil- and named, the process of classification is lion species of vascular plants if there were complete, or the taxonomic structure of the no proper mechanism for grouping the same. whole largest most inclusive group has been Whatever may be the criterion for classifi- achieved. Because of the hierarchical ar- cation—artificial characters, overall mor- rangement of categories to which the groups phology, phylogeny or phenetic relationship— are assigned, the classification achieved the basic steps are the same. The organ- is known as hierarchical classification. isms are first recognized and assembled into This concept of categories, groups and taxo- groups on the basis of certain resemblance. nomic structure can be illustrated in the These groups are in turn assembled into form of a box-in-box figure (Figure 3.1) or a larger and more inclusive groups. The pro- dendrogram (resembling a pedigree chart, cess is repeated until finally all the organ- Figure 3.2). isms have been assembled into a single, largest most inclusive group. These groups TAXONOMIC GROUPS, CATEGO- Taxonomic groups or Taxa ( ) are arranged RIES AND RANKS in order of their successive inclusiveness, the least inclusive at the bottom, and the Taxonomic groups, categories and ranks are most inclusive at the top. inseparable once a hierarchical classifica- The groups thus formed and arranged are tion has been achieved. Rosa alba is thus next assigned to various categories, having nothing else but a species and Rosa is noth- a fixed sequence of arrangement (taxo- ing other than a genus. However, the dif- nomic hierarchy), the most inclusive group ferences do exist in concept and application. assigned to the highest category (generally The categories are like shelves of an a division) and the least inclusive to the low- almirah, having no significance when est category (usually a species). The names empty, and importance and meaning only are assigned to the taxonomic groups in such after something has been placed in them. a way that the name gives an indication of Thereafter, the shelves will be known by the category to which it is assigned. Rosales, their contents: books, toys, clothes, shoes Myrtales, and Malvales all belong to the or- etc. Categories in that sense are artificial der category and Rosaceae, Myrtaceae and and subjective and have no basis in reality. Malvaceae to the family category. Once all They correspond to nothing in nature. How- Hierarchical Classification 47

Figure 3.1 Processes of assembling taxonomic groups according to the hierarchical system, depicted by box-in-box method. In the above example, there are 18 species grouped into 10 genera, 6 families, 4 orders, 3 subclasses, 2 classes and 1 division. ever, they have a fixed position in the hier- with ending –aceae signifies a family which archy in relation to other categories. But among others also includes roses, belong- once a group has been assigned to a particu- ing to the genus Rosa) we establish the polar category the two are inseparable and the sition of taxonomic groups in the hierarchi- category gets a definite meaning because it cal system of classification. Some important now includes something actually occurring characteristics, which enable a better un- in nature. The word genus does not carry a derstanding of the hierarchical system of specific meaning but the genus Rosa says a classification, are enumerated below. lot. We are now talking about roses. There 1. Different categories of the hierarchy is practically no difference between category are higher or lower according to and rank, except in the grammatical sense. whether they are occupied by more Rosa thus belongs to the category genus, inclusive or less inclusive groups. and has generic rank. If categories are like Higher categories are occupied by more shelves, ranks are like partitions, each sepa- inclusive groups than those occupying rating the given category from the category lower categories. above. Taxonomic groups, on the other hand, 2. Plants are not classified into catego- are objective and non-arbitrary to the extent ries but into groups. It is important to that they represent discrete sets of organ- note that a plant may be a member of isms in nature. Groups are biological enti- several taxonomic groups, each of ties or a collection of such entities. By as- which is assigned to a taxonomic cat- signing them to a category and providing an egory, but is not itself a member of any appropriate ending to the name (Rosaceae taxonomic category. A plant collected 48 Plant Systematics

Figure 3.2 Dendrogram method for depicting the hierarchical system based on same hypothetical example as in Figure 3.1.

from the field may be identified as Poa guish the taxa. Dicots are thus annua (assigned to species category). conveniently separated from monocots It is a member of Poa (assigned to by possession of two cotyledons, genus category), Poaceae (assigned to pentamerous flowers, reticulate vena- family category) and so on, but the plant tion and vascular bundles in a ring as can’t be said to be belonging to the spe- against one cotyledon, trimerous flow- cies category. ers, parallel venation and scattered 3. A taxon may belong to other taxa, but vascular bundles in monocots. But it can be a member of only one category. when taken individually, Smilax is a Urtica dioica, thus, is a member of monocot with reticulate venation and Urtica, Urticaceae, Urticales, and so on, Plantago is a dicot with parallel vena- but it belongs only to species category. tion. Similarly Nymphaea, is a dicot 4. Categories are not made up of lower with scattered bundles, and the flow- categories. The category family is not ers are trimerous in Phyllanthus, made up of the genus category, since which is a dicot. there is only one genus category. 5. The characters shared by all members UTILIZATION OF CATEGORIES of a taxon placed in a lower category provide the characters for the taxon Taxonomic categories possess only relative immediately above. Thus, the charac- value and an empty category has no founda- ters shared by all the species of Brassica tion in reality and obviously can’t be defined. make up the characters of the genus An important step in the process of classifi- Brassica. The characters shared by cation is to assign taxa to an appropriate Brassica and several other genera form category. It thus becomes imperative to distinguishing characters of the fam- decide what should be the properties of taxa ily Brassicaceae. It is important to note to be included in a particular category? Only that the higher a group is placed in the with a proper utilization of the concept of hierarchy, the fewer will be the char- categories can their application in hierar- acters shared by the subordinate units. chical systems be meaningful. The problem Many higher taxa, as such (e.g. Dicots: is far from resolved. An attempt will be made Magnoliopsida) can only be separated here to discuss the relevant aspects of the by a combination of characters; no sin- inclusion of type of entities or groups of gle diagnostic character may distin- entities under different categories. Hierarchical Classification 49 Species concept ing to the taxa at other ranks. Thus we can sort herbarium sheets into Darwin aptly said: ‘Every biologist knows different species without difficulty, approximately what is meant when we talk without knowing or bothering to know about species, yet no other taxon has been how many genera are covered by these subjected to such violent controversies as sheets. We cannot recognize genera or to its definition’. A century and a half has describe them without reference to passed, so much advancement in the taxo- the included species. Species is thus nomic knowledge has been achieved, yet the the only category dealing directly with statement of Darwin is as true today as it the plants. was then. Numerous definitions of species 3. Whether defined in terms of morpho- have been proposed, making it futile to logical discontinuity or restriction of recount all of them. Some significant as- gene exchange, species is unique in pects of the problem will be discussed here. being non-arbitrary to both inclusion Probably the best explanation of diversity of and exclusion. A group is non-arbitrary opinions can be explained as under. to inclusion if all its members are con- ‘The species is a concept. Concepts are tinuous by an appropriate criterion. It constructed by the human mind, and as hu- would be arbitrary to inclusion if it mans think differently we have so many shows internal discontinuity. A group definitions of a species.’ Obviously a con- is non-arbitrary to exclusion if it is cept can’t have a single acceptable definition. discontinuous from any other group by The word species has different meaning the same criterion. A group not show- for different botanists. According to ICBN, ing discontinuity with other groups is which has attempted to clarify the meaning arbitrary. All higher taxa although of the word species, ‘species are convenient non-arbitrary to exclusion are arbitrary classificatory units defined by trained bi- to inclusion, i.e. they exhibit internal ologists using all information available’. discontinuity as now species with The word species has a dual connotation in external discontinuity form part of biological science. First, the species is a these taxa. naturally-occurring group of individual organisms that comprises a basic unit of evolution. Second, the species is a category Ideal Species within a taxonomic hierarchy governed by A perfect situation! Species that can be eas- various rules of nomenclature. ily distinguished and have no problem of identity. Such species, however, are very Species as Basic Unit of few; common examples include Apiaceae, Asteraceae and the genera Allium and Se- Taxonomy dum. The following characteristics are ex- The following information serves to substan- pected in an ideal species: tiate the view that species constitutes the 1. The species poses no taxonomic basic unit of classification or, for that mat- problems and is easily recognized as a ter, taxonomy (systematics): distinct entity on the basis of morpho- 1. Species is considered the basic unit of logical characters. taxonomy, since in the greater major- 2. It exhibits no discontinuity of variation ity of cases, we do not have infraspecific within, i.e. it contains no subspecies, names. This is especially common in varieties or formas. families such as Apiaceae (Umbelli- 3. It is genetically isolated from other ferae) and Liliaceae. species. 2. Species, unlike other taxa, can be de- 4. It is sexually reproducing. scribed and recognized without relat- 5. It is at least partially outbreeding. 50 Plant Systematics

Unfortunately, ideal species are rare pose of nomenclature, all organisms must among the plant kingdom and the greater be referable to species. Species, by this majority of species pose situations contrary concept, can be defined by the language of to one or more of the above criteria. formal relations and not by property of their organisms. The concept considers Idea of Transmutation species to be a category in taxonomic hier- This is an ancient Greek idea which per- archy and may correspond to a specific name sisted as late as the seventeenth century. in the binomial system of nomenclature. Greeks believed in the transmutation of The concept is logically sound but scientifi- wheat into barley, Crocus into Gladiolus, bar- cally irrelevant since the ultimate aim is ley into oats, and many other plants, under to place a particular group of individuals in certain conditions. The supporters of this a species. notion often included professional botanists like Bobart (who swore that Crocus and Typological Species Concept Gladiolus, as likewise the Leucojum, and This concept was first proposed by John Ray Hyacinths by a long standing without re- (1686) and further elaborated by C. Linnaeus planting have in his garden changed from in Critica botanica (1737). Linnaeus refuted one kind to the other) as reported by Robert the idea of transmutation of species. Sharrock (1660) in his book History of the Linnaeus believed that although there is propagation and improvement of vegetables by some variation within a species, the spe- the concurrence of art and nature. Sharrock cies by themselves are fixed (fixity of spe- fortunately, however, on investigation did cies) as created by the Almighty Creator. The not find any proof of this in the field. So called species, according to the concept, is a group transmutation can be explained as nothing of plants which breed true within their other than the result of unintentional mix- limits of variation. Towards the later part ing of seeds or other propagules of another of his life, however, Linnaeus moved away plant with a particular crop before plantation. from idea of fixity of species and was con- The present author had a glimpse of this vinced that species can arise by hybridiza- fallacy while studying the weeds in saffron tion. In his later publication (Fundamenta (Crocus sativus) fields of Kashmir valley. With fructificationis, 1762), Linnaeus imagined a few vegetative specimens of Iris reticulata that at the time of creation, there arose as (whose corms and leaves are closely similar many genera as were the individuals. These, to saffron; the flowers are quite distinct) in in the course of time, were fertilized by oth- his hand, the author tried in vain to con- ers and thus arose species until so many vince the saffron grower (who always thinks were produced as now exist. These species that he knows more about his crop) that the were sometimes fertilized by other species plant he was carrying was not saffron. The of the same genus, giving rise to varieties. author managed to escape the assault but The typological concept, however, should not was more convinced that this Iris (which does be confused with typification, which is a dis- not grow elsewhere in Kashmir valley) would tinct methodology of nomenclature, provid- have come unintentionally from Persia ing names to taxonomic groups. where it grows commonly, and from where the Kashmir saffron is supposed to have been Taxonomic Species Concept introduced. The concept of transmutation is The doctrine of fixity was challenged by now firmly rejected. Lamarck (1809) and finally Darwin (1859), who recognized continuous and discontinu- Nominalistic Species Concept ous variation and developed his taxonomic This nominalistic species concept is also species concept based on morphology, more only of academic interest now. For the pur- appropriately known as the Morphological Hierarchical Classification 51 species concept. According to this concept, 1. It is useful for general taxonomic pur- the species is regarded as an assemblage poses especially the field and of individuals with morphological fea- herbarium identification of plants. tures in common, and separable from 2. The concept is very widely applied and other such assemblages by correlated most species have been recognized morphological discontinuity in a number using this concept. of features. The supporters of this view be- 3. The morphological and geographical lieve in the concept of continuous and dis- features used in the application of this continuous variations. The individuals of a concept can be easily observed in species show continuous variation, share populations. certain characters and show a distinct dis- 4. Even experimental taxonomists who do continuity with individuals belonging to an- not recognize this concept, apply this other species, with respect to all or some of concept in cryptic form. these characters. 5. The greater majority of species recog- Du Rietz (1930) modified the taxonomic nized through this concept correspond species concept by also incorporating the role to those established after experimen- of geographic distribution of populations and tal confirmation. developed the morpho-geographical species The concept, however, also has some concept. The species was defined as the inherent drawbacks: smallest population that is permanently 1. It is highly subjective and different separated from other populations by dis- sets of characters are used in differ- tinct discontinuity in a series of biotypes. ent groups of plants. The populations recognized as distinct spe- 2. It requires much experience to prac- cies and occurring in separate geographical tice this concept because only after areas are generally quite stable and remain considerable observation and so even when grown together. There are, experience can a taxonomist decide however, examples of a few species pairs the characters which are reliable in a which are morphologically quite distinct, particular taxonomic group. well adapted to respective climates, but 3. The concept does not take into account when grown together, they readily interbreed the genetic relationships between and form intermediate fertile hybrids, bridg- plants. ing the discontinuity gap between the species. Examples are Platanus orientalis of the Biological Species Concept Mediterranean region and P. occidentalis of The biological species concept was first de- E. United States. Another well-known pair veloped by Mayr (1942) who defined species is Catalpa ovata of Japan and China and C. as groups of actually or potentially inter- bignonioides of America. Such pairs of spe- breeding natural populations, which are cies are known as vicarious species or reproductively isolated from other such vicariants and the phenomenon as groups. The words ‘actually or potentially’, vicariance or vicariism. being meaningless, were subsequently Morphological and morpho-geographical dropped by Mayr (1969). Based on the same types of taxonomic species have been widely criteria, Grant (1957) defined species as a accepted by taxonomists who even take into community of cross-fertilizing individuals account the data from genetics, cytology, linked together by bonds of mating and ecology, etc., but firmly believe that species reproductively isolated from other species recognized must be delimited by morpho- by barriers to mating. The recognition of logical characters. biological species thus involve: (a) inter- The taxonomic species concept has sev- breeding among populations of the same eral advantages: species; and (b) reproductive isolation 52 Plant Systematics between populations of different species. species according to the biological Valentine and Love (1958) pointed out that species concept) but morphologically species could be defined in terms of gene similar (single species according to the exchange. If two populations are capable taxonomic species concept). Such of exchanging genes freely either under species are known as sibling species. natural or artificial conditions, the two 4. Fertility-sterility is only of theoretical are said to be conspecific (belonging to the value in allopatric populations. same species). On the other hand, if the 5. It is difficult and time consuming to two populations are not capable of ex- carry out fertility-sterility tests. changing genes freely and are reproduc- 6. Occurrence of reproductive barriers tively isolated, they should be considered has no meaning in apomicts. specifically distinct. The concept has sev- 7. Necessary genetic and experimental eral advantages: data are available for only very few 1. It is objective and the same criterion species. is used for all the groups of plants. Stebbins (1950), it would appear, combined 2. It has a scientific basis as the popu- two concepts when he stated that species lations showing reproductive isolation must consist of systems of populations do not intermix and the morphological that are separated from each other by differences are maintained even if the complete or at least sharp discontinuities species grow in the same area. in the variation pattern, and that these 3. The concept is based on the analysis discontinuities must have a genetic basis. of features and does not need experi- These populations with isolating mecha- ence to put it into practice. nisms (different species) may occur either The concept, first developed for animals, in the same region (sympatric species) or holds true because animals as a rule are in different regions (allopatric species). sexually differentiated and polyploidy is very Fortunately, although the taxonomic and rare. When applying this concept to plants, biological concepts are based upon different however, a number of problems are encoun- principles, the species recognized by one tered: concept, in the majority of cases, stand the 1. A good majority of plants show only veg- test of the other. Morphology provides the evi- etative reproduction, and hence the dence for putting the genetic definition into concept of reproductive isolation as practice. such cannot be applied. 2. Reproductive isolation is commonly verified under experimental condi- Evolutionary Species Concept tions, usually under cultivation. It may This concept was developed by Meglitsch have no relevance for wild populations. (1954), Simpson (1961) and Wiley (1978). Al- 3. Genetic changes causing morphologi- though maintaining that interbreeding cal differentiation and those causing among sexually reproducing individuals is reproductive barriers do not always go an important component in species cohe- hand in hand. Salvia mellifera and S. sion, this concept is compatible with a broad apiana are morphologically distinct (two range of reproductive modes. Wiley (1978) separate species according to the taxo- defines: an evolutionary species is a sin- nomic species concept) but not gle lineage of ancestor-descendant popu- reproductively isolated (single species lations which maintains its identity from according to the biological species con- other such lineages, and which has its cept). Such species are known as own evolutionary tendencies and histori- compilospecies. Contrary to this, Gilia cal fate. This concept avoids many of the inconspicua and G. transmontana are problems of the biological concept. Lineage reproductively isolated (two separate is a single series of demes (populations) that Hierarchical Classification 53 share a common history of descent, not lished by Linnaeus. Microspecies are dis- shared by other demes. The identity of spe- tinct from cryptic species, which are mor- cies is based on recognition systems that phologically similar but cytologically or physi- operate at various levels. In sexually repro- ologically different. Stace (1989) uses the ducing species, such systems include rec- term semi-cryptic species for the latter. ognition because of phenotypic, behavioural and biochemical differences. In asexual spe- Biosystematic Species cies phenotypic, genotypic differences main- Concept tain the identity of species. Identity in both sexual and asexual species may also be due The term biosystematic species has been to distinct ecological roles. Viewed from the used by Grant (1981) to refer to the catego- standpoint of evolutionary species concept, ries based on fertility relationships as de- however, the important question is not termined by artificial hybridization experi- whether two species hybridize, but whether ments. Ecotype refers to all members of a two species do or do not lose their distinct species that ‘represent a product of genetic ecological and evolutionary roles. If, despite response of a species towards a particular some hybridization, they do not merge, then habitat’. The ecotypes, which are able to they remain separate species in the evolu- exchange genes freely without loss of fertil- tionary perspective. ity or vigour in the offsprings, form an Several other terms have been proposed ecospecies. An ecospecies corresponds to a to distinguish species based on specific cri- taxonomic species. A group of ecospecies teria. Grant (1981) recognizes microspecies capable of limited genetic exchange consti- as ‘populations of predominantly uniparen- tutes a coenospecies. A coenospecies is con- tal plant groups which are themselves uni- sidered equivalent to a subgenus. A group of form and are slightly differentiated morpho- related coenospecies between which hybrid- logically from one another’; they are often ization is possible—directly or through in- restricted to a limited geographical area. termediates— constitutes a comparium, Microspecies develop in inbreeding species, which is considered equal to a genus. Com- but are usually not stable over longer peri- plete sterility barriers exist between genera. ods. They may undergo cross-fertilization sooner or later forming recombinant types Infraspecific ranks which themselves become new The species is regarded as the basic unit of microspecies. Several microspecies have classification and many works, including the been found in Erophila verna mostly repre- Flora of USSR, do not recognize infraspecific senting single biotypes or groups of similar taxa. Many European, American and Asian biotypes some of which are marked by only Floras, however, do recognize taxa below one or two characters. These may be dis- the rank of species. The international Code tinguished as clonal microspecies (repro- of Botanical Nomenclature recognizes five ducing by vegetative propagation, e.g. infraspecific ranks: subspecies, variety Phragmites), agamospermous microspecies (Latin, varietas), subvariety, form (Latin, (reproducing by agamospermy, e.g. Rubus), forma) and subform. Of these, three (sub- heterogamic microspecies (reproducing by species, variety and form) have been widely genetic systems, e.g. Oenothera biennis or used in the literature. Rosa canina), and autogamous microspecies Du Rietz (1930) defined subspecies as a (predominantly autogamous and chromo- population of several biotypes forming somally homozygous, e.g. Erophila). The term more or less a distinct regional facies of a microspecies was first suggested by Jordan species. Facies stands for race. Morphologi- (1873) and as such they are often termed as cally distinct but interfertile populations of Jardanons to distinguish them from a species growing in different geographical Linnaeons, the normal species, first estab- regions are maintained as distinct subspe- 54 Plant Systematics cies due to the geographical isolation of the by cytogenetic and geographic infor- species. mation in relation to morphology. Du Rietz defined variety as a population 2. The genera should not be distinguished of several biotypes, forming more or less a on a single character but a sum total local facies of a species. The term variety of several characters. In a number of is commonly used for morphologically dis- cases, genera are easily recognized on tinct populations occupying a restricted geo- the basis of adaptive characters (adap- graphical area. Emphasis is on a more lo- tations in response to ecological calized range of the variety, compared with niches), as in the case of establishing the large-scale regional basis of a subspe- aquatic species of Ranunculus under a cies. Several varieties are often recognized separate genus Batrachium. within a subspecies. The term variety is also 3. There is no size requirement for a used for variations whose precise nature is genus. It may include a single species not understood, a treatment often necessary (monotypic genus) as Leitneria, in the pioneer phase of taxonomy. Ginkgo, Milula or many (Polytypic Forma is often regarded as sporadic genus): Euphorbia (2100 species), variant distinguished by a single or a few Astragalus (2000) Carex (1800), Senecio linked characters. Little taxonomic signifi- (1500) and Acacia (1300) being the cance is, however, attached to minor and examples of large genera. The genus random variations upon which the forms are Senecio was earlier included more than normally based. 2500 species, but it has now been split into several genera. The only impor- Genus tant criterion is that there should be a decided gap between the species of two The concept of genus is as old as folk genera. If the two genera are not science itself as represented by names readily separable, then they can be rose, oak, daffodils, pine and so on. A genus merged into one and distinguished as represents a group of closely-related spe- subgenera or sections. Such an cies. According to Rollins (1953), the func- exercise should take into consideration of the genus concept is to bring together tion the concept in other genera of the species in a phylogenetic manner by family, size of the genus (it is more placing the closest related species within convenient to have subgenera and the general classification. When attempt- sections in a larger genus) and ing to place a species within a genus, the traditional usage. primary question would be, is it related to 4. When generic limits are being drawn, the undoubted species of that genus? Mayr it is absolutely necessary that the (1957) defined genus as a taxonomic cat- group of species should be studied egory which contains either one species throughout the range distribution of or a monophyletic group of species, and the group, because characters stable is separable from other genera by a de- in one region may break down cided discontinuity gap. It was earlier elsewhere. believed that a genus should always be readily definable on the basis of a few tech- Family nical floral characters. A more rational A family, similarly, represents a group of recognition should take the following closely-related genera. Like genus, it is also criteria into consideration: a very ancient concept because the natural 1. The group, as far as possible, should groups now known as families, such as be a natural one. The monophyletic legumes, crucifers, umbels, grasses have nature of the group should be deduced been recognized by laymen and taxonomists Hierarchical Classification 55 alike for centuries. Ideally, families should fication. Although there is no marked dis- be monophyletic groups. Like the genus, the continuity between Lamiaceae (Labiatae) family may represent a single genus and Verbenaceae, the two are maintained (Podophyllaceae, Hypecoaceae, etc.) or as distinct families. The same tradition several genera (Asteraceae: nearly 1100). prevents taxonomists from splitting Most taxonomists favour broadly-conceived Rosaceae, which exhibits considerable family concepts that lend stability to classi- internal differences. 56 Plant Systematics

Chapter 4 Descriptive Terminology

Any botanical analysis of a plant necessi- HABIT AND LIFE SPAN tates the availability of information about its Annual: A plant living and completing its life characteristics. The descriptive information cycle in one growing season. Ephemerals about the morphology of a plant are annuals surviving for one or two weeks (phytography) is suitably expressed in semi- (Boerhavia repens). technical language through a set of terms, which provide an unambiguous representa- Biennial: A plant living for two seasons, grow- tion of the plant. The descriptive terminol- ing vegetatively during the first and flower- ogy thus precedes any taxonomic or phylo- ing during the second. genetic analysis of a taxon. Whereas the veg- Perennial: A plant living for more than two etative morphology of vascular plants years and flowering several times during the (Tracheophyes) uniformly includes informa- life span (except in monocarpic plants which tion about the organs such as root, stem as live for several years but perish after flow- leaves, the reproductive morphology may dif- ering, as in several species of Agave and fer in different groups. The Pteridophytes are bamboos). In herbaceous perennials, the represented by strobili, cones, sporophylls, aerial shoot dies back each winter, and the microsporophylls, megasporophylls and annual shoots are produced from subaerial spores, Gymnosperms by cones, megasporo- stock every year, those with a rhizome, tu- phylls, microsporophylls and seeds. The flow- ber, corm or bulb better known as geophytes. ering plants have distinct inflorescences, A woody perennial, on the other hand has flowers, seeds and fruits. All these organs woody aerial shoots which live for a number show considerable variability, amply de- of years. A woody perennial may be a tree picted through a large vocabulary of descrip- (with a distinct trunk or bole from the top of tive terms. which the branches arise— deliquescent Morphological terminology has been in tree as in banyan, a totally unbranched cau- use for description of species for several cen- dex with a crown of leaves at top as in palms, turies and continues to be the principal or the main stem continues to grow gradu- source of taxonomic evidence. The descrip- ally narrowing and producing branches in tive terminology is very exhaustive, and as acropetal order— excurrent tree as in such only the most commonly used terms Polyalthia) or a shrub (with several distinct are illustrated here. branches arising from the ground level). A Descriptive Terminology 57 suffrutescent plant is intermediate be- Assimilatory: Green chlorophyll-containing tween woody and herbaceous plants, with the roots capable of carbon assimilation as in basal woody portion persisting year after year Tinospora cordifolia, and many species of whereas the upper portion dies back every Podostemaceae. year. A weak climbing plant may be woody Fibrous: Threadlike tough roots common in (liana) or herbaceous (vine). monocots, especially grasses, usually adven- It should be noted that the terms herb, titious in nature. shrub, suffrutescent plant and tree repre- Buttressed: enlarged, horizontally spread sent different forms of habit. Annual, bien- and vertically thickened roots at the base of nial and perennial denote the life span or certain trees of marshy areas. duration of the plant. Fleshy: Thick and soft with a lot of storage HABITAT tissue. Storage roots may be the modification of taproot: Plants grow in a variety of habitats. Terres- (i) Fusifom: Swollen in the middle and trial plants grow on land, aquatic plants in tapering on sides, as in radish water and those on other plants as epi- (Raphanus sativus). phytes. Terrestrial plant may be a meso- (ii) Conical: Broadest on top and gradu- phyte (growing in normal soil), xerophyte ally narrowed below, as in carrot (growing on dry habitats: psammophyte on (Daucus carota). sand, lithophyte on rock). An aquatic plant (iii) Napiform: Highly swollen and almost may be free-floating (occurring on water sur- globose and abruptly narrowed below, face), submerged or emersed (wholly under as in turnip (Brassica rapa). water), emergent (Anchored at bottom but Modifications of the storage adventitious with shoots exposed above water), floating- roots include: leaved (anchored at bottom but with float- (i) Tuberous: Clusters of tubers growing ing leaves), or a helophyte (emergent marsh out from stem nodes, as in sweet po- plant in very shallow waters). A plant grow- tato (Ipomoea batatas) and tapioca ing in saline habitats (terrestrial or aquatic) (Manihot esculenta). is known as halophyte, whereas one in (ii) Fasciculated: Swollen roots occurring acidic soils as oxylophyte or oxyphyte. in clusters, as in Asparagus and some Saprophyte grow on decaying organic mat- species of Dahlia. ter, parasite lives and depends on another (iii) Nodulose: Only the apices of adventi- organism. tious roots becoming swollen like beads, as in Curcuma amada and ROOTS Costus speciosus. Roots unlike stems lack nodes and intern- (iv) Moniliform: Portions of a root are al- odes, have irregular branching and produce ternately swollen and constricted giv- endogenous lateral roots. Upon seed germi- ing beaded appearance, as in Dioscorea nation, usually the radicle elongates into a alata. primary root, forming a taproot, but several Haustorial (sucking): Small roots penetrat- other variations may be encountered: ing the host xylem tissue for absorbing wa- Adventitious: Developing from any part ter and nutrients as in partial parasites other than radicle or another root. (Viscum) or also the photosynthetic materi- Aerial: Grows in air. In epiphytes, the aerial als by penetrating the phloem tissue as well, roots termed epiphytic roots are found as in total parasites (Cuscuta). hanging from the orchids and are covered Mycorrhizal: Roots infested with fungal with a spongy velamen tissue. Orchids also mycelium which helps in root absorption. carry some clinging roots which penetrate The fungal mycelium may penetrate corti- crevices and help in anchorage. cal cells (endotrophic mycorrhizae found in 58 Plant Systematics

Figure 4.1 Roots. A: Fusiform fleshy root of Raphanus sativus; B: Conical fleshy root of Daucus carota; C: Napiform fleshy root of Brassica rapa; D: Root-tuber of Ipomoea batatas; E: Fasciculated tuberous roots of Dahlia; F: Nodulose roots of Curcuma amada; G: Moniliform roots; H: Pneumatophores of Avicennia; I: Stilt roots of Zea mays; J: Stilt roots of Pandanus; K: Prop roots of Ficus benghalensis; L: Aerial roots of Dendrobium; M: Haustorial roots of Viscum, sending haustoria only into the host xylem; N: Mycorrhizal roots of Pinus. orchids) or may largely form a mantle over large hanging prop roots of Ficus species are the root with a few hyphae penetrating be- often used in bungee jumping sport. tween the outer cells (ectotrophic mycor- Stilt: Adventitious roots arising from the rhizae found in conifers). In specialized VAM lower nodes of the plant and penetrating the (vesicular arbuscular mycorrhizae) found soil in order to give increased anchorage as in grasses, the fungal hyphae penetrate cor- in maize (Zea mays), screw-pines (Pandanus) tical cells, forming a hyphal mass called and Rhizophora. arbusculum. Respiratory: Negatively geotropic roots of some mangroves (e.g. Avicennia) which grow STEMS vertically up and carry specialized lenticels Stems represent the main axes of plants, (pneumathodes) with pores for gaseous ex- being distinguished into nodes and intern- change. Such roots are also known as pneu- odes, and bearing leaves and axillary buds matophores. at the nodes. The buds grow out into lateral Prop: Elongated aerial roots arising from shoots, inflorescences or flowers. A plant horizontal branches of a tree, striking the may lack stem (acaulescent) or have a dis- ground and providing increased anchorage tinct stem (caulescent). The latter may be and often replacing the main trunk as in aerial (erect or weak) or even underground. several species of Ficus (e.g. the great Acaulescent: Apparently a stemless plant banyan tree F. benghalensis in the Indian having very inconspicuous reduced stem. Botanical Garden at Sibpur, Kolkata). The The reduced stem may often elongate at the Descriptive Terminology 59 time of flowering into a leafless flowering (iii) Axillary (lateral) bud: Bud located in axis, known as scape as found in onion. the axil of a leaf. Arborescent: Becoming treelike and woody, (iv) Bulbil: Modified and commonly en- usually with a single main trunk. larged bud meant for propagation. In Ascending: Stem growing upward at about Agave and top onion (Allium x proliferum) 45-60o angle from the horizontal. flower buds get modified into bulbils. (v) Dormant (winter) bud: Inactive well Bark: Outside covering of stem, mainly the protected bud usually to survive win- trunk. Bark may be smooth, exfoliating ter in cold climates. (splitting in large sheets), fissured (split or (vi) Flower bud: Bud developing into flower. cracked), or ringed (with circular fissures). (vii) Mixed bud: A bud bearing both em- Bud: Short embryonic stem covered with bud bryonic leaves and flowers. scales and developing leaves and often found (viii) Naked bud: Not covered by bud scales. in leaf axils. Buds are frequently helpful in (ix) Pseudoterminal bud: Lateral bud near identification and may present considerable the apex appearing terminal due to diversity: death or non-development of terminal (i) Accessary bud: An extra bud on either bud. side (collateral bud) or above (super- (x) Scaly (covered) bud: Covered by bud posed bud or serial bud) the axillary scales. bud. (xi) Terminal bud: Located at stem tip. (ii) Adventitious bud: Bud developing (xii) Vegetative bud: Bearing embryonic from any place other than the node. leaves.

Figure 4.2 Buds. A: Axillary bud with 2 collateral buds in Acer; B: Axillary bud and a superposed bud in Juglans regia; C: Scaly bud of Ficus covered with bud-scale; D: Winter buds in Salix; E: Terminal bud with two collateral buds; G: Intrapetiolar bud hidden by petiole base; H: Same with petiole removed; I: Bulbil developing from one flower of Agave; J: Pseudoterminal bud, taking terminal position due to death or non-development of terminal bud; K: Vegetative bud of Brassica oleracea var. capitata (cabbage). 60 Plant Systematics

Figure 4.3 Stem, subaerial and underground modifications. A: Tunicated bulb of Allium cepa; B: Same in vertical section, showing concentric layers of leaf sheaths; C: Scaly bulb of Lilium with separate fleshy leaf sheaths; D: Stem tuber of Solanum tuberosum with eye buds; E: Rhizome of Zingiber officinale with fleshy branched horizontal stem; F: Corm of Crocus sativus covered with scale leaves; G: Same in longitudinal section showing the solid inside as opposed to the bulb; H: Runner of Oxalis, rooting at nodes; I: Stolon of Fragaria vesca, arching down to strike roots at nodes; J: Sucker in Chrysanthemum, underground and rising up to produce shoot; K: Offset in Eichhornia crassipes, like runner but shorter and thicker.

Caulescent: With a distinct stem. Subaerial: generally perennial partially hid- Caudiciform: Low swollen storage stem at den stems: ground level, from which annual shoots (i) Runner: Elongated internodes trailing arise as in Calibanus and some species of along the ground and generally produc- Dioscorea. ing a daughter plant at its end as in Culm: Flowering and fruiting stem of grasses Cynodon and Oxalis. and sedges. (ii) Sobol: Like runner but partially un- Erect: Growing erect as an herb, shrub derground as in Saccharum or a tree. spontaneum, and unlike rhizome, not Lignotuber: Swollen woody stem at or below a storage organ. ground level, from which persistent woody (iii) Stolon: Like runner but initially grow- aerial branches arise, as in Manzanita. ing up and then arching down and Pachycaul: Woody trunk-like stem swollen striking roots in soil as in strawberry. at base functioning for storage as in bottle (iv) Sucker: Like runner but underground tree Brachychiton. and growing up and striking roots to Phylloclade (cladophyll): Stem flattened and form new plant as in Chrysanthemum green like leaves bearing scale leaves as in and Mentha arvensis. Opuntia. A phylloclade of one internode (v) Offset: Shorter than runner and found length found in Asparagus in known as in aquatic plants like Eichhornia Cladode. crassipes. Pseudobulb: Short erect aerial storage or Subterranean (underground): Growing propagating stem of certain epiphytic below the soil surface and often specially orchids. modified: Descriptive Terminology 61

(i) Bulb: A reduced stem surrounded by Spine is like a thorn but generally weaker thick fleshy scale leaves. The leaves and developing from the leaf or stipule. may be arranged in a concentric man- Thorns may bear leaves (Duranta), flowers ner surrounded by a thin membranous (Prunus), or may be branched (Carissa). scale leaf (tunicated bulb of onion— Weak: Plant not strong enough to grow erect: Allium cepa) or leaves only overlapping (i) Creeper: Growing closer to ground and along margins (scaly or imbricate bulb often rooting at the nodes, as in Oxa- of garlic—Allium sativum). lis. (ii) Corm: A vertical fleshy underground (ii) Trailer: Trailing along the surface and stem covered with some scale leaves often quite long. They are usually pros- and with a terminal bud, as in Gladi- trate or procumbent, lying flat on olus. ground as in Basella, but sometimes (iii) Rhizome: A horizontal dorsiventral decumbent when the tips start grow- fleshy underground stem with nodes ing erect or ascending, as in Portulaca. and internodes and covered with scale (iii) Climber: Weak plant which uses a sup- leaves, as in Ginger. port to grow up and display leaves to- (iv) Stem tuber: Underground portions of wards sunlight. This may be achieved stem modifies into tubers as in potato. in a number of ways: Thorn: Branch or axillary bud modified into (a) Twiner (stem climber): Stem coil- a hard sharp structure, being deep-seated ing round the support due to spe- and having vascular connections as opposed cial type of growth habit, as in Ipo- to prickles which are mere superficial out- moea and Convolvulus. growths without vascular connections. (b) Root climber: Climbing with the help of adventitious roots which cling to the support, as in species of Piper. (c) Tendril climber: Climbing with the help of tendrils which may be modified stem (Passiflora, Vitis), modified inflorescence axis (Antigonon), modified leaf (Lathyrus aphaca), modified leaflets (Pisum sativum), modified petiole (Clematis), modified leaf tip (Gloriosa), modified stipules (Smilax) or even modified root (Parthenocissus). (d) Scrambler: Spreading by leaning or resting on support, as in Rose. (e) Thorn climber: Climbing or reclin- ing on the support with the help of thorns, as in Bougainvillea. (f) Hook climber: Climbing with the Figure 4.4 Stem, aerial modifications. A: Phyl- help of hooked structures (Galium). loclade of Opuntia; B: Cladodes in Asparagus; C: Portion enlarged to LEAVES show whorl of cladodes in axil of scale-leaf; D: Phylloclades of Leaves are green photosynthetic organs of a Ruscus, leaf-like and bearing flow- plant arising from the nodes. Leaves are usu- ers; E: Thorn of Prunus; F: Tendril ally flattened, either bifacial (dorsiventral) of Luffa. with adaxial side (upper surface facing stem 62 Plant Systematics

Figure 4.5 Phyllotaxy of leaves. A: Rosulate; B: Alternate; C: Diagramatic representation of distchous (2-ranked) arrangement; D: Diagramatic representation of tristichous (3- ranked) arrangemt; E: Whorled leaves in Galium; F: Opposite and decussate leaves of Lamium; G: Opposite and superposed leaves of Quisqualis; H: Imbricated leaves. axis) different from abaxial side (lower sur- all leaves are found to lie in a fixed number face facing away from stem axis) or may be of vertical rows or orthostichies. The ar- unifacial (isobilateral) with similar adaxial rangement commonly agrees with the Fi- and abaxial surfaces. A leaf is generally dif- bonacci series (Schimper-Brown series), ferentiated into a leaf blade (lamina) and a wherein numerator and denominator in petiole. A leaf with a distinct petiole is termed each case are obtained by adding up the pre- petiolate, whereas one lacking a petiole is ceding two (1/2, 1/3, 1+1/2+3=2/5, 1+2/ sessile. A petiole may be winged (Citrus), 3+5=3/8, and so on) In grasses the leaves swollen (Eichhornia), modified into tendril are in two rows (2-ranked, distichous or ½ (Clematis), spine (Quisqualis) or become modi- phyllotaxy), so that the third leaf is above fied into a flattened photosynthetic phyllode the first leaf. Sedges have three rows of (Australian Acacia). Two small stipules may leaves (3-ranked, tristichous, or 1/3 phyl- be borne at the base of the petiole. The leaf lotaxy), the fourth leaf above the first leaf. terminology affords a wide diversity. The leaf China rose and banyan show pentastichous base may sometimes be sheathing or arrangement, where the sixth leaf lies above pulvinate (swollen). the first one, but in doing so leaves complete two spirals and the phyllotaxy is known as Leaf arrangement 2/5 phyllotaxy. Carica papaya depicts octastichous arrangement, wherein the (Phyllotaxy) ninth leaf lies above the first one and three Alternate: Bearing one leaf at each node. spirals are completed in doing so, thus a The successive leaves usually form a spiral 3/8 phyllotaxy. Leaf bases of date palm and pattern, in mathematical regularity so that sporophylls of pinecone are closely packed Descriptive Terminology 63 and internodes are extremely short making A Simple leaf may be undivided or in- it difficult to count the number of rows cised variously depending upon whether the (orthostichies). Such an arrangement is incision progresses down to the midrib (pin- known as parastichous. nate) or towards the base (palmate): Imbricated: The leaves closely overlapping (i) Pinnatifid: The incision is less than one another, as in Cassiope. halfway towards the midrib. Opposite: Bearing pairs of leaves at each (ii) Pinnatipartite: The incision is more node. The pairs of successive leaves may be than halfway towards the midrib. parallel (superposed) as in Quisqualis or at (iii) Pinnatisect: The incision reaches al- right angles (decussate) as in Calotropis and most the midrib. Stellaria. (iv) Palmatifid: The incision is less than Whorled (verticillate): More than three halfway towards the base. leaves at each node as in Galium, Rubia and (v) Palmatipartite: The incision is more Nerium. than halfway towards the base of leaf Radical: Leaves borne at the stem base of- blade. ten forming a rosette (rosulate) in reduced (vi) Palmatisect: The incision reaches stems, as in Primula and Bellis. almost the base of leaf blade. Cauline: Leaves borne on the stem. (vii) Pedate: Deeply palmately lobed leaves Ramal: Leaves borne on the branches. with lobes arranged like the claw of a bird. Leaf duration A compound leaf has incision reaching Leaves may stay and function for few days the midrib (or leaf base) so that there are to many years, largely determined by the ad- more than one distinct blades called as leaf- aptation to climatic conditions: lets or pinnae. It may similarly be pinnate Caducuous (fugacious): Falling off soon af- when the leaflets are borne separated along ter formation, as in Opuntia. the rachis (cf. midrib of simple leaf) or pal- Deciduous: Falling at the end of growing sea- mate when the leaflets arise from a single son so that the plant (tree or shrub) is leaf- point at the base. Pinnate compound leaves less in winter/dormant season. In tropical may be further differentiated: climate, the tree may be leafless for only a (i) Unipinnate (simple pinnate): The few days. Salix and Populus are common ex- leaflets are borne directly along the amples. rachis. In paripinnate leaf (Cassia), Evergreen (persistent): Leaves persisting the leaflets occur in pairs and as such throughout the year, falling regularly so that the terminal leaflet is missing and tree is never leafless, as in mango, pines there are even numbers of leaflets. In and palms. It must be noted that whereas an imparipinnate (Rosa) leaf, on the the term persistent is used for the leaves, other hand, there is a terminal leaf- the term evergreen is commonly associated let, resulting in odd number of leaflets. with trees with such leaves. (ii) Bipinnate (twice pinnate): The pin- Marcescent: Leaves not falling but wither- nae (primary leaflets) are again divided ing on the plant, as in several members of into pinnules, so that the leaflets Fagaceae. (pinnules) are borne on the primary branches of the rachis as in Mimosa Leaf incision/type of leaves pudica. A leaf with a single blade (divided or not) is (iii) Tripinnate (thrice pinnate): The dis- termed simple, whereas one with two or section goes to the third order so that more distinct blades (leaflets) is said to be the leaflets are borne on secondary compound. branches of the rachis as in Moringa. 64 Plant Systematics

Figure 4.6 Leaf incision. A: Undivided with pinnate venation; B: Pinnatifid; C: Pinnatipartite; D: Pinnatisect; E: Pinnate compound- imparipinnate leaf of Rosa; F: Pinnate compound-paripinnate leaf of Cassia; G: Bipinnate leaf of Acacia nilotica; H: Pinnate-trifoliate leaf of Medicago, note middle leaflet with longer petiolule; I: Tripinnate leaf of Moringa; J: Triternate leaf of Thalictrum; K: Undivided with palmate venation; L: Palmatifid; M: Palmatipartite; N: Palmatisect; O: Palmate compound-digitate; P: Unifoliate leaf of Citrus; Q: Bifoliate; R: Trifoliate leaf of Trifolium, note all leaflets with equal petiolules as opposed to pinnate trifoliate leaf; S: Trifoliate leaf of Oxalis; T: Quadrifoliate leaf of Marsilea; U: pedate leaf of Vitis pedata.

(iv) Decompound: Here the dissections go lower two leaflets are reduced and the beyond the third order, as in Fennel. terminal leaflet looks like a simple The term is sometimes used for leaves leaf but has a distinct joint at base, as more than once compound. seen in Citrus plants. (v) Ternate: The leaflets are present in (ii) Bifoliate (binnate): A leaf with two groups of three. Leaf may be ternate leaflets, as found in Hardwickia. (pinnate with three leaflets, i.e. (iii) Trifoliate (ternate): A leaf with three trifoliate), biternate (twice pinnate leaflets, as in Trifolium. The trifoliate with three pinnae and three pinnules) leaf of Medicago and Melilotus has ter- triternate or decompound ternate. minal leaflet with a longer petiolule Palmate compound leaf does not have a ra- (stalk of leaflet) than basal leaflets and chis and the leaflets arise from the top of is accordingly a pinnate trifoliate leaf. the petiole: (iv) Quadrifoliate: A leaf with four leaflets, (i) Unifoliate: A modified situation in as in Paris and aquatic pteridophyle commonly a trifoliate leaf when the Marsilea. Descriptive Terminology 65

(v) Multifoliate (Digitate): A leaf with Hastate: Shaped like an arrow head with two more than four leaflets, as in Bombax. basal lobes directed outwards, as in Typhonium; also referring to hastate leaf Stipules base. The leaves of several species bear two small Lanceolate: Shaped like a lance, much stipules as outgrowths from the leaf base. longer than broad and tapering from a broad Leaves with stipules are termed stipulate base towards the apex, as in bottle-brush and those without stipules as exstipulate. plant (Callistemon lanceolatus). They show a lot of structural diversity: Linear: Long and narrow with nearly paral- Free-lateral: Free and lying on either side lel sides as in grasses and onion. of the petiole base, as in china-rose (Hibis- Lunate: Shaped like half-moon, as in cus rosa-sinensis). Passiflora lunata. Adnate: Attached to the base of petiole for Lyrate: Lyre-shaped; pinnatifid with large some distant, as in Rose. terminal lobe and smaller lower lobes, as in Intrapetiolar: The two stipules are coher- Brassica campestris. ent to form one, which lies in the axil of a Oblanceolate: Like lanceolate but with leaf as in Gardenia. broadest part near apex. Interpetiolar: A stipule lying between the Obcordate: Like cordate but with broadest petioles of two adjacent leaves, commonly part and notch at apex, as in Bauhinia. due to fusion and enlargement of two adja- Oblong: Uniformly broad along the whole cent stipules of different leaves as found in length as in banana. several members of Rubiaceae like Ixora. Obovate: Ovate, but with broadest part near Ochreate: The two stipules united and form- the apex, as in Terminalia catappa. ing a tubular structure ochrea, found in fam- Ovate: Egg-shaped, with broadest part near ily Polygonaceae. the base, as in Sida ovata. Foliaceous: Modified and enlarged to func- Orbicular (rotund): Circular in outline. The tion like leaves as in Lathyrus aphaca, where peltate leaf of Nelumbo is orbicular in out- the whole leaf blade is modified into tendril line. and stipules are foliaceous. Pandurate: Fiddle shaped; obovate with si- Tendrillar: Stipules modified into tendrils nus or indentation on each side near the as in Smilax. base and with two small basal lobes, as in Spiny: Stipules modified into spines as in Jatropha panduraefolia. Acacia. Peltate: Shield shaped with petiole attached to the lower surface of leaf (and not the mar- Leaf shape (outline of lamina) gin), as in Nelumbo. The shape of leaf/leaflet blade shows con- Reniform: Kidney-shaped, as Centella siderable variability and is of major taxo- asiatica. nomic value. Runcinate: Oblanceolate with lacerate or Acicular: Needle shaped, as in pine. parted margin, as in Taraxacum. Cordate: Heart shaped, with a deep notch at Sagittate: Shaped like an arrowhead with base, as in Piper betle. two basal lobes pointed downwards, as in Cuneate: Wedge-shaped, tapering towards Sagittaria and Arum; also referring to sagit- the base, as in Pistia. tate leaf base. Deltoid: Triangular in shape. Spathulate (spatulate): Shaped like a Elliptical: Shaped like an ellipse, a flattened spatula, broadest and rounded near the apex, circle usually more than twice as long as gradually narrowed towards the base, as in broad, as in Catharanthus roseus. Euphorbia neriifolia. 66 Plant Systematics

Figure 4.7 Leaf outline. A: Acicular; B: Subulate; C: Linear, common in grasses; D: Lanceolate; E: Oblong; F: Spathulate; G: Cordate; H: Ovate; I: Obovate; J: Oblanceolate; K: Peltate; L: Reniform; M: Hastate; N: Runcinate; O: Lunate; P: Sagittate; Q: Pandurate; R: Deltoid; S: Lyrate; T: Elliptic.

Subulate: Awl-shaped, tapering from a broad Double serrate (bi-serrate): The serrations base to a sharp point. are again serrate similarly as in Ulmus. Entire: Smooth, without any indentation, as Leaf margin in Mango. The edge of a leaf blade is known as margin Retroserrate: Teeth pointed downwards. and may show any of the following conditions: Revolute: Margin rolled down. Crenate: With low rounded or blunt teeth, Serrate: With sharp teeth pointing upward as in Kalanchoe. like saw, as seen in rose. Crisped: Margin strongly winding in verti- Serrulate: Minutely or finely serrate. cal plane giving ruffled appearance to leaf. Sinuate: Margin winding strongly inward as Dentate: With sharp teeth pointing out- well as outward. wards. Undulate (repand, wavy): Margin winding Denticulate: Minutely or finely dentate. gradually up and down and wavy, as in Double crenate (bi-crenate): Rounded or Polyalthia. blunt teeth are again crenate Double dentate: Sharp outward teeth are Leaf base again dentate. The term bi-dentate, though In addition to the terms cordate, cuneate, sometimes used here, is inappropriate, as hastate, sagittate already described above it more correctly refers to a structure bear- when referring to the leaf base, the following two teeth. ing additional terms are frequently used: Descriptive Terminology 67

Figure 4.8 Leaf margin. A: Entire; B: Crenate; C: Crenulate; D: Dentate; E: Denticulate; F: Ser- rate; G: Serrulate; H: Bi-serrate; I: Undulate; J: Sinuate; K: Crispate.

Amplexicaul: The auriculate leaf base com- Leaf apex pletely clasps the stem. Leaf apex may similarly present a number Attenuate: Showing a long gradual taper to- of diverse terms: wards the base. Acute: Pointed tip with sides forming acute Auriculate: With ear like appendages at the angle, as in mango. base, as in Calotropis. Acuminate: Tapering gradually into a Cuneate: Wedge shaped, with narrow end at protracted point, as in Ficus religiosa. the point of attachment. Aristate: With a long bristle at the tip. Decurrent: Extending down the stem and ad- Attenuate: Tip drawn out into a long taper- nate to the petiole. ing point. Oblique: Asymmetrical with one side of the Caudate: Apex elongated and tail-like. blade lower on petiole than other. Cirrhose: With slender coiled apex, as in Perfoliate: The basal lobes of leaf fusing so banana. that the stem appears to pass through the Cuspidate: Abruptly narrowed into sharp leaf, as in Swertia. When the bases of two spiny tip, as in pineapple. opposite leaves fuse and the stem passes Emarginate: With a shallow broad notch at through them, it is termed connate perfoli- tip, as in Bauhinia. ate as seen in Canscora. Mucronate: Broad apex with a small point, Rounded: With a broad arch at the base. as in Catharanthus. Truncate: Appearing as if cut straight Obtuse: Broad apex with two sides forming across. an obtuse angle, as in banyan. 68 Plant Systematics

Figure 4.9 Leaf apex and leaf base. Leaf apex. A: Acute; B: Acuminate; C: Aristate; D: Caudate; E: Emarginate; F: Retuse; G: Rounded; H: Mucronate; I: Truncate; J: Obtuse; K: Cirrhose. Leaf base. L: Attenuate; M: Amplexicaul; N: Connate-perfoliate; O: Per- foliate; P: Cuneate; Q: Auriculate; R: Cordate; S: Truncate; T: Decurrent.

Retuse: With a slight notch generally from Lanate: Wooly, with long intertwined hairs. an obtuse apex, as in Crotalaria retusa. Pilose: Covered with long distinct and scat- Truncate: Appearing as if cut straight across tered hairs. as in Paris. Puberulent: Minutely pubescent. Pubescent: Covered with soft short hairs. Leaf surface Rugose: With wrinkled surface. The surface of leaves, stems and other or- Scabrous: Surface rough due to short rough gans may present a variety of surface points. indumentation, whose characteristics are Scurfy: Covered with scales. highly diagnostic in several taxa. The sur- Sericeous: Covered with soft silky hairs, all face may be covered by trichomes (hairs, directed towards one side. glands, scales, etc.) arranged variously: Stellate: Covered with branched star-shaped Arachnoid : Covered with entangled hairs hairs. giving a cobwebby appearance. Strigose: Covered with stiff appressed hairs Canescent : Covered with grey hairs. pointing in one direction. Ciliate : With marginal fringe of hairs. Tomentose: Covered with densely matted Floccose: Covered with irregular tufts of soft hairs, wooly in appearance. loosely tangled hairs. Velutinous: Covered with short velvety Glabrate: Nearly glabrous or becoming gla- hairs. brous with age Villous: Covered with long, fine soft hairs, Glabrous: Not covered with any hairs. Some- shaggy in appearance. times but not always synonymous with The hairs covering the surface may be smooth surface. unicellular or multicellular, glandular or Glaucous: Surface covered with a waxy coat- nonglandular. The hairs may be un- ing, which easily rubs off. branched or branched variously. They may Glandular: Covered with glands or small bear one row of cells (uniseriate), two rows secretory structures. (biseriate) or several rows (multiseriate). Glandular-punctate (gland-dotted): Surface Some species of plants, especially some aca- dotted with immersed glands, as in Citrus. cias bear specialized glands domatia at the Hirsute: Covered with long stiff hairs. leaf base, which house ants which protect Hispid: Covered with stiff and rough hairs. plants from herbivores. Descriptive Terminology 69

Figure 4.10 Surface coverings. A: Arachnoid; B: Ciliate; C: Floccose; D: Glandular; E: Hirsute; F: Hispid; G: Pilose; H: Puberulent; I: Rugose; J: Scabrous; K: Sericeous; L: Stellate; M: Strigose; N: Tomentose; O: Villous.

Venation monotelic) inflorescence, on the other hand, the main axis has limited growth, being ter- The distribution of vascular bundles that are minated by the formation of a flower, and as visible on the leaf surface as veins consti- each level of branching bears one flower, tutes venation. Dicots exhibit a network of there are generally a limited number of flow- veins (reticulate venation); whereas mono- ers, and the oldest flower is either in the cots usually have non-intersecting parallel centre, or flowers of different ages are mixed veins (parallel venation). Each type of ve- up. An inflorescence is sometimes carried nation may encounter a single midrib from on a leafless axis. Such a leaf less axis aris- which the secondary veins arise (Unicostate ing from aerial stems is termed a peduncle or pinnate), or more than one equally strong (inflorescence pedunculate) and the one veins entering the leaf blade (multicostate arising from basal rosette of leaves as scape or palmate). In ferns and Ginkgo, the vena- (inflorescence scapigerous). tion is dichotomous with forked veins.

INFLORESCENCE Racemose types The following variations of the racemose type Inflorescence is a modified shoot system are commonly encountered: bearing flowers (modified shoots). The term Raceme: A typical racemose inflorescence inflorescence appropriately refers to the ar- with single (unbranched) axis bearing flow- rangement of flowers on the plant. The flowers on distinct pedicels, as in Delphinium. ers may either occur singly (in leaf axils — solitary axillary or terminal on the stem— Panicle: Branched raceme, the flowers be- solitary terminal) or may be organized into ing borne on the branches of the main axis, distinct inflorescences. Two principal types as in Yucca. of inflorescences are differentiated. In race- Spike: Similar to raceme but with sessile mose (indeterminate or polytelic), inflores- flowers, as in Adhatoda. cence the axis is of unlimited growth, api- Spadix: Variation of a spike where the axis cal bud continuing to grow, thus bearing old- is fleshy and the flowers are covered by a est flower towards the base and youngest to- large bract known as spathe, as found in wards the top. In cymose (determinate or Alocasia and Arum. 70 Plant Systematics

Corymb: Flat-topped racemose inflorescence more determinate branches arising below with longer lower pedicels and shorter up- the terminal flower at each level: per pedicels so that all flowers reach the Monochasial (Uniparous) cyme: One same level, as in Iberis amara. branch arising at each node so that when Corymbose-raceme: Intermediate between the sympodial (false) axis differentiates, a a typical raceme and a typical corymb, all limited number of bract-opposed flowers (in- flowers not managing to reach the same stead of many and axillary in raceme) are height, as in Brassica campestris. formed. Two types of monochasia are found: Catkin (ament): A spike-like inflorescence (i) Helicoid cyme: Successive branches of reduced unisexual flowers, as in Morus. (each forming one flower) are borne on Umbel: Flowers arising from one point due same side so that the inflorescence to condensation of axis, with oldest flowers is often coiled, as in the family towards the periphery and youngest towards Boraginaceae (e.g. Myosotis). the center as in the family Apiaceae (ii) Scorpioid cyme: Successive branches (Umbelliferae). Compound umbel has (each forming one flower) are borne on branches bearing the umbels also borne in alternate sides. In rhipidium found in umbellate manner. Solanum nigrum, all the flowers lie in Head: Flat-topped axis bearing crowded same plane as the main axis. sessile flowers as in Acacia and Mimosa. Dichasial (Biparous) cyme: Two branches Capitulum: Flat-topped inflorescence like arising below the apical flower at each level head (and often known as head) but with disso that the flower is between the fork of two Stellaria Dianthus tinct ray florets and disc florets (one or both branches, as in and . types), surrounded by involucre bracts (phyl- Polychasial (multiparous) cyme: More than laries), as found in the family Asteraceae two branches arising at each node below the (Compositae). terminal flower so that a broad inflorescence of several flowers is formed, as in Viburnum. Cymose cluster: Cymose group of flowers Cymose types arising from a point due to reduction of axis. A cymose inflorescence may be primarily dif- Cymose umbel: Looking like an umbel but ferentiated on account of bearing one or formed by grouping together of numerous

Figure 4.11 Inflorescence: racemose types. A: Raceme of Linaria; B: Corymbose raceme of Bras- sica; C: Corymb of Cassia; D: Panicle of Yucca; E: Umbel of Prunus; F: Compound umbel of Foeniculum; G: Catkins of Betula; H: Spike of Achyranthes; I: Spadix of Colocasia; J: Capitulum of Helianthus. Descriptive Terminology 71

Figure 4.12 Inflorescence: cymose and specialized types. Cymose types. A: Helicoid cyme of Heliotropium; B: Scorpioid cyme of Ranunculus bulbosus; C: Biparous cyme of Dianthus; D: Multiparous cyme of Viburnum. Specialized types. E: Verticillaster of Salvia; F: Cyathium of Euphorbia; G: Hypanthodium of Ficus cunia. cymes so that the flowers of different ages FLOWER are mixed up, as found in Allium. A flower is a highly modified shoot bearing specialized floral leaves. The axis of the Specialized types flower is condensed to form thalamus (torus In addition to the typical determinate and or receptacle) commonly bearing four whorls indeterminate types, some mixed and spe- of floral parts: calyx (individual parts sepals), cialized types are also encountered: corolla (individual parts petals), Androecium Cyathium: Complex type of inflorescence (individual parts stamens) and Gynoecium met in genus Euphorbia, having a cup- (individual parts carpels). In some plants, the shaped involucre (formed by fused bracts) calyx and corolla may not be differentiated usually carrying five nectaries along the rim and represented by a single or two similar and enclosing numerous male flowers (in whorls of perianth (individual members scorpioid cymes, without perianth and bear- tepals: a term formerly restricted to petal ing a single stamen) in axils of bracts and like perianth of monocots). The flower is single female flower in the centre. usually carried on a pedicel and may or may Verticillaster: Characteristic inflorescence not be subtended by a reduced leaf known of family Lamiaceae. Each node of the inflo- as bract. The pedicel may sometimes carry rescence bears two opposite clusters of small bracteoles (if present usually two in dichasial cymes, subsequently becoming dicots, one in monocots). As a general rule, monochasial as the number of flowers in members of different whorls alternate each each cluster exceeds three. Due to the con- other. The terms associated with the gen- densation of the axis, flowers of different eral description of flower in usual sequence ages appear to form a false whorl or verticel. includes: Hypanthodium: Typical inflorescence of figs Bract having vessel like receptacle with a small Bracteate: Flower in the axil of a bract. opening at the top and bearing flowers along Ebracteate: Bract absent. the inner wall. Bracteolate: Bracteoles present on pedicel. Thyrse: A mixed inflorescence with race- Pedicel mose main axis but with cymose lateral clus- Pedicellate: Pedicel distinct, often ters as seen in grape vine. longer than flower. 72 Plant Systematics

Figure 4.13 Insertion of floral parts. A: Hypogynous with superior ovary; B: Perigynous with cup- shaped hypanthium and superior ovary; C: Perigynous with flask-shaped hypanthium, ovary superior; D: Perigynous with partially immersed semi-inferior ovary; E: Epigy- nous with inferior ovary, without free hypanthium above the ovary; F: Epigynous with inferior ovary and with free hypanthium above the ovary.

Subsessile: Pedicel much shorter, often all parts of perianth) more or less of the shorter than flower. same shape and size. Sessile: Pedicel absent. Zygomorphic: Asymmetrical flower, Complete: All the four floral whorls present. which may be divided into equal halves by one or more but not all vertical planes. Incomplete: One or more floral whorl In practice such flower has parts of calyx lacking. and/or corolla (or perianth) of different Symmetry: Symmetry of a flower is largely shapes and sizes. based on relative shapes and sizes of sepals Sexuality (or calyx lobes) in calyx whorl and/or rela- Bisexual (perfect): Bearing both stamens tive shapes and sizes of petals (or corolla and carpels. lobes) in the corolla whorl. Unisexual (imperfect): Bearing either Actinomorphic: Symmetrical flower stamens or carpels. which can be divided into equal halves Staminate (male): Bearing stamens only. when cut along any vertical plane. In prac- Pistillate (female): Bearing carpels only. tice an actinomorphic flower has all parts Dioecious: With male and female flowers of the calyx and all parts of the corolla (or on the different plants. Descriptive Terminology 73

Monoecious: With male and female flow- Spirocyclic: Calyx and corolla cyclic but sta- ers on the same plant. mens and carpels spirally arranged, as in Polygamous: With male, female and bi- Ranunculaceae. sexual flowers on the same plant. Insertion: Insertion of floral parts on the Calyx thalamus not only determines the shape of Description of the calyx starts with the num- the thalamus, it also reflects on the rela- ber of sepals in same whorl (5—typical on tive position of floral whorls, as also whether dicots, 3—typical of monocots), in two whorls the ovary is superior (and, consequently, (2+2, as in crucifers) or forming two lips (1/ other whorls inferior) or inferior (and, con- 4 in Ocimum, 3/2 in Salvia): sequently, other whorls superior): Polysepalous (aposepalous, chorisepa- Hypogynous: The thalamus is convex so lous): Sepals free, and consequently more that the other floral parts are inserted be- than one units (poly—many). low the ovary. The ovary in this case is superior and other floral whorls inferior. Gamosepalous: Sepals fused. Once the ca- There is no hypanthium. lyx is gamosepalous, it commonly gets differentiated two parts: calyx tube, the fused Perigynous: The thalamus is depressed part and calyx lobes (no longer sepals), the to the extent that the level of ovary is lower free part. The shape of the calyx tube should than the other whorls and the thalamus be described. It may be campanulate (bell- forms either a saucer-shaped, cup-shaped shaped as in Hibiscus), urceolate (urn- or flask-shaped hypanthium. It must be shaped as in fruiting calyx of Withania ), tu- noted that although hypanthium sur- bular (tube-like as in Datura), or bilabiate rounds the ovary, it is free from the ovary, (two-lipped as in Ocimum). the other floral whorls are borne along the rim of the hypanthium, yet the ovary is Caducous: Falling just after opening of flow- morphologically still superior and other flo- ers. ral whorls inferior. The ovary may some- Deciduous: Falling along with petals in ma- times be partially immersed and thus ture flower. semi-inferior. Persistent: Persisting in fruit. Epigynous: the hypanthium is fused with Accrescent: Persisting and enlarging in the ovary, so that the other floral whorls fruit. appear to arise from the top of the ovary. Aestivation: Arrangement of sepals (or pet- The ovary is obviously inferior and other als) in the flower bud. Term vernation is used floral whorls superior. There may or may exclusively for arrangement of young leaves not be a free hypanthium above the ovary; in a bud. The following main types of aesti- in the former case, other floral parts ap- vation are met: pear to arise from the top of ovary. (i) Valvate: Margins of sepals or calyx Pentamerous: Five members in each floral lobes not overlapping. whorl (excluding stamens and carpels), typi- (ii) Twisted: Overlapping in regular pat- cal of dicots. tern, with one margin of each sepal Tetramerous: Four members in each floral overlapping and other being over- whorl, as in crucifers. lapped. Trimerous: Three members in each floral (iii) Imbricate: With irregular overlapping. whorl, as in monocots. In Quincuncial imbricate, two sepals Cyclic (tetracyclic): Calyx, corolla, are with both margins outer, two with androecium and gynoecium in four separate both margins inner, and fifth with one whorls. outer and one inner margin. 74 Plant Systematics

Figure 4.14 Aestivation of calyx and corolla parts. A: Valvate; B: Twisted; C: Imbricate; D: Quincuncial imbricate; E: Vexillary.

Description of aestivation may be followed variously coloured. In some cases, sepals or by colour of sepals (green or petaloid), and petals may bear a small pouch a condition whether they are inferior or superior. known as saccate (lateral sepals of Brassica or corolla of Cypripedium— is more like slip- Corolla per and called calceolate). Sometimes the base may be produced into a tube like struc- Description of the corolla follows the same ture known as spur (corolla as calcarate) as bilabiate pattern as calyx except that corolla in Delphinium and Aquilegia. In some flow- polypeta- may be 4/1 or 2/3, corolla may be ers (Aconitum), the corolla may be shaped like lous apopetalous choripetalous gamo- ( , ), or a helmet, when it is termed as galeate. petalous sympetalous ( ), corolla tube may be Present inner to corolla in some cases is infundibuliform additionally (funnel- an additional whorl generally attached to the Datura rotate shaped) as in , (tube very short throat of the corolla (or inner whorl of the with large lobes spreading out at right angle perianth). Such a whorl is known as corona to the tube like spokes of a wheel), as in and may be consisting of appendages from Solanum salverform salver shaped , or ( - , perianth (Narcissus), corolla (corolline corona hypocrateriform Catharanthus ), as in . The as in Nerium) or from stamens (staminal co- junction of corolla tube and lobes (constitut- rona as in Hymenocallis). The flower is ing limb) is known as throat. Petals may known as coronate. sometimes be narrowed into a stalk termed as claw, the broader part then constituting the limb. Specialized types of corolla are en- Perianth countered in Brassicaceae (cruciform—four The description of perianth in the flowers free petals arranged in the form of a cross), lacking distinct calyx and corolla follows the Caryophyllaceae (caryophyllaceous—five same pattern specifying the number, num- free clawed petals with limb at right angles ber of whorls, perianth being polyphyllous to the claw), Rosaceae (rosaceous—five (apotepalous) or gamophyllous (syntepa- sessile petals with limbs spreading out- lous), aestivation, and the colour of the pe- wards) and Fabaceae (Papilionaceous—re- rianth. The parts when free are called sembling a butterfly with single large poste- tepals in place of sepals or petals. rior petal vexillum or standard, two lateral petals alae or wings, and two anterior pet- Androecium als slightly united to form keel or carina; Stamens representing the androecium the aestivation is vexillary or descending present a more complicated architecture as imbricate, with the standard being the out- compared to sepals and petals. Each stamen ermost, overlapping two wings, which in turn has an anther—typically tetrasporangiate overlap keel). The petals may similarly be with two anther sacs (microsporangia) in Descriptive Terminology 75

Figure 4.15 Corolla types. A: Cruciform; B: Papilionaceous; C: Caryophyllaceous; D: Rosaceous; E: Campanulate; F: Tubular; G: Infundibuliform (Funnel-shaped); H: Hypocrateriform; I: Urceolate; J: Bilabiate; K: Spurred (Calcarate); L: Coronate; M: Personate; N: Calceolate; O: Galeate. each of the two anther lobes—, carried on a Epipetalous: Filaments attached to the filament. The two anther lobes are often petals, a characteristic feature of sym- joined with the help of a connective, which petalous families. in some primitive families, is a continua- Epiphyllous (epitepalous): Filaments at- tion of the filament. The description of tached to the perianth. androecium, likewise, starts with the num- Relative size: Stamens in a flower are gen- ber of stamens in a single or more whorls. erally of the same size, but the following Major descriptive terms include: variations may be encountered in some Fusion: Stamens may generally be free, but flowers: if fused it can take a variety of forms: Didynamous: Four stamens, two shorter Polyandrous: Stamens free throughout. and two longer, as in Ocimum. Monadelphous: Filaments of all stamens Tetradynamous: Six stamens, two shorter united in a single group, as in family in outer whorl and four longer in inner Malvaceae. whorl, as in crucifers. Diadelphous: Filaments of stamens Heterostemonous: Same flower with sta- united in two groups, as in Lathyrus. mens of different sizes, as in Cassia. Polyadelphous: Filaments united in more Diplostemonous: Stamens in two whorls, than two groups, as in Citrus. the outer whorl alternating with petals as Syngenesious (synantherous): Filaments in Murraya. free but anthers connate into a tube, as Obdiplostemonous: Stamens in two whorls in family Asteraceae. but outer whorl opposite the petals, as in the Synandrous: Stamens fused completely family Caryophyllaceae. through filaments as well as anthers, as Antipetalous: Stamens opposite the petals, in Cucurbita. as in the family Primulaceae. 76 Plant Systematics

Figure 4.16 Androecium types. A: Epipetalous staments. Length. B: Didynamous; C: Tetrady- namous; D: Heterostemonous. Fusion. E: Diadelphous; F: Monadelphous; G: Syngenesious. Attachment. H: Adnate; I: Basifixed; J: Dorsifixed; K: Versatile. Dehiscence. L: Longitudinal; M: Transverse; N: Poricidal; O: Valvular. P: Monothecous reniform anther.

Bithecous: Stamen with two anther lobes (iv) Versatile: Filament attached nearly at (each anther lobe at maturity becomes the middle of connective so that an- unilocular due to coalescence of two adja- ther can swing freely as, in Lilium and cent microsporangia) so that anther is two- grasses. celled at maturity. Dehiscence: Anther dehiscence commonly Monothecous: Stamen with single anther occurs by the formation of sutures along the lobe so that mature anther is single-celled, point of contact of two anther sacs, but con- as in family Malvaceae. siderable variation in their location may be Attachment: Common modes of attachment found: of filament to the anther include: Longitudinal: The two sutures extend (i) Adnate: Filament continues into con- longitudinally, one on each anther lobe as nective which is almost as broad, as in Datura. found in Ranunculus. Transverse: Suture placed transversely, (ii) Basifixed: The filament ends at the as in monothecous anthers of family base of anther (when connective ex- Malvaceae. tends up to base of anther) or at least Poricidal (apical pores): Anther opening base of connective (when anther lobes by pores at the tip of anther, as in Solanum extend freely below the connective). nigrum. The resultant anther is erect, as in Brassica. Valvular: Portions of anther wall opening (iii) Dorsifixed: Filament attached on the through flaps or valves, as in Laurus. connective above the base. The result- Centripetal: Developing from the outside to ant anther is somewhat inclined, as the inside so that the oldest stamens are in Sesbania. towards the periphery. Descriptive Terminology 77

Centrifugal: Developing from centre to- number of rows of ovules (placental lines) wards the periphery, so that the oldest flow- would equal the number of united carpels. A ers are towards the centre. solitary carpel would obviously have a single Included: Stamens are shorter than the co- chamber with a single ovule or a single row rolla. of ovules. On the other hand, if ovary is more Exserted: Stamens protruding far beyond the than one chambered, it obviously has more petals as in Umbellifers. than one carpels, and the number of chambers would indicate the number of carpels. Introrse: Slits of the anther facing towards There are, however, atypical cases. Single the centre. chambered ovary may have a central column Extrorse: Slits of the anther facing towards bearing ovules (since septa disappeared), or outside. in a single chambered ovary there may be Androphore: Extension of thalamus bearing single large ovule because all others (from stamens. one or more placental lines) have disap- Gynostegium: Structure formed by the fu- peared. In both these cases, the number of sion of stamens with the stigmatic disc, as carpels can be known by counting the num- in family Asclepiadaceae. ber of free styles, or if style is one the num- Gynostemium: Structure formed by fusion ber of stigmas or stigmatic lobes. In extreme of stamens with gynoecium, as in family cases, even this may not help, as in Anagallis Orchidaceae. arvensis, when the number of suture lines on the fruit would help. The number of car- Gynoecium pels are represented as monocarpellary (carpel one), bicarpellary (carpels two), Gynoecium represents a collection of car- tricarpellary (carpels three), tetracarpellary pels in a flower. The distinction between (carpels four), pentacarpellary (carpels five), carpel and pistil is often ambiguous. In and multicarpellary (carpels more than reality the carpels are components of a five). The number of chambers similarly are gynoecium whereas the pistils represent represented as unilocular, bilocular, visible units. Thus, if carpels are free, there trilocular, tetralocular, pentalocular and would be as many pistils (simple pistils). On multilocular. Gynoecium with free carpels the other hand, if the carpels are united (and is apocarpous, whereas one with fused car- obviously more than one), the flower would have only one pistil (compound pistil). Each carpel is differentiated into a broad basal ovary containing ovules, an elongated style, and pollen-receptive apical part stigma. Any attempt to describe gynoecium requires a transverse section through the ovary. An additional longitudinal section is always helpful. Carpel number and fusion A flower having more than one separate pis- Figure 4.17 Carpel fusion. A: Apocarpous; B: tils would have as many carpels, which are Apocarpous with fused styles and stigmas (which, in turn, also fused free. On the other hand, if the pistil is one, with anthers to form gynostegium); there could either be one carpel, or more C: Syncarpous with free styles and than one fused carpels. A section through stigmas (synovarious); D: Syncar- the ovary helps to resolve the matter in most pous with free stigmas (synstylo- cases. If the ovary is single chambered, the various); E: Syncarpous. 78 Plant Systematics

Figure 4.18 Placentation. A: Marginal; B: Parietal with 3 carpels; C: Parietal with false septum in crucifers (parietal-axile); D: Parietal with false septa in cucurbits; E: Basal; F: Api- cal; G: Axile; H: Axile with false septa in Datura; I: Free central with usual central column attached at the base and top of the ovary; J: Free central in Primulaceae in Longitudinal section showing placental column projecting from the base; K: Superfi- cial in Nymphaea. pels (at least ovaries fused) as syncarpous. parietal-septate. In family Syncarpous gynoecium may have free styles Cucurbitaceae, the three parietal pla- and stigma (synovarious) or free stigmas centae intrude into ovary cavity and (synstylovarious) or all fused. often meet in the centre making false-axile placentation. Placentation (iii) Axile: Ovary more than one chambered and placentae along the axis as Placentation refers to the distribution of plain Hibiscus. centae on the ovary wall and, consequently, (iv) Free-central: Ovary single cham- the arrangement of ovules. The following bered, ovules borne along the central major types are found: column, as in family Caryophyllaceae. (i) Marginal: Single chambered ovary (v) Basal: ovary single chambered, with with single placental line commonly single ovule at the base, as found in with single row of ovules, as in family Asteraceae (Compositae). Lathyrus. (vi) Superficial: Multilocular ovary with (ii) Parietal: Single chambered ovary with whole inner wall of ovary lined with more than one discrete placental lines placentae as in Nymphaea. In laminar as, in family Capparaceae. In family placentation, the ovules arise from Brassicaceae, the ovary later becomes surface of septa. bilocular due to the formation of a false septum, the ovules present at the Style and Stigma junction of septum and ovary wall, a condition often known as parietal-ax- Simple: Single style or stigma resulting from ile. In some members of Aizoaceae, single carpel or fused styles or stigmas. the ovules arise from inner ovary walls Bifid: Style or stigma divided into two as in of septate ovary, a condition known as family Asteraceae. Descriptive Terminology 79

Plumose stigma: Feathery stigma with trichome-like branches as in Poaceae and Cyperaceae. Ovule Ovule represents megasporangium, attached to the placenta by funiculus, which joins the ovule at the hilum. Base of the ovule is known as chalaza, and the tip as micropyle. Ovule has a female gametophyte (embryo sac) surrounded by nucellus, in turn, enveloped by two integuments. The following terms are commonly associated with ovules: Orthotropous (atropous): Straight erect ovule with funiculus, chalaza and micro- Figure 4.19 Style and stigma. A: Lateral style; pyle in one line, as in family Polygonaceae. B: Gynobasic style; C: Bifid feath- Anatropous: Inverted ovule with micro- ery stigma in Poaceae; D: Sessile pyle facing and closer to funiculus, as in and radiate stigma of Papaver; E: Ricinus. Tripartite funnel-shaped stigma of Amphitropous: Ovule placed at right Crocus; F: Capitate stigma of angles to the funiculus, as in Ranunculus. Alchemilla; G: Discoid stigmas of Hibiscus; H: Bifid stigma in Campylotropous: Curved ovule so that Asteraceae. micropyle is closer to chalaza, as in Brassicaceae. Terminal style: Arising from the tip of ovary, Circinotropous: Funiculus very long and the most common type. surrounding the ovule, as in Opuntia. Gynobasic style: Arising from central base Hemianatropous (hemitropous): Body of the ovary, as in family Lamiaceae. half-inverted so that funiculus is attached Capitate: Stigma appearing like a head. near middle with micropyle terminal and Lateral style: Style arising from the side of at right angles. the ovary, as in Mangifera and Alchemilla. Bitegmic: Ovule with two integuments, common in polypetalous dicots. Stylar beak: Persistent style, extended into a long beak Unitegmic: Ovule with single integument, common in sympetalous dicots. Pistillode: Sterile pistil, devoid of any fer- Crassinucellate: Ovule with massive tile ovules, as in ray floret of radiate head of nucellus, found in primitive polypetalous Helianthus. dicots. Radiate stigma: Sessile disc like with radi- Tenuinucellate: Ovule with thin layer of ating branches, as in Papaver. nucellus, as in sympetalous dicots. Stylopodium: Swollen basal part of style surrounded by nectary persisting in fruit of um- FRUITS bellifers. A fruit is a matured and ripened ovary, Sessile stigma: Seated directly on ovary, wherein the ovary wall gets converted into style being reduced as in Sambucus. the fruit wall pericarp (differentiated into Discoid stigma: Disc-shaped stigma. outer epicarp, middle mesocarp and inner Globose stigma: Stigma spherical in shape. endocarp), and the ovules into seeds. Three 80 Plant Systematics

many-seeded segments, as in Mimosa. Sometimes considered as a type of schizocarpic fruit. Siliqua: Fruit developing from bicarpellary syncarpous superior ovary, which is initially one chambered but subsequently becomes two chambered due to the formation of a false septum, visible on the outside in the form of a rim known as replum. The fruit dehisces along both sutures from the base upwards, valves separating from septum and seeds remaining attached to the rim (replum), characteristic of the family Brassicaceae. The fruit is narrower and longer, at least three times longer than broad, as in Bras- Figure 4.20 Ovules. A: Orthotropous; B: Anat- sica and Sisymbrium. ropous; C: Campylotropous; Silicula: Fruit similar to siliqua but D: Hemianatropous; E: Amphi- shorter and broader, less than three times F: tropous; Circinotropous. longer than broad as seen in Capsella, Lepidium and Alyssum. Silicula is commonly flattened at right angles to the false main categories of fruits are recognized: septum (Capsella, Lepidium) or parallel to simple fruits developing from a single ovary the false septum (Alyssum). of the flower, aggregate fruits developing from several free carpels within the flower, Capsule: Fruit developing from syncar- and composite fruits involving several flow- pous ovary and dehiscing in a variety of ers or the whole inflorescence. ways: Circumscissile (pyxis): Dehiscence Simple fruits transverse so that top comes off as a lid or operculum, as in Anagallis arvensis. A single fruit develops from a flower having Poricidal: Dehiscence through terminal a single carpel or several united carpels so pores as in poppy (Papaver). that the flower has a single ovary. Such a Denticidal: Capsule opening at top ex- fruit may be dehiscent opening by a suture posing a number of teeth as in Primula exposing seeds or remain indehiscent. and Cerastium. Dehiscent fruits Septicidal: Capsule splitting along septa and valves remaining attached to septa Such fruits are generally dry and burst along as in Linum. the suture to release their seeds. Common Loculicidal: Capsule splitting along loc- types are enumerated below: ules and valves remaining attached to Follicle: Fruit developing from superior septa, as in family Malvaceae. monocarpellary ovary and dehiscing along Septifragal: Capsule splitting so that Consolida one suture, as in . valves fall off leaving seeds attached to Legume or pod: Fruit developing like fol- central axis as in Datura. licle from monocarpellary superior ovary but dehiscing along two sutures, as in legumes. Schizocarpic fruits Lomentum: Modified legume, which splits This fruit type is intermediate between transversely at constrictions into one- or dehiscent and indehiscent fruits. The fruit, Descriptive Terminology 81

Figure 4.21 Fruits. A: Achene of Ranunculus; B: Cypsela of Ageratum with scaly pappus; C: Nut of Castanea; D: Pod of Pisum; E: Single follicle of Calotropis; F: Siliqua of Bras- sica; G: Silicula of Capsella bursa-pastoris; H: Capsule of Datura; I: Cremocarp in umbellifers; J: A pair of lomentum fruits in Mimosa; K: Double samara of Acer; L: Capsule of Primula dehiscing by apical teeth (denticidal); M: Operculate capsule of Papaver with poricidal dehiscence; N: Pyxis of Celosia with circumscissile dehiscence; O: Capsule of Abelmoschus esculentus with loculicidal dehiscence; P: Pome of Malus pumila; Q: Hip of Rosa with etaerio of achenes inside; R: Drupe of Prunus; S: Berry of Lycopersicon esculentum; T: Pseudocarp of Fragaria, an accessary fruit with etaerio of achenes; U: Etaerio of drupes in Rubus; V: Syconium of Ficus developing from hypothodium inflorescence; W: Sorosis of Morus. 82 Plant Systematics instead of dehiscing, rather splits into num- Utricle: Similar to nut but with papery ber of segments, each containing one or more often inflated pericarp as in Chenopo- seeds. Common examples of schizocarpic dium. fruits are: Fleshy indehiscent fruits: Such fruits Cremocarp: Fruit developing from have fleshy and juicy pericarp even at bicarpellary syncarpous inferior ovary and maturity. Common examples are: splitting into two one seeded segments Drupe: Fruit with usually skinny epi- known as mericarps, as in umbellifers. carp, fibrous or juicy mesocarp and hard Carcerulus: Fruit developing from stony endocarp, enclosing single seed, as bicarpellary syncarpous superior ovary seen in mango, plums and coconut. and splitting into four one seeded seg- Berry: Fruit with uniformly fleshy peri- ments known as nutlets, as in family carp with numerous seeds inside, as Lamiaceae. seen in Solanum, tomato and brinjal. Double samara: Fruit developing from syn- Pepo: Fruit formed from inferior ovary of carpous ovary, two or four chambered, cucurbits with epicarp forming tough pericarp of each chamber forming a wing, rind. fruit splitting into one-seeded winged segments as in maple (Acer). It must be noted Hesperidium: Fruit developing from su- that single samara of Fraxinus, is a single- perior ovary with axile placentation, epi- seeded dry winged indehiscent fruit and carp and mesocarp forming common rind not a schizocarpic fruit. and endocarp produced inside into juice Regma: Fruit developing from vesicles, as seen in citrus fruits. multicarpellary syncarpous ovary and Pome: Fruit developing from inferior splitting into one-seeded cocci, as in Rici- ovary, an example of accessory (false) nus and Geranium. fruit, wherein fleshy part is formed by thalamus and cartilaginous pericarp is Indehiscent fruits inside, as seen in apple. Balausta: Fruit developing from inferior Such fruits do not split open at maturity. ovary, pericarp tough and leathery, seeds They may be dry or fleshy: attached irregularly, succulent testa be- Dry indehiscent fruits : Such fruits have ing edible, as seen in pomegranate dry pericarp at maturity, and are repre- (Punica granatum). sented by: Achene: Single seeded dry fruit developing from a single carpel with superior Aggregate fruits ovary. Fruit wall is free from seed coat. Aggregate fruits develop from multi-carpel- Achenes are often aggregated, as in fam- lary apocarpous ovary. Each ovary forms a ily Ranunculaceae. fruitlet, and the collection of fruitlets is Cypsela: Single seeded dry fruit, simi- known as etaerio. Common examples are lar to (and often named achene) but de- etaerio of achenes in Ranunculaceae, veloping from bicarpellary syncarpous in- etaerio of follicles in Calotropis, etaerio of ferior ovary, as in family Asteraceae. drupes in raspberry (Rubus) and etaerio of Caryopsis: Fruit similar to above two but berries in Polyalthia. In Rose the etaerio of fruit wall fused with seed coat as seen achenes is surrounded by a cup like hy- in grasses. panthium forming a specialized accessory Nut: One-seeded, generally large fruit de- fruit known as hip. The fruit of strawberry veloping from multicarpellary ovary and (Fragaria), though also an etaerio of with hard woody or bony pericarp, as seen achenes, is an accessory fruit, the edible in Quercus and Litchi. part being the fleshy thalamus. Descriptive Terminology 83

Multiple (composite) fruits Symbol Explanation Alternate A multiple fruit involves ovaries of more than Symbol one flower, commonly the whole inflorescence. Common examples are: Flowers actinomorphic * Sorosis: Composite fruit develops from the or X whole inflorescence and floral parts become Flowers zygomorphic edible, as seen in Morus (having fleshy peri- Flowers pistillate anth but dry seeds) and Artocarpus (with fleshy rachis, perianth and edible seeds). Flowers staminate 5 Syconium (syconus): Fruit developing from K5 Sepals five and free CA hypanthodium inflorescence of figs. There Sepals five and united 5 is a collection of achenes borne on the in- K(5) CA 2+2 side of fleshy hollow receptacle. K2+2 Sepals 4 in two whorls CA K(3/2)Calyx bilabiate, upper lip FLORAL FORMULA with 3 lobes, lower with 2 The floral formula enables convenient Sepals 4-5 in number 4-5 graphical representation of essential floral K4-5 CA 5 characteristics of a species, mainly incor- C5 Petals 5 and free CO porating its sexuality, symmetry, number 5 and fusion of floral parts and ovary position. C(5) Petals 5 and united CO It is more convenient to represent Calyx by C(2/3)Corolla bilabiate, upper K (or CA), Corolla by C (or CO), Perianth by P, lip with 2 lobes, lower Androecium by A and Gynoecium by G. The with 3 number of parts in a floral whorl are indi- Perianth with 5 free tepals cated by a numeral (as such when free, but P5 when united within parentheses or a circle. P(5) Perianth with 5 united tepals Adnation between whorls is indicated by a Perianth with 6 free tepals in curve (above or below). Inferior ovary has a P3+3 line above G, while the superior ovary has two whorls 5 one below. Complete sequential represen- A5 Stamens five and free A tation of components of floral formula with Stamens five and united 5 major variations is given in Figure 4.22. A(5) A 2+2 Representative floral formulae of some A2+2 Stamens didynamous A species of angiosperms are presented in Stamens tetradynamous 2+4 Figure 4.23. Along side each floral formula A2+4 A 1+ 9 is given a list of features of the species on A1+(9)Stamens diadelphous A which the floral formula is constructed. C A Stamens epipetalous CO 5 A5 FLORAL DIAGRAM (5) 5 The floral diagram is a representation of the G Carpels 2 and free, G2 cross-section of the flower, floral whorls ar- 2 ovary superior ranged as viewed from above. The floral dia- 2 gram not only shows the position of floral G(2) Carpels 2 and united, G parts relative to the mother axis and each ovary inferior other, but also their number, fusion or not, overlapping, the presence and position of Figure 4.22 Representation of different fea- bracts, insertion of stamens, the number of tures of floral whorls in a floral anther sacs, whether the anthers are ex- formula. 84 Plant Systematics

Figure 4.23 Floral formulae of some representative species of few families of angiosperms depicting diversity of features depicted. The important features on which each formula is based are shown in the right column. trorse or introrse, and more importantly, a anterior side. The remaining components section through the ovary, depicting the type of the flower—depending upon whether they of placentation, the number of ovules vis- are closer to the mother axis or the bract— ible in a section, and the presence or ab- occupy postero-lateral and antero-lateral po- sence of a nectary. It also if some stamens sitions, respectively. The members of differ- are nonfunctional (represented by ent floral whorls are shown arranged in con- staminodes) and whether the ovary is func- centric rings, calyx being the outermost and tional or represented by a pistillode. the gynoecium the innermost. A large ma- The branch (or the inflorescence axis) bear- jority of dicot flowers are pentamerous, and ing the flower is known as mother axis, and as such the five members of each whorl (ex- the side of flower facing it as posterior side. cluding gynoecium in the centre) are ar- The bract, if present is opposite the mother ranged such a way that four of them occur axis, and the side of flower facing it is the in pairs (members of each pair occupying Descriptive Terminology 85

Figure 4.24 Stems. A: Arboreus stem (trunk) of Cyclobalanopsis glauca; B: Tendril climbing stem of Luffa cylindrica; C: Scandent stem of Allamanda violacea; D: Creeping stem of Zebrina pendula; E: Offset of Eichhornia crassipes; F: Runner of Oxalis corniculata; G: Twining stem of Jacquemontia pentantha; H: Succulent stem of Echinopsis terescheckii; I: Rhi- zome of Zingiber officinale; J: Phylloclade of Ruscus aculeatus; K: Bulb of Allium cepa; L: Tuber of Solanum tuberosum; M: Corm of Alocasia; N: Phylloclade of Opuntia elatior. 86 Plant Systematics

Figure 4.25 Leaves. A: Alternate phyllotaxy in Citrus; B: Opposite decussate phyllotaxy in Calotropis procera; C: Whorled phyllotaxy in Alstonia scholaris; D: Ovate long acuminate leaf of Ficus religiosa; E: Sagittate leaf of Sagittaria sagitifolia; F: Palmately lobed leaf of Rubus trifidus; G: Palmately lobed leaf- lobes further pinnately lobed in Carica papaya; H: Palmate leaf of Acer palmatum; I: Unifoliate compound leaf of Citrus medica; J: Palmately trifoliate compound leaf of Oxalis corniculata; K: Palmate compound leaf of Cannabis sativa; L: Pinnate compound leaf of Rosa; M: Peltate orbicular leaf of Tropaeolum majus; N: Bipinnate compound leaf of Leucaena leucocephala; O: Panduraeform leaf of Jatropha panduraefolia; P: Grass leaf with leaf sheath and free lamina of Zea mays; Q: Pitcher leaf of Sarracenia flava. Descriptive Terminology 87

Figure 4.26 Inflorescences. A: Solitary flower of Malvaviscus arboreus; B: Corymbose-raceme of Brassica campestris; C: Corymb of Iberis amara; D: Rhipidium of Solanum nigrum; E: Cyathium of Euphorbia milii; F: Spike of Adhatoda vasica; G: Panicle of spikelets of Zea mays; H: Cob (spike of spikelets) of Zea mays; I: Spike of spikelets of Triticum aestivum; J: Raceme of verticillasters in Salvia splendens; K: Spike of Acanthus spinosus; L: Raceme of Delphinium ajacis; M: Hypanthodium of Ficus religiosa; N: Cymose cluster with spathaceous bracts of Rhoeo discolor; O: Umbel of Astrantia major; P: Radiate capitulum of Viguieria helianthoides; Q: Discoid capitulum of Ageratum houstonianum; R: Spadix of Amorphophalus titanum; S: Cymose umbel of Agapanthus umbellatus. 88 Plant Systematics

Figure 4.27 Fruits. A: Dehisced capsule of Gossypium hirsutum with exposed hairy seeds; B: Capsule of Papaver orientale; C: Dehisced capsule of Chiranthodendron pentadactylon; D: Etaerio of achenes of Anemone occidentalis; E: Double samara of Acer griseum; F: Pod of Dalbergia sissoo; G: Cypsela of Haplopappus macrocephalus; H: Cypsela of Sonchus oleraceous; I: Schizocarp of Abutilon indicum; J: Carcerulus of Salvia splensens; K: Drupe of Juglans nigra; L: Drupe of Prunus persica; M: Pome of Malus pumila; N: Same in Longitudinal section; O: Pod of Clitoria ternatea; P: Hesperidium of Citrus sinensis; Q: Same in Transverse section; R: Berry of Lycopersicon esculentum; S: Same in Transverse section; T: Berry of Ribes menziesii; U: Etaerio of drupes of Rubus nepalensis; V: Pepo of Cucumis sativus in Transverse section; W: Whole pepo; X: Accessory fruit of Fragaria vesca; Y: Siliqua of Brassica campestris; Z: Dehisced capsule of Stellaria media; a: Pod of Leucaena leucocephala; b: Multiple fruit of Liquidam- bar styracifolia; c: Multiple fruit of Arbutus unedo; d: Balausta of Punica granatum. Descriptive Terminology 89

Figure 4.28 Floral diagrams of some representative members of major families. A: Brassica campestris (Brassicaceae); B: Stellaria media (Caryophyllaceae); C: Hibiscus rosa-sinensis (Malvaceae); D: Lathyrus odoratus (Fabaceae-Faboideae); E: Acacia nilotica (Fabaceae- Mimosoideae); F: Foeniculum vulgare (Apiaceae); G: Ray floret of Helianthus annuus (Asteraceae); H: Disc floret of H. annuus; I: Calotropis procera (Apocynaceae- Asclepiadoideae); J: Withania somnifera (Solanaceae); K: Ocimum basilicum (Lamiaceae); L: Male flower of Morus alba (Moraceae); M: Female flower of M. alba; N: Narcissus pseudo-narcissus (Amaryllidaceae); O: Avena sativa (Poaceae), floral diagram of spikelet; P: Zea mays (Poaceae), floral diagram of female spikelet; Q: Z. mays, floral diagram of male spikelet. complementary position) the fifth one is the diagram by anthers, each with two anther odd member. It is also to be remembered lobes (shown by a deep fissure) and latter, in that in large majority of dicots (except turn, with two anther sacs (with a less Fabaceae and few others), the odd sepal oc- deeper cleft). The lobes face towards the out- cupies posterior position (of the remaining side in extrorse anthers and towards the four, two form antero-lateral pair, and the ovary in introrse anthers. Epipetalous sta- remaining two the postero-lateral pair). The mens are shown by a line joining the an- different whorls usually alternate each thers with the petals. A few representative other, and accordingly the odd petal occupies types of floral diagram are shown in Figure anterior position, the petals alternate with 4.28. sepals. The stamens accordingly alternate The floral diagram summarizes the infor- with petals and are opposite the sepals. In mation about the presence or absence of flowers with two whorls of stamens, the outer bracts and bracteoles, number, fusion and whorl alternates with petals, whereas the aestivation of sepals and petals (or tepals if inner is opposite the petals (because it al- there are no separate sepals and petals, as ternates with the outer whorl of stamens). shown in Moraceae). The calyx and corolla The stamens are represented in the floral forming bilabiate arrangement are appropri- 90 Plant Systematics ately shown with the number of lobes in up- for the entire cyathium may be drawn, per and lower lip (as seen in Lamiaceae). supplemented by floral diagrams of male and The stamens with united filaments are de- female flowers. In family Poaceae also, it is picted by joining anthers via lines (diadelp- helpful to make a floral diagram for the hous condition in Fabaceae-Faboideae), whole spikelet (shown in Avena sativa), or whereas the united anthers are shown by separate diagrams for male and female physically touching anther margins. In fami- spikelets if the male and female flowers oc- lies with complex floral arrangement such cur in separate inflorescences or at least as the cyathium in Euphorbia, floral diagram separate spikelets (shown in Zea mays). Chapter 5 Process of Identification

Recognizing an unknown plant is an impor- properly prepared, can retain their essen- tant constituent taxonomic activity. A plant tial features for a very long period, proving specimen is identified by comparison with to be immensely useful for future scientific already known herbarium specimens in a studies, including compilation of floras, taxo- herbarium, and by utilizing the available lit- nomic monographs and, in some cases, even erature and comparing the description of the experimental studies, since the seeds of unknown plant with the published descrip- several species can remain viable for many tion/s. Since the bulk of our plant wealth years even in dry herbarium specimens. grows in areas far removed from the centres of botanical research and training, it Fieldwork becomes imperative to collect a large num- The fieldwork of specimen preparation in- ber of specimens on each outing. For proper volves plant collection, pressing and partial description and documentation, these speci- drying of the specimens. The plants are col- mens have to be suitably prepared for incor- lected for various purposes: building new poration and permanent storage in a her- herbaria or enriching older ones, compila- barium. This goes a long way in compiling tion of floras, material for museums and floristic accounts of the different regions of class work, ethnobotanical studies, and in- the world. The availability of the specimens troduction of plants in gardens. In addition, in the herbaria often provides reasonable in- bulk collections are done for trade and drug formation about the abundance or rarity of manufacture. Depending on the purpose, re- a species, and helps in preparing lists of rare sources, proximity of the area and duration or endangered species, and also provides suf- of studies, fieldwork may be undertaken in ficient inputs for efforts towards their con- different ways: servation. Collection trip: Such a trip is of short dura- SPECIMEN PREPARATION tion, usually one or two days, to a nearby A specimen meant for incorporation in a her- place, for brief training in fieldwork, vegeta- barium needs to be carefully collected, tion study and plant collection by groups of pressed, dried, mounted and finally properly students. labelled, so that it can meet the demands of Exploration: This includes repeated visits rigorous taxonomic activity. Specimens, to an area in different seasons, for a period 92 Plant Systematics of a few years, for intensive collection and study, aimed at compilation of floristic accounts. Expedition: Such a visit is undertaken to remote and difficult area, to study the flora and fauna, and usually takes several months. Most of our early information on Hi- malayan flora and fauna has been the result of European and Japanese expeditions. Equipment The equipment for fieldwork may involve a long list, but the items essential for collection include plant press, field notebook, bags, vasculum, pencil, cutter, pruning shears, knife and a digging tool (Figure 5.1). Figure 5.2 Plant press containing pressed specimens. Vasculum placed Plant Press alongside (Photograph courtesy A plant press consists of two wooden, plywood Mr. S. L. Kochhar). or wire mesh planks, each 12 inches X 18 inches (30 cm X 45 cm), between which are camp or the organization, is called the drying press. It is much heavier and has an increased number of corrugated sheets, one alternating each folded blotter containing one folded newspaper. In countries such as India which use thick coarse paper for newsprint, blotters can be dispensed with, in at least subsequent changes, as the paper Figure 5.1 Common implements helpful in collection. A: Trowel; B: Prunning soaks sufficient moisture and serves the shears; C: Knife; D: Pickaxe. purpose of blotters as well. placed corrugated sheets, blotters and news- Field Notebook paper sheets (Figure 5.2). Two straps, chains A field notebook or field diary is an impor- or belts are used to tighten the press. Cor- tant item for a collector. A well-designed field rugated sheets or ventilators are made of notebook (Figure 5.3) has numbered sheets cardboard, and help ventilation and the con- with printed proforma for entering field notes sequent drying of specimens. The ducts of such as scientific name, family, vernacular the corrugated sheet run across and not name, locality, altitude, date of collection and lengthwise to in order to afford shorter dis- for recording any additional data collected in tance and larger number of ducts. the field. The multiple detachable slips at The plant press carried in the field, and the lower end of the sheet, separated by per- called a field press is light weight and forated lines and bearing the serial number generally has one corrugated sheet alternat- of the sheet, can be used as tags for mul- ing with one folded blotter containing ten tiple specimens of a species collected from newspaper sheets, one meant for each a site, and serve as ready reference to the specimen. information recorded in the field notebook. The plant press used for subsequent press- The number also serves as the collection ing and drying of specimens, kept at the base number for the collector. Process of Identification 93 Vasculum Collection A vasculum is a metallic box with a tightly- The specimen collected should be as com- fitted lid and a shoulder sling. It is used to plete as possible. Herbs, very small shrubs, store specimens temporarily before press- as far as possible, should be collected coming, and also to store bulky parts and fruits. plete, in flowering condition, along with It is generally painted white to deflect heat leaves and roots. Trees and shrubs should be collected with both vegetative and flowering shoots, to enable the representation of Department of Botany both leaves and flowers. All information concerning the plant should be recorded in the University of Kashmir field notebook and a tag from the sheet at- Srinagar- 190006 tached to the concerned specimen. It is advisable to collect a few specimens of each species from the site, to ensure that reserve specimens are available if one or more get Date: 14- 3- 1970 No. 1068 destroyed, and also to ensure that duplicates can be deposited in different herbaria, when finally mounted on sheets. Name: Iris ensata Local Name: KRISHM Family: Iridaceae Pressing Locality: Harwan, Kashmir The specimens should be placed in the field Altitude: 1900 m press at the first opportunity, either directly Habitat: Open grassland meadow after collection, or sometimes after a tem- Collector: Gurcharan Singh porary storage in a vasculum or a polythene Determinavit: Self bag. A specimen shorter than 15 inches (38 Notes: Perennial herb, forming isolated patches, flowers light blue.

a b c d

No. 1068 No. 1068 No. 1068 Figure 5.4 a-c: Different methods of folding longer herbaceous plants; d, use of flexostat slips for holding plants in folded condition. Note that the tip of the plant (arrow) would al- Figure 5.3: A sheet from field notebook with ways be erect for convenient study relevant entries. of this important portion with leaves and flowers. and affords easy detection when left in the field. Being bulky, the vasculum is com- cm) should be kept directly in the folded monly substituted by a polythene bag, newspaper after loosely spreading the leaves which is almost weightless. A number of and branches. Herbs, which are generally polythene bags can be carried for easy stor- collected along with the roots, if longer than age, as these can be readily made airtight 15 inches, can be folded in the form of a V, using a rubber band and, as such, the plants N or W (Figure 5.4, a-c), always ensuring that retain their freshness for many hours. the terminal part of the plant with leaves, 94 Plant Systematics flowers and fruits, is erect, and when finally Such specimens are collected in bags and mounted, the specimens can be easily stud- made to float in a tray filled with water, at ied, without having to invert the herbarium the bottom of which a white sheet of paper sheet. Specimens of grasses and some other is placed. The paper is lifted gently, carry- groups, which show considerable elasticity, ing the specimen along and placed in a blot- are difficult to hold in a folded condition. ter and pressed. As the slender water plant These specimens can be managed by using sticks to the paper, the sheet along with the flexostat (a strip of stiff paper or card with specimen is shifted from one blotter to an- 2.5 cm long slit). One flexostat inserted at other during the process of drying, and fi- each corner (Figure 5.4 d) holds the speci- nally pasted on the herbarium sheet as such. men in place. Succulents and cacti have a large amount To press bulky fruits, these may be thinly of proliferated parenchyma storing water sliced. Large leaves can be trimmed to re- and, unless special care is taken, these tain any lateral half. It is useful to invert some plants readily rot and fungal infection sets leaves so that the under surface of the leaves in. Such plants are handled by giving slits can also be studied from a pressed leaf. on thick organs and scooping out the succulent tissue or, alternately, salt is sprinkled Handling special groups on the slits to drive out the moisture. The plants may also be killed by pretreatment A few groups of plants such as conifers, wa- with ethyl alcohol or formaldehyde. ter plants, succulents and mucilaginous Mucilaginous plants such as members plants pose problems during collection and of the family Malvaceae stick to the blotters need special methods. and are difficult to process. These plants Conifers, although easy to collect and should be placed between waxed or tissue press, pose problems during drying. The tis- paper or else folds of muslin cloth. Only the sues of conifers remain living for a long time blotter should be changed every time the and progressive desiccation during pressing press is opened and the specimen separated and drying initiates an abscission layer at from the tissue paper or muslin only when the base of leaves and sporophylls. As such a fully dry. dry twig readily disintegrates, losing its leaves Aroids and bulbous plants continue to grow with a slight touch, a problem occasionally even in a press even after they have pre- encountered in Abies, Picea, Cedrus, and sev- sumably been properly pressed and dried. eral other genera. Before pressing, such twigs These should be killed with ethyl alcohol and should be immersed in boiling water for one formaldehyde prior to pressing. minute, a pretreatment that kills the tissues and prevents the abscission formation dur- Drying ing drying. Page (1979) has suggested pretreatment method involving immersion in Drying of pressed plant specimens is a slow 70% ethyl alcohol for 10 minutes, followed by process if no artificial heat is used. immersion in 50% aqueous glycerine solution for four days. Since the pretreatment re- Natural Drying moves the bloom and waxes, and results in a Natural drying of specimens is a slow pro- slight colour change, an untreated portion of cess, which may take up to one month for the plant should also be preserved, kept in a complete drying. The plants, freshly col- small pouch and attached to the herbarium lected, are placed in a press without corru- sheet along with the pretreated specimen, gated sheets and the press is locked for 24 for reference. hours. During this sweating period, plants Water plants, especially with submerged lose some moisture, become flaccid and can leaves, readily collapse due to the absence be easily rearranged. The folded sheet con- of cuticle and are difficult to press normally. taining the specimen is lifted and placed in Process of Identification 95 a fresh dry folded blotter. In countries using drying. This solar drier, with practically no thick coarse newsprint, changing the news- operational cost, should provide a right step paper is also necessary, and the plant should towards energy conservation. be carefully transferred from one newspa- The rapid drying of specimens using arti- per to another. The use of a blotter in such ficial heat has, however, inherent limita- a case can be dispensed with, especially af- tions of rendering plants brittle, loss of bloom ter one or two changes. The change of blot- and some colour change in leaves. ters or newspaper sheets is repeated every In arid regions, plants can be dried par- few days, increasing the interval between tially during travel, by placing the press hori- the changes successively until the speci- zontally on the luggage rack of the vehicle, mens are fully dry. The whole process of dry- with the corrugate ducts facing front, forc- ing may take about 10 days to one month, ing the dry wind through the corrugates as depending on the specimens and the climate the vehicle moves forward. of the area. Specimens pressed and dried are next mounted on herbarium sheets, and properly Drying With Artificial Heat labelled before these can be incorporated in Drying with the help of artificial heat takes a herbarium. 12 hours to two days. The specimens, after the initial sweating period in the field press, HERBARIUM METHODS are transferred to a drying press, with an A herbarium is a collection of pressed and ample number of corrugated sheets, usually dried plant specimens, mounted on sheets one alternating every folded blotter contain- bearing a label, arranged according to a ing one specimen. The press is kept in a sequence and available for reference or drier, a cabinet in which a kerosene lamp study. In practice, it is a name given to a or electric bulb warms the air, drying the place owned by an institution, which main- specimens by movement through the cor- tains this orderly collection of plant speci- rugates. Use of a hot air blower in the cabi- mens. Most of the well-known herbaria net speeds up circulation of the hot air and, of the world made their beginning from consequently, faster drying is achieved. botanical gardens. Sinnott (1983) developed a solar powered drier capable of drying 100 specimens on a sunny day, and attaining a temperature of Botanical gardens up to 600 Celsius in the centre of the press. Although gardens existed in ancient China, The unit consists of a flat plate collector and India, Egypt and Mesopotamia, these gar- a drying box to hold the press. The collector dens were not botanical gardens in the true is composed of a wooden frame, a blackened sense. They existed for growing food plants, aluminium absorber plate, insulation and a herbs, and ornamentals for aesthetic, reli- glass or Plexiglas glazing to retain and chan- gious and status reasons. The famous ‘hang- nel heat into the drying box. One-inch space ing gardens’ of Babylon in Mesopotamia is a is provided between the glazing and the ab- typical example. The first garden for the pur- sorber plate. The air enters the collector at pose of science and education was main- the open bottom of the collector panel, is tained by Theophrastus in his Lyceum at heated by conduction from the absorber, Athens, probably bequeathed to him by his rises by convection into the drying box, teacher, Aristotle. Credit for establishment moves through the corrugates and finally of the first modern botanical garden belongs exits from the uncovered top of the drying to Luca Ghini (ca 1490-1556), a professor of box, taking with it moisture from the plant botany who developed it at Pisa, Italy in 1544. specimens. Drying is accomplished in a These were followed by botanical gardens at single day, occasionally two days for complete Padua and Florence in 1545. 96 Plant Systematics Roles of a Botanical Garden sity, as also in conserving rare and endangered species. The Proceedings Botanical gardens have been instrumental of the Symposium on Threatened and in motivating several well-known authors to Endangered species, sponsored by New develop their own systems of classification York Botanical Garden in 1976, pub- while trying to fit the plants grown in the lished as Extinction is Forever, and the garden, into some previous system of clas- conference on practical role of botani- sification, e.g. Linnaeus, while working at cal gardens in conservation of rare and Uppsala and Bernard de Jussieu at threatened species sponsored by the Versailles. Although the majority of the bo- Royal Botanical Garden, Kew and pub- tanical gardens house plant species which lished as Survival and Extinction, are the climate of the area can support, several among the major examples of the role well-known botanical gardens have con- of botanical gardens in conservation. trolled enclosures to support specific plants. 6. Seed exchange: More than 500 botani- Tropical gardens often need indoor growing cal gardens across the world operate space, screen houses for most plants and an informal seed exchange scheme, glasshouses for the majority of cacti and offering annual lists of available succulents in wet tropical and temperate species and a free exchange of seeds. gardens. Glasshouses in temperate gardens 7. Herbarium and library: Several often require winter heating. Botanical gar- major botanical gardens of the world dens play the following important roles: have herbaria and libraries as an in- 1. Aesthetic appeal: Botanical gardens tegral part of their facilities, and offer have an aesthetic appeal and attract taxonomic material for research at a a large number of visitors for observa- single venue. tion of general plant diversity as also 8. Public services: Botanical gardens the curious plants, as for example, the provide information to the general Great Banyan Tree (Ficus public on identification of native and benghalensis) in the Indian Botanical exotic species, methods of propagation Garden at Kolkotta. and also supply plant material through 2. Material for botanical research: Bo- sale or exchange. tanical gardens generally have a wide range of species growing together and Major Botanical Gardens offer ready material for botanical research, which can go a long way in Thousands of botanical gardens located understanding taxonomic affinities. worldwide are maintained by various insti- 3. On-site teaching: Collection of plants tutes. Of these, nearly 800 important gar- is often displayed according to fami- dens are documented in the International Di- lies, genera or habitats, and can be rectory of Botanical Gardens published by used for self-instruction or demonstra- Henderson (1983). A botanical garden today tion purposes. is an area set aside and maintained by an 4. Integrated research projects: Botani- organization for growing various groups of cal gardens with rich living material plants for study, aesthetic, conservation, can support broad-based research economic, educational, recreational and sci- projects which can integrate informa- entific purposes. Some of the major botani- tion from such diverse fields as cal gardens are discussed below: anatomy, embryology, phytochemistry, cytology, physiology and ecology. New York Botanical Garden, USA: 5. Conservation: Botanical gardens are This garden was christened the New York now gaining increased importance for Botanical Garden in 1891, when the Torrey their role in conserving genetic diver- Botanical Club adopted its foundation as a Process of Identification 97 corporation chartered by the State. David tanical garden and botanical research and Hosak founded the garden in 1801 as Algin resource centre in the world. The garden was Botanic Garden. developed in the 1600s by Kew House owned Professor N. L. Britton, the most produc- by Richard Bennet. The widow of the Prince tive taxonomist of his time, directed the idea of Wales commissioned the garden in 1759 and William Aiton took over as its superin- tendent. Sir Joseph Banks introduced large collections from different parts of the world. In 1841, the management of the garden was transferred from the crown to the parliament and Sir William Hooker became its first official director. He was mainly responsible for the advancement of the garden, enlarging it from a mere 6 ha. to more than 100 ha. and building a palm house. Sir J. D. Hooker, who succeeded his father as its Director, added rhododendrons, and also authored several important publications. John Figure 5.5 Haupt conservatory complex of New Hutchinson worked and developed his fa- York Botanical Garden. mous system of classification here. of advancement of botanical knowledge The garden (Figure 5.6) has since grown through research at this botanical garden. into a premier Research and Educational The garden (Figure 5.5) today covers 100 ha. in the heart of New York City along the Bronx River. In addition 778 ha. Mary Flager Cary Arboretum at Millbrook has been added to the jurisdiction of the garden. There are 15,000 species distributed in the demonstration gardens, Montgomery conifer collection, Stout day lily garden, Havemeyer lilac collection, Rhododendron and Azalea collection, Everett rock garden, herb garden, rose garden, arboretum and conservatory complex. The garden has a systematic arrangement of trees and shrubs that make it a place of interest for the general public as well as botanists and horticulturists. The garden plays a major role in conservation of rare and endangered species. The garden has a well-maintained herbarium of over 5 million specimens from all over the world, but mainly Figure 5.6 Princess of Wales House at Royal from the New World. The library houses over Botanic Gardens Kew. 200,000 volumes and over 500,000 items (including pamphlets, photographs, letters, Institute with excellent herbarium and etc.). It also maintains a huge botanical library. Originally the garden covered an area database. of 120 ha. The outstation of the Royal Botanic Gardens, Kew at Wakehurst Place near Royal Botanic Gardens, Kew: More Ardingly in West Sussex is a rural estate of popularly known as ‘Kew Gardens’, this his- 202 ha. with an Elizabethan mansion, and torical garden is undoubtedly the finest bo- was acquired in 1965. The Royal Botanic 98 Plant Systematics

Gardens Kew has directed and financed its mature temperate trees. Tropical plants are development so that Wakehurst Place now maintained indoors, including Aroid House, makes a vital contribution in maintaining Palm House, Filmy Fern House etc. Several the international reputation of the Living interesting plants such as Victoria amazonica Collections Department (LCD). In particular from South America and Welwitschia the practical in-situ conservation policies mirabilis from Angola are also growing here. pursued, and the rich and diverse plant col- Kew Herbarium, undoubtedly the most fa- lections, which are maintained, add greatly mous herbarium of the world, maintains over to the LCD’s activities. The environmental 6 million specimens of vascular plants and conditions of the High Weald of Sussex con- fungi from every country in the world. There trast with those of Kew by offering varied to- are over 275,000 type specimens as well. pography, higher rainfall and more diverse The library at Kew is very extensive with and moisture retentive soils. These com- over 750,000 books and journals a resource bine together to provide a range of microcli- for all Kew’s research work. Kew Bulletin and mates, which make possible the successful Index Kewensis are its two continuing pre- cultivation of a great diversity of plants, mier publications. many of which do not thrive at Kew. Kew maintains databases on plant names, There are substantive differences in the taxonomic literature, economic botany, layout and content of the collections at plants for arid lands and on plant groups of Wakehurst Place which act to complement special economic and conservation value. those at Kew. In particular the botanical Kew also makes about 10, 000 identifications collections are laid out in a floristic manner a year through its Herbarium service and reflecting the way that temperate plant provides specialist advice on taxonomy and communities have evolved. The botanical nomenclature in difficult cases. Kew is in- collections are supported by extensive volved in major biodiversity research ornamental displays exploiting the wide programmes in many parts of the world, in- range of available biotopes and acting as pri- cluding tropical and West Asia, SE Asia, Af- mary visitor attractants. A final element of rica, Madagascar, South America, and the the woodland cover is forestry plots compris- Pacific and Indian Oceanic islands. The Her- ing high forest and Christmas tree planta- barium runs an international Diploma tions. Jodrell Laboratory at Kew has estab- Course in Herbarium Techniques. The Gen- lished itself as the world centre in the study eral Catalogue now contains over 122,000 of plant anatomy, cytogenetics and plant records and is available throughout RBG Kew biochemistry. on the network. The Royal Botanic Gardens’ Living collections at Kew and Wakehurst Place are a mul- Missouri Botanical Garden, USA: tilevel encyclopaedic reference collection re- Considered one of the top three botanical flecting global plant diversity and providing gardens in the world, the Missouri Botani- a reference source which serves all the as- cal Garden is a National Historical Landmark pects of botanical and horticultural science and a centre for botanical research, educa- within Kew, Great Britain and throughout tion and horticultural display. The garden the world. It is probably the largest and most was founded by an Englishman Henry Shaw diverse living collection in the world. The and opened to public in 1859 with active help two sites provide quite different environ- from Asa Gray and Sir William Hooker and ments, allowing the development of two dif- Enelmann. Today, the garden covers 79 fering but complementary collections. The acres and operates the world’s most active living collections at Kew are most diverse tropical botany research programme. with 351 families, 5465 genera and over Under the leadership of Dr Peter Raven, 28,000 species growing successfully. The ar- its Director, the Garden plays a leading role boretum covers the greatest area with large in strategies of conservation and sustain- Process of Identification 99 able living. The garden is known for its The Missouri Botanic Garden is one of the Climatron® conservatory, a geodesic green- world’s leading research centres for botani- house dome with climatic control, support- cal exploration and research, with nearly 25 ing a vibrant tropical rainforest, under a 0.5 major flora projects. The information is acre roof (Figure 5.7). It also has a Japanese shared via website TROPICOS, the world’s Garden (Seiwa-en) covering 14 acres, the largest database, containing more than largest Japanese strolling Garden in North 920,000 scientific plant names and over 1,800,000 specimen records. The garden’s highly regarded education programme seeks to improve science instruction in the St. Louis region, reaching more than 137,000 students each year. With more than 5.3 million specimens (mosses, ferns, gymnosperms, and angiosperms), the herbarium ranks second in the USA and 6th in the world. It has collections dating back to mid 1700s. The herbarium specializes in having collections of G. Boehmer, Joseph Banks, D. Solander (who accompanied Captain Jamers Cook in his first voyage around the world), and Charles Darwin. During the last five years, the herbarium has added an average of 120,000 mounted specimens per year to its collection. In addition to the many gift specimens sent to the specialists, this herbarium loans an average of 34,000 specimens annually, and borrows about 27,000 specimens. The herbarium staff also provides identifications from their area of expertise. The pace of development of the herbarium can be judged from the fact from being number 13th in the world in 1990 (Woodland, 1991), the herbarium today has risen to number six. The reference library of the garden has over 220,000 volumes, including many rare Figure 5.7 Climatron® at the Missouri Botani- books. cal Garden, a Geodesic dome with Among its major research activities in- Climatic control and supporting clude Flora of North America project, five vol- tropical rainforest. (Photograph by umes having already been published, cov- Jack Jennings/Courtesy the Mis- souri Botanical Garden). ering the plants of USA, Canada and Greenland. The garden also coordinates Flora of China project, 25 volumes being planned, America, with a proud collection of to be completed in 15 years starting from Hamerocallis, Iris, roses, Hosta, and several 1994. economic plants (Figure 5.8). There are also Chinese, English German and Victorian Gar- Pisa Botanical Garden, Italy: The dens. Over 4,000 trees thrive on the Pisa Garden, developed by Luca Ghini in grounds, including some rare and unusual 1544, is credited as the first modern botani- varieties. cal garden. The garden was known for the 100 Plant Systematics

The botanical garden today comprises an area of 126 acres. About 20,000 different species of plants are cultivated here. The section on plant geography covering 39 acres, one of the biggest of its kind in the world, depicts the whole of the Northern Hemi- sphere. The arboretum and taxonomy section covers 42 acres and includes around 1800 species of trees and shrubs and nearly 1000 species of herbaceous plants, the latter arranged according to the classification system of Adolph Engler. The botanical mu- Figure 5.8 Japanese Garden at the Missouri seum specializes in the display of botanical Botanical Garden. (Photograph by exhibits, being the only museum of its kind Jack Jennings/Courtesy the in Central Europe with models of various Missouri Botanical Garden). life-forms. The main tropical greenhouse (Figure finest specimens of Aesculus hippocastanum, 5.9), with its length of 60 m and height of Magnolia grandiflora, and several other species. Though the garden does not exist today, the records of its design demonstrate geometric outlay of plantings that are characteristic of several continental gardens even today.

Padua Botanical Garden, Italy: The garden is a contemporary of Pisa Botanical Garden, established in 1545. The specialty of this garden is the elegance and Halian taste, which has been wedded to the service of science. The elegance and beauty of Padua Botanical Garden are equalled by Kew Gardens only.

Berlin Botanic garden and Museum, Berlin-Dahlem: The Berlin Botanic Gar- den was set up in 1679 when the Grand Duke of Berlin gave instructions to open an Figure 5.9 Tropical greenhouse of the Berlin agricultural model garden in Schoneberg, a Botanic Garden at Dahlem. village near Berlin. Due to lack of space, it was later relocated to Dahlem. The garden 23 m, is one of the largest in the world, fea- developed largely due to the efforts of C. L. turing tall trees with epiphytes, rich ground Wildenow, who built it up from an old run- vegetation and lianas, which give an idea of down royal garden. Adolph Engler and L. the vast variety of tropical vegetation. Diels, who were its subsequent directors, improved its quality and content. Much of Cambridge University Botanical the garden was destroyed during World War Garden: The Cambridge University II. It was rebuilt largely through the efforts Botanical Garden was founded in 1762 as a of Robert Pilger, its then director. small garden on 5 acres of land in the Process of Identification 101 centre of Cambridge. It was moved to the Although the herbarium technique was a present location in 1831 when Prof. J.S. well-known botanical practice at the time of Henslow established it on newly-acquired Linnaeus, he departed from the convention land of the University covering 40 acres. The of mounting and binding the specimens into garden is artistically landscaped with sys- volumes. He mounted specimens on single tematic plantings, winter-hardy trails, an al- sheets, storing them horizontally, a practice pine garden and a chronological bed. The followed even today. latter is in the form of a narrow bed (300 x 7 From isolated personal collections, her- feet) divided into 24 sections, each contain- baria have grown into large institutions of ing plants introduced during a 20-year pe- national and international stature with mil- riod. Tropical houses are one of the major lions of specimens from different parts of the attractions of the garden and contain palms world. Index Herbariorum, edited by Patricia and other tropical plants. Holmgren (Figure 5.10) (Holmgren, Holmgren, & Barnett, 1990) lists the world’s Herbaria important herbaria. Each herbarium is identified by an abbreviation that is valuable in It was again Luca Ghini who initiated the locating the type specimens of various spe- art of herbarium making by pressing and cies. The major herbaria of the world with sewing specimens on sheets of paper. This approximate number of specimens in the or- art was disseminated throughout Europe by der of importance are listed in the table 5.1. his students who mounted sheets and bound In India Central National Herbarium (CAL) them into book volumes. of the Indian Botanic Garden, Botanical Sur- vey of India, Kolkotta has over 1.3 million specimens. The herbarium of Forest Re- search Institute, Dehradun (DD) and National Botanical Research Institute, Lucknow (LUCK) are other major herbaria in India, with collections from all over the world.

Roles of a Herbarium From a safe place for storing pressed specimens, especially type material, herbaria have gone a long way in becoming major centres of taxonomic research. Additionally, herbaria also form an important link for research in other fields of study. The classification of the world flora is primarily based on herbarium material and associated literature. More recently, the herbaria have gained importance for sources of information on endangered species and are of primary interest to conservation groups. The major roles played by a herbarium include: Figure 5.10 Patricia K. Holmgren Director 1. Repository of plant specimens: Pri- Emerita of the Herbarium, New York Botanical Garden, the edi- mary role of a herbarium is to store tor of Index Herbariorum and 2 dried plant specimens, safeguard volumes of Intermountain Flora. these against loss and destruction by (Courtesy New York Botanical insects, and make them available for Garden, Bronx). study. 102 Plant Systematics

Table 5.1 Major herbaria of the world, listed in the order of number of specimens.

Herbarium Abbr. No. of specimens 1. Museum National d’Histoire Naturelle (Museum of Natural History), Paris, France* P, PC 9,377,300 2. New York Botanical Garden, New York, USA NY 7,000,000 3. Komarov Botanic Institute, Saint Petersburg (Formerly Leningrad), Russia. LE 7,000,000

4. Royal Botanic Gardens, Kew, Surrey, UK K 7,000,000 5. Conservatoire et Jardin Botaniques (Conservatory and Botanical Garden), Geneva, Switzerland G 6,000,000 6. Missouri Botanical Garden, Saint Louis, Missouri, USA MO 6,000,000 7. British Museum of Natural History, London, UK BM 5,200,000 8. Combined Herbaria, Harvard University, A, FH, GH, Cambridge, Massachusetts, USA** ECON, AMES 5,000,500 9. Naturhistorika Riksmuseet, Stockholm, Sweden S 4,400,000 10. US National Herbarium (Smithsonian), Washington, USA US 4,340,000 Information updated on 17 February, 2009 from Institutional websites. * Specimens are located at Laboratoire de Phanérogamie (P) and Laboratoire de Cryptogamie (PC). **Consists of Arnold Arboretum (A), Farlow Herbarium (FH), Gray’s Herbarium (GH), The Economic Herbarium of Oakes Ames (ECON) and Oaks Ames Orchid Herbarium (AMES).

2. Safe custody of type specimens: Type 5. Identification of specimens: The specimens are the principal proof of majority of herbaria have a wide-rang- the existence of a species or an ing collection of specimens and offer infraspecific taxon. These are kept in facilities for on-site identification or safe custody, often in rooms with having the specimens sent to the restricted access, in several major herbarium identified by experts. Re- herbaria. searchers can personally identify their 3. Compilation of Floras, Manuals and collection by comparison with the duly Monographs: Herbarium specimens identified herbarium specimens. are the ‘original documents’ upon 6. Information on geographical which the knowledge of taxonomy, distribution: Major herbaria have evolution and plant distribution rests. collections from different parts of the Floras, manuals and monographs are world and, thus, scrutiny of the speci- largely based on herbarium resources. mens can provide information on the 4. Training in herbarium methods: geographical distribution of a taxon. Many herbaria carry facilities for 7. Preservation of voucher specimens: training graduates and undergradu- Voucher specimens preserved in ates in herbarium practices, organiz- various herbaria provide an index of ing field trips and even expeditions to specimens on which a chromosomal, remote areas. phytochemical, ultrastructural, Process of Identification 103

micromorphological or any specialized paper envelops called fragment packets are study has been undertaken. In the often attached to the herbarium sheet to case of a contradictory or doubtful hold seeds, extra flowers or loose plant parts. report, the voucher specimens can be critically examined in order to arrive Labelling at a more satisfactory conclusion. An herbarium label is an essential part of a permanent plant specimen. It primarily con- Mounting of Specimens tains the information recorded in the field Pressed and dried specimens are finally diary (Field notebook) at the time of collec- mounted on herbarium sheets. A standard tion, as also the results of any subsequent herbarium sheet is 29 by 41.5 cm (11½ by identification process. The label is located 16½ inches), made of thick handmade pa- on the lower right corner of the herbarium per or a card sheet. The sheet should be rela- sheet (Figure 5.11), with the necessary in- tively stiff to prevent damage during han- formation recorded on the pre-printed pro- dling of specimens. It should have a high rag forma, printed directly on the sheet or on content (preferable 100 per cent) with fibres the paper slips which are pasted on the running lengthwise. sheets. It is ideal to type the information. If The specimens are attached to the sheet handwritten, it should be in permanent ink. in a number of ways. Many older specimens Ball pens should never be used, as the ink in the herbaria are frequently found to have often spreads after some years. been sewn on the sheets. Use of adhesive There is no agreement as to the size of a linen, paper or cellophane strips is an easier herbarium label, the recommendations be- and faster method of fixing specimens. Archer ing as diverse as 2¾ by 4¼ inches (Jones method involves the use of small strips of liq- and Luchsinger, 1986) and 4 by 6 inches uid plastic extruded from a container with a (Woodland, 1991). The information commonly narrow nozzle. Most of the contemporary recorded on the herbarium label includes: specimens are fixed using liquid paste or glue Name of the institution in one of the two ways, however: Scientific name (i) Paste or glue is applied to the Common or vernacular name backside (if distinguishable) of the Family specimen, which is later pressed onto Locality the mounting sheet and allowed to dry Date of collection in the pressed condition for a few Collection number hours. This method is slower but more Name of the collector economical. Habit and habitat including field notes (ii) Paste or glue is smeared on a glass or An expert visiting a herbarium may want plastic sheet, the specimen placed on to correct an identification or record a name the sheet and the glued specimen change. Such correction is never done on transferred to a mounting sheet. This the original label but on a small annotation method is more efficient but expensive. label or determination label, usually 2 by The use of methylcellulose as adhesive 11 cm and appended left of the original la- mixed in a solution of 40% alcohol, instead bel. This label, in addition to the correction, of pure water was suggested by Tillet (1989) records the name of the person and the date for fixing herbarium specimens. It decreases on which the change was recorded. Such the drying time and also prevents growth of information is useful, especially when more micro-organisms. The stem and bulky parts than one annotation label is appended to a may often require adhesive strips or even herbarium sheet. The last label is likely to sewing for secure fixing of specimens. Small be the correct one. 104 Plant Systematics

Voucher herbarium specimens of a most commonwealth countries) or Engler research study often have authentic infor- and Prantl (Europe and North America). Many mation about the specimens recorded in the herbaria of the latter category follow the form of a voucher label. number code of families and genera given by Dalla Torre and Harms (1900-1907). Filing of Specimens The specimens belonging to a species are placed in a folder made of thin strong paper, Mounted, labelled and treated (to kill insect termed species cover. The species covers pests) specimens are finally incorporated in belonging to a particular genus are often a herbarium, where they are properly stored arranged alphabetically and placed inside a genus cover, a heavy manilla folder made of a thicker paper. More than one genus cover may be used if the number of species are more, or if the specimens are to be arranged geographically, and often differently coloured for different geographical regions. The genus covers of a family are arranged according to the system of classification being followed. The demarcation between the two families (last genus of a family and first genus of the next family) is done using a sheet of paper with a front-hanging label, indicating the name of the next family. The folders are stacked in pigeonholes of the herbarium cases and the arrangement is suitable for shifting of folders as the number of specimens increase with time. Unknown specimens are kept in separate folders marked dubia, placed towards the end of a genus (when the genus is identified) or a family (when the family is identified but not the genus), as the case may be, so that an expert can examine them conveniently. Standard herbarium cases are insect- and dust-proof with two or more tiers of pigeonholes, each 19 in. deep, 13 in. wide and 8 in. high (Figure 5.12). Type specimens are usually kept separately in distinct folders or often in separate Figure 5.11 A sample herbarium sheet with herbarium cases, sometimes even separate mounted specimen and a label. rooms, for better care and safety. A herbarium commonly maintains an and looked after. Small herbaria arrange index register in which all the genera in specimens alphabetically according to the herbarium are listed alphabetically and family, genus and species. Larger herbaria, against each genus is indicated family however, follow a particular system of number and the genus number, the two help classification. Most herbaria usually follow in convenient incorporation and retrieval of Bentham and Hooker (British herbaria and specimens in a herbarium. Process of Identification 105 Pest control (c) The embryo in the seed gets killed, thus destroying a Herbarium specimens are generally suffi- valuable source of experi- ciently dry, and as such not attacked by mental research, as seeds bacteria or fungi. They are, however, easily from herbarium specimens attacked by pests such as silverfish, are often used for growing new plants for research projects. 2. Use of repellents: Chemicals with an offensive odour or taste are kept in herbarium cases to keep pests away from specimens. Naphthalene and Paradi-chlorobenzene (PDB) are commonly used repellents, usually pow- dered and put in small muslin bags kept in pigeonholes. PDB is more toxic Figure 5.12 Herbarium cabinet with filed speci- and as such prolonged exposure of mens used in New York Botanical Garden Herbarium (Photograph workers should be avoided. For people courtesy New York Botanical working 8 hours a day in a 5 day per Garden). week schedule, the upper exposure level for naphthalene is 75 PPM and dermestid beetles (cigarette beetle, for PDB 10 PPM. drugstore beetle and black carpet beetle). 3. Fumigation: In spite of pre-treatment Control measures include: of specimens and the use of repel- 1. Treating incoming specimens: lents, fumigation is necessary for Specimens have to be pest free before proper herbarium management. Fu- they can be incorporated into a her- migation involves exposing specimens barium. This is achieved in three to the vapours of certain volatile toxic ways: substances. A mixture of ethylene (i) Heating at temperatures up to dichloride (3 parts) and carbon tetra- 60oC for 4-8 hours in a heating chloride (1 part) was once commonly cabinet. The method is effective used for fumigation. Ethylene but the specimens become dichloride is explosive without carbon brittle. tetrachloride, but the latter is (ii) Deep-freezers have now replaced extremely toxic to humans, causing heating cabinets in most her- liver damage, and as such the use of baria of the world. A temperature this fumigant has been banned. Some of –20 to –60oC is maintained in herbaria also use Ethylene bromide, most herbaria. Ethylene oxide, Lauryl pentachloro- (iii) Microwave ovens have been used phenate (Mystox), Methyl bromide by some herbaria, but as indi- (often used synergistic with carbon cated by Hill (1983), the use of mi- dioxide) or Malathion for fumigation, crowave ovens has some serious but these are also toxic for humans. shortcomings including: Integrated Pest Management pro- (a) Stems containing moisture gram (IPMP) for safer herbarium use burst due to sudden vapori- emphasises prevention of insect en- zation of the water inside. tering the herbarium, rather than (b) Metal clips, staples on the relying on toxic chemicals to kill them sheets get overheated and once inside the herbarium. It also may char the sheet. encourages the use of: 106 Plant Systematics

a) Deep freezing not only to treat in- moth, cigarette beetles and ware- coming specimens but also to kill house beetles. insects in the herbarium. The e) Insect electrocuters are useful for bundles of specimens are placed detecting and controlling flying in plastic bag, the bag sealed, and insects. These emit ultraviolet the bundle placed in freezer for light that attracts flying insects several days. The bag (sealed) is particularly flies and moths. next left at room temperature for Where fumigation is essential 7-10 days to allow any eggs to use of safer fumigants like hatch and then refrozen for 3-4 Pyrethrin, sulphuryl fluoride days. (Vikane), dichlorovos (no pest, b) Anoxic treatment, involves the Vapona resin strips or Raid strips usage of bag impermeable to oxy- are suitable for herbarium cases; gen and containing specimens one-third of a strip is placed in and a oxygen scavanger. The pest each herbarium case for seven to is killed by depriving it of oxygen. ten days twice a year.), carbon dioxide and cyanogen (often used synergistic with carbon dioxide). Dowfume-75 has been cleared by the Environmental Protection Agency for use in herbaria. Virtual Herbarium Virtual herbarium is a database of consisting of images of Herbarium specimens and the supporting text, available over the internet. It is a huge advancement in herbarium use and design, coupling physical specimens directly with internet and integrating complete specimen data, with Figure 5.13 The researchers comparing speci- resources or information generation and mens inside the herbarium at the retrieval. Although a virtual herbarium Missouri Botanical Garden. cannot exist without a physical herbarium, (Photograph by Jack Jennings/ it enjoys several advantages over a physical Courtesy the Missouri Botanical Garden.) herbarium: 1. Images being available electronically, c) Small sticky trap placed in hidden user may not have to handle physical areas of the herbarium and her- specimens, thus reducing the damage barium cases to trap insects. Such substantially. traps should be checked regularly 2. Whereas it may take months to sort for insects trapped. out specimens of a collector or a coun- d) Pheromone traps involve the use try in a physical herbarium, the same of natural scents which insects can be done done in few seconds use to communicate with each through a virtual herbarium. other. Certain insects are at- 3. Virtual herbarium greatly increases tracted to these traps from the the user interaction. Only few hun- surrounding area and are very ef- dred visitors may visit a physical fective. Specific traps are available herbarium in a month, but during the for drug store beetles, Indian meal same period thousands of users can Process of Identification 107

access the virtual herbarium sitting Fairchild Tropical Garden Virtual in the comfort of their offices. Herbarium (eFTG) has record of more than 4. Physical herbarium usually stores only 100,000 specimens, more than 200,000 specimens, and the user has to spend photographs (including data labels). There considerable time in the library to are more than 20,000 high resolution collect relevant information. A virtual photographs of specimens, that can be zoomed herbarium on the other hand provides in or out of the browser. Nearly 60, 000 information on descriptive details, records are are searchable online by family, geographical distribution, photographs, genus, collector and other fields. eFTG is the illustrations, manuscripts, published first truly Virtual Herbarium as Web portal work, microscopic preparations, gene of the herbarium allows simultaneous search sequences and nomenclature through throughVirtual Herbaria of FTG (Fairchild hyperlinks. Tropical Garden), FLAS (Florida Museum of 5. Physical herbarium can offer only own Natural History), MO (TROPICOS-Missouri specimens for study, whereas portals Botanical Garden), NY Cassia- New York of major virtual herbaria offer facility Botanical Garden), S (LinneanHerbarium, of searching several virtual herbaria Swedish Museum of Natural History, Leiden), simultaneously. BM (Btitish Museum of Natural History- 6. Physical specimens are prone to dam- including Clifford Herbarium) CAYM (National age through handling or during Trust for Cayman Islands), INB (Instituto hazardous situation. Thousands of Nacional de Biodiversidad, Costa Rica), TAMU specimens and valuable holotypes (Texas A & M University). The virtual preserved in Berlin herbarium were herbarium of FTG thus affectively includes destroyed during second the World not only specimens from Fairchild Herbarium, War. Digitized images, on the other but also from other herbaria. It also provides hand can be saved on several comput- species lists, interactive keys and photo- ers, at different locations. graphs of living specimens in various data- 7. Majority of research projects don’t bases and indices. need physical specimens, and as such Australia’s Virtual Herbarium (AVH) is a electronic images can be utilized, collaborative project of the State, Common- saving the time and cost for trans- wealth and Territory herbaria, being devel- portation of actual specimens. oped under the auspices of the Council of Virtual herbaria with searchable database Heads of Australian Herbaria (CHAH), rep- have been been developed by many major resenting the major Australian collections. organisations like New York Botanical It is an on-line botanical information re- Garden (KE EMu), Royal Botanic Gardens source accessible via the web, providing im- Melbourne (AVH), Fairchild Tropical Garden mediate access to the wealth of data associ- (E-FTG), Australian Virtual Herbarium (AVH) ated with scientific plant specimens in each and Royal Botanic Gardens, Kew (ePIC). Australian herbarium. Though initiated in 1990, the NYpc project Australian herbaria house over six mil- of New York Botanical Garden became lion specimens that are a primary source of operational in 1995. The data was information on the classification and distri- transferred to new platform KE EMu in 2004 bution of plants, algae and fungi. These with additional search and display specimens are the working tools of scien- capabilities. The Virtual herbarium tists who contribute to our knowledge and presently consists of digital collection of understanding of biodiversity and conserva- 850,000 herbarium specimens and 120,000 tion through the discovery, classification high resolution images, updated daily. and description of new species. These will Garden pursues the goal of digitizing all of be enhanced by images, descriptive text and its 7 million plant and fungi specimens. identification tools. 108 Plant Systematics

The AVH is accessed via the website of ceeding and as of June 2006 the database any participating herbarium. A gateway at consisted of c193,600 specimens. Further each of these herbaria links to the databases digitization is likely to focus on type speci- of all the other herbaria, consolidating the mens. A potential c7,000,000 specimens combined data into a nation-wide view of the (c275,000 types) may eventually be digitized. botanical information. Most data related to specimens will be stored by the custodial IDENTIFICATION METHODS institution, and there will be some re- Identification of an unknown specimen is a sources, such as the scientific names data- common taxonomic activity, and often com- base (Australian Plant Names Index, APNI) bined with determination of a correct name. which will be common to all. More than 70% The combined activity is appropriately re- of the specimens housed in Australian her- ferred as specimen determination. Before baria have been databased, providing a com- the specimen can be identified, it is desir- prehensive resource for accurate depiction able to describe it and prepare a list of char- of geographic distribution and occurrence, acter-states, mainly pertaining to floral historical mapping, information valuable for structure. Whereas fresh specimens may be understanding the threatening processes of described more conveniently, the dried vegetation clearance and weed invasion. specimens may be softened by immersing Flexible on-line search options allow you to in water or a wetting agent such as aero- customise the data you generate to suit your sol OT (dicotyl sodium sulfosuccinate 1 per requirements. cent, distilled water 74 per cent and Metha- Australia’s Virtual Herbarium provides nol 25 per cent). Pohl’s softening agent is the opportunity to deliver descriptions of the an excellent detergent solution for soften- flora dynamically linked to data and infor- ing flowers and fruits for dissection. The mation from across the continent, and dis- identification of an unknown plant may be tributed on-line as an electronic Australian achieved by comparison with identified her- Flora - a one-stop source of current infor- barium specimens or through the help of mation on the plants, algae and fungi of the taxonomic literature. Both methods may be entire Australian continent. New observa- combined for a more reliable identification. tions can be released with minimal delay The unknown specimen meant for iden- as they are confirmed and recorded in the tification is sent to a herbarium, where an database. expert on the plant group examines and iden- The Strong ePIC database software of Royal tifies it by comparison with duly identified Botanic Gardens, Kew also provides a win- specimens (Figure 5.13). The user can also dow for digitized herbarium specimens. The visit a herbarium and personally compare Herbarium’s core digital collection and identify his specimens. programme was initiated in 2002 and since Computers have entered in a big way into then digital resources have grown at an in- solving identification problems. Electronic creasing rate, as well as central Herbarium revolution in recent years has opened up a Catalogue, have an image server and many new, faster and more reliable method of iden- project databases with information about tification. The photograph, description or specimens that were built before the Cata- illustration of parts can be put up on a logue became available. These are being website, with information to a relevant moved into the Catalogue as resources per- e-mail list, whose members can help in mit. Label data from dry and spirit specimens achieving identification within hours. of flowering plants, ferns and gymnosperms held in Kew's herbarium are being uploaded. Information recorded includes the plant Taxonomic literature name, collection and determination data, Various forms of literature incorporating locality and type status. Digitization is pro- description, illustrations and identification Process of Identification 109 keys are useful for proper identification of Australiensis by G. Bentham (1863- unknown plants. The library is, therefore, 1878). as important in taxonomic work as a her- 4. Comprehensive treatments have a barium, and knowledge of taxonomic litera- much broader scope. Although no ture is vital to the practicing taxonomist. The world Flora has ever been written, literature of taxonomy is one of the oldest several important works have and most complicated literatures of science. attempted a worldwide view. Examples: Several bibliographic references, indexes Genera plantarum of G. Bentham and and guides are available to help taxonomists J.D. Hooker (1862-83), Die Naturlichen to locate relevant literature concerning a pflanzenfamilien of A. Engler and taxonomic group or a geographical region. K.A. Prantl (1887-1915) and Das The major forms of literature helpful in iden- Pflanzenreich of A. Engler (1900-1954). tification are described below. Electronic Floras (eFloras) Floras Last few years have seen the online availability of digitized form of many popular flo- A Flora is an inventory of the plants of a ras. These Online Floras known as Elec- defined geographical region. A Flora may be tronic Floras (eFloras) provide oppurtunity for fairly exhaustive or simply synoptic. Lists of users to work dynamically on floristic treat- the Floras may be found in the Geographical ments, and to browse and search these treat- Guide to the Floras of the World by S.F. Blake ments. One such effort by Missouri Botani- (Part I, 1941; Part II, 1961) and Guide to the cal Gardens has resulted in the publication Standard Floras of the World by Frodin (1984). of www.eFloras.org/, combining together the Depending on the scope and the area cov- information from several Floras including ered, the Floras are categorized as: Flora of Chile, Flora of China, Flora of Mis- 1. Local Flora covers a limited geo- souri, Flora of North America, Flora of Paki- graphical area, usually a state, county, stan, Moss Flora of China, Trees and Shrubs city, a valley or a small mountain of Andes and Ecuador, as also the Annotated range. Examples: Flora of Delhi by Checklist of Flowering Plants of Nepal. J.K. Maheshwari (1963), Flora These Floras can be searched through com- Simlensis by H. Collet (1921), Flora of mon search engine to obtain relevant infor- Tamil Nadu by K.M. Mathew (1983), mation. The hyperlinks to families, genera Flora of Missouri by J.A. Steyermark and species are very handy in identification (1963) and Flora of Central Texas by R.G. and retrieving information. The website also Reeves (1972). hosts the interactive Actkey Provided by the 2. Regional Flora includes a larger geo- Harvard University Herbarium, allowing graphical area, usually a large coun- visitors to locate and use a key for identify- try or a botanical region. Examples: ing an unknown specimen. The keys for Flora of British India by Sir J.D. Hooker Families of Angiosperms by Bertel Hansen (1872-1897), Flora Malesiana by C.G. & Knud Rahn, Families of Dicotyledons of the Steenis (1948), Flora Iranica by K.H. Western Hemisphere South of the United Rechinger (1963), Flora of Turkey and States, Generic Tree Flora of Madagascar, East Aegean Islands by P.H. Davis and Key to Taxa of China in ActKey, Trees and Flora SSSR by V. L. Komarov and B.K. Shrubs of Borneo, and Weeds Of Rain Fed Shishkin (1934-1964). A Flora cover- Lowland Rice Fields Of Laos And Cambodia ing a country is more appropriately are already incorporated in a user friendly known as a National Flora. interface. 3. Continental Flora covers the entire Royal Botanical Gardens Kew has hosted continent. Examples: Flora Europaea eFlora Flora Zambesiaca providing not only by T.G. Tutin et al., (1964-80) and Flora an easy way of searching the information 110 Plant Systematics but also an identification tool. This website A revision is less comprehensive than a allows you to search for a plant name across monograph, incorporating less introductory the whole Flora, which would otherwise material and including a synoptic literature entail looking up separate indexes. It also review. A revision includes a complete syn- allows the creation of lists of: endemics, spe- onymy but the descriptions are shorter and cies from a particular division or country, often confined to diagnostic characters. The species that match a particular habit and of geographical scope is usually worldwide. species that occur at a specific altitude. As A conspectus is an effective outline of a far as posible no changes have been made revision, listing all the taxa, with all or ma- to the information existing in the original jor synonyms, with or without short diagno- text and the information is presented in the sis and with a brief mention of the geographi- same way as in the original. cal range. Species plantarum of C. Linnaeus (1753) is an ideal example. Manuals A synopsis is a list of taxa with much A manual is a more exhaustive treatment abbreviated diagnostic distinguishing state- than a Flora, always having keys for identi- ments, often in the form of keys. fication, description and glossary but generally covering specialized groups of plants. Icones (Illustrations) Examples: Manual of Cultivated Plants by Illustrations, often with detailed analysis of L.H. Bailey (1949), Manual of Cultivated Trees the parts are usually published along with and Shrubs Hardy in North America by the text in Floras and Monographs, but may A. Rehder (1940) and Manual of Aquatic Plants sometimes be compiled exclusively and of- by N.C. Fassett (1957). ten serve as useful tools for identification. A manual differs from a monograph in the In fact, many species of plants based on pub- sense that the latter is a detailed taxonomic lished illustrations only, without any accom- treatment of a taxonomic group. panying description or diagnosis before 1 January 1908 have been accepted as validly Monographs published. Two principal compilations of Icones are Hooker’s Icones and Wight’s Icones. A monograph is a comprehensive taxonomic Others of interest include Illustrations of treatment of a taxonomic group, generally a plants from Europe (Hegi, 1906-1931), North genus or a family, providing all taxonomic America (Gleason, 1963), Pacific states data relating to that group. Usually the (Abrams, 1923-1960), Pacific coast trees geographical scope is worldwide since it is (McMinn and Maino, 1946), Germany impossible to discuss a taxon without includ- (Garcke, 1972), Korea (Lee, 1979). ing all its members, and often all its species, subspecies, varieties and forms are discussed. The monograph also includes an Journals exhaustive review of literature, as also a Whereas Floras, manuals and monographs report on author’s research work. A mono- are published after a lot of taxonomic input graph includes all information related to and it may take several decades before they nomenclature, designated types, keys, are revised, if at all, taxonomic journals pro- exhaustive description, full synonymy and vide information on the results of ongoing citation of specimens examined. Examples: research. A continuous update on additional The Genus Pinus by N.T. Mirov (1967), The taxa described or reported from a region, Genus Crepis by E. B. Babcock (1947), A Mono- nomenclatural changes and other taxonomic graph of the Genus Avena by B.R. Baum information is essential for continuance of (1977), The Genus Datura by A.F. Blakeslee taxonomic activity. Reference to a publica- et al., (1959) and The Genus Iris by W.R. Dykes tion in a journal includes volume number (1913). (all issues within a year bear the same Process of Identification 111 volume number; trend not followed by a few ral History), Paris; a peer-reviewed journal journals), issue number (numbered within of plant biology, devoted to the inventory, a volume, a monthly journal would have 12 analysis and interpretation of vascular issues, quarterly 4 issues and so on) and plants biodiversity; publishes original page numbers on which a particular article results, in French or English, of botanical appears. Common journals devoted largely research, particularly in systematics and to taxonomic research include: related fields; two issues appear each year. Adansonia continues as from 1997 the Bul- The journal of the International Taxon- letin du Muséum national d'Histoire naturelle, Association for Plant Taxonomy devoted to section B, Adansonia, Botanique, phytochimie. systematic and evolutionary biology with Other important taxonomic journals in- emphasis on botany; published quarterly by clude Journal of the Arnold Arboretum the International Bureau for Plant Taxonomy (Harvard), Bulletin Botanical Survey of India and Nomenclature, Botanisches Institut der (Calcutta), Botanical Magazine (Tokyo) and Universitaet Wien, Austria. Systematic Botany (New York). Kew Bulletin- International peer-reviewed Journal of Plant Taxonomy; published Supporting literature in four parts in one year by Royal Botanic With a large amount of research material Gardens, Kew; containing original articles being published throughout the world, there of interest mainly to vascular plant and is always need for supporting literature to mycological systematists; each part illus- give consolidated information about the trated with line drawings and photographs works published the world over. They also and also features a Book Review and Notices help in tracking down material concerning section. a particular taxon covering a certain period. Taxonomic Literature, an exhaustive series Plant Systematics and Evolution- of Regnum vegetabile, covers full bibliographi- Published by Springer, Wien from 1974 on- cal details of literature extremely helpful in wards; originally started in 1851 under the searching type material, priority of names, name Österreichisches Botanisches dates of publication and biographic data on Wochenblatt was published between 1958 to authors. Originally published in 1967, it is 1973 as Österreichische Botanische Zeitschrift; under constant revision with 3 supplements devoted to publishing original papers and of the 2nd edition published between 1992- reviews on plant systematics in the broad- 97 (Stafleu and Mennega). est sense, encompassing evolutionary, phylogenetic and biogeographical studies at Abstracts or Abstracting journals: the populational, specific, higher taxonomic These provide a summary of different levels; taxonomic emphasis is on green articles published in various journals plants; volumes each with four numbers throughout the world. Biological Abstracts and published randomly, usually 6-7 volumes in Current Advances in Plant Science are more one year. general in approach. The Kew Record of Taxonomic Literature covers all articles Botanical Journal of Linnaean relevant to taxonomy. Society- Published on behalf of Linnean Index: An Index provides an alphabetic Society by Blackwell Synergy, London; three volumes with four monthly issues each pub- listing of taxa with reference to their publi- lished in one year; publishes original re- cation. Index Kewensis is by far the most search papers in the plant sciences. important reference tool, first published in 2 volumes from Royal Botanic Gardens, Kew Adansonia- Published by Muséum na- (1893-1895), covering names of species and tional d'Histoire naturelle (Museum of Natu- genera of seed plants published between 112 Plant Systematics

AMEBIA, Regel, Pl. Nov. Fedsch. 58 (1882) err. typ = Arnebia, Forsk. (Boragin.).

AMERCARPUS, Benth in Lindl. Veg. Kingd. 554 (1847) = Indigofera, Linn. (Legumin.).

AMECHANIA, DC. Prodr. vii. 578 (1839)= Agarista, D. Don (Ericaceae). hispidula, DC. l. c. 579 (=Leucothoe hispidula). subcanescens, DC. l. c. (=Leucothoe subcanescens). AMELANCHIER, Medic. Phil. Bot. i. 135 (1789). ROSACEAE, Benth. & Hook.f. i. 628. ARONIA, Pers. Syn. ii. 39 (1807. PERAPHYLLUM, Nutt. in Torr. & Gray, Fl. N. Am. i. 474 (1840). XEROMALON, Rafin. New Fl. Am. iii. 11 (1836). alnifolia, Nutt. in Journ. Acad. Phil. vii. (1834)22.__ Amer. bor. asiatica, Endl. in Walp. Rep. ii. 55= canadensis Bartramiana, M. Roem. Syn. Rosifl. 145= canadensis. Botryapium, DC. Prodr. ii. 632= canadensis. canadensis, Medic. Gesch. 79; Torr. & Gray, Fl. N. Am. i. 473. __Am. bor.; As. or. chinensis, Hort. ex Koch, Dendrol. i. 186=Sorbus arbutifolia.

Figure 5.14 Portion of a page from Index Kewensis. Generic name Amebia (Normal caps) Regel is synonym of genus Arnebia (Bold small case) Forsk. of family Boraginaceae. Generic name Amelanchier (Bold caps) Medic. is correct name with generic names Aronia Pers., Peraphyllum Nutt. and Xeromalon Rafin. as synonyms. Species names Amelanchier alnifolia (Normal small case) Nutt. and A. canadensis Medic. are correct, whereas the names A. asiatica (italics small case) Endl., A. Batramiana M. Roem.and A. Botryapium DC. are synonyms of A. canadensis. A. chinensis Hort. is similarly synonym of Sorbus arbutifolia.

1753 and 1885. Regular Supplements used with bibliographic references to the place of to be published every 5 years and 18 Supple- first publication. At the beginning of the ments appeared up to 1985. Supplement 19 nineteen eighties the data was transferred was published in 1991 covering the years to a computer database which continues to 1986 to 1990. Since then the listing has expand at the rate of approximately 6000 been published annually under the title Kew records per year. To make this data gener- Index. ally available, it was decided to publish the Index Kewensis (Figure 5.14) is a list of new whole Index Kewensis as a CD-ROM in 1993. and changed names of seed-bearing plants This contains almost 968,000 records. Process of Identification 113

Illustrations of vascular plants can be lo- was produced by Dr. Hu Shiu-ying (Arnold cated through Index Londinensis, which con- Arboretum of Harvard University) and his tains information up to 1935. More recent staff. The Hu Card Index was prepared in the information can be found in the 2-volume early 1950s when the Arnold Arboretum un- work Flowering Plant Index of Illustrations and dertook a project to prepare a flora of China. Information compiled by R. T. Isaacson (1979). Royal Botanic Gardens Kew, The Harward A listing of all generic names can be found University Herbaria, and the Australian in Index Nominum Genericorum (ING) a 3-vol- National Herbarium, under the collaborative ume work published in 1979 under the se- project, have developed International Plant ries Regnum Vegetabile. The first supplement Names Index (IPNI), a single web database appeared in 1986. It has now been put on which combines citation data for seed plants the database and can be directly accessed from Index Kewensis, the Gray Herbarium through the Internet. Card Index, and the Australian Plant Names Index Holmiensis (earlier Index Holmensis) Index (APNI). It provides information on is an alphabetic listing of distribution maps names and associated basic bibliographical found in taxonomic literature of vascular details of all seed plants. Its goal is to elimi- plants. It commenced publication in 1969. nate the need for repeated reference to pri- Gray Herbarium Card Index is information mary sources for basic bibliographic infor- on cards, which has now been set up on a mation about plant names. The data are database. Usually on the same pattern as freely available and are gradually being stan- Index Kewensis, the Index has been pub- dardized and checked. IPNI is intended to be lished in 10 volumes between 1893 and a dynamic resource, depending on direct 1967. A 2-volume supplement was published contributions by all members of the botani- by G. K. Hall in 1978. The Gray Herbarium cal community. Index Database currently includes 350,000 Numerous valuable Dictionaries have records of New World vascular plant taxa at been published but by far the most useful is the level of species and below. The Index in- Dictionary of Flowering Plants and Ferns pub- cludes from its 1886 starting point, the lished by J. C. Willis. The 8th edition revised names of plant genera, species and all taxa by Airy Shaw appeared in 1973. The book of infraspecific rank. The Gray Index has in contains valuable information concerning common with Index Kewensis its involve- genera and families providing name of the ment with taxon names, although they dif- author, distribution, family and the number fer in biological and geographical coverage. of species in the genus. The Gray Index covers vascular plants of the Americas; Index Kewensis includes seed plants worldwide. Only the Gray Index has Taxonomic Keys nomenclatural synonyms cross-referenced Taxonomic keys are aids for rapid identi- to basionyms. The information is now ac- fication of unknown plants. They consti- cessible over the Internet via keyword tute important component of Floras, manu- searches from the E-mail Data Server and als, monographs and other forms of litera- through the Biodiversity and Biological Col- ture meant for the identifying plants. In ad- lections Gopher. Indices covering other dition, identification methods in recent groups of plants have also been published: years have incorporated the usage of keys Index Filicum for Pteridophytes, and Index based on cards, tables and computer pro- Muscorum for Bryophytes. grams. The latter are primarily designed for The Hu Card Index is a file of 158,844 cards identification by non-professionals. These for Chinese plant names, now housed in the keys are fundamentally based on characters, Harvard University Herbaria building where which are stable and reliable. The keys are it is available for use in person. The Index helpful in a faster preliminary identifica- 114 Plant Systematics tion, which can be backed up by confirma- ated, spur absent, petals without tion through comparison with the detailed nectary. description of the taxon provisionally iden- 3. Anemone: Plants herbaceous, fruit tified with. Before identification is at- achene, calyx not differentiated, peri- tempted, however, it is necessary that the anth petaloid, spur absent. unknown plant is carefully studied, de- 4. Clematis: Plants woody, fruit achene, scribed and a list of its character states pre- calyx not differentiated, perianth pared. Based on the arrangement of charac- petaloid, spur absent. ters and their utilization, two types of iden- 5. Caltha: Plants herbaceous, fruit folli- tification keys are differentiated: cle, calyx not differentiated, perianth 1. Single-access or sequential keys; and petaloid, spur absent. 2. Multi-access or multientry keys 6. Delphinium: Plants herbaceous, fruit (polyclaves). follicle, calyx not differentiated, perianth petaloid, spur one in number. Single Access or Sequential 7. Aquilegia: Plants herbaceous, fruit fol- Keys licle, calyx petaloid, not differentiated from corolla, spurs five in number. Single-access keys are usual components of Based upon the above information the fol- Floras, manuals, monographs and other lowing couplets and leads can be identified: books meant for identification. The keys are 1. Plants woody based on diagnostic (important and conspicu- Plants herbaceous ous) characters (key characters) and as such 2. Fruit achene the keys are known as diagnostic keys. Most Fruit follicle of the keys in use are based on pairs of con- 3. Calyx and corolla differentiated trasting choices and as such are dichoto- Calyx and corolla not differentiated mous keys. They were first introduced by J. 4. Spur present P. Lamarck in his Flore Francaise in 1778. Spur absent The construction of a dichotomous key starts 5. Number of spurs 1 with the preparation of a list of reliable char- Number of spurs 5 acters for the taxon for which the key is to be 6. Petal with nectary at base constructed. For each character the two con- Petal without nectary at base trasting choices are determined (e.g., habit woody or herbaceous). Each choice constitutes It must be noted that three choices are a lead and the two contrasting choices form available for spur (absent, one, five). It has a couplet. For characters having more than been broken into two couplets to maintain two available choices the character can be the dichotomy. Based on the arrangement split to make it dichotomous. Thus if flowers of couplets and their leads, three main types in a taxon could be red, yellow or white the of dichotomous keys are in use: Yoked or first couplet would constitute flowers red vs. Indented key, Bracketed or parallel key, non-red and the second couplet flowers and Serial or numbered key. yellow vs. white. We shall illustrate the 1. Yoked or Indented key: This is one of construction of keys taking an example from the most commonly used keys in Floras and family Ranunculaceae. The diagnostic manuals especially when the keys are characters of some representative genera are smaller in size. In this type of key, the state- listed below: ments (leads) and the taxa identified from 1. Ranunculus: Plants herbaceous, fruit them are arranged in visual groups or yokes achene, distinct calyx and corolla, spur and additionally the subordinate couplets are absent, petal with nectary at base. indented below the primary one at a fixed 2. Adonis: Plants herbaceous, fruit distance from the margin, the distance in- achene, calyx and corolla differenti- creasing with each subordinate couplet. We Process of Identification 115

1 Stem woody at base; achenes 3.5-5 mm 8. pustulatus 1 Stem not woody; achenes 2-3.75 mm 2 Annual or biennial 3 Achenes smooth at least between the ribs; strongly compressed and + winged 1. asper 3 Achenes rugose or tuberculate between the ribs, neither strongly compressed nor winged 4 Leaf-lobes strongly constricted at base, or narrowly linear; terminal lobe usually about as large as lateral lobes; ligules longer than corolla-tube; achenes abruptly contracted at base 2. tenerrimus 4 Leaf-lobes (if present) not constricted at base; terminal lobe usually much larger than lateral lobes; ligules about as long as corolla-tube; achenes gradually nar rowed at base 3. oleraceous 2 Perennial

Figure 5.15 Portion of a polythetic key of the yoked type used in Flora Europaea for genus Sonchus (vol. 4, p. 327). shall select the fruit type as the first cou- those appearing on a single page, but if the plet, as it divides the group into two almost key is very long running into several pages, equal halves and the taxa excluded would be an Indented key exhibits important draw- almost equal whether the fruit in the un- backs. Firstly, it becomes difficult to locate known plant is an achene or a follicle. The the alternate leads of initial couplets, as they yoked or indented key for the taxa under con- may appear on any page. Secondly, with the sideration is shown below: number of subordinate couplets increasing substantially, the key becomes more and 1. Fruit achene. more sloping, thus reducing the space avail- 2. Calyx differentiated from corolla. able for writing leads. This may result in 3. Petal with basal nectary 1. Ranunculus wastage of a substantial page space. The 3. Petal without basal nectary..2. Adonis problem is clearly visible in Flora Europaea 2. Calyx not differentiated from corolla. where attempts to reduce the indentation 4. Plants woody…..……....4. Clematis distance in longer keys has further compli- 4. Plants herbaceous…..3. Anemone cated the usage of keys. These two disad- 1. Fruit follicle. vantages are taken care of in the Parallel or 5. Spur present. Bracketed key. 6. Number of spurs 1...... 6. Delphinium 2. Bracketed or Parallel key: This type 6. Number of spurs 5...... 7. Aquilegia of key has been used in larger floras such 5. Spur absent……………....5. Caltha as Flora of USSR, Plants of Central Asia, and Flora of British Isles. The two leads of a cou- It is important to note that all genera with plet are always together and the distance achene fruit appear together and form vi- from the margin is always the same. Sev- sual groups; leads of subordinate couplets are eral variations of this are used wherein the at increasing distance from the margin and second lead of the couplet is not numbered, the leads of initial couplets are far separated, as in Flora of British Isles or else the second whereas those of subsequent subordinate lead is prefixed with a + sign as in Plants of couplets are closer. Such an arrangement Central Asia. The arrangement of couplets is very useful in shorter keys, especially in this type of key is useful for longer keys 116 Plant Systematics as the location of alternate keys is no prob- 8. Number of spurs 5 ...... 7. Aquilegia lem (two are always together) and there is 9. (7) Spur absent ...... 5. Caltha no wastage of page space. There is, however, Such a key retains the visual groups of one associated drawback; the statements are statements and taxa, alternate leads, even no longer in visual groups. The reference to though separated, are easily located and the primary lead is often difficult, but this prob- there is no wastage of page space. lem is usually solved by indicating the An inherent drawback of dichotomous number of primary lead within parenthesis keys is that the user has a single fixed as done in several Russian Floras such as choice of the sequence of characters decided Flora Siberia and Plants of Central Asia. A by the person who constructs the key. In the typical bracketed key is illustrated below: said example if information about the fruit 1. Fruit achene…………………………...... 2 is not available, it is not possible to go be- 1. Fruit follicle ...... 5 yond the first couplet. 2. Calyx differentiated from corolla ...... 3 2. Calyx not differentiated from corolla .... 4 Guidelines for dichotomous keys 3. Petal with basal nectary ... 1. Ranunculus Certain basic considerations are important 3. Petal without basal nectary ..... 2. Adonis for the construction of dichotomous keys. 4. Plants woody ...... 4. Clematis These include: 4. Plants herbaceous ...... 3. Anemone 1. The keys should be strictly dichoto- 5. Spur present ...... 6 mous, consisting of couplets with only 5. Spur absent...... 5. Caltha two possible choices. 6. Number of spurs 1 ...... 6. Delphinium 2. The two leads of a couplet should be 6. Number of spurs 5 ...... 7. Aquilegia mutually exclusive, so that the accept- Retention of positive features of the Par- ance of one should automatically lead allel key and visual groups of the Yoked key to the rejection of another. is achieved in the Serial key. 3. The statements of the leads should not be overlapping. Thus, the two leads 3. Serial or numbered key: Such a key ‘leaves 5-25 cm long’ and ‘leaves 20-40 has been used for the identification of ani- cm long’ would find it difficult to place mals and also adopted in some botanical taxa with leaves that are between works. This key retains the arrangement of 20 and 25 cm in length. Yoked key, but with no indentation so that 4. The two leads of a couplet should start distance from the margin remains the with the same initial word. In our same. The location of alternate leads is example, both leads of the first couplet made possible by serial numbering of cou- start with ‘Fruit’. plets (or leads when separated) and indicat- 5. The leads of two successive couplets ing the serial number of the alternate lead should not start with the same initial within parentheses. A serial key for the taxa word. In our example the word ‘spur’ in question would appear as under: appears in two successive couplets and 1. (6) Fruit achene. as such in the second one the language 2. (4) Calyx differentiated from corolla. has been changed to start with 3. Petal with basal nectary. .. 1. Ranunculus ‘Number’. If such a change were not 3. Petal without basal nectary… ... 2. Adonis possible it would be convenient to pre- 4. (2) Calyx not differentiated from corolla. fix the second couplet with ‘The’. Thus, 5. Plants woody ...... 4. Clematis the other alternative for the second 5. Plants herbaceous ...... 3. Anemone couplet would have the two leads worded 6. (1) Fruit follicle. as ‘The spur 1’ and ‘The spurs 5’. 7. (9) Spur present. 6. For identification of trees, two keys 8. Number of spurs 1 ...... 6. Delphinium should be constructed based on Process of Identification 117

vegetative and reproductive charac- 3. The single character used in the cou- ters separately. As trees commonly plet may be exceptional. Such likeli- have leaves throughout the major part hood is not possible when more than of the year, and flowers appear briefly one character is used. when in many trees leaves are not yet developed, such separate keys are Multi-Access Keys (Polyclaves) essential for identification round the Such multientry order-free keys are user- year. oriented. Many choices of the sequence of 7. Avoid usage of vague statements. characters are available. Eventually, it is the Statements such as ‘Flowers large’ vs. user who decides the sequence in which to ‘Flowers small’ may often be confus- use the characters, and even if the infor- ing during actual identification. mation about a few characters is not avail- 8. An initial couplet should be selected able, the user can go ahead with identifica- in such a way that it divides the group tion. Interestingly, identification may often into more or less equal halves, and the be achieved without having to use all the character is easily available for study. characters available to the user. Such iden- Such a selection would make the tification methods often make use of cards. process of exclusion faster, whichever Two basic types of cards are in use: lead is selected. 9. For dioecious plants, it is important Body-punched cards to have two keys based on male and These cards are also named window cards female flowers separately. or peek-a-boo cards, and make use of cards 10. The leads should be prefixed by num- with appropriate holes in the body of the card bers or letters. This makes location (Figure 5.16). The process involves using one of leads easier. If left blank, the loca- card for one attribute (character-state). In tion of leads is very difficult, especially our example we shall need 11 cards (we have in longer keys. chosen only diagnostic characters above, The keys described above have a single whereas our list in polyclaves could include character included in a couplet, with two more characters, and thus more cards to contrasting statements about the character make it more flexible). in the two leads. Such keys are known as It should be noted that we selected 12 leads monothetic sequential keys. The common- and 6 couplets, with 4 leads for spur. Now we est forms of keys used in floras, however, shall need only three actual attributes: ‘spur have at least some couplets (Fig 5.15) with absent’, ‘spur 1’ and ‘spurs 5’. Numbers are several statements about the different char- printed on the cards corresponding to the acters in each lead. These keys are known taxa for which the identification key is as polythetic sequential keys. Such meant. In our example, we use only 7 of these polythetic keys, also known as synoptic keys numbers corresponding to our 7 genera. On are especially useful for constructing keys each card, holes are punched corresponding for higher categories. Such keys have three to the taxa in which that attribute is present. basic advantages over the monothetic keys: In our example card ‘Habit woody’ will have 1. One or more characters may be only one hole at number 4 (genus Clematis), unobservable due to damage or non- and the card ‘Habit herbaceous’ will have occurrence of requisite stage in the holes at 1,2,3,5,6,7 (all seven except num- specimen. In such cases, a monothetic ber 4). Once the holes are punched at appro- key becomes useless. priate positions in all the cards, we are ready 2. User can make a mistake in deciding for identification. The user studies the un- about a single character. This error known plant and makes a list of characters, gets minimized if more than one according to the sequence he wishes and the character is used. characters that are available to him. 118 Plant Systematics

Figure 5.16 A body-punched card for herbaceous habit for the seven representative genera of Ranunculaceae: 1- Ranunculus, 2- Adonis, 3- Anemone, 4- Clematis, 5- Caltha, 6- Delphinium, 7- Aquilegia. Note the diagonal trim on upper left corner of card for proper alignment of cards.

The user starts the identification process hole is clipped out to form an open notch in- by picking up the first card concerning the stead of a circular hole along the edge. first attribute in his list of attributes of the For actual identification, all the cards are unknown plant. He next picks up the sec- held together as a pack. A needle is inserted ond card concerning the second attribute in the hole corresponding to the first at- from his list and places it over the first card. tribute of the unknown plant. As this needle This will close some holes of the first card is lifted up the taxa containing this attribute and some of the second card. Only those would fall down, and those lacking that at- holes will remain open which correspond tribute would remain in the pack lifted by to the taxa, which contain both the at- the needle. The latter are rejected. The tributes. The third card is subsequently cards falling down are again arranged in a placed over the first two and the process is pack, the needle inserted in the hole corre- repeated with additional cards until finally sponding to the next attribute of the un- only one hole is visible through the pack of known plant. The process is repeated until selected cards. The taxon to which this hole finally a single card falls down. The taxon, corresponds is the identification of the un- which this card represents, is the identifi- known plant. cation of the unknown plant. Note that we may not have to explore all Edge-punched cards attributes of the unknown plant; identifica- An edge-punched card differs from the body tion may be achieved much before we have punched card in that there is one card for reached the end of the list of attributes of each taxon and holes are punched all along the unknown plant. the edge of the card, one for each attribute. In our example here, we shall need seven Tabular keys cards, one for each genus. These holes are Tabular keys are essentially similar to the normally closed along the edge (Figure 5.17). polyclaves in the sense that they can take For each attribute, present in the taxon the care of exhaustive lists of attributes and are Process of Identification 119

Figure 5.17 Edge-punched card for genus Ranunculus. Only the attributes represented in the example above are pictured. Many more attributes could be added along the vacant holes to make the identification process more versatile. easier to use. The data are incorporated, formulae are arranged in alphabetic order however, not on cards but in tables with taxa in the same manner as words in a dictio- along the rows and attributes along the col- nary. Based on the attributes of the umns. The attributes represented in each unknown plant, its taxonomic formula is taxon are pictured with the help of appropri- constructed. The next step is as simple as ate symbols or drawings (Figure 5.18). The locating a word in the dictionary. The attributes not represented in a taxon show formula is located in the alphabetic list and a blank space in the column. Thus the table its identification read against the formula. will have as many rows as taxa and as many The above example of Ranunculaceae columns as the number of attributes for could be extended here by assigning alpha- which information is available. bets to the attributes: A: Woody; B: Herba- The identification process begins with a ceous; C: Achene; D: Follicle; E: Spur absent; strip of paper whose width is equal to each F: Spur 1; G: Spurs 5; H: Calyx differentiated row and vertical lines separated by the width from corolla; I: Calyx not differentiated from of the columns. The attributes present in corolla, only perianth present; J: Nectary the unknown plant are pictured on this strip present; K: Nectary absent. of paper. The strip of paper is next placed The seven representative genera would towards the top of the table and slowly low- thus have the formulae as given below: ered and compared with each row. The row ACEIK ...... Clematis with which the entries match represents the BCEHJ ...... Ranunculus identification of the unknown plant. BCEHK ...... Adonis BCEIK ...... Anemone Taxonomic formulae BDEIK ...... Caltha A taxonomic formula is really an alphabetic BDFIJ ...... Delphinium formula based on a specific combination of BDGIK ...... Aquilegia alphabets. The various attributes in this Such formulae are really useful in the method are coded with alphabets. Each taxon identification process and have been incor- thus gets a unique alphabetic formula. These porated in the written version of the multi- 120 Plant Systematics

Figure 5.18 Tabular key for the identification of representative genera of family Ranunculaceae. Only selected attributes as in the above example are pictured. More attributes could be added in additional columns to make the identification process more versatile. access key to the Genera of Apiaceae in the tween the user and the computer. The com- Flora of Turkey (Hedge and Lamond, 1972). puter program starts with the first couplet of the key, enquires about the attribute in Computers in Identification the unknown plant and on the information Over the years, computers have been in- provided, and handles the key asking rel- creasingly used in data collection, process- evant questions until finally the actual iden- ing and integration. They have also found tification is achieved. use in a big way in scanning and identifying human ailments, which has greatly Computer-Constructed Keys helped health management programmes. Appropriate programs may be developed Computers have also found use in plant iden- which can construct a taxonomic key based tification, whereby we no longer need on the taxonomic information about the taxa, trained botanists for this task. The follow- in the same way and based on the same logic ing main approaches are used in computer which is used by man to construct keys identification: manually. Such keys permanently stored in a computer can be handled as above for the Computer-Stored Keys step-wise process of identification. Dichotomous keys are constructed in the Simultaneous Character-set usual manner, fed into a computer and run using an appropriate program, which may Identification be appropriately designed for step-wise pro- Taxonomic keys are an aid to rapid identifi- cessing of the key through a dialogue be- cation and always provide only a provisional Process of Identification 121 identification, confirmation being achieved (DEscription Language for TAxonomy), only after comparison with a detailed descrip- which is a flexible and powerful method of tion of the specific taxon. This comparison recording taxonomic descriptions for pro- with the detailed description is not done in cessing by a computer. DELTA, a shareware the first place, as comparing the description program, has been adopted as a standard for of the unknown plant with the description of data exchange by the International Taxo- all taxa of the group or the area would be la- nomic Databases Working Group. It enables borious, time consuming and often impos- the generation and typesetting of descrip- sible. Such a comparison can be achieved tions and conventional keys, conversion of through a computer in a matter of seconds. DELTA data for use by classification pro- With such an approach, the whole set of char- grams, and the construction of Intkey pack- acters of the unknown plant may be fed into ages for interactive identification and infor- the computer simultaneously, and a com- mation retrieval. The System developed in puter program used to compare the descrip- the Natural Resources and Biodiversity Pro- tion with the specific group and to suggest gram of the CSIRO (Commonwealth Scien- the taxon with which the description tific and Industrial Research Organisation, matches. In case complete information is not Australia) Division of Entomology over a pe- available, the computer program may be able riod of 20 years M.J. Dallwitz, T.A. Paine and to suggest possible alternate identifications. E.J. Zurcher, is in use world-wide for diverse kinds of organisms, including fungi, plants, Automated Pattern Recogni- and wood. The programs are continually re- tion Methods fined and enhanced in response to feedback from users. Computer technology has now developed to The DELTA program Key generates con- the extent that fully-automated identifica- ventional identification keys. Characters tion can be achieved. The computer fitted are selected by the program for inclusion in with optical scanners can observe and record the key based on how well the characters features, compare the same with those al- divide the remaining taxa. This information ready known and make important conclu- is then balanced against subjectively deter- sions. Programs and techniques are already mined weights, which specify the ease of use available for human diagnosis, including and reliability of the characters. chemical spectra and photomicrographs of DELTA data can be readily converted to chromosomes, abnormality in human tis- the forms required by programs for phyloge- sues and even in vegetation and agricultural netic analysis, e.g. Paup, Hennig86 and surveys. MacClade. The characters and taxa for these analyses can be selected from the full Interactive Keys dataset. Numeric characters are converted Last two decades have seen the development into multistate characters, as numeric char- of sophisticated computer based programs acters cannot be handled by these programs. designed to collect, integrate and use it for Printed descriptions can be generated to fa- organising descriptions and associated taxon cilitate checking of the data. data and also help in the identification of Setting up a simple Delta identifi- taxa through user friendly interfaces. Some cation: Although the DELTA system has of the Major ones are briefly described here. capabilities of setting up of strong and sophisticated identification procedures, a DELTA System simple one can be built with basic knowl- The DELTA System is an integrated set of edge in computers. The first step in the pro- programs based on the DELTA format cess is to create a new data set (the exist- 122 Plant Systematics

Figure 5.19 Identification window of the Intkey (version 5) for the seven genera of Ranunculaceae. Selection of character state herbaceous (shown in the panel of used characters) leads to the rejection of one taxon (Clematis, which has woody habit) shown in the panel of eliminated taxa. Selection further character states of the known plant would eliminate further taxa till only one identified taxon remains. ing one can also be used, some even down- description to the character. Select the char- loaded from the internet). Create a new folder acter type from the list of Unordered under Delta directory and give it an appro- multistate (Say for flower colour with char- priate name. Open Delta Editor and click acter states yellow, red, white, etc.; New Dataset from menu. This will open multistate includes binary characters also Attribute editor with 4 panels. A click in the such as woody and herbaceous habit), Or- upper left panel will open Item editor for the dered multistate (height range such as first taxon. Enter its name (images, com- 1-10 cm, 11-20 cm, 21-30 cm, etc.; similarly ments and change of settings can be added two states with plants up to 20 cm tall and later on) and click Done to come back to the more than 20 cm tall), Integer numeric (say Attribute editor (else add image, sound, leaves per node), Real numeric (seed size change settings and then click done). Now say 2.4 cm) or text information (say about click in the upper right panel will open habitats). If Multistate character has been }character editor. Give appropriate name or selected (ordered or unordered), click states Process of Identification 123 tab (if not already done), enter first Charac- Action sets again, select ‘Translate into Key ter state in the lower right panel, it will Format’ and click Run and proceed similarly. automatically be defined in the left panel. Now open Action sets again, change Tab from Now click below this entry in the left panel Confor to Key, select ‘Confirmatory charac- and enter second Character state in the ter RTF’ and click Run. In the Action sets right panel. Repeat this till all states (pos- again now change the Tab back to Confor, sible in the other taxa included in the iden- select ‘Translate into Intkey format’ and tification process, but yet to be entered) have click Run. Go to the Action sets for the last been entered. Next select character Num- time, change to Intkey Tab, select ‘Intkey ber 2, give it a name, and select type. If the initializing File’ and click Run. The process numeric (real or integer) has been selected, will complete and Intkey program window states tab won’t appear. You will select the will open (don’t forget to add dataset to the unit (cm, mm, leaves per node). For text char- Intkey Index when prompted when you close acter, add appropriate notes in the notes tab. Intkey program; or else add dataset when you After all the characters have been selected, open Intkey program window next time) with click Done to go back to the Attribute editor. four panes with the list of characters in the Now click in the left upper panel to add upper left pane and the list of taxa in the the second taxon and repeat this till all the upper right pane, both lower panes being taxa have been added. The Attribute editor empty. will now show a list of taxa in the upper left Using Intkey program window, one can panel and the characters (identified as high- identify an unknown plant from this group lighted U-unordered multistate, O-ordered of taxa by reading the first character in the multistate, I-integer numeric, R-real unknown plant, clicking the appropriate numeric and T-text) in the upper right panel. character in the left upper pane and Any character missing from the list can be clicking or entering the right choice of the added and appropriately defined. Now select character state when prompted. This will taxa one by one. For each taxon, enter (verify) eliminate and show certain taxa in the lower the state in the right panel after expanding right pane and the used character in the the character icon (+ not expanded, – ex- lower left pane (Figure 5.19). As you use more panded) till information for all the taxa has and more characters, some more taxa will been entered. Save the dataset under the be rejected and the process will end when a folder already created in the beginning. You single identified taxon is remains in the can open the dataset now to add any images, upper right pane. You can click i (informa- comments or change settings if desired. The tion) icon to view image (if added) or read identification program needs a large full description of taxon. number of files in the folder created for a Intkey can also be used to access Delta particular dataset. The following procedure data and images over the internet. For this will create these files automatically. data files (such as iitems, ichars), intkey.ini, Open Dataset in the Delta editor and click contents.ind (together with rtf files), and File-->Export directive. Delta Files to export image files (optional) are put in a zip file (or dialogue box appears. Click OK, subse- self extracting zip file) and uploaded to the quently Done and then Close (if necessary website along with startup file (*.ink; which from X on top). Open Delta editor (if closed). contains the information and the path of Click view-->Action sets. Print character list uploaded files of the project), intkey.ini, appears. See that the Confor Tab is active. imagePath (optional) and InfoPath(optional). Select ‘Print character list-RTF’. Click Run. A data-set index file or link in WWW page In the next dialogue Box click Yes. Go to Ac- must point to the special startup file (*.ink; tion sets again, select ‘Translate into Natu- not intkey.ini or intkey.ink). The startup file ral Language-RTF-Single file for all taxa’ and tells Intkey where the data set and its asso- click Run, subsequently click Yes. Go to ciated images are found on the website. 124 Plant Systematics

When a person using an internet browser up the identification window with four clicks on a link to an intkey startup file, the panels, like Intkey. Character panel is browser activates Intkey and passes it a copy upper left window, but right upper panel of startup file. Intkey itself then retrieves shows character states, lower right panel the the actual data set from the web, extracts the matching items panel showing match- its contents, and begins identification. For ing or remaining taxa (click any taxon to get this web applicability, however, Intkey has its full description) and the lower left panel to be installed on both Web server and each the query criteria panel: display of previous each client PC, and an association of files (used) character state selections. NaviKey has to be developed by the manager of Web also allows checkbox matching options to: a) server, where the project files are located. Restrict view on used characters and Intkey based web applications are avail- character states of remaining items. b) Re- able for several families and Genera from tain items unrecorded for the selected char- Flora of China, Families of the World (Watson acters. c) Retain items matching at least and Dallwitz), Grass Genera of the World one selected state of resp. characters. d) Use (Watson and Dallwitz), Grass Species of the extreme interval validation, and e) Use World (RBG, Kew), Tree and Shrub Genera of overlapping interval validation.NaviKey does Borneo (J.K. Jarvie & Ermayanti), indentifica- not display the list of excluded taxa but the tion facility for the vascular flora of Western total number of taxa and number remain- Australia, and is available in FloraBase. Ad- ing are displayed. ditionally, interactive keys (using Intkey) to The use of software as web application is the families and genera of flowering plants very convenient. Just fill in the title and in Western Australia are soon to be added subtitle of the project being developed in to FloraBase, with specialist keys for cer- NaviKeyAppletWebpageTemplate.html using tain significant genera also well advanced. html editor (say Frontpage), upload the whole folder to your website, and provide a link to NaviKey NaviKey.html page. As this page opens, the Navikey is a simple Java based interactive java application gets loaded and the program identification key, a free program, which is ready for interactive identification. works on Delta flat files (chars, items and NaviKey identifications are available for specs- present in your folder if you have de- several families and genera of Flora of China veloped a database ready for identification and genus Arisaema (Guy Gusman & Eric through Intkey, as detailed in preceding Gouda) and Flowering Plant Families of paragraphs). NaviKey v. 4 is developed in the Jamaica (Gerald Guala & Jimi Sadle) frame of BIOTa Africa project (An Interna- tional Research Network on biodiversity, Lucid Systems sustainable use and conservation) by Dieter Lucid software (Lucid3) is a commercial Neubacher and Gerhard Rambold (University powerful and widely acclaimed Lucid of Bayreuth, Germany), based on an earlier Professional identification and diagnostic version (NaviKey v. 2.3 by Michael Bartley software developed by Centre for Biological and Noel Cross, Harvard University Her- Information Technology, The University of barium, Boston, USA). The program can be Queensland, Brisbane Australia. The Lucid3 downloaded from www.NaviKey.net and can system comprises a Builder and Player for be used both as stand alone application or creating and deploying effective and power- as web application. After downloading the ful identification and diagnostic keys. It and unzipping the the file, the folder will have allows creation of interactive, random-ac- a number of files on your computer. Simply cess keys that can be deployed over the World add the three flat files of your project to this Wide Web or CD. folder. For using it as stand alone applica- The key when used for the identification tion simply click NaviKey.jar, and it will open of an unknown specimen progressively Process of Identification 125 eliminates entities that do not match the XID System allows the user to randomly chosen features until only one or a few pos- select characteristics that are consistent sible entities remain. Further information with their specimen and skill level. If the user and images can be accessed to confirm the cannot decide upon a characteristic, they may identification. query the program, which will provide a list The basic elements of a Lucid3 key are: a of suggestions in order of ease of use, effec- list of entities; a list of features and states tiveness, and items remaining.In general, that may be used to describe those entities; much more data is included on each item/ a matrix of score data for the features asso- species than is necessary to identify it. With ciated with each of the entities for the fea- this abundance of data, the user can identify tures; and various attachments ( images, any of the items/species using the charac- web pages etc) for the entities and features, teristics most obvious and easy to describe. to provide extra information to users. With each characteristic entered by the user, The Lucid3 Builder provides all the tools the program eliminates all species that do necessary to create the entity and feature not have the combination of features entered. lists, encode the score data, and attach in- XID also offers 1000 Weeds of North formation files to items. The package in ad- America CD ROM. This is the most compre- dition includes Lucid Phoenix, a computer hensive weed identification reference ever based dichotomous or pathway key Builder published in North America. Contains 140 and Player that enables traditional paper grass-like and 860 broadleaf weeds, features based identification keys to be published on include Interactive key, color photos of all the Internet or CD. Phoenix keys are inter- species, illustrated glossary of terms, page active, can be enhanced with multimedia, number references to over 40 weed refer- and delivered across the Internet seamlessly. ence books, searchable geographic data, Additional Fact Sheet Fusion software is a and State level distribution maps. tool to facilitate the rapid generation of standardised fact sheets in HTML (Hyper ActKey Text Markup Language) or XML (eXtensible ActKey is a web based interactive identifi- Markup Language). cation program developed by Hong Song of XID (Expert Identification the Missouri Botanical Garden. This Java- based program uses MySQL as the database Systems) server, and can handle data sets in DELTA, XID Services Inc. produces commercial soft- MS Excel, MS Access and Lucid formats. ware with emphasis on biological sciences, ActKey identification is available for the and is one of the leading providers of expert floras of China, North America, Madagascar, identification systems for major universi- Borneo, at the Harvard University Herbaria ties and botanical gardens in United States. Editorial Center, and hosted at eFlora XID offers two identification packages: website. Examples include several keys to the Pankey, a DOS bassed identification pro- large and medium-sized genera of China (also gram, and XID Authoring Systems, Windows in Chinese); the genera of Brassi-caceae of based databases and Program for Identifica- the world by Ihsan Al-Shehbaz; Salix tion. The XID Authoring System allows au- (Salicaceae) of North America by George W. thors to create their own “smart key” or ran- Argus (also in Chinese); angiosperm families dom access expert system for the identifi- by B. Hansen and K. Rahn (also in Chinese cation of plants, animals, or any other ob- and Spanish); Trilliaceae (Trillium and Paris) ject. The elegant simplicity of the XID Sys- of the world by Susan B. Farmer, the generic tem makes it extremely user friendly, and tree flora of Madagascar by George Schatz, is as useful for school teacher as for the pro- and the trees & shrubs of Borneo by James fessional scientist. K. Jarvie & Ermayanti, respectively. 126 Plant Systematics

Meka biodiversity documentation and species MEKA (pronounced “mecca”) is an interactive identification. Linnaeus II supports the Multiple-Entry Key Algorithm to enable rapid creation of taxonomic databases, optimizes identification of biological specimens, now the construction of easy-to-use identifica- designed to run under Windows. The program, tion keys, expedites the display and compari- distrubuted free, is developed by Christopher son of distribution patterns, and promotes Meacham, Jepson Herbarium, Berkeley, CA. the use of taxonomic data for biodiversity The user picks character states that are studies. There are three 'modules' of present in the specimen from a list of possi- Linnaeus II: the 'Builder' to manage your bilities. As the character states are scored data and to create an information system, by picking them, MEKA eliminates taxa that the 'Runtime' engine to publish completed no longer match the list of scored character information systems on CD-ROM/DVD-ROM, states. Different windows display different and the 'Web Publisher' to publish your com- aspects of the underlying data base. As the pleted project as a Web site. identification progresses the windows are The package offers three identification updated automatically. An index screen modules: Text Key™- an electronic ver- makes it easy to find and score particular sion of written dichotomous keys, The Pic- classes of character states. MEKA does not ture Key™ - similar to the Text Key but lead the user in a fixed stepwise progression picture- based, and IdentifyIt™, the most through a series of questions. Instead, the powerful identification tool. It is a multi- user can perform identifications by scoring ple-entry key based on a matrix of taxa, character states in any order. This makes it characters, and character states. Unlike possible to identify specimens that are much the Species and Higher Taxa, which hold more fragmentary than is possible with di- text descriptions of the taxa, in IdentifyIt chotomous keys. New Windows version in- taxa are described in a more structured cludes a conversion function that can con- format: as a series of character states. vert any MEKA key to the SLIKS (Stinger’s This allows you to easily obtain answers Light Weight Interactive Key Software) for- to specific questions like, "Which species mat developed by Gerald Guala for Web-based are red and/or white". identification. Thomas J. Rosatti has devel- In addition to these interactive Keys Il- oped many Meka keys to California plants, lustrations of plants from various parts of and Prof. Knud Ib Christensen of the Botanic the World as also the illustrations of eco- Garden of the University of Copenhagen key nomic plants are put up at various to Old World Crataegus. websites hosted by different institutions, SLIKS software is a small free Javascript particularly one supporting Virtual her- program developed to facilitate the use of baria and eFloras. These illustrations are interactive keys. SLIKS is written in sim- available for help in identification. ple Javascript and runs over the web or lo- A number of electronic lists are main- cally on your machine. Users can download tained by listservers. Taxacom is one such their own copy or use it from your web site. list very active on taxonomic matters, It runs through the web browser so it is es- subscribed to by numerous active taxonomists sentially platform independant. all over the world. There is a regular exchange on matters of taxonomic interest. Any member with a problem can seek IndentifyIt opinions from all members simultaneously. IdentifyIt is identification software of com- An unknown plant can be identified by prehensive commercial Linnaeus II sending its description to the list. Still multifunctional research tool developed by better, a photograph or illustration of the ETI BioInformatics, for systematists and unknown plant can be put up on a website biodiversity researchers. It facilitates with information to the members. The mem- Process of Identification 127 bers may go to the website, observe the DNA Barcoding photograph or illustration and send their comments to the member concerned or the list DNA Barcoding is the most recent approach itself. Many users are being benefitted to fix the identity of different species, to through this web based interaction. ultimately facilitate a common database for Last few years have seen the spurt of living organisms. Consortium for the internet based exchange of information. Barcode of Life (CBOL) is an international Indiantreepix (http://groups.google.co.in/ collaboration of natural history museums, group/indiantreepix) is Google e-group de- herbaria, biological repositories, and voted to creating awareness, helping in iden- biodiversity inventory sites, together with tification, discussion and documentation of academic and commercial experts in Indian Flora. It is one of busiest group con- genomics, taxonomy, electronics, and sisting of experts from various fields. The computer science. The mission of CBOL is group also aims at compiling a database of to rapidly accelerate compiling of DNA photographs, nomenclature, relevant infor- barcodes of known and newly discovered mation and local names in different Lan- plant and animal species, establish a public guages. The database is building up at rapid library of sequences linked to named pace, and new taxa are added to the database specimens, and promote development of after confirmation from several experts. portable devices for DNA barcoding. FlowersOfIndia, another website (http:// DNA barcoding is a technique for www.flowersofindia.net/index.html) devoted characterizing species of organisms using to Indian flowering plants has separate data- a short DNA sequence from a standard and bases with links to photographs arranged agreed-upon position in the genome. DNA according to botanical names (alphabetic or barcode sequences are very short relative sorted family wise) and common names. to the entire genome and they can be Plants of different categories such as Flower- obtained reasonably quickly and cheaply. ing trees, Orchids, Medicinal plants, Garden The cytochrome c oxidase subunit 1 Flowers, Bulbous plants, Himalayan Flowers mitochondrial region (COI) is emerging as can be accessed through separate links. New the standard barcode region for higher images are being continuously added after animals. Because of its slow rate of evolution confirmation by experts. Vascular plant im- in higher plants, however, is not suitable for age library (http//botany.csdl. tamu.edu/ barcoding, and after experimenting with FLORA/gallery.htm) was developed originally chloroplast plastid trnH-psbA intergeneric with support from Texas Higher Education co- spacer gene, botanists at the Proceedings of ordinating Board as a part of Digital Flora of National Academy of Sciences, Cameroon Texas. Links are provided family wise to the and Plant Working Group of CBOL in 2009, images of plant species in databases includ- have decided to use two genes rbcL and matK ing Flowers of India, CalPhotos, Flora of Chile, for DNA barcoding of plants. Once the Missouri plants, Floral images, Plants of Ha- barcodes of all species of plants are waii, Oregon Flora image project, and several established, identification of plants may be individual image collections. CalPhotos is a possible through a handheld scanner. It may huge databas developed under a project of be useful for detecting illegal plants at check BSCIT of University of California, Berkeley, points, and also make the process of and contains more than 215,750 images of identification much simpler. However, at plants, animals, fossils, peoples and land- this point, detection of closely related species scapes around the world. Nearly 118,000 im- may not be possible, and traditional methods ages of plants can be browsed alphabetically may be used before more refined methods of and also searched through easy criteria. DNA barcoding are developed. Chapter 6 Variation, Biosystematics, Population Genetics and Evolution

It is now a universally agreed upon fact that dynamic structure. Clausen et al. (1945) different species are not fixed entities but regard genetics, cytology, comparative systems of populations which exhibit varia- morphology and ecology as furnishing the tion and wherein no two individuals are iden- critical data which together, when applied tical. This concept of variations was first pro- to the study of organic evolution, make up posed by Lamarck and further developed by biosystematics. These two different Darwin, culminating in his famous book Ori- approaches aim at the same problem, the gin of Species (1859). Systematics is a unique study of variations. natural science concerned with the study of The study of biosystematics, mainly the individual, population and taxon relation- experimental systematics and population ships for purposes of classification. The study genetics approach the common aim, al- of plant systematics is based on the premise though the methodology is different. The ex- that in the tremendous variation in the perimental systematist usually begins with plant world, there exist conceptual discrete classical interpretation of species and works units (usually named as species) that can backwards so as to understand the genetic be recognized, classified, described, and mechanisms involved. The population ge- named, on the further premise that logical neticist, on the other hand, begins with raw relationships developed through evolution population, discarding any classical concept exist among these units. in mind. He works into a series of group con- The studies on variations, experimental cepts which may or may not be comparable studies and hybridization studies in light of to the taxonomists concept of species. genetic information are commonly covered under the term biosystematics. The term was first proposed by Camp & Gilly (1943 as TYPES OF VARIATION Biosystematy) to delimit natural biotic units The recognition of taxonomic units is based and to apply to these units a system of on the identification of the occurrence and nomenclature adequate to the task of con- the degree of discontinuity in variation in veying precise information regarding their the populations. The variation may be con- defined limits, relationships, variability and tinuous when the individuals of a popula- Variation, Biosystematics, Population Genetics and Evolution 129 tion are separable by infinitely small differ- ronmental conditions. Such populations are ences in any of the attributes. In a discon- named ecophenes. In Epilobium; the tinuous variation, however, there is a dis- sun-plants have small, thick leaves, many tinct gap between two populations, each hairs and a short stature, whereas the showing its own continuous variation for a shade-plants have larger thinner leaves particular attribute. The discontinuity be- with fewer hairs and a taller stature. tween the populations primarily results from isolation in nature. Isolation plays a major Genetic variation role in establishing and widening the gap mutation between the populations, allowing evolution Genetic variation may result from recombination to take its destined course with no distur- or . Mutation is the occur- bance. Variation in plants includes three rence of heritable change in the genotype of fundamental types: developmental, environ- an organism that was not inherited from its ancestors. It is the ultimate source of mental and genetic. variation in a species and replenishes the supply of genetic variability. A mutation may Developmental variation be as minute as the substitution of a single A distinct change in attributes is often found nucleotide pair in the DNA (point mutation), during different stages of development. Ju- change in a sequence nucleotides control- venile leaves of Eucalyptus, Salix and Populus ling gene action (Gene mutation) or as great are often different from the mature leaves, as a major change in the chromosome and may often cause much confusion, but structure (chromosomal mutation). may prove equally useful when both types of Chromosomal mutation may be due to leaves are available from a plant. The first deletion, inversion, aneuploidy or polyploidy. leaves of Phaseolus are opposite and simple, Recombination is a reassortment of chromo- the later ones alternate and pinnately com- somes, bringing together via meiosis and pound. As the seedling stage is most critical fertilization the genetic material from in a plant’s life, the characters present dur- different parents and producing a new ing this period surely have survival value. genotype. Takhtajan proposed a neotenous origin for angiosperms on the assumption of juvenile VARIANCE ANALYSIS simple leaves of seed ferns having persisted Since no two individuals in a population are in the adult forms, which were the direct similar, there is need for some objective progenitors of angiosperms. analysis for useful comparison. It is, however, often impossible to collect information Environmental variation about all the individuals of a population, and Environmental factors often play major role as such is reasonable to analyse a repre- in shaping the appearance of a plant. sentative sample. It is essential that this Heterophylly is the common manifestation sample should represent random subset of of environmental variation. The submerged the population. The simplest tool is to leaves of Ranunculus aquatilis are finely calculate the mean or average by adding the dissected, whereas the emergent leaves of series of values and dividing the total by the the same plant are broadly lobed. The first number of values. The formula for calculat- submerged leaves of Sium suave are pin- ing the mean is: nately dissected and flaccid; the older S Xi emerged leaves are pinnately compound and X = n stiff. The individuals of a species often exhibit phenotypic plasticity, expressing where X represents the mean, S summation different phenotypes under different envi- of all values of X, Xi represents the individual 130 Plant Systematics

Table 6.1 Mean, variance and standard devia- removed from mean, the variance would be tion of two samples based to plant higher. The variance may either be calcu- height. The two samples have the lated for a population, or a sample from the same mean but different variance population. The variance for a population and standard deviation, highlighting may be calculated as: the significance of these calcula- n tions. 2 å (–)XXi i = 1 2 2 Height (cm) (Xi - X) (Xi -X) s = (Xi) n Sample Sample Sample Sample Sample Sample A B A B A B To obtain the variance, the difference be- 18 22 18 15 = 3 22 15 = 7 9 49 tween each value of the attribute (X) and the

14 10 14 15 = -1 10 15 = -5 1 25 mean is squared and a sum of these squares is divided by the number of observation (n). 16 06 16 15 = 1 06 15 = -9 1 81 For calculating sample variance (s2) the sum 15 16 15 15 = 0 16 15 = 1 0 1 of squares is divided by n – 1 instead of n. The formula for sample variance may be 17 12 17 15 = 2 12 15 = -3 4 9 written as: 19 19 19 15 = 4 19 15 = 4 16 16 n 2 å (–)XXi 12 11 12 15 = -3 11 15 = -4 9 16 i = 1 s2 = 14 27 14 15 = -1 27 15 = 12 1 144 n – 1 For the calculation of sample variance, 13 14 13 15 = -2 14 15 = -1 4 1 the reason for dividing by n – 1 and not by n, 16 21 16 15 = 1 21 15 = 6 1 36 is related to the degrees of freedom. If we

14 09 14 15 = -1 09 15 = -6 1 36 have a single value we can’t compare it, if we have two we have one comparison 12 13 12 15 = -3 13 15 = -2 9 4 (2 – 1), if we have three values we have two

∑Xi = 180 180 comparisons (3 – 1), and if there are n

Mean values, n – 1 comparisons are possible. While X= 15 15 calculating population variance, with large number of values , the difference of one 2 2 Variance S = ∑ (Xi -X) = 5.09 38 n - 1 would be irrelevant, and as such the sum is Standard deviation S = √ S2 2.256 6.17 divided directly by n. Two samples may have the same mean, but different variance (Table 6.1). The square root of variance is repre- values of an attribute under study and n sented by standard deviation. Latter is represents the number of values. Thus, five often preferred over the variance because it plants of a species with height 15 cm, 12 shares the same units as the original mea- cm, 10 cm, 22 cm and 16 cm would have a surements, whereas the variance is in the mean of 15 cm ((15+12+10+22+16)/5). The units squared. The reason for first squaring extent of variation within a population of a the values and then determining the square species is best represented by determining root, is to obtain the real picture of the variance. It is a measure of the spread variation. If simple difference of each value of individual observations around the mean, and mean is summed, the negative values i.e. how variable the individuals and their (measurements lower than the mean) may measurements are. It is defined as the av- get cancelled by positive values (measure- erage squared deviation from the mean. If ments higher than the mean), and the various individuals were not far from this result would be zero, and thus meaningless. mean the variance would be minimum. On The squaring converts all values to plus and the other hand, if many individuals were far thus a real diversion from the mean on Variation, Biosystematics, Population Genetics and Evolution 131 either side is taken into account. We may This is significant in economical plants thus determine the standard deviation of a where it is important to determine whether population as: the attributes are related to environmental ss22= variations or genotype. If former is true, it is advisable to improve cultural practices, if and that for a sample as: it is related to genotype, selective breeding would be the answer. ss22= For our sample data, the sample variance REPRODUCTIVE SYSTEMS 2 2 2 would be [(15-15) + (12-15) + (10-15) + The diverse mechanisms of reproduction in 2 2 (22-15) + (16-15) ]/4 = 21 and the sample seed plants can be classified under four standard deviation major categories. Allogamy involves cross- 21= 4. 5825 fertilization between closely related individuals growing at a suitable distance from The determination of sample size from a each other, and results in the formation of population is crucial for the calculation of hybrids. Cross-fertilization promotes het- variance and standard deviation. Sample erozygosity, resulting in considerable varia- size n can be computed from magnitude of tion and diversity in individuals. Autogamy standard deviation (this can be estimated involves self-fertilization, resulting in inbred from the smallest and the largest value of offsprings. It promotes homozygosity, yield- an attribute (say smallest 5, largest 45, ing uniform populations. Agamospermy in- mean 25, deviation 20), level of confidence volves production of seeds resulting from the desired (z, say 0.95%) and maximum width development of embryos from maternal tis- of units from true value (d, say 5): sue without fertilization. Finally, the repro- z 22s duction may result from vegetative propa- n = gation of somatic regions such as shoot seg- d2 ments, bulbs, rhizomes, corms and other veg- For the above parameters the adequate etative structures. Both allogamy and auto- sample size is (0.95 x 0.95) = 0.902 x (20 x gamy are examples of sexual reproduction, 20) = 360.8/(5 x 5) = 14.4. Thus 15 would be involving meiosis and fertilization. The last ideal sample size with these parameters. two, circumvent sexual reproduction and The analysis of variance data is often com- multiplication occurs through asexual re- plicated, especially where more than one production, and are often termed apomixis. factors are responsible for variation. The The products of asexual reproduction are technique of Analysis of variance (ANOVA) known as ramets, where as products of developed by Sir Ronald Fisher (1930) is com- sexual reproduction, which show genetic monly used for dividing the variance into variation as genets. components. It is a powerful statistical procedure for determining whether the differences from the mean are significant, i.e. Outbreeding larger than expected by chance. Thus for Outbreeding, as mentioned earlier is largely example, if probability value of less than responsible for genetic and phenetic diver- 0.002 (There is less than one per cent sity in populations. It is also known as out- chance than variation obtained is due to crossing, allogamy or xenogamy. It enables chance) is obtained through variance analy- plants to adapt to wide range of environmen- sis, the results are due to factors others than tal conditions, and increases likelihood of chance. The analysis involves partitioning survival and evolutionary change. A variety the variance and comparing the role of vari- of mechanisms promote outbreeding. These ous factors (environmental, genetical, etc.). are briefly described below: 132 Plant Systematics

1. Dioecy: The phenomenon involves the lization between the gametes derived occurrence of unisexual flowers, with from the same flower. Gametophytic male and female flowers in different self-incompatibility results from individuals. Some variations of this genetic composition of male gameto- are also encountered as for example, phyte, and sporophytic self-incompat- some individuals having male flowers ibility by genetic composition of others bisexual flowers (androdioecy), sporophytic tissue such as style and some individuals having female flow- stigma. ers others bisexual flowers (gynodioecy), or some individuals Hybridization having male flowers others female and still others bisexual flowers (trioecy). Although occurrence of breeding barriers is 2. Dichogamy: The situation reflects the dominant criterion for distinction between maturation of male and female floral the species, several cases of interspecific parts at different times. In some mem- hybridization have been reported. Based on bers of Apiaceae and Asteraceae, pol- the studies of the Flora British Isles, Stace len grains mature and are released (1989) concluded that there are approxi- before gynoecium is mature and re- mately 70, 000 different naturally occurring ceptive, the phenomenon known as interspecific hybrids, accounting for more protandry. In others, like members of than one fourth of the total number of Chenopodiaceae, the gynoecium is species of seed plants on this planet. mature and receptive before the pol- Natural hybridization is common in Salix, len maturation and release, a feature Helianthus, Quercus, Senecio and Tragopogon. known as protogyny. It is more common in perennials as 3. Herkogamy: It results from physical compared to annuals. separation and stamens and carpels. Hybridization between different species This could be achieved by heterostyly, usually results in sterile offsprings, due to differences in the length of stamens failure of pairing at meiosis, but in several and carpels. In the phenomenon genera like Senecio and Tragopogon, inter- known as distyly some flowers have specific hybridization is often followed by short style and longer stamens (thrum chromosomal duplication, the resulting poly- flowers), whereas others have long ploid (Allopolyploid; Amphiploid) genera- style and short stamens (Pin flowers). tion is sexually stable due to normal meio- In a rarer situation known as trisyly, sis of paired genomes. Many such polyploid three types of stamen and carpel species with distinct characters have been lengths occur. In other cases the style reported in these genera. is curved away from stamens, either Occurrence of intergeneric hybrids is towards right (right-handed flowers) or much rarer, and there may be less than 300 left (left-handed flowers), the situation naturally intergeneric hybrids world-wide. known as enanciostyly. In some gen- Such hybrids are reported mostly in Poaceae era like Mimulus, the stigmas close and Orchidaceae, although in the latter fam- after being touched by a pollinator, ily there are many artificially synthesized thus preventing pollination from intergeneric hybrids, often involving five same flower (movement herkogamy). In different genera. others like Kalmia, the pollinator trig- gers the movement of one or more sta- Introgressive hybridization mens, dusting insect with pollen (trig- The process of introgressive hybridization, ger herkogamy). also known as introgression involves the 4. Self-incompatibility: The phenom- gradual infiltration of one species into that enon refers to the prevention of ferti- of another, and commonly involves species Variation, Biosystematics, Population Genetics and Evolution 133 with some degree of reproductive isolation. share intermediate area largely occupied by The phenomenon involves three steps: the products of hybridization. Juniperus formation of F1 hybrids, their backcrossing virginiana, a mesophytic tree of eastern North with one or another parental species, and America has shown introgression of bushy natural selection of certain favourable re- xerophyte J. ashei from dolomitic outcrops combinant types. The hybrids generally pro- in Texas and Okhlahoma. Throughout the duce a lot of variability through backcross- intermediate area are seen plants with ing and F2 segregation, and may produce hy- partial recombination of characters between brid swarms., occupying a variety of habi- the two well differentiated species. tats. Backcrossing with parental species fre- It must be mentioned that the process of quently results in reversion of hybrid off- introgression may lead to the development springs towards parental types. Backcross- of variants with no taxonomic status, their ing may also result in movement of genes recognition as ecotypes, subspecies, or if the from one species to another via the hybrids intermediate species is sufficiently distinct, and backcrosses. Introgression may lead to recognition as distinct species. three diverse consequences. In some cases, as Gilia capitata, it may lead to merging of Recognition of Hybrids species. The species has eight geographical races, of which three are believed to have The identification of hybrid nature of an off- been distinct in Pliocene. Subsequent gene spring is possible through the use of some flow led to intergrading races, and as such important criteria. they are included under single species. In- Phenetic intermediacy: Hybrids tend trogression may also transfer genetic ma- to have phenetic intermediacy between the terial from one species to another without putative parents. It is easier to recognize merging them. Introgressants, which get morphological characters, which can be plot- stabilized, may lead to the formation of new ted on a scatter diagram (Figure 6.1). Hybrids species. can also detected by calculating hybrid in- Two types of introgression are commonly dex. A list of characters by which the two recognized. Sympatric introgression com- species differ is prepared. Each character- monly occurs between species occurring in state of one species is assigned zero score, the same general geographical area, but whereas each contrasting character-state of occupying different habitats. In California another species given a score of 2. The the introduced Helianthus annuus has hybrid index of each species is calculated by introgressed with native serpentine species summing up the score. Thus one species will H. bolanderi, and the vigorous weedy vari- have hybrid index of 0, and another species ant of latter has spread into irrigated areas. 2n (n refers to the number of characters by Such introgression usually results in the which two species differ). wider spread of one species as compared to another. In England, for example Silene alba Reduced fertility: Hybrids between dif- is spreading in weedy areas, whereas S. ferent species commonly tend to have re- dioica, a woodland species is contracting. In duced fertility, some being totally sterile. Scotland, on the other hand, the more hu- The degree of sterility is reflected upon the mid climate allows S. dioica to flourish out- degree of heterozygosity between genomes side woodlands, on hedgebanks and cliff of parental species. A hybrid which perishes ledges. at zygote stage would represent maximum Allopatric introgression occurs heterozygosity, whereas a hybrid which between species which are now fully manages to produce viable seeds, although allopatric, but had contact in the past. Such less vigorous than either parents, would species are centered in different areas but depict least heterozygosity between parents. 134 Plant Systematics

11 10 9 8 7 6 5 4 3 2 1 2 3 4 5 6 7 8 9 10 11 Stabilization of hybrids Hybrids generally tend to obscure distinction between parental species, due to interme- A diacy, segregation and consequent character combinations. The hybrids, however,

Leaf(mm) breadth often establish themselves as distinct taxa C through a number of methods. Commonest of these is bypass sexual processes and perpetuate by asexually means such as vegetative propagation and agamospermy. B The hybrid may similarly become established sexually by hybridization followed by duplication of chromosomes (Amphiploidy), a phenomenon common in several genera, such as Senecio and Tragopogon. The hybrids 1 2 3 4 5 6 7 8 9 10 11 12 may also establish through translocation Leaf length (cm) heterozygosity, wherein multivalent rings of chromosomes are formed at meiosis, as Figure 6.1 Scatter diagram of populations of seen in Oenothera. In other cases unbal- presumed parental species (A and anced polyploidy, wherein female parents B) and hybrid population. Latter shows structural intermediacy. contributes greater number of chromosome More characters can be added and sets, as compared to male parent. In genus depicted by appropriate symbols. Rosa, for example hybrids are often established because female parent contributes four sets of chromosomes, and male parent F2 segregation: Although F1 hybrids may only one set. tend to be normal, the next (F2) generation In some genera such as Quercus, there is might show a lot of variability, exhibiting the frequent hybridization between closely segregation of parental characters. There related species, resulting in the production may thus be reappearance of parental forms, hybrid swarms. Such sets of hybridizing as also many new recombinations of paren- species constitute a syngameon, or tal characters. semispecies. Distributional area: The hybrids between two species can also be verified by Outbreeders with internal studying their distribution. In case of paren- barriers tal species occupying the same area, the Several genera are reported to include spe- hybrid populations would commonly be lo- cies or species complexes, which include cated in the same area. In case of species races which are not morphologically very occupying different but adjacent areas, hy- distinct, but are unable to interbreed, owing brids would commonly be located in the con- to differences in chromosome number or tact area, or transitional area between the structure (structural hybridity), in others parental species. the chromosomal differences are not clear Artificial synthesis: Hybrids can often (cryptic structural hybridity). Such inter- be created artificially through breeding tech- sterile races are often known as semi-cryp- niques. The comparison of these artificial tic species. Intersterile populations with no hybrids with suspected natural hybrids can apparent morphological distinction are help in confirming their identity. known as cryptic or sibling species. Variation, Biosystematics, Population Genetics and Evolution 135 Inbreeding seed formation occurs without sexual union. Vegetative apomixis is common in Also known as selfing, involves union of ga- plants where sexual reproduction is not pos- metes from the same plant. It may either sible. It is encountered in dioecious species occur within the same flower (autogamy), of Elodea with flowers of only one sex, some or between different flowers of the same species of Poa where flowers are replaced plant (geitonogamy). Although it ensures by bulbils, and sexually sterile species of Po- reproduction, even when there are fewer tentilla, Mentha and Circaea, where genetic individuals, or pollinators are not available. reasons don’t permit normal sexual repro- It, however, reduced variation in populations duction. Agamospermy may be manifested and may even result in accumulation of del- in a variety of ways. Embryo may be formed eterious alleles, a phenomenon known as directly from the sporophytic tissue such as inbreeding depression. Inbreeding species nucellus (adventive embryony), or from tend to exist as relatively uniform popula- diploid gametophyte where meiosis is by- tions, often differing considerably from one passed (gametophytic apomixis), either another, because of absence of gene flow archesporial cells (diplospory) or somatic between them. This commonly results in the cells (apospory) developing directly into dip- production of pure lines. In several genera loid gametophyte. Embryo may develop from of flowering plants, distinct inbreeding popu- unreduced egg (parthenogenesis) or from a lations have been recognized as distinct spe- somatic cell (apogamy). Gametophytic apo- cies. Although they are mostly interfertile, mixis occurs in several families such as Ro- but very low level of outbreeding, and very saceae and Asteraceae. Although male par- high level of inbreeding ensures that the ent does not contribute towards embryonic taxa remain distinct. Those taxa with very tissue, nevertheless pollination is neces- minor differences, but reproductively iso- sary because one of the male nucleus has lated, are known as microspecies, also to fuse with female nucleus to produce en- called as Jordanons, as they were first rec- dosperm, the phenomenon known as ognized by Jordon (1873). Being the result of pseudogamy. Apogamy occurs is prevalent inbreeding, such microspecies are uniparen- in ferns. tal in origin. Many microspecies are recog- The populations produced by agamo- nized with Andropogon virginicus species com- spermy may often show smaller differences, plex, where many inbreed due to cleisto- because any genetic mutation is preserved gamy. Several authors, however, avoid rec- in population, and as these are stable ognizing them as distinct species, because through generations, they are usually rec- of their great numbers. ognized as distinct taxa, often as apomictic Outbreeding and inbreeding are, however, microspecies (agamospecies). Such not isolated mechanisms. Some plants show microspecies are more stable than those both, a phenomenon known as allautogamy. produced through inbreeding (Jardanons). Species of Viola and Clarkia, for example, Agamospecies with better dispersal mecha- have two types of flowers: normally open nisms, as in Taraxacum and Hieracium, are (chasmogamous) flowers which experience widely spread, whereas those with poorly de- cross-pollination. Others remain closed veloped dispersal mechanisms as in Ranun- (cleistogamous), and are self-pollinated. culus are narrowly distributed. Apomixis The phenomenon of apomixis in a broader POPULATION GENETICS sense includes non-sexual reproduction, Population genetics deals with the applica- either through vegetative propagation (veg- tion of genetic principles to populations of a etative apomixis) or agamospermy, where particular species. A population constitutes 136 Plant Systematics a group of individuals growing in a specific Mating systems area and freely interbreeding. A group of interbreeding individuals who share a Three types of mating patterns are recog- common set of genes constitute a Mende- nized, which determine the genotype fre- lian population. The widely distributed quencies of populations. In random mating, species often have separate populations in the two genotypes mate in proportion to their different geographical regions, known as relative frequencies in the population. A subpopulations. Each subpopulation grow- population may undergo random mating with ing in a particular geographical area respect to some traits, but nonrandom with constitutes a local population. The entire respect to others at the same time. Assor- set of genetic information covering all tative mating is a type of nonrandom alleles in a population, forms its gene pool. mating in which the mates are formed on The evolutionary process is best understood the basis of their degree of similarity in phe- by studying the gene pool of Mendelian notype. In human population positive assor- population and not the individual members. tative mating is more common, as mating partners are more similar in phenotype, for example skin colour. In several species of Allele frequencies plants negative assortative mating is While analysing genetic data, it is more logi- prevalent, the mating partners differing in cal to talk in terms of genotype frequency phenotype. In Primula officinalis, for example and allele frequency, instead of absolute pin type flowers (long style and short numbers. Thus in a population with alleles stamens) produce pollen lower down in flower A and a, and 100 aa individuals, 300 but receive pollen higher up, where as the heterozygous Aa individuals and 600 thrum type flowers (long stamens short style) homozygous AA individuals, the genotypic receive pollen lower down, and produce frequencies are calculated as: higher up. Consequently the insect pollinators that work deeper into flower collect AA = 600/1000 = 0.6 pollen from pin types flowers and deposit on Aa = 300/1000 = 0.3 stigma of thrum type flowers. Pollinators aa = 100/1000 = 0.1 working higher up (due to shorter mouth It must be noted AA genotype has 600+600 = parts) do the reverse, collecting pollen from 1200 A alleles, Aa genotype 300 A and 300 a thrum type flowers and depositing on pin type alleles, and aa genotype 100+100 = 200 a flowers. alleles. This totals 1500 A alleles and 500 a The third type of mating involves inbreed- alleles. Allele frequency as such would be ing, mating between relatives, and in calculated as: bisexual flowers, generally between gametes of the same flower. A = 1500/2000 = 0.75 a = 500/2000 = 0.25 Hardy-Weinberg Law Please note, lower the allele frequency, rarer Most species of animals and plants, except it is. Once the value touches 0, the allele is inbreeding plants, random mating is preva- lost, and the other allele with value of 1 lent form of reproduction. Thus each type of would get fixed. mating pair is formed as often as would be It is more appropriate to analyze popula- expected by chance encounter between the tions in terms of alleles, and not genotypes, genotypes. In a randomly mating population because genotypes are disrupted during the with genotype consisting of alleles A and a, process of segregation in subsequent with allele frequency of p and q, respectively generations. (note p + q = 1), genotypes formed from Variation, Biosystematics, Population Genetics and Evolution 137

Table 6.2 Chi-square table showing the relationship between Chi-square vales, degrees of freedom and the probability. For a particular degree of freedom the nearest Chi-square value is located from the row, the the appropriate probability value read from the top row. Probability values lower than 0.05 are highly significant and do not support the hypothesis being tested. The values higher than 0.05 support the hypothesis. freedom Degrees of Probability 0.95 0.90 0.70 0.50 0.30 0.20 0.10 0.05 0.01 0.001 Chi-square values 1 0.004 0.016 0.15 0.46 1.07 1.64 2.71 3.84 6.64 10.83 2 0.10 0.21 0.71 1.39 2.41 3.22 4.61 5.99 9.21 13.82 3 0.35 0.58 1.42 2.37 3.67 4.64 6.25 7.82 11.35 16.27 4 0.71 1.06 2.20 3.36 4.88 5.99 7.78 9.49 13.28 18.47 5 1.15 1.61 3.00 4.35 6.06 7.29 9.24 11.07 15.09 20.52 6 1.64 2.20 3.83 5.35 7.23 8.56 10.65 12.59 16.81 22.46 7 2.17 2.83 4.67 6.35 8.38 9.80 12.02 14.07 18.48 24.32 8 2.73 3.49 5.53 7.34 9.52 11.03 13.36 15.51 20.09 26.13 9 3.33 4.17 6.39 8.34 10.66 12.24 14.68 16.92 21.67 27.88 10 3.94 4.87 7.27 9.34 11.78 13.44 15.99 18.31 23.21 29.59 15 7.26 8.55. 11.72 14.34 17.32 19.31 22.31 25.00 30.58 37.70 20 10.85 12.44 16.27 19.34 22.78 25.04 28.41 31.41 37.57 45.32 30 18.49 20.60 25.51 29.34 33.53 36.25 40.26 43.77 50.89 59.70 50 34.76 37.69 44.31 49.34 54.72 58.16 63.17 67.51 76.15 86.66

fusion of A and a gametes of either parent (five assumptions) the frequencies of the would be AA, Aa, Aa and aa. In terms of alleles don’s change over time. The law also allele frequencies the genotypes could be concluded that as long as mating is random, written as: the genotype frequencies remain in the proportion of p2, 2pq and q2. The sum of AA: p2 AA: 2pq aa: q2 genotype frequencies equals 1, i.e. p2 + 2pq The foundations for these calculations-a + q2 =1. The allelic frequencies remain con- landmark contribution in population genet- stant from generation to generation, in ics- were laid by Godfrey Hardy and Wilhelm such randomly mating populations. Weinberg, independently in 1908. The law Although it is difficult for a population to is based on assumptions that in a infinitely be infinitely large in size, but a fairy large large, randomly mating population, free from population satisfies the requirement. If the mutation, migration and natural selection size of the population is limited, chance 138 Plant Systematics deviations from the expected rates can re- the expected values. It helps us to conclude sult in changes in allelic frequency, a phe- whether the departure is within the prob- nomenon known as genetic drift. It must ability limits, or due to some other phenom- also be remembered, however, that random enon operating on the population. Goodness mating does not always mean that popu- of fit is conventionally measured in terms lations must be interbreeding randomly of chi-square . It is calculated as follows: for all the traits for the law to hold true. In S (Observed value – Expected value)2 human populations, for example, where mar- c2 = riages are chosen on the basis of religion, Expected value cast and colour, the mating partners do not Supposing phenotype X represents a select blood groups or other such traits, population heterozygous for one pair of which may thus satisfy the Hardy Weinberg alleles, and Y homozygous recessive. law. The law thus applies to any locus for Mating between the two is expected to which random mating occurs, even if mat- produce progeny with the two phenotypes in ing is nonrandom for other loci (traits). the ratio of 1:1 ( X = A + a, Y = a + a; pheno- For Hardy-Weinberg law to apply, the popu- types Aa, Aa, aa, aa; X = 2, Y = 2). Supposing lations must be free from mutation, migra- there is a progeny of 30 individuals with 18 tion and natural selection. It is important to of X phenotype and 12 of Y phenotype, note that the condition of no evolutionary whereas the expected number for each phe- change applies only to the trait (locus) in notype is 15. question. A population may be subject to evolutionary processes acting on some genes, 22 2 (18 – 15) (12 – 15) 9 9 while still meeting the Hardy-Weinberg as- c12=+=+= 15 15 15 15 sumptions for other loci. The populations which satisfy the requirements of the law Closer the observed values are to the are said to be in genetic equilibrium or expected, lower the value of c2. If the two Hardy-Weinberg equilibrium. If the ob- match perfectly the values would be zero, served genotype proportions are different although it never happens in nature. Once from the expected, one or more assumptions the c2 value has been calculated, the good- of the law have been violated. ness of fit of this value to the expected numbers is determined. Two parameters are Null hypothesis and Chi- essential for this interpretation. First the number of degrees of freedom for a particu- Square Test lar c2 test is calculated, as number of classes A population with random mating should rep- of data minus one. In our case there are two resent the progeny with numbers of various classes of data (phenotypes X and Y), hence phenotypes closer to the expected numbers. one degree of freedom. The second param- For any population analysis it is important eter is the probability p, which can be deter- to determine, whether the observed values mined from graph of the Chi-square test. The match (fit) the expected values or not. Null graph shows range of c2 values along the X hypothesis states that there is no real dif- axis, probability along the Y axis and curves ference between the observed and the pre- of different degrees of freedom running from dicted data. If the statistical analysis shows base towards the right top. The vertical line that the difference between predicted and starting from the specific c2 value is located observed values is due to chance, the null at the point it touches the relevant curve, hypothesis is proved, if not, it is rejected. and a horizontal line from this point towards Although we could never expect a perfect the left touching the Y axis determines the match, the calculation of goodness of fit, probability values. The probability can also be gives us an indication of the departure from read from the statistical table for Variation, Biosystematics, Population Genetics and Evolution 139

Chi-square (Table 6.2). A value of p between Female = XX = p2(XAXA); 2pq(XAXa); 0.01 (1 per cent; worse fit; one in 100 stud- q2(XaXa) ies, this value would appear by chance) and Male = XY = p(XAY); q(XaY) 0.05 (5 percent; bad fit; one in 20 studies, this value would appear by chance) is considered This is the obvious reason for the preva- significant. A value lower than 0.01 is con- lence of X-linked recessive traits such as sidered highly significant and the hypothesis colour blindness and haemophilia among is rejected outright. It is, however, safer to human males. reject any value lower than 0.05. A value of p higher than 0.05 shows that the departure of Inbreeding and the observed values from expected values is not significant, and the hypothesis is supported. Hardy-Weinberg Law It is important to note that Chi-quare value Inbreeding constitutes another important is calculated on the basis of actual numbers departure from random mating. It is often and not on the basis of percentages or ratios measured in terms of coefficient of inbreed- of various phenotypes. ing (F), which can be calculated as:

(Observed heterozygosity – Expected heterozygosity) Extension of Hardy-Weinberg F = Expected heterozygosity Law Hardy-Weinberg Law may also be extended Greater the value of F, the greater the to situations such as multiple alleles and reduction in heterozygosity relative to that sex-linked alleles. Consider a population expected from the Hardy-Weinberg expecta- with three alleles A, B and C with allele tion. If genotypes are in Hardy-Weinberg pro- frequencies of p, q and r respectively. The portions, F = 0, because observed heterozy- frequencies of various genotypes would be gosity equals expected one. In self-fertiliza- represented as: tion, common in plants, however, the decreases with every generation and homozy- (p + q + r)2 = p2 (AA) + 2pq(AB) + q2 (BB) gosity increases consequently. Supposing we + 2pr (AC) + 2qr (BC) + r 2 (CC) start with a completely heterozygous population Aa reproducing by self-fertilization. In a population with allele frequencies of After one generation the progeny will con- p = 0.52, q = 0.31 and r = 0.17, the following sist of 1/4 AA, 1/2 Aa and 1/4 aa. In next genotypes are frequencies are expected if the generation homozygotes AA will produce only population is in Hardy-Weinberg equilib- AA progeny, aa will produce only aa progeny, rium: whereas only heterozygotes will again seg- AA = p2 = (0.52)2 = 0.27 regate into half heterozygotes and half ho- AB = 2pq = 2(0.52 x 0.31) = 0.32 mozygotes (1/4 AA, 1/4 aa). This will reduce heterozygotes to 1/4 of the total population. BB = q2 = (0.31)2 = 0.10 After large number of generations, there will AC = 2pr = 2(0.52 x 0.17) = 0.18 be no heterozygotes, and the population will BC = 2qr = 2(0.31 x 0.17) = 0.11 be divided into half AA and half aa. CC = r 2 = (0.17)2 = 0.03 It should, however, be noted that although The law can similarly be applied to genotype frequencies change from one gen- sex-linked alleles. In human populations, for eration to another, the allele frequencies example males are XY and females XX. For remain constant. X-linked alleles the female genotypes show normal Hardy-Weinberg distribution, whereas EVOLUTION the male genotypes are distributed in the Evolution consists of progressive changes in same frequencies as respective alleles the gene pool, associated with progressive 140 Plant Systematics adaptation of a population to its environment. amino acid, when it is known as silent The evolution is the end result of four mutation. Mutations may be irreversible or distinct processes, which result in changes reversible. Change from A to a constitutes in allelic frequencies, ultimately resulting forward mutation, whereas from a to A as in cumulative changes in the genetic char- reverse mutation. In reversible mutations, acteristics of populations. It is believed that forward mutations are offset by reverse these processes over a geological time lead mutations and as such an equilibrium in to the evolution of species. allele frequencies is reached.

Mutation Migration It is now agreed that variation in heritable Migration is similar to mutation in that new traits results from mutations. Mutation is alleles are introduced into the local popula- an important process in evolution. It was tion, although the new alleles are derived earlier believed that variations result mostly from another population, and not from from adaptive inheritable change induced by mutation within the same population. In environment. This adaptation theory, populations with no migrations, the genetic based on Lamarckism, believed in the changes cause considerable differentiation inheritance of acquired characteristics. The in subpopulation of a population. This middle of twentieth Century saw the emer- genetic differentiation among subpopula- gence of mutation theory, to explain tions gets minimized when exchange of changes in several bacterial populations. individuals through migration occurs. Only Although some mutations occur only in the a small amount of migration is sufficient to somatic cells, and not passed to the next prevent the accumulation of high level of generation (somatic mutation), others genetic differentiation. However, in spite of occurring in germ cells are transmitted from migration, the genetic differentiation may one generation to another (genetic muta- continue if other evolutionary forces, such tion; germ-line mutation). A mutation may as natural selection for adaptation to local involve changes within the same base type environment, are operating. (purine to purine; pyrimidine to pyrimidine), when its is known as transition mutation; in others it may involve changes from a Random Genetic Drift purine to a pyrimidine or vice versa, when Although population is supposed to be it is termed transversion mutation. A infinite in size as per Hardy-Weinberg Law, mutation in which base pair change in DNA in practice they are finite or limited in size, causes a change in mRNA codon so that a although large enough so that chance different amino acid is inserted into the factors have little effects on allelic frequen- polypeptide chain constitutes missense cies. Some populations, however, may be mutation. On the other hand, a change that small and the chance factors may produce results in mRNA codon for an amino acid to large changes in allelic frequencies. Ran- stop is known as nonsense mutation. dom change in allelic frequency due to Most of the newly arising mutations are chance is called random genetic drift or harmful to the organism, and are eliminated simply genetic drift. Ronald Fisher and from the population in successive genera- Sewall Wright, who laid the foundations of tion. Some mutations may result in amino population genetics, were the first to describe acid changes that cause detectable change how genetic drift affects the evolution of in structure or function of the organism. populations. Such neutral mutations also do not partici- Imagine a small population with equal pate in evolution. Similarly a base pair may number of individuals with either of the two change mRNA codon that inserts the same biallelic traits. In a population of twenty Variation, Biosystematics, Population Genetics and Evolution 141 individuals, say 15 carry homozygous domi- les may bounce a bit, but do not stray too nant genotype, 5 heterozygous genotype and much from steady state. 10 homozygous recessive genotype. the frequency of a allele would be 5 + 20 = 25, Natural Selection i.e. 0.62. Supposing all the individuals carrying the dominant allele (AA or Aa Natural selection is the deriving force of genotypes) perish, the population will be left adaptive evolution. The theory of natural with only a allele, and hence allelic selection was first developed independently frequency of a equals 1. The genetic drift, by Charles Darwin and Alfred Russel Wallace and consequently evolution has occurred in and presented at the Linnean Society of the population due to chance. London in 1858. Darwin further pursued this In addition to random factors such as theory and published in his famous book, The floods, fires or cyclones which cause genetic Origin of Species (1859). The theory has drift due to mortality, the genetic drift may undergone considerable refinement through also result from other causes. In small popu- the incorporation of genetic concepts in the lations, although large number of gametes succeeding years. The theory is based on two are produced, only a few will participate in premises. First- In all organisms, more fertilization and represented in the zygotes offspring are produced than survive and of next generation. This process of random reproduce (originally proposed by Thomas sampling (sampling error) of gametes from Malthus); Second- Organisms differ in their generation to generation, may result in ability to survive and reproduce, and some of changes in allele frequencies by chance, these differences are due to genotype. It is and consequent genetic drift. deduced that in every generation, the Genetic drift may cause a number of evo- genotypes that promote survival in the lutionary changes in addition to changes in prevailing environment (favoured allelic frequencies. As different populations genotypes) must be present in excess among may experience genetic drift in different individuals of reproductive age , and hence directions, and as a result, the populations the favoured genotypes will contribute diverge in allelic frequencies. Also, we disproportionally to the offsprings of the next expect more genetic drift in smaller popula- generation. As a result of this process, the tions as compared to larger populations. alleles that enhance survival and reproduction increase in frequency from Mutation versus Random generation to generation, and the population becomes progressively better equipped to Genetic Drift survive and reproduce in the prevailing Mutation continues to introduce new genetic environment (Survival of the fittest). This changes in populations, whereas random progressive genetic improvement constitutes genetic drift removes certain traits from the the process of evolutionary adaptation. population. How does the balance between two opposite forces is achieved? Infinite Darwinian Fitness and alleles model attempts to explain this balance. According to this model, each Fitness Coefficient mutation in a gene is assumed to generate For natural selection to operate, survival of a novel allele that has never been seen the fittest is not the only criteria, the popu- before. The model also assumes that lation should be able to reproduce and pass random genetic drift occurs by the repeated on the fit genes to the next generation. The random sampling, as described earlier. In relative reproductive ability of a genotypes this situation the mutation and genetic drift is represented as Darwinian fitness. It is balance each other, and an equilibrium is represented by W, and when comparing reached. In this state of balance, some alle- populations, the one able to produce most 142 Plant Systematics offspring is given value of 1. Other popula- being recessive, s equals 1, and the num- tions are assigned value relative to this. ber of a alleles eliminated by selection will Supposing out of the four populations A be proportional to q2s according to Hardy- produces 15 offspring, B 10, C 8 and D 5 Weinberg proportions, where as the number offspring. The population A will be assigned of new a alleles introduced by mutation will W value of 1, B 10/15 = 0.66, C 8/15 = 0.53, be proportional to m. At equilibrium the two and D 5/15 = 0.33. should balance and as such q2s = m It is, however, important to consider the number of offspring surviving, rather than $ t q = number produced. Darwinian fitness can st+ also be used to calculate Selection coeffi- $ cient, which is a measure of relative where q stands for equilibrium value. In intensity of selection against a genotype, or those cases where the harmful allele shows selective disadvantage of a disfavoured partial dominance in having small detri- genotype. It is symbolized as s and calculat- mental effect on fitness of the heterozygous ed as: carriers then the fitness of genotypes AA, Aa and aa can be written as 1 : 1 - hs : 1 - s, s = 1 - W where hs stands for selection coefficient Thus for above populations the selection against heterozygous carriers, h refers to coefficient would be calculated as: Popula- the degree of dominance. When h = 1, the tion A s = 1- 1 = 0, B 1 - 0.66 = 0.44, C 1 - 0.53 harmful allele is completely dominant, but = 0.47, D 1 - 0.33 = 0.67. Thus Population A when h = 0 it is completely recessive, and has zero selective disadvantage, B 44%, C when h = 1/2 the fitness of heterozygous 47%, and D 67% selective disadvantage. genotype is average of homozygous geno- Whereas the estimation of fitness is types. For most harmful alleles that show relatively easier with microorganisms with partial dominance, the value of h is smaller shorter life span, the same in higher than 1/2. organisms may take several years of study. In such organisms it is convenient to divide Heterozygote superiority fitness into its component parts, and Whereas in most cases of selection, the estimate these parts separately. The fitness of heterozygote is intermediate commonly used components include: between dominant and recessive genotypes, viability, the probability that the zygote of a or equalling one of them, some cases of se- genotypes survives up to reproductive stage, lection lead to superior heterozygote. The and fertility, the average number of offspring phenomenon is known as overdominance, produced by a genotype during the reproduc- heterozygote superiority or heterosis. An tive period. equilibrium of allelic frequencies is maintained, because both alleles are favoured in Selection-Mutation Balance heterozygous state. Selection will lead to The process of natural selection reduces the changes in allelic frequencies, but once the frequency of harmful alleles in a population. equilibrium is reached, the frequencies will These harmful alleles, however, are never stabilize. With overdominance the fitness of eliminated, since mutations from wild types genotypes AA, Aa and aa may be written as continuously produce harmful alleles. These 1 - s : 1 : 1 - t, where s and t are the selection two opposite forces maintain an equilibri- coefficients against AA and aa, respectively. um within a population. In selection- The proportion of A alleles eliminated by mutation balance new mutations exactly off- selection in event of random mating is p2s/ set selective eliminations. In populations p = ps, and the proportion of a alleles elim- (with A a alleles) with harmful (lethal) allele inated by selection is q2t/q = qt. When the Variation, Biosystematics, Population Genetics and Evolution 143 equilibrium is reached and the selective views concerning the evolution of species. elimination of the two alleles is balanced. Kimura (1968) proposed neutral theory of µ $ evolution, according to which most genetic ps = qs variation observed in natural populations µ t due to accumulation of neutral mutations. p = st+ Whereas the nonneutral mutation affects the phenotype of the organism and can be With overdominance of one allele, the acted upon by natural selection, the neu- allele frequencies ultimately reach equilib- tral mutation does not affect the phenotype rium, but the rate of approach depends on of the organism and not acted on by natural magnitudes of s and t. The equilibrium is selection. Since neutral mutations do not reached much faster, when there is a strong affect phenotype, they spread throughout a selection against homozygotes. population according to their frequency of appearance and to genetic drift. This non- Molecular evolution Darwinian evolution has been called as Molecular evolution involves changes in survival of the luckiest as opposed to sur- populations at the level of DNA and protein vival of the fittest as advocated by Darwin- sequences. It attempts to correlate these ian theory. Although Kimura agreed with changes with evolution of new genes and Darwin that natural selection is responsible organisms. Whereas the population genet- for adaptive changes in species during ics is concerned with changes in gene fre- evolution, but he stressed that modern quencies from generation to generation, the variation in gene sequences is explained by molecular evolution considers much longer neutral variation rather than adaptive time frames, associated with speciation. variation. The field of molecular evolution is In further elaboration of their theory, multidisciplinary, involving data from genet- Kimura et al., (1974) developed five prin- ics , ecology, evolutionary biology, statistics ciples that govern the evolution of genes at and even computer science. The analysis of molecular level: molecular data can help in unravelling the 1. For each protein, the rate of evolution, historical records preserved in genomes, and in terms of amino acid substitutions, identifying the dynamics behind evolution- is approximately constant with regard ary processes to understand and reconstruct to neutral substitutions that do not the chronology of change. affect protein structure or function. Molecular evolution mostly operates by 2. Proteins that are functionally less im- substitutions that lead to the change of codon portant for the survival of an organ- for one amino acid to another. Leucine codon ism, or parts of a protein that are less CUU, for example can be changed to isoleu- important for its function, tend to cine codon AUU by change in single base evolve faster than more important pro- pair of DNA, where the change to codon for teins or regions of a protein. In other chemically dissimilar asparagine (AAU), two words, during evolution, less important base pair changes must occur. The meth- proteins will accumulate amino acid ods of analysing DNA sequence data, and its substitutions more rapidly than impor- utilization in phylogenetic analysis is tant proteins. discussed in detail in the chapter on 3. Those amino acid substitutions that Molecular Systematics. do not disrupt the existing structure and function of a protein (conservative substitutions) occur more fre- Neutral Theory of Evolution quently in evolution than those which Molecular studies over the last few decades disrupt (disruptive substitutions) ex- have also seen emergence of alternate isting structure and function. 144 Plant Systematics

4. Gene duplication must always precede America) are well established species the emergence of a gene having a new but readily interbreed when brought function. into the same area (vicarious species). 5. Selective elimination of definitively 2. Ecological isolation: Two species deleterious mutations and random fix- occupy the same general area but ing of selectively neutral or very occupy different habitats. Silene alba slightly deleterious alleles occur far grows on light soils in open places more frequently in evolution than while S. dioica on heavy soils in shade. Darwinian selection of definitely ad- Their habitats rarely overlap, but vantageous mutants. when they do, hybrids are encoun- Although, the DNA sequencing of tered. hundreds of thousands of different genes 3. Seasonal isolation: Two species oc- from thousands of species has provided cur in the same region but flower at compelling support for the five principles, different seasons. Sambucus racemosa there are, however, some geneticists called and S. nigra flower nearly 7 weeks selectionists, who oppose neutralist theory. apart. It is, however, agreed by all that genetic drift 4. Temporal isolation: Two species and natural selection both play key roles in flower during the same period but dur- evolution. ing different times of the day. Agrostis tenuis flowers in the afternoon, Speciation whereas A. stolonifera flowers in the morning. Speciation is a general term for a number 5. Ethological isolation: Two species of different processes which involve the pro- are interfertile but have different duction of new species. The speciation com- pollinators. Humming-birds for exam- monly results from the development of bar- ple, are attracted to red flowers and riers to gene flow. Different types are isolat- hawk-moths to white ones. ing mechanisms are responsible for the de- 6. Mechanical isolation: Pollination be- velopment of barriers. tween two related species is prevented Isolating Mechanisms by structural differences between flowers, as for example between Ophrys Isolation is the key factor preventing inter- insectifera and O. Apifera. mixing of distinct species through preven- II. Post-pollination Mechanisms tion of hybridization. Based on whether isolating mechanisms operate before or after 1. Gametophytic isolation: This is the sexual fusion, two main types of mecha- commonest isolating mechanism nisms are distinguished: prezygotic mecha- wherein cross-pollination occurs but nisms and postzygotic mechanisms. A de- the pollen tube fails to germinate or if tailed classification of isolating mechanisms germinated, it can’t reach and penetrate the embryo sac. is presented below. 2. Gametic isolation: In such cases, re- A. Prezygotic mechanisms ported in several crop plants, the pollen tube releases the male gametes (operating before sexual fusion) into the embryo sac, but gametic and/ I. Pre-pollination Mechanisms or endospermic fusion does not occur. 1. Geographical isolation: Two species are separated geographically by a gap B. Postzygotic mechanisms larger than their pollen and seed dis- (operating after sexual fusion) persal. Platanus orientalis (Mediterra- 1. Seed incompatibility: The zygote or nean region) and P. occidentalis (North even immature embryo is formed but Variation, Biosystematics, Population Genetics and Evolution 145

fails to develop and as such a mature allopolyploids. Such allopolyploids depict seed is not formed. The phenomenon normal pairing at meiosis and thus repre- is commonly encountered in cross sent well-isolated, phenotypically as well as between Primula elatior and P. veris. genotypically distinct species. Classical 2. Hybrid inviability: Mature seed is example hybridization followed by polyploidy formed and manages to germinate but is provided by evolution of bread wheat Triti- the F1 hybrid dies before the flower- cum aestivum, although it has taken a ing stage is reached. The phenom- period of several thousand years starting enon is commonly encountered in from Neolithic times. The two diploid spe- crosses between Papaver dubium and cies Triticum monococcum (AA) and Aegilops P. rhoeas. speltoides (BB) were involved in the evolu- 3. F1 hybrid sterility: F1 hybrids are tion of tetraploid T. dicoccum (AABB). Subse- fully viable and reach flowering stage quent hybridization between the latter and but flowers may abort or abortion may Aegilops tauschii (Syn: A. squarrosa) (DD) and occur as late as F2 embryo formation, subsequent duplication resulted in the evo- with the result that the F1 hybrid fails lution of hexaploid T. aestivum (AABBDD). to produce viable seeds. Abrupt speciation also results from the phe- 4. F2 hybrid inviability or sterility: F2 nomenon of apomixes, and an increasing hybrid dies much before reaching the number of species are being formed in gen- flowering stage or fails to produce era such as Taraxacum, Euphrasia and seeds. Alchemilla, where the normal reproductive Once prezygotic isolation is partially process is bypassed and any expressive mu- achieved, there is a snowball effect in which tations are retained within the population. the rate of accelerates. Individuals who en- gage in interspecific mating suffer an in- Gradual speciation creasing disadvantage until at last the bar- This is a more common phenomenon in na- rier of gene flow is complete. New species ture. It may involve phyletic evolution when may develop through the mechanism of one species might evolve into something dif- abrupt speciation or gradual speciation. ferent from its ancestor over a period of time (phyletic speciation). Alternatively, a popu- Abrupt speciation lation belonging to a single species might The phenomenon of abrupt speciation is differentiate into two evolutionary lines commonly involves sympatric populations of through divergent evolution (additive spe- two different species and as such is also ciation). known as sympatric speciation. It is commonly the result of a sudden change in chro- Phyletic Speciation mosome number or structure, producing The concept of phyletic speciation has been instantly an almost irreversible barrier the subject of considerable debate. It is the between populations and thus effectively sequential production of species within a isolating them. Phenomenon is met in gen- single evolutionary lineage. Species A might, era such as Tragopogon, Bromus and Senecio over a period of time, change through spe- (see examples under Chromosomes in chap- cies B and C into species D without ever ter on Taxonomic evidence) . The species splitting. The new species produced in this are often well isolated and any chance manner are variously called successional hybridization fails to culminate into suc- species, palaeospecies, and allochronic cessful hybrids because of genomic differ- species. The species which have become ences. In some cases, however, hybridiza- extinct in the process are termed taxonomic tion may be accompanied by chromosome extinctions. Wiley (1981), while agreeing duplication resulting in the formation of with the concept of phyletic character trans- 146 Plant Systematics

Ancestral species Ancestral species

Environmental differentiation

Race A Race B

Subspecies B Adaptive radiations Subspecies A

Reproductive Isolation Species B Reproductive isolation Species A

Species B Species A Species B Species A

A B

Figure 6.2 Allopatric speciation. A: Allopatric speciation through environmental differentiation, successive adaptive radiations and development of reproductive isolation. B: Allopat- ric speciation resulting from geographical separation of populations of an ancestral species. Variation, Biosystematics, Population Genetics and Evolution 147 formation, rejects the concept of phyletic mental differentiation. They then speciation on the grounds that: undergo adaptive radiations to develop 1. Recognition of phyletic species is an physical and physiological differences, arbitrary practice. Mayr (1942) argues which sooner or later get genetically that delimitation of species, which do fixed (ecotypes). With further morpho- not belong to the same time-scale, is logical and physiological differentia- difficult. tion, they form distinct varieties (or 2. Arbitrary species result in arbitrary subspecies). Development of reproduc- speciation mechanisms. tive isolation establishes these as dis- 3. Phyletic speciation has never been tinct species that will retain their satisfactorily demonstrated. identity even if a future chance should draw them together (Figure 6.2 A). Allopatric introgressive speciation Additive Speciation 2. : Although origin of species through Additive speciation is the commonest mode hybridization is commonly results from of speciation, which adds to the diversity of sympatric species, examples of living organisms. Mayr (1963) suggested the speciation involving two allopatric spe- occurrence of reductive speciation, whereby cies, which had contacts in the past, two previously independent species fuse into are also reported. Quercus brandegei, a third, new species, themselves becoming now confined to Cape Region of Baja extinct. Hybridization likewise produces new California, extended to west in Terti- species but this always leads to an addition ary times and had a narrow zone of in the number of species. contact in Edwards Plateau escarp- It is impossible to imagine that two evo- ment area, with Q. virginiana of S. E. lutionary species can actually fuse to pro- Coastal plain of U.S.A. Allopatric duce a third species and themselves become introgression between the two species extinct. This may happen in a particular re- occurred at the contact zone, but the gion, but not over the entire range of these genes spread slowly because of limited species. The various modes of additive spe- contact of parental species and pre- ciation are described below: dominantly rhizomatous propagation. 1. Allopatric speciation: Lineage inde- The introgressed population, now in pendence and consequent speciation contact with only Q. virginiana, is suf- result from geographical separation of ficiently stabilized to be classified as lineages, i.e. the actual physical sepa- a distinct species Q. fusiformis. ration of two relatively large popu- 3. Allo-parapatric speciation: Such lations of a single species. Over a speciation occurs when two period of time, such separation would populations of an ancestral species enable these geographical races to de- are separated, differentiate to a degree velop and maintain gene combinations that is not sufficient for lineage inde- controlling their morphological and pendence, and then develop lineage physiological characters. The develop- independence during a period of ment of reproductive isolation would parapatry (limited sympatry). It differs sooner or later result in the establish- from allopatric speciation in the sense ment of distinct species (Figure 6.2 B). that speciation is completed after a Allopatric speciation may also period of sympatry and the process of result from the development of new attaining lineage independence is species along the boundaries of a large potentially reversible because it is central population. These marginal possible that two partly differentiated populations (races) get separated from populations could form a single evolu- the main population during environ- tionary lineage showing clinal varia- 148 Plant Systematics

tion after they meet rather than the somal modifications. The resultant period of sympatry reinforcing differ- chromosome arrangement must be ences between them. fully viable in the homozygous state 4. Parapatric speciation: This occurs but of reduced viability in the hetero- when two populations of an ancestral zygous state. species differentiate despite the fact 6. Sympatric speciation: The examples that no complete disjunction has oc- of sympatric speciation due to hybridi- curred. The daughter species may zation and apomixis have been dis- share a small fraction of their respec- cussed under abrupt speciation. The tive ranges and interbreed within this process of ecological sympatric narrow contact zone and yet still dif- speciation is a slow one of gradual ferentiate. speciation. The ecological differences 5. Stasipatric speciation: This is simi- in the habitats result in adaptive lar to parapatric speciation except that radiations in populations which gradu- it results from spontaneous chromo- ally evolve into new species. Chapter 7 Taxonomic Evidence

Over the last few decades, the affinities be- last two centuries, more and more micro- tween plant groups have been redefined as scopic characters of morphology were incor- more and more information is accumulated porated. Although floral morphology has been from various sources. Newer approaches in the major material for classifications, other recent years include (a) increasing reliance morphological characters have also contrib- on phytochemical information (Chemotax- uted in specific groups of plants. The diver- onomy); (b) studies on ultrastructure and sity of morphological features has already micromorphology; (c) statistical analysis of been discussed in detail under Descriptive the available data without much a priori terminology in Chapter Four. weighting and providing a synthesis of all the available information (Taxometrics); Habit and (d) analysis of phylogenetic data to con- Life-forms—though of little significance to struct phylogenetic relationship diagrams taxonomy—allow a means of estimating (Cladistics). The aforesaid disciplines con- adaptiveness and ecological adjustment to stitute the major modern trends in tax- the habitat. In Pinus, bark characters are onomy. Data continues to flow from differ- used for identification of species. Woody and ent disciplines, so that the process of analy- herbaceous characters have been the pri- sis and synthesis is an ongoing activity. Tax- mary basis of recognition of Lignosae and onomy (Systematics) is as such a field of Herbaceae series within dicots by unending synthesis. The following disci- Hutchinson (1926, 1973). plines have contributed to a greater or lesser For several decades it was believed that extent to a better understanding of taxo- trees or shrubs with simple leaves repre- nomic affinities between plants. sented the most primitive condition within angiosperms. Increased evidence over the last decade, however, is pointing towards the MORPHOLOGY assumption that the perennial herbaceous Morphology has been the major criterion for condition in paleoherbs such as Cerato- classification over the last many centuries. phyllaceae, Nymphaeaceae and Piperaceae The initial classifications were based on represents the archetype of the most primi- gross morphological characters. During the tive angiosperms. 150 Plant Systematics Underground parts used fruit morphology in identification of Indian genera of Compositae (Liguliflorae). Rhizome characteristics are important for In Asteraceae—the shape cypsela (usually identification of various species of the ge- called achene), presence or absence of pap- nus Iris. Similarly, bulb structure (whether pus and whether the pappus is represented bulbs are clustered on rootstock or not) is by hairs, scales or bristles, the presence or an important taxonomic criterion in the ge- absence of beak, and its length, the number nus Allium. Davis (1960) has divided Turk- of ribs on the cypsela—constitute valuable ish species of the subgenus Ranunculus of identifying features. The number of capsule genus Ranunculus based on rootstock and valves is used in segregating genera in fam- habit. ily Caryophyllaceae (Melandrium, Silene, Cerastium). Seed characters are valuable Leaves identification features in the genus Veronica. Leaves are important for identification in palms, Salix and Populus. The genus Azadirachta has been separated from Melia ANATOMY among other features by the presence of Anatomical features have played an increas- unipinnate leaves as against bipinnate in ingly important role in elucidation of phylo- the latter. Similarly, the genus Sorbus has genetic relationships. Anatomical charac- been separated from Pyrus, and genus teristics are investigated with the help of a Sorbaria separated from Spiraea on the ba- light microscope; whereas ultrastructure sis of pinnate leaves. Stipules are an im- (finer details of contents) and micromor- portant source for identification in Viola and phology (finer details of surface features) Salix. Leaf venation is important for the iden- are brought out using an electron micro- tification of the species in Ulmus and Tilia. scope. Anatomical work of taxonomic sig- Interpetiolar stipules are useful for identifi- nificance was largely undertaken by Bailey cation within family Rubiaceae. and his students. Carlquist (1996) has discussed the trends of xylem evolution, espe- Flowers cially in the context of primitive an- Floral characters are extensively used in de- giosperms. limitation of taxa. These may include the calyx (Lamiaceae), corolla (Fabaceae, Cory- Wood anatomy dalis), stamens (Lamiaceae, Fabaceae- Wood represents secondary xylem constitut- Mimosoideae), or carpels (Caryophyllaceae). ing the bulk of trees and shrubs, formed A gynobasic style is characteristic of through the activity of vascular cambium. Lamiaceae. Similarly, the gynostegium It primarily consists of tracheids and ves- characterizes Asclepiadaceae (now recog- sels. Tracheids are long narrow elements nized as subfamily Asclepiadoideae of fam- with tapering ends, imperforate at ends, and ily Apocynaceae). Different species of Euphor- transfer of water and minerals occurring bia have a distinctive cyathium inflores- through pit-pairs (two adjacent pits of two tra- cence with clusters of male flowers each rep- cheids, separated by primary cell walls). The resented by a single stamen. vessels, on the other hand, are composed of vessel elements, much broader than trac- Fruits heids and with perforation plates at ends Fruit characteristics are very widely used (with opening not having primary walls un- in identification. Coode (1967) used only fruit like pit-pair). Vessel elements are joined characteristics in delimitation of species of end to end to form long tubes, the vessels. the genus Valerianella. Singh et al. (1972) Perforation plate may be simple with a Taxonomic Evidence 151 single opening, or compound with several associated gaps (lacunae) left in the vascu- openings. Latter with elongated openings in lar cylinder of stem at each node are dis- a row like a ladder is known as scalariform, tinctive for several groups. The node may a common type in primitive angiosperms. have single gap (unilacunar) from single leaf trace or three leaf traces (two additional commonly entering stipules) or three gaps (trilacunar) associated with three leaf traces (Fig- ure 7.1) The genus Illicium has been separated from Winteraceae because of unilacunar nodes, continuous pseudosiphonostele and the absence of granular material in stomatal depressions. Trichomes Figure 7.1 Nodal anatomy. A: Unilacunar node Trichomes constitute appendages of epider- with one leaf trace; B: Trilacunar mis which may be non-glandular or glandu- node with three leaf traces; C: lar. Non-glandular trichomes may be in the Unilacunar node with three leaf form of simple unicellular or multicellular traces. hairs (common in Brassicaceae, Lauraceae and Moraceae), in the form of vesicles, Vessels are absent in Gymnosperms, but peltate hairs (Olea) or flattened scales. present in Angiosperms. It is commonly believed that there has been a progressive evolution in angiosperms from tracheids to long, narrow vessel elements with slanted, scalariform perforation plates, to short, broad vessel elements with simple perforation plates. Studies on wood anatomy have contributed largely in arriving at the conclusion that Amentiferae constitute a relatively advanced group, and that Gnetales are not ancestral to angiosperms. Bailey (1944) concluded that vessels in angiosperms arose from tracheids with scalariform pitting, whereas in Gnetales they arose from tracheids with circular pitting, thus suggesting an independent origin of vessels in these two groups. Demonstration of vessel-less angiosperms (Winteraceae, Trochoden- draceae), also having other primitive features, has led to the conclusion that angiosperm ancestors were vessel-less. The separation of Paeonia into a distinct family Figure 7.2 Trichomes. A: Simple unicellular Paeoniaceae and Austrobaileya into a sepa- hair; B: Multicellular hair; C: rate family Austrobaileyaceae has been sup- Scale; D: Candelabra trichome of ported by studies of wood anatomy. Verbascum; E: Vesicular hair of Nodal anatomy has considerable signifi- Atriplex; F: Peltate hair; G: Stellate cance in angiosperm systematics. The num- hair Styrax; H: Secretary gland of ber of vascular traces entering leaf base and Thymus; I: Stinging hair of Urtica. 152 Plant Systematics

Figure 7.3 Stomatal apparatus in Angiosperms. A: Anomocytic type with epidermal cells around stomata not differentiated; B: Paracytic type with two or more cells parallel to the guard cells differentiated as subsidiary cells; C: Diacytic type with two subsidiary cells at right angles to the guards cells; D: Anisocytic type with three subsidiary cells of unequal size; E: Actinocytic type with stomata surrounded by a circle of radiating cells; F: Tetracytic type with four subsidiary cells; G: Cyclocytic type with concentric rings of subsidiary cells; H: Graminaceous type with dumb-bell shaped guard cells with two small subsidiary cells parallel to the guard cells.

Branched hairs may be dendroid, stellate stinging hairs of Urtica are highly special- (Styrax) or candelabrum-like (Verbascum). ized with silica tip which readily breaks Glandular trichomes may be sessile or when hair is touched. The broken tip is stalked and present a variety of forms. sharp like a syringe and easily penetrates Unicellular glandular hairs of Atriplex are the skin injecting irritating cell contents. bladder-like (Figure 7.2) with few-celled stalk Trichomes hold considerable promise in and basal cell and they secrete salt. Others systematics of angiosperms. Trichomes may secrete nectar (calyx of Abutilon), mu- have been of considerable help in Cruciferae cilage (leaf base of Rheum and Rumex). The (Schulz, 1936), especially in the genera Taxonomic Evidence 153

Arabis and Arabidopsis. Trichome characters stomata in the former as against anomocytic are very useful in the large genus Astraga- in the latter. The stomatal features, how- lus (with more than 2000 species). The Hi- ever, are not always reliable. In Streptocarpus malayan species Hedera nepalensis is dis- (Sahasrabudhe and Stace, 1979) cotyledons tinguished from its European relative H. have anomocytic while mature organs have helix in having scaly trichomes as against anisocytic stomata. In Phyla nodiflora (syn stellate in the latter. In family Combretaceae = Lippia nodiflora) the same leaf may show the trichomes are of immense significance anomocytic, anisocytic, diacytic and in classification of genera, species or even paracytic stomata (Pant and Kidwai, 1964). varieties (Stace, 1973). Trichomes are also diagnostic characters for many species of Ver- Leaf anatomy nonia (Faust and Jones, 1973). The florets of Poaceae are reduced and do Epidermal features not offer much structural variability. Leaf anatomy has been of special taxonomic help Epidermal features are also of considerable in this family. The occurrence of the C-4 taxonomic interest (SEM epidermal features pathway and its association with Kranz are discussed under ultrastructure and anatomy (dense thick-walled chlorenchy- micromorphology). Prat (1960) demonstrated matous bundle sheath, mesophyll simple), that one can distinguish a Festucoid type has resulted in revised classification of sev- (simple silica cells, no bicellular hairs) and eral genera of grasses. Melville (1962, 1983) Panicoid type (complicated silica cells, developed his gonophyll theory largely on the bicellular hairs) of epidermis in grasses. basis of the study of venation pattern of Stomatal types (Figure 7.3) are distinctive leaves and floral parts. The rejection of San- of certain families such as Ranunculaceae miguelia and Furcula as angiosperm fossils (anomocytic), Brassicaceae (anisocytic), from the Triassic has largely been on the Caryophyllaceae (diacytic), Rubiaceae (para- basis of detailed study of the venation pat- cytic), and Poaceae (graminaceous). Ano- tern of leaves (Hickey and Doyle, 1977). The mocytic type has ordinary epidermal sur- more recent rediscovery of Sanmiguelia from rounding the stomata. In others the epider- the Upper Triassic of Texas (Cornet 1986, mal cells surrounding the stomata are dif- 1989) points to presumed angiosperm incor- ferentiated as subsidiary cells. There may porating features of both monocots and be two subsidiary cells at right angles to the dicots. Discovery of the Late Triassic Pan- guard cells (diacytic), two are more parallel naulika (Cornet) from the Virginia-North to the guard cells (paracytic), or three sub- Carolina border has reopened the possibili- sidiary cells of unequal size (anisocytic). ties of Triassic origin of angiosperms. Other types include actinocytic type with stomata surrounded by a ring of radiating cells, cyclocytic with more than one con- Floral anatomy centric rings of subsidiary cells and tetra- Floral anatomy has been one of the thor- cytic with four subsidiary cells. The stomatal oughly explored areas, with significant con- complex of Poaceae is distinctive in having tributions to the understanding of the phy- two dumb-bell shaped guard cells with two logeny of angiosperms. Vascular traces in small subsidiary cells parallel to the guard the carpels of various genera of the family cells. Ranunculaceae have confirmed the origin Stace (1989) lists 35 types of stomata in of achene (Ranunculus, Thalictrum, etc.) from vascular plants. Closely related families follicle (Delphinium, Aquilegia, etc.) through Acanthaceae and Scrophulariaceae are successive reduction in the number of distinguished by the presence of diacytic ovules ultimately to one. The additional 154 Plant Systematics traces which would have gone to other species. Floral anatomy also supports the ovules, now aborted, can be observed in separation of Menyanthes from Gentianaceae many genera. There, thus, is no justifica- into a distinct family Menyanthaceae. The tion for Hutchinson’s separation of achene- genus Centella is separated from Hydrocotyle bearing genera and follicle-bearing genera on the basis of inflorescence being a cyme, into separate families Ranunculaceae and and ovules receiving vascular supply from Helleboraceae, respectively. alternate bundles. In Hydrocotyle, the inflo- Melville (1962, 1983) developed his rescence is an umbel and the ovules receive gonophyll theory after studying the vascu- vascular supply from fusion of two adjacent lature of carpel and other floral parts through bundles. Paeonia is a classical example of a the clearing technique. He believed the an- genus, which was removed from family giosperm carpel to be a modified dichotomous Ranunculaceae into a distinct family fertile branch adnate to the petiole of a leaf. Paeoniaceae. The separation has been sup- Sporne (1971) cautioned against such a dras- ported by evidence from morphology, embry- tic conclusion citing the example of bath- ology and chromosomes. Floral anatomy also room loofah. supports this separation, as both sepals and The genus Melandrium was segregated petals have many traces, carpels have five from Silene on the basis of the ovary being traces and the stamens are centrifugal. De- unilocular as against partly septate in Silene. velopmental studies have indicated that Detailed floral anatomy revealed that in all some flowers, such as Apiaceae and the species of both genera, the ovary is mul- Ericaceae, that appear to have free petals, tilocular, at least in the early stages of de- are gamopetalous early in development. velopment. The septa break down to various They are, therefore, considered to have degrees in different species as the ovary de- evolved from gamopetalous ancestors. velops. Thus structurally, the ovaries are similar. The two genera were consequently merged into the single genus Silene. EMBRYOLOGY The inferior ovary in angiosperms has been formed in two ways: appendicular ori- Embryology has made a relatively lesser gin (formed by fusion of calyx, corolla and contribution in understanding taxonomic their traces to the ovary wall; in this case, affinities. This is primarily because of long all vascular traces have normal orientation, preparatory work needed for embryological i.e. phloem towards the outside) or by axial studies. More often, the study of hundreds invagination (formed by depression of the of preparations may reveal just a single thalamus; the inner vascular traces have embryological characteristic of any signifi- reverse orientation, i.e. phloem towards the cance. It may take many years of laborious inside). Studies on floral anatomy have con- and painstaking research to study even a firmed that in a large majority of families, few representatives of a family. The embryo- the inferior ovary is of appendicular origin. logical features of major significance include Only in a few cases (Rosa, Cactaceae, etc.) microsporogenesis, development and struc- is the origin by axial invagination of the ture of ovule, embryo sac development, thalamus. endosperm and embryo development. Floral anatomy has also supported the inclusion of Acer negundo under Acer, and Families marked out by dis- does not support its separation into a distinct genus Negundo. Although this spe- tinct embryological features cies is specialized in having a dioecious A number of families of angiosperms are habit and anemophily, the anatomy of the characterized by unique embryological fea- flower shows unspecialized features of other tures found in all members. These include: Taxonomic Evidence 155 Podostemaceae swollen petiole, semiepigynous disc and spiny fruit. The following embryological fea- Family Podostemaceae includes perennial tures support this separation: (i) pyramidal aquatic herbs, which have a unique embryo- pollen grains with 3 folded crests (bluntly tri- logical feature in the formation of a angular and basin shaped in Onagraceae); pseudoembryo sac due to the disintegration (ii) ovary semi-inferior, bilocular with single of the nucellar tissue. The family is also ovule in each loculus (not inferior, trilocu- characterized by the occurrence of pollen lar, with many ovules); (iii) Polygonum type grains in pairs, bitegmic tenuinucellate of embryo sac (not Oenothera type); (iv) en- ovules, bisporic embryo sac, solanad type of dosperm absent (not present and nuclear); embryogeny, prominent suspensor hausto- (v) embryo Solanad type (not Onagrad type); ria, and absence of triple fusion and, conse- (vi) one cotyledon extremely reduced (both quently, endosperm. not equal); and (vii) fruit large one-seeded Cyperaceae drupe (not loculicidal capsule). Family Cyperaceae is characterized by the Paeonia formation of only one microspore per mi- The genus Paeonia was earlier included un- crospore mother cell. Following meiosis, of der the family Ranunculaceae (Bentham and the four microspore nuclei formed, only one Hooker; Engler and Prantl). Worsdell (1908) gives rise to pollen grain. Besides suggested its removal to a distinct family, Cyperaceae, only Epacridaceae in a few Paeoniaceae. This was supported on the ba- members shows the degeneration of three sis of centrifugal stamens (Corner, 1946), flo- microspore nuclei. Cyperaceae is distinct ral anatomy (Eames, 1961) and chromosomal from these taxa in pollen shedding at the 3- information (Gregory, 1941). The genus as celled stage, as against the 2-celled stage such has been placed in a distinct shedding in Epacridaceae. monogeneric family, Paeoniaceae, in all modern systems of classification. The sepa- Onagraceae ration is supported by the following embryo- Family Onagraceae is characterized by logical features: (i) centrifugal stamens (not Oenothera type of embryo sac, not found in centripetal); (ii) pollen with reticulately-pit- any other family except as an abnormality. ted exine with a large generative cell (not This type of embryo sac is 4-nucleate and is granular, papillate and smooth, small gen- derived from the micropylar megaspore of erative cell); (iii) unique embryogeny in the tetrad formed. which early divisions are free nuclear forming a coenocytic stage, later only the periph- Specific examples of the role eral part becomes cellular (not onagrad or solanad type); and (iv) seed arillate. of embryological data There are a few examples of the embryologi- Exocarpos cal data having been very useful in the in- The genus Exocarpos (sometimes mis- terpretation of taxonomic affinities: spelled Exocarpus) is traditionally placed under the family Santalaceae. Gagnepain Trapa and Boureau (1947) suggested its removal The genus Trapa was earlier (Bentham and to a distinct family Exocarpaceae near Hooker, 1883) included under the family Taxaceae under Gymnosperms on the basis Onagraceae. It was subsequently removed of articulate pedicel, ‘naked ovule’ and to the family Trapaceae (Engler and Diels, presence of a pollen chamber. Ram (1959) 1936; Hutchinson, 1959, 1973) on the basis studied the embryology of this genus and of distinct aquatic habit, two types of leaves, concluded that the flower shows the usual 156 Plant Systematics angiospermous character, the anther has a est. The number of nuclei present at the time distinct endothecium and glandular tape- of shedding is also significant. Most primi- tum, pollen grains shed at the 2-celled stage, tive angiosperms are shed at 2-nucleate embryo sac of the Polygonum type, endosperm stage, whereas in more advanced groups cellular, and the division of zygote trans- pollen is shed at 3-nucleate stage. verse. This confirms that the genus Angiosperms mostly have pollen grains of Exocarpos is undoubtedly an angiosperm, radial symmetry, bilateral symmetry being and a member of the family Santalaceae, found in several gymnosperms. Most pollen with no justification for its removal to a dis- grains are globose in shape, although boat- tinct family. The genus is as such placed in shaped, ellipsoidal and fusiforms are also Santalaceae in all the major systems of clas- met in different angiosperms. Since most sification. pollen grains at least in early stages form tetrads, the outer end of grain is termed Loranthaceae distal pole, whereas the inner end where grains meet as proximal pole, and the line The family Loranthaceae is traditionally joining the two poles as polar axis. The line divided into two subfamilies—Loranthoideae running around the pollen at right angles to and Viscoideae—largely on the basis of pres- the polar axis is termed as equator. ence of a calyculus below the perianth in the former and its absence in the latter. Maheshwari (1964) noted that the Pollen aggregation Loranthoideae has triradiate pollen grains, Microsporogenesis yields four microspores Polygonum type of embryo sac, early embryog- which mature into pollen grains. In large eny is biseriate, embryo suspensor present, majority of angiosperms the pollen grains and viscid layer outside the vascular supply separate prior to release. Such single in fruit. As against this, Viscoideae have pollen grains are known as monads. In rare spherical pollen grains, Allium type of cases pollen grains are released fused in embryo sac, early embryogeny many tiered, pairs, when they are known as dyads. In embryo suspensor absent, and viscid layer many angiosperms the four microspores do inside the vascular supply of fruit. He thus not separate and the pollen grains form a advocated separation of the two as distinct tetrad. Five different types of tetrads are families Loranthaceae and Viscaceae. The differentiated: separation was accepted by Takhtajan (1980, 1. Tetrahedral tetrad- four pollen grains 1987, 1997), Dahlgren (1980), Cronquist form a tetrahedron: four grains com- (1981, 1988) and Thorne (1981, 1992). pacted in a sphere. Such pollen grains are found in family Ericaceae. 2. Linear tetrad- four pollen grains PALYNOLOGY arranged in a straight line as in genus The pollen wall has been a subject of con- Typha. siderable attention, especially in an attempt 3. Rhomboidal tetrad- four pollen grains to establish the evolutionary history of in one plane, with two separated from angiosperms. Some families, such as one another by close contact of the Asteraceae, show different types of pollen other two. grains (eurypalynous), whereas several 4. Tetragonal tetrad- four grains are others have a single morphological pollen in one plane and equally spaced as in type (stenopalynous). Such stenopalynous Philydrum. groups are of considerable significance in 5. Decussate tetrad- four grains in two systematic palynology. Pollen grains present pairs, arranged at right angles to one a number of features of taxonomist inter- another, as in genus Lachnanthes. Taxonomic Evidence 157

is lacking (atectate pollen grain), and the exine appears granular. Above layers of exine are clearly visible under an electron microscope, but when observed under a light microscope, the inner layer known as nexine, includes endexine plus foot layer of ektexine. The upper layers consisting of columella, tectum and the supratectal sculpturing constitute sexine.

Pollen wall sculpturing Present on the outer surface of tectum are Figure 7.4 Fine structure of Pollen wall. often certain supratectal projections, which A, Intine, B, Endexine, C, Foot layer, provide a variety of sculpturing to exine wall. D, Baculum and E, Tectum. Note In some cases lacking tectum, the sculptur- the aperture formed due to break ing is formed by columellae. The common in the tectum and baculum layers. types of sculpturing include: baculate (rod- In some genera, such as Calliandra of shaped elements, each known as baculum), Mimosoideae, the pollen grains are connate clavate (club-shaped elements), echinate in a group of more than four. Such pollen (spine-like elements longer than 1 micron), grains constitute a polyad. A polyad gener- spinulose (spine-like elements shorter than ally consists of eight pollen grains, and rarely 1 micron; scabrate), foveolate (pitted sur- of more than ten. In some members of fam- face with pores), reticulate (forming net- ily Orchidaceae, as for example genus work, each element known as murus and Piperia, large number of pollen grains form space in between as lumen), fossulate (lon- irregular groups, of which there are more gitudinal grooves), verrucate (short wart-like than one groups in a theca. These are known elements), gemmate (globose or ellipsoid elas massulae. In subfamily Asclepiadoideae ements), psilate (smooth surface), and stri- of family Apocynaceae, and several mem- ate (having thin striations on surface). bers of orchidaceae, all pollen grains of a theca are fused into a single mass known as Pollen aperture pollinium. Pollen aperture is a specialized region of pollen wall through which the pollen tube comes Pollen wall out. The exine may be inaperturate (with- The pollen grain wall is made of two princi- out an aperture) or aperturate. An aperturate pal layers, outer exine and inner intine. The pollen may have a single pore (monoporate), exine is hard and impregnated with a single slit running at right angles to the sporopollenin, a substance that makes it equator (monocolpate), three slits resistant to decay, and enables preservation (tricolpate), three pores (triporate) three in fossil record. Exine is further differenti- slits each with a geminate pore in middle ated into two layers: outer ektexine and in- (tricolporate), with many pores ner endexine. The ektexine is further dis- (multiporate) accompanied by a variety of tinguished into basal foot layer, radially surface ornamentations (Figure 7-5). Pollen elongate columella and roof like tectum with one or more slits located at the polar (Figure 7.4). In some taxa the columella may end is accordingly termed, monosulcate, be replaced by granular middle layer. Simi- disulcate and trisulcate, depending on the larly in some primitive angiosperms tectum number of slits. Pollen grain with slits joined 158 Plant Systematics

Figure 7.5 SEM of pollen grains. A: Nonaperturate pollen grain of Persea americana; B: Monosulcate pollen grain of Magnolia grandiflora; C: Monoporate pollen grain of Siphonoglossa; D: Tricolporate pollen grain of Scaevola glabra; E: Polyporate spinose pollen grain of Ipomoaea wolcottiana; F: Tricolpate pollen grain of Disanthus cercidifolius. (A, after Fahn, 1982; C, after Mauseth, 1998 courtesy R. A. Hilsenbebeck, Sul Ross State University; F, after Endress, 1977; rest, after Gifford and Foster, 1988). at poles is termed syncolpate. Aperture several genera with wind pollination. The having three branches is termed tricho- vestigial scattered patches of adhesive layer tomosulcate. on wind pollinated pollen have been consid- Monocolpate condition is widely spread in ered as evidence of the derivation of primitive dicots and a majority of monocots. anemophily from entomophily. The pollen of anemophilous plants is Fossil studies over the last three decades usually small, rounded, smooth, rather thin- have confirmed monosulcate pollen of walled and dry with shallow furrows. Anemo- Clavitopollenites described (Couper, 1958) philous pollen is found in Populus, Poaceae, from Barremian and Aptian strata of the Cyperaceae, Betulaceae and several other Early Cretaceous of southern England (132 families. Insect- and bird-pollinated pollen, to 112 Mya) to be the oldest recorded on the other hand, is large, sculptured and angiosperm fossil with distinct sculptured often coated with adhesive waxy or oily exine, resembling the pollen of extant substance. The pollen of Asteraceae is genus Ascarina. generally highly elaborate but simplification Brenner and Bickoff (1992) recorded towards loss of sculpturing has occurred in similar but inaperturate pollen grains from Taxonomic Evidence 159 the Valanginian (ca 135 Mya) from the Helez through Transmission Electron Microscopy formation of Israel, now considered being the (TEM). On an average basis, the resolution oldest record of angiosperm fossils (Taylor power of SEM is 250A (20 times as good as and Hickey, 1996). This last discovery has optical microscope, but 20 times lesser than led to the belief that the earliest angiosperm TEM). Behnke and Barthlott (1983) have pollen were without an opening, the made extensive studies of SEM and TEM monosulcate types developing later. characters. In most of the examples stud- Many claims of angiosperm records from ied, Electron Microscopy (EM) characters the strata, earlier than the Cretaceous were proved to be stable and unaffected by envi- made, but largely rejected. Erdtman (1948) ronmental conditions. described Eucommiidites as a tricolpate dicotyledonous pollen grain from the Jurassic. Micromorphology This, however, had bilateral symmetry instead of the radial symmetry of angiosperms SEM studies have been made primarily on (Hughes, 1961) and a granular exine with pollen grains, small seeds, trichomes and gymnospermous laminated endexine (Doyle surface features of various organs. In most et al., 1975). Among examples of the role of of these organs (except pollen grains), the pollen grains in systematics is Nelumbo studies involved the epidermis. The value whose separation from Nymphaeaceae into of epidermal studies lies in the fact that an a distinct family Nelumbonaceae is largely epidermis covers almost all the organs and supported by the tricolpate pollen of Nelumbo is always present, even in herbarium speci- as against the monosulcate condition in mens. The epidermis is thick and stable in Nymphaeaceae. SEM preparations and is little affected by Brenner (1996) proposed a new model for environment. However, it is important to the evolutionary sequence of angiosperm pol- note that only comparable epidermis should len types. The earliest angiosperm pollen be studied (e.g. petals of all plants, leaves of (from the Valanginian or earlier) was small, all plants, not petals of some and leaves of circular, tectate-columellate and without an others). Most of SEM studies have been con- aperture. In the Hauterivian, there was pos- centrated on seed-coats which are usually sible occurrence of thickening of the intine thick-walled and stable in vacuum, thus fa- coupled with thickened endexine and evo- cilitating quick preparation for SEM exami- lution of the sulcus. A considerable diversi- nation without the need for complicated de- fication of these monosulcate pollens oc- hydration techniques. The micromorphology curred in the Barremian. Tricolpate pollen of the epidermis includes the following as- evolved in northern Gondwana in the lower pects: Aptian. Multicolpate and multiporate pollen arose at a later stager. Primary Sculpture This refers to the arrangement and shape MICROMORPHOLOGY AND of cells. The arrangement of cells is specific for several taxa. In Papaveraceae, seed- ULTRASTRUCTURE coat cells by a particular arrangement form Although widely used in lower plants, elec- a reticulate supercellular pattern (Figure tron microscopy has been a comparatively 7.6-D), which is a family character. The new approach for flowering plants. The finer members of Caryophyllaceae, Portulacaceae details of external features (micromorphol- and Aizoaceae exhibit a specific arrange- ogy) have been explored in the recent years ment and orientation of smaller and larger by Scanning Electron Microscopy (SEM), cells known as “centrospermoid” pattern. whereas the minute details of cell contents There is specific distribution of long and (ultrastructure) have been discerned short cells over the veins in the family 160 Plant Systematics

Figure 7.6 SEM seed characteristics of angiosperms. A: Seed of Sceletium campactum (Aizoaceae) showing centrospermoid cell arrangement; B: Seed-coat of Aeginatia indica (Orobanchaceae) with isodiametric deeply concave cells and reticulate secondary structure; C: Single isodiametric tetragonal cell of seed-coat of Matucana weberbaueri (Cactaceae) with heavy secondary sculpturing; D: Seed of Eschscholzia californica (Papaveraceae) with cells arranged to form a supercellular net-like pattern; E: Seed- coat of Jacaranda macarantha (Bignoniaceae) with stellate epicuticular sculpture; F: Seed of Dichaea sp. (Orchidaceae) almost one cell long with heavy marginal thickenings and irregular secondary sculpture. (From Barthlott, 1984).

Poaceae. The shape of cells is mainly de- Secondary Sculpture termined by the outline of the cells, boundaries of the walls, relief, and cell wall cur- The secondary sculpture (Microrelief) is vature (flat, convex or concave). Outline of formed by the deposition of cuticle over the cells may be isodiametric (usually tetrago- outer wall or due to secondary wall thicken- nal or hexagonal: Figure 7.6-B and C), elon- ings, often shrinking and collapsing in gated in one direction (Figure 7.6-F). Cell desiccated cells. It may be smooth, striate boundaries of superficially visible anticlinal (Figure 7.6-C), reticulate (Figure 7.6-B) or walls may be straight (Figure 7.6-B and C), micro-papillate (verrucose). All members of irregularly curved or undulated (S-, U-, Urticales have curved trichomes with silici- omega-, V- types) and are of high taxonomic fied cuticular striations at the base, and significance in family Cactaceae and micro-papillations on the trichome body. Orchidaceae. Relief of the anticlinal This single character of trichomes allows for boundary may be channelled or raised. In precise circumscription of the order primitive members of Cactaceae, cell junc- Urticales (Barthlott, 1981). Loasiflorae is tions are depressed, whereas in derived circumscribed by unicellular irregularly Cactinae they are raised. The curvature of hooked trichomes. Secondary wall thick- outer periclinal walls may be flat, concave enings are always of a high taxonomic (Figure 7.6-B) or convex. significance. In Orchidaceae, for example Taxonomic Evidence 161 longitudinal striations caused by underlying Tertiary sculpture is generally lacking secondary thickenings are restricted to all from seeds. In orchidaceae, however, cer- members of Catasetinae. tain tribes possess epicuticular waxes on their seed-coats. Seed-coats of Jacaranda Tertiary Sculpture (Figure 7.6-E) have stellate epicuticular sculpture known as ‘star scales’, a feature Tertiary sculpture is formed by epicuticular characteristic of this genus. Many members secretions such as waxes and other muci- of Aizoaceae are characterized by seed-coat laginous adhesive lipophilic substances and with epicuticular secretions forming long shows a variety of patterns. Secondary and upright rodlets and small rodlets lying on the tertiary sculpturing are mutually exclusive cell surface. as the presence of waxes would invariably Cactaceae is a huge family commonly di- mask the cuticle; the cuticle would be vis- vided into three subfamilies, of which ible only if there are no wax deposits. Cactoideae includes 90 per cent species but Winteraceae have a particular type and dis- its classification is difficult because of uni- tribution of wax-like secretions (alveolar form floral characters, pollen morphology and material not soluble in lipid solvents) on plasticity. Barthlott and Voit (1979) analyzed their stomata, similar to gymnosperms, and 1050 species and 230 genera by SEM for absent in all other angiosperms. seed coat structure in the family Cactaceae. In monocots orientation and pattern of epi- The simple unspecialized testa of cuticular waxes seem to provide a new taxo- Pereskoideae supports its ancestral posi- nomic character of high systematic signifi- tion. Opuntioideae has a unique seed with cance. Four types of wax patterns and crys- a hard aril, thus confirming its isolated po- talloids have been distinguished (Barthlott sition, also indicated by pollen morphology. and Froelich, 1983): Cactoideae shows complex diversity, con- 1. Smooth wax layers in the form of thin firming its advanced position and subtribes films, common in angiosperms. have been recognized based on seed-coat 2. Non-oriented wax crystalloids in the structure, each subtribe possessing distinc- form of rodlets or platelets with no tive features. Thus the genus Astrophytum regular pattern. These are common in has been transferred from Notocactinae to dicots and Lilianae groups of Cactinae. monocots. Orchidaceae is another large family with 3. Strelitzia wax-type with massive complicated phylogenetic affinities. Minute compound wax projections composed of ‘dust seeds’ show microstructural diversity rodlet-like subunits that form massive of the seed-coat. Studies of over 1000 spe- compound plates around the stomata. cies (Barthlott, 1981) have helped in better This wax type is found in Zingiberanae, subdivision into subfamilies and tribes. Commelinanae, and Arecanae. It is Barthlott also supports the merger of also found in Velloziales, Bromeliales, Cypripediaceae with Orchidaceae, a sugges- and Typhales, which further differ tion incorporated in several recent classifi- from other Lilianae in a starchy cation (Judd et al., 2002; APG II, 2003; endosperm. 4. Convallaria wax-type with small wax Thorne, 2003; Stevens, 2003). platelets arranged in parallel rows, which cross the stomata at right an- Ultrastructure gle and form a close circle around Ultrastructure studies of angiosperms have each polar end of the stoma, similar provided valuable taxonomic information to the lines of an electromagnetic from phloem tissue, mainly sieve tube ele- field. This type is restricted to Lilianae ments. Besides this, information has also only. come from studies of seeds. 162 Plant Systematics

Figure 7.7 Various forms of sieve-tube plastids and their possible evolution (After Behnke and Barthlott, 1983).

Sieve-tube plastids (i) PI-subtype. The plastids contain single crystalloids of different sizes Studies on sieve-tube plastids were first and shapes and/or irregularly initiated by Behnke (1965) in the family arranged filaments. This subtype is Dioscoreaceae. Since then, nearly all thought to be the most primitive in angiosperm families have been investigated flowering plants, mainly Magnoliales, for the taxonomic significance of these plas- Laurales and Aristolochiales. tids. All sieve-element plastids contain starch (ii) PII-subtype. This subtype contains grains differing in number, size and shape. several cuneate crystalloids oriented The protein accumulates in specific plastids towards the centre of the plastid. in the form of crystalloids and filaments. All investigated monocots contain this Thus two types of plastids are distinguished: subtype. It is significant to note P-type which accumulate proteins and S-type that only members of dicots with which do not accumulate proteins. Starch this subtype, Asarum, and Saruma accumulation is of no primary importance in of Aristolochiaceae are widely classification, since it may be present or regarded among the most absent in both types of plastids. P-type plas- primitive members of dicots, a tids are further divided into six subtypes possible link between monocots and (Behnke and Barthlott, 1983) (Figure 7.7): dicots. Taxonomic Evidence 163

ders Caryophyllineae, Chenopodineae and Phytolaccineae, earlier established by Friedrich (1956). Whereas Takhtajan had recognized these three suborders in his 1983 revision, in his final revision of his classification, he merged Phytolaccineae with Caryophyllineae, thus recognizing only two suborders Caryophyllineae and Chenopodineae. Of the three orders recognized in Caryophyllidae of Takhtajan, only Caryophyllales contains PIII-subtype plastids while the other two orders, Polygonales and Plumbaginales, contain S-type plastids. Behnke (1977) as such, advocated retention of only Caryophyllales under Caryophyllidae and removal of the other two orders to subclass Rosidae whose members also contain S-type plastids. The suggestion was not accepted by Takhtajan (1987) and Cronquist (1988), who retained all the three orders under Caryophyllidae. Takhtajan, however, Figure 7.8 Different forms of P III–subtype placed the three orders under sepa- sieve-element plastids all with rate superorders (Cronquist does not ring–like bundle of filaments (F). 19 recognize superorders). On further and 20: P IIIa with globular crys- intensive studies of plastids within talloid (C); 21: P IIIb with polygo- the group, Behnke (1997) advocated nal crystalloid; 22: PIIIc without Sarcobatus crystalloid. (From Behnke, 1977). the removal of genus from the family Chenopodiaceae on the basis of the presence of PIIIcf plastids (iii) PIII-subtype. This subtype contains a and absence of PIIIf, which are char- ring-shaped bundle of filaments. PIII- acteristic of family Chenopodiaceae. subtype is confined to Centrospermae He places the genus in an independ- (Caryophyllales) and the removal of ent family, Sarcobataceae. Bataceae and Gyrostemonaceae has (iv) PIV-subtype. The plastid contains a been supported by the absence of this few polygonal crystalloids of variable subtype in these families. Further, size. This subtype is restricted to the forms are recognized based on the order Fabales. presence or absence of crystalloids (v) PV-subtype. The plastid contains (Figure 7.8) into PIIIa (globular crys- many crystalloids of different sizes and talloid), PIIIb (hexagonal crystalloid) shapes. This subtype is found in the and PIIIc (without crystalloid). Based order Ericales and family Rhizophora- on the distribution of these forms, ceae. Behnke (1976) proposed division of the (vi) PVI-subtype. The plastid contains a order into three family-groups which single circular crystalloid. This sub- exactly correspond to the three subor- type is found in family Buxaceae. 164 Plant Systematics Dilated Cisternae sieve-tube elements have also been reported in Boraginaceae, and may prove useful. Dilated Cisternae (DC) were first described by Bonnett and Newcomb (1965) as dilated Non-phloematic TEM sections of endoplasmic reticulum in the root cells of Raphanus sativus. Originally found Characters in Brassicaceae and Capparaceae, DC have Protein bodies in seeds through TEM, SEM now been found in several other families of and dispersive X-ray techniques have dem- angiosperms but are concentrated in the or- onstrated their significance if qualitative and der Capparales (Brassicaceae and quantitative aspects are both taken into ac- Capparaceae) and form a part of the charac- count. Similarly, SEM studies of starch grains ter syndrome of this order. The DC may be are also potential sources of information of utricular, irregular or vacuole-like in form taxonomic significance. with filamentous, tubular or granular contents. They have been proposed to be func- CHROMOSOMES tionally associated with glucosinolates and Chromosomes are the carriers of genetic myrosin cells found in this order. information and as such have a considerable significance in evolutionary studies. Phloem (p-) proteins Increased knowledge about chromosomes P-proteins are found only in sieve elements and their behaviour has largely been respon- of angiosperms and occur in the form of fila- sible for extensive biosystematic studies and ments or tubules. These assemble into large development of the biological species concept. discrete bodies, and are not dissolved dur- During the first quarter of the twentieth cen- ing maturation of the sieve-element, unlike tury, chromosomal data were relatively single membrane organelles. The composi- sparse. Such information has markedly tion and three-dimensional arrangement of increased over the last few decades, however, these proteins exhibit taxonomic specific- with ample useful information coming from ity. They are dispersed over the entire cell studies of the banding pattern. Three types as the cell matures but in some dicots, a of chromosomal information have been of single non-dispersive (crystalline) body of significance in Systematics. various shapes may be found in addition to dispersive ones. Crystalline bodies are Chromosomal number absent in monocots. Their shape is often spe- Extensive records of chromosome numbers cific and thus of taxonomic importance. are available in the works of Darlington and Globular crystalline bodies are found in Janaki-Amal (1945), Darlington and Wylie Malvales and Urticales. Fabanae, which is (1955), Federov (1969) and Löve et al. (1977). characterized by PIV-subtype plastids, has The International Association of Plant spindle-shaped crystalline bodies in the Taxonomy (IAPT) has also been publishing an family Fabaceae. The feature has supported Index to Plant Chromosome Numbers in its the transfer of Swartzia to Fabaceae. series Regnum Vegetabile. Between 1967 and 1977, the series published 9 volumes mostly Nuclear inclusions forming annual lists of chromosome Nuclear inclusions in the form of protein crys- numbers. An updated server of the Missouri tals occur in phloem- and Ray parenchyma, Botanical Garden maintains the records of primarily in the families of Asteridae. Five chromosome numbers and can be queried for types of crystals have been differentiated. online information about plant species. The Structural differences are significant for chromosome counts are usually reported as classification within Scrophulariaceae and diploid number (2n) from mitosis of sporo- Lamiaceae (Speta, 1979). Protein crystals in phytic tissue but when based on mitosis in Taxonomic Evidence 165 gametophytic tissue or on meiosis studies, counts are reported as haploid (n). The gametophytic chromosome number of diploid species is designated as base- number (x). In diploid species as such n = x, whereas in polyploid species n is in multiples of x. A hexaploid species with 2n = 42 will thus have n = 21, n = 3x and 2n = 6x. The chromosome number in angiosperms exhibits considerable variation. The lowest number (n = 2) is recorded in Haplopappus gracilis (Asteraceae) and the highest (n = 132) in Poa littoroa (Poaceae). The alga Spirogyra cylindrica also contains n = 2, whereas the record of the highest chromosome number (n = 630) is found in Ophioglossum reticulatum (Pteridophytes). Such a range of variation, (n = 2 to n = 132), however, within nearly a quarter a million species of angiosperms, may not be very significant in taxonomic delimitation, but there have been instances of the isolated role of studies on chromosomes. Raven (1975) provided a review of Figure 7.9 Mitotic chromosomes of Trades- chromosome numbers at the family level in cantia spathacea (2n=12) with sis- angiosperms. He concluded that the origi- ter chromatids and centromere. nal base-number for angiosperms is x = 7 and that comparisons at the family level are valid only when the base-number (and not n Spartina was for long placed in the tribe or 2n) is used. The family Ranunculaceae is Chlorideae (x = 10) although its chromo- dominated by genera with large chromosomes (x= 7) were at variance. Marchant somes (and x = 8). The two genera Thalictrum (1968) showed the genus to have, in fact and Aquilegia—originally placed in two x = 10, thus securing placement within separate subfamilies or tribes (and even two Chlorideae. separate families Ranunculaceae and The classical study of the genus Crepis Helleboraceae by Hutchinson, 1959, 1973 (Babcock, 1947) based separation from the along with other achene bearing and follicle closely related genera on chromosomal bearing genera, respectively)—are distinct number and morphology. This led to the in having small chromosomes (and x = 7) and separation of the genus Youngia and merger as such have been segregated into a distinct of Pterotheca with Crepis. Similarly, in the tribe. The genus Paeonia with very large genus Mentha which has small, structurally chromosomes (and x = 5) has been separated uniform chromosomes, the chromosome into a distantly related family Paeoniaceae, numbers provide strong support for subdivi- a placement which has been supported by sion into sections Audibertia (x = 9), Pulegium morphological, anatomical and embryologi- (x = 10), Preslia (x = 18) and Mentha (x = 12). cal data. Significant records in other The duplication of chromosome numbers families include Rosaceae with x = 17 in leading to polyploidy may prove to be of taxo- subfamily Pomoideae, whereas other sub- nomic significance. The grass genus Vulpia families have x = 7, 8 or 9. In Poaceae contains diploid (2n = 14), tetraploid (2n =28) similarly subfamily Bambusoideae has and hexaploid (2n = 42) species. The genus x = 12, whereas Pooideae has x = 7. is divided into five sections, of which three 166 Plant Systematics

Figure 7.10 Ideogram of the somatic complement of Allium ampeloprasm. Of the 32 somatic chromosomes, 8 show secondary constriction (courtesy Prof. R. N. Gohil).

contain only diploids, one diploids and would exhibit the problem of pairing at tetraploids and one all three levels of ploidy. meiosis but the hybridization followed by du- It is presumed that tetraploid and hexaploid plication leading to hexaploidy can form a species of Vulpia arose from diploid progeni- perfectly normal independent species. Such tors. The duplication of chromosome num- facts have led to the detection of hybrids or ber of a diploid species may form a tetraploid confirmation of suspected hybrids. Senecio (autopolyploid). Such a polyploid, however, (Asteraceae) includes the diploid S. squalidus does not show any or at most may show (2n = 20), the tetraploid S. vulgaris (2n = 40) minor differences from the diploid species, and the hexaploid S. cambrensis (2n = 60). and is rarely recognized as an independent The last is intermediate in morphology taxonomic entity. The hybrid between two between the first two and is found in the diploid species contains one genome from area where these two grow. Additionally, either parent and thus, generally doesn’t sterile triploid hybrids between two species survive because of failure of chromosomal have been reported. It seems clear that S. pairing during meiosis. Hybridization cambrensis is an allohexaploid between the followed by duplication of chromosomes other two species (Stace, 1989). Similarly, establishes a tetraploid (allopolyploid; based on chromosome number and karyo- amphiploid) with normal pairing as both type, Owenby (1950) concluded that genomes are in pairs. Such a tetraploid Tragopogon mirus (2n = 24), a tetraploid hybrid with distinct characteristics may be species arose as an amphiploid between two recognized as an independent species. diploid species, T. dubius and T. porrifolius A triploid hybrid between a diploid species (2n = 12). and a tetraploid species may, similarly, not Whereas a species generally shows a survive as genome from the diploid parent single chromosome number, certain Taxonomic Evidence 167 populations or infraspecific taxa (subspecies, similarity. This was supported by the distinc- variety, forma) may sometimes show a tive bimodal karyotype of Agavaceae con- different chromosome number (or even differ- sisting of 5 large chromosomes and 25 small ent chromosomal morphology). Such popula- ones. Rudall et al. (1997) advocated the tions or infraspecific taxa constitute transfer of Hosta (placed in Hostaceae; cytotypes. Hesperocallidaceae by Thorne, 1999), Camassia and Chlorogalum (both placed under Liliaceae by Hutchinson, 1973; Chromosomal structure Hyacinthaceae by Thorne, 1999) to family Chromosomes show considerable variation Agavaceae on the basis of possession of bi- in size, position of centromere (Figure 7.9) modal karyotype, a suggestion incorporated and presence of secondary constriction. The by Judd et al. (2002) and Thorne (2003). chromosomes are commonly differentiated Rousi (1973), from his studies on the genus as metacentric (with centromere in middle), Leontodon, showed that data on the basic submetacentric (away from middle), acro- number, chromosome length, centromeric centric (near the end) or telocentric (at the position and the occurrence of satellites end). The chromosomes are also character- provide evidence for the relegation of the ized by their size. In addition the occurrence former genus Thrincia (x = 4) as a section of and position of secondary constriction, subgenus Apargia along with section which demarcates a satellite is important Asterothrix (x = 4, 7). The subgenus Leontodon in chromosomal identification and charac- is distinct with x = 6 or 7, and a different terization. The identification of satellites is chromosome morphology. often difficult, and especially when the sec- Cyperaceae and Juncaceae were earlier ondary constriction is very long, a satellite placed far apart due to distinct floral struc- may be counted as a distinct chromosome. ture. Both families have small chromosomes This situation has often led to erroneous without distinctive centromeres, the latter chromosome counts. The structure of the may be diffuse or non-localized. These fami- chromosome set (genome) in a species is lies as such are now considered to be closely termed karyotype and is commonly dia- related. Such chromosomes (holocentric grammatically represented in the form of an chromosomes) do not depend on a discrete ideogram (Figure 7.10) or karyogram. An centromere for meiosis and mitosis and may analysis of a large number of studies has undergo fragmentation with no deleterious led to the conclusion that a symmetrical effect. This may result in variable chromo- karyotype (chromosomes essentially simi- somal counts. In the Luzula spicata group, lar and mainly metacentric) is primitive and chromosomal counts are reported to be an asymmetric karyotype (different types 2n = 12, 14, and 24. Interestingly, the total of chromosomes in a genome) advanced, the chromosomal volume is the same and the latter commonly found in plants with spe- higher chromosome number is the result of cialized morphological features, such as Del- fragmentation (agmatoploidy) of these phinium and Aconitum. holocentric chromosomes. Different chromo- An interesting example of utilization of some numbers may often occur in different chromosomal information is family cells of the same root-tip (mixoploidy). The Agavaceae. The family contains about 16 occurrence of accessory chromosomes genera such as Agave (and others formerly (known as B-chromosomes) in higher plants placed in Amaryllidaceae due to inferior generally does not have a significant effect ovary) and Yucca (and others formerly placed on morphology and, thus, is of little taxo- in Liliaceae due to superior ovary). These nomic importance. B-chromosomes in bryo- genera were shifted and brought into phytes, contrarily, are very small (termed m- Agavaceae on the basis of great overall chromosomes) and often highly diagnostic. 168 Plant Systematics

In recent years, considerable break- chromosomes without chiasmata so that through has been achieved in the study of chromosomes fall apart before metaphase banding patterns of chromosomes using (desynapsis). In extreme cases, the entire Giemsa and fluorochrome stains. Already genome may fail to pair. The genome analy- different techniques such as C-banding, sis of suspected hybrids has helped in G-banding, Q-banding and Hy-banding are establishing the parentage of several poly- in use, and help in clearly distinguishing ploid species. the heterochromatic and euchromatic A diploid hybrid between two species regions. C-banding is very useful in indicat- generally exhibits failure of meiotic pairing ing the position of centromeres in cases due to non-homology of genomes resulting where they cannot be identified by conven- in hybrid sterility, but when hybridization tional staining. is followed by duplication of chromosomes to The technique of silver-staining has been form a tetraploid hybrid, the latter shows developed to highlight NOR (nucleolar orga- normal pairing between the two genomes nizing region). An interesting study of the derived from the same parent and is gener- chromosomes of top onion (variously recog- ally fertile. A triploid hybrid may, similarly, nized as Allium cepa var. viviparum or be sterile but a hexaploid one fertile. A. fistulosum var. proliferum) as also those of Genome analysis has confirmed that the A. Cepa and A. fistulosum was done by hexaploid Senecio cambrensis is allohexaploid Schubert, Ohle and Hanelt (1983). By Giemsa between tetraploid S. vulgaris and diploid S. banding pattern and silver-staining studies, squalidus. Similarly the tetraploid they concluded that some chromosomes of Tragopogon mirus is the result of hybridiza- top onion resemble A. cepa and others tion between the two diploid species T. dubius resemble A. fistulosum. Of the two satellites, and T. porrifolius. The most significant case, one resembles either species. Top onion is however, is the common bread wheat as such a pseudodiploid with no homologous Triticum aestivum, a hexaploid with AABBDD pair. The study confirmed that top onion is genome. Genome analyses have confirmed a hybrid between the two aforesaid parents, that genome A is derived from the diploid and thus would be better known as A. x T. monococcum, B from Aegilops speltoides, proliferum (Moench) Schrad. (based on Cepa both genomes being represented in the proliferum Moench), and not as a variety of tetraploid T. dicoccum. Genome D is derived either species. Interestingly, the top onion from the diploid Aegilops tauschii. owes its existence to the bulbils, which are produced in place of an inflorescence and ensure the multiplication of the hybrid, CHEMOTAXONOMY which is otherwise sterile. Chemotaxonomy of plants is an expanding field of study and seeks to utilize chemical information to improve upon the classifica- Chromosomal behaviour tion of plants. Chemical evidence has, in The fertility of a plant is highly dependent fact, been used ever since man first began on the ability of meiotic chromosomes to to classify plants as edible and inedible, pair (synapsis) and their subsequent sepa- obviously based on their chemical differ- ration. The meiotic behaviour of chromo- ences. Chemical information about medici- somes enables comparison between nal plants in herbals published nearly five genomes to detect the degree of homology, centuries back was concerned with localiza- especially when they are a result of hybrid- tion and application of physiologically- ization. A greater degree of genomic non- active secondary metabolites such as sa- homology results in either failure of ponins and alkaloids. Knowledge about chem- pairing (asynapsis) or a loose pairing of istry of plants greatly increased during the Taxonomic Evidence 169 eighteenth and nineteenth centuries. The The utilization of studies on DNA and RNA greatest interest has been generated over for understanding of phylogenetic relations the last 40 years, however, with the devel- has received a great boost over the last de- opment of improved techniques for studying cade, meriting the establishment of a new biological molecules, especially proteins and field referred to as Molecular Systematics, nucleic acids. In recent years, interest has and would be dealt separately after chemot- focused on the study of allelochemy and re- axonomy. Only proteins would be described alization of the concept that the animal king- in this section. dom and the plant kingdom have experi- enced a chemical coevolution. Plants continuously evolve new defensive chemical Primary metabolites mechanisms to save themselves from preda- Primary metabolites include compounds, tors, and animals evolve methods to over- which are involved in vital metabolic path- come these defenses. In the process, some ways. Most of them are universal in plants plant species have developed animal hor- and of little taxonomic importance. Aconitic mones, thus disturbing the hormonal levels acid and citric acid, first discovered from Ac- of animals if ingested. onitum and Citrus respectively, participate in A large variety of chemical compounds are Krebs cycle of respiration and are found in found in plants and quite often the biosyn- all aerobic organisms. The same is true of thetic pathways producing these compounds the 22 or so amino acids forming proteins, differ in various plant groups. In many in- and the sugar molecules, which are involved stances the biosynthetic pathways corre- in the Kalvin cycle of photosynthesis. The spond well with existing schemes of classi- quantitative variations of these primary me- fication based on morphology. In other cases, tabolites may, however, be of taxonomic sig- the results are at variance, thus calling for nificance sometimes. In Gilgiochloa indurata revision of such schemes. The natural (Poaceae), alanine is the main amino acid chemical constituents are conveniently di- in leaf extracts, proline in seed extracts and vided as under: asparagine in flower extracts. Rosaceae is similarly rich in arginine. Micromolecules: Compounds with low molecular weight (less than 1000). Primary metabolites: Compounds in- Secondary metabolites volved in vital metabolic pathways—cit- Secondary metabolites perform non-vital ric acid, aconitic acid, protein amino functions and are less widespread in plants acids, etc. as compared to primary metabolites. These Secondary metabolites: Compounds are generally the by-products of metabolism. which are the by-products of metabo- They were earlier considered to be waste lism and often perform non-vital func- products, having no important role. Recently, tions— non-protein amino acids, phe- however, it was realized that they are im- nolic compounds, alkaloids, glucosino- portant in chemical defense against preda- lates, terpenes, etc. tors, pathogens, allelopathic agents and also Macromolecules: Compounds with high help in pollination and dispersal (Swain, molecular weight (1000 or more). 1977). Gershenzon and Mabry (1983) have Non-semantide macromolecules: provided a comprehensive review of the sig- Compounds not involved in information nificance of secondary metabolites in higher transfer—starches, celluloses, etc. classification of angiosperms. The following Semantides: Information carrying mol- major categories of secondary metabolites ecules—DNA, RNA and proteins. are of taxonomic significance: . 170 Plant Systematics

Figure 7.11 Structure of important phenolic molecules and a betalain (Betanidin). (*indicates the position of sugar.)

Non-protein amino acids localized in vacuoles in cell, and are found in combination with sugars as glycoside. A large number of amino acids not associ- (Simple phenolics can be tested by extraction with ated with proteins are known (more than 300 ethanol. Take 5-6 gm of chopped leaf tissue in a or so). Their distribution is not universal but beaker and add 30 ml of 70% ethanol; heat over specific to certain groups and, as such, holds water bath at 60-70 degree centigrade for 20 minutes; filter and concentrate filtrate over water bath promise for taxonomic significance. till about 0.5 ml is left; load the sample on Whatman Lathyrine is, thus, known only from paper (No. 1) using BAW: Butanol, Acetic acid and Lathyrus. Canavanine occurs only in water in ratio of 4:1:5; run chromatogram, dry and Fabaceae and is shown (Bell, 1971) to be a observe under UV light; spray with mixture (1:1) of 1% Ferric chloride and 1% Potassium ferricyanide protection against insect larvae. These and calculate Rf value). These are widely amino acids are usually concentrated in distributed in the plant kingdom; common storage roots and, as such, root extracts are examples being catechol, hydroquinone, phlo- generally used for their study. roglucinol and pyragallol. Coumarins, a group of natural phenolics, have a characteristic Phenolics smell. The crushed leaves of Anthoxanthum Phenolic compounds form a loose class of odoratum can thus be identified by this char- compounds, based upon a phenol (C6 H 5 OH). acteristic odour. More than 300 coumarins Simple phenolics are made of a single ring have been reported from nearly 80 families and differ in position and number of OH of plants. They are a group of lactones formed groups. These are water soluble and are by ring closure of hydroxycinnamic acid. Taxonomic Evidence 171

Figure 7.12 Structure of anthocyanin forming molecules, differing in right three positions, middle position absent in Cyanidin, Paeonidin and Pelargonidin, but having OH in Malvidin, Delphinidin and Petunidin. Cyanidin has OH at both other positions, Paeonidin has one replaced by OCH3, Pelargonin upper is missing, Malvidin has both replaced by OCH3, Delphinidin has OH at both and Petunidin one having OH and other OCH3.

Lignin is a highly branched polymer of beakers to dryness on water bath uncovered; to each three simple phenolic alcohols. Whereas add 1% methanolic HCl; load each sample on two circular whatman (No. 1) filter paper, load spot in gymnosperm lignin is composed of coniferyl centre using Forestall solvent: HCl, Acetic acid and alcohol subunits, the angiosperm lignin is water (3:10:30); mark spots visually; observe one a mixture of coniferyl and sinapyl alcohol set of chromatograms of A and B under UV; expose subunits. The alcohols are oxidized to free second set to ammonia vapours by rotating discs over open mouth of NH3 bottle and observe under radicals by peroxidase enzyme, and the freed UV. Phenyl propanoids can be detected similarly radicals react to form lignin. except that extraction is done using diethyl ether Flavonoids, the more extensively studied instead of ethyl estate, only organic layer is retained and the solvent use for chromatography is BAW compounds, are based on a flavonoid nucleus (Butanol : Acetic acid: Distilled water-4:1:5). consisting of two benzene rings joined by a Common examples are flavonols (mainly C3 open or closed structure (Figure 7.11). colourless and commonly occurring as (Presence of flavonoids can be detected as fol- co-pigments, yield bright yellow spot in chro- lows: Finely chop 5 gm of flower petals or tepals in beaker; add 20 ml of 2N HCl, cover with aluminium matogram after acid hydrolysis), flavones foil, and heat at 80-90 degree centigrade for 30-40 (similar, yield dull brown spots), minutes in water bath; filter and extract filtrate with glycoflavones, biflavonyls (similar, yield dull 15-20 ml ethyl acetate in separating funnel, shake absorbing spots on BAW), isoflavones and allow solvent to evaporate; two layers are formed, upper organic and lower inorganic aqueous layer (colourless, often found in roots of legumes), (mostly anthocyanins); collect them in two separate flavanones (colourless, occur in leaves, beakers; label beaker with upper organic layer as B; citrus fruits, yield red colour with HCl), cha- if aqueous layer is coloured heat for 5-10 minutes to lcones or aurones (usually occur in yellow expel ethyl acetate; put back in separating funnel, add 2-4 ml of amyl alcohol, shake, transfer upper flowers, yield red colour with NH3), Antho- organic layer to beaker and mark it as A; heat both cyanins (red, blue coloured water soluble) 172 Plant Systematics

Table 7.1 Classification of Betalain containing families and potential relatives.

Structural Chemical Compromise Compromise classification classification classification-I classification-II (Engler & Prantl) (Mabry, 1963) (Alston & Turner, 1971) (Mabry, 1976)

Centrospermae Chenopodiales Caryophyllidae Caryphyllales Chenopodiaceae Chenopodiaceae Chenopodiales Chenopodinea Amaranthaceae Amaranthaceae Chenopodiaceae Chenopodiaceae Nyctaginaceae Nyctaginaceae Amaranthaceae Amaranthaceae Phytolaccaceae Phytolaccaceae Nyctaginaceae Nyctaginaceae Gyrostemonaceae Aizoaceae Phytolaccaceae Phytolaccaceae Aizoaceae Portulacaceae Aizoaceae Aizoaceae Portulacaceae Basellaceae Portulaceae Portulaceae Basellaceae Cactaceae Basellaceae Basellaceae Caryophyllaceae Didiereaceae Cactaceae Cactaceae Molluginaceae Didiereaceae Didiereaceae Caryophyllales Cactales Caryophyllaceae Caryophyllales Caryophyllineae Cactaceae Molluginaceae Caryophyllaceae Caryophyllaceae Molluginaceae Molluginaceae Sapindales Didiereaceae

and leucoanthocyanins (mainly colourless, and having quite distinct metabolic pathways mainly in heartwood and leaves of trees, yield of synthesis. However, they carry the same anthocyanins). functions as anthocyanins. Betalains are Anthocyanins and Anthoxanthins are mutually exclusive with anthocyanins, and important pigments in the cell sap of petals concentrated in the traditional group Cen- providing red, blue (anthocyanins), and yel- trospermae of Engler and Prantl, now recog- low (anthoxanthins) colours in a large num- nized as order Caryophyllales. Of the nine ber of families of angiosperms. They are families which contain betalains, seven formed by anthocyanadins combining with were included in Centrospermae, Cactaceae different sugars at different places. Six main placed in Cactales or Opuntiales and the categories (Figure 7.12) of anthocyanin form- ninth was placed in Sapindales. Traditional ing molecules are recognized providing dif- Centrospermae also included Gyrostemo- ferent colours: Cyanidin-magenta; naceae, Caryophyllaceae and Molluginaceae Pelargonidin-orange-red; Delphinidin- which lack betalains and contain anthocya- purple, blue, mauve; Petunidin-purplish; nins instead. Mabry et al., (1963) on the Paeonidin-magenta and Malvidin-purple. basis of separate structure and metabolic These pigments are absent in some fami- pathways, suggested the placement of only lies and replaced by highly different com- betalain-containing families in Centrosper- pounds, betacyanins and betaxanthins (to- mae, thus advocating the inclusion of gether known as betalains), which consist Cactaceae and Didiereaceae and exclusion of heterocyclic nitrogen-containing rings of Gyrostemonaceae, Caryophyllaceae and Taxonomic Evidence 173

in all members of Centrospermae and thus suggested a compromise by including all families within subclass Caryophyllidae with betalain-containing families placed under the order Chenopodiales and the other two (Caryo- phyllaceae and Molluginaceae) placed under Caryophyllales. Interestingly, Mabry (1976), on the basis of DNA/RNA hybridization studies, found closer affinities between these families and suggested the placement of all these families under Caryophyllales with the betalain-containing families under the suborder Chenopodiineae and the two non- betalain families under Caryophyllineae. This final compromise has met with mixed response in recent years with the morphological, anatomical and DNA/RNA hybridization evidence overriding the betalain evidence. Takhtajan (1997) places only Chenopodiaceae and Amaranthaceae in Che- nopodiineae, Dahlgren (1989) and Cronquist (1988) and APG II (2003) did not recognize suborders, and Thorne (2007) recognising four suborders, Caryophyllaceae and Mollug- inaceae separated under different suborders. It is interesting to note that the betalains have also been reported in Basidiomycetes (Fungi), in some cases the same substance found in both fungi and angiosperms. The above studies on the significance of distribution of betalains in Centrospermae bring home the fact that chemical data are useful in taxonomic realignments when such Figure 7.13 Two-dimensional paper chromato- accord with data from other fields. The grams of the flavonoids in two species of Hymenophyton (after significance is reduced when larger Markham et. al., 1976). evidence from elsewhere contradicts the chemical evidence. Thus, whereas no questions were ever asked about the removal of Molluginaceae (Table 7.1). Whereas the in- Gyrostemonaceae and the inclusion of clusion of Cactaceae and Didiereaceae was Cactaceae and Didiereaceae, there has been readily accepted (thus bringing all betalain- no agreement about the removal of Caryo- containing families in the same order Cen- phyllaceae and Molluginaceae as it goes trospermae), the exclusion of Caryophyl- against the evidence from morphology, laceae and Molluginaceae was strongly op- anatomy, ultrastructure and DNA/RNA posed on the basis of structural data. This hybridization. This also highlights the danger clash between orthodox and chemical tax- of relying too much on one type of evidence. onomy initiated renewed interest in the Studies on phenolic compounds have group. helped in solving some specific problems. Behnke and Turner (1971), on the basis of Bate-Smith (1958) studied five phenolic ultrastructure studies, reported P-III plastids characters of different sections in the 174 Plant Systematics

and H. flabellatum, and that there is no justification for their merger. Similar studies in the genus Baptisia (Fabaceae) by Alston and Turner (1963) have been very useful in the detection of hybridization. Each species of the genus has a distinctive spectrum of flavonoids, and the hybrid can be easily identified by the combination of flavonoid pattern of both parental species in the suspected hybrid. It is interesting to note that the ten taxa recognized (four parental and six hybrid), could not be differentiated on the basis of morphological or biochemical characters alone, but a combination of both enabled a complete separation. The flavonoids in these studies were extracted from either flower or leaf.

Alkaloids Alkaloids are organic nitrogen-containing bases, usually with a heterocyclic ring of some kind. They form one of the largest class of secondary metabolites, with nearly 10,000 different types reported. They are insoluble in water but soluble in organic solvents, but Figure 7.14 Main Examples of alkaloids found their salts are soluble in water and insoluble in the plant kingdom. The distri- in organic solvents. Their distribution is bution of some is highly specific. restricted to some 20% of angiosperms. They are mostly present in storage tissues, seeds, genus Iris. The chemical evidence supported fruits and roots. They act as chemical the division into various sections, but defence of plants against herbivory, and I. flavissima, originally placed in the section allelopathic reactions between plants. Pogoniris resembled species of the section Alkaloids are generally classified on the Regelia on the basis of phenolic charac- basis of predominant ring system present in teristics. Chromosomal evidence also the molecule. They are synthesized from a supported this transfer. few common amino acids like tyrosine, tryp- The technique of two-directional paper tophan, ornithine, argenine and lysine. chromatography, which brings about a more Tobacco alkaloid Nicotine (Nicotiana) is pronounced separation of flavonoids, has synthesized from nicotinic acid and caffeine proved very useful in taxonomic studies. (coffee beans and tea leaves) from purine. Hymenophyton (Bryophytes) was considered Isoquinolene alkaloids morphine, codeine by some researchers to be a monotypic and papaverine are found in opium poppy genus, but by others to include two species. (Papaver somniferum). Their distribution is Markham et al., (1976) on the basis of rapid often specific and thus taxonomically signifi- flavonoid extraction, two-dimensional cant (Figure 7.14). Conalium is the simplest chromatographic analysis and identification known alkaloid found in Conium maculatum (Figure 7.13) concluded that the genus (Apiaceae). Alkaloids are present in special- contains two distinct species, H. leptodotum ized parts of plant. Higher nicotine content Taxonomic Evidence 175

concentrate on water bath at 100 degree centigrade to one fourth volume; add NH4OH or NH3 dropwise till pH rises to 9-10 and precipitate alkaloids; centrifuge at 2000 rpm for 5-10 minutes; wash with 1% NH4OH; dissolve in few drops of ethanol; repeat above steps with tea, cigarette and coffee as control; take circular Whatman paper No. 1, immerse in 5% Sodium dihydrogen citrate for 5 minutes, dry in oven; make pore in centre of disc, mark circle of 1 cm, load extract and run chromatogram using solvent (butanol 217 ml, water 32 m, acetic acid 1.2 gm); and dry; on one chromatogram spray Iodoplatinate reagent (10 ml 5% Platinum chloride, add 240 ml 2% KI, make final volume to 500 ml with water) and to other Dragendroff’s reagent (make two solutions, one 0.6 gm Bismith subnitrate + 2 ml HCl+ 1m water; second 6 gm KI dissolved in 10 ml water; mix two solutions and filter, add 7 ml conc. HCl and 15 ml water, dilute to 400 ml with water); dry chromatograms and observe colour under UV; calculate Rf value. For Solvent extraction method take 2 gm of chopped plant material in a beaker containing 20 ml methanol; heat on water bath for 30 minutes at 70 degree centigrade, covering beaker with aluminium foil to prevent evapora- tion of methanol; filter, suspend residue in 2 ml methanol, add 12 ml HCl to break cell wall and release cell sap, shake and filter; wash residue with 8 ml of 1% HCl, and filter; collect all three filtrate, add NH4OH or NH3 and adjust pH to 10-11; add precipitate formed in separating funnel, and add chloroform, shake and collect lower organic layer; repeat procedure with chloroform, and label all collected solution as A; to acqeous layer in separating funnel add a pinch of sodium sulphate and 20 ml of mixture of ethanol and chloroform (2: 3 ratio); Figure 7.15 Glucosinolates. A: Mustard oil collect and label organic layer as B; put solutions A glucosid; B: Glucocapparine; and B in test tubes heat in water bath till volume is C: General structure of Gluco- reduced to about 2 ml; add 2 ml of 1% HCl and 2 ml sinolates. of chloroform in both test tubes, two layers are formed; collect upper layer using dropper; if turbid is found in only older leaves. In Datura alkaloids occur only in seeds. Alkaloids are more widely distributed in dicots as compared to monocots. Some of them are of medicinal importance at low concentration, but toxic at high concentration. Some such as lycotonine (Delphinium), scopolamine (Datura), and atropine (Atropa) cause poison- ing of livestock. Alkaloids are generally extracted from plants in weak acid alcoholic solution and precipitated by NH3. Their presence is tested through chromatic method, and quantified by solvent extraction method. For chromatographic method, take 10 gm of chopped plant tissue in beaker containing 30 ml of Figure 7.16 Structure of Amygdalin, cyanogenic 10% acetic acid in ethanol; heat in water bath at 60 glycosides found in seeds of al- degree centigrade for 40 minutes and filter; mond. 176 Plant Systematics filter through a piece of cotton film; put a drop of this extracted sample of alkaloids in a groove tile, add 2-3 drops of different reagents (1, Mayer’s reagent: dissolve 1.63 gm HgCl2 in 60 ml of distilled water; separately dissolve 5 gm KI in 10 ml of distilled water; mix two and distilled water to make 100 ml. 2, Wagner’s reagent: dissolve 1.27 gm io- dine and 2 gm KI in 10 ml of distilled water, make volume to 100 ml. 3, Dragendroff’s reagent, described above. 4, Scheilden’s reagent: dissolve 25 gm sodium tungstate and 17 gm of disodium hydrogen phosphate (Na2HPO4) in 125 ml of distilled water; adjust pH to 4 or 5 by using conc. HNO3 and note the change of colour and precipitate formation. Mears and Mabry (1971), in studies conducted on the family Fabaceae, observed that the alkaloid hystrine occurs only in three genera Genista, Adenocarpus (both belonging to Genistae) and Ammodendron (originally placed in Sophorae). The latter, however, lacks matrine, characteristic of Sophorae. This indicates that the transfer of the last genus also to Genistae is warranted. Families Papaveraceae and Fumariaceae are Figure 7.17 closely related. This affinity is supported Terpenoids: Menthol and Camphor, the monoterpenoids; Sweroside, a by the occurrence of the alkaloid protopine seco-iridoid from Swertia, Gentia- in both. naceae; Amarolide, a quassinoid Gershenzon and Mabry (1983) reported triterpenoid derivative from Ailan- that tropane alkaloids of Solanaceae and thus, Simaroubaceae. Convolvulaceae are similar, suggesting a close relationship. The families are placed ae and Fumariaceae were placed in the same in the same order in recent systems. Papa- order, Rhoeadales. Chemical and other veraceae, earlier grouped with Cruciferae evidence, however, supported the placement and Capparaceae, is now removed to nearer of Cruciferae and Capparaceae in the order Ranunculales on the basis of the absence of Capparales (on the basis of the presence of glucosinolates and presence of benzyliso- glucosinolates) and Papaveraceae and quinolene. Nymphaeaceae and Nelumbona- Fumariaceae in the order Papaverales—or ceae differ in the sense that the former lacks suborder Papaverineae of Ranunculales benzylisoquinolene alkaloids. Benzyliso- (Thorne, 2003)—(on the basis of the absence quinolene, and the alkaloids that can of glucosinolates and the presence of the be derived from it, are characteristic of alkaloid benzylisoquinolene). Bataceae and Magnoliidae, as also family Rutaceae, some Gyrostemonaceae were once placed in Rhamnaceae and genus Croton. Centrospermae (Caryophyllales) but subsequently removed due to the absence of Glucosinolates betalains. This removal was supported by the Glucosinolates are sulphur containing com- presence of glucosinolates, which are absent pounds found in 15 families of angiosperms, in Caryophyllales. mainly concentrated in the order Capparales (Figure 7.15). Mustard oils or isothiocyanates Cyanogenic Glycosides are hydrolytic products of glucosinolates. Orig- Cyanogenic glycosides are phytotoxins inally Cruciferae, Capparaceae, Papaverace- which occur in at least 2000 plant species, of Taxonomic Evidence 177 which a number of species are used as food can be fixed in the cap of screw vial; place strips in in some areas of the world. They are hydroly- picric acid (5.7 gm in 500 ml of distilled water, saturated with sodium bicarbonate and filtered) for sed by various enzymes to release hydrogen 5 minutes and dry with drier or in oven, paste strips cyanide, the process known as cyanogenesis, in the cap of the vial; put chopped leaves or plant and the plants as cyanogenic plants. Cassava material in so as cover the entire base of vial, add and sorghum are especially important staple 2-3 drops of distilled water and 1-2 drops of toluene, crush material with glass rod; cap the vial; foods containing cyanogenic glycosides. picrate paper in cap should not touch plant tissue There are approximately 25 cyanogenic or walls of vial; incubate at 600 C for 2 hours ; glycosides known. The major cyanogenic observe the change of paper colour to red. Ferrous glycosides found in the edible parts of plants hydroxide paper test: Dip rectangular strips of Whatman paper in 10% FeSO4 solution for 5 min- used for human or animal consumption utes, remove and dry; next immerse in 20% NaOH include Amygdalin (Figure 7.16; almonds, solution for 20-30 seconds and dry, and fix ino cap Prunus dulcis), Dhurrin (Sorghum album, of vial; put crushed leaves in vial, add 2-3 drops of S. bicolor). Linamarin (cassava, Manihot distilled water and 2-3 drops of toluene, crush using glass rod; cap the vial and incubate at 600 for 2 esculenta; lima beans, Phaseolus lunatus), hours; immerse strips in 30% H2SO4; observe colour Lotaustralin (cassava, Manihot cartha- change to prussian blue due to formation of sodium ginensis; lima beans, Phaseolus lunatus). ferric ferrocyanide. Prunasin (stone fruits, Prunus avium, P. padus, P. persica, P. macrophylla), and Taxiphyllin Terpenes (bamboo shoots, Bambusa vulgaris). The po- Terpenes include a large group of compounds tential toxicity of a cyanogenic plant depends derived from the mevalonic acid precursor primarily on the potential that its consump- and are mostly polymerized isoprene derivation will produce a concentration of HCN that tives. Common examples are camphor is toxic to exposed animals or humans. Hy- (Cinnamomum), menthol (Mentha), and caro- drogen cyanide is released from the cyano- tenoids (Figure 7.17). They seem to have a genic glycosides when fresh plant material definite role in the allelopathic effects of is macerated as in chewing, which allows plants. They are lipid soluble found in single enzymes and cyanogenic glycosides to come membrane bound liposomes, in glandular together, releasing hydrogen cyanide. Cya- cells as essential oils, and can be easily nides inhibit the oxidative processes of cells extracted with petroleum ether and chloro- causing them to die very quickly. Because form, and can be separated by GLC (Gas Liq- the body rapidly detoxifies cyanide, an adult uid Chromatography), enabling qualitative human can withstand 50-60 ppm for an hour as well as quantitative measure of chemi- without serious consequences. However, cal differences. exposure to concentrations of 200-500 ppm Terpenes are isomeric unsaturated hydro- for 30 minutes is usually fatal. Whereas most carbons of the basic 5-carbon isoprene of the cyanogenic glycosides are widely (CH2=C(CH3)-CH=CH2) present in Hamame- spread, others such as cyclopentenoid cya- lis japonica. Terpenoids, the common group nogenic glycosides are restricted in distribu- of terpenes are distinguished as 10-Carbon tion mainly to Flacourtiaceae, Passifloraceae, Monoterpenoids (Fennel, Menthol-Mentha, Turneraceae, and Malesherbiaceae. Leucine Gymnosperms), 15-C Sesquiterpenoids derived cyanogenic glycosides are found in (Asteraceae as sesquiterpenol, ABA, some Rosaceae, Fabaceae, and Sapindaceae. Sev- essential oils), 20-C Diterpenoids (Taxus- eral families belonging to Magnoliales and Taxol, gibbrellins), 30-C Triterpenoids Laurales contain Cyanogenic glycosides de- (sterols, steroids, saponins, betulin in Betula rived from tyrosine. papyrifera), 40-C Tetraterpenoids (Caro- Presence of cyanogenic glycosides can be tested by two methods. Picrate paper test: Cut Whatman tenoids) and poly-C Polyterpenoids (Rubber). no. 1 filter paper into rectangular strips so that they They have been largely used in distinguishing 178 Plant Systematics specific and subspecific entities, geographic lies. The occurrence of iridoids in several races and detection of hybrids. Studies in unrelated families, e.g. Hamamelidaceae Citrus have focused on determination of the and Meliaceae, however, suggests that origin of certain cultivars. Studies on iridoids could have arisen independently sev- Juniperus viginiana and J. ashei have refuted eral times in the evolution of angiosperms. previous hypotheses about extensive hybrid- The occurrence of a distinctive iridoid ization and introgression between the two aucubin in Budleja has been taken to sup- species. Their distribution in Pinus has been port its transfer from Loganiaceae to used (Mirov, 1961) to understand relation- Budlejaceae. Aucubin and geniposide, have ships. P. jeffreyi has been considered a vari- shown antitumoral activities. ety of P. ponderosa, but turpentine distribu- Iridioid presence in plant tissues can be tested tion showed that it strongly resembles the using Trim-Hill Reagent. Take 5 gm of chopped leaves in a beaker containing 5 ml of 1 % HCl; heat on group Macrocarpae and not Australes to which water bath at 40-500C for 30 minutes; filter using P. ponderosa belongs. A major contribution of coarse filter paper; take 0.1 ml of filtrate in a test terpenoid chemistry has been the use of ses- tube; add 1 ml Trim-Hill Reagent (THR: 10 ml acetic quiterpene lactones in the family acid, 1 ml 0.2 % CuSO4 and 0.5 ml conc. HCl); warm over spirit lamp for few seconds; change of colour Compositae. Many tribes within the family commonly to yellow, orange or red confirms presence are characterized by distinct types of sesquit- of iridoids. Quantitative estimation can be done by erpene lactones they produce. This helped to reading absorption at 609 nm, concentration calcu- establish that genus Vernonia has two cen- lated on the basis of standard curve of aucubin. tres of distribution—one in the Neotropics Cronquist (1977) proposed that chemical and the other in Africa. Similarly, studies on repellents had an important role in the evo- Xanthium strumarium (McMillan et al., 1976) lution of major groups of dicots. The alkaloid have thrown some light on the origin of Old Isoquinolene of Magnoliidae gave way to World and New World populations. Old World tannins of Hamamelidae, Rosidae and populations produce xanthinin/ or Dilleniidae, which in turn gave way to the xanthinosin, whereas the New World popula- most effective iridoids in Asteridae, the fam- tions contain xanthinin or its stereoisomer ily Compositae developing the most effective xanthumin. Plants of the chinense complex sesquiterpene lactones. (from Louisiana) contain xanthumin and are believed to be the source of introduced Non-Semantide chinense populations in India and Australia. Macromolecules Triterpenoids occur in several families. Betulin occurs only in bark of white birch In addition to DNA and RNA, which will be (Betula papyrifera) and its relatives, is wa- dealt under Molecular systematics, the mac- terproof highly flammable, and is taxonomi- romolecules include proteins , and complex cally useful at species level. Triterpene sa- polysaccharides such as starches and ponins occur in Apiaceae and Pittosporaceae celluloses. Starches are commonly found in and support their close relationship. the form of grains which may be concentric Iridoids constitute another important (Triticum, Zea) or eccentric (Solanum group of terpenes (mostly monoterpene lac- tuberosum) and present anatomical charac- tones). They are present in over 50 families teristics which can be seen under a micro- and their presence is correlated with sym- scope. Detailed studies of starch grains petaly, unitegmic tenuinucellate ovules, under SEM also hold promise for taxonomic cellular endosperm and endosperm hausto- significance. ria. Assuming that ‘independent origin of several groups with this combination of inde- Proteins pendent attributes is unlikely’, Dahlgren Proteins, together with nucleic acids, are brought together all iridoid-producing fami- often called Semantides, which are primary Taxonomic Evidence 179 constituents of living organisms and are species A, but when mixed with the protein involved in information transfer. Based on extract of species B, the degree of precipitin their position in the information transfer reaction would depend on the similarity DNA is a primary semantide, RNA second- between the proteins of the two species. ary semantide and proteins the tertiary The antiserum obtained from the mam- semantides. Semantides are popular mal normally contains several immunoglo- sources of taxonomic information, and most bulins that can bind to the same antigen, is of this information has come from proteins. said to be polyclonal. This is because an The information about DNA and RNA will be antigen activates several different lympho- discussed under Molecular Systematics in cytes within the animal, each producing a the next section; only proteins are being different antibody for the same antigen. discussed here. Techniques have now been developed which Proteins are complex macromolecules can generate monoclonal antibodies. In a made up of amino acids linked into a chain method developed by Milstein and Köhler by peptide bond, thus forming a polypeptide (1975), antibody-producing lymphocyte of chain, organized into a three dimensional mammal (which can not grow and divide in structure. Because of their complex struc- cultures) was fused with malignant myoloma ture, special techniques are necessary for the cell (cancer cell which can grow rapidly in isolation, study and comparison of proteins. cultures) to produce hybrid cells called hy- These methods include serology, electro- bridoma. These hybridomas can grow, pro- phoresis and amino acid sequencing. liferate and produce large amount of monoclonal antibody. Serology Antigens are mostly extracted from seeds and pollen. In early works, crude total com- The field of systematic serology or serotaxo- parison of precipitin reactions was done but nomy had its origin towards the turn of the now more refined methods have been twentieth century with the discovery of developed which can bring about individual serological reactions and development of the antigen-antibody reactions. Major methods discipline of immunology. Precipitin reactions include: were first reported by Kraus (1897). The technique was originally applied by J. Bordet (1899) in his work on birds, when he reported that immune reactions are relatively specific and the degree of cross reactivity was essentially proportional to the degree of relationship among organisms. The present technique of serology is based on immunological reactions shown by mammals when invaded by foreign proteins. In the study of estimating relationships between plants, the plant extract of species A containing proteins (antigens) is injected into a mammal (usually a rabbit, mouse or goat). The latter will develop antibodies, each specific to an antigen with Figure 7.18 Double-diffusion serology. A: An- which it forms a precipitin reaction, coagu- tigens and antibodies moving lating and thus making it non-functional. towards each other on the gel. These antibodies are extracted from the body 1-10 refer to antigen mixtures from of the animal as antiserum. This antiserum ten different taxa; B: Resultant is capable of coagulating all proteins in precipitant lines. 180 Plant Systematics

Radio-immunoassay (RIA) In this technique the antibodies or antigens are labelled with radioactive molecules enabling their detection even when present in minute quantities. Enzyme-linked immunosorbent assay (ELISA) In this technique either the antibodies or antigens are labelled linked with enzymes, Figure 7.19 Immuno-electrophoresis. A: Anti- thus enabling detection even in very small gen separation by electrophoresis; quantities. B: Antibodies and separated antigens diffusing towards each other; It must be noted that there are specific C: Resultant precipitant lines. sites on proteins (determinants), which are capable of initiating production of immu- noglobulins in specific cells of mammals. Double-diffusion serology Determinants are regions consisting of In this technique the antigen mixture and 10-20 amino acids and one protein may com- antiserum are allowed to diffuse towards one prise several different determinants and another in a gel (Figure 7.18). The different thus several antigens. proteins travel at different rates and thus Extensive studies of the immunoelectro- the reactions occur at different places on the phoretic patterns of the genus Bromus were gel. This method allows comparison of done by Smith (1972, 1983). Results showed precipitin reactions of several antigen mix- that North American diploids of the genus tures from different taxa simultaneously on are reasonably diverse. The study also high- the same gel. In a modification of this lighted that antisera raised from different method, the antiserum is placed in a circu- species could provide different results. On lar well surrounded by a ring of several wells the basis of serological studies, Smith containing the samples of antigens. established the distinct identity of B. Pseudosecalinus, previously recognized as Immuno-electrophoresis a variety of B. secalinus. This separation was In this technique the antigens are first supported by cytological evidence also. separated unidirectionally in a gel by elec- Serological studies have also supported the trophoresis and then allowed to travel removal of Nelumbo from Nymphaeaceace towards the antiserum (Figure 7.19). This into a separate family Nelumbonaceae, method enables a better separation of con- placement of Hydrastis in Ranunculaceae stituent reactions but has the limitation that (and not Berberidaceae), and merger of only one antigen mixture can be handled on Mahonia with Berberis (Fairbrothers, 1983). a single gel. Serology may be done through comparison of protein mixtures or the comparison Absorption of single isolated and purified proteins. Protein mixtures from different species Schneider and Liedgens (1981) developed a often contain a large number of common pro- complex but excellent procedure of mono- teins, especially those involved in common clonal culture of antibodies, but unfortu- metabolic processes. The antibodies for nately used this for construction of a ‘phylo- these common proteins (antigens) are first genetic tree’ not parallel with accepted evo- removed from the antiserum so that there lutionary schemes. Fairbrothers (1983) cau- is a more logical comparison of precipitin tioned that an evolutionary tree should not reactions. be constructed on the reactions of a single Taxonomic Evidence 181 enzyme or a single species. Lee (1981) remove water; pour 5% Stacking gel (0.82 ml using purified protein for antigen and using Acrylamide-bisacrylamide, 3.27 ml distilled water, 0.625 ml 0.5 M Tris-HCl, 0.05 ml 10% SDS, 0.25 ml different techniques concluded that Franse- 10% APS, 5μl TEMED) up to one third volume of ria (Asteraceae) should be merged with glass mould, insert comb carefully so that bubbles Ambrosia. are not formed, allow to polymerize for 30 min; in- stall gel assembly into electrophoresis apparatus; add 5X SDS Running buffer (6.026 g Tris, 28.8 g Electrophoresis Glycerine, 2 g SDS; make to 200 ml with distilled The technique of serology serves to compare water) in upper and lower chamber, remove the comb from under the buffer; load protein samples of the degree of similarity between the protein different concentrations into wells by micropipette mixtures of different species and does not in- (also load molecular weight marker proteins in one volve the identification of proteins. The sepa- lane); connect electrodes and run current of 20 mA ration and identification of proteins can be for 10-15 min, increase current to 40 mA, track the mobility of sample; disconnect power, remove gel done by electrophoresis. Separation is based carefully; stain gel with Coommassie Blue stain on the amphoteric properties of proteins (200 ml methanol, 50 ml glacial acetic acid, 250 ml whereby they are positively or negatively water, 0.25% Coommasie Blue) for 15-30 min; charged to various extents according to the destain gel till bands are visible. Method for Western blotting: Use gel from elec- pH of the medium, and will travel through gel trophoresis without staining; make cut at bottom of at various speeds across a voltage gradient, gel for orientation; cut nitrocellulose sheet to the usually carried out in a polyacrylamide gel size of gel and dip in transfer buffer (14 g glycerine, (polyacrylamide gel electrophoresis—PAGE). 3 g Tris base, 0.75 g SDS, 100 ml methanol, make volume to 1 litre with distilled water); soak sponge The procedure involves homogenizing the tis- in transfer buffer and place wet sponge on gel sues (containing proteins) in a buffer solu- holder; place Whatman paper on sponge; place gel tion. Sample is loaded into wells in the cen- over Whatman paper avoiding air bubbles; keep tre of the gel. The current is run for a spe- membrane with shining surface towards gel and roll with glass pipette; place Whatman 3 mm paper cific time, and the proteins run up to differ- over the membrane and a second sponge over the ent points on the gel. The gel, usually 1 cm paper; place assembly in transfer tank containing thick, is cut into three thin slices, each about sufficient transfer buffer to completely cover the blot; 3 mm thick. These slices are subjected to place assembly in case with gel facing the cathode and membrane the anode; run current for 4 hours different staining techniques and proteins at 36 V; lift membrane and stain with Poinceau S are identified using various criteria. In com- Staining Solution. monly used Western blot technique the protein bands are transferred from the gel to In the technique of isoelectric focusing, nitrocellulose membrane for further process- a gel of a single pore size, is set up with a pH ing. In disc-electrophoresis, a gel of larger gradient (usually 3-10), so that proteins pores is placed over a gel of smaller pores. come to lie on the gradient corresponding to The former is used for crude separation and their iso-electric point. These can be sub- the latter for a complete separation. sequently separated more completely by disc- electrophoresis. Isoelectric focusing of Rubisco (Ribulose 1, 5 diphosphate carboxy- Method for SDS-PAGE Electrophoresis: Prepare working concentrations of 2, 5, 10 and 25 μg of lase) has been very useful in determining protein sample by diluting the stock solution; add relationship between species of Avena, loading buffer (5 ml 0.5 M Tris, pH 6.8, 8 ml 50% Brassica, Triticum, and several other genera. Glycerol, 8 ml 10% SDS, bromophenol blue, 2 ml It is an excellent protein for helping to evalu- β− mercaptoethanol added immediately before loading); boil for 5 min; store in ice; clean, dry and ate hybridization. assemble glass plates of casting assembly; prepare Electrophoretic studies have supported the 10% resolving gel (3.24 ml Acrylamide-bisacrylamide, origin of hexaploid wheat (Triticum aestivum) 3.5 ml distilled water, 2.5 ml 1.5 M Tris-HCl, 0.1 from Aegilops tauschii and T. dicoccum. Johnson ml 10% SDS, 0.5 ml 10% APS, 10μl TEMED) and pour into assembly up to its two third position; over- (1972), working on storage proteins showed lay with water ; allow gel to polymerise for 30 min, that T. aestivum (AABBDD) and T. dicoccum 182 Plant Systematics

Figure 7.20 Cladogram of 25 species of seed plants based on the ‘ancestral sequence method’ used by Boulter (1974) (after Boulter).

(AABB) possess all proteins of the A genome morphological and cytological data. By mixing of the diploid T. monococcum (AA). They also proteins of A. tauschii and T. dicoccum it share proteins of the B genome of uncertain was seen that the electrophoretic properties origin. The D genome is believed to have of the mixture closely resemble those of come from Aegilops tauschii as evidenced by T. aestivum, thus proving the origin of the Taxonomic Evidence 183 latter from the two previous species. Electro- differences between the proteins result from phoretic studies have also helped to assess different sequences of amino acids in the species relationships in Chenopodium polypeptide chain. It is now possible to break (Crawford and Julian, 1976), by combining off the amino acids from the polypeptide data from flavonoids with proteins. A flavonoid chain one by one, identify each chromato- survey of seven species showed that in some graphically and build up the sequence of taxa, the flavonoid data were fully compatible amino acids step by step. Cytochrome c is with interspecific protein differences, but in the most commonly used molecule and out some cases, did not agree. Thus, Chenopo- of 113 amino acids, 79 vary from species to dium atrovirens and C. leptophyllum had species, but alteration of even one of the identical flavonoid patterns but could be other 34 destroys the functioning of the distinguished by their different seed protein molecule. Being present in all aerobic or- spectra. C. desiccatum and C. atrovirens, on the ganisms, it is ideal for comparative studies. other hand, were closely similar in seed Boulter (1974) constructed a cladogram proteins but differed in flavonoids. Both (Figure 7.20) of 25 species of spermatophytes flavonoid and protein evidence, however, dis- using the ‘ancestral sequence method’. tinguished C. hians from C. leptophyllum, thus Ginkgo biloba, the only gymnosperm used providing support to their recognition as sepa- occupied isolated position in the cladogram. rate species. Vaughan et al., (1966) through Ginkgo with an isolated phylogenetic posi- the study of serology and electrophoresis have tion is no new discovery, but rather a long shown that Brassica campestris and B. oleracea established fact. But the fact that amino acid are closer to each other than to B. nigra. sequencing also produces a similar Electrophoresis has also made possible cladogram establishes the significance of the separation of allozymes (different forms such studies in understanding phylogeny. of the same enzyme with different alleles Recent data from various fields have at one locus) and isozymes (or isoenzymes pointed to the merger of Aegilops with with different alleles at more than one Triticum. Autran et al., (1979) on the basis of locus). Barber (1970) showed that certain N-terminal amino acid sequencing supported polyploids possess isozymes of all their this merger. In general, the number of amino progenitors plus some new ones. Backman acid differences is roughly parallel to the (1964) crossed two strains of maize, each distance between the organisms in tradi- with three different isozymes. F1 possessed tional classifications, suggesting that the all six isozymes. The hybrids thus show method is broadly reliable. There are, how- molecular complementation. ever, certain contradictions. The number of Studies of the genus Tragopogon have con- differences between the cytochrome c of Zea firmed that the tetraploid T. mirus is a hybrid mays and Triticum aestivum (both members of between two diploid species, T. dubius and the same family Poaceae) is greater than T. porrifolius. Whereas the parental diploids between Zea mays and certain dicotyledons. were found to be divergent at close to 40 per It has been found that cytochrome c and cent of the 20 enzyme loci examined, the plastocyanin (another protein commonly tetraploid hybrid possessed completely addi- used in amino acid sequencing studies) can tive enzyme patterns. The evidence thus sup- exhibit a large number of parallel substitu- ported the recognition of a hybrid on the basis tions (identical changes from one amino acid of morphological and chromosomal evidence. to another at the same position in the protein in different organisms), thus rendering them unsuitable for constructing phylog- Amino acid sequencing enies. The practical solution is to use evi- Since only 22 amino acids are known to be dence from a wide range of proteins, prefer- the constituents of proteins, the primary ably using different techniques. 184 Plant Systematics

MOLECULAR SYSTEMATICS years ago the primary atmosphere consisted of only hydrogen and helium, but being too The closing years of the past century saw small a planet to hold these light gases, they the concentration of macromolecular stud- floated away into space. The earth accumu- ies towards DNA and RNA, resulting in the lated its secondary atmosphere because of establishment of an emerging field of mo- volcanic activity in early hot earth and the lecular systematics. Although flavonoids gases consisted of largely steam, variable and isozymes also constitute molecular data, amounts of CO , N , SO , H S, HCl, Sulphur molecular systematics commonly deals ex- 2 2 2 2 and smaller quantities of H , CH , SO , NH . clusively with the utilization of nucleic acid 2 4 3 3 There was no free oxygen. Our present at- data. As molecular data reflects gene-level mosphere is of biological origin, in which changes, it was believed to reflect true phy- methane and ammonia have largely been logeny better than morphological data. It has, consumed, inert components like nitrogen however, been realized that molecular data remained unchanged, and oxygen produced may also pose similar problems, although by photosynthesis. This happened nearly there are more molecular characters avail- 2500 m years ago when Cyanobacteria, the able and comparison is generally easier. first photosynthetic bacteria made their appearance. The ultraviolet radiations from Molecular evolution the sun, together with lightening discharges Traditionally, different taxa, especially the caused the gases to react in the primeval species have been characterized primarily atmosphere forming simple organic com- on morphological differences (phenotypes). pounds such as amino acids, sugars and Additionally differences in physiology, bio- nucleic acid bases. This mostly happened chemistry, anatomy, palynology, embryology, because of gases dissolving in primeval gross chromosome structure and behaviour, oceans and continuing to react forming have been used in refining evolutionary primitive soup, the precursor of life. Further trees. Although, it had been long recognized reactions formed polymers, globules and that evolution is based on genetic changes, eventually the first primitive cell. only during the last two decades, there have The possibility of such reactions in the been forceful drive to use genetic material primitive atmosphere was demonstrated by for a better understanding of evolutionary re- a Russian biochemist Alexander Oparin in lationships. Those species that are closely 1920s who proposed that life evolved before related, are expected to have greater simi- there was any free oxygen in the atmosphere. larities in their genetic material than the The oxygen if present at that stage would distantly related species. During the past have reacted with precursor organic mol- decade, molecular genetics has taken a ecules formed in the atmosphere, oxidizing dominant role in enabling us to understand them back into carbon dioxide and water. speciation and evolution clearly. Differences These reactions were mimicked by biochem- in the nucleotide sequences are quantita- ist Stanley Miller in 1950s, who subjected a tive and can be analyzed using mathemati- mixture of methane, ammonia and water cal principles, utilizing the help of computer vapour to high voltage discharge or to ultra- programs. Evolutionary changes at the DNA violet light, and the products allowed to dis- level can be objectively compared among solve and react in water. As long as oxygen different species to establish evolutionary was excluded, the results were similar pro- relationships. ducing several organic molecules such as amino acids, formic acid, glycolic acid, lactic Evolution of Nucleic acids acid, acetic acid, propionic acid, succinic acid, urea, purines, pyrimidines and sugars. These and Proteins energy sources can also destroy these organic When Earth originated nearly 5000 million molecules present in the atmosphere. The Taxonomic Evidence 185 occurrence of primeval oceanic atmosphere nucleotide changes give rise to synonymous helped shielding and preserving these or- codons, that code for the same amino acid. ganic molecules and prevented their destruction. Organic acids, particularly amino acids Evolutionary Rates within are soluble in water and non-volatile, and little chance of their returning to atmosphere. a Gene The polymerization of amino acids and It is now well established that different parts other monomers to form macromolecules of genes evolve at widely different rates, requires energy for formation of bonds and reflecting the extent of natural selection on removal of water. Such polymers known as each part. Some nucleotides code for amino proteinoids can be generated by simple heat- acid sequence of a protein (Coding ing of amino acids at around 1500 C for a few sequences), whereas others do not code for hours. Such heating could have occurred amino acids in a protein (noncoding near volcanoes or when pools left behind by sequences). Latter include introns, leader changing coastline evaporated. Inorganic regions, trailer regions (all these are tran- polyphosphates present in the primeval times scribed but not translated), and 5’ and 3’ would have helped in condensation. flanking sequences that are not transcribed. It is generally thought that RNA probably Pseudogenes, which are nucleotide evolved first through polymerisation of sequences that no longer produce functional nucleotides present in primeval environ- gene products as they have accumulates ment. When RNA template is incubated with inactivating mutations, also constitute mixture of nucleotides and zinc as a cata- noncoding sequences. Even within coding lyst, a complementary piece of RNA is regions of functional gene, not all nucleotide synthesized. The complementary strand in substitutions produce a corresponding turn will act as template to generate more change in the amino acid sequence of a of original RNA molecule. protein. Many substitutions occurring at the It is assumed that RNA originated even third position of triplet codons have no before proteins. It is also believed that effect on the amino acid sequence of the pro- earliest organisms had both genes and en- tein because such changes often produce zymes made of RNA and formed RNA world. synonymous codons. The examples of enzymatically active RNA Although synonymous and nonsynony- are found in Ribozymes and self-replicating mous nucleotide changes are likely to arise introns. Later proteins infiltrated and took in equal frequency (because enzymes re- over the role of enzymes. This was followed sponsible for DNA replication and repair can by the evolution of DNA as genetic material, not differentiate between the two), yet the and RNA relegated to the role of intermedi- rate of synonymous nucleotide changes (con- ate between genes and the enzymes. servative substitutions of Kimura) is about Changes in DNA sequences (mutations) five times greater than observed rate of non- lead to the changes in the codons, that in synonymous changes (disruptive substitu- turn determine the sequence of various tions of Kimura). This is because synony- amino acids, deciding the final structure and mous changes do not alter protein structure function of a protein. These changes com- and function and are tolerated by natural se- monly result from changes of one or more lection, but the nonsynonymous changes are base pairs in a DNA sequence. Two types of usually detrimental and are excluded by nucleotide changes occur in the genome. natural selection. Synonymous substitution Some changes give rise nonsynonymous rates and not nonsynonymous nucleotide codons, coding for different amino acid, and changes are, as such, the fair reflection of thus resulting in a corresponding change in actual mutation rate within a genome. the amino acid sequence of a protein. Other Pseudogenes and 3’ flanking regions also 186 Plant Systematics show high evolutionary rates, comparable to synonymous changes. 5’ flanking regions Large Single copy region show a little slower rates, whereas leader atpB and trailer regions show very low evolution- rbcL ary rates, slightly higher than nonsynonymous changes. It is as such obvious that nucleotide changes in noncoding regions or codings that do not alter amino acid se- matK quences, have high rate of evolution, whereas changes in coding regions, especially those affecting amino acid sequences show very low rate of evolution, as most of Inverted them get filtered out by natural selection. Repeat B

It is important note that whereas muta- Inverted tions are changes in nucleotide sequences Repeat A that occur because of mistakes in DNA repli- ndhF cation or repair processes, the substitutions Small Single are mutations that have passed through the copy region filter of selection at least at some level. Figure 7.21 Chloroplast DNA with location of genes commonly used in molecu- Location of molecular data lar systematics. Systematists use molecular data from three different locations within a plant cell: chlo- as each cell contains several mitochondria, roplast, mitochondrion and the nucleus, the number of mtDNA molecules per cell yielding three different types of genome could be very large. Most mtRNA molecules (DNA). Chloroplast genome is the smallest are circular, but linear in Chlamydomonas ranging from 120 to 160 kbp (kilo base pairs) reinhardtii. In vascular plants, mtDNA is con- in higher plants (up to 2000 kbp in alga Ac- siderably larger, circular, containing many etabularia), mitochondrion genome 200 to noncoding sequences, including some that 2500 kbp, whereas the nuclear genome is are duplicated. The physical mapping of much larger often ranging between million genes in vascular plants has shown that to more than billion kbp. Although the these are located in different positions on former two are inherited from the maternal mtDNA circles of different species, even in parent, the latter is biparental. Mitochon- fairly closely-related species. This renders drion genome undergoes a lot rearrange- mtDNA less useful in phylogenetic studies. ments, so that many different forms may be found within the same cell, and hence is of Chloroplast DNA little significance in interpreting phyloge- Studies of DNA in plants have largely been netic relationships, whereas the other two undertaken from chloroplast compared to the are highly stable not only within the same other two cellular genomes. This is because cell, but also within a species, and present chloroplast DNA (cpDNA) can be easily iso- useful taxonomic tools. lated and analyzed. It is also not altered by evolutionary processes such as gene dupli- Mitochondial DNA cation and concerted evolution (in rRNA, hav- Mitochondrial DNA has been studied from ing thousands of copies of repeated segments several species of plants. Each mitochon- so that mutation in one sequence gets cor- drion contains several copies of mtDNA, and rected to match other copies, this homog- Taxonomic Evidence 187 enization process is termed as concerted 18S (SSU) 5.8S 26S (LSU) evolution). It also has an added advantage IGS in that it is highly conserved in organisation, size and primary sequence. Chloroplast DNA is closed circular molecule (Figure 7.21) with two regions that encode the same genes but in the opposite direction and known as ITS1 ITS2 inverted repeats. Between the inverted repeats are single copy regions. All cpDNA Figure 7.22 A portion an array of ribosomal molecules carry basically the same set of genes. Each unit has three sub- genes, arranged differently in different spe- units separated by two ITS (in- cies of plants. These include genes for ribo- ternal transcribed spacer) re- somal RNA, transfer RNA, ribosomal proteins gions. Adjacent units are separated by IGS (intergenic spacers). and about 100 different polypeptides and subunits of enzyme capturing CO2. Most studies of chloroplast DNA have ited biparentally, the chloroplast genome is focused on chloroplast gene rbcL, which inherited maternally. Thus the hybrid plant encodes large subunit of photosynthetic will possess the nuclear complement of both enzyme RuBisCO (ribulose-1,5-biphosphate parents but only the cpDNA of the maternal carboxylase/ oxygenase, carbon acceptor in plant. all photosynthetic eukaryotes and The study of nuclear genes has tradition- cyanobacteria. The gene occurs in all plants ally involved ribosomal RNA. Ribosomal genes (except parasites), is fairly long (1428 bp), are arranged in tandem arrays of up to sev- presents no problems of alignment, and has eral thousand copies. Each set of genes has many copies available in the cell. Ready a small subunit (18S) and a large subunit availability of PCR primers has made it pos- (26S) separated by a smaller (5.8S) gene (Fig- sible to generate over 2000 sequences, ure 7.22). It must be noted that 5S RNA al- primarily of seed plants. Other commonly though also a part of the unit, but of the un- used chloroplast genes include atpB, (beta known function is synthesized separately subunit of ATP synthetase involved in the outside nucleolus. The three subunits are synthesis ATP), matK (maturase involved separated by internal transcribed spacers in splicing type II introns from RNA tran- (ITS: ITS1 and ITS2). Each set of genes is scripts), and ndhF (subunit of chloroplast separated from adjacent one by a larger NADH dehydrogenase, which functions in spacer (variously known as IGS- intergenic converting NADH to NAD+H, involved in spacer, EGS- extragenic spacer or NTS- reactions of respiration. Of these four nontranscribed spacer). Sequences of 18S and commonly used genes rbcL, atpB, and matK 26S genes have been used in phylogenetic belong to large single copy region, where studies, because they have some highly con- as ndhF is located on small single copy servative regions which help in alignment, region. and other variable regions, which help to distinguish phylogenetic groups. Recently ITS Nuclear DNA region has been used to determine relationships among species. In general, the ITS re- The nuclear DNA, although more difficult to gion has supported relationships inferred analyze, and hence used less frequently has two great advantages. Certain nuclear from chloroplast studies and morphology. sequences evolve more rapidly than cpDNA sequences, and thus allow finer level of dis- Molecular techniques crimination at population level than cpDNA. The techniques of handling molecular data Also, whereas the nuclear genome is inher- saw great advancements over past few de- 188 Plant Systematics cades, starting with comparison of whole hydroxyapatite. Any radioactive strands (A) DNA molecules. It is now possible to break that have separated from the DNA duplexes DNA at specific sites, generate maps of in- pass through the column, and the amount is dividual genes, determine sequence of measured from their radioactivity. A graph genes, and make multicopies of a DNA showing the percentage of ssDNA at each through Polymerase chain reaction (PCR) temperature is drawn. The temperature at technique. These help in generating enough which 50% of the DNA duplexes (dsDNA) have molecular data for comparison. been denatured (T50H) is determined. Bolton (1966) found that only half nucle- Total DNA/DNA otide sequences in the DNA of Vicia villosa are similar (homologous) with those of Pisum, hybridization while only 1/5th are homologous between The early studies on utilization of nucleic Phaseolus and Pisum. In the technique of acids in systematics involved DNA/DNA hy- DNA/RNA hybridization, the RNA is hybrid- bridization using the whole DNA for study. ized with the complementary DNA of related In a method developed by Bolton and plants. Mabry (1976) used this technique in Mecarthy (1962), the extracted DNA is Centrospermae (Caryophyllales) and con- treated to make it single stranded. The DNA cluded that the family Caryophyllaceae (al- of another organism is, similarly, made though lacking betalains) is quite close to single stranded. The two are subsequently betalain-containing families, but not as allowed to hybridize in vitro. The degree of close as the latter are to each other. reassociation (annealing) expresses the degree of similarity in sequences of nucle- Chromosome painting otides of the two organisms. Procedure in- The technique of chromosome painting pro- volves heating DNA so that it becomes de- vides another way to compare entire ge- natured into single strands (ssDNA). The nomes. A fluorescent label is attached to the temperature is lowered just enough to allow DNA of individual chromosomes of one spe- the multiple short sequences of repetitive cies. These chromosomes are exposed to the DNA to rehybridize back into double-stranded chromosomes of another species. The re- DNA (dsDNA). The mixture of ssDNA (repre- gions of gene homology will hybridize taking senting single genes) and dsDNA (represent- up the fluorescent label and the ‘painted’ ing repetitive DNA) is passed over a column chromosomes can be examined under a mi- packed with hydroxyapatite. The dsDNA croscope. The method is a modification of sticks to the hydroxyapatite; ssDNA does not fluorescence in situ hybridization (FISH). and flows right through. The purpose of this Chromosome painting studies in humans step is to be able to compare the informa- have shown that human chromosome 6 has tion-encoding portions of the genome — counterparts in chromosome 5 of chimpan- mostly genes present in a single copy — zee, chromosome 7 of pig and chromosome without having to worry about varying 23 of cow as few examples. amounts of noninformative repetitive DNA. The ssDNA of species A is made radioactive. The radioactive ssDNA is then allowed to Unravelling DNA Structure rehybridize with nonradioactive ssDNA of Understanding DNA structure involves the same species (A) as well as — in a sepa- complex procedure to unravel the arrange- rate tube — the ssDNA of species B. After ment of genes in DNA, and sequence of hybridization is complete, the mixtures arrangement of nucleotides which differen- (A/A) and (A/B) are individually heated in tiates different genes and the DNA of differ- small (2°–3°C) increments. At each higher ent organisms. The procedure involves some temperature, an aliquot is passed over distinct steps. Taxonomic Evidence 189

DNA Cleaving This technique is a landmark development of 1970s that can be used to generate physical maps of individual genes or the entire genome. The DNA extracted from a species is cut (cleaved) at specific points (recognition-site; restriction site), yielding restriction fragments using restriction endonucleases (REs). The specific enzymes are named using the first letter of the genus and the first two letters of the species of the bacterium from which the enzyme is isolated. Thus, enzyme EcoRI which cleaves DNA at every site where it finds sequence GAATTC (Figure 7.23) is obtained from Escherichia coli. HindIII obtained from Haemophilus influenzae strain Rd cleaves DNA at AAGCTT, and BamHI from Bacillus amyloliquefaciens cleaves GGATCC. More than 400 restriction enzymes have already been isolated. Their natural function is to inactivate invading viruses by cleaving the viral DNA. Majority of restriction enzymes recognize a 6-nucleotide sequence, but others recognize 4- nucleotide sequence. Thus AluI (from Arthrobacter luteus) recognizes AGCT, TaqI (from Thermus aquaticus) TCGA, and HaeIII (from Haemophilus aegypticus) GGCC. Each restriction enzyme can recognize a sequence four to six nucleotides long, having twofold rotational symmetry, because it can be rotated 1800 without change in the base sequence. Thus, sequence recognized by EcoliRI—if read from ‘5 to 3’ in both strands, of DNA segment—would read GAATTC, but if read from ‘3 to 5’ in both strands it would Figure 7.23 Cleavage of DNA using EcoRI re- read CTTAAG. This symmetry is known as striction enzyme. The enzyme gives palidrome (as, for example, in nonsense staggered cuts to ensure compli- phrase: AND MADAM DNA that is read simi- mentary single stranded termini. larly from both ends). This feature combined with the fact that most restriction enzymes give staggered cuts (and not straight cuts) middle of the recognition sequence, result- wherein they cut two strands of DNA at dif- ing in blunt end or flush end. ferent points, produces complementary The use of restriction enzymes allows the single-stranded termini that can be rejoined DNA to be dissected into a precisely-defined later using enzyme DNA ligase. Such set of specific segments. Using different enzymes produce sticky ends or cohesive enzymes, sites cleaved by different enzymes ends. Others like AluI and HaeIII, however, can be identified and ordered into a restric- make simple double stranded cut in the tion map or physical map. 190 Plant Systematics

Method of DNA Cleaving: Label three sterile and complementary ends of two different microfuge tubes as E (for EcoRI), H (for HindIII) and l DNA molecules join to form double stranded (for control). In tube E add 12μl distilled water, 2μl of 10 X Buffer (prepared by dissolving 108 g Tris, 55 recombinant DNA, in the presence of DNA g Borate and 7.4 g EDTA in 700 ml of distilled wa- ligase. For successful cloning, one of the ter, adjust pH to 8.3 and sterilize by autoclaving), parental DNAs incorporated into recombi- μ 5ml of lamda DNA (1mg) and 1 l of EcorRI restriction nant DNA molecule is capable of self-repli- enzyme ( 2 U). In tube H add same chemicals except 1μl of HindIII restriction enzyme ( 2 U) instead of cation, and is known as cloning vector. In EcorRI. In l tube add same chemicals but replace practice, the gene or DNA fragment of distilled water for restriction enzyme. Flick all tubes interest is inserted into a specially-chosen to mix well and spin for 5 minutes in microfuge. cloning vector, which is used as a vehicle Incubate all tubes at 37oC for 60 minutes in water bath. Stop reaction by incubating tubes at 65oC for 5 for carrying foreign DNA into a suitable host minutes. Subject contents of all three tubes to agar- cell, such as a bacterium. ose gel electrophoresis for 1 hour at 100 V. Stain the gel with ethidium bromide. Fragments with be lined in each lane according to size. These can be com- Plasmid vector pared and suitably analysed. Plasmids are extra-chromosomal double- Method of Agarose Gel Electrophoresis: Prepare stranded circular DNA molecules present in 1% agarose in 1X TBE buffer; heat the mixture on a microorganisms, especially bacteria. The hot plate or microwave until the solution becomes plasmid chosen as vector contains a gene for μ clear; add Ethidium bromide (EtBr) (0.5 g/ml in antibiotic resistance. In the most commonly- 0.5X TBE buffer) to agarose solution when it cools to 45-500C; clean the casting tray, place on table employed technique (Figure 7.24-I), the re- and adjust equilibrium bubble; position the comb 1 combinant plasmids (with foreign DNA in- mm above the plate; pour solution into gel tray en- serted into plasmid) are added to an E. coli suring that there is no bubble between or under the bacterial culture pretreated with calcium teeth of the comb; allow the gel to set; pour some 1X TBE buffer over the gel; remove the comb; mix 1.5 ions. When subjected to brief heat shock, μl each of DNA sample and bromophenol blue track- such bacteria are stimulated to take up DNA ing dye (dissolve 70 g sucrose in 50 ml distilled from their surrounding medium. Once within water by heating, add 0.25 g bromophenol blue and the bacterial cell, the plasmid replicates au- 20 ml 0.5M EDTA, raise volume to 100 ml) and slowly load mixture into wells; connect assembly tonomously and is passed on to the progeny with power supply and run the gel at voltage of 80 during cell division. The bacteria containing V until the dye has travelled 75% of the distance; recombinant plasmid can be separated by turn off the equipment, remove the gel and view treatment with an antibiotic which removes under UV; alternately stain gel with 0.025% methylene blue for 20-30 minutes, destain with luke- bacterial cells without plasmid. Because a warm water for 30 minutes and observe under white large number of different recombinant plas- light. mids are formed, incorporating different segments, the one of interest can be separated DNA Cloning by combined procedure of replica plating and A detailed analysis of DNA requires avail- in situ hybridization (Figure 7.24-III). ability in sufficient quantity of DNA or its Through replica plating, numerous dishes restriction fragments. DNA cloning is a with representatives of the same bacterial technique to produce large quantities of a colony are prepared. In one of the replica specific DNA segment. plates, cells are lysed and DNA fixed on to The technique of cloning has largely been surface of nylon or nitrocellulose membrane. made possible through recombinant DNA DNA is next denatured; membrane is incu- technology. The DNA molecules from two dif- bated with labelled single stranded DNA ferent sources are treated with restriction probe, containing complementary sequence enzyme that makes staggered cuts in DNA, being sought. The unhybridized probe is leaving single-stranded tails in either of the washed away, and the location of labelled cleaved DNA. These tails act as sticky ends hybrids determined by autoradiography. In Taxonomic Evidence 191

Figure 7.24 DNA Cloning. I. Cloning using plasmid vector. A: DNA fragment of an organism; B: Cleaved plasmid DNA; C: Recombinant DNA molecule (5-10 kb); D: Bacterium; E: Bacterium with recombinant DNA. II. Cloning eukaryotic DNA using lambda phage. A: Mutant strain of lambda phage with DNA having two EcoRI cleavage sites; B: Extracted DNA of phage treated with EcoRI; C: Two fragments of phage DNA, middle segment discarded; D: DNA segment from eukaryotic cell (about 25 kp); E: Recombinant DNA; F: Recombinant DNA packed into phage head; G: Culture dish with bacterial culture with clear plaques of phage infection. III: Combined procedure of replica plating and in situ hybridization. A: Dish with bacterial colonies; B: Trans- ferring bacterial cells from dish (a) to a filter paper (b); C: Filter paper with bacterial colonies; D: inoculating empty culture dish by pressing filter paper; E: Dish with bacterial colonies; F: Culture dish with bacterial colonies for replica plating; G: Nitrocellulose membrane with replica of bacterial colonies; H: DNA separated by lysis of cells and denatured to become single stranded adhering to membrane; I: Radiograph of labelled hybrid. 192 Plant Systematics refined technique of fluorescence in situ A yeast gene can be cloned in shuttle vec- hybridization (FISH), probe labelled with tor, subjected to site-specific mutagenesis fluorescent dyes is used, and labelled hybrids in E. coli, and then moved back to the yeast localized with fluorescent microscope. to examine the effects of induced modifica- The live representatives of the identified tions in native host cells. clones can be found on corresponding sites on the original plates, these cells are grown Artificial chromosome vectors into large colonies, which serve to amplify Attempts have been made over the recent recombinant DNA plasmid. After sufficient years to develop vectors which can accom- amplification, the DNA is extracted and modate DNA sequences larger than 45 kb. recombinant plasmid DNA is separated from One of the most important of these vectors is bacterial DNA. The recombinant plasmid DNA YAC (yeast artificial chromosome), which is again treated with the same restriction can accept DNA fragments as large as 1000 enzyme that releases plasmid DNA from the kb. More recently the use of BAC (bacterial cloned DNA segments. Latter can be sepa- artificial chromosome) has become more rated from plasmid DNA by centrifugation. common. BACs are specialized bacterial plasmids (F factors) that contain bacterial Bacteriophage vector origin of replication, and can accommodate Bacteriophage λ (lambda) is commonly used up to 300 kb of DNA segments. as a vector. The DNA of the phage is linear 50 kb in length. During treatment with re- Amplification through PCR striction enzyme middle 15 kb segment of The earlier procedures for obtaining a large phage DNA which contains genes for lysis and quantity of DNA were very cumbersome, in- can be dispensed with is replaced with foreign volving the cloning of genes into bacteria, DNA. The resultant recombinant DNA is which replicate genes along with their own packed into phage heads in vitro (Figure 7.24-II). genome. The development of PCR (poly- Phage particles can inject the recombi- merase chain reaction) technique has now nant DNA molecules into E. coli cells, where made it possible to obtain large number of they will replicate and produce clones of re- copies of a gene using enzyme in place of combinant DNA molecules. As lambda heads bacteria. Small pieces of single-stranded can accommodate molecules of only 45 to 50 DNA with known sequence are used as prim- kb size, it can accommodate inserts (foreign ers (Figure 7.25). These primers are built DNA fragments) of only 10-15 kb. from templates of short regions of DNA that occur at either end (flanking) of DNA seg- Cosmid vector ment of interest, do not occur any where else in genome (unique), and are invariable (con- For inserting larger DNA insertion, cosmid served) in all taxa to be investigated. The vectors are used. A cosmid is a hybrid be- extracted DNA from a species is mixed with tween plasmid and lambda phage. Cosmids the primer, DNA polymerase (usually taq combine plasmid’s ability to replicate au- polymerase, which can tolerate heat), buff- tonomously with in vitro packaging capacity ers, salts and free nucleotides in a tube. The of lamda phage. A cosmid vector can carry mixture is alternately heated and cooled. out inserts of 35 to 45 kb. Heating denatures DNA making it single- stranded. The subsequent cooling allows Eukaryotic shuttle vectors primers to bind to the complementary DNA Some of the most useful cloning vectors are sequences. Polymers are designed so that shuttle vectors that can replicate in both E. they can not bind with each other. The tem- coli and another species. Such shuttle vec- perature is then raised to make polymerase tors are very useful for genetic dissections. active, bind to the already formed complex Taxonomic Evidence 193

(DNA + polymerase), and begin synthesis of complementary strand (at DNA region not bound by primers) using free nucleotides. The temperature is raised further to dena- ture DNA and the cycle repeated, thus making enough copies of DNA.

Method: Prepare PCR mix E by mixing (all previously placed in ice, taken out and thawed) 35μl au- toclaved water (pH 7.0), 5μl 10X PCR buffer, 2μl mixture of deoxyribonucleotides (dNTPs- 10mM of each nucleotide: dATP, dCTP, dGTP and dTTP), 1μl Forward primer (10μm), 1μl Reverse primer (10μm), 5μl Genomic DNA template(25 ng/μl) and 1μl Taq DNA polymerase (5 units/μl); prepare one more PCR mix without DNA template and label as C; put 20-50μl of each mixture in PCR tubes, briefly centrifuge, insert tubes into thermal cycler; program PCR machine for temperature 94°C (step 1, 5 min: primary denaturation), 94°C (step 2, 1 min: secondary denaturation), Annealing temperature (about 5- 10°C less than Tm of the primers, step 3, 1 min), 72°C (step 4 and 5, 1.5 min), hold, 4 min; take out tubes when temperature comes down to 4°C and place in ice; analyze further by gel electrophoresis as described earlier.

DNA libraries DNA libraries are collections of cloned DNA fragments. Two basic types of DNA libraries can be created. Genomic libraries are produced from the total DNA extracted from the nuclei and contain all of the DNA sequences of the species. cDNA libraries (cDNA— complementary DNA) on the other hand, are derived from DNA copies of usually the mes- senger RNA, and thus represent DNA sequences which are expressed in the species. This is significant because a large number of DNA sequences do not express themselves, and are of little significance. Some- times, individual chromosomes of an organism are isolated by a procedure that sorts chromosomes based on size and the DNA content. The DNAs from the isolated chromosomes are then used to construct chromosome-specific DNA libraries, which facilitates the search for a gene that is known to reside on a particular chromosome. This is particularly useful for organisms with large genomes, such as humans. To construct a DNA library, the DNA from Figure 7.25 Polymerase chain reaction tech- a species is randomly cleaved using enzymes nique. 194 Plant Systematics which recognize short nucleotide sequences, probe. The segments of different sizes can the fragments are incorporated into lambda be ordered to generate physical maps. phage and multiple copies of each recombi- Method: Perform gel electrophoresis of DNA sample; nant DNA obtained. These are stored and con- look for fluorescent bands; treat gel with 200 ml of stitute a permanent collection of all DNA se- 0.25 M HCl for 15 minutes; rinse with distilled quences present in the genome of a species. water and treat twice with 200 ml denaturing solu- To construct a cDNA library using mRNA, a tion (DS: 1 M NaCl, 0.5 M NaOH) for 15 minutes each; neutalize the gel by soaking in 200 ml of complementary stand of DNA is constructed Neatralising solution (2.5 M NaCl, 0.5 M Tris-HCl by reverse transcriptase. RNA-DNA duplexes (60.5 g/l), adjust pH to 7.4 with conc. HCl) for are converted into double-stranded DNA mol- 15 minutes; Lay transfer buffer TB (20 X SSC, 3 M NaCl (175 g/l), 0.3 M Tri Sodium Citrate (88 g/l)), ecules by combined activity of ribonuclease prewetted double layer of Whatman paper onto trans- H, DNA polymerase I, and DNA ligase. The fer tray, so as to reach both ends of reservoir; put double-stranded DNA is incorporated into gel upside down on Whatman paper, roll gently with lambda phage and further processed as de- pipette to remove bubbles; place TB-prewetted nylon membrane on the gel; put 3 layers of TB- tailed above. prewetted Whatman paper on top of it; place 1 dry Whatman paper on top; put 3 layers of blotting papers on top of Whatman papers; pour 200-400 ml Gene Mapping 20X SSC buffer into tray; add 10-20 cm layers or Above techniques contribute in developing 2/3 of a pack of paper towels; place 500g weight on the physical maps of gene. Whereas restric- top and allow the transfer for 12-16 hours; take out membrane from assembly; crosslink DNA on nylon tion enzymes enable cleavage at specific membrane by exposing it to UV light for 3-5 min- sites, the cloning and amplification tech- utes; for detection either expose membrane to niques help in obtaining a large number of X-Ray film or else stain the membrane with 0.025% copies of fragments. methylene blue for 20 minutes and then destain in Identification of the location of genes and water. DNA sequences on restriction fragments The technique of Northern blot hybrid- separated by gel electrophoresis constitutes ization, (so named as it is opposite of South- an important step of genome mapping. The ern blot technique), is used to hybridize RNA process of gene mapping has been simpli- molecules separated by electrophoresis. fied with the availability of cloned organelle Denaturing is affected by formaldehyde, and genomes which are used as probes. In the after transfer to the membrane, the RNA commonly used Southern blot hybridiza- blot is hybridized either with RNA probe or tion method (named after E. M. Southern, DNA probe. who published it in 1975), a cloned piece of The procedure of gene mapping is suffi- chloroplast DNA (to be used as probe) is la- ciently complex. It involves crossing two plants, belled with radioactive phosphorus and de- selfing F1 and producing a large number of natured to produce single-stranded DNA. F2 plants. Genotypes of parents and offsprings The cleaved DNA from the specific species, are determined using various markers. after electrophoretic separation of frag- Although physical maps can be constructed by ments, is placed on a nylon or nitrocellu- identifying and aligning overlapping DNA lose membrane, and denatured by using fragments, more elaborate genetic maps are alkaline solution and finally immobilized by constructed using genetic markers. drying or UV irradiation. It is renatured and Genetic map can be unified with physical allowed to bind to the radioactive probe on map using molecular markers. The physical a nylon membrane. Only matching se- map thus obtained will afford single frame- quences will bind, and carry the radioac- work for organizing and integrating diverse tive tag. When transferred to an X-ray film types of genetic information, including the the bound bands will appear as dark bands, position of chromosome bands, chromosome which will show the positions of DNA se- breakpoints, mutant genes, transcribed quences that have hybridized with the regions, and DNA sequences. Taxonomic Evidence 195

Figure 7.26 Structure of DNA. One of the four bases is joined to a deoxyribose sugar to form nucleoside, which links with a phosphate to yield a nucleotide. A long chain of nucleotides forms the DNA strand having OH (3’ terminus) group at one end and phosphate (5’ terminus) at the other end. Purines bases have double ring structure, whereas pyrimidines have single ring structure.

Gene Sequencing fine structure map of a gene or chromosome Sequencing determines the exact order of (Figure 7.26). Today, sequencing is a rou- the bases (adenine, cytosine, guanine and tine laboratory procedure. A complete thymine) constituting nucleotides in a por- sequence of human genome has been de- tion of a DNA and thus building an ultimate veloped, as also the small annual weed 196 Plant Systematics

Arabidopsis thaliana, developing into a strong cence as they pass through the well (tube or genetic tool. Two main procedures of DNA gel). The output is directly analyzed by a com- sequencing are commonly used. puter, which analyses, records and prints In the first procedure developed by Allan out the results. Maxam and Walter Gilbert, the DNA chain The PCR product can be sequenced di- is cleaved using four different chemical rectly using restriction enzymes. Since re- reactions, each targeting A, G, C or C+T. In striction sites are spread at several places the second procedure developed by Fred on the DNA, the results are less sensitive Sanger (chain termination method) and col- to local vagaries of selection or differences leagues, there is in vitro synthesis of DNA in in mutation rate. Sequencing of both the presence of radioactive nucleotides and spe- strands often minimizes errors. cific chain terminators to generate four populations of radioactively-labelled frag- Analysis of Sequence data ments that end with As, Gs, Cs and Ts, re- For the analysis of changes at the level of spectively. nucleotides and the amino acids, the align- The procedure begins with obtaining iden- ment of DNA sequences derived from differ- tical DNA fragments up to about 500 bp us- ent taxa constitutes an important step. Align- ing a restriction enzyme. The preparation ment helps in detection of insertion, dele- is divided into four samples. Each sample is tion or substitutions of one or more base denatured into single strands, incubated pairs at different sites within a DNA. When with a short radioactively-labelled oligo- comparing two sequences with L positions nucleotide complementary to 3’ end of single (nucleotides), of which D positions are dif- strands. To each sample is also added DNA ferent, the evolutionary distance counted A polymerase and all the four deoxyribonu- number of different models have been pro- clease triphosphate precursors (dNTPs). To posed to explain evolutionary distance be- one sample is now added chain terminator tween two sequences on account of nucle- ddATP (2’, 3’ -dideoxyadenosine triphos- otide changes. phate), to the second ddGTP (2’, 3’ - dideoxyguanosine triphosphate), to the third Jukes-Cantor Model ddCTP (2’, 3’ -dideoxycytidine triphosphate), and to the fourth ddTTP (2’, 3’ - T. Jukes and C. Cantor (1969) realized, even dideoxythymidine triphosphate). The first before the DNA sequences were available for sample after reaction will have all the seg- analysis, that alignments between se- ments terminated at As, the second at Gs, quences with many differences might cause the third at Cs and the fourth at Ts. The frag- a significant underestimation of the actual ments are separated on gel electrophoresis, number of substitutions that occurred since and their positions determined by autorad- sequences last shared a common ancestor. iography. Different bands, representing dif- They assumed that each nucleotide was as ferent segments will be arranged like a lad- likely to change into any of the other three der. By reading the ladder, a complete nucle- nucleotides. A can thus equally well change otide sequence of DNA chain can be deter- into T, C or G. Based on this assumption they mined. In conventional slab-gel procedure, created a mathematical model in which rate four different samples are loaded in four dif- of change to any one of the three alterna- ferent wells on a gel. Nowadays, automated tive nucleotides was assumed to be a, and DNA sequencing machines are used which the overall rate of substitution for any given make use fluorescent dyes instead of radio- nucleotide was 3a. According to this model, active nucleotide. The products of all four if a site within a gene was occupied by a samples are run through single well, and C (t = 0), then the probability (P) that this photocells are used to detect the fluores- site would still be same nucleotide at time Taxonomic Evidence 197

1 (t = 1) would be PC(1) = 1 - 3a. On the other If evolutionary rates between species are hand if C changed to some other nucleotide, similar, substitution rates can help in cal- the probability that after time t, the site would culating the dates of evolutionary events. contain C can be calculated as: -4at Kimura two-parameter (K2P) Model PC(t) = (3/4)e The model was proposed by M. Kimura (1980) The probability rate matrix for the and accounts for different rates of nucle- changes in four nucleotides can be repre- otide changes involving transitions and sented as under: transversions. Supposing we assign value a for transitions and b for transversions, the A G C T probability rate matrix would be represented A 1-3a a a a as:

G aaa1-3a A G C T 1-a-2b a b b C aa1-3a a A

T aa a1-3a G abb1-a-2b

C bb1-a-2b a

It was , however, subsequently realized T bb a1-a-2b that transitions (change from purine to purine; pyrimidine to pyrimidine) proceed at much faster rate than transversions (purine to pyrimidine or vice versa), but the Jukes- The number of substitutions per site (dis- Cantor model can still be taken into account tance between two sequences could be cal- for calculating the number of substitutions culated as: (the distance between two sequences) per site (K) when multiple substitutions were possible: K or dK2P = 1/2 1n (1-2P – Q ) – 1/4 1n (1 – 2Q) K or djc= –3/4 1n( 1 - (4/3)p) P Q Where p is the fraction of the nucleotide where and are observed fractions of that a simple count reveals to be different aligned sites whose two bases are related by between two sequences. It follows from the a transition or a transversion, respectively. equation that if two sequences have fewer Once the sequences are generated, they mismatches, p is small and the chance of must be aligned. First the sequences of a multiple substitutions is also small. On the given length are aligned by arranging ho- other hand if number of mismatches are mologous nucleotides in corresponding col- large, the actual number of multiple substi- umns. Alignment is simpler for conserved tutions per site will be considerably larger genes, where all taxa will have same num- than what is counted. ber of nucleotides per gene. Some other genes Once number of substitutions per site (K) which have some deletions, additions, inver- is calculated, knowing the time taken for sions or translocations in some taxa, are dif- divergence (T), the rate of substitution (r) ficult to align. Similarly DNA with multiple can be calculated as: copies of a gene makes it difficult to assess homology. Several computer programs are r = K/(2T) available to produce alignment, but the as- For calculating substitution rates, data sumptions used in each program should be from at least two species should be available. carefully examined before the program can 198 Plant Systematics

DNA Alignment Coding of characters 2 0 2 5 3 Species 1 3 1 4 0 1 2 3 4 5 A GTCCAAGACTCTCAGTGGTTCAATCGTCTGTT 2 0 2 4 3

B CTCCAAGTCTCTCACTG ------TCGTCAGTT 1 3 1 5 0

C CTCCAAGACTCTCAGTGGTTCAATCGTCTGTT 1 0 2 4 3

D GTCCAAGTCTCTCACTGGTTCAATCGTCTGTT 2 3 1 4 3

Figure 7.27 Alignment of a DNA sequence for 32 nucleotide positions in four species. nucleotides at a particular position showing variation can be coded as characters, and are shown in bold. The codes assigned to nucleotide states are A=0, C=1, G=2 and T=3. Character number four here involves deletion of a particular sequence in species B. Presence of this deletion is coded as 5 and absence of deletion as 4. Computer programs (such as DNADIST and DNAPARS of PHYLIP) are available which can read DNA sequence data directly.

be used for a particular set of taxa. In phylo- from A to G or vice versa; or from C to T and genetic analysis each nucleotide position is vice versa) are more common than considered as one character, and each of the transversions (A to T, A to C, G to C, G to T; C four nucleotides as one character state. A to A, C to G, T to A, T to G). The latter are large number of nucleotide positions, how- often given more weight depending upon the ever don’t show variation among taxa, and of frequency of distribution in the taxa, more others that are variable are often uninfor- frequently the transitions are distributed, mative because of being autapomorphic for a greater weight is consequently given to given taxon. This leaves only a small propor- transversions. Thus if transitions occur 4 tion of nucleotide positions that can be used times more than transversions, a transition for phylogenetic analysis. Chromosomal mu- may be given weight of 1 and transversion a tations such as additions, deletions and weight of 4. Computer programs such as translocations are identified as evolutionary DNAPARS, DNADIST, etc. of PHYLIP are avail- novelty, and are generally given more able, which can read and analyse the DNA weightage than individual nucleotides (Fig- sequence data directly. Details are described ure 7.27). Such chromosomal changes rep- under chapter on Developing Classifications. resenting apomorphy are important and of- Whereas alignment of simple chloroplast ten used in establishing a lineage. Thus all genes such as rbCL is easier, others such members of subfamily Faboideae lack one of as genes encoding RNAs, secondary struc- the inverted repeats found in the chloroplast ture (folding) of the molecule is also ac- DNA of most angiosperms. counted for. The nucleotide differences that In our example illustrated in Figure 7.27, result in major changes in the structure of the four nucleotides are given coding from 0 a product, such as ribosomal RNA or a pro- to 3 for different nucleotides. Other strate- tein, and may have greater effect in the plant gies could also be used. Transitions (change function, often receive greater weight than Taxonomic Evidence 199

I SNP II SNP

G-A-A-T-T-C G-A-A-T-T-C G-A-A-T-T-C G-A-A-T-T-C G-A-A-C-T-C G-A-A-T-T-C C-T-T-A-A-G C-T-T-A-A-G C-T-T-A-A-G C-T-T-A-A-G C-T-T-G-A-G C-T-T-A-A-G

Cleavage with EcoRI Cleavage with EcoRI

SNP SNP

G A-A-T-T-C G A-A-T-T-C G A-A-T-T-C G A-A-T-T-C G-A-A-C-T-C G A-A-T-T-C C-T-T-A-A G C-T-T-A-A G C-T-T-A-A G C-T-T-A-A G C-T-T-G-A-G C-T-T-A-A G

Figure 7.28 The effect of the location of SNPs in the restriction sites in two DNA molecules. DNA with TA nucleotide pair shows normal cleaving with EcoRI, resulting in two restriction fragments. In another DNA (II) substitution of CG pair prevents cleaving resulting in single large cleavage fragment. This results in unequal fragments in different DNA molecules. those changes that do not affect the func- ously developed. Some of the commonly used tion. Several computer algorithms are avail- procedures are discussed below. able to evaluate and handle such analysis. Single-Nucleotide DNA Polymorphism Polymorphisms (SNPs) Utilization of sequence data in phylogenetic DNA differences in a population may often be analysis involves the identification of unique the result of differences in single nucleotide sequences which show certain differences in pair at a particular locus, say from C-G to T- different organisms or populations. These A. This may result in three genotypes in a sequences, which could be used as genetic population: homozygous with C-G at corre- markers in identification of character-state sponding sites on both homologous chromo- differences between the target taxa, and somes, homozygous with T-A at correspond- ultimate construction of phylogenetic trees. ing sites on both homologous chromosomes, The phenomenon is also known as DNA and heterozygous with C-G in one chromo- Fingerprinting or DNA polymorphism. The some and T-A in homologous chromosome. technique is now widely used in forensic However, all SNPs are not located on coding investigations. A variety of methods have sequences or genes. In human genome, for been developed to detect this polymorphism. example, any two randomly chosen DNA mol- Each method has its own advantages and ecules differ at one SNP site about every 1000- limitations, and suitable for a particular 3000 bp in protein coding DNA, but 500-1000 situation. New methods are being continu- bp in noncoding DNA segments. SNPs are 200 Plant Systematics most common types of genetic differences Step 1 among human populations, and are uniformly Isolate DNA from species A and cleave using EcoRI distributed over the chromosomes. The SNPs can be easily detected if they are located in a cleavage site (Figure 7.28). Thus a sequence GAATTC can be cleaved by EcoRI, but a corresponding GAACTC sequence can’t be cleaved as T has been re- Step 2 placed with C (and on the complementary Cleave these fragments using HindIII segment A replaced by G). This will result in larger DNA fragment in the latter case. Restriction Fragment Length Polymorphisms (RFLPs) Step 3 RFLP results from the fact that a mutation Construct Restriction Site map that causes changes in base sequence may result in loss or gain of a cleavage site, thus EcoRI EcoRI alleles differing in the presence or absence 5000 6000 of a cleavage site. This may also result from SNPs located at cleavage sites as indicated 3500 5300 earlier. As a result fragments of different HindIII HindIII lengths are yielded. The method is widely Step 4 used for identification of individuals, species Construct Restriction Site map for species B and compare or populations. The DNA from a species is EcoRI EcoRI cleaved using a restriction enzyme (say 5000 6000 EcoRI) yielding a certain number of frag- Species A ments (Figure 7.29). These fragments can be separated using Southern blotting proce- 3500 5300 HindIII HindIII dure, and a map of these constructed. These fragments are further fragmented using an- EcoRI EcoRI EcoRI other enzyme (say HindIII), and the data 3000 5000 6000 incorporated into original map. Restriction Species B site fragments obtained are coded as characters and character-states for phylogenetic 3400 5300 7800 analysis. HindIII HindIII HindIII The absence or presence of a restriction site in closely related species and the pre- Step 4 sumed hybrids can also be detected by Code characters for species A & B Southern blotting procedure. Species A, for EcoRI HindIII HindIII EcoRI HindIII EcoRI HindIII example lacks restriction site at 3000 bp position (allele a, genotype aa), where this 3000 3400 3500 5000 5300 6000 7800 site is present in species B (allele A, genotype AA). Southern blotting technique will Species A - - + + + + - yield longer first restriction fragment of 5000 Species B + + - + + + + bp length for aa genotype, whereas it will yield fragment of 3000 bp length in AA geno- Figure 7.29 Major steps involved in Restriction types. The heterozygous Aa genotype, pre- Fragment Length Polymorphism suming the alleles are codominant will yield (RFLP) procedure. Taxonomic Evidence 201

A B C D Random Amplified Polymorphisms (RAPDs) 1 RAPD method is commonly used for popula- 2 tion studies and involves short (10bp) random PCR primers that will bind to the matching sequences on genome. The ap- 3 proach is useful for species where cloned 4 DNA probes are not available (essential for Southern blotting method), or where DNA se- 5 quences are not known (necessary for PCR amplification where oligonucleotide primers have to be constructed). The method uses 6 PCR primers of 8-10 nucleotides with 7 random sequence. These primers are tried singly or in pairs in PCR reactions to am- 8 plify segments of DNA from a species. These short primers anneal at multiple sites on 9 DNA, and those that anneal at suitable distance are able to amplify unknown region 10 between them. The presence or absence of such amplified regions in different individu- 11 als can be suitably coded for analysis. The procedure helps in identifying different genotypes in the population. The morphologic 12 characters of interest are mapped accord- 13 ing to their linkage to markers. The results of one of several primers used are shown in Figure 7.30. Gel electrophoresis yields 13 Figure 7.30 Results of one of the several prim- bands, of which four show polymorphism, the ers used for RAPD procedure on rest nine are monomorphic. Each of the poly- DNA from four species. A total of morphic allele can be represented similarly 13 bands appear on electrophore- as + for the presence of band, - for its ab- sis gel, 4 show polymorphism in sence, and if + is dominant, both genotypes species compared , whereas 9 are +/+ and +/– will show this band, whereas it monomorphic. will be lacking in –/– genotype. Thus for the last band in the gel species B and C have –/ two fragments from homologous chromo- – genotype, where as A and D are either +/+ somes, one of 3000 bp length and another of or +/–. 5000 bp length. RFLP analysis, however, contains much Amplified Fragment Length lesser data than complete DNA sequencing, accounting only for presence or absence of Polymorphisms (AFLPs) sites 6-8 base pairs long, but the method AFLP (amplified fragment length polymor- affords advantage of surveying larger seg- phism) technology is used for nucleic acid ments of DNA. The use of this method has, fingerprinting, exploiting molecular genetic however, declined with the development of variations existing between closely related improved and less expensive sequencing genomes in the form of restriction fragment techniques in the recent years. length polymorphisms. 202 Plant Systematics

Step 1 appropriate restriction endonucleases Isolate DNA from sources of interest and digest with 2 REs (REs). For most plant DNAs , two REs are used: one a rare cutter having 6-bp recogni- G-A-A-T-T-C T-C-G-A tion site, and the other a frequent cutter C-T-T-A-A-G A-G-C-T with 4-bp recognition site. In the second step, specific double-stranded oligodeoxynu- cleotide adapters (primer adapters) are ligated to the ends of the digested DNAs to EcoRI Taq I generate chimeric molecules. These primers are so designed that they bind at both G A-A-T-T-C T C-G-A cut ends of fragments. In the third step the chimeric fragments are subjected to PCR amplification to provide sufficient template C-T-T-A-A G A-G-C T DNA for fingerprinting PCRs. During the Step 2 fourth step, PCR products are resolved on Ligate adapters to digested DNAs through electrophoresis using polyacrylamide sequencing gel, which separates the amplified DNA fragments that exhibit length polymorphisms, enabling the recognition of numerous genetic markers. One of the earliest significant results of N-N-G-A-A-T-T-C T-C-G-A-N-N this method were obtained by Jansen and Palmer (1987), who found a unique order of N-N-C-T-T-A-A-G A-G-C-T N-N genes in the large single-copy region of the Step 3 chloroplast genome in Asteraceae. This PCR amplification unique order could be explained by single inversion of the DNA, a feature lacking in all other angiosperms, strongly confirming that the Asteraceae family is monophyletic. 5’ N-N-C-T-T-A-A-G The family Poaceae, similarly, has three in- N-N-G-A-A-T-T-C versions in the chloroplast genome. Out of these three inversions, one is unique to the family and confirms its monophyletic sta- A-G-C-T-N-N tus. Of the other two, one is shared with T-C-G-A-N-N Joinvilleaceae and one with both families Joinvilleaceae and Restionaceae, suggesting that these two are the sister groups of Step 4 Poaceae. Product separation and analysis Simple Tandem Repeat Poly- morphisms (STRPs) Figure 7.31 Basic steps in Amplified Fragment Length Polymorphism (AFLP) pro- STRP results from the fact DNA molecules tocol. N-N represents a particular may differ in the number of copies of a se- nucleotide sequence. quence of few nucleotides repeated in tandem at a particular locus. In TGTGTG sequence, for example, two base pairs are re- AFLP procedure involves four basic steps peated. Such repeated nucleotides are (Figure 7.31). In first step DNAs from differ- known as tandem repeats. STRPs present ent sources are isolated and digested with at different loci may differ in sequence and Taxonomic Evidence 203

SPECIES A

3’ A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5’ SPECIES B 5’ T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3’ 3’ A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5’

5’ T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3’ Primer 5’ T-A-G-C-C-A-A 3’ A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5’

5’ T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3’ G-A-G-G-T-T-A 5’ Primer

Primer 5’ T-A-G-C-C-A-A 3’ A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5’

5’ T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3’ G-A-G-G-T-T-A 5’ Primer 5’ T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3’ 3’ A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5’

5’ T-A-G-C-C-A-A-C-A-C-A-C-A C-A-C-A-C-A-C-T-C-C-A-A-T 3’ 3’ A-T-C-G-G-T-T-G-T-G-T-G-T G-T-G-T-G-T-G-A-G-G-T-T-A 5’

5’ T-A-G-C-C-A-A-C-A-C-A-C-A-C-A C-A-C-A-C-A-C-A-C-T-C-C-A-A-T 3’ 3’ A-T-C-G-G-T-T-G-T-G-T-G-T-G-T G-T-G-T-G-T-G-T-G-A-G-G-T-T-A 5’

Figure 7.32 VNTR procedure. Specific primers to flank regions of tandem repeats are constructed and used for PCR amplification of DNA segments with tandem repeats, for comparison of different species. length of repeating unit, and in minimum ers that flank tandem repeats, and then and maximum number of tandem copies using PCR technology to generate multiple occurring in the DNA of a population. A re- copies of tandem repeat DNA, whose length peating sequence of 2-9 bp is often known can be determined by gel electrophoresis as microsatellite or SSLP (Simple se- (Figure 7.32). VNTR technology generates quence length polymorphism), whereas data quickly and efficiently and is often one of 10-60 bp as minisatellite. If these used for population studies, for examining repeated sequences show variation within relationships within a species, or between a population or a species, they are known closely related species. as variable number tandem repeats STRP is very useful in mapping, as a large (VNTRs). At a given locus in different indi- number of alleles present in the population viduals, the length of tandem repeats may often have high proportion of genotypes that vary, because of irregularities of crossing are heterozygous for different alleles. STRPs over and replication, and as such can be are widely used in DNA typing (DNA finger- used as genetic marker. Identification of printing) involving identification of human microsatellites involves constructing prim- individuals in criminal investigation. 204 Plant Systematics

A B C D A B C D as character, and unique allele combinations as character states (Figure 7.33). A

35 comparison electrophoresis bands of four species for enzyme I with two allozymes can 31 be coded as 0 for allozyme separated at posi- 27 tion 18 and 1 for allozyme separated at position 21. Similarly Enzyme II with three 21 allozymes can be coded as 0 for 27, 1 for 31

18 and 2 for 35. Enzyme I, as such would be coded Enzyme Enzyme I II as 1 for species A-C with band at 21 and 0 for D for band at 18. For enzyme II, similarly Enzyme Enzyme Species I II species A has band at 31 coded as 1, B at 35 A 1 1 coded as 2 and C as 3 having bands at 31 and 35. Allozyme data can also be coded as B 1 2 loss of each allele as one state and gain as C 1 3 another state. Allozyme data can also be D 0 0 coded on the basis of allele frequency. A species with two alleles in the frequency of 90/ 10% would be coded differently from another Figure 7.33 Allozyme electrophoresis data for species with same alleles but with fre- two enzymes, enzyme I with two quency of 40/60%. allozymes and enzyme II with three allozymes. The coding of data for four species, of which Examples of Molecular studies species D represents an outgroup is presented below.Each locus is Whereas considerable progress has been treated as character and combi- made in the mapping of chloroplast genome, nation of character states as char- similar success in nuclear genome is at its acter states. infancy. Questions of speciation are being addressed through genome mapping in Helianthus. Some progress has also been Allozymes made in grasses and the family Solanaceae. Different forms of an enzyme differing in dif- In Helianthus, Riesberg and his co-workers ferent alleles at the same locus constitute (1996) reported that H. annuus and H. allozymes, as distinct from isozymes show- petiolaris differed by at least seven translo- ing differences at different loci. Allozymes cations and three inversions, which affected are separated and detected using starch recombination and possibilities of introgres- electrophoresis as against gel electrophore- sion. The genome of hybrid derivative H. sis for DNA sequencing. Allozymes differing anomalus, was rearranged relative to both slightly in amino acid composition will take parents, and the species was partially repro- different charges and migrate differently, ductively isolated from both parents. They and can be identified using specific stains. also created new hybrids between the two Allozymes have traditionally been used to parental species and found that chromo- assess genetic variation within a population somal rearrangements were similar to the or a species, but they can also be used naturally occurring hybrid species, H. for phylogenetic analysis of closely related anomalus. Belford and Thomson (1979), us- species. ing side-copy sequence hybridization in Allozyme data can be coded in a variety of Atriplex concluded that division into two sub- ways. Each allele may be coded as a charac- genera in this genus is not correct. ter and its presence or absence as charac- Bayer et al., (1999) on the basis of se- ter states. Alternately a locus may be treated quence analyses of the plastid atpB and rbcL Taxonomic Evidence 205

(A) Rice (B) Wheat (C) Maize (D) Fox tail (E) Sugar cane (F) Sorghum (G) Ancestral millet cereal

R1a R5a R12a R1a R1a R1a S1 R1a R1a R1b W1 R10 M3 R1a R5a M8 F R1b F R1b R1b R1b R5b R1b R5b R5a R5a R2 R1b R5b I R5a R5a R5b R4a R6a R5b S2 R5b R6a R3a R6a W2 R7 M6 R6b R6a H R6b R3b R4b R5a R6b M9 R6b R6a S3 R6a R8 H R3c R5b R8? R6b R6b R3c R8 R1a R3c B R3a R4a R8 R8 W3 R1b R3c R3c S4 R3b R4b R8 R10 R10 R2 C A R3c R3c R3b R10 R3b R2 R5a W4 M1 R10 R10 R3c S5 R11a R3b R3b M5 R3a R10 R3b R5b R11b R3a R3a C R3a R3a R12a G R2 R12b R6a R3b R11a R11a R9 R6b R11b R11a R12a R2 M4 R2 A S6 R7 W5 R12b R9 M7 R2 G R12a R4a R7 R9 R7 D R11a S7 R4a R12a R4b R3a R8 R4b R4a R9 R12b S8 R11a R12a I R9 R4b R7 R11b R9 R2 M2 M10 R9 W6 R7 R12a S9 R4a R7 R10 R6a E R11a W7 R8 R4b D R9 S10R4a R11a R6b R7 1 R4b R11b 6 7 R4a B R12a R4b 8 3 R12b 3 2 9 I H 3 1 F H 4 I F 5 a b a b B 7 b 5 6 4 a 8 A A 1 a c 1 b12 3 b Rice a 5 a Rice E 4 10 C 5 B b C 1010 7 5 1 9 11 2 a b G G I D 2 D 6 2 9 7 8 4 6

5 II

Figure 7.34 Grass genome evolution. I: Conserved linkages (synteny groups) between the rice genome and other grass species. A: Rice genome with chromosomes divided into blocks of linked genes; B: Wheat genome with chromosomes showing correspondance with rice segments; C: Maize genome with duplicated blocks indicating ancient tet- raploidy; D: Foxtail millet genome; E: Sugar cane genome; F: Sorghum genome; G: Inferred or ‘reconstructed’ order of segments in a hypothetical ancestral creal genome cosisting of a single chromosome pair. II. Circular arrangement of synteny groups in above grasses. Thin dashed lines indicate connections between blocks of genes. (After Moore et al., 1995). 206 Plant Systematics

DNA, found a support for an expanded order Because of the synteny groups in the Malvales, including most of the genera pre- genomes, homologous genes can often be viously included in Sterculiaceae, Tiliaceae, identified by location alone. It must, how- Bombacaceae and Malvaceae. They propose ever, remembered that the circular diagram to merge Sterculiaceae, Tiliaceae and is only for convenient representation; there Bombacaceae with Malvaceae and subdivide is not indication that the ancestral grass this enlarged family Malvaceae into nine chromosome was actually circular. It was a subfamilies based on molecular, morphologi- normal linear chromosome. cal and biogeographical data. A large number of workers have targeted the family Poaceae using different criteria Grass Genome and techniques. All molecular phylogenies point to the Stipeae to be an early-diverging Genome analysis of cereal grasses has lineage. The morphological characters of the provided useful information. Of the common Stipeae are thus a mixture of synapo- cereal grasses, rice has the smallest ge- morphies linking them with pooids and nome (400 mb). Maize genome is 2500 mb, symplesiomorphies, which they share with whereas the largest genome is found in many other grasses. The studies based on wheat (17,000 mb). In spite of large varia- chloroplast gene: cpRFLP (Davis and Soreng, tions in chromosome number and genome 1993), ndhF sequences (Catalan et al., 1997), size, there are a number of genetic and and nuclear genes: through ITS (Hsiao et al., physical linkages between single-copy genes 1994), phytochrome b (Mathews and that are remarkably conserved amid a back- Sharrock, 1996), and granule bound starch ground of very rapidly evolving repetitive synthase I (Mason-Gamer et al., 1998) all DNA sequences. By comparison of rice chro- supported the same placement of Stipeae. mosomes numbered R1 to R12 (Figure 7.34-I), Similar studies of comparison of results from with conserved regions marked in lower chloroplast DNA and nuclear DNA in case (R1a, R1b, etc.), it is found that con- Triticeae, however, produced different served regions homologous to rice are found results, although two chloroplast phylogenies in other cereals. The wheat monoploid chro- constructed from RFLP (Mason-Gamer and mosome set is designated W1 through W7. Kellog, 1996) and rpoA sequences (Petersen One region of W1 contains single-copy se- and Seberg, 1997) produced similar results. quences that are homologous to those in rice segment R5a, another contains single- copy sequences that are homologous to those New World Tetraploid in rice segment R10, and still another contains single-copy sequences homologous Cottons to those in rice segment R5b. Each of such Genomic studies in genus Gossypium conserved physical and genetic linkages is (Wendel et al., 1995) using isozymes, called a synteny group. It is notable that nuclear ITS sequences, and chloroplast re- maize genome has repetition of segments, striction site analysis, indicated that New confirming that maize is a complete, very orld diploids are monophyletic, as are the Old ancient tetraploid with two duplicated World diploids. The New World tetraploid cot- genome blocks rearranged relative to each tons, including G. hirsutum were formed by other. allopolyploidy of genomes A (from the Old Simultaneous comparison of above cereal World) and D (from the New World). It was grass genomes is better represented with the found that H. hirsutum has a chloroplast de- help of a circular diagram (Figure 7.34-II). rived from one of the African species, and it The segments are arranged into a circle in must have acquired it only about 1-2 mil- the same order in which they were aligned lion years ago, well after the formation of the in the hypothetical ancestral chromosome. Atlantic Ocean. Taxonomic Evidence 207

3. A rapid life cycle (about 6 weeks from germination to mature seed). 4. Prolific seed production and easy cultivation in restricted space. 5. Efficient transformation methods utilizing Agrobacterium tumefaciens. 6. A large number of mutant lines and genomic resources · 7. Multinational research community of academic, government and industry laboratories. 8. Easy and inexpensive to grow. 9. Compared to other plants, it lacks the repeated, less-informative DNA sequences that complicate genome analysis. The Ara bidopsis Genome Initiative (AGI) is an international collaboration to sequence the genome of the model plant Arabidopsis Figure 7.35 Arabidopsis thaliana, small annual herb from family Brassicaceae, thaliana. Begun in 1996 with the goal of com- whose genome is most completely pleting the genome sequence by 2004, the known among the angiosperms, is genome sequencing was completed at the aptly known as the guinea-pig of end of 2000. Comprehensive information on plant kingdom. Arabidopsis genome is available on the internet via The Arabidopsis Information Arabidopsis Genome Resource (TAIR), which provides a comprehensive resource for the scientific commu- Insignificant small crucifer, Arabidopsis nity working with Arabidopsis thaliana. TAIR thaliana (Figure 7.35), often ignored in the is a collaboration between the Carnegie In- field, holds great promise for opening new stitution of Washington Department of Plant frontiers of phylogenetic analysis. With its Biology, Stanford, California, and the National small genome size of 114.5 mbp (as com- Center for Genome Resources (NCGR), pared to 165 mbp in Drosophila melanogaster Santa Fe, New Mexico. Funding is provided and 3000 mbp in humans), the species is by the National Science Foundation. the most completely known genetically Important studies on Arabidopsis thaliana among all flowering plants. During the last have been devoted to genetic control of de- 8 to 10 years, Arabidopsis thaliana has be- velopment. Transgenic plants of this species come universally recognized as a model have been created that either overexpress plant for such studies. Although it is a non- or underexpress cyclin B. Overexpression of commercial member of the mustard family, cyclin B results in accelerated rate of cell it is favored among basic scientists because division; underexpression results in decel- it develops, reproduces, and responds to erated rate. Plants with faster rate of cell stress and disease in much the same way division contain more cells and are some- as many crop plants. The choice of what larger than their wild type counter- Arabidopsis as a genetic tool has been forced parts, but otherwise they look completely by the following attributes: normal. Likewise, plants with the decreased 1. Small genome (114.5 Mb/125 Mb total). rate of cell division have less than half the 2. Extensive genetic and physical maps normal number of cells, but they grow at al- of all 5 chromosomes. most the same rate and reach almost the 208 Plant Systematics

Whorl The studies on genetic control of flower Gene 1 2 3 4 3 2 1 Activity development in Arabidopsis have revealed interesting results. During floral development (as in other tetracyclic plants), each ag whorl of the floral parts (sepals, petals, stamens and carpels) arises from a separate whorl of initials. Three types of mutations result in three different phenotypes, one ap3 & pi lacking sepals and petals, the second lacking petals and stamens and the third lack-

ap2 ing stamens and carpels. Crosses between homozygous organisms have resulted in identification of four genetic groups (Table Sepal Petal Stamen Carpel Stamen Petal Sepal 7.2). Mutations in the gene ap2 (apetala-2) result in phenotype without sepals and pet- Figure 7.36 Graphic representation of control als. The phenotype lacking petals and sta- of floral development in mens is caused by mutation in either of two Arabidopsis thaliana by the overlap- genes, ap3 (apetala-3) or pi (pistillata). The ping action of four genes. Gene ap2 is expressed in the outer two genotype lacking stamens and carpels is whorls (sepals and petals), ap3 and caused by mutations in the gene ag (aga- pi are expressed in the middle two mous). Each of these genes has been cloned whorls (petals and stamens) and and sequenced. They are all transcription ag in the inner two (stamens and factors, members of MAD box family of tran- carpels). Each whorl has a unique scription factors, each containing a combination of active genes. sequence of 58 amino acids. An interesting finding from this study is same size as wild-type plants, because as that mutation in any of the genes eliminates the number of cells decrease, the individual two floral organs belonging to adjacent cells get larger. The plants thus have ability whorls. The pattern suggests that ap2 is nec- to adjust to abnormal growth conditions, as essary for sepals and petals, ap3 and pi are opposed to animals which frequently develop both necessary for stamens and ag neces- proliferative cancer cells. sary for stamens and carpels. As mutant phenotypes are caused by loss-of-function in alleles, it may be inferred that ap2 is expressed in whorls 1 and 2, ap3 and pi Table 7.2 Floral development in mutants expressed in whorls 2 and 3, and ag is of Arabidopsis thaliana. expressed in whorls 3 and 4. The floral development in this plant is thus controlled Genotype Whorl by combinational effect of these four genes. ______Sepals develop from tissue in which ap2 is 12 34 active; petals by combination of ap2, ap3 and pi, stamens by combination of ap3, pi and wildtype sepals petals stamens carpels ag; and carpels where only gene ag is ap2/ap2 carpels stamens stamens carpels expressed. This is graphically represented ap3/ap3 sepals sepals carpels carpels in figure 7.36. It is pertinent to remember that ap2 pi/pi sepals sepals carpels carpels expression and ag expression are mutually ag/ag sepals petals petals sepals exclusive. In presence of ap2 transcription factor ag is repressed, and in the presence of ag transcription factor, ap2 is repressed. Taxonomic Evidence 209

Accordingly, in ap2 mutants, ag expression single copy region), for ‘b’ subunit of ATP syn- spreads to whorls 1 and 2, and, in ag mu- thase (AtpB), ITS region of ribosome, phyto- tants, ap2 expression spreads to whorls 3 and chrome B, and granule bound starch 4. This assumption enables us to explain the synthaseI. An encouraging congruence of re- phenotypes of single and even double mu- sults of these diverse studies was met in tants. This pattern of gene expression has tribe Stipeae of grasses. In other cases, re- been assayed by in situ hybridization of RNA sults from chloroplast phylogeny and nuclear in floral cells with labelled probes for each of phylogeny did not agree, suggesting caution the genes. The results confirm the above as- in relying on any attribute singly for consumption of repressive action of concerned structing molecular phylogenies. The gene genes. It is significant that triple mutation trees constructed from rbcL have great util- involves all the genes. The phenotype of ap2 ity in angiosperms. Chase et al., (1993) at- pi ag triple mutant does not have any nor- tempted to yield the phylogeny of all seed mal floral organs. There are concentric plants using 499 rbcL sequences. The analy- whorls of leaves instead. sis proved a few sequences to be pseudogenes, and entire families were repre- Gene trees sented by single sequences. The data set Molecular systematics presents powerful have been reanalyzed by other authors to tools for constructing phylogenetic trees. yield parsimonious trees (Rice et al., 1997). Commonly used methods over the recent RbcL data has supported that Caryophyllidae years include studies on chloroplast DNA is monophyletic. It has also supported the using restriction site polymorphism (cpRFLP), union of family pairs Asclepiadaceae- analysis of chloroplast gene for subunit F of Apocynaceae, Araliaceae-Apiaceae, and NADP dehydrogenase (ndhF, in the small copy Brassicaceae-Capparaceae. The data also region), for ‘a’ and ‘b’ subunits of RNA supported the polyphyletic nature of Saxifra- polymerase II (rpoA and rpoC2, in a large gaceae and Caprifoliaceae. 210 Plant Systematics

Chapter 8 Developing Classifications

Systematics aims at developing classifica- of numerical taxonomy with cladistic meth- tions based on different criteria and, often a ods. It is, however, essential to understand distinct methodology is employed for the the concepts of each, and the final integra- analysis of data. Data handling to establish tion in phylogeny reconstruction. relationships between the organisms often makes use of one of the two methods: phe- PHENETIC METHODS netic methods and phylogenetic methods, often providing different types of classifica- Numerical taxonomy received a great im- tion. Distinction is sometimes also made be- petus with the development and advance- tween phylogenetic and evolutionary clas- ment of computers. This field of study is also sification schemes. Phylogenetic methods known as mathematical taxonomy (Jardine aim at developing a classification based on and Sibson, 1971), taxometrics (Mayr, 1966), an analysis of phylogenetic data, and devel- taximetrics (Rogers, 1963), multivariate oping a diagram termed cladogram or phy- morphometrics (Blackith and Reyment, 1971) logenetic tree, or more recently, simply and phenetics. The modern methods of nu- tree, which depicts the genealogical descent merical taxonomy had their beginning from of taxa. Biologists practicing this methodol- the contributions of Sneath (1957), Michener and Sokal (1957), and Sokal and ogy are known as cladists, and the field of Michener (1958) which culminated in the study as cladistics. The term, however, is publication of Principles of Numerical Tax- slowly being replaced by phylogenetic sys- onomy (Sokal and Sneath, 1963), with an ex- tematics. The phylogenetic concepts panded and updated version Numerical Tax- present a huge diversity of variation, unfor- onomy (Sneath and Sokal, 1973). The latter tunately often contradictory, leading to dif- authors define Numerical taxonomy as ferent interpretations of similar results. A grouping by numerical methods of taxo- brief understanding of these is, therefore, nomic units into taxa on the basis of their necessary before attempting to explore this character states. Before the development complex field. Before the development of of modern methods of cladistics, the modern methods of cladistics, the numeri- numerical methods were also used for cal methods were largely used for drawing drawing phylogenetic inferences from the phylogenetic inferences from the data analy- data analysis. sis. The modern Phylogenetic methods, how- The last few decades have witnessed a ever, integrate the concepts and practices forceful debate on the suitability of the Developing Classifications 211 empirical approach or operational approach in systematic studies. Empirical taxonomy forms the classification on the basis of taxonomic judgment based on observation of data and not assumptions. Operational taxonomy, on the other hand, is based on operational methods, experimentation to evaluate the observed data, before a final classification. Numerical taxonomy finds a balance between the two as it is both empirical and operational (Figure 8.1). It must be remembered that numerical taxonomy does not produce new data or a new system of classification, but is rather a new method of organizing data that could help in better understanding of relationships. Spe- Figure 8.1 Relationship between empirical, op- cial classifications are based either on one erational and numerical taxonomy or a few characters or on one set of data. (after Sneath and Sokal, 1973). Numerical taxonomy seeks to base classifications on a greater number of characters the better a given classification will from many sets of data in an effort to probe. duce an entirely phenetic classification of 2. A priori, every character is of equal maximum predictivity. weight in creating natural taxa. 3. Overall similarity between any two en- Principles of Taxometrics tities is a function of their individual similarities in each of the many char- The philosophy of modern methods of nu- acters in which they are being com- merical taxonomy is based on ideas that pared. were first proposed by the French naturalist 4. Distinct taxa can be recognized be- Michel Adanson (1763). He rejected the idea cause correlations of characters dif- of giving more importance to certain char- fer in the groups of organisms under acters, and believed that natural taxa are study. based on the concept of similarity, which is 5. Phylogenetic inferences can be made measured by taking all the characters into from the taxonomic structures of a consideration. The principles of modern nu- group and also from character corre- merical taxonomy developed by Sneath and lations, given certain assumptions Sokal (1973) are based on the modern inter- about evolutionary pathways and pretation of the Adansonian principles and mechanisms. as such are termed neo-Adansonian prin- 6. Taxonomy is viewed and practiced as ciples. It would, however, be wrong to visu- an empirical science. alize Adanson as the founder of numerical 7. Classifications are based on phenetic taxonomy, because he worked in a different similarity. academic environment from that of today, when tools of investigation were much dif- The methodology of numerical taxonomy ferent. These principles of numerical tax- involves the selection of operational units onomy are enumerated below. (populations, species, genera, etc., from which the information is collected) and char- 1. The greater the content of informa- acters. The information from these is tion in the taxa of a classification and recorded, and similarity (and/or distance) the more characters it is based upon, between units is determined using various 212 Plant Systematics statistical formulae. The ultimate analysis fined phenetic relationship as an arrange- involves comparison of similarity data and ment by overall similarity, based on all constructing diagrams or models, which pro- available characters without any weight- vide a summary of the data analysis. These ing. Sneath and Sokal (1973) define phe- diagrams or models are used for final syn- netic relationship as similarity (resem- thesis and better understanding of the rela- blance) based on a set of phenotypic char- tionships. The major advantages of numeri- acteristics and not phylogeny of organ- cal taxonomy over conventional taxonomy isms under study. It is distinct from a cla- include: distic relationship, which is an expression 1. Numerical taxonomy has the power to of the recency of common ancestry and is integrate data from a variety of represented by a branching network of an- sources such as morphology, physiol- cestor-descendant relationships. Whereas ogy, phytochemistry, embryology, the phenetic relationship is represented by anatomy, palynology, chromosomes, a phenogram, the cladistic relationship is ultrastructure and micromorphology. depicted through a cladogram. This is very difficult to do by conventional taxonomy. 2. Considerable automation of the data CLADISTIC METHODS processing promotes efficiency and Although phylogenetic diagrams (now appro- the work can be handled by even less priately known as phylograms) have been skilled workers. used by Bessey (1915), Hutchinson (1959, 3. Data coded in numerical form can be 1973), and contemporary authors of classifi- integrated with existing data-process- cation systems to depict the relationships ing systems in various institutions between taxa, the cladograms are distinct and used for the creation of descrip- in the sense that they are developed using tions, keys, catalogues, maps and a distinct methodology. This method was first other documents. proposed by W. Hennig (1950, 1957), a Ger- 4. The methods, being quantitative, pro- man zoologist who founded the subject of phy- vide greater discrimination along the logenetic systematics. The term cladistics spectrum of taxonomic differences, for this methodology was coined by Mayr and can provide better classifications (1969). An American Botanist, W. H. Wagner, and keys. working independently, developed a method 5. The creation of explicit data tables for of constructing phylogenetic trees, called the numerical taxonomy necessitates the groundplan-divergence method, in 1948. use of more and better described char- Over the years, cladistics has developed into acters, which will necessarily improve a forceful methodology of developing phylo- conventional taxonomy as well. genetic classifications. 6. The application of numerical taxonomy Cladistics is a methodology that attempts has posed some fresh questions con- to analyse phylogenetic data objectively, in cerning classification and initiated a manner parallel to taxometrics, which efforts for re-examination of classifi- analyses phenetic data. Cladistic methods cation systems. are largely based on the principle of parsi- 7. A number of biological and evolution- mony according to which, the most likely ary concepts have been reinterpreted, evolutionary route is the shortest hypothet- thus introducing renewed interest in ical pathway of changes that explains the biological research. pattern under observation. Taxa in a truly Numerical taxonomy aims at determin- phylogenetic system should be monophylet- ing phenetic relationships between organic. It has been found that symplesiomorphy isms or taxa. Cain and Harrison (1960) de- (possession of primitive or plesiomorphic Developing Classifications 213 character-state in common by two or more ‘These families are primitive because they taxa) does not necessarily indicate monophy- possess primitive characters (or character- ly. Synapomorphy (possession of derived or states) and primitive characters (or charac- apomorphic character-state in common by ter-states) are those which are possessed by two or more taxa), on the other hand, is a these primitive families’. Over the recent more reliable indicative of monophyly. It is years, a better understanding of these con- thus common to use homologous shared and cepts has become possible. It is generally derived character-states for cladistic stud- accepted that evolution has proceeded at dif- ies. Before analysing the methodology of han- ferent rates in different groups of plants so dling data for phylogenetic analysis, it is im- that among the present-day organisms, portant to understand the major terms and some are more advanced than others. The concepts used in Phylogenetic Systematics. first step in the determination of relative advancement of characters, is to ascertain which characters are plesiomorphic and Phylogenetic Terms which are apomorphic. Stebbins (1950) argued that it is wrong to consider the charac- Many important terms have been repeatedly ters as separate entities, since it is through used in discussions on the phylogeny of an- the summation of characters peculiar to an giosperms, with diverse interpretation, individual, that natural selection operates. which has often resulted in different sets of Sporne (1974) while agreeing with this, be- conclusions. A prominent case in point is lieved that it is scarcely possible initially to Melville (1983), who regards the angiosperms avoid thinking in terms of separate charac- as a monophyletic group. His justification— ters, which can be treated better statistically. several ancestral forms of the single fossil Given insufficient fossil records of the ear- group Glossopteridae gave rise to an- liest angiosperms, comparative morphology giosperms—renders his view as polyphyletic has been largely used to decide the relative in the eyes of the greater majority of authors advancement of characters. Many doctrines who believe in the strict application of the have been proposed but unfortunately most concept of monophyly. The involvement of rely on circular reasoning. Some of the more than one ancestor makes angiosperms important doctrines are described below: a polyphyletic group, a view that has been The Doctrine of conservative regions firmly rejected. A uniform thorough evalua- holds that certain regions of plants have tion of these concepts is necessary for proper been less susceptible to environmental in- understanding of angiosperm phylogeny. fluence than others and, therefore, exhibit primitive features. Unfortunately, however, Plesiomorphic and over the years, every part of the plant has Apomorphic Characters been claimed as conservative region. Also, the assumption that a flower is more con- A central point to the determination of the servative than the vegetative parts is derived phylogenetic position of a particular group from classifications which are based on this is the number of primitive (plesiomorphic) assumption. or advanced (apomorphic) characters (al- The doctrine of recapitulation holds that though the term character is often used early phases in development are supposed broadly in literature, more appropriately to exhibit primitive features, i.e. ‘ontogeny primitive or advanced and similarly repeats phylogeny’. Gunderson (1939) used plesiomorphic and apomorphic refer to dif- this theory to establish the following ferent character-states of a character, and evolutionary trends: polypetaly to gamopetaly not different characters) that the group con- (since the petal primordia are initially tains. In the past, most conclusions on primi- separate, the tubular portion of the corolla tiveness were based on circular reasoning: arises later); polysepaly to gamosepaly; 214 Plant Systematics actinomorphy to zygomorphy and apocarpy to that certain morphological characters are syncarpy. The concept originally applied to statistically correlated and the fact can be animals does not always hold well in plants used in the study of evolution. Sinnot and where ontogeny does not end with embryog- Bailey (1914) demonstrated a positive cor- eny but continues throughout the adult life. relation between trilacunar node and Neoteny (persistence of juvenile features in stipules. Frost (1930) believed that correla- mature organism) is an example wherein a tion between characters arises because persistent embryonic form represents an ad- rates of their evolution have been correlated. vanced condition. Sporne (1974) has, however, argued that cor- The doctrine of teratology was advocated relation can be shown to occur even though by Sahni (1925), who argued that when a the rates of evolution of characters are not normal equilibrium is upset, an adjustment the same. Within any taxonomic group, is often effected by falling back upon the primitive characters may be expected to surer basis of past experience. Thus, tera- show positive correlation merely because tology (abnormality) is seen as reminiscent their distribution is not random. By defini- of some remote ancestor. According to tion, primitive members of that group have Heslop-Harrison (1952), some teratological retained a relatively high proportion of an- phenomena are just likely to be progressive cestral (plesiomorphic) characters, while ad- or retrogressive, and each case must be vanced members have dispensed with a rela- judged on its own merit. tively high proportion of these same char- The doctrine of sequences advocates that acters—either by loss or replacement with if organisms are arranged in a series in different (apomorphic) characters. It follows, such a way as to show the gradation of a par- therefore, that the distribution of ticular organ or structure, then the two ends plesiomorphic characters is displaced to- of the series represent apomorphy and wards primitive members, which have a plesiomorphy. The most crucial decision, higher proportion of plesiomorphic charac- however, is from which end should the se- ters, than the average for the group as a ries be read. whole. Departure from the random can be The doctrine of association advocates statistically calculated in order to establish that if one structure has evolved from an- correlation among characters. Based on other, then the primitive condition of the these calculations, Sporne (1974) prepared derived one will be similar to the general a list of 24 characters in Dicotyledons and condition of the ancestral structure. Thus, 14 in Monocotyledons, which exhibit posi- if vessels have evolved from tracheids, then tive correlation. These characters, because the vessels similar to tracheids (vessels with of their distribution, have been categorized longer elements, smaller diameter, greater as magnoloid and amarylloid, respectively. angularity, thinner walls and oblique end Based on the distribution of these charac- walls) represent a more primitive condition ters, Sporne calculated an advancement than vessels with broader, shorter, more cir- index for each family and projected the cular elements with horizontal end walls. placement of different families of an- The doctrine of common ground plan ad- giosperms in the form of a circular diagram, vocates that characters common to all mem- with the most primitive families near the bers of a group must have been possessed centre, and the most advanced along the pe- by the original ancestor and must, therefore, riphery. That the earliest members of an- be primitive. The doctrine, however, cannot giosperms are extinct is clear from the fact be applied to angiosperms in which there is that none of the present-day families has an exception for almost every character. the advancement index of zero. All living The doctrine of character correlation was families have advanced in some respects. acknowledged during the second decade of The concept of apomorphic and the previous century when it was realized plesiomorphic characters in understanding Developing Classifications 215 the phylogeny of angiosperms has been con- homologous with leaves because their de- siderably advanced with the recent develop- velopment is identical. ment of cladistic methods. These employ a During the latter half of the present cen- distinct methodology, somewhat similar to tury, phylogenetic interpretation has been taxometric methods in certain steps in- applied to these terms. Simpson (1961) de- volved, leading to the construction of cla- fined homology as the resemblance due to dograms depicting evolutionary relation- inheritance from a common ancestry. Anal- ships within a group. Certain groups of an- ogy, similarly, represents functional simi- giosperms are reported to have a combina- larity and not due to inheritance from a tion of both plesiomorphic and apomorphic common ancestry. Mayr (1969) similarly de- characters, a situation known as fined homology as the occurrence of simi- heterobathmy. Tetracentron has primitive lar features in two or more organisms, vesselless wood but the pollen grains are ad- which can be traced to the same feature vanced, being tricolpate. in the common ancestor of these organisms. It is, as such, imperative that homol- Homology and Analogy ogy between two organisms can result only from their having evolved from a common Different organisms resemble one another ancestor, and the ancestor must also con- in certain characters. Taxonomic groups or tain the same feature or features for which taxa are constructed based on overall resem- the two organisms are homologous. blances. The resemblances due to homology Wiley (1981) has provided a detailed in- are real, whereas those due to analogy are terpretation of these terms. Homology may generally superficial. A real understanding either be between two characters, two char- of these terms is, thus, necessary in order acter states, or between two organisms for a to keep organisms with superficial resemblance in separate groups. The two terms as such play a very important role in understanding evolutionary biology. These terms were first used and defined by Owen (1848). He defined Homology as the occurrence of the same organ in different animals under every variety of Figure 8.2 Homology between characters (or forms and functions. He defined Analogy character states). In the first ex- as the occurrence of a part or an organ ample, character A is plesiomorphic in one animal which has the same func- and B is apomorphic. In the second tion as another part or organ in a differ- example, B is apomorphic in rela- ent animal. If applied to plants, the rhizome tion to A but plesiomorphic in rela- of ginger, the corm of colocasia, tuber of tion to C as all three belong to an potato, and runner of lawn grass are all evolutionary transformation series. homologous, as they all represent a stem. The tuber of potato and the tuber of sweet particular character or character state. Two potato, on the other hand, are analogous as characters (or character-states) are the latter represents a root. homologous if one is directly derived from Darwin (1959) was the first to apply these the other. Such a series of characters is terms to both animals and plants. He defined called an evolutionary transformation homology as that relationship between series (also called morphoclines or parts which results from their develop- phenoclines). The original, pre-existing ment from corresponding embryonic parts. character (or character- state) is termed The parts of a flower in different plants are plesiomorphic and the derived one as thus homologous and these, in turn, are apomorphic or evolutionary novelty. 216 Plant Systematics

Three or more character-states may be 4. When the same relatively simple char- homologous if they belong to the same evo- acter is found in a large number of lutionary transformation series (ovary su- species, it is probably homologous in perior—>half-inferior—> inferior). The terms all the species. Sets of characters may plesiomorphic and apomorphic are, however, similarly be homologous. relative. In an evolutionary transformation 5. If two organisms share the characters series representing characters A, B and C of sufficient complexity and judged (Figure 8.2), B is apomorphic in relation to A homologous, other characters shared but it is plesiomorphic in relation to C. by the organisms are also likely to be Two or more organisms may be homolo- homologous. gous for a particular character (or charac- A B C A A B B C C ter-state) if their immediate common ancestor also had this character. Such a character is called shared homologue. If the character-state is present in the immediate common ancestor, but not in the earlier ancestor (Figure 8.3), i.e. the character-state is a derived one, the situation is known as synapomorphy. If the character-state is I II present in the immediate common ancestor, as well as in the earlier ancestor, i.e. it is an original character-state, the situation is known as symplesiomorphy (note sym-). The homology between different organ- Figure 8.3 Homology between two organisms isms is termed special homology, as repre- B and C. In diagram I, similarity is sented by different types of leaves in differ- due to symplesiomorphy as the ent species of plants. Different leaves in the character was unchanged in the same plant such as foliage leaves, bracts, previous ancestor. In II, it is due floral leaves would also be homologous, rep- to synapomorphy as the previous resenting serial homology. The following ancestor had a plesiomorphic character and the two now share a de- criteria may be helpful in identifying homol- rived character. ogy in practice: 1. Morphological similarity with respect Parallelism and convergence to topographic position, geometric po- Unlike homology, if the character shared by sition, or position in relation to other two organisms is not traced to a common an- parts. A branch, for example, occurs cestor, the similarity may be the result of in the axil of a leaf, although it may homoplasy (sometimes considered synonym be modified in different ways. of analogy). It can result in three different 2. Similar ontogeny. ways. One, the organisms have a common 3. Continuation through intermediates, ancestor but the character-state was not as for example, the evolution of mam- present in their common ancestor (parallel- malian year from gills of fishes, evo- ism). It could also result from two different lution of achene fruit from follicle in characters in different ancestors evolving Ranunculaceae. Similarly, vessels into identical character-states (conver- having evolved from tracheids, the gence). Similarity could also arise from loss primitive forms of vessels are more of a particular character (reversal), thus like tracheids, with elongated nar- reverting to ancestral condition (loss of pe- rower elements with oblique end rianth in some families). All the three situ- walls. ations represent false synapomorphy Developing Classifications 217 because the similar character-state is de- wind pollination in such unrelated rived and not traced to a common ancestor. families as Poaceae, Salicaceae and Simpson (1961) defined parallelism as Urticaceae, pollinia in Asclepiadaceae the independent occurrence of similar and Orchidaceae. changes in groups with a common ances- 3. Convergence may also be due to simi- try, and because they had a common an- lar modes of dispersal, as seen in cestry. The two species Ranunculus hairy seeds of Asteraceae, tripartitus and R. hederacea have a similar Asclepiadaceae and some Malvaceae. aquatic habit and dissected leaves and have 4. Convergence commonly occurs be- acquired these characters by parallel evolu- tween relatively advanced members of tion. The development of vessels in Gnetales respective groups. Arenaria and and dicotyledons also represents a case of Minuartia form natural groups of spe- parallelism. cies which were earlier placed within Convergence implies increasing similar- the same genus Arenaria. The two spe- ity between two distinct phyletic lines, ei- cies Arenaria leptocladus and Minuartia ther with regard to individual organ or hybrida show more similarity than to the whole organism. The similar fea- between any two species of these two tures in convergence arise separately in two genera. If the similarity is patristic or more genetically diverse and not closely (result of common ancestry), then the related taxa or lineages. The similarities two species would represent the most have arisen in spite of lack of affinity and primitive members of respective have probably been derived from different sys- groups (Figure 8.5-I) and it would have tems of genes. Examples may be found in been advisable to place all of the spe- the occurrence of pollinia in Asclepiadaceae cies in the same genus Arenaria. The and Orchidaceae, and the ‘switch habit’ (circular sheath at nodes) in Equisetum, Ephe- A B C A B C dra and Polygonum. The concepts of parallelism and convergence are illustrated in Figure 8.4. Convergence is generally brought about by similar climates and habitats, similar methods of pollination or dispersal. Once the convergence has been identified between two taxa, which have been grouped together, I they are separated to make the groups natu- II ral and monophyletic. The following criteria may help in the identification of convergence: 1. Convergence commonly results from adaptation to similar habitats. Wa- Figure 8.4 Examples of convergence (I) and par- ter plants thus usually lack root hairs allelism (II) between organisms A and root cap but contain air lacunae. and B. In convergence, similarity is Annuals are predominant in deserts, between organisms derived from which also have a good number of suc- different lineages. In parallelism, culent plants. The gross similarity the ancestor is common but both A and B have evolved an apomorphic between certain succulent species of character independently. In both Euphorbiaceae and Cactaceae is a cases, similarity represents false very striking example of convergence. synapomorphy. Dissimilarity be- 2. Convergence may also result from tween B and C in both diagrams is similar modes of pollination such as due to divergence. 218 Plant Systematics

F G H A B C D E studies have shown, however, that these two species are the most specialized in each group (Figure 8.5-II) and thus show convergence. Separa- tion of the two genera is justified, because placing all the species within the same genus Arenaria would render the group polyphyletic, a situation that evolutionary biologists avoid. I It is pertinent to mention that although m the concepts parallelism and convergence seem to be distinct and theoretically sound, n and often easy to apply when discussing homoplasious (non-homologous) similarity in the case of closely related organisms (parallelism), or distantly related organisms (convergence), the distinction is not always clear. In Figure 8.5-I, for example if we did not know F G H A B C D E the evolutionary history of the group before level m, there was no way of telling whether all the eight species had a common ancestor or not. For practical reasons, it is always safer to refer homoplasious situations together. Some recent authors like Judd et al., (2002) treat parallelism and convergence as same. Reversal is a common evolutionary pro- II cess, wherein loss of a particular character may lead to apparent similarity with ancestral condition. The occurrence of reduced unisexual flowers without perianth or with reduced perianth in Amentiferae was once considered to be primitive situation, but the evidence from wood anatomy, floral anatomy Figure 8.5 Two possible reasons for similar- and palynology have shown that apparent ity between species A and B. In (I), A (cf. Arenaria leptocladus) and B (cf. simplicity of these flowers is due to evolu- Minuartia hybrida) are the most tionary reduction (reversal), and as such the primitive members of respective lin- assumed similarity to angiosperm ancestral eages FGHA (cf. Arenaria) and BCDE condition is representation of homoplasy, a (cf. Minuartia). The two lineages have false similarity between an evolutionary common ancestry and thus consti- advancement (secondary reduction) and tute a single monophyletic group ancestral simple condition. (cf. Arenaria s. l.). In (II), A and B happen to be the most advanced members of the respective groups, Monophyly, Paraphyly and the two lineages are distinct and Polyphyly as such similarity between A and B is superficial due to convergence, These terms have been commonly used in justifying the independent recogni- taxonomy and evolutionary literature with tion of two lineages (cf. distinct gen- such varied interpretation that much con- era Arenaria and Minuartia). fusion has arisen in their application. Developing Classifications 219

A B C D A B C D more lineages from one immediately ancestral taxon of the same or lower rank. Such a definition would be true if, say, genus B evolved from genus A through one species of the latter, since in that case, the m genus B would monophyletic at the same I II rank (genus) as well as at the lower (species) rank. On the other hand, if genus B n evolved from two species of genus A, it would be monophyletic at the genus level but polyphyletic at the lower rank. A B C D Most authors, however, including Heslop- Harrison (1958) and Hennig (1966), adhere to a stricter interpretation of monophyly, namely the group should have evolved from a single immediately ancestral species m III which, may be considered as belonging to the group in question. There are thus two different levels of monophyly: a minimum n monophyly wherein one supraspecific taxon is derived from another of equal rank (Simpson’s definition), and a strict monophyly Figure 8.6 Concepts of monophyly, paraphyly wherein one higher taxon is derived and polyphyly. In (I) groups AB and from a single evolutionary species. CD are monophyletic as each has Mayr (1969) and Melville (1983) follow the a common ancestor at level m. concept of minimum monophyly. Most au- Similarly. group ABCD is monophyl- thors, including Heslop-Harrison (1958), etic as it has a common ancestor Hennig (1966), Ashlock (1971) and Wiley at level n. In (II) group ABC is (1981), reject the idea of minimum mono- paraphyletic as we are leaving out phyly. All supraspecific taxa are composed descendant D of the common an- of individual lineages that evolve indepen- cestor at level n. In (III) group BC is polyphyletic as their respective dent of each other and cannot be ancestral ancestors at level m do not belong to one another. Only a species can be an to this group. ancestor of a taxon. The supraspecific ancestors and, for that matter, supraspecific taxa are not biologically meaningful entities Defined broadly, the terms monophyly (deri- and are only evolutionary artifacts. vation from a single ancestor) and polyphyly Hennig (1966) defined a monophyletic (derivation from more than one ancestor) group as a group of species descended from would have different meanings depending a single (‘stem’) species, and which in- upon how far back we are prepared to go in cludes all the descendants from this spe- evolutionary history. If life arose only once cies. Briefly, a monophyletic group comprises on Earth, all organisms (even if you place all the descendants that at one time bean animal species and a plant species in the longed to a single species. A useful analysis same group) are ultimately monophyletic in of Hennig’s concept of monophyly was made origin. There is thus a need for a precise by Ashlock (1971). He distinguished between definition of these terms, to make them two types of monophyletic groups:: those that meaningful in taxonomy. are holophyletic when all descendants of Simpson (1961) defined monophyly as the most recent common ancestor are con- the derivation of a taxon through one or tained in the group (monophyletic sensu 220 Plant Systematics

Monophyly Paraphyly Polyphyly

Figure 8.7 The application of cutting rules to distinguish between monophyly, paraphyly and polyphyly. The group is represented by lighter portion of the tree. Monophyletic group can be separated by a single cut below the group, a paraphyletic group by one cut below the group and one or more higher up. A polyphyletic is separated by more than one cut below the group. A monophyletic group represents one complete branch, a paraphyletic group one larger portion of the branch; whereas the polyphyletic group represents more than one pieces of a branch (based on Dahlgren et al., 1985).

Hennig) and those that are paraphyletic group, i.e., it represents more than one and do not contain all descendants of the piece of a branch. most recent common ancestor of the group. Gerhard Haszprunar (1987) introduced the A polyphyletic group, according to him, is term orthophyletic while discussing the phy- one whose most recent ancestor is not cla- logeny of Gastropods. An orthophyletic group distically a member of that group. The is a stem group, i.e. a group that is terms holophyletic and monophyletic are paraphyletic because a single clade (the now considered synonymous. Diagrammatic crown group), has been excluded. The term representations of Ashlock’s concept of has not been followed in other groups, espe- polyphyly, monophyly and paraphyly is pre- cially in botanical systematics. Sosef (1997) sented in Figure 8.6. compares the existent hierarchical models An excellent representation of mono- of classification. He argues that a phyloge- phyly, paraphyly and polyphyly is presented netic tree can be subdivided according to a by ‘cutting rules’, devised by Dahlgren and monophyletic hierarchical model, in which Rasmusen (1983). The distinction is based only monophyletic units figure or, according on how the group is separated from a repre- to a ‘Linnaean’ hierarchical model, in which sentative evolutionary tree (Figure 8.7). A both mono- and paraphyletic units occur. monophyletic group is separated by a Most present-day phylogeneticists try to fit single cut below the group, i.e. it repre- the monophyletic model within the set of no- sents one complete branch. A paraphyletic menclatural conventions that fit the Lin- group is separated by one cut below the naean model. However, the two models are group and one or more cuts higher up, i.e. intrinsically incongruent. The monophyletic it represents one piece of a branch. A poly- model requires a system of classification of phyletic group, on the other hand, is sepa- its own, at variance with currently accepted rated by more than one cut below the conventions. Since, however, the mono- Developing Classifications 221 phyletic model is unable to cope with reticu- a polyphyletic group, because they are derived late evolutionary relationships; it is from two separate ancestors at level m. If, unsuited for the classification of nature. The however, A, B, and C are under one group, B Linnaean model is to be preferred. This and C would still now be components of a renders the acceptance of paraphyletic paraphyletic group, because one descendant supraspecific taxa inevitable. of the common ancestor at level n is kept out As is true for the distinction between par- of the group. A natural group would be one, allelism and convergence, similarly, the con- which includes all descendents of the com- cepts of paraphyly and polyphyly (both of which mon ancestor, or the group is monophyletic. are rejected by modern phylogenetic systematics while constructing classification), hold good, when the former is applied to a group of Phylogenetic Diagrams closely related organisms and latter to dis- The affinities between the various groups tantly related organisms. The concepts of plants are commonly depicted with the become ambiguous when a small group of help of diagrams, with several innovations. organisms is considered. In Figure 8.6-III, These diagrams also help in understanding taxa B and C— if brought together—would form the classification of included taxa. An

Figure 8.8 A phylogenetic tree representing the evolutionary history of plants including angiosperms. The vertical axis represents the geological time scale. Only extant (living) plants are shown reaching the top. 222 Plant Systematics understanding of these terms is necessary for a correct interpretation of putative relationships. These branching diagrams are broadly known as dendrograms. Any diagram showing the evolutionary history of a group in the form of branches arising from one or more points has often been referred as a phylogenetic tree, but the use of terms is now becoming more precise, and more innovative diagrams are being developed often providing useful information about different taxa mapped in the diagram. The most common form of diagram is one where the length of branch indicates the degree of apomorphy. Such diagrams were sometimes classified as cladograms (Stace, 1980), but the term has now been restricted to diagrams constructed through the distinct methodology of cladistics (Stace, 1989). Figure 8.9 Phylogenetic tree of angiosperms presented by Dahlgren (1975) with Diagrams with vertical axis representing the a section of the top (subsequently degree of apomorphy are now more appro- named phylogenetic ‘shrub’ by priately known as phylograms. The earli- Dahlgren, 1977). est well-known example of such a phylogram is ‘Bessey’s cactus’ (see Fig 10.11). In such history. The vertical axis in such a diagram diagrams the most primitive groups end represents the geological time scale. In such near the base and the most advanced reach a diagram, the origin of a group is depicted the farthest distance. by the branch diverging from the main stock Hutchinson (1959, 1973) presented his and its disappearance by the branch termi- phylogram in the form of a line diagram (fig- nation. Branches representing the fossil ure 10.13). The recent classifications of groups end in the geological time when the Takhtajan (1966, 1980, 1987) and Cronquist (1981, 1988) have more innovative group became extinct, whereas the extant phylograms in which the groups are de- plant groups extend up to the top of the tree. picted in the form of balloons or bubbles As already mentioned, the relative advance- whose size corresponds to the number of ment of the living groups is indicated by their species in the group (an approach also found distance from the centre, primitive groups in Besseyan cactus). Such phylograms thus being near the centre, and advanced groups not only depict phylogenetic relationships towards the periphery. A phylogenetic tree between the groups, they also show the de- representing possible relationships and the gree of advancement as also the relative evolutionary history of seed plants is pre- number of species in different groups. Such sented in Figure 8.8. diagrams have been popularly known as Dahlgren (1975) presented the phyloge- bubble diagrams. The bubble diagram of netic tree (preferred to call it phylogenetic Takhtajan (Figure 10.16) is more detailed ‘shrub’ in 1977) of flowering plants with all and shows the relationship of the orders extant groups reaching the top, and the within the ‘bubble’; as mentioned earlier, cross-section of the top of the phylogenetic Woodland (1991) aptly described it as tree was shown as top plane of this diagram ‘Takhtajan’s flower garden’. (Figure 8.9). In subsequent schemes of The phylogenetic tree is a commonly Dahlgren (1977, 1983, 1989), the branching used diagram in relating the phylogenetic portion of the diagram was dropped and only Developing Classifications 223

Figure 8.10 Mapping of pollen grain dispersal stage in different dicotyledons on a two-dimensional diagram (Dahlgrenogram) of Dahlgren, representing transverse section through the top of a phylogenetic shrub. Pollen grain dispersal in 2-celled stage (unshaded), 3-celled stage (dotted), or mixed (hatched). (Courtesy Gertrud Dahlgren). the top plane (cross-section of the top) pre- thetical pathway of changes within a group sented as a two-dimensional diagram (Fig- that explains the present phenetic pattern, ure 8.10), and this has been very useful in using the principle of parsimony. A cla- mapping the distribution of various charac- dogram is a representation of the inferred ters in different groups of angiosperms, and historical connections between the entities the comparison of these provides a good as evidenced by synapomorphies. The verti- measure of correspondence of various char- cal axis of the cladogram is always an acters in phylogeny. This diagram has been implied, but usually non-absolute time scale. popularly known as ‘Dahlgrenogram’. Cladograms are ancestor-descendant Thorne’s diagram (2000) is similarly the sequences of populations. Each bifurcation top view of a phylogenetic shrub (Figure of the cladogram represents a past specia- 10.23), in which the centre representing the tion that resulted in two separate lineages. extinct primitive angiosperms, now absent, It must be pointed out, however, that is empty. considerable confusion still exists between A cladogram represents an evolutionary application of the terms cladogram and diagram utilizing cladistic methodology, phylogenetic tree. Wiley (1981) defines a cla- which attempts to find the shortest hypo- dogram as a branching diagram of entities 224 Plant Systematics

Figure 8.11 Tree (cladogram) for different families of the order Alismatales. Support indicated for branches refers to bootstrap support, discussed in subsequent pages. (Repro- duced from APweb vesion 7 (June , 2008), with permission from Dr P. F. Stevens.) where the branching is based on inferred changes, depending on which species is historical connections between the enti- ancestral and being relegated lower down on ties as evidenced by synapomorphies. It the vertical axis. In the case of higher taxa, is, thus, a phylogenetic or historical den- the number of cladograms and phylogenetic drogram. He defines a phylogenetic tree as trees could possibly be equal, because higher a branching diagram portraying hypoth- taxa cannot be ancestral to other higher taxa esized genealogical ties and sequences of since they are not units of evolution but historical events linking individual or- historical units composed of separately ganisms, populations, or taxa. At the spe- evolving species. cies and population level, the number of pos- Over the recent years, it has been thus sible phylogenetic trees could be more than becoming increasingly common to construct cladograms for particular character evolutionary diagrams using cladistic Developing Classifications 225 methodology, assuming that these charac- Phylogeny and Classification ter-state changes (represented as evolutionary scale or tree length) correspond to the The construction of phylogenetic classifica- geological time scale, and call these evolution involves two distinct steps: determining tionary diagrams as evolutionary tree (Judd the phylogeny or evolutionary history of a et al., 2008), phylogenetic tree, or simply group, and construction classification on the tree (Stevens, 2008), synonymous with a basis of this history. Imagine a lineage (or cladogram. clade- a group of individuals producing suc- A Phenogram is a diagram constructed cessively, similar and genetically related in- on the basis of numerical analysis of phe- dividuals, generally represented by lines in a netic data. Such a diagram is the result of cladogram) with woody habit, alternate leaves, utilization of a large number of characters, cymose inflorescence, 5 red petals, 5 stamens, usually from all available fields, and involves 2 free carpels, and dry fruit with many seeds. calculating the similarity between taxa and Over a period of time, some population ac- constructing a diagram through cluster quires herbaceous habit and the original lin- analysis. Such a diagram (Figure 8.20) is eage splits into two, one with woody habit and very useful, firstly because it is based on a the second with herbaceous habit (Figure large number of characters, and secondly 8.12). In the lineage with woody habit, one lin- because a hierarchical classification can be eage emerges with fused carpels, while the achieved by deciding upon the threshold other loses one of the two carpels. The one levels of similarity between taxa assigned with fused carpels loses 3 of the five stamens to various ranks. in one or more populations, and that with a It must be pointed out that the modern single carpel doubles the number of stamens phylogenetic methods, which aim at con- to ten in one or more populations. The herba- structing phylogenetic trees, also some- ceous lineage, similarly, splits into one with times use large number of characters for yellow petals and one with white petals, the comparison, especially when dealing with former developing fleshy fruits in one or more morphological data, and there seem to be a populations, and the latter having the num- lot of similarities in data handling and com- ber of seeds reduced to one in some popula- putation, but are unique in the utilization tions. The present descendents of the origi- of evolutionary markers and, consequently, nal ancestor are thus represented by eight lin- produce slightly different results. With the eages, which have developed a few incorporation of distance methods in the con- apomorphic character-states, but also share struction of trees, the classical difference plesiomorphic character-states such as alter- between the terms is largely disappearing. nate leaves, 5 petals, and cymose inflores- Modern cladistic programs develop trees in cence. There must be hundreds of more which branch lengths are indicated, and plesiomorphic states, but of little significance plotting programs offer the choice to indicate in classification, as the above three. Note that branch lengths (and often called phylograms) the ancestral species at level I, II (woody habit, or not. In latter case branches may be 2 free carpels), IA (herbaceous habit, red pet- square (line running vertically and horizon- als), III (herbaceous habit, yellow petals and tally- and often called phenogram; Figure free carpels and dry fruit), and IV (herbaceous 8:21) or V-shaped (cladogram; Figure 8.11). habit, white petals, 5 stamens and many These may be presented as upright or as seeds) and have disappeared, whereas those horizontal trees (prostrate trees) . Modern at level V, and VI are still represented (al- trees contain information about evolution- though with minor changes) in the form of E ary markers such as bootstrap support, and G, respectively. Also note that united car- branch length, and Bremer support, as pels have arisen twice independently. The discussed in subsequent pages. same is also true for the loss of three stamens. 226 Plant Systematics

A B C D E F G H

Single seed 2 stamens 10 stamens Fleshy fruit Carpels united 2 stamens III IV V VI

Carpels united Yellow petals White petals 1 carpel II IA A Herbaceous habit

Figure 8.12 Evolutionary history of a hypothetical group of organisms which started with the ancestral species with woody habit, alternate leaves, cymose inflorescence, 5 red petals, 5 stamens, 2 free carpels and dry fruit with many seeds. Eleven character state transformations at different stages have resulted in 8 present day species. Note that two of the changes (carpel union and loss of three stamens) have occurred twice, and as such only nine genetic switches are involved. The ancestral species at levels I , IA, II, III an IV have disappeared.

Having known the evolutionary history of genus, and include all 8 species (2 genera) the group, we could use synapomorphy and in one family (and, of course, depending upon the concept of monophyly. Assuming that all the degree of diversity from related families, eight lineages (groups of populations) are suf- this could still be a constituent of a mono- ficiently distinct to be recognized as distinct typic order). The third option would be to have species, we would have eight species. The a single genus of eight species. simplest way would be to group these eight Note the importance of synapomorphy in species into four genera, each having a com- determining monophyly. Character-states mon ancestor. Two of these common ances- alternate leaves, cymose inflorescence and tors have disappeared, but two are still liv- 5 petals (character-states of different char- ing and would also be included in the respec- acters not same) have been passed un- tive genera (it will be more appropriate to changed in all the eight descendents (spe- regard E as ancestral to F and G ancestral to cies), which as such are symplesiomorphic H). These could be further assembled into for each of these, and this symplesiomorphy two families of four species each (two gen- will be valid between any two (or more) era each) having a common ancestor at level species that you choose to combine into a IA and II, and these two families into one genus, say, D and E, or C and F, or say order with a common ancestor at level I. ABCDE. On the other hand, if we consider Please note that common ancestor at level only synapomorphy, the monophyly is easily I, IA, II, III and IV are also no longer living. deciphered. A and B are accordingly The second option would be to include synapomorphic for yellow petals, C and D for ABCD in one genus, and EFGH in another white petals, E and F for one carpel and Developing Classifications 227

Stamens 2

Stamens >2

Carpels united

Carpels free C B Plants woody Plants herbaceous Plants woody Carpels united Carpels free Stamens 2 Stamens >2 Plants herbaceous

Stamens 2

Stamens >2

Plants herbaceous Carpels united

Carpels free Plants woody Carpels Stamens Habit D

Herbaceo Free > 2 Plants us Plants herbaceous Woody Free > 2 Plants Plants woody

Woody United > 2 Carpels united Plants Stamens 2 Woody United 2 Plants A E

Figure 8.13 Diagrams based on evolutionary pattern depicted in Figure 10.11. A: Venn diagram based on the assumption that there are 21 woody species of which, 13 are with united carpels, and 8 with free carpels. Of the 13 with united carpels, 7 have 2 stamens whereas 6 have more stamens. B: An unrooted tree based on Venn diagram. C: A possible rooted tree, if evolutionary history of the group was not known, 15 possible rooted trees could be drawn. D. Rooted tree based on knowledge that herbaceous habit arose from woody habit, and we know further evolution of woody species. Other possibilities are discussed subsequently. E: Data matrix of above, where the number of species are not indicated. 228 Plant Systematics

G and H for united carpels. Similarly, A, B, C leaves, cymose inflorescence and five pet- and D are synapomorphic for herbaceous als. The species at level IA and above addi- habit. The development of fleshy fruit in A, tionally share woody habit, VI and above ad- single seed in C, 10 stamens in F represent ditionally united carpels, V and above one the occurrence of a derived character state carpel (and not fused carpels). Similarly, spe- in a single taxon, and termed as cies at level II and above share herbaceous autapomorphy. Such character states are habit (instead of woody habit) in addition to not helpful in cladogram construction, al- three common, at level III and above addi- though indicative of divergence. Develop- tionally yellow petals, and at level IV and ment of 2 stamens in D and H independently above additionally (in place of yellow petals) represents homoplasy, and may lead to ar- white petals. tificial grouping of these two, if history of the The situation depicted above can be more group was not properly known. It must, how- easily represented through the concept of ever, be noted that symplesiomorphy may nested groups, more conveniently repre- sometimes be helpful in detecting mono- sented as a set of ovals, a Venn diagram (Fig- phyly, especially where in some other taxa, ure 8.13A). The diagram drawn here is based it has evolved into another character-state. on the assumption that we have informa- As such, out of the four plesiomorphic char- tion from a large group in which there are acter-states listed here, only the woody habit 21 woody species of which 13 are with united has changed to herbaceous habit, and as carpels and 8 with free carpels. Of the 13 such in the remaining taxa (E, F, G and H) with united carpels 7 have 2 stamens where symplesiomorphy of woody character-state as 6 have more stamens. identifies monophyly of the group ABCD. It The information is presented in the form must be remembered that synapomorphy of an unrooted network (unrooted tree) (Fig- and symplesiomorphy are a reflection of ho- ure 8.13B). The herbaceous species are mology for a particular character-state (or shown towards the left of left double arrow, more than one character-states, each be- and the woody species towards the right. longing to a different character). Similarly, the species towards the left of the All above options would render (genus, fam- middle double arrow are with free carpels ily or order) monophyletic groups, the ulti- while those towards the right with fused car- mate goal of phylogenetic systematics. Any pels. The species towards the left of the right other options won’t work. Keeping D and E double arrow have more than 2 stamens and in one genus (or CDE or DEF) would make it those towards the right just 2 stamens. polyphyletic, promptly rejected once de- It must be noted that in constructing the tected, because the group is derived from above Venn diagram and the unrooted net- more than one ancestor. Keeping ABC un- work, only three character-state transforma- der one genus, or FGH under one genus tions are accounted for. We have completely would make paraphyletic groups because left out grouping of herbaceous plants and we are not including all the descendents of the woody plants with a single carpel. Inclu- the common ancestor (we are leaving out D sion of these would make the diagrams in first genus and E in second). In the same much more complicated, and present sev- way, putting more than four species (but less eral alternatives. Also, the more meaning- than eight) under the same genus would ful trees have to be rooted (the most primi- make it paraphyletic. Paraphyletic taxa are tive end at the base), to reflect the phylog- strongly opposed by phylogenetic system- eny. Even with the phylogenetic history of atists; the classical case is the demise of the group known, there could be several traditional division of angiosperms into variations of the rooted tree, two simple ones monocots and dicots, over the last decade. being shown in the Figure 8.13C and 8.13D. It must be noted that all eight species— If we did not know the evolutionary history whatever way you classify— share alternate of the group, a number of variations would be Developing Classifications 229 possible, depending upon which character- Taxa-Operational Units state is plesiomorphic, and which character (habit, carpel fusion or stamen number) The first step in data analysis involves the forms the root, and what would be the se- selection of Taxa for data collection, often quence of the character changes on the tree. called Operational Taxonomic Units (OTUs) The character-states chosen for analysis in Taxometrics, Operational Evolutionary should necessarily be homologous (one de- Units (OEUs) in cladistics, referring to the rived from another) and non-overlapping. The sample from which the data is collected. Al- analysis becomes more meaningful when it though it would be ideal to select different is established that the evolution of a par- individuals of a population, practical consid- ticular character-state has been the result erations make it necessary to select the of a corresponding genetic change, and not members of the next lower rank. Thus, for a mere plastic environmental influence. the analysis of a species would need selec- This fact underlies the importance of the tion of various populations, for the study of a emerging field of molecular analysis in phy- genus they would be different species, and logenetic systematics. It is believed that for a family they would be different genera. the recognition of molecular character-states It is not advisable, however, to use genera (nucleotide sequences) is often easier and and higher ranks, as the majority of char- more precise, although there are always ac- acters would show variation from one spe- companying problems. cies to another and thus would not be suit- The problem with vascular plants, espe- able for comparison. The practical solution cially the angiosperms, is that we know very would be to use one representative of each little about their evolutionary history. The taxon. Thus, if a family is to be analysed and fossil records, which generally give fair in- its genera to be compared, the data from one formation about evolution, are very scarce- representative species of each genus can be ly represented. What we have available with used for analysis. Once the taxa are selected, us is a mixture of primitive, moderately ad- a list of such taxa is prepared. A unique fea- vanced and advanced groups. Almost each ture of cladistic studies, however, is that the group has some plesiomorphic and some list of taxa generally includes a hypotheti- apomorphic character-states, and relative cal ancestor, the comparison with which re- proportion of one or the another delimit the veals crucial phylogenetic information, and relative advancement of various groups. At- is used for rooting of the tree. It is, increas- tempt to reconstruct the evolutionary histo- ingly being realized that only a species is ry of the group involves comparative study the valid evolutionary entity, and all taxa at its living members, sorting out plesiomor- higher ranks are artifacts, constructed for phic and apomorphic character states, and the sake of convenience. A meaningful distribution of these in various members. analysis would always be one derived from Once the evolutionary history of the group data from various species (taken from popu- has been constructed, monophyletic groups lations) and not any higher rank directly. at various levels of inclusiveness are identified, assigned ranks, and given appropriate names, to arrive at a working system of Characters classification. A conventional definition of a taxonomic character is a characteristic that distin- guishes one taxon from another. Thus, PHYLOGENETIC DATA ANALYSIS white flowers may distinguish one species The methodology of cladistics with incorpo- from another with red flowers. Hence, the ration of numerical methods involves a num- white flower is one character and red flower ber of steps. another. A more practical definition espoused 230 Plant Systematics by numerical taxonomists defines charac- information is not available (a large num- ter (Michener and Sokal, 1957) as a feature, ber of plants in a population are not in fruit) which varies from one organism to an- or the information is irrelevant (trichome other. By this second definition, flower type if a large number of plants are without colour (and not white flower or red flower) is trichomes), or the characters which show a a character, and the white flower and red much greater variation within the same flower are its two character-states. Some taxon. Such characters are omitted from the authors (Colless, 1967) use the term at- list. This constitutes residual weighting of tribute for character-state but the two are characters. The characters (leaves, bracts, not always synonymous. When selecting a carpels) or character states (simple leaf, pal- character for numerical analysis, it is im- mate compound leaf, pinnate compound leaf) portant to select a unit character, which chosen should also be homologous, in terms may be defined as a taxonomic character of sharing common ancestry or belonging of two or more states, which within the to same evolutionary transformation series. study at hand cannot be subdivided logi- The ‘petals’ of Anemone are modified sepals cally, except for the subdivision brought and thus not homologous with the petals of about by the method of coding. Thus, tri- Ranunculus and hence not comparable. Simi- chome type may be glandular or eglandular. larly, the tuber of sweet potato (a modified A glandular trichome may be sessile or root) cannot be compared with the tuber of stalked. An eglandular trichome may, simi- potato (a modified stem). larly, be unbranched or branched. In such a case, a glandular trichome may be recognized as a unit character and an eglandular Binary and multistate trichome as another unit character. On the characters other hand, if all glandular trichomes in The characters most suitable for computer OTUs are of the same type and all eglandular handling are two-state (binary or presence- trichomes are of the same type, the trichome absence) characters (habit woody or herba- type may be selected as a unit character. The first step in the handling of charac- ceous). However, all characters may not be ters is to make a list of unit characters. A two-state. They may be qualitative preliminary step involves character compat- multistate (flowers white, red, blue) or quan- ibility study in which each character is ex- titative multistate (leaves two, three, four, amined to determine the proper sequence five at each node). Such multistate charac- of character-state changes that take place ters can be converted into two-state (flowers as the evolution progresses (morphoclines white or coloured; leaves four or more vs or transformation series). The list should leaves less than four). Or else the charac- include all such characters concerning ters may be split (flowers white vs not white, which information is available. A priori, all red vs not red, blue vs not blue; leaves two characters should be weighted equally (no vs not two, three vs not three and so on). weighting to be given to characters). Such a splitting may, however, give more Although some authors advocate that some weightage to one original character (flower characters should subsequently be assigned colour or number of leaves). It is essential more weightage than others (a posteriori that different character states identified are weighting), such considerations generally discrete or discontinuous from one another. get nullified when a large number of char- Discreteness of character states can be acters is used. It is generally opined that evaluated by comparing the means, ranges, numerical studies should involve not less and standard deviations of each character than 60 characters, but more than 80 are for all taxa in analysis. Additionally t-tests desirable. For practical consideration, there and multivariate analysis may also be used may be some characters concerning which for evaluating character state disreteness. Developing Classifications 231

ABAB AB I

ABC C CD II III BAC ABC ACB A CB IV B A C B C A AB CAB BA V CBA VI

Figure 8.14 Ordering and polarity of character states. I: Binary character with single possible switch. II: Unordered three-state character with single possible switch. III: Unor- dered Four-state character with single possible switch. IV: Ordered three-state character with two possible switches and three possible morphoclines. V: Polarized binary character with two possible morphoclines. VI: Ordered and Polarized three- state character with 6 possible morphoclines.

Ordering of Character-states and cytosine) at a particular locus, and as such present four character-states. As re- A binary character will have single step or versals are common in these, these are al- switch (Figure 8.14-I) necessary for change. ways left unordered. The minimum number of switches possible (Wagner parsimony) in a multistate char- Assigning Polarity acter will depend whether the character states are ordered or left unordered. In an It is, however, necessary to determine the unordered transformation series each char- relative ancestry of the character-states, or acter state can evolve into every other char- the assignment of polarity. The designation acter state, and represents a single switch of polarity is often one of the more difficult (Figure 8.14-II, III). A three-state character and uncertain aspects of phylogenetic analy- will have two switches or steps, and three sis. For this, the comparison may be made possible morphoclines (Figure 8.14-IV), four- within the concerned group (in-group com- state character three switches and several parison) or relatives outside the group (out- morphoclines. Whereas ordering of two-state group comparison). The latter may often pro- characters is relatively easy, multi-state vide useful information, especially when the characters are often difficult to order, and out-group used is the sister-group of the con- changes may often be reversible, and it is cerned group. If two character-states of a advisable to leave them unordered, and iden- character are found in a single monophyl- tify only one switch (Fitch parsimony). The etic group, the state that is also found in a molecular characters are different DNA se- sister-group is likely to be plesiomorphic and quences, that may differ in having one of that found only within the concerned mono- the four bases (adenine, thymine, guanine phyletic group is likely to be apomorphic. 232 Plant Systematics

A B C A B C D A B C D A 0 1 2 A 0 1 2 3 A 0 1 1 1

B 1 0 1 B 1 0 1 2 B 1 0 1 1

C 2 1 0 C 2 1 0 1 C 1 1 0 1

D 3 2 1 0 D 1 1 1 0 I II III A B A B C D A 0 1 A 0 1 5 5

B 1 0 B 1 0 5 5

IV C 5 5 0 1 D 5 5 1 0 V

Figure 8.15 Data matrix of coded character states. I: Ordered three-state character. II: ordered four-state character. III: Unordered character. IV: Binary character. V: Differential weighting to character state changes; imagine A and B represent Purines (Adenine and Guanine), C and D Pyrimidines (Cytosine and Thymine), purine to purine or pyrimidine to pyrimidine change (transition) is given 1 step weight, but purine to pyrimidine change or reverse (transversion) given 5 steps weight.

Ingroup comparison (also known as com- after the polarity criterion is included and mon ground plan or commonality principle) the selection of single appropriate mor- is based on the presumption that in a given phocline representing the true sequence group (presumably monophyletic), the primi- even more challenging. tive structure would tend to be more common. Thus all 8 species of cladogram in Fig- Character Weighting and ure 8.12 share plesiomorphic character states: alternate leaves, cymose inflores- Coding cence and five petals. Five species have The coding of character states is done by plesiomorphic 5 stamens, two derived 2 sta- assigning non-negative integer values. Bi- mens and one with 10 derived stamens. nary characters are conveniently assigned Similarly four species have red petals’ and 0 and 1 for two states. If possible to distin- two each with white and yellow petals. It is guish, plesiomorphic state is assigned 0 and assumed that the evolution of a derived con- apomorphic state 1 code (Figure 8.15-IV). It dition will occur in only one of potentially is often assumed that whereas the same numerous lineages of the group; thus the character-state may arise more than once ancestral condition will tend to be in the ma- within a group between closely related spe- jority. As is evident from Figure 8.14, the cies (parallelism), or between remotely re- number of possible morphoclines increases lated species (convergence; the distinction Developing Classifications 233

Table 8.1 A portion of the data matrix with hypothetical t OTUs and n characters. Binary coding involves for state a and 1 for state b. The NC code stands for characters not comparable for that OTU. In this analysis a total of 100 characters were used but only nine are pictured here.

Characters à mic mic e

g ound yp uatic uatic

p q

1-herbaceous e 0-PII-te mic 0-bite

y g le 1-com yp p OTUs (t) 1-inferiorerior orate 0-monosulcate p p

Habitat 0-terrestrial 1-a Leaves 0-sim Ovule 1-unite Carpels 0-free 1-united Plastids 1-PI-t Fruit 0-follicle 1-achene Ovary 0-su Pollen 1-tri Habit 0-wood 1. 1 0 1 1 0 1 1 1 1 2. 1 0 1 1 1 1 0 0 1 3. 0 NC 0 1 0 0 1 1 1 4. 1 1 1 0 1 0 0 0 0 5. 1 0 1 1 0 1 1 0 1 6. 1 1 0 1 1 NC 0 1 0 7. 0 1 1 0 1 1 0 0 1 8. 0 0 0 1 0 0 1 1 1 9. 1 1 1 0 0 1 1 0 0 10. 0 0 0 1 1 0 1 1 1 11. 1 0 1 1 0 1 0 0 1 12. 1 1 0 0 1 1 0 0 1 13. 0 0 1 0 1 0 1 0 1 14. 1 0 1 0 1 0 1 0 1 15. 0 1 1 0 0 1 1 0 0 between parallelism and convergence is be done as 0 for most primitive character- sometimes omitted) for a simple character, state (simple leaf), 1 for intermediate char- it is highly unlikely for more complex character-state (pinnately lobed leaf) and 2 more acters. It is also assumed that whereas many most advanced state (pinnately compound genes must change in order to create a mor- leaf) (Figure 8.15-I). In molecular data, phological structure, one gene change is transversions (Purine to pyrimidine or py- enough for its loss (reversal). This Dollo’s rimidine to purine changes) are given more law is taken into account when choosing weightage (Figure 8.15-V) over transitions trees, gains of structures counted more than (purine to purine or pyrimidine to pyrimi- losses, a process known as Dollo parsimony. dine), because the latter occur more fre- Such weighting of characters is often com- quently and are easy to reverse, whereas the mon in phylogenetic analysis. In transfor- former is a less likely biochemical change. mation series leaf simple —> pinnately lobed Restriction site gains may similarly be —> pinnately compound, the development of weighted over site losses. A complex char- pinnate compound leaf from simple leaf oc- acter, presumably controlled by many genes, curred in two steps, and needs to be given may change less easily than a simple char- more weightage. The coding may accordingly acter controlled by fewer genes. The former 234 Plant Systematics is often given more weighting over a simple Similarly sympetalous members tend to character. It may be assumed that leaf have epipetaly and tenuinucellate ovules. anatomy may not change easily but hairi- Such correlated characters receive lesser ness may change readily. The number of weighting. If two characters are correlated, steps between two character states is con- each gets 1/2 weighting, if three 1/3 weight- veniently represented through character ing and so on. step matrix (Figure 8.15). One may, how- It is always advisable to identify and in- ever, be tempted to count leaf anatomy char- clude the most ancestral taxon (outgroup) as acter as equivalent to two changes in hairi- last taxon (or first taxon, as certain programs ness. This may often be the result of bias to choose first taxon for rooting) in the list of obtain desired results. It is reasonable, how- taxa. If it is possible to identify plesiomorphic ever, to adopt the approach of numerical tax- and apomorphic character-states, 0 repre- onomy to give equal weighting to all the sents plesiomorphic character-state and 1 characters in the preliminary analysis, the apomorphic character-state of a particu- identify those characters which show the lar character. Outgroup taxon in the matrix least homoplasy and give them more gets 0 code for all character states (Table 8.4). weightage in the subsequent analysis, a pro- For multistep changes, or unlikely events cess known as successive weighting. This appropriate codes as indicated in Figure 8.15 avoids a bias towards a particular charac- are transferred to the matrix. Outgroup taxon ter, and as such enables rational treatment in the matrix is essential in final rooting of of available data. the most parsimonious cladogram (tree). Residual weighting involves excluding a character from the list when information for a large number of taxa is not available, or is Measure of similarity irrelevant. But in certain cases, information may be available for a particular character Once the data have been codified and for large number of OTUs but not for a few. entered in the form of a matrix, the next step Alternately, the information may be irrel- is to calculate the degree of resemblance evant for a few taxa (say, the number of spurs between every pair of OTUs. A number of in a taxon, which lacks spurs). Such char- formulae have been proposed by various acters are used in analysis but for the taxa authors to calculate similarity or dissimi- for which information is not available or is larity (taxonomic distance) between the irrelevant, an NC code (Not Comparable) is OTUs. If we are calculating the similarity entered in the matrix. Whenever the NC (or dissimilarity) based on binary data coded code is encountered, the program bypasses as 1 and 0, the following combinations are that particular character for comparing the possible. concerned taxon. For data handling by computers, the NC code is assigned a particular (not 0 or 1) numeric value. Such residual weighting should, however, be avoided when appreciable number of taxa are not comparable for a particular character. The coded data may be entered in the form of a matrix with t number of rows (OTUs) and n number of columns (character-states) with the dimension of the matrix (and the number of Number of matches m = a + d attributes) being t x n (Table 8.1). Number of positive matches a Certain characters in plants evolve Number of mismatches u = b + c together. Occurrence of stipules and Sample size n = a + b + c + d = m + u trilacunar nodes is usually correlated. j and k are two OTUs under comparison Developing Classifications 235 Some of the common formulae are dis- Yule coefficient cussed below: This coefficient has been less commonly used in numerical taxonomy. It is calculated Simple matching coefficient as: This measure of similarity is convenient ac – bc S = and highly suitable for data wherein 0 and Y ad – bc 1 represent two states of a character, and 0 does not merely represent the absence of Taxonomic distance a character-state. The coefficient was intro- Taxonomic distance between the OTUs can duced by Sokal and Michener (1958). The be easily calculated as a value 1 minus coefficient is represented as: similarity or 100 minus percentage similar- Matches ity. It can also be directly calculated as Eu- S = SM Matches + Mismatches clidean distance using formula proposed by Sokal (1961): m or + éùn 1/2 mu D=S 2 jk êú(–XXij ik ) ëûi = 1 It is more convenient to record similarity in percentage (Table 8.2). In that case, the The average distance would be repre- formula would read: sented as: m D2 S = ´ 100 = jk SM + d jk mu n When comparing a pair of OTUs, a match is Other commonly used distance measures scored when both OTUs show 1 or 0 for a par- include Mean character difference (M.C.D.) ticular character. On the other hand, if one proposed by Cain and Harrison (1958), OTU shows 0 and another 1 for a particular Manhattan metric distance coefficient character, a mismatch is scored. (Lance and Williams, 1967) and Coefficient of divergence (Clark, 1952). Jaccard Coefficient of Once the similarity or distance between association every pair of taxa has been calculated, the data are presented in a second matrix with The coefficient was first developed by Jaccard t x t dimensions where both rows and col- (1908) and gives weightage to scores of 1 umns represent taxa (Table 8.2; Table 8.3). only. This formula is thus suitable for data It must be noted that diagonal t value in the where absence-presence is coded and 1 rep- matrix represents self-comparison of taxa resents the presence of a particular char- and thus 100% similarity. These values are acter-state, and 0 its absence. The formula redundant as such. The values in the is presented as: triangle above this diagonal line would be a similar to the triangle below. The effective S = number of similarity values as such would J au+ be t x (t-1)/2. Thus if 15 OTUs are com- where a stands for number of characters pared the number of values calculated would that are present (scored 1) in both OTUs . be 15 x (15-1)/2 = 105. This can similarly be represented as a A data matrix with coded character-states percentage similarity. for each taxon can be used for calculating 236 Plant Systematics

Table 8.2 Similarity matrix of the representative hypothetical taxa presented as percentage simple matching coefficient.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 OTUs 1 100 2 47.0 100 3 54.0 47.0 100 4 49.0 54.0 52.0 100 5 50.0 51.0 44.0 48.5 100 6 46.0 59.0 46.0 47.0 48.0 100 7 47.0 48.0 48.0 46.0 65.0 47.0 100 8 56.0 51.0 56.0 51.5 46.0 58.0 25.0 100 9 50.0 45.0 49.0 50.0 60.0 40.0 79.0 30.0 100 10 50.0 45.0 54.0 50.5 58.0 41.0 77.0 36.0 92.0 100 11 53.0 54.0 49.0 45.5 65.0 51.0 92.0 31.0 75.0 73.0 100 12 48.0 47.0 49.0 50.0 58.0 42.0 81.0 30.0 96.0 94.0 75.0 100 13 47.0 44.0 49.0 49.5 59.0 44.0 68.0 41.0 81.0 83.0 62.0 81.0 100 14 55.0 46.0 55.0 51.5 57.0 44.0 72.0 39.0 81.0 81.0 72.0 81.0 74.0 100 15 56.0 45.0 57.0 53.0 54.0 44.0 67.0 40.0 78.0 72.0 67.0 74.0 67.0 87.0 100

Table 8.3 Dissimilarity matrix of the representative hypothetical taxa based on the similarity matrix in Table 8.2.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 OTUs 1 0.0 2 53.0 0.0 3 46.0 53.0 0.0 4 51.0 46.0 48.0 0.0 5 50.0 49.0 56.0 51.5 0.0 6 54.0 41.0 54.0 53.0 52.0 0.0 7 53.0 52.0 52.0 54.0 35.0 53.0 0.0 8 44.0 49.0 44.0 48.5 54.0 42.0 75.0 0.0 9 50.0 55.0 51.0 50.0 40.0 60.0 21.0 70.0 0.0 10 50.0 55.0 46.0 49.5 42.0 59.0 23.0 64.0 8.0 0.0 11 47.0 46.0 51.0 54.5 35.0 49.0 8.0 69.0 25.0 27.0 0.0 12 52.0 53.0 51.0 50.0 42.0 58.0 19.0 70.0 4.0 6.0 25.0 0.0 13 53.0 56.0 51.0 50.5 41.0 56.0 32.0 59.0 19.0 17.0 38.0 19.0 0.0 14 45.0 54.0 45.0 48.5 43.0 56.0 28.0 61.0 19.0 19.0 28.0 19.0 26.0 0.0 15 44.0 55.0 43.0 47.0 46.0 56.0 33.0 60.0 22.0 28.0 33.0 26.0 33.0 13.0 0.0

Developing Classifications 237 the distance (and, consequently, the simi- replace intuition with analysis. The method larity) between every pair of taxa, including was based on determining the apomorphic the hypothetical ancestor. The distance is character-states present within a taxon and calculated as the total number of character- then linking the subtaxa based on relative state differences between two concerned degree of apomorphy. Interestingly, whereas taxa, the data presented as t x t matrix the method found little favour with zoologists, (Table 8.5). it has been used in many botanical studies. This method is closer to taxometric meth- Kluge and Farris (1969) and Farris (1970) ods, because both plesiomorphic and developed a comprehensive methodology for apomorphic character-states are given the development of Wagner trees, based on equal weightage, but the inclusion of hypo- the principle of parsimony. The method is thetical ancestor is always crucial for the the basis of many phylogeny computer algo- study. rithms currently in use. A given dataset Another method of calculating distance may, however, yield many possible equally involves calculation of the number of parsimonious trees due to homoplasy, as apomorphic character-states common be- more than one character-state change may tween the pairs of concerned taxa, ignoring occur during the evolutionary process of a the possession of plesiomorphic character- particular group of organisms. states in common (Table 8.6). Since only The following steps are involved in the synapomorphy is likely to define monophyl- analysis: etic groups, this method is closer to the original cladistic concept. 1. Determine which of the various characters (or character-states) in a series of character transformations are Construction of Trees apomorphic. Different methods are available for the final 2. Assign the score of 0 to the analysis of cladistic information. Three of plesiomorphic character and 1 to the these commonly used in phylogenetic analy- apomorphic character in each trans- sis include Parsimony-based methods, Dis- formation series. If the transformation tance methods and Maximum likelihood series contains more than two homo- method. logues, then these ‘intermediate apomorphies’ may be scaled between 0 and 1. Thus, a transformation se- Parsimony-based methods ries of three characters may be scored The methods are largely based on the bio- as 0, 0.5 and 1 (or 0, 1 and 2 depend- logical principle that mutations are rare ing on the weighting assigned). events. The methods attempt to minimise 3. Construct a table of taxa (EUs) and the number of mutations that a phylogenetic coded characters (or character-states: tree must invoke for all taxa under consid- see Table 8.3). eration. A tree that invokes minimum num- 4. Determine the divergence index for ber of mutations (changes) is considered to each taxon by totalling up the values. be the tree of maximum parsimony. The Since apomorphic character-states evolutionary polarity of taxa is decided for are coded 1, the divergence index in construction of such trees. The Wagner effect represents the number of groundplan divergence method, an apomorphies (character-states) in a example of this, was first developed by H. W. taxon, except in cases of weighted cod- Wagner in 1948 as a technique for deter- ing. For the data matrix in Table 8.4, mining the phylogenetic relationships the divergence index for 15 taxa would among organisms that he hoped would be calculated as: 238 Plant Systematics

Table 8.4 Data matrix of t taxa and n characters scored as 0 (plesiomorphic) and 1 (apomorphic) character-states. Multistate character is assigned 0 for ancestral state, 1 for intermediate and 2 for most advanced state.The matrix is similar to Table 9.1 but only 9 characters pictured are used for calculations. Also the last taxon included is the hypothetical ancestor in which all character-states are scored as 0 (plesiomorphic), as it is presumed that the ancestor would possess all characters in a plesiomorphic state. Characters (n)à

Taxa (t)

Habit Habit 0-woody 1-herbaceous Fruit 0-follicle 1-achene Ovary 0-superior 1-inferior Leaves 0-simple 1-lobed2-compound Habitat 0-terrestrial 1-aquatic Pollen 1-triporate0-monosulcate Ovule 1-unitegmic0-bitegmic Carpels 1-united0-free Plastids 0-PII-type 1-PI-type 1. 1 0 1 1 0 1 1 1 1 2. 1 0 1 1 1 1 0 0 1 3. 0 1 0 1 0 0 1 1 1 4. 1 1 1 0 1 0 0 0 0 5. 1 0 1 2 0 1 1 0 1 6. 1 1 0 1 1 1 0 1 0 7. 0 1 1 0 1 1 0 0 1 8. 0 0 0 1 0 0 1 1 1 9. 1 1 1 0 0 1 1 0 0 10. 0 0 0 1 1 0 1 1 1 11. 1 0 1 2 0 1 0 0 1 12. 1 1 0 0 1 1 0 0 1 13. 0 0 1 0 1 0 1 0 1 14. 1 0 1 0 1 0 1 0 1 15. 0 0 0 0 0 0 0 0 0

Taxon Divergence index equals its divergence index. The lines 17connecting the taxa are determined 26by shared synapomorphies (see Table 358.6). The cladogram (Wagner tree) is 44presented in Figure 8.16. 57Not all cladistic methods apply the prin- 66ciple of parsimony. The methods of compat- 75ibility analysis or clique analysis utilize the 84concept of character compatibility. Such 95methods can detect and thus omit ho- 10 5 moplasy. They can be carried out manually 11 6 or using a computer program, and can gen- 12 5 erate both rooted as well as unrooted trees. 13 4 Groups of mutually compatible characters 14 5 are termed cliques. Let us consider two 15 0 characters, A and B, with two character- Note that the hypothetical ances- states each. Four character-state combina- tral taxon 15 has an index of 0. tions are possible: 5. Plot the taxa on a graph, placing each Assuming the evolution has proceeded taxon on a concentric semicircle that from A1 to A2 and from B1 to B2. If all the Developing Classifications 239

Table 8.5 t x t matrix presenting distance between taxa expressed as the number of character- state differences between pairs of taxa.

Eus 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

______1 0 2 3 0 3 4 7 0 4 7 4 8 0 5 2 3 6 7 0 6 5 5 6 4 7 0 7 6 3 7 3 6 6 0 8 3 6 1 8 5 6 7 0 9 4 5 7 3 4 6 4 7 0 10 4 5 2 7 6 5 6 1 8 0 11 3 2 7 6 1 6 5 6 5 7 0 12 6 3 7 3 6 4 2 7 4 6 5 0 13 5 4 5 4 5 8 3 4 5 3 6 5 0 14 4 3 6 3 4 7 4 5 4 4 5 4 1 0 15 7 6 5 4 7 6 5 4 5 5 6 5 4 5 0

Table 8.6 t x t matrix presenting distance between taxa expressed as number of derived (apomorphic) character-states common between pairs of taxa.

EUs 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

______

1 X 2 5 X 3 4 2 X 4 2 3 0 X 5 5 4 2 2 X 6 3 3 2 2 2 X 7 3 4 1 3 3 2 X 8 4 2 4 0 2 2 1 X 9 4 3 1 3 4 2 3 1 X 10 4 3 4 1 2 3 2 4 1 X 11 4 4 1 2 5 2 3 1 3 1 X 12 3 4 1 3 3 3 4 1 3 2 3 X 13 3 3 2 2 3 1 3 2 2 3 2 2 X 14 4 4 2 3 4 2 3 2 3 3 3 3 4 X 15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 X ______240 Plant Systematics four combinations are met in nature then obviously there must have been at least one reversal (A2 to A1) or parallelism (A1 to A2 occurring twice), and as such A and B are incompatible. On the other hand, if only two or three of the combinations occur, then A and B are compatible. Cliques are formed by comparing all pairs of characters and finding mutually compatible sets. The largest clique is selected from the data to produce a cladogram. Finally, a rooted tree or network is obtained according to whether or not a hy- Fig. 8.16 General representation of a Wagner pothetical ancestor was included in the tree. analysis.

Multiple Trees small portion of the herbaceous lineage with The unrooted tree constructed in Figure yellow petals, again assuming that there are 8.13-B represented only a small portion of a total of 15 herbaceous species of which six the evolutionary sequence. Extension of this are with red petals and 9 with yellow petals. tree would make it more complicated and Of these nine 4 are with united carpels and present a lot of possibilities. Let us add a 5 with free carpels. The additional Venn dia- Carpels united Plants herbaceous Plants Petals yellow Plants woody Carpels united Carpels free Carpels Petals red Carpels free Carpels Stamens >2 Stamens 2

Plants woody Plants herbaceous R Plants herbaceous Plants woody Petals yellow Carpels united

Carpels united Stamens 2

B A

Figure 8.17 A: The Venn diagram for woody species, the same as Figure 10.12A. B: The Venn diagram for a small portion of the herbaceous lineage of assumed 15 species of which 6 are with red petals and 9 with yellow petals, latter with 4 species having united carpels and 5 free carpels. C: Extension of the unrooted tree of Figure 10.12B to include the species depicted in the Venn diagram B here. There are 5 actual character state changes but with 4 switches as united carpels have arisen twice. Developing Classifications 241 Plants herbaceous Petals yellow Petals red Plants woody united Carpels Carpels free Carpels Stamens >2 Stamens 2

Plants woody

Plants herbaceous Petals red

Petals yellow

Figure 8.18 Possible variation of the unrooted tree presented n figure 10.14C, if we did not have any idea about the evolutionary history of the group. Note that tree length has increased to six, and habit has changed twice from woody to herbaceous and from red to yellow petals. Such homoplasious situations are uncommon. gram for the herbaceous species and the being included in the tree, the number of extended unrooted tree is presented in the options would increase. Also we have to con- Figure 8.17-C. It must be noted that here vert each unrooted tree into a rooted tree we know the evolutionary history of the so that the most primitive basal end of the group—which normally is never known—and tree is known, and different lineages pre- the aim of phylogenetic analysis is to recon- sented as the more advanced branches. This struct and depict this evolutionary history brings in many more options, as indicated through trees. The unrooted tree here has earlier. In our example, where we know the five character-state changes (actual history of the tree, the tree can be rooted at changes, tree length) involved. The change R, as indicated by an arrow (Figure 8.17-C), from free to united carpels has occurred but in a large majority of cases, it is a com- twice, and as such there are only four ge- plicated process, and a lot of hypotheses, netic switches involved. If we did not have strategies and algorithms come into play. the knowledge about the evolutionary his- A number of sophisticated computer algo- tory of the group, we would try a number of rithms are available which compare trees variations. One possible variation of the and calculate their lengths. The widely used unrooted tree would be to link 4 herbaceous ones include NONA, PAUP, and PHYLIP. species with united carpels to the woody spe- These programs determine the number of cies with united carpels, thus presenting a possible trees, and then sort out the short- single change of free to united carpels. But est of all these. If we are dealing with three this brings in further changes. Now, change species, three rooted trees are possible [A from woody habit has occurred twice, change (B, C)], [B (A, C)] and [C (A, B)] (Figure 8.19), from red to yellow petals has occurred twice, if 4 taxa are mapped the 15 trees are pos- and more significantly the number of actual sible, 5 then 105, for 10 taxa 34,459,425 trees changes (tree length) has increased to six and so on. (Figure 8.18), with same four genetic The number of possible rooted trees for n switches involved. With more descendents number of taxa can be calculated as: 242 Plant Systematics

A B A B C B A C C B A B

IIIIIIIVA

C A B C D A C B D A B C D A C B D

VI VII VIII IX

Figure 8.19 Possible number of rooted and unrooted trees. I: Single rooted tree for two taxa. II-IV: Three possible rooted trees for three taxa. V: One possible unrooted tree for three taxa. VI-IX: Some of the possible 15 rooted trees for four taxa.

Nr = (2n-3)! / [(2 n –2 ) X (n-2)! ] was not known we should expect 135135 It can also be calculated as: rooted trees and 10395 unrooted trees. The figures also highlight the enormous chal- Nr = P (2 i - 1) lenges in reconstructing the evolutionary where P represents the product of all factors history of any group. (2 i -1) from i = 1 to i = n - 1. A large number of trees generated are A simpler way to calculate the possible sorted and, ones presenting the shortest evo- number of rooted trees is as follows: lutionary path, in agreement with the principle of parsimony, are shortlisted. Nr = (2(n + 1) –5) X number of trees for (n –1) taxa Distance methods As noted above, the number of possible Distance methods were originally developed rooted trees is much more than number of for handling phenetic information and con- possible unrooted trees. Latter can be cal- struction of phenograms, some of these have culated as: now been incorporated in cladistic method- Nu = (2n - 5)! / [(2 n –3 ) X (n-3)! ] ology. Cluster analysis is the most commonly or more simply as: used method of constructing trees. Nu = number of rooted trees for (n – 1) taxa Cluster analysis Thus, for 3 taxa, 3 rooted trees and 1 Data presented in OTUs x OTUs (t x t) unrooted trees are possible (Figure 8.19), for matrix are too exhaustive to provide any 4 taxa 15 rooted trees and 3 unrooted trees meaningful picture and need to be further and for 5 taxa, 105 rooted trees are possible condensed to enable a comparison of units. but only 15 unrooted trees. For our 8 spe- Cluster analysis is one such method in cies in Figure 8.12, if evolutionary history which OTUs are arranged in the in the Developing Classifications 243 order of decreasing similarity. The earlier technique or minimum method), the can- methods of cluster analysis were cumber- didate OTU for admission to a cluster has some and involved shifting of cells with simi- similarity to that cluster equal to the similar values in the matrix so that OTUs with larity to the closest member within the clus- closely similar similarity values were ter. The connections between OTUs and clus- brought together as clusters. Today, with the ters and between two clusters are estab- advancement of computer technology, pro- lished by single links between pairs of OTUs. grams are available which can perform an This procedure frequently leads to long strag- efficient cluster analysis and help in the con- gly clusters in comparison with other SAHN struction of cluster diagrams or pheno- cluster methods. The phenogram for our data grams. The various clustering procedures using this strategy is shown in Figure 8.20. are classified under two categories. The highest similarity value in our matrix (see Table 8.2) is 96.0 between OTUs 9 Agglomerative methods and 12, and as such they are linked at that Agglomerative methods start with t clusters level. The next similarity value of 94.0 is equal to the number of OTUs. These are suc- between OTUs 10 and 12, but since 12 has cessively merged until a single cluster has already been clustered with 9, 10 will join finally been formed. The most commonly this cluster linked at 94.0. The process is used clustering method in biology is the Se- repeated till all OTUs have been agglomer- quential Agglomerative Hierarchic Non- ated into single cluster at similarity value overlapping clustering method (SAHN). The of 53.0. method is useful for achieving hierarchical In the complete linkage clustering classifications. The procedure starts with method (farthest neighbour or maximum the assumption that only those OTUs would method) the candidate OTU for admission be merged which show 100% similarity. As to a cluster has similarity to that cluster no two OTUs would show 100% similarity, equal to its similarity to the farthest mem- we start with t number of clusters. Let us ber within the cluster. This method will gen- now lower the criterion for merger as 99% erally lead to tight discrete clusters that join similarity; still no OTUs would be merged as others only with difficulty and at relatively in our example the highest similarity re- low overall similarity values. corded is 96.0%. The best logical solution In the average linkage clustering would be to pick up the highest similarity method, an average of similarity is calcu- value (here 96.0) and merge the two con- lated between a candidate OTU and a clus- cerned OTUs (here 9 and 12). By inference, ter or between two clusters. Several varia- if our criterion for merger is 96.0 we will tions of this average method are used. The have t-1 clusters. Subsequently the next unweighted pair-group method using arith- lower similarity value is picked up and the metic averages (UPGMA) computes the av- number of clusters reduced to t-2. The pro- erage similarity or dissimilarity of a candi- cedure is continued until we are left with a date OTU to a cluster, weighting each OTU single cluster at the lowest significant simi- in the cluster equally, regardless of its struc- larity value. Since at various steps of clus- tural subdivision. The method originally tering a candidate OTU for merger would developed for the procedures of numerical cluster with a group of OTUs, it is important taxonomy has been applied in phylogenetic to decide the value that would link the clus- analysis with relevant modifications, and ters horizontally in a cluster diagram. A used for the construction of trees. UPGMA number of strategies are used for the method procedure begins with as many purpose. clusters as the number of taxa. The two taxa In the commonly used single linkage with minimum distance merged to reduce clustering method (nearest neighbour the number of clusters by one. In the next 244 Plant Systematics

Figure 8.20 Cluster diagram of 15 OTUs based on similarity matrix in Table 8.2 using single linkage strategy. step average distance between new cluster now recalculated as presented in step 2 and remaining taxa are determined by tak- matrix. The lowest distance in this matrix ing the average distance between these two is 4 between D and F which are united into members and all other remaining taxa, one cluster. With this merger the distance weighting each taxon in the cluster equally between taxa/clusters is recalculated and regardless of its structural subdivision, and presented in step 3 matrix. The lowest merging the taxon with smallest distance distance 5.5 is now between clusters (AE)B to the first cluster. The process is repeated and DF, which are next united. Finally the with this new cluster of three taxa, and the distance between this enlarged cluster and procedure continues till all the taxa are C is recalculated as presented in step 4 merged, the most distant taxon joining last matrix. Finally the two clusters (((AE)B)(DF)) of all. From measure of similarity or dissimi- and C are united at distance of 6.5 to form larity of taxa (OEUs) as presented in Table final cluster ((((AE)B)(DF))C). The resulting 8.5 and 8.6, a network presenting minimum phenogram and reconstructed phylogenetic dissimilarity is constructed. Analysis of data tree constructed from the analysis are from first six taxa of table 8.4 is presented presented in Figure 8.21. in Figure 8.21. The procedure begins by unit- The distance matrix can similarly be gen- ing nearest taxa A and E (with minimum erated from single nucleotide differences distance of 2). Next matrix in now con- between homologous DNA sequences structed in which distance between (AE) and derived from different species. Six such hy- rest of the taxa is recalculated. The lowest pothetical sequences from different species value in this matrix (step 1 matrix) is be- are presented in Figure 8.22. The distance tween (AE) and E, which are next united at matrix is based on number nucleotide dif- distance level 3 into (AE)B. The distance be- ferences between different sequences. A and tween this cluster and rest of the taxa is F with lowest distance are merged, followed Developing Classifications 245

Taxa A B C D E F Taxa AE B C D F Taxa (AE)B C D F A 0 AE 0 (AE)B 0 B 3 0 B 3 0 C 6 0 C 4 7 0 C 5 7 0 D 5.5 8 0 D 7 4 8 0 D 7 4 8 0 F 5.5 6 4 0 E 2 3 6 7 0 F 6 5 6 4 0 Step 2 matrix F 5 5 6 4 7 0 Step 1 matrix Distance Matrix AEB DCF

Taxa (AE)B FD C 7 6 5 4 3 2 1 0

(AE)B 0 distance FD 5.5 0 C 6 7 0 Step 3 matrix

Taxa ((AE)B)(FD) C ((AE)B)(FD) 0 A E B D F C C 6.5 0 Taxa Phylogenetic tree Phenogram

Figure 8.21 Construction of phenogram and phylogenetic tree (cladogram) based on distance matrix concerning first six taxa in Table 8.4 using UPGMA clustering method. The taxa with minimum distance are united and treated as single cluster in next matrix, and distance values recalculated as average of distance from either of united taxa. The procedure repeated till all taxa are united. The phylogenetic tree is constructed based on sequence of clustering of taxa. by recalculation of new matrix in which A Figure 8.23 presents results of RAPD analy- and F form one cluster and value of each sis of 8 taxa, where only polymorphic bands taxon is calculated as average distance from are shown, monomorphic bands being omit- A and F. Now lowest value is shared by B and ted. The distance matrix based on similar- D which form second cluster. The values are ity matrix was processed using PHYLIP, as recalculated similarly , and successively C shown in Figure 8.24. Distance methods are joins AF cluster, and then E joins (AF)C suitable for handling both morphological and cluster. The two clusters are finally merged molecular data, or a combination of both. to enable construction of phylogenetic tree These methods use all data with usually either as phenogram or as cladogram. Some equal importance, whereas the parsimony types of genetic polymorphism data such as methods use only informative molecular RAPD are best handled when sharing of 0 data. In general for a site to be informative, code by two taxa in the matrix is ignored when handling sequence data, irrespective when both taxa lack a given polymorphic of how many sequences are aligned, it has band in gel electrophoresis. Jaccard coeffi- to have at least two different nucleotides, cient is best suited for handing such data. and each of these nucleotides has to be 246 Plant Systematics

10 20 30 40 50 A GCCAACGTCG ATGCCACGTT GTTTAGCACC GGTTCTTGTC CGATCACAGA TGT B GCCAACAATG ATACCACGCC GTCCAGCACC GATTCTCGTC CGAGTACCGA TGT C GGTAACGTCA ATGGGACGTT GTCCAGCACC GGTTCATGTC CAAGCAGAGA TGT D GCCAACATTG ATACCACGCC GTTTAGCTGC GACACTCGTC CGATCACCAA TGT E GCTAACGACA ATACCAGGCT GTCCAGCTCC GGTTTACGTC CGAGCACAGA TGT F GCCAACATCG ATGGGACGTT GTTTAGCTCC GATTCATGTC CAATCACCAA TGT

Taxa ABCDEFTaxa AF B C D ETaxaAFBD C E A 0 AF 0 AF 0 B 13 0 B 14.5 0 BD 13.5 0 C 11 17 0 C 11.5 17 0 D 13 10 24 0 C 11.5 20.5 0 D 12.5 10 24 0 E 13 12 12 18 0 E 15.5 15 12 0 E 15.5 12 12 18 0 F 9 16 12 12 18 0 Matrix step 2 Distance matrix Matrix step 1 A F C E B D Taxa (AF)CBD E A F C E B D (AF)C 0 0 BD 16.75 0 E 13.5 15 0 5 Matrix step 3 10

Taxa ((AF)C)E BD 15 ((AF)C)E 0 20 BD 15.875 0 Phenogram Cladogram Final Matrix ((((A,F:9),C:11.5),E:13.5),:15.875 (B,D:10));

Figure 8.22 Construction of phylogenetic tree based on single nucleotide differences in hypothetical DNA sequences of six species. Distance matrix is constructed based on the number of nucleotide differences between each pair of DNA sequences and presented in distance matrix. Further analysis proceeds as detailed in Figure 8.21, and also in the text on these pages. present at least twice. Thus in the sequence lution occurring in different lineages. Some data presented in Figure 8.22, out of 28 sites distance methods such as transformed dis- showing nucleotide differences in six se- tance method and neighbour-joining quences, there are only 12 informative sites method, although more complex are capable which can be used in parsimony analysis. of incorporating different rates of evolution Procedures based on UPGMA method, how- within the lineages. ever, don’t account for different rates of evo- Developing Classifications 247

R A B C D E F G H A B C D E F G H 1 011 11010 2 1 2 01101110 3 3 10110101 4 4 01010110 5 5 10101011 11101010 6 6 01110110 7 7 10011101 8 8 9 9 01001011 10 10110111 10 11 00000101 11 12 10101011 12 13 11111100 13 II I 1 2 3 4 5 6 7 8 9 10 11 12 13 A B C D E F G H

A 0101 1 0 0 1 1 0111 A 1.0 B 011 1 1 1 1 0 1 101 0 B 1.00.46 C 1110 0 0 1 1 0 1011 C 1.00.300.33 1.00.250.450.36 D 0010 1 1 0 1 1 1100 D 1.00.160.660.330.36 E 1101 0 0 1 1 0 1001 E 1.00.360.500.450.540.33 F 0110 1 1 1 0 0 1101 F 1.00.360.400.400.360.600.15 G 1011 0 1 1 0 1 1000 G 1.00.250.600.500.420.330.420.60 H 0101 1 1 0 1 0 1101 H III IV Figure 8.23 Phylogenetic analysis of data concerning polymorphic bands from gel electrophoresis from DNA of 8 taxa. I: Polymorphic bands of DNA from 8 taxa (A-H), R representing reference bands; II: Binary coded matrix of the polymorphic bands; III: The same matrix presented in conventional format; IV: Lower triangular matrix of similarity matrix using Jaccard coefficient, wherein sharing of 0 state (absence of bands) is ignored. Further handling of data using UPGMA program of PHYLIP is presented in Figure 8.24.

Divisive methods tion analysis (William, Lambert and Lance, Divisive methods as opposed to agglo- 1966). The method has been mostly used in merative methods, start with all t OTUs as ecological data employing two state charac- a single set, subdividing this into one or ters. It builds a dendrogram from the top more subsets; this is continued until downwards as opposed to cluster analysis, further subdivision is not necessary. The which builds a diagram from the bottom up. commonly used divisive method is associa- The first step in the analysis involves 248 Plant Systematics

8 Taxona 0.00 0.54 0.67 0.64 0.64 0.67 0.85 0.40 Taxonb 0.54 0.00 0.70 0.55 0.67 0.46 0.40 0.58 Taxonc 0.67 0.70 0.00 0.75 0.34 0.55 0.64 0.67 Taxond 0.64 0.55 0.75 0.00 0.84 0.50 0.60 0.58 I Taxone 0.64 0.67 0.34 0.84 0.00 0.64 0.60 0.50 Taxonf 0.67 0.46 0.55 0.50 0.64 0.00 0.64 0.40 Taxong 0.85 0.40 0.64 0.60 0.60 0.64 0.00 0.75 Taxonh 0.40 0.58 0.67 0.58 0.50 0.40 0.75 0.00 (((Taxona:0.20000,Taxonh:0.20000):0.11000,(Taxonc:0.17000, Taxone:0.17000):0.14000):0.01500,((Taxonb:0.20000,Taxong:0.20000):0.08125, II (Taxond:0.25000,Taxonf:0.25000):0.03125):0.04375);

III IV

Figure 8.24 Construction of phylogenetic tree based on polymorphic bands from gel electrophoresis from DNA of 8 taxa using UPGMA program of PHYLIP; I: Square distance generated from Figure 8.23-IV, each value calculated 1-similarity value. II: Outtree file generated by UPGMA option of NEIGHBOUR program; III: Upright square tree (Phenogram) plotted through DRAWGRAM program; IV: Cladogram, but with branch lengths omitted. calculating chi square value between every For each character the sum of chi-square is pair of characters using the formula: computed and the character showing maximum chi square value is chosen as the first 2 2 n(ad – bc) differentiating character. The whole set of X = hi [(a + b)(a + c)(b + d)(c + d)] OTUs is divided into two clusters, one containing the OTUs which show the charac- where i stand for the character being com- ter-state a and another containing OTUs pared and h for any character other than i. which show the character-state b. Within Developing Classifications 249 each cluster, again, the character with the culated similarity values as 100 minus simi- next value of the sum of chi square is se- larity (if similarity values are in percent- lected and the cluster subdivided into two age) or 1 minus similarity (if similarity val- clusters as before. The process is repeated ues range between 0 to 1). A dissimilarity till further subdivision is not significant. matrix based on Table 8.2 is presented in Table 8.3. Hierarchical classifications The first step in the ordination starts with The phenogram constructed using any tech- construction of the x-axis (horizontal axis). nique or strategy can be used for attempt- In the commonly used method of polar ordi- ing hierarchical classification, by deciding nation, the two most distant OTUs are se- about certain threshold levels for different lected as the end points (A and B) on x-axis. ranks. One may tentatively decide 85 per In our example, these are OTU 8 and 7 with cent similarity as the threshold for the spe- a distance (dissimilarity value) of 75. The cies, 65 for genera and 45 for families and position of all other OTUs on this axis can recognize these ranks on the basis of num- be plotted one by one. OTU 10 has a distance ber of clusters established at that thresh- of 64 from A (OTU 8) and a distance of 23 old. Whereas such an assumption can help from B (OTU 7). A compass with a radius of in hierarchical classification, the point of 64 units is swung from A and a compass with conflict would always be the threshold level a radius of 23 units is swung from B, form- for a particular rank. Some may argue—and ing two arcs. A line joining the intersection are justified in doing so—to suggest 80 per of two arcs forms a perpendicular on the x- cent (or any other value) as the threshold axis, and the point at which the line crosses for species. It is more common, therefore, the x-axis is the position of the OTU. The to use terms 85 per cent phenon line, 65 distance between the x-axis and the point of per cent phenon line, and 45 per cent intersection of arcs is the poorness of fit of phenon lines. These terms may conve- the concerned OTU. The location of OTU on niently be used till such time that sufficient the axis from the left (point A) can also be data are available to assign them formal taxo- calculated directly instead of plotting: nomic ranks to the various phenon lines. LAC–BC222+ dd The results of cluster analysis are com- x = monly presented as dendrograms known as 2L phenograms. They can also be presented as where x is the distance from the left end, L contour diagrams (Figure 8.25), originally is the dissimilarity value between A and B developed under the name Wroclaw dia- (length of x-axis), dAC is dissimilarity be- gram by Polish phytosociologists. The con- tween A and the OTU under consideration tour diagram may also incorporate the and dBC as the dissimilarity between B and levels at which clustering has taken place. the OTU under consideration. The poorness of fit (e) of this OTU can be calculated as: Ordination Ordination is a technique which determines ed= AC22 – x the placement of OTUs in two-dimensional or three-dimensional space. The results of After the position of all OTUs has been de- two-dimensional ordination are conve- termined and the poorness of fit calculated, niently represented with the help of a scat- a second axis (vertical axis or y-axis) has to ter diagram and those of three-dimensional be calculated. For this, the OTU with the ordination with the help of a three-dimen- highest poorness of fit (most poorly fitted to sional model. The procedure works on dis- x-axis) is selected and this forms the first tance values calculated directly from the reference OTU of y-axis. The second refer- coded data or indirectly from the already cal- ence OTU is selected as that one with the 250 Plant Systematics

Figure 8.25 Contour diagram based on the phenogram shown alongside. highest dissimilarity to the first reference constructing a scatter diagram or a three- OTU of y-axis, but within 10 per cent (of the dimensional model. length of x-axis) distance on x-axis. The po- A commonly used ordination technique sition of all other OTUs on the y-axis and known as principal component analysis also their poorness of fit is determined as ear- calculates values for a two-dimensional scat- lier. By using the values of poorness of fit to ter diagram. In this method, however, the val- y-axis, a z-axis can be similarly generated ues on the horizontal as well as the vertical and the position of all OTUs on z-axis deter- axis are non-zero, ranging from -1 to 1 (calcu- mined similarly. The values can be used for lated as eigenvalues) and as such the Developing Classifications 251 scatter diagram is presented along four axes: positive horizontal, negative horizontal, positive vertical and negative vertical (Fig 8.26). The technique is based on the assumption that if a straight line represented a single character, all the OTUs could be placed along the line according to their value for that character. If two characters were used, a two-dimensional graph would suffice to locate all OTUs. With n characters, n-dimensional space is required to locate all OTUs as points in space. Principal component analysis determines the line through the cloud of points that accounts for the greatest amount of variation. This is the first principal component axis. A second axis, produced perpendicular to the Figure 8.26 Plot of the results of the princi- first, accounts for the next greatest amount pal component analysis of 18 of variation. The procedure ultimately pro- hypothetical taxa. duces axes one less than the number of OTUs. The first two axes are generally plot- likelihood is selected. The method is espe- ted to produce a scatter diagram. The proce- cially suited to molecular data, where the dure also calculates eigenvectors, which probability of genetic changes can be mod- indicate the importance of a character to a eled more easily. With this approach, the particular axis. The larger the eigenvector probabilities are considered for every indi- in absolute value, the more important is vidual nucleotide substitution in a set of that particular character. sequence alignments. It is commonly un- A related method of ordination is princi- derstood that transitions occur three times pal co-ordinate analysis developed by Gower more frequently as compared to (1966). This technique enables computation transversions. Thus if C, T, and A occur in of principal components of any Euclidean one column (representing one site), the se- distance matrix without being in possession quences with C and T (pyrimidines) are more of original data matrix. The method is also likely to be closely related than sequence applicable to non-Euclidean distance and as- with A (Purine). Using objective criteria sociation coefficients as long as the matrix probability for each site and every possible has no large negative eigenvalues. Princi- tree that describes the relationship of sepal co-ordinate analysis also seems to be less quences. The tree with highest aggregate disturbed by NC entries than principal com- probability is selected as representation of ponents. a true phylogenetic tree. Using any one of the methods, a large Maximum Likelihood method dataset commonly used, and which includes The method is similar to distant method in many homoplasies, large number of short- that all data is taken into consideration. In est trees may be generated by these auto- this method, similarly character-state trans- mated algorithms. These short listed trees formations are compared, and the probabil- have to be further compared. ity of changes determined. These probabilities are used to calculate the likelihood that The Consensus Tree a given tree would lead to the particular data The use of automated methods based on par- set observed, and the tree with maximum simony, even after applying relevant strate- 252 Plant Systematics gies yield several trees, all presenting short- Majority-rule consensus tree est pathways, based on parsimony but with Majority-rule consensus tree shows all the different linkages among the taxa (OEUs), groups which appear in a majority of trees, and often presenting different evolutionary say, more than 50 per cent of the trees. It is history. Molecular studies of Clusiaceae by useful to indicate for each group on the con- Gustafsson et al., (2002) for example, includ- sensus tree the percentage number of the ing 1409 nucleotides of chloroplast gene rbcL most parsimonious trees in which the group positions using PAUP*4.0b8a parsimony appeared. Such a consensus tree, however, analysis method, yielded 8473 most parsi- provides a partial summary of the phyloge- monious trees for the 26 species compared. netic analyses, and may be inconsistent with Interestingly, the number of trees generated was so large that search for trees 3 steps the trees from which it is derived. longer than most parsimonious trees was aborted. More significantly different data Semi-strict consensus tree sets (molecular, morphology) may yield dif- A semi-strict consensus tree is useful when ferent trees. While selecting the consensus comparing trees from different data sets, or tree, the commonest approach is to identify with different terminal taxa. The consensus the groups, which are found in all the short tree developed indicates all the relationships listed trees, and build a consensus tree. This supported by both type of trees or any one of could be achieved in different ways. these, but not contradicted by any. Thus, in Figure 8.27, tree II does not give us any in- Strict consensus tree formation about the time of origin of E, F and G, the tree I indicates that they originated A more conservative approach in building a successively. Similarly, tree I does not indi- consensus tree involves including only cate any close relationship between C and monophyletic groups that are common to all D, whereas the tree II does. The semi-strict the trees. The tree developed this way is consensus tree IV as such presents such in- known as strict consensus tree. Consider formation, not contradicted by either tree. the two most parsimonious trees (although there could often be numerous trees of same shortest length available for comparison) as Evaluating consensus tree shown in Figure 8.27-I and 8.27-II. Developing a consensus tree involves the Imagine that all groups A to J are mono- use of intuition, making guesses and devel- phyletic. Tree I shows that A and B are very oping hypothesis. A number of evaluation closely related, and so are H and I. C, D, E, strategies are used to test the soundness of and F are shown arising successively and the tree and measuring support for either are related in that sequence. Tree II shows the tree as a whole or for its individual a similar relationship between H and I, and branches. These values are generally pub- between A and B (but group J is shown re- lished along with the tree, to allow the fair lated to these two). The tree also shows that assessment of the final results for compari- C and D are closely related. As relationships son of trees based on different datasets. between E, F, and G are ambiguous, they are shown arising from the same point in evo- Consistency Index lutionary history. The consensus tree III The principle of Parsimony is based on a ba- would thus omit taxon J (which is absent sic rule of science known as Ockham’s ra- from tree I), show A and B, as also H and I as zor, which says ‘do not generate a hypoth- in the two trees I and II. The other taxa C, esis any more complex than is demanded D, E, F, and G are shown arising from the by the data’. Some information in the data same point. may be representing homoplasy (reversals, Developing Classifications 253

A B C D E F G H I A B J C D E F G H I

I II

A B C D E F G H I A B C D E F G H I

III IV

Figure 8.27 Two most parsimonious trees for a particular group of organisms, with monophyletic taxa A to J. I: showing C, D, E and F arising successively. II: E, F, G are shown arising at the same time from a common point, C and D being closely related. III: Strict consensus tree of trees I and II. IV: Semi-strict consensus tree of trees I and II. parallelisms). Dollo parsimony (as indicated changes. In the tree shown in Figure 8.13B, above) minimizes the use of homoplasious there are three character-state changes, characters. The commonest measure of ho- each involving one switch, and, as such, the moplasy is the Consistency Index (CI), consistency index would measure 3/3 = 1. which is calculated by dividing the number The tree shown in Figure 8.17C has five of genetic switches by actual genetic actual character-state changes (tree length changes on the tree. is 5), but it involves only four genetic switches. As carpel fusion has occurred Consistency Index CI = Min /L twice, the consistency index would accordingly be 4/5 = 0.8. In the tree shown in Min stands for the minimum possible tree Figure 8.18, the number of genetic switches length or genetic switches, and L for the ac- remains the same as four but the tree tual tree length or actual number of genetic length has increased to six due to two 254 Plant Systematics parallel (or convergent) evolutions; the CI changes in the character with actual num- would be calculated as 4/6 = 0.66. ber of changes in the character. RI is com- Consistency Index may also be calculated puted by first calculating the maximum pos- for individual characters. In Figure 8.13B as sible tree length, if the apomorphic charac- such CI for all characters is one, while in ter-state originated independently in every 8.17-C, it is 0.5 for carpel fusion (minimum taxon that it appears in, or say, the taxa are number of changes possible—one for binary unrelated for the said character-state. The character divided by actual number of value of RI is calculated as: changes—here 2 since the character has changed twice) and 1 for rest. In Figure 8.18, Retention Index RI = (Max – L)/(Max – Min) CI is 0.5 for habit and petal colour, and 1 for stamen number and carpel fusion. The char- Max stands for the maximum tree length acters that lower the CI of a tree (or which possible, L the actual tree length and Min have lower CI) are considered to be the minimum tree length possible. The tree homoplasious. The inclusion of a larger in Figure 8.17-C thus has a maximum pos- number of homoplasious characters in the sible tree length of 9 (minimum length of 4 analysis lowers CI for the tree and contra- and actual length of 5 as we already know) dicts phylogeny. There may also be a char- and the RI would be (9-5)/(9-4) = 0.8. Higher acter, which changes only in one (or a very the RI, sounder is the tree. few) species, and may be of no relevance in others. Suppose one species develops spiny Bremer Support (Decay Index) fruits. The length or number of spines would The principle of parsimony, followed in phy- not be of any relevance in rest of the spe- logenetic analyses, aims at selecting the cies without spines. Such a situation (a shortest tree. Some parts of the tree may single species having a particular charac- beore reliable than others. This is commonly ter) is known as autapomorphy. Since such evaluated by comparing the shortest tree a character has changed only once, it gives with those one or more steps longer. Decay CI of 1, and as such the inclusion of many index or Bremer Support is the measure of such characters would increase the consistency index of the tree, and provide false how many extra steps are needed before the support. Such uninformative characters are original clade (group) is not retained. Thus as such omitted before calculating CI. if an internode has decay index of 3, then The Consistency index values are often the clade (monophyletic group) arising from dependent on the number of taxa analyzed. it is maintained even in the cladogram 3 Any increase in number of taxa lowers CI steps longer than the shortest tree (see Fig- values, and this is true for data from differ- ure 8.29). Certain branches of the tree which ent sources, morphological or molecular. appear in the shortest tree, but disappear, or ‘collapse’ in the tree one step longer, are Retention Index not drawn in the strict consensus tree. Although theoretically the value of CI could Greater the decay index value, more robust range between 0 and 1, it rarely goes below is that internode of the cladogram. 0.5. For a character that, has changed five Branches of the tree may also be tested times on a tree (this is a remote possibil- by comparing the number of genetic changes ity), CI will be 0.2. More so, the value of CI leading up to a particular group, and the for a tree, very rarely may go below 0.5, and CI of individual characters involved. Doyle the values thus range between 0.5 and 1. et al., (1994) on the basis of morphological The Retention Index (RI) corrects this nar- data, developed a tree having 18 character row range of CI by comparing maximum (and changes leading to angiosperms. Of these not minimum as in CI) possible number of 18 characters 11 had CI of 1, thus Developing Classifications 255 supporting the view that angiosperms form volves sampling fewer than the full number a unique group of plants. of characters. The user is asked for the fraction of characters to be sampled. Block- Bootstrap Analysis bootstrapping is useful for handling corre- Any realistic analysis requires that the data lated characters. When this is thought to used is randomized. Many techniques are have occurred, we can correct for it by sam- available for randomizing the data. Bootstrap pling, not individual characters, but blocks analysis is the commonly used method de- of adjacent characters. Block bootstrap and veloped by Bradley Efron (1979). Its use in was introduced by Künsch (1989). If the cor- phylogeny estimation was introduced by relations are believed to extend over some Felsenstein (1985). Matrix in the Figure number of characters, you choose a block 8.28-A contains information on the basis of size, B, that is larger than this, and choose which the unrooted tree in Figure 8.17-C is N/B blocks of size B. In its implementation constructed. Without touching the rows, any here the block bootstrap “wraps around” at column is chosen at random to become the the end of the characters (so that if a block first column; similarly any other as second starts in the last B-1 characters, it contin- and the process is repeated till the number ues by wrapping around to the first charac- of columns in the new matrix is the same as ter after it reaches the last character). Note in the original matrix. As the columns are also that if you have a DNA sequence data picked up from the original matrix, the new set of an exon of a coding region, you can matrix may contain some characters repre- ensure that equal numbers of first, second, sented several times (the same column may and third coding positions are sampled by have been picked up at random more than using the block bootstrap with B = 3. Partial once), while others may have been omitted block-bootstrapping is similar to partial (the columns were not picked up at all). The bootstrapping except sampling blocks rather method is known as random sampling with than single characters. replacement. The resultant matrix B shows Jackknife analysis (Jackknifing) is that character carpel fusion was picked up similar to bootstrap analysis but differs in twice, whereas the random selection process that each randomly selected character may missed the stamen number. be resampled only once, and not multiple Repeating the method of random selection, times, and the resultant resampled data multiple such matrices (usually more than matrix is smaller than the original. Delete- 100) are constructed, and for each matrix half-jackknifing involves sampling a ran- the most parsimonious tree/trees found. dom half of the characters, and including The consensus tree is developed from these them in the data but dropping the others. most parsimonious trees. In this consensus The resulting data sets are half the size of tree, the percentage number of trees (gen- the original, and no characters are dupli- erated by bootstrap analysis) that contain cated. The random variation from doing this that clade is indicated as bootstrap support should be very similar to that obtained from value of that clade. Bootstrap analysis based the bootstrap. The method is advocated by on the assumption that differential weight- Wu (1986). Delete-fraction jackknifing was ing by resampling of the original data will advocated by Farris et. al. (1996) and involves tend to produce same clades if the data are deleting a fraction 1/e (1/2.71828). This good, and reflect actual phylogeny and very retains too many characters and will lead to little of homoplasy. A bootstrap value of 70 overconfidence in the resulting groups when per cent or more is generally considered as there are conflicting characters. This and good support to the clade. the preceding options form a part of the Several variations of bootstrap analysis SEQBOOT program of Phylip software, and are available. The partial bootstrapping in- the user is asked to supply the fraction of 256 Plant Systematics Stamens Carpels Carpels Carpels eals Peta Petals ABHabit Habit

Herbaceous United > 2 Yellow Yellow United Herbaceous United Plants Plants

Herbaceous Free > 2 Yellow Yellow Free Herbaceous Free Plants Plants

Herbaceous Free > 2 Red Red Free Herbaceous Free Plants Plants

Woody Free > 2 Red Red Free Woody Free Plants Plants

Woody United > 2 Red Red United Woody United Plants Plants

Woody United 2 Red Red United Woody United Plants Plants

Figure 8.28 A: Matrix based on the tree 9:16A. B: One possible matrix after procedure of random sampling with replacement.

characters that are to be retained. The pro- fore. It shuffles the character order sepa- gram also offers permuting method, with rately for each species. following alternatives. Permuting species It is a common practice, and conse- within characters involves permuting the quently more informative, to indicate the columns of the data matrix separately. This branch length (number of steps needed to produces data matrices that have the same reach that clade), bootstrap or jackknife sup- number and kinds of characters but no taxo- port and Bremer support (decay index) for nomic structure. It is used for different pur- each clade in the consensus tree (Figure poses than the bootstrap, as it tests not the 8.29). variation around an estimated tree but the hypothesis that there is no taxonomic struc- Effect of Different Outgroups ture in the data: if a statistic such as num- An important component of procedures gen- ber of steps is significantly smaller in the erating rooted trees is the incorporation of actual data than it is in replicates that are an outgroup in the analysis. In morphologi- permuted, then we can argue that there is cal data, the outgroup choice can influence some taxonomic structure in the data phylogenetic inference. In molecular data, (though perhaps it might be just the pres- one specific concern is the levels of se- ence of a pair of sibling species). Permuting quence divergence between outgroups and characters simply permutes the order of the ingroups and the subsequent possibility of characters, the same reordering being ap- spurious long-branch attraction (Albert et al., plied to all species. It is included as a pos- 1994). The robustness of tree can be tested sible step in carrying out a permutation test by using randomly-generated outgroup se- of homogeneity of characters (such as the quences, excluding all outgroups, and using Incongruence Length Difference test). Per- outgroups selectively. Sytsma and Baum muting characters separately for each spe- (1996), investigating the molecular phylog- cies permute data so as to destroy all phylo- enies of angiosperms, found that removal of genetic structure, while keeping the base all outgroups generated 27 shortest unrooted composition of each species the same as be- trees. Using Ginkgo only as outgroup yielded Developing Classifications 257

Ranunculus repens

Aquilegia formosa

Piper amalago

-G +1 80 * Piper marginata 60 Peperomia metallica +4 90 Saururus cernuus +2 Gymnotheca chinensis 81 +1 -A 22 +3 Houttuynia cordata 29** 94 Anemopsis californica

Acorus calamus >5 -G 96 Lilium tigrinum 28** +1 76 Scilla violacea

Cabomba caroliniana 28 -G Lactoris fernadeziana 16 *** Saruma henryii

Chloranthus spicatus +3 Magnolia denudata 53 +1 74 Illicium floridanum

Figure 8.29 Tree developed from the study of 16 species of paleoherbs and 2 outgroup taxa, using 58 morphological and ontogenetic characters. The cladogram requires 214 steps and has CI = 0.51 and RI = 0.65. Bootstrap values are underlined and indicated below a branch. Decay Index is indicated above the branch. Ranunculus repens and Aquilegia formosa were chosen as outgroup taxa. (Drawn from Tucker and Douglas, 1996). 258 Plant Systematics lineages identical with baseline study (which These programs are basically similar to included all outgroups); when only conifers those designed for development of were used as outgroup, the consensus tree phenograms, but differing essentially in the was less resolved and many nodes collapsed. requirement to select one taxon for rooting Use of Gnetales us outgroup increased the in most programs. PHYLIP (Phylogeny In- number of steps needed to yield baseline to- ference package), is a commonly used set of pologies, and interestingly, Ceratophyllum is programs for inferring phylogenies (evolu- shown as sister to all angiosperms except tionary trees) by parsimony, compatibility, eudicots. distance matrix methods, and likelihood. It can also compute consensus trees, compute Effect of Lineage Removal distances between trees, draw trees, Lineage removal strategy highlights the resample data sets by bootstrapping or problems of lineage extinction, which often jacknifing, edit trees, and compute distance leads to a particular group (especially criti- matrices. It can handle data that are nucle- cal in angiosperms where fossil record is otide sequences, protein sequences, gene meager) not being sampled in analysis, thus frequencies, restriction sites, restriction giving distorted phylogenies. The same may fragments, distances, discrete characters, also be true for extant taxa, for which very and continuous characters. Distance matrix little data is available. The removal of all ma- can be generated using programs such as jor lineages, one at a time (Sytsma and DNADIST (which handles nucleotide se- Baum, 1994), provided useful information. quence data; it gives you choice to set The removal of Ceratophyllum, paleoherbs IIb weightage for transversions/transitions), (Chloranthaceae, and Magnoliales) had no PRODIST (which works with protein se- effect on the remaining angiosperm topol- quences) and RESTDIST (which works with ogy, whereas the removal of paleoherbs I restriction site data). The most commonly (Aristolochiales and Illiciales), Laurales and used programs of PHYLIP for handling dis- eudicots showed substantial changes. tance matrix data include FITCH, KITSCH, and NEIGHBOR These deal with data which Effect of Exemplars comes in the form of a matrix of pairwise NEIGH- The large computational load in handling a distances between all pairs of taxa BOR UPGMA large data is often reduced by using place- offers option in which no taxon holders or exemplars. These are often used needs to be selected for rooting, whereas to represent large lineages. The use of ex- neighbor-joining option of this program, as emplars can warn about the possible arti- well as FITCH and KITSCH need one taxon facts when sparsely-sampled lineages ap- to be selected for rooting, otherwise by de- pear in basal positions. In such cases, more fault first taxon is used for rooting. The taxa can be added to the data set for further outtree generated by these programs can be DRAWGRAM DRAWTREE analyses. But in the case of basal clade plotted using or , where a large number of taxa are extinct, latter plotting only unrooted trees. the results could be ambiguous. The results DRAWGRAM provides a variety of options to from angiosperms have shown that clades choose from. The trees can be drawn hori- shift around with ease when the number of zontal or vertical, branches square taxa sampled for each lineage is reduced, (phenogram), v-shaped (cladogram), curved and the use of exemplars at times could give or circular. The branch lengths may be depicted (phylogram) on the tree. The DNA se- misleading results. quence data presented in Figure 8.22 was analysed using PHYLIP programs. Outputs Automated Trees are presented in Figure 8.30. DNA sequence A number sophisticated computer programs data can also be handled by DNAPARS pro- are available to construct phylogenetic trees. gram which performs Parsimony analysis Developing Classifications 259

6 53 Taxona GCCAACGTCG ATGCCACGTT GTTTAGCACC GGTTCTTGTC CGATCACAGA TGT Taxonb GCCAACAATG ATACCACGCC GTCCAGCACC GATTCTCGTC CGAGTACCGA TGT Taxonc GGTAACGTCA ATGGGACGTT GTCCAGCACC GGTTCATGTC CAAGCAGAGA TGT I Taxond GCCAACATTG ATACCACGCC GTTTAGCTGC GACACTCGTC CGATCACCAA TGT Taxone GCTAACGACA ATACCAGGCT GTCCAGCTCC GGTTTACGTC CGAGCACAGA TGT Taxonf GCCAACATCG ATGGGACGTT GTTTAGCTCC GATTCATGTC CAATCACCAA TGT 6 Taxona 0.000000 0.297888 0.253844 0.301576 0.306645 0.199728 Taxonb 0.297888 0.000000 0.470560 0.229212 0.276609 0.401604 ((((Taxona:0.09986,Taxonf:0.09986):0.03265,Taxonc:0.13251):0.04302, Taxonc 0.253844 0.470560 0.000000 0.736034 0.286112 0.276199 Taxone:0.17553):0.02684,(Taxonb:0.11461,Taxond:0.11461):0.08776); Taxond 0.301576 0.229212 0.736034 0.000000 0.475079 0.278527 III II Taxone 0.306645 0.276609 0.286112 0.475079 0.000000 0.460436 Taxonf 0.199728 0.401604 0.276199 0.278527 0.460436 0.000000 IV Taxono GGCAACGACG ATACCACGTT GTTTAGCTCC GGTTCTCGTC CCAGCAGCCA TGT

Figure 8.30 Analysis of the DNA sequence data presented in Figure 8.22 using PHYLIP. I: Infile, first line indicating number of taxa and number of nucleotides in each sequence; II: Square distance matrix (outfile) generated by DNADIST program; III: Outtree file generated by NEIGHBOR program using UPGMA option; IV: DNA sequence of the 7th hypothetical taxon (taxono) used for rooting; V-VI: Square tree (Phenogram) and V-shaped tree (cladogram); VII: Unrooted tree of same; VIII-XVI: Diagrams based on 7-taxa sequences; VIII: Phenogram, UPGMA option; IX-XI: Phylogram, Phenogram and Cladogram based on neighbour-joining option of NEIGHBOR; XII: Phenogram based on DNAML program; XIII: Phenogram based on FITCH program; XIV: Phenogram based on KITSCH program; XV: Tree (Phenogram) generated based on DNAPARS program; XVI: Majority-rule consensus tree based on CONSENSE program, using outtree files of above six programs. (All trees except VII (plotted using DRAWTREE) plotted using different options of DRAWGRAM program). 260 Plant Systematics

15 9 Taxon1 101001111 Taxon2 101011001 Taxon3 010000111 Taxon4 111010000 Taxon5 101101101 Taxon6 110011010 Taxon7 011011001 Taxon8 000000111 Taxon9 111001100 BC Taxon10 000010111 Taxon11 101101001 Taxon12 110011001 Taxon13 001010101 Taxon14 101010101 Taxon15 000000000

Figure 8.31 Construction of trees using MIX program of PHYLIP based on matrix in the Table 8.4. A: Input file with fourth character converted into binary (simple and compound leaves) character. Out of the 34 parsimonious trees generated by Mix, Consensus tree generated by CONSENSE program presented as Phenogram (B), Cladogram (C) and Phylogram (D). and selects the best tree. It gives you choice allows the user to choose an initial tree, and to select the number of trees to be saved, displays this tree on the screen. The user 10000 being the default. The program di- can look at different sites and the way the rectly yields the outtree file. PROTPARS, nucleotide states are distributed on that similarly performs Parsimony analysis of tree, given the most parsimonious recon- Protein sequences. The protein sequences struction of state changes for that particu- are given by the one-letter code used by the lar tree. The user then can specify how the late Margaret Dayhoff’s group in the Atlas of tree is to be rearranged, rerooted or written Protein Sequences, and consistent with the out to a file. By looking at different rearrange- IUB standard abbreviations. DNAMOVE ments of the tree the user can manually which handles data similar to DNAPARS, search for the most parsimonious tree, and Developing Classifications 261 can get a feel for how different sites are af- quencies contains number of species (or fected by changes in the tree topology. populations) and number of loci , where as DNAML program carries out analysis of DNA the second line contains number of alleles sequences using Maximum Likelihood for each locus. the default number of data Method. The program uses both informative for each species (A-all) contains one allele and non-informative sites and yields the less for each locus. thus for three loci with outtree file directly. RESTML similarly 2, 3 and 2 alleles respectively there would handles restriction site data using maxi- be four values. Without A option, there mum likelihood method. Binary data coded should be 7 values. The values in dataset as 0 (ancestral state) and 1 (advanced state) are preceded and followed by blanks. The data is handled by MIX, which performs parsimony from continuous characters does not contain analysis and generates outtree which can the second line, the data would include num- be plotted using DRAWGRAM. Input data ber of species and the number of characters from Table 8.4 and most parsimonious tree in the first line (only line above species generated using MIX program is presented data). in Figure 8.31. For this analysis fourth PHYLIP also offers programs to yield con- multistate character was converted into bi- sensus tree (CONSENSE), Bootstrapping nary character (simple and compound (SEQBOOT) and a host of related programs. leaves). Using Wagner parsimony the pro- The following information may be useful in gram was able to generate 34 trees. Taxon handling DNA sequence data. 15 was used for rooting. CONSENSE program Prepare infile of DNA sequences in which was used to select the majority rule consen- taxon name takes 10 characters followed by sus tree. MOVE handles binary data and is sequences in groups of 10 (separated by a an interactive program which allows the space), last three nucleotides being termi- user to choose an initial tree, and displays nating codon. First taxon should be one in- this tree on the screen. The user can look tended as one used for rooting. Number of at different characters and the way their taxa (sequences used) and number of nucle- states are distributed on that tree, given the otides in each sequence forms first line of most parsimonious reconstruction of state file. Longer sequences can be interleaved changes for that particular tree. The user (giving first part of sequences of all taxa and then can specify how the tree is to be then next part of all taxa) or aligned (finish- rearraranged, rerooted or written out to a ing one sequence and then going to second). file. By looking at different rearrangements Save this file in text format in notepad (ANSI of the tree the user can manually search code should be used; is default in notepad). for the most parsimonious tree, and can get Distance matrix can be prepared using a feel for how different characters are af- dnadist.exe program. When program asks for fected by changes in the tree topology. infile, type above file name along with .txt Multistate data can similarly be handled ending. Choose the ratio of transitions and by PARS, and can be converted into binary transversions, so that program can handle data by FACTOR program. Data from Gene it accordingly. You can also choose distance frequencies and continuous characters is model such as F84, Kimura, Jukes-Cantor handled by CONTML (constructs maximum and Logdet. Give name of your output file likelihood estimates of the phylogeny; (preferably in txt format so that you can open handles both types of data), GENDIST (com- and see it in notepad). The file can be saved putes genetic distances for use in the dis- as square matrix or only lower triangle. The tance matrix programs; handles data from above file can be used for generating clus- gene frequencies) and CONTRAST (exam- ters through Fitch, Kitsch, and Neighbor pro- ines correlation of traits as they evolve along grams. Each program searches for the short- a given phylogeny; handles continuous char- est tree. When program asks for infile, type acters data). The data matrix for gene fre- the name of above output file. Give name of 262 Plant Systematics

A B C D E F G H I A B C D E F G H I

m n n m

o o

p I p II

Figure 8.32 Attempts towards construction of monophyletic groups. I: Strict consensus tree as presented in the Figure 8.27-III. With poorly resolved phylogenies, the separation of H and I in a group distinct and of the same rank as group CDEFG would create a paraphyly, as HI are left out of the descendents of common ancestor o. II: A consensus tree (hypothetical) with better resolved phylogenies. Both groups CDEFG and HI are monophyletic and, in turn could be assembled into more inclusive group with common ancestor at level o, now containing all descendents of the common ancestor. This group (CDEFG, HI) and AB (also monophyletic) could be assembled into one most inclusive monophyletic group, containing all descendents of the common ancestor at p. output file (of this program) or simply ask for paint file to save as image file in Paint. You replacement if program reports that file is can change options by clicking File->change already present. Neighbour provides a choice parameters in tree preview and go back to between Neighbour-joining (in which one drawgram to generate other types of trees. taxon is to be chosen for rooting) and UPGMA Binary data can similarly be input in infile (in which no taxon for rooting has be se- with just replacing nucleotide alphabets with lected). After selection of choice press Y. Pro- binary 0 and 1 data as presented in Table gram will generate outtree file, if already 8.31 and handled by various programs men- present replace it. You can read this file if tioned earlier. saved in txt format. The above outtree file can be used for plotting trees using DRAWGRAM or DRAWTREE programs. Draw Gene Trees and Species Trees program asks for intree file. Type in the Traditional the phylogenetically trees are name of above outtree file. It will next ask constructed using data from multiple char- for name of font file. Type font1 or any other acters, and if genetic data is used, from within the Phylip folder. The program pro- analysis of multiple genes. Such trees, ap- vides you number of choices including propriately known as species trees reflect phenogram and cladogram. It also provides the evolutionary history of related groups of choice between indicating branch lengths species, and consequently a single species. (construction of conventional phylogram) or A phylogenetic tree based on the divergence not (conventional phenograms and cla- observed within a single homologous gene dograms where taxa end at same height). is most appropriately called a gene tree. The On typing Y tree preview will appear. Press genes commonly used for the construction Print screen on keyboard and paste on new of gene trees have been described in Developing Classifications 263 chapter 7. Although they have been broadly Consider the strict consensus tree rep- used in recent years in the construction of resented in the Figure 8.27-III. This tree is phylogenies, a single gene may not always reproduced in the Figure 8.32-I. As noted reflect relationships between species, be- earlier, the phylogenetic relationships because divergence within genes, especially tween taxa (these could be different species, the sequence polymorphism occurs before genera, etc.) C, D, E, F, and G are poorly re- the splitting of populations that give rise to solved, and as such they are shown arising new species. from the common point, and consequently common ancestor as level o. Although H and I form a distinct group with a common an- Developing Classification cestor as m, but leaving these two out of the group including CDEFG would render latter Once the phylogeny of a group has been de- as paraphyletic (cf. traditional separation of veloped, the evolutionary process within the dicots and monocots). The safest situation group can be reconstructed, the morphologi- would be to include all the seven taxa into cal, physiological and genetic changes can one group, which may be regarded as belong- be described, and the resultant information ing to the same rank as the group including used in the classification of the group. Phy- A and B. All the nine taxa may next be in- logenetic classifications are based on the cluded into the single most inclusive group recognition of monophyletic groups and avoid with common ancestry at level p. We are thus including paraphyletic and often completely able to construct groups at two ranks only. reject paraphyletic groups. Such classifica- Now supposing the phylogenies of the taxa tions are superior over classifications based were better resolved and we had obtained a on overall similarity in several respects: consensus tree as shown in Figure 8.32-II. 1. Such a classification reflects the ge- Now taxa C,D,E,F and G belong to a lineage nealogical history of the group much which diverged from the main lineage, suc- more accurately. cessive to the divergence of the lineage 2. The classification based on mono- formed by A and B. Placement of H and I into phyletic groups is more predictive and one group HI would not create any problem of greater value than classification as both this group as well as the group based on some characteristics. CDEFG are monophyletic with separate com- 3. Phylogenetic classification is of ma- mon ancestors at level m and q, respectively. jor help in understanding distribution The groups CEDFG and HI could next be as- patterns, plant interactions, pollen sembled into group CDEFGHI with common biology, dispersal of seeds and fruits. ancestor at o. Note that the group AB can 4. The classification can direct the next be merged with CDEFGHI to form single search for genes, biocontrol agents most inclusive group ABCDEFGHI. Now we and potential crop species. have been able to construct taxa at three 5. The classification can be of consider- ranks instead of two from tree I. able help in conservation strategies. Supposing the taxa A to I included in the The evolutionary history of the of the group tree, are different species. From tree II, thus of 8 living species shown in Figure 8.12 was we are able to recognize three genera AB, known with precise point of character trans- CDEFG and HI. The last two are next as- formations, and the construction of mono- sembled into family CDEFGHI and the phyletic groups, assembled into successively former a monotypic family AB. The other al- more inclusive groups, did not pose much ternative was to place A and B in two sepa- problem. But it is often not the case. Even, rate monotypic genera (depending on the de- most resolved consensus trees are often gree of morphological and genetic divergence ambiguous in several respects. obtained) which are then assembled into 264 Plant Systematics family AB. The two families may next be as- affinities with very poor support, with highly sembled into order ABEDEFGHI. There could unstable position. be other possibilities also. The second rank The final decisions on the recognition of could be a subfamily and the third a family. groups are, however, often based on personal Similarly, a third rank could be a suborder interpretation of phylogenies. Chloranthus, instead of an order. These final decisions in this tree as well in several others, is are often made, based on the size of the closer to Magnolia (Magnoliales) and Laurus group, degree of divergence, and the reliabil- (Laurales), but often finds different treat- ity of characters. All the groups recognized ment. APG II places Chloranthaceae after above would be monophyletic at the respec- Amborellaceae at the start of Angiosperms. tive ranks. Judd et al., had earlier (1999) placed Next, let us look at the tree shown in the Chloranthaceae under order Laurales of Figure 8.29, a study on paleoherbs. Ranun- Magnoliid complex, but have now (2008) culus and Aquilegia were used as outgroup shifted the family among basal ANITA Grade representing family Ranunculaceae; their with uncertain position. APweb of Stevens isolated position from paleoherbs is clearly (2008), which places the family under order depicted in the tree. Paleoherbs constitute Chloranthales. Thorne had earlier (1999, a group of taxa of uncertain affinities, which 2000) placed Chloranthaceae in have been placed differently in various clas- Magnoliidae—>Magnolianae— sification schemes, but a few points seem >Magnoliales—> Chloranthineae (other sub- to have been resolved. Piper, and Peperomia orders within the order being Magnoliineae, (both belong to Piperaceae) form a distinct and Laurineae), but subsequently (2003) ingroup, and so do Saururus, Gymnotheca, cluded the family after Amborellaceae un- Houttuynia and Anemopsis (all four belonging der order Chloranthales, the first order of to Saururaceae), and the two families a well Magnoliidae, finally (2006, 2007) separated supported (bootstrap support of 90 per cent). under subclass Chloranthidae, a placement This was confirmed by comparison of seven somewhat similar to APG II. Further discus- published trees of paleoherbs. Cabomba, sion on angiosperm affinities will be Lactoris and Saruma have least resolved resumed in the next chapter. Chapter 9 Phylogeny of Angiosperms

Angiosperms form the most dominant group giosperms dominate all major terrestrial veg- of plants with at least 253,300 species etation zones, account for the majority of pri- (Thorne, 2007), a number much greater mary production on land, and exhibit bewil- than all other groups of plants combined to- dering morphological diversity. Unfortu- gether. Not only in numbers, angiosperms nately, much less is known about the origin are also found in a far greater range of habi- and early evolution of angiosperms, result- tats than any other group of land plants. The ing in a number of different views regarding phylogeny of angiosperms has, however, their ancestors, the earliest forms and been a much-debated subject, largely be- course of evolution. The origin of an- cause of very poor records of the earliest angiosperms may be conveniently discussed giosperms. These earliest angiosperms prob- under the following considerations. ably lived in habitats that were not best suited for fossilization. Before trying to What are Angiosperms? evaluate the phylogeny, it would be useful Angiosperms form a distinct group of seed to have an understanding of the major terms plants sharing a unique combination of char- and concepts concerning phylogeny in gen- acters. These important characters include eral, and with respect to angiosperms in carpels enclosing the ovules, pollen grains particular. germinating on the stigma, sieve tubes with companion cells, double fertilization resulting in triploid endosperm, and highly reduced ORIGIN OF ANGIOSPERMS male and female gametophytes. The an- The origin and early evolution of angiosperms also have vessels. The pollen giosperms are enigmas that have intrigued grains of angiosperms are also unique in botanists for well over a century. They con- having non-laminate endexine and ectexine stituted an ‘abominable mystery’ to Darwin. differentiated into a foot-layer, columellar The mystery is slowly being ‘sleuthed’ and layer and tectum (tectum absent in at the present pace of Sherlock Holms’ re- Amborellaceae). The angiosperm flower typi- search, it may be no more mysterious cally is a hermaphrodite structure with car- within the next two decades than for any pels surrounded by stamens and the latter other major group. With the exception of co- by petals and sepals, since insect pollina- nifer forest and moss-lichen tundra, an- tion prevails. Arbuscular mycorrhizae are 266 Plant Systematics

Table 9.1 Geological time scale.

Time Era Period Epoch Stage ______m years (mya) __0.01__ Quaternary Holocene __2.5 ______Pleistocene______7 __ Cenozoic Pliocene __26 __ Miocene __38 __ Tertiary Oligocene __54 __ Eocene __65 ______Palaeocene______74 __ Maestrichtian __83 __ Campanian __87 __ Santonian __89 __ Upper Coniacian __90 __ Turonian __97 ______Cenomanian _ __112__ Cretaceous Albian __125__ Aptian __132__ Mesozoic Barremian __135__ Lower Hauterivian __141__ Valanginian __146______Berriasian___ Upper Jurassic Middle __208______Lower______Upper Triassic Middle __235______Lower______280__ Permian______345__ Carboniferous______395__ Devonian______430__ Palaeozoic Silurian______500__ Ordovician______570______Cambrian______2400_ Precambrian Algonkian______4500_ Archaean also unique to angiosperms (except anemophily. In spite of these and other ex- Amborellaceae, Nymphaeales and ceptions, this combination of characters is Austrobaileyales). The vessel elements of an- unique to angiosperms and not found in any giosperms typically possess scalariform per- other group of seed plants. forations. There may be individual exceptions to What is the age of most of these characters. Vessels are absent in some angiosperms (Winteraceae) while Angiosperms? some gymnosperms have vessels (Gnetales). The time of origin of angiosperms is a mat- The flowers are unisexual without perianth ter of considerable debate. For many years, in several Amentiferae, which also exhibit the earliest well-documented angiosperm Phylogeny of Angiosperms 267 fossil was considered to be the form-genus other fossil pollens from the Jurassic age at- Clavitopollenites described (Couper, 1958) tributed to Nymphaeaceae ultimately turned from Barremian and Aptian strata of Early out to be gymnosperms. Cretaceous (Table 9.1) of southern England In the last few years Sun et al., (1998, (132 to 112 mya-million years), a 2002) have described fossils of Archaefructus monosulcate pollen with distinctly sculptured from Upper Cretaceous (nearly 124 mya) of exine, resembling the pollen of the extant China, with clearly defined spirally arranged genus Ascarina. Brenner and Bickoff (1992) conduplicate carpels enclosing ovules, a fea- recorded similar but inaperturate pollen ture not reported in earlier angiosperms. grains from the Valanginian (ca 135 mya) of The fruit is a follicle. This is considered to the Helez formation of Israel, now consid- be the oldest record of angiosperm flower. ered to be the oldest record of angiosperm Several vegetative structures from the fossils (Taylor and Hickey, 1996). Also found Triassic were also attributed to angiosperms. in Late Hauterivian (Brenner, 1996) of Is- Brown (1956) described Sanmiguilea leaves rael (ca 132 mya) were Pre-Afropollis (mostly from the Late Triassic of Colorado and sug- inaperturate, few weakly monosulcate), gested affinity with Palmae. A better under- Clavitopollenites (weakly monosulcate to standing of the plant was made by Cornet inaperturate), and Liliacidites (monosulcate, (1986, 1989), who regarded it as a presumed sexine similar to monocots). From Late primitive angiosperm with features of mono- Barremian have been recorded Afropollis and cots and dicots. Although its angiosperm ve- Brenneripollis (both lacking columellae) and nation was refuted by Hickey and Doyle Tricolpites (the first appearance of tricolpate (1977), Cornet (1989) established its an- pollen grains) giosperm venation and associated reproduc- The number and diversity of angiosperm tive structures. Our knowledge of this con- fossils increased suddenly and by the end of troversial taxon, however, is far from clear. the Early Cretaceous (ca 100 mya) period Marcouia leaves (earlier described as major groups of angiosperms, including her- Ctenis neuropteroides by Daugherty, 1941) are baceous Magnoliidae, Magnoliales, Laurales, recorded from the Upper Triassic of Arizona Winteroids and Liliopsida were well repre- and New Mexico. Its angiosperm affinities sented. In Late Cretaceous, at least 50 per are not clear. cent of the species in the fossil flora were Harris (1932) described Furcula from the angiosperms. By the end of the Cretaceous, Upper Triassic of Greenland as bifurcate leaf many extant angiosperm families had ap- with dichotomous venation. Although it peared. They subsequently increased expo- seems to approach dicots in venation and nentially and constituted the most dominant cuticular structure, it has several non-an- land flora, continuing up to the present. giospermous characters including bifurcat- The trail in the reverse direction is in- ing midrib and blade, higher vein orders with complete and confusing. Many claims of an- relatively acute angles of origin (Hickey and giosperm records before the Cretaceous were Doyle, 1977). made but largely rejected. Erdtman (1948) Cornet (1993) has described Pannaulika, described Eucommiidites as a tricolpate di- a dicot-like leaf form from Late Triassic cotyledonous pollen grain from the Jurassic. from the Virginia-North Carolina border. It This, however, had bilateral symmetry in- was considered to be a three-lobed palmately stead of the radial symmetry of angiosperms veined leaf. The associated reproductive (Hughes, 1961) and granular exine with gym- structures were attributed to angiosperms nospermous laminated endexine (Doyle et but it is not certain that any of the repro- al., 1975). This pollen grain was also discov- ductive structures were produced by the ered in the micropyle of seeds of the female plant that bore Pannaulika. Taylor and cone of uncertain but clearly gymnosper- Hickey (1996), however, do not accept its mous affinities (Brenner, 1963). Several angiosperm affinities, largely on the basis 268 Plant Systematics of the venation pattern, which resembles was made by Martin et al., (1989) using nine more that of ferns. Much more information angiosperm sequences from gapC, the is needed before the Triassic record of an- nuclear gene encoding GADPH (cytosolic giosperms can be established. glyceraldehydes-3-phosphate dehydroge- Cornet (1996) described Welwitschia like nase). The observed number of fossil as Archaestrobilus cupulanthus from the nonsynonymous substitutions between each

Late Triassic of Texas. The plant had simi- pair of species (Ka) was compared to esti- larly constructed male and female spikes, mated rates of Ka (substitutions per site per each possessing hundreds of spirally ar- year) inferred from known divergence times ranged macrocupules. The fossil has revived (e.g. plants-animals, plants-yeast, mammal- renewed interest in gnetopsids. chicken, human-rat). The results implied Given the inconclusive pre-Cretaceous separation of monocots and dicots at 319 + record of angiosperms, it is largely believed 35 mya, a dicot radiation at 276 + 33 mya, that angiosperms arose in the Late Juras- and cereal grass divergence at 103 + 22 mya. sic or very Early Cretaceous (Taylor, 1981) The results were questioned by several au- nearly 130 to 135 mya ago (Jones and thors, since the study used a single gene. Luchsinger, 1986). Wolfe et al., (1989) attempted to date the Melville (1983), who strongly advocated his monocot-dicot split using a large number of gonophyll theory, believed that angiosperms genes in chloroplast genome and using a arose nearly 240 mya ago in the Permian three-tiered approach. They suggested Late and took nearly 140 mya before they spread Triassic (200 mya) as the likely estimate of widely in Cretaceous. The Glossopteridae monocot-dicot split. Martin et al., (1993) pro- which gave rise to angiosperms met with a vided new data to support Carboniferous ori- disaster in the Triassic and disappeared, this gin (~300 Mya) of angiosperms. They used disaster slowing down the progress of an- both rbcL and gapC sequences for this study. giosperms slow until the Cretaceous when Sytsma and Baum (1996) conclude that the their curve entered an exponential phase. results strongly caution using the molecu- This idea has, however, found little favour. lar clock for dating unless extensive sam- There has been increasing realization in pling of taxa and genes with quite different recent years (Troitsky et al., 1991; Doyle and molecular evolution is completed. Thus, the Donoghue, 1993; and Crane et al., 1995) to resolution of angiosperm phylogeny may distinguish two dates—one in the Triassic have to wait for a more complete molecular when the stem angiosperms (‘angiophytes’ data and its proper appraisal. sensu Doyle and Donoghue, 1993 or ‘proangiosperms’ sensu Troitsky et al., 1991) What is the place of their ori- separated from sister groups (Gnetales, gin? Bennettitales and Pentoxylales) and the second in the Late Jurassic when the crown It was earlier believed that angiosperms group of angiosperms (crown angiophytes) arose in the Arctic region (Seward, 1931), split into extant subgroups (Figure 9.1). with subsequent southwards migration. Axelrod (1970) suggested that flowering plants evolved in mild uplands (upland Molecular Dating theory) at low latitudes. Smith (1970) located There have been a number of attempts to the general area of South-East Asia, adja- estimate the time of divergence of an- cent to Malaysia as the site where angiosperms (node B in Figure 9.1) by applying giosperms evolved when Gondwana and a molecular clock to nucleotide sequence Laurasia were undergoing initial fragmen- data. The results mostly pointing to much tation. Stebbins (1974) suggested that their earlier origin of angiosperms have, however, origin occurred in exposed habitats in ar- been contradictory. The first detailed attempt eas of seasonal drought. Takhtajan (1966, Phylogeny of Angiosperms 269

1980), who believed in the neotenous origin became widespread following changing sea of angiosperms, suggested that angiosperms levels during the Early Cretaceous. arose under environmental stress, probably Although agreeing with the role of envi- as a result of adaptation to moderate sea- ronmental stress, many authors in recent sonal draught on rocky mountain slopes in years (Hickey and Doyle, 1977; Upchurch and areas with monsoon climate. Wolfe, 1987; Hickey and Taylor, 1992) have Retallack and Dilcher (1981) believed that suggested that early angiosperms lived along the earliest angiosperms were probably stream- and lake-margins (lowland theory). woody, small-leaved plants occurring in the Later, they appeared in more stable Rift valley system adjoining Africa and South backswamp and channel sites, and lastly, on America. Some of these angiosperms river terraces. Taylor and Hickey (1996) adapted to the coastal environments and suggested that ancestral angiosperms were Gnetales

Angiosperms Caytoniaceae Bennettitales

Cenozoic Pentoxylon

Cretaceous

II Jurassic

Triassic

Figure 9.1 Phylogenetic tree of anthophytes (angiosperm lineage and sister groups). Point (I) marks when angiosperm lineage separated from sister groups in the Late Triassic, and (II) marks the splitting of crown angiosperms into extant subgroups in the Late Jurassic. Dotted line represents conclusions for which fossil record is not available (diagram based on Doyle and Donoghue, 1993). 270 Plant Systematics perennial rhizomatous herbs and evolved monophyletic, as is a genus from a genus, a along rivers and streams on sites of rela- family from a family. The principle, accord- tively high disturbance with moderate ing to him, is that to be monophyletic, a amounts of alluviation. These sites would taxon of any rank must be derived solely from have been characterized by high nutrient another taxon of the same rank. Gloss- levels and frequent loss of plant cover due to opteridae and Angiospermidae belong to the periodic disturbances. same rank subclass. Both taxa consist of minor lineages that may be likened to a rope Are Angiosperms monophyl- with many strands, a situation called pachyphyletic. This explanation, however, etic or polyphyletic? conforms to the concept of minimum mono- Engler (1892) considered angiosperms to be phyly and does not satisfy the rule of strict polyphyletic, monocotyledons and dicotyle- monophyly, which is now, the accepted dons having evolved separately. Consider- criterion for monophyly. able diversity of angiosperms in the Early Cretaceous and the extant angiosperms led What are the possible several authors, including Meeuse (1963) and Krassilov (1977) to develop models for ancestors? polyphyletic origin of angiosperms. This view Ancestry of angiosperms is perhaps one of is largely supported by considerable diver- the most controversial and vigorously sity in the early angiosperm fossils. debated topics. In the absence of direct fos- Most recent authors, including sil evidence, almost all groups of fossil and Hutchinson (1959,1973), Cronquist (1981, living gymnosperms have been considered 1988), Thorne (1983, 1992, 2000, 2007), as possible ancestors by one authority or the Dahlgren (1980, 1989), Takhtajan (1987, other. Some authors even suggested the 1997), Judd et al. (2002, 2008), Bremer et al. Isoetes origin of monocotyledons because (APG II, 2003), and Stevens (APweb, 2008) the plant has a superficial resemblance with believe in the monophyletic origin of an- onion, albeit with no trace of seed habit. The giosperms, monocotyledons having evolved various theories have revolved around two from primitive dicotyledons. This view is basic theories, viz., the Euanthial theory supported by a unique combination of char- and the Pseudanthial theory of angiosperm acters such as closed carpels, sieve tubes, origin. Some other theories projecting her- companion cells, four microsporangia, trip- baceous ancestry for the angiosperms have loid endosperm, 8-nucleate embryo sac and also recently received attention, making the reduced gametophytes. Sporne (1974), on the question of ancestry of angiosperms rather basis of statistical studies, also concluded more ambiguous: that it is highly improbable that such a unique combination of characters could have arisen more than once, independently from Euanthial Theory gymnosperm ancestors. Also known as Anthostrobilus theory, It is interesting to note that Melville Euanthial theory was first proposed by Arber (1983) considered angiosperms to be mono- and Parkins (1907). According to this theory, phyletic but the explanation that he offers the angiosperm flower is interpreted as clubs him with the proponents of polyphyl- being derived from an unbranched bisexual etic origin. He believes that angiosperms strobilus bearing spirally arranged ovulate arose from several different genera of and pollen organs, similar to the hermaph- Glossopteridae. According to him, the spe- rodite reproductive structures of some cies is not always to be considered as the extinct bennettitalean gymnosperms. The ancestor for determining a monophyletic carpel is thus regarded as a modified me- nature. A species from another species is gasporophyll (phyllosporous origin of carpel). Phylogeny of Angiosperms 271

The bisexual flower of Magnoliales has been Cycadeoidea, which had an elongated recep- considered to have evolved from such a struc- tacle with perianth-like bracts, a whorl of ture. Also agreeing with this general prin- pollen-bearing microsporophylls surrounding ciple, various authors have tried to identify the ovuliferous region having numerous different gymnosperm groups as possible ovules and interseminal scales packed angiosperm ancestors: together. There were, however, signs of abscission at the base of the male structure, which would have shed, exposing the ovular Cycadeoidales (Bennettitales) region. The group, now better known as The plant was believed to look like cycads Cycadeoidales, appeared in the Triassic and with a short compact trunk and a crown of disappeared in the Cretaceous. Their poten- pinnate compound leaves (Figure 9.2-A). It tial as angiosperm ancestors was largely was earlier suggested that the microsporo- built upon the studies of Wieland (1906, phylls opened at maturity but the subsequent 1916). Lemesle (1946) considered the group studies of Crepet (1974) showed that to be ancestral to angiosperms, primarily be- microsporophylls were pinnate, and distal cause of the hermaphrodite nature of tips of pinnae were fused, the opening of the

Figure 9.2 Cycadeoidea. A: Suggested reconstruction of plant with a compact trunk and numerous pinnate leaves. B: Suggested reconstruction of the cone cut open to show the arrangement of microsporangia. Ovulate receptacle is in the centre (A, after Delevoryas, 1971; B, after Crepet, 1974). 272 Plant Systematics

had rachis with branching pinnae, each with a synangium of four microsporangia. The seed-bearing structure (Caytonia) had rachis with two rows of stalked cupules (Figure 9.3- B). Each cupule contained several ovules borne in such a way that the cupule is recurved, with a lip like projection (often called stigmatic surface) near the point of attachment (Figure 9.3-C). The discovery of pollen grains within the ovules was thought to suggest their true gymnosperm position, however, rather than being angiosperm ancestors. Krassilov (1977) and Doyle (1978) regarded the cupule as homologous to the carpel, whereas Gaussen (1946) and Stebbins (1974) considered it the outer integument of the ovule. Cladistic studies of Doyle and Donoghue (1987) support the caytoniales-angiosperm lineage. Thorne (1996) agreed that angiosperms probably evolved during the Late Jurassic from Figure 9.3 Caytoniaceae. A: Palmately com- some group of seed ferns. pound leaf of Sagenopteris phillipsi. B: Caytonia nathorstii with two rows Cycadales of cupules. C: Reconstruction of Sporne (1971) suggested possible links be- cupule of Caytonia sewardii. (B and C from Dilcher, 1979; C, from tween Cycadales and angiosperms in the Stewart and Rothwell, 1993). palm-like habit of Cycadales, the ovules being borne on leaf-like microsporophylls, trends in the reduction of sporophyll blade region was not structurally possible, and as seen in various species of Cycas. Although they later disintegrated internally (Figure it may be difficult to assume Cycadales as 9.2-B). The ovules were terminal in contrast ancestral to angiosperms, the fact that they to their position in carpels of angiosperms. have been derived from pteridosperms, and Caytoniaceae yet resemble angiosperms further supports the origin of angiosperms from pteri- Opinion has strongly inclined in the recent dosperms. years towards the probability that angiosperms arose from Pteridosperms or seed ferns, often placed in the order Pseudanthium Theory Lyginopteridales but more commonly under Commonly associated with the Englerian Caytoniales. Caytoniaceae was described School, the theory was first proposed by from the Jurassic of Cayton Bay in Yorkshire Wettstein (1907), who postulated that an- by Thomas, and subsequently from giosperms were derived from the Greenland, England and Canada. The group Gnetopsida, represented by Ephedra, Gnetum appeared in the Late Triassic and disap- and Welwitschia (formerly all placed in the peared towards the end of the Cretaceous. same order Gnetales). The leaves (Sagenopteris ) were borne on The group shows more angiosperm char- twigs and not the trunk. These had two pairs acteristics than any other group of living or of leaflets (rarely 3 to six leaflets) and were fossil gymnosperms. These include the pres- net veined. Male structures (Caytonanthus) ence of vessels, reticulate dicot-like leaves Phylogeny of Angiosperms 273

vesselless living angiosperms (cf. Winteraceae). Amentiferae are now regarded as advanced due to floral reduction. Tricolpate pollen grains also represent an advanced condition. More importantly, Gnetopsida is a very young group. But this theory has been strongly supported by Young (1981), who challenged the view that first angiosperms were vesselless

Figure 9.4 Ephedra. A: A small portion of plant with opposite scale-like leaves. B: Male strobili on a branch. C: A male strobilus with series of opposite bracts, apical bract subtending male stalk with several microsporangia. D: Female strobilus with series of whorled bracts, uppermost closely clasping ovules. (Gnetum), male flower with perianth and bracts, strong gametophyte reduction, and fusion of the second male gametophyte with the ventral canal nucleus. Ephedra resembles Casuarina in habit. Wettstein ho- mologized the compound strobili of Gnetales with the inflorescences of wind-pollinated Amentiferae, and regarded the showy insect pollinated bisexual flowers of Magnolia as pseudanthia derived by aggregation of unisexual units, the carpel thus representing a modified branch (Stachyosporous origin Figure 9.5 Resconstruction of Archaestrobilus of carpel). cupulanthus and isolated organs. A: A number of features, however, refute this Associated leaf of Pelourdea poleoensis. B: Associated sterile theory: different origin of vessels (Bailey, lower part of strobilus. C: Female 1944) in angiosperms (from tracheids with strobilus with numerous spirally scalariform pitting) and Gnetosids (from tra- arranged macrocupules. D: Dis- cheids with circular pitting), several persed seed. (After Cornet, 1996). 274 Plant Systematics

Figure 9.6 Pentoxylales. A: Suggested reconstruction of Pentoxylon sahnii with strap-shaped leaves. B: Suggested reconstruction of seed cones (From Sahni, 1948). and assumed that vessels were lost in sev- macrocupule had an axially curled (tubular) eral early lines. Muhammad and Sattler bract-like organ with a narrow shaft and (1982) found scalariform perforations in ves- expanded funnel shaped apex. The sel-elements of Gnetum, suggesting that an- macrocupules contained an ovule (or seed) giosperms may be derived from Gnetales af- surrounded by sterile scales. Three to four ter all. Carlquist (1996), however, concludes very small bracts were present attached that this claim from Gnetum does not hold near the base and surrounding the when large samples are examined. macrocupule. The basal group of angiosperms accord- Each male macrocupule contained fila- ing to this theory included amentiferous- ment like appendages instead of sterile hamamelid orders Casuarinales, Fagales, scales within. Outside, the macrocupule was Myricales and Juglandales. It is significant crowded with numerous bivalved mi- to note that Wettstein (1907) also included crosporophylls, each with four pollen sacs in this basal group, Chloranthaceae and attached to an inflated stalk. On the out- Piperaceae, which have been inviting con- side of the female macrocupule were present siderable attention in recent years. gland-like structures resembling the stalks The importance of Gnetopsids in an- bearing pollen sacs on the male giosperm phylogeny has been further macrocupule. This suggests an origin from strengthened by the discovery of Welwitschia a bisexual macrocupule. The pollen grains like fossil described by Cornet (1996) as are radially symmetrical and monosulcate. Archaestrobilus cupulanthus from the Late The plant is regarded as a gnetophyte more Triassic of Texas (Figure 9.5). The plant had primitive than extant Gnetales. similarly constructed male and female Ephedra is generally considered to be the spikes, each possessing hundreds of spirally most primitive of the three living genera of arranged macrocupules. Male spikes were gnetopsids. Cornet believes that borne in clusters of three, whereas female Archaestrobilus possessed characters that spikes occurred singly. Each female may be plesiomorphic even for Ephedra, such Phylogeny of Angiosperms 275

Figure 9.7 Glossopteridae. A: Dictypteridium feistmantelii (Glossopteris tenuinervis) vegetative branch. B: Fertile branch (Gonophyll) of Lidgettonia mucronata C: Fertile branch of Denkania indica with cupules. (A: from Chandra and Surange, 1976; B and C from Surange and Chandra, 1975)

as radial symmetry of floral parts which are gins (i.e. angiosperms are polyphyletic). In spirally arranged and not opposite. He be- most Magnoliidae and their dicotyledonous lieves that Bennettitales, Gnetales, derivatives, they are modified pluriaxial sys- Pentoxylales and angiosperms had a com- tems (holanthocorms) that originated from mon ancestry sometimes before Late Trias- the gnetopsids via the Piperales, whereas sic. Gnetales are relatives of angiosperms the modification of an originally uniaxial sys- and Bennettitales that underwent drastic tem (gonoclad or anthoid) gave rise to flow- floral reduction and aggregation in response ers of Chloranthaceae. Meeuse (1963) pos- to wind pollination. tulated a separate origin of monocotyledons Taylor and Hickey (1996) have presented from the fossil order Pentoxylales through a hypothesis for the derivation of the flower the monocot order Pandanales. of Chloranthaceae from the inflorescence Pentoxylales (Figure 9.6) were described unit (anthion) of gnetopsids, with consider- from the Jurassic of India and New Zealand. able reduction in the reproductive parts. The stem (Pentoxylon) had five conducting strands. The pollen-bearing organ (Sahnia) was pinnate: free above and fused into a cup Anthocorm Theory below. The seed-bearing structure was simi- This theory is a modified version of the lar to a mulberry with about 20 sessile seeds, pseudanthial theory and was proposed by each having an outer fleshy sarcotesta and Neumayer (1924) and strongly advocated by the inner hard sclerotesta. The sarcotesta Meeuse (1963, 1972). According to this was considered homologous to the cupule of theory, the angiosperm flower (‘functional seed ferns. The carpel of angiosperms was reproductive unit’) has several separate ori- regarded as a composite structure being an 276 Plant Systematics

_____Anthophytes______Angiophytes (possible)______Crown Angiophytes Triassic Jurassic reticulate reticulate Bennettitaleans Gnetopsids pollen Sanmiguillia pollen Angiosperms

Figure 9.8 A consensus phylogeny of Anthophytes proposed by Taylor and Hickey (1996). Note that Pentoxylon has been excluded from sister groups (now only Bennettitaleans and Gnetopsids) of angiophytes. ovule-bearing branch fused with a support- minal ovules on dichotomous groups of ing bract. It is interesting, however, to note branches. Folding of the scutella along the that Taylor and Hickey (1996) no longer in- cluster of its ovules forms the angiosperm clude Pentoxylon as a member of condition, an indication of this closure be- Anthophytes, which include angiosperm ing found in the Permian fossil Breytenia. In lineage and its sister groups Bennettitales Lidgettonia, the fertile branch consists of four and gnetopsids (see Figure 9.12). According to eight disc-like bearing several seeds. In to them, Pentoxylon lacks key anthophyte Denkania, described from Raniganj , India, characteristics such as distal, medial and about six seed-bearing cupules are attached proximal positioning of female, male and to long stalks borne from the midrib of fer- sterile organs on the reproductive axis, as tile scale. well as the enclosure of ovules by bract-de- The leaves of Glossopteris (Figure 9.7) are rived organs. lanceolate, with distinct reticulate venation. In Glossopteris, the fertile region is cone-like with a transition from leaves to fertile Gonophyll Theory scales, spirally arranged and conforming to The Gonophyll theory was developed by the anthostrobilus. In Mudgea, there is a Melville, (1962, 1963, 1983) largely on the suggestion of anthofasciculi, i.e. leafy struc- basis of a study of the venation pattern. He tures with two fertile branches, one male derived angiosperms from Glossopteridae, and the other female, forming the an- which formed important elements in the giosperm flowers as found in Ranunculus and flora of Gondwanaland. He further derived Acacia. angiosperm flower from gonophyll, a fertile Melville believed that angiosperms arose branching axis adnate to a leaf. In simple 240 mya ago in the Permian and took around Glossopterids Scutum and Ottokaria, the fer- 140 mya before they spread widely in the Cre- tile branch consisted of a bivalved scale (hav- taceous. It is pertinent to point out, as ex- ing two wings) called the scutella with ter- plained earlier, that although he considered Phylogeny of Angiosperms 277

Figure 9.9 Dr D. L. Dilcher palaeobotanist with the Florida Museum of Natural History at the University of Florida, who has pioneered research on Angiosperm fossils with specimen (above left) and reconstruction (above right) of recently described (Sun, Dilcher et al., 2002) Archaefructus sinensis, believed to be the oldest angiosperm fossil nearly 124 mya old. 278 Plant Systematics angiosperms to be monophyletic, his justifi- lineage continuing as Angiophytes up to the cation puts him among the proponents of the Late Jurassic when it further split into stem polyphyletic origin of angiosperms. Angiophytes (the early extinct angiosperms) and crown Angiophytes constituting the ex- Herbaceous Origin tant groups of angiosperms (Figure 9.8). Krassilov, who believed in the polyphyletic Hypothesis origin of angiosperms, identified three Ju- rassic groups as proangiosperms: The herbaceous origin hypothesis resembles Caytoniales, Zcekanowskiales and the Pseudanthial theory but the ancestral Dirhopalostachyaceae. Pollen germinating plant is considered to be a perennial rhi- on the lip, according to him, would be rather zomatous herb instead of a tree. The term disappointing because these plants would paleoherb was first used by Donoghue and then be classified as angiosperms and ex- Doyle (1989) for a group of derivative (not cluded from discussion of their ancestors. ancestral) forms of Magnoliidae having He evolved the Laurales-Rosales series from anomocytic stomata, two whorls of perianth Caytoniales. Zcekanowskiales had bivalved and trimerous flowers, including Lactoridaceae Aristolochiaceae, Cabombaceae, Piperales, Nymphaeaceae and monocots. According to this hypothesis, ancestral angiosperms were small herbaceous plants with a rhizomatous to scrambling perennial habit. They had simple leaves that were reticulately veined and had a primary venation pattern that would have been indiffer- ently pinnate to palmate, whereas the secondary veins branched dichotomously. The vegetative anatomy included sieve-tube elements and elongate tracheary elements with both circular-bordered and scalariform pitting and oblique end walls. The flowers occurred in cymose to racemose inflorescences. The small monosulcate pollen had perforate to reticulate sculpturing. Carpels were free, ascidiate (ovules attached proximally to the closure) with one or two orthotropous, bitegmic, crassinucellate ovule and dicotyledonous embryo. The aforesaid authors cite extreme rarity of fossil an- Figure 9.10 Reconstruction of leafy branch giosperm wood and abundance of leaf impres- with flower of Archaeanthus sions in early fossils. linnenbergeri from middle Creta- Consensus is emerging from recent phy- ceous. (After Dilcher and Crane, logenetic studies that gnetopsids represent 1984.) the closest living relatives of angiosperms, whereas the closest fossil group is the capsules provided with stigmatic bands and Bennettitales. Angiosperm lineage, together showed links with monocots. Dirhopalo- with these two groups, constitutes stachyaceae had paired ovules exposed on Anthophytes. The group is believed to have shield-like lateral appendages and probably split in the Late Triassic, the angiosperm evolved in Hamamelidales. Phylogeny of Angiosperms 279 Using the oldest, most complete fossil an- Transitional-Combinational giosperm on record, David Dilcher (Figure 9.9), a palaeobotanist with the Florida Mu- Theory seum of Natural History at the University of J. Stuessy (2004) published a transitional- Florida, recently announced the discovery of combinational theory for the origin of an- a new basal angiosperm family of aquatic giosperms, initiating renewed interest in plant, Archaefructaceae. It was published in angiosperms and also serving to explain sev- the journal Science with coauthors Ge Sun eral recent divergent viewpoints and find- of the Research Center of Palaeontology at ings. The theory suggests that the an- Jilin University, Qiang Ji of the Geological giosperms evolved slowly from the seed Institute of the Chinese Academy of Geo- ferns in the Jurassic. Carpel was the first sciences at Beijing and three others (Sun to develop, followed by the double fertiliza- et al., 2002). The family is based on a single tion and then the development of flower. genus Archaefructus with two species, These three fundamental transitions may Archaefructus sinensis and Archaefructus have taken more than 100 million years to lianogensis. These were probably aquatics complete. The theory is proposed in view of herbs and living at least 124 mya. the difficulty in finding ancestors for an- Archaefructus has perfect flowers rather un- giosperms, yet also considering their sud- like those of extant angiosperms— there is den appearance and explosive evolutionary no perianth, the receptacle is very elon- success. The extant angiosperms did not gated, and the stamens are paired. The fruits appear until Early Cretaceous when the fi- are small follicles formed from conduplicate nal combination of all three important an- carpels helically arranged. Adaxial elongate giosperm features occurred, as presented stigmatic crests are conspicuous on each by fossil record. This combination provided carpel. Earlier to this, Dilcher and Crane the opportunity for explosive evolutionary (1984) had described Archaeanthus diversification, especially in response to se- linnenbergeri (Figure 9.10) from uppermost lection from insect pollinators, as also the Albian/mid-cenomanian (approx 110 mya) of accompanying modifications in compatibil- middle Cretaceous as a primitive flowering ity and breeding systems. The theory at- plant with simple bilobed leaves, terminal tempts to explain discrepancy between fos- flower with numerous free carpels produc- sil and molecular phylogenetic data, latter ing follicle fruit. suggesting pre-Cretaceous origin of an- Archaefructus was about 50 cm high, rooted giosperms when DNA (and protein) se- in the lake bottom and was partially sup- quences showed first changes accompany- ported by the water. Thin stems reached to ing carpel evolution, much earlier than fi- the water’s surface. Pollen and seed organs nal combination of all the three angiosperm extended above the water. The leaves were features. The theory also suggests that bar- possibly submerged. Seeds probably dispersed ring extinct seed ferns, from which the car- on the water and floated towards the shore pel arose, other gymnosperms had no direct where they germinated in shallower areas, phylogenetic connections to modern he added. This is considered to be the oldest angiosperms. record of an angiosperm flower. It is placed Stuessy suggests that meaningful mor- in a distinct family Archaefructaceae, prob- phological cladistic analyses should focus on ably sister to all extant angiosperms. Accord- ties between pteridosperms and an- ing to Stevens (2005), It is unclear as to how giosperms directly, and not include rest of it relates to extant angiosperms and its flow- the gymnosperms. He believes that new bi- ers are perhaps better interpreted as inflo- ology of pollination and breeding systems that rescences (Zhou et al. 2003; Ji et al. 2004; favoured outcrossing and developed an- Crepet et al. 2004). giosperm pollen, took place only after the 280 Plant Systematics

advanced vessels in an aquatic environment yet gave rise to terrestrial monocots with more primitive vessel elements in the metaxylem of roots. They thus favoured the origin of Alismataceae from terrestrial forms. According to Hutchinson (1973), monocots arose from Ranales along two lines, one (Ranunculoideae) giving rise to Alismatales and other (Helleboroideae) giving rise to Butomales. Takhtajan (1980, 1987) proposed a common origin for Nymphaeales and Alismatales from a hypothetical terrestrial herbaceous group of Magnoliidae. Dahlgren et al., (1985) believed that monocots appeared in the Early Cretaceous some 110 mya ago when the ancestors of Magnoliiflorae must have already acquired some of the present attributes of that group Figure 9.11 Casuarinaceae. Casuarina suberba. but were less differentiated; some other di- A: Branch with male inflores- cotyledonous groups had already branched cences; B: Portion of male inflo- off from the ancestral stock. Thorne (1996) rescence; C: Male flower with believes that monocotyledons appear to be single stamen; D: Part of female very early offshoot of the most primitive di- inflorescence showing 3 flowers; cotyledons. In their rbcL sequence studies, E: Fruits; F: Seed with broad wing. Chase et al., (1993) and Qiu et al. (1993) found the monocots to be monophyletic and derived from within monosulcate Magnoliidae. flower had developed, explaining the absence Acorus, Melanthiaceae, and Butomus are re- of angiosperm pollen record prior to 130 mya. garded to be the least specialized Monocoty- ledons. Origin of monocotyledons It was originally believed (Engler, 1892) that BASAL LIVING ANGIOSPERMS monocotyledons arose before dicotyledons and are polyphyletic (Meeuse, 1963). It is Angiosperms are now increasingly believed now largely believed that monocotyledons to have evolved in very Late Jurassic or very evolved from dicots monophyletically. Ac- Early Cretaceous. The course of evolution cording to Bailey (1944) and Cheadle (1953), within the group is being thoroughly exam- vessels had independent origin and special- ined with newer tools of research. ization in monocots and dicots, and thus There was general agreement for nearly monocots arose from vesselless dicots. a century that the early angiosperms were Cronquist did not agree with the indepen- woody shrubs or small trees (herbaceous dent origin of vessels in two groups. He con- habit being derived), with simple evergreen sidered monocots to have an aquatic origin entire and pinnately veined leaves with from ancestors resembling modern stipules. Concerning the most primitive liv- Nymphaeales. This was strongly refuted, ing angiosperms, there have been two op- however, by studies of vessels done by posing points of view: Englerian school (Con- Kosakai, Mosely and Cheadle (1970). They sidering Amentiferae, particularly considered it difficult to believe that puta- Casuarinaceae to be the most primitive tively primitive Alismataceae evolved dicots) and the Besseyan school (Bisexual Phylogeny of Angiosperms 281

Casuarinaceae (Figure 9.11) to be the most primitive dicot family, and the one derived from Ephedraceae. It is now agreed that Casuarinaceae and the other members of Amentiferae have advanced tricolpate pollen grains, wood anatomy is relatively advanced and the simplicity of flowers is due to reduction rather than primitiveness. They have also secondarily achieved wind pollination. Other advanced features include trilacunar nodes, cyclic stamens, syncarpous pistil with axile placentation. Magnoliids

Figure 9.12 Flower and a twig of Magnolia The alternative Besseyan School (Ranalian campbellii with elongated fruiting School) considers the Ranalian complex (in- axis (reproduced with permission cluding Magnoliales), having bisexual flow- from Oxford University Press). ers with free, equal, spirally arranged floral parts, representative of the most primitive angiosperms. flowers of Magnoliales to be the most primitive). During the last few years the Magnoliaceae paleoherbs are emerging as the strong con- Bessey (1915), Hutchinson (1959, 1973), tenders. The candidate basal groups are dis- Takhtajan (1966, 1969) and Cronquist (1968) cussed below: all believed that large solitary flower of Mag- nolia (Figure 9.12) (‘Magnolia the primitive Casuarinaceae theory’) with an elongated floral axis bear- According to the Englerian School—the ing numerous spirally arranged stamens and view now largely rejected— Amentiferae with carpels, is the most primitive living repre- reduced unisexual flowers in catkins (or sentative. The stamens of Magnolia and aments) constitute the most primitive liv- other closely related genera are laminar, ing angiosperms. Engler, as well as Rendle perianth undifferentiated, and pollen grains (1892) and Wettstein (1935) considered monosulcate and boat-shaped. In the subsequent works, however, Takhtajan agreed that the flower of Magnolia is more advanced than those found in Winteraceae and Degeneriaceae. Winteraceae After several decades of Magnolia being considered as the most primitive living angiosperm, the view was challenged by Gottsberger (1974) and Thorne (1976), who considered the most primitive flowers to have been middle sized, with fewer stamens and carpels, and grouped in lateral clusters Figure 9.13 Winteraceae Flowering twig of as in the family Winteraceae, to which such Drimys winteri. primitive genera as Drimys (Figure 9.13) 282 Plant Systematics have been assigned. This view is supported by the occurrence of similar stamens and carpels, absence of vessels, morphology similar to pteridosperms, high chromosome number suggesting a long evolutionary history, and less specialized beetle pollination of Drimys compared to Magnolia. Takhtajan (1980, 1987) later acknowledged that moderate sized flowers of Degeneria and Winteraceae are primitive, and the large flowers of Magnolia and Nymphaeaceae are of secondary origin. How- ever, he considered Degeneriaceae to be the most primitive family of living angiosperms. Cronquist (1981, 1988) also discarded Mag- nolia while considering Winteraceae to be the most primitive. Degeneriaceae Takhtajan, who was earlier a strong sup- Figure 9.14 Degeneriaceae. Degeneria vitiensis. A: Branch with flowers; B: Sta- porter of Magnolia as the most primitive liv- men; C: Transverse section of car- ing angiosperm, has abandoned this view in pel; D: Fruit. favour of Degeneriaceae and Winteraceae to be the basal angiosperm families, but has maintained since 1980 to regard Degeneriaceae as the most primitive. ous spirally arranged tepals, and few ovulate Degeneriaceae (Figure 9.14) may be rec- carpels. Food bodies terminating the stamen ognized by their spiral, entire, exstipulate connectives indicate beetle pollination. leaves and large, axillary flowers with many The family (Figure 9.15) is regarded as the tepals and a single carpel. Vessel elements most basal family of Laurales. It is interest- have scalariform perforations. Leaves are ing to note that genus Idiospermum (which spirally arranged and pollen boat-shaped. The was recognized as new genus based on most significant plesiomorphic features in- Calycanthus australiensis by S. T. Blake in clude stigma running the entire length of 1972) was considered as the most primitive the carpel, laminar stamens with three flowering plant by these authors. Endress veins, the fruit a follicle and embryo with 3 (1983) had described ‘In all respects, to 4 cotyledons. Ideospermum gives the impression of a strange living fossil’. Calycanthaceae Suggestions have also come projecting Paleoherbs Calycanthaceae (Loconte and Stevenson, The last decade of the twentieth century has 1991) as basic angiosperms with a series of seen the strong development of an alterna- vegetative and reproductive angiosperm tive herbaceous origin hypothesis for an- plesiomorphies such as shrub habit, giosperms (Taylor and Hickey, 1996) origi- unilacunar two-trace nodes, vessels with nally developed as paleoherb hypothesis. The scalariform perforations, sieve-tube ele- most primitive angiosperms are considered ments with starch inclusions, opposite to be rhizomatous or scrambling perennial leaves, strobilar flowers, leaf-like herbs with simple net-veined leaves, flow- bracteopetals, poorly differentiated numer- ers in racemose or cymose inflorescences, Phylogeny of Angiosperms 283

atophyllaceae (towards the end of Magnoliid complex) as having uncertain position. APG II, like Thorne places Amborellaceae and Chloranthaceae at the beginning of angiosperms (but as unplaced families), whereas family Ceratophyllaceae is placed before Magnoliids.

Chloranthaceae Taylor and Hickey (1996) consider Chloranthaceae (Figure 9.16) the basic angiosperm family. The family shows several plesiomorphic characters such as flowers in an inflorescence, plants dioecious, carpels solitary, placentation apical, and fruit drupaceous with small seeds. The family is the oldest in the fossil record, the fossil genus Clavitopollenites being assigned to Figure 9.15 Calycanthaceae. Calycanthus Chloranthaceae and closer to the genus occidentalis. A: Flowering twig Ascarina. The stems of Sarcandra are primi- with solitary terminal flower. B: tively vesselless, but Carlquist (1996) has L. S. of flower showing free car- reported vessels in this genus. The family pels. C: Flower with some tepals and stamens removed. is considered to be earliest to record wind pollination in angiosperms. The plants are mostly herbaceous, some with free carpels containing one or two species being shrubs. The flowers are highly ovules. A number of families are included reduced, subtended by a bract and without in the group. Thorne (2000) had placed all of any perianth, and arranged in decussate them under Magnoliales, along with Magno- liaceae and Winteraceae. In his later revision (2003), however, placed Amborellaceae and Chloranthaceae (together with Trime- niaceae and Austrobaileyaceae) under Chlo- ranthales, the first order of Magnoliidae (and accordingly angiosperms), the families arranged in that order. Subsequently (2006, 2007) he separated them under distinct subclass Chloranthidae, at the begining of angiosperms. The family Ceratophyllaceae is placed after the monocot families, towards the beginning of Ranunculidae. The placement of Amborellaceae at the beginning of angiosperms is found in the classification Figure 9.16 Chloranthaceae. A: Ascarina schemes of Judd et al. (2003), APG II (2003) lanceolata, flowering branch. B: A male flower C: fruit D: Bi- and APweb (Stevens, 2003). The position of sexual flower of Chloranthus the other two families is, however, not set- henryi with bract, three stamens tled. Judd. et al. and APweb consider both and pistil with tufted stigma. Chloranthaceae (towards the end of basal E: Bisexual flower of Sarcandra families before Magnoliid complex) and Cer- glabra. 284 Plant Systematics pairs. The flowers are unisexual in Ascarina, Hedyosmum and Ascarinopsis but bisexual in Chloranthus and Sarcandra. Stamens vary in number from 1 to 5. The carpel lacks style, and single orthotropous ovule is bitegmic. Taylor and Hickey believe in the origin of Chloranthaceae from gnetopsids, hypoth- esizing that the ovule and the bract subtending the floral unit in Chloranthaceae are homologous with one of the terminal ovules and proanthophyll subtending the anthion (inflorescence unit) of gnetopsids. Chloranthaceae has undergone considerable reduction in its number of parts as well as general level of elaborateness. They also believed that the outer integument of the angiosperm bitegmic ovule has ring-like origin and is homologous with the ovular bracts that form the second integument in the gnetopsids. Figure 9.17. Ceratophyllaceae. Ceratophyllum submersum. A: A portion of plant; B: Whorl of leaves at node; C: Ceratophyllaceae Male flower; D: Young stamen; Chase et al., (1993) on the basis of rbcL had E: Dehiscing stamen; F: Fruit; G: expressed the view that Ceratophyllaceae Longitudinal section of fruit with represents the basal angiosperm family. The pendulous seed. family has fossil record extending back to apomorphic character-states. Parsimony the Early Cretaceous. Cladistic studies by analysis using PAUP resulted in 10 trees at Sytsma and Baum (1996) based on molecu- 590 steps. Calycanthaceae appeared as first lar data support the placement of branch. Magnoliaceae, Winteraceae and Ceratophyllum (Figure 9.17) at the base of an- Chloranthaceae hypotheses appeared two giosperms, but the authors cautioned that steps longer, whereas Ceratophyllaceae and resolution of basal angiosperm relationships Casuarinaceae hypotheses appeared six steps may have to await both the collection of ad- longer. ditional molecular and morphological data as Other families that are considered belong- well as further theoretical advances in phy- ing to paleoherbs and share plesiomorphic fea- logenetic systematics. Hickey and Taylor tures include Saururaceae, Piperaceae, (1996) felt that aquatic plant with highly re- Aristolochiaceae, Barclyaceae, Cabombaceae duced vegetative body and pollen wall, and Nymphaeaceae. They share characters tenuinucellate, unitegmic ovules is a poor of herbaceous habit, tectate-columellate candidate for the basal-most position. Thorne monosulcate pollen, apocarpous gynoecia, (1996) believed the family is highly specialized and its relationships are highly ob- and simple floral units. scured. Other specialized features include lack of roots, dissected leaves, reduced vas- Amborellaceae culature and the lack of stomata. The family Amborellaceae has attracted Loconte (1996) carried out cladistic analy- considerable interest in the recent years, sis of the above taxa proposed by different being unique in angiosperms in lacking authors as most basal angiosperms. He in- pollen tectum and being inaperturate to cluded 69 taxa in the study scoring 151 lacerate. Amborellaceae (Figure 9.18) are Phylogeny of Angiosperms 285

primitive living angiosperms being woody or herbaceous, the general features of primitive angiosperms are largely settled. They have simple alternate exstipulate leaves, which are entire and petiolate with poorly organized reticulate venation and with unilacunar, two-trace nodes. The vessels are absent or tracheid-like. Flowers are bisexual, radially symmetrical with spirally arranged floral parts. Stamens are broad, undifferentiated with marginal microsporangia. Carpels are broad with large number of ovules, stigma along the margin and not completely sealed, ovules bitegmic, crassinucellate. Fruits are follicular.

Coevolution with Animals Studies on comparative morphology, pollina- Figure 9.18 Amborellaceae. Amborella trichopoda. A: Fully opened fe- tion biology and biochemistry have clearly male flower; B: Close up of a elucidated the role of animals in the evolu- branch; C: Male flower. (photo tion of angiosperms. It is suggested that B, courtesy University of Cali- Animal kingdom and Plant kingdom, particu- fornia, Santa Cruz; A, photo larly the Angiosperms have undergone a pro- courtesy Missouri Botanical cess of co-evolution, wherein the evolution Garden). of one has influenced the other. This has proceeded in various ways. shrubs without vessels, with unilacunar nodes, 2-ranked, exstipulate leaves; the margins are both serrate and rather undu- Pollination late. The plant is dioecious and the flowers Early seed plants, the gymnosperms were are small in cymes, with an undifferenti- wind pollinated with sticky sap exuding from ated perianth of spirally arranged 5-8 tepals. micropyles trapping the pollen. Early insects, The staminate flowers have 10-25 stamens, the beetles were probably attracted to this sessile anthers and pollen with granulate sap and pollen by chance. The better polli- ektexine. The carpellate flowers have 1-2 nation and increased seed set encouraged staminodes and 5-6 whorled incompletely the selection towards showy flowers more at- closed carpels that develop into drupelets tractive to insects, edible flower parts, pro- with pock-marked stones and pockets of al- tein rich pollen, nectaries and bisexual flow- most resinous substances. ers so that same insect visit can both Relationships at the base of the an- deposit the pollen and pick up for visit to angiosperm lineage are being clarified. other flower. Increased visits by insects posed Amborellaceae are most likely to be sister danger to the exposed seeds, resulting in to other angiosperms, Nymphaeaceae sis- selection towards protection of seeds in ter to the rest, then Austrobaileyales. closed carpel, a major step towards the evolution of angiosperms. Increased protection of seeds encouraged smaller seeds in EVOLUTIONARY TRENDS increased numbers and shorter life cycle to Although there has been some recent con- overcome drought conditions. Complete troversy regarding the habit of the most closure of carpel was accompanied by the 286 Plant Systematics differentiation of stigmatic region for receiv- ingested by the insect larvae elevate the ing pollen, and the distinct style to keep the level of hormone, resulting in their develop- stigma within the reach of insects. To suite ment into abnormal asexual adults. The lar- to the floral mechanisms the early beetles vae as such, learn to avoid such plants. were slowly replaced by higher insects such Some plant products help insects against as moths, butterflies, bees, wasps and flies, predators. Monarch butterfly, for example, coinciding with the floral diversification of ingests cardiac glucoside from milkweed angiosperms. Asclepias. Such butterflies if ingested by Beetle pollinated flowers are typically dull blue jays make latter violently sick. Blue or white with fruity odours, edible petals and jays learn to recognize the toxic brightly heavily protected seeds. Bee pollinated flow- coloured monarch butterflies. The milkweed, ers are brightly coloured (blue or yellow but thus helps to protect monarch butterfly from not red) with honey guides and with lot of pol- blue jay. len and nectar. Butterfly pollinated flowers are red, blue or yellow. Moth pollinated flowers Basic evolutionary trends mostly open at night and have heavy fragrance to attract moths. Moth and Butterfly Evolution within Angiosperms has proceeded pollinated flowers generally have long corolla along different lines in different groups. Nu- tubes with nectaries at the base. Bird polli- merous trends in the evolution of an- nated flowers are bright red or yellow, pro- giosperms have been recognized from com- duce large amount of nectar, with little or no parative studies of extant and fossil plants. fragrance. Bat pollinated flowers are dull The general processes involved in attaining coloured, open at night and have fruity odour. diversity of angiosperms are underlined below. Biochemical coevolution Fusion Plants and their insect predators are believed to have undergone adaptive radiation in During the course of evolution in an- stepwise manner, with the plant groups giosperms, fusion of different parts has led evolving new and highly effective chemical to floral complexity. Fusion of like parts has defenses against herbivores and the latter led to the development of gamosepaly, continually evolving means of overcoming gamopetaly, synandry and syncarpy in vari- these defenses. Mustard oils of Brassicaceae ous families of angiosperms. Stamens have are toxic for many animals, yet they attract shown fusion to different degrees: fusion of other herbivores such as cabbage worm filaments only (monadelphous condition in which uses the mustard oils to locate the Malvaceae), fusion of anthers only cabbage plant for laying its eggs. The chemi- (syngenesious condition found in cal hypericin in genus Hypericum repels al- Asteraceae) or complete fusion (synandry as most all herbivores but the beetle genus in Cucurbita). Carpels may similarly be fused Chrysolina can detoxify hypericin and use it only by ovaries (Synovarious: to locate the plant. Caryophyllaceae), only by styles (synstylous: The evolution of new chemical defense of Apocynaceae) or complete fusion of both ova- plant has resulted in plants often acquiring ries and styles (Synstylovarious: Solanaceae, the growth hormones found in insect larvae. Primulaceae). Fusion of unlike parts has re- Proper levels of juvenile hormone in insect sulted in an epipetalous condition (fusion of larvae are essential for the hatching of in- petals and stamens), formation of sect larvae into normal sexual adults. Sev- gynostegium (the fusion of stamens and gy- eral species of plants such as Ageratum con- noecium: Asclepiadaceae) and formation of tain hormone juvabione, similar to the ju- an inferior ovary (fusion of calyx with ovary: venile hormone of insects. Such plants if Apiaceae, Myrtaceae, etc.). Phylogeny of Angiosperms 287 Reduction Remoration Relatively simple flowers of many families The term was suggested by Melville (1983) have primarily been the result of reduction. to refer to evolutionary retrogression found The loss of either stamens or carpels has in angiosperms and their fossil relatives. resulted in unisexual flowers. The loss of one The fertile shoots of angiosperms, accord- perianth whorl has resulted in ing to him, show venation pattern changes monochlamydeous forms, and their total ab- progressively from vegetative leaves through sence in achlamydeous forms. There has successive older evolutionary stages in also been individual reduction in the num- bracts and sepals, and the most ancient in ber of perianth parts, number of stamens and petals. The innermost parts in a bud as such carpels. Within the ovary different genera represent the most primitive evolutionary have shown reduction in the number of condition, and the outermost the most re- ovules to ultimately one, as seen in the cent condition. transformation of follicle into achene within There has been some shift in the under- the family Ranunculaceae. There has also standing of angiosperm phylogeny to support been reduction in the size of flowers, mani- the stachyosporous origin of angiosperm fested in diverse families such as carpel (Taylor and Kirchner, 1996). With the Asteraceae and Poaceae. Reduction in the acceptance of such a viewpoint, the repro- size of seeds has been extreme in ductive axis with many flowers, few carpels Orchidaceae. Male flower of Euphorbia pre- per flower and few ovules per carpel are an- sents a single stamen, there being no peri- cestral. Evolution proceeded along two direc- anth or any trace of a pistillode, only a joint tions from this: one with few flowers, each indicates the position of thalamus and the of which had many carpels and few ovules demarcation between the pedicel and the and the other with few flowers, each filament. containing few carpels and many ovules. The evolutionary trends in angiosperms are thus Change in Symmetry often complicated and frequent reversal of From simple radially symmetrical actino- trends may be encountered, as for example morphic flowers in primitive flowers devel- the secondary loss of vessels in some oped zygomorphic flowers in various fami- members. lies to suit insect pollination. The size of corolla tube and orientation of corolla lobes Xylem evolution changed according to the mouthparts of the Xylem tissue of angiosperms largely consists pollinating insects, with striking specializa- of dead tracheids and vessels, supporting fi- tion achieved in the turn-pipe mechanism bers and living ray cells. Tracheids are elon- of Salvia flowers, and female wasp like flow- gate, imperforate water conducting cells ers of orchid Ophrys. found in almost all lower vascular plants, gymnosperms and angiosperms. Vessels are Elaboration perforate elements largely restricted to an- This compensating mechanism has been giosperms, although also found in extant found in several families. In Asteraceae and gnetopsids, some species of Equisetum, Se- Poaceae, the reduction in the size of flowers laginella, Marsilea and Pteridium. The pres- has been compensated by an increase in the ence of vessels in gnetopsids, the closest number of flowers in the inflorescence. relatives of angiosperms, had given rise to Similarly, reduction in the number of ovules the speculation that the latter arose from has been accompanied by an increase in the former. The studies of Bailey and associates, size of ovule and ultimately seed, as seen in however, showed that the vessels in the two Juglans and Aesculus. groups arose independently. In gnetopsids, 288 Plant Systematics

Figure 9.19 Presumed evolutionary transformation of gymnosperm tracheid with circular pitting (A) to angiosperm tracheid with scalariform pitting (B), further to vessel-element with oblique perforation plate with numerous scaraliform bars (C). Further shortening and broadening of vessel-element, perforation plate becoming more and more horizontal and reduction in the number of bars in the perforation plate ultimately led to shortest, broad vessel element with transverse simple perforation plate. Ves- sel-element E shows one scalariform and one simple perforation plate. Note conspicuous tails, a reminder of tracheids in vessel-elements D, E and F with still oblique perforation plates. J represents the vessel-element of Quercus alba, being more broader than long and with a simple large perforation. they developed from tracheids with circular Because all fossil and almost all extant pitting and in angiosperms from tracheids gymnosperms possess tracheids with circu- with scalariform pitting. It is also pointed out lar-bordered pitting, it has led to the conclu- by Carlquist (1996) that circular pitting in sion that the tracheid is the most primitive the vessels of gnetopsids, as also the gym- type of tracheary element in the an- nosperm tracheids in general, is different giosperms. As tracheids have given rise to from angiosperms in having pits with torus vessel elements, the most primitive type of and pit margo with pores much larger than vessels have long narrow vessel elements those of angiosperms. Although some an- with tapering ends. The tracheids in angiosperms do have pit membrane with torus, giosperms have scalariform pitting, and as the pit margo is always absent. such it is assumed that these tracheids Phylogeny of Angiosperms 289 arose from tracheids of gymnsperms with stem metaxylem by Takahashi, 1988). This circular pitting. In the transformation of tra- led Carlquist to conclude that vessels have cheids with scalariform pitting to vessel el- originated numerous times in dicotyledons. ements with scalariform pitting, the earli- It had often been held that vessels arose est elements had perforation plates with nu- first in the secondary xylem and later in the merous scalariform bars. During further evo- metaxylem, and that specialization has lution of vessels, elements became smaller gradually advanced from the secondary to and broader, and perforation plates more primary xylem. Carlquist pointed out that horizontal. There has been an accompanied scalariform pitting is widespread in the met- reduction in the number of scalariform bars, axylem of vascular plants and if primitive resulting in shortest broadest vessel ele- angiosperms were herbs, in accord with ments with simple perforation plate and paleoherb hypothesis, metaxylem would be transverse end wall (Figure 9.19) in most expected to have scalariform pitting of advanced forms. Hamamelididae were once tracheary elements. The development of regarded to be primitive due to their simple woody habit—if featured paedomorphosis— floral structure, but have advanced vessel would extend scalariform patterns in second- elements and thus considered advanced ary xylem. over Magnoliidae with primitive elongated narrow vessel elements. This is supported by studies on floral anatomy and palynology. Stamen Evolution Carlquist (1996), based on a survey of wood The most primitive type of Stamen in an- anatomy, has identified a number of distinct giosperms represented in genera like Degen- evolutionary trends in angiosperms. The eria, Austrobaileya, Himantandra and Magno- cambial initials have shortened, the ratio lia (Figure 9. 20) and other primitive genera of length accompanying fibers to vessel ele- is laminar, 3-veined leaf-like organ without ments (F/V ratio) has shown an increase any clear cut distinction of fertile and ster- from 1.00 in primitive dicotyledons to about ile parts. The pollen sacs (sporangia) are 4.00 in the most specialized woods, and an- borne near the centre either on the abaxial gular outline of vessels changed to circular (dorsal) side (Degeneria, Annonaceae and outline together with widening of their di- Himatandraceae) or on adaxial (ventral) side ameter. There was also a progressive reduc- (Austrobaileya and Magnolia). Semilaminar tion in the number of scalariform bars, ulti- stamens occur in some other primitive fam- mately resulting in simple perforation, fa- ilies like Nymphaeaceae, Ceratophyllaceae cilitating an easier flow of water. The lat- and Eupomatiaceae. In further specializa- eral walls showed a shift from scalariform to tion of stamen, there has been reduction of the opposite circular pits and finally to al- sterile tissues and retraction of marginal ternate circular pits, so as to provide better areas. The proximal part became filament mechanical strength. Imperforate tracheids and distal part the anther. The midvein re- have shown a shift to fibre-tracheids to fi- gion formed the connective, and distal part nally libriform fibres. Shortening of fusiform the appendage, as seen in several genera. initials is correlated with storeying of woods. In primitive families, connective forms a It is interesting to note that cladistic stud- major part of anther. In more advanced fami- ies have shown that present-day vessel-less lies, the connective is highly reduced angiosperms do not form a single clade and (Acanthaceae, Plantaginaceae) or may be are distributed in diverse groups such as almost absent. In some families such as Hamamelidales (Trochodendron and Betulaceae, the connective as well as the Tetracentron), Magnoliales (Amborellaceae, upper part of filament may become divided Winteraceae), and Laurales (Sarcandra: Ves- and two anther lobes get separated. In more sels have been, however, reported in root primitive families the connective is secondary xylem by Carlquist, 1987 and in produced above into an appendage which 290 Plant Systematics

Figure 9.20 Evolution of stamen in angiosperms. A-D: Primitive laminar stamens without clear distinction of anthers and filaments; A: Austrobaileya scandens with adaxial pollen sacs (microsporangia); B: Himantandra baccata with abaxial pollen sacs; C: Degeneria vitiensis with abaxial pollen sacs; D: Magnolia maingayi with adaxial pollen sacs; E: Laminar stamen of Magnolia nitida with marginal pollen sacs and prolonged sterile appendage; F: Semilaminar stamen of Michelia fuscata with marginal pollen sacs and narrowed filament; G: Outer semilaminar stamen of Nymphaea odorata with petaloid filament and narrow anthers; H: inner stamen with narrower filament and differentiated anther region; I: Stamen of Illicium parviflorum with reduced anther region and broad filaments; J: Stamen of Opuntia pusilla with well differentiated anthers and filament; K: Stamen of Poa pratensis with reduced connective and thread-like filament; L: Stamen of Penstemon canescens with well-defined filament and large anthers with distinct anther lobes but reduced connective; M: Stamen of Betula nigra with divided connective and filament. disappears progressively in more advanced It is generally agreed that primitive families. stamen was laminar, with two pairs of spo- Broad laminar filament, merging with the rangia, borne on adaxial or abaxial side, be- rest of stamen represents the most primi- cause both situations are met in primitive tive state. It becomes narrower and finally families. During the course of evolution, the terete in advanced families. The stamens stamen became more slender, its laminar with well marked narrow filament may have form slowly disappearing, and sporangia basal, dorsal or versatile attachment with occupying marginal position. The transfor- anthers. Basifixed condition is the most mation of broad laminar to narrow stamens primitive, versatile the most advanced of- is clearly depicted in Nymphaea from outer ten commonly seen in grasses and to inner stamens and in different species of Amaryllidaceae. the genus. Phylogeny of Angiosperms 291

A typical anther of angiosperms is monothecous anthers of Malvaceae and bithecous with two anther lobes with the two some other families result from splitting of anther sacs in each, finally merging into stamens, thus separating the two anther one. The anther with a single anther lobe, lobes. In others, like Salix, there may be a as in Malvaceae, has a single final sac partial connation of two stamens resulting (theca) and as such monothecous. The in apparent dichotomy. Anatomical evidence

Figure 9.21 Two different models for evolution of exine and pollen grains in Angiosperms. Walker and Walker, 1984 (on left). A: Exine of ancestral gymnosperm with homogenous sexine and laminated nexine; B: Same but sexine with granular infratectal layer; C: Pollen grain of same, boat shaped and monosulcate; D: Exine of most primitive angiosperm with smooth sexine and disappearance of laminated nexine; E: Same but with homogenous sexine; F: Monosulcate pollen of same; G: Exine with development of tectum, infratectal layer and homogenous nexine; H: Same but with loss of tectum.: I: Monosulcate pollen grain with intectate exine. Brenner, 1996 (on right). I: Exine of early angiosperm, tectate-columellate and without aperture; II: Exine with initiation of endexine (shaded solid black); III. Nonaperturate early pollen with circular outline; IV: Exine with complete endexine layer and initiation of sulcus; V: Exine with developed sulcus; VI: Monosulcate pollen of basal angiosperms; VII: Monosulcate boat-shaped pollen of Magnoliids and monocots; VIII: Circular monosulcate pollen of dicots; IX: Tricolpate pollen of Eudicots which might have developed from monosulcate or inaperturate forms; X: Uniporate pollen; XI: Uniporate pollen of Winteraceae in tetrads. (Modified from Brenner, 1996). 292 Plant Systematics shows two independent vascular supplies lar in outline, tectate columellate, and with- derived from opposite sides of the receptacle, out aperture. A possible intine thickening as opposed to families where splitting of sta- was accompanied by developments of endex- mens occurs. ine layer above intine in Hauterivian. The next step involved evolution of sulcus and divergence of monocot and dicot pollen types Pollen grain evolution from basic dicot stock. In Barremian diver- A large number of families in monocots and sification of monosulcate pollen grains oc- several primitive dicots of the magnoliid curred with migration to different geographi- complex bear monosulcate pollen grains, a cal regions. In Lower Aptian tricolpate pol- condition generally considered to be the len evolved from either monosulcate or primitive one in angiosperms. Walker and inaperturate forms in northern Gondwana, Doyle (1975) and Walker and Walker (1984) resulting in evolution of eudicots. suggested that the primitive angiosperm It is suggested by Brenner that the for- pollen grain is large- to medium-sized, boat- mation of sulcus during Early Cretaceous shaped, smooth-walled, with homogenous or may have been an adaptation that was a granular infratectal layer, the tectum being more effective way of releasing recognition absent (pollen atectate) and endexine (a proteins involved in pollen-tube development layer unique to angiosperms, being absent while the later development of tricolpate con- in gymnosperms) either missing or poorly dition in the Aptian would be a further ex- developed under the apertural area. This tension of this process. type of pollen is found among extant an- The formation of endexine before aperture giosperms in Annonaceae, Degeneriaceae development may reflect the development of and Magnoliaceae. The prototype of this was intine thickening, which is related to sul- gymnosperm pollen which was monosulcate, cus development. In extant angiosperms, the large, boat-shaped with laminated nexine, intine beneath the aperture stores recogni- homogenous sexine or with granular tion proteins. infratectal layer (Figure 9.21), a pollen type common in Bennettitales, Gnetopsids (excluding Gnetum) and Pentoxylon. In evolution Carpel evolution of angiosperm pollen from this, the lami- Carpel is a structure unique to angiosperms nated nexine disappeared, nexine became enclosing and protecting ovules. The evolu- granular to tectate with columella and re- tion of carpel probably played a major role in ticulate surface to those with intectate diversity and success of angiosperms as it collumellae. not only protected seeds from predators, but Brenner and Bickoff (1992) recorded glo- also carried associated benefits. These in- bose inaperturate pollen grains from the cluded seed dissemination via the evolution Valanginian (ca 135 mya) of the Helez for- of numerous dispersal mechanisms, effec- mation of Israel, now considered to be the tive fertilization by transport of pollen grains oldest record of angiosperm fossils. These to the stigma and growth of a pollen tube, pollen grains resemble those of Gnetum in promotion of outbreeding by insect pollina- general shape and lack of aperture, and also tors through the evolution of special struc- found in Chloranthaceae, Piperaceae, and tural mechanisms and through the devel- Saururaceae, which are gaining increased opments of intraspecific and interspecific attention as basal angiosperm families. This incompatibilty. led Brenner (1996) to postulate a new model It is more common in recent years to dif- for the evolution of angiosperm pollen. The ferentiate three types of carpels, a termi- earliest pollen in angiosperms, developed in nology developed by Taylor (1991). Ascidiate Valanginian or earlier from stock that also carpels have ovules attached proximally to gave rise to Gnetum, had small pollen, circu- the closure, plicate ones have ovules Phylogeny of Angiosperms 293 attached along margins of the closure and Phyllosporous origin ascoplicate carpels are intermediate between the two. Among the believers of phyllosporous origin, The nature of carpel in angiosperms has suggest that carpel is a folded leaf with been the subject of considerable discussion. adaxial surfaces (conduplicate), or involute The dominant view supported by Bailey and abaxial surfaces in contact (involute) with Swamy (1951), Cronquist (1988), Takhtajan many ovules along the margins (or (1997) and several others considers carpel submargins) of closure (Bailey and Swamy, as homologous to megasporophyll, appropri- 1951; Eames, 1961). Others suggest that the ately named as phyllosporous origin of car- leaf is fundamentally peltate (Baum, 1949; pel (Lam, 1961). Others believe that carpel Baum and Leinfellner, 1953), as many car- consists of a subtending bract with placenta pels have cup-shaped primordia. representing a shoot with distally placed The conduplicate view of the origin of car- ovules, concept named as stachyosporous pel was advocated by Bailey and Swamy origin (Pankow, 1962; Sattler and Lacroix, (1951). In primitive type of carpel, the stigma 1988). is represented by a crest extending from

Figure 9.22 Phyllosporous concept of carpel evolution. A-I, conduplicate closure; J-N, involute closure; O-U, closer along margins. A: Carpel of Drimys piperita with long stigmatic crest; B: Transverse section of same showing partially closed margins; C: Trans- verse section of carpel of Degeneria vitiensis with flared up margins and conspicuous papillose growth; D-F: Stages in conduplicate closing of carpel with disappearance of stigmatic region (broken lines) from the body of carpel and its localization towards the tip, resulting in marginal placentation; G: Fusion of adjacent carpels by lateral cohesion of open conduplicate carpels forming parietal placentation; H: Fusion by adnation of free margins of conduplicate carpels to the thalamus forming axile placentation; I: Fusion by cohesion of ventral surfaces of the carpels formong axile placentation. J-K: Involute closing of carpels by meeting of dorsal surfaces of carpels. M-N: Examples of fused carpels with involute closure. L: Erythraea centaurium; M: Isanthus brachiatus; N: Limnophila heterophylla. O-Q: Closure by fusing margins of carpel with ultimate merging of ventral bundles; R: Fusion of margins of adjacent opens carpels with merging of ventral bundles and formation of parietal placentation. S-U: Fusion of sides of closed carpels with merging of adjacent lateral bundles and ventral bundles resulting in axile placentation. (A-H based on Bailey and Swamy, 1951; J-N based on Eames, 1961; O-U after Eames and MacDaniels, 1947). 294 Plant Systematics apex to base of carpel (decurrent) as in some tively primitive families. The ovules in species of Drimys, Himantandra and these carpels derive their vascular supply Degeneria. In Degeneria and Butomus, the chiefly from a smaller meshwork of the double nature of the crest is evident in mar- bundles, and rarely from dorsal bundle or gins flaring back from the line of contact. In ventral bundles. There was consequent re- Degeneria and Drimys, the margins of car- duction in the number of ovules and their pels are incompletely closed by interlocking restriction to submarginal position with vas- papillose cells of the stigmatic crest. The cular supply coming from ventral bundles. carpels have three traces, one dorsal and two The evidence of this transition is seen in ventral, the latter providing vascular supply Winteraceae and Degeneriaceae. to ovules. From this type of carpel, the closed Closing of carpels may also result from carpel of other angiosperms developed by clo- fusing of incurved margins of carpels. Pro- sure of adjacent adaxial surfaces (Figure gressive fusion results in final fusion of ad- 9.22 D-F) and concentration of stigmatic jacent ventral bundles (Figure 9.22 O-P) in margins to the upper part of the carpel, re- follicular carpel. Fusion of margins of adja- duction in the number of ovules and their cent open carpels results in parietal placen- restriction to lower part differentiating as tation with only ventral bundles ultimately ovary, the middle sterile portion forming the merging, whereas the fusion of sides of style. The fusion of adjacent carpels in the closed carpels results in axile placentation formation of syncarpous gynoecium may with both adjacent lateral bundles as well have proceeded along different directions. as ventral bundles merging. Lateral cohesion of open conduplicate car- Involute closing of carpels was advocated pels resulted in unilocular ovary with pari- by Joshi (1947), Puri (1960) and several other etal placentation (Figure 9.22 G). Axile pla- workers. In such carpels, the margins of the centation (with number of locules equalling carpel are involuted and abaxial (and not the number of fusing carpels) may have re- adaxial surfaces) or margins are in contact. sulted from adnation of free margins to the The example of such carpels involved in the thalamus (Figure 9.22 H) or cohesion of ven- formation of syncarpous gynoecium is seen tral sutures of carpels (Figure 9.22 I). Differ- in several genera (Figure 9.22 L-N). Although ent families of angiosperms exhibit differ- there have been suggestions that involute ent degrees of fusion, some like types may have evolved from conduplicate Caryophyllaceae with free styles and stig- types, Eames (1961) considered it highly un- mas, others like Solanaceae with complete likely, as such a derivation would involve fusion of ovaries, styles and stigmas. Free change from contact by adaxial sides to con- central placentation may result from disso- tact by abaxial sides, a major change, far lution of septa from ovary with axile placen- more complicated and circuitous than usu- tation (Caryophyllaceae) the placental col- ally found in evolutionary derivation. He umn being attached to the base and top of suggested that several independent closure the ovary. It may also result from protruding of carpels occurred in different phylogenetic thalamus carrying the placenta from the lines. base of the ovary (Primulaceae). The basal The theory that the carpel is a peltate placentation with the number of ovules re- leaf was strongly advocated by Baum and duced to basal one may be derived from one Leinfellner (1953). The peltate form of car- (Alismataceae) or more than one carpels pel is assumed to have arisen by turning up- (Asteraceae). ward (ventrally of the basal lobes of the Laminar placentation with ovules scat- lamina and their fusion, margin to margin, tered over the entire inner surface of the as in the formation of peltate leaves. A trans- ovary wall is considered to be the most primi- verse meristem, known as cross zone, de- tive type, present in Nymphaeaceae, velops where the two marginal meristems Cabombaceae, Butomaceae and other rela- meet. As the carpel primordium elongates, Phylogeny of Angiosperms 295

Sister Groups Angiosperms Kirchner (1996). The theory is gaining increased interest with the renewed interest ancestral derived in gnetopsids as close relatives of angiosperms. The theory holds that the carpel few flowers envelope represents a bract and placenta many (> 7) carpels/flower homologous with a shoot bearing distally placed ovules. This bract-terminal ovule system is directly homologous to the one found Many “flowers”, many flowers 1 or 2 ovules/ 1 or 2 carpels/flower, in outgroups including Gnetales, the clos- “flower” 1 or 2 ovules/carpel est living sister-group. According to this theory, ascidiate carpel with few ovules rep-

few flowers resents an ancestral stage. It is believed 1 or 2 carpels/flower, that the origin of plicate (conduplicate) and many (> 7) ovules/carpel ascoplicate carpel types would be due to in- Figure 9.23 Evolution of carpel and floral types tegration of the gynoecial primordia and ovu- in angiosperms based on lar (placental) growth areas. stachyosporous model proposed Taylor and Kirchner found further evi- by Taylor and Kirchner (1996). An- dence for stachyosporous origin from: cestral type is based on suggested 1. Ingroup phylogeny based on structural homologies between female struc- and DNA sequences, rbcL cpDNA tures of sister groups. datasets which place either woody or herbaceous magnoliids as basal clades the cross zone, continuous with the marginal suggest that ascidiate carpels with 1 meristems, is said to build up a ventral strip or 2 ovules represent ancestral state. of carpel wall, which, united with the lateral 2. Outgroup analysis involving walls, forms a tubular organ. Under this Bennettitales, Gnetales and theory, the ovules are borne on the wall Cordaitales which suggest that female formed by the cross zone. Peltate carpels may reproductive structures are compound be manifest peltate carpels with well-de- organs. fined stalks and tubular lamina with well- 3. Morphogenic analysis involving un- marked cross zone (Thalictrum) or latent derstanding of floral development in peltate with short tubular base and cross Antirrhinum and Arabidopsis through zone present only in early ontogeny mutagenic analysis, study of the de- (Calycanthus). According to this theory, the velopment of carpel in Datura by ex- achene of Ranunculus having a single ovule amining chromosomal chimeras (car- on latent cross zone is considered to be the pel wall is similar to petals and leaves first stage in the building of tubular follicle. in development; carpel with two types This theory is reverse of the most commonly of primordia, one forming the wall and held view that the follicle represents a more one with distinct central ridge which primitive state, and that the achene of Ra- develops into septum, placenta and nunculus is derived. false septum and functions like floral apex), study of carpel development in Stachyosporous origin Nicotiana using Ac-GUS reporter sys- The idea was first developed by Hagerup tem using GUS bacterial gene as (1934, 1936, 1938) who suggested that con- marker (showing that whereas carpel duplicate carpels have two growth areas. The wall is composed only L1 and L2 lay- theory was further developed by Lam (1961), ers, the placental region has an addi- Melville (1962, 1983—who proposed a varia- tional L3 layer). tion of this as gonophyll theory) and more Based on new evidence, Taylor and recently Taylor (1991) and Taylor and Kirchner concluded that ancestral carpel is 296 Plant Systematics ascidiate with marginal stigma and basal to theory (axial theory) developed by German slightly lateral placentation of one or two school of botanists and supported by Schleide, orthotropous ovules. The evolution of curved Eichler, Sachs and others, according to which ovules and placement of the ovules in other inferior ovary resulted from invagination of positions was to direct the micropyle away the floral receptacle which surrounds the from the stigma or pollen-tube transmission- ovary. tissue. They suggested that reproductive The accumulating anatomical evidence axes with many flowers, few carpels per has shown that inferior ovary has evolved a flower, and few ovules per carpel were an- number of times in different groups of ancestral (Figure 9.23). giosperms, in some due to adnation of floral From such an ancestral type developed parts and in others due to axial invagina- two types of inflorescences: one with few tion. In certain plants like Hedera, separate flowers, each of which had many carpels and traces related to different floral organs are few ovules and the other with few flowers found, in others like Juglans, different stages each containing few carpels and many of bundle fusion can be found in the inferior ovules. ovary. Such plants also have normal orientation of vascular bundles (phloem outside, Gonophyll theory xylem inside) and evidently, the inferior ovary is appendicular in origin. Melville (1962, 1983) developed his gonophyll An axial invagination of floral receptacle theory largely on the basis of studies of vas- will eventually result in inverted vascular culature in leaves and floral whorls. This bundles (xylem on outside, phloem inside) theory is a variation of stachyosporous ori- in the inner part of inferior ovary, with nor- gin. According to him, the ovary consists of mal orientation in the outer part. This has sterile leaves and ovule-bearing branches been observed in the inferior ovaries of attached to the petiole of the leaf. Each leaf, Cactaceae and Santalaceae. In others like together with the fertile branch, is consid- Rosa, the lower part of the fleshy receptacle ered a unit and termed as gonophyll instead has invaginated receptacular tissue of carpel. This theory has already been dis- whereas the upper portion consists of fused cussed under probable ancestors of an- floral parts. The adnation of floral parts giosperms. above or surrounding the ovary in a large number of plants forms hypanthium, a structure distinct from but often confused Evolution of Inferior ovary with the calyx tube, the latter involving It has been universally agreed that the in- the cohesion of sepals only. The develop- ferior ovary in angiosperms is a derived ment of inferior ovary has occurred within state. The nature of origin of this type had several families, as genera with superior two opposing views. Linnaeus, de Candolle ovary and those with inferior ovary may and many early botanists believed in the be encountered in the same family as origin of an inferior ovary through adnation seen in Rosaceae, Gesneriaceae, of bases of outer floral whorls to the gyno- Nymphaeaceae and several others. In ecium, a view known as appendicular Nymphaeaceae, Nuphar has superior theory (Candollean theory, concrescence ovary, Nymphaea semi-inferior and theory). Others believed in the receptacular Euryale superior ovary. Chapter 10 Systems of Classification

The urge to classify plants has been with Preliterate Mankind man since he first set his foot on this planet, borne of a need to know what he should eat, Although no written records of the activities avoid, use as cures for ailments and utilize of our preliterate ancestors are available, it for his shelter. Initially, this information is safe to assume that they were practical was accumulated and stored in the human taxonomists having acquired knowledge as brain and passed on to generations through to which plants were edible and which cured word of mouth in dialects restricted to small their ailments. Primitive tribes in remote communities. Slowly, man learned to put his areas of the world still carry the tradition of knowledge in black and white for others to preserving knowledge of the names and uses share and improve upon. We have now of plants by word of mouth from one genera- reached a stage whereby a vast amount of tion to another. Such classifications of information can be conveniently stored and plants developed by isolated communities utilized for far-reaching conclusions aimed through the need of the society and without at developing ideal systems of classification, the influence of science are termed Folk tax- which depict the putative relationships be- onomies; often parallel modern taxonomy. tween organisms. Historical development of The common English names grass and sedge classification has passed through four dis- are equivalent to the modern families tinct approaches, beginning with simple Poaceae and Cyperaceae and illustrate this classifications based on gross morphology to parallel development between folk taxonomy the latest phylogenetic systems incorporat- and modern taxonomy. ing all types of phenetic information. Early Literate Civilizations CLASSIFICATIONS BASED ON Early civilizations flourished in Babylonia, Egypt, China and India. Though the written GROSS MORPHOLOGY records of Indian botany appeared several cen- Classifications based on features studied turies before those of the Greeks, they re- without microscopic aids continued until the mained in obscurity, not reaching the outside seventeenth century, when the naked eye world. Moreover, they were written in San- was the sole tool of observation. The trail skrit, a language not easily understood in the backwards leads us to preliterate man. West. Crops such as wheat, barley, dates, 298 Plant Systematics melons and cotton were grown during the Leucippus or Alcippus, Theophrastus then Vedic Period (2000 BC to 800 BC). Indians ob- proceeded to Athens, and became a mem- viously knew about descriptive botany and ber of the Platonic circle. After Plato’s death, cultural practices. The first world symposium he attached himself to Aristotle , and after on medicinal plants was held in the Hima- the latter’s death, he inherited his library layan region in the seventh century BC. The and the garden. He rose to become the head Atharva Veda, written around 2000 BC de- of the Lyceum at Athens. scribes the medicinal uses of various plants. Theophrastus (Figure 10.1) is credited with having authored more than 200 works most Theophrastus––Father of botany of which survive as fragments or as quota- Theophrastus (372 BC to 287 BC), the suc- tions in the works of other authors. Two of cessor of Aristotle in the Peripatelic School his botanical works have survived intact, how- (those following the philosophy propagated by ever, and are available in English translations: Aristotle), was a native of Eresus in Lesbos. Enquiry into plants (1916) and The Causes of plants (1927). Theophrastus described about 500 kinds of plants, classified into four major groups: the trees, shrubs, subshrubs and herbs. He also recognized the differences between flowering plants and non-flowering plants, superior ovary and inferior ovary, free and fused petals and also fruit types. He was aware of the fact that many cultivated plants do not breed true. Several names used by Theophrastus in his De Historia plantarum, e.g. Daucus, Crataegus and Narcissus, to name a few, are in use even today. Theophrastus was fortunate to have the patronage of Alexander the Great. During his conquests, Alexander made arrangements to send back materials to Athens, enabling Theophrastus to write about exotic plants such as cotton, cinnamon and bananas. Bo- tanical knowledge at the Lyceum in Athens thus flourished during this truly golden age of learning, whose botanical advance Theophrastus was privileged to steer.

Parasara––Indian scholar Parasara (250 BC to 120 BC) was an Indian Figure 10.1 Theophrastus (372 BC to 287 BC) scholar who compiled Vrikshayurveda (Sci- the Greek philosopher, credited to be the father of botany, wrote ence of plant life), one of the earliest works more than 200 manuscripts. dealing with plant life from a scientific standpoint, a manuscript discovered a few decades His original name was Tyrtamus, but he ago. The book has separate chapters on mor- later became known by the nickname phology, properties of soil, forest types of In- ‘Theophrastus’ given to him—it is said—by dia and details of internal structure, which Aristotle, to indicate the grace of his con- suggest that the author possessed a magni- versation. After receiving his first introduc- fying apparatus of some kind. He also tion to philosophy in Lesbos from one described the existence of cells (rasakosa) Systems of Classification 299 in the leaf, transportation of the soil solu- Cicilia. Being a physician in the Roman tion from the root to the leaves where it is army, he travelled extensively and gained digested by means of chlorophyll [ranjakena firsthand knowledge about plants used for pacyamanat] into nutritive substance and treating various ailments. He wrote a truly the by-products. Plants were classified into outstanding work, Materia medica, present- numerous families [ganas] on the basis of ing an account of nearly 600 medicinal morphological features not known to the Eu- plants, nearly 100 more than Theophrastus. ropean classification until the eighteenth Excellent illustrations were added later. Writ- century. Samiganyan [Leguminosae] were ten in a straightforward style, the book was distinguished by hypogynous flowers, five an asset for any literate man for the next 15 petals of different sizes, gamosepalous calyx centuries. No drug was recognized as genu- and fruit being a legume. Svastikaganyan ine unless mentioned in Materia medica. It [Cruciferae] similarly, were differentiated as is no less a tribute to Dioscorides that a having calyx resembling a swastika, ovary beautiful illustrated copy of the book was pre- superior, 4 free sepals and petals each, six pared for Emperor Flavius Olybrius Onycius stamens of which 2 are shorter and 2 car- around 500 AD, who presented it as a gift to pels forming a bilocular fruit. Unfortunately, his beautiful daughter Princess Juliana this great scientific advance did not reach Anicia. The manuscript, better known as Europe at that time, where scientific knowl- Codex Juliana, is a prize manuscript pre- edge was just making its debut. served in Vienna. Materia medica was not a Among the other Indian scholars, Caraka deliberate attempt at classification but le- (Charaka—Ist century AD) wrote Caraka gumes, mints and umbels were described as samhita (Charaka samhita) in which he rec- separate groups. ognized trees without flowers, trees with flowers, herbs which wither after fructifica- Medieval Botany tion and other herbs with spreading stems as separate groups. This huge treatise on During the Middle Ages (fifth to fifteenth Indian medicine, containing eight divisions, century AD), little or no progress was made is largely based on a much earlier treatise in botanical investigation. During this dark published by Agnivesh. A. C. Kaviratna period in history, Europe and Asia witnessed translated it into English in 1897. wars, famine and epidemics, and the only worthwhile contribution was copying and re- Caius Plinius Secundus– copying of earlier manuscripts, unfortunately often with errors added. The straw- Pliny the Elder berry plant was thus shown to have five leaf- The decline of the Greek Empire witnessed lets instead of three in several manuscripts. the emergence of the Romans. Pliny (23 AD The manuscripts were lost at a faster rate to 79 AD), a naturalist who served under the than they could be copied. Roman army, attempted a compilation of everything known about the world in an exten- Islamic Botany sive 37-volume work Historia naturalis, 9 vol- The ascent of the Muslim Empire between umes of which were devoted to medicinal 610-1100 AD saw the revival of literacy. plants. In spite of a few errors and fanciful Greek manuscripts were translated and pre- tales from travellers, the Europeans held this served. Being practical people, they concen- work in reverential awe for many centuries. trated on agriculture and medicine and pro- Pliny died during the eruption of Vesuvius. duced lists of drug plants. Ibn-Sina, better known as Avicenna authored Canon of medi- Pedanios Dioscorides cine, a scientific classic along the lines of Dioscorides (first Century AD), of Greek par- Materia medica. Another Muslim scholar, Ibu- entage, was a native of the Roman province al-Awwan, in the twelfth century described 300 Plant Systematics nearly 600 plants, and interpreted their German Fathers of Botany. Otto Brunfels sexuality as well as the role of insects in fig (1464-1534) wrote Herbarium vivae eicones in pollination. Although Muslim scholars pro- three volumes (1530-1536), a herbal that duced several practical lists of drug plants, marked the beginning of modern taxonomy, but did not develop any significant scheme and contained excellent illustrations pre- of classification. pared from living plants. The text, however, was of little value, comprising extracts from Albertus Magnus–– earlier writers. Jerome Bock (Hieronymus Doctor Universalis Tragus), who lived between 1498 and 1554, wrote New kreuterbuch in 1539, which con- Albertus Magnus (1193-1280 AD), called Doc- tained no illustrations but did include accu- tor Universalis by his contemporaries and rate descriptions based on firsthand knowl- Aristotle of the Middle Ages by historians, edge, also mentioning the localities and is the best remembered naturalist of that habitats. He described 567 species classi- period. He wrote on many subjects. The bo- fied as herbs, shrubs and trees. The herbal, tanical work De vegetabilis dealt with me- written in German, was widely understood dicinal plants and provided descriptions of as compared to the manuscripts of earlier plants based on firsthand information. scholars, which were in Greek and Latin, Magnus is believed to be the first to recog- languages which had by then become nize monocots and dicots based on stem obsolete. Leonard Fuchs (1501-1566), structure. He also separated vascular and regarded as more meritorious than his non-vascular plants. contemporaries, wrote De Historia stirpium in 1542, containing descriptions as well as Renaissance illustrations of 487 species of medicinal The fifteenth century saw the onset of the plants (Figure 10.2). Renaissance in Europe, with technical in- Valerius Cordus (1515-1544), whose tragic novations, mainly the printing machine and early death prevented him from becoming the the science of navigation. Invention of the greatest of all herbalists, undertook to study printing machine with movable type around plants from living material. He travelled in 1440 ensured wide circulation of manu- the forests of Germany and Italy, where un- scripts. Navigation led to the successful ex- fortunately he fell ill and died at the young ploitation of botanical wealth from distant age of 29. His work Historia plantarum, pub- places. lished in 1561, many years after his death, contained accurate descriptions of 502 species, 66 apparently new. He was perhaps the Herbalists first to show how to describe plants from na- Printing made books cheap. The first to be- ture accurately. Unfortunately, Konrad come popular were medically-oriented books Gesner, the editor of his work chose to add on plants. Specialists started producing their illustrations, which were not only of poor qual- own botanical-medical books, which were ity, but also wrongly identified, and the work easily understood as compared to ancient suffered for no fault of Valerius Cordus manuscripts. These came to be known as At the times when herbals flourished in herbals and the authors who wrote these Germany, Pierandrea Mathiola was active were known as herbalists. The first herb- in Italy, producing Commentarii in sex libros als were published under the name Gart der Pedacii Dioscorides in 1544, adding many il- Gesundheit or Hortus sanitatus. These were lustrations, though it was a commentary on cheaply done and of poor quality. The out- Dioscorides. The Dutch Big Three— standing herbals came from German herb- Rembert Dodoens, Carolus Clusius and alists Otto Brunfels, Jerome Bock, Valerius Mathias de L‘obel—spread the botanical Cordus and Leonard Fuchs, constituting the knowledge to Holland and France through Systems of Classification 301 Early Taxonomists With renewed interest in plants and extensive explorations of Europe, Asia, Africa and the New World, the list of plant names increased enormously, signifying the need for a formalized scheme of classification, naming and description of plants. Botany, hitherto dependent on medicine, started to spread its wings as a science per se.

Andrea Cesalpino (1519-1603)— The first plant taxonomist Andrea Cesalpino was an Italian botanist who studied botany under Luca Ghini and became the Director of the Botanical Gar- den and later professor of botany and medicine at Bologna. He went to Rome in 1592 as the personal physician to Pope Clement VIII. He prepared a herbarium of 768 well- mounted plants in 1563, which is still preserved in the Museum of Natural History Figure 10.2 Illustration of Plantago major from at Florence. His work De Plantis libri in 16 Fuch’s De Historia Stirpium (1542) volumes appeared in 1583 and contained (reproduced from Arber: Herbals, descriptions of 1520 species of plants their origin and Evolution, 1938: grouped as herbs and trees and further dif- used with permission from Cam- ferentiated on fruit and seed characters. bridge University Press). Cesalpino subscribed to the Aristotelian logic, taking decisions based on reasoning their herbals. William Turner, in his Herball and not the study of features. It was not (1551-1568), swept out many old supersti- surprising, therefore, that he considered tions concerning plants. Herball won for pith akin to the spinal cord of animals and Turner the title of Father of British Botany. leaves having the sole role of protecting the Herbalism also saw the emergence of the apical bud. However, he highlighted the sig- doctrine of signatures, a result of the urge nificance of reproductive characters, an to search for clues from plants. Many me- attitude not liked by his contemporaries, but dicinal plants, the doctrine held, are stamped having much bearing on the subsequent with a clear indication of their medicinal classifications of Ray, Tournefort and use. This was based upon the belief that Linnaeus. plants and plant parts cured that particular portion of the human body, which they resembled. Thus, herbs with yellow sap Joachin Jung (1587-1657)— would cure jaundice, the walnut kernel The first terminologist would comfort the brain and maidenhair fern A brilliant teacher in Germany, Jung suc- would prevent baldness. Paracelsus and ceeded in defining several terms such as Robert Turner were the main proponents of nodes, internodes, simple and compound this doctrine, later ridiculed when more leaves, stamens, styles, capitulum composed knowledge concerning medicinal plants was of ray and disc florets. Though he left no pub- acquired from the seventeenth century lications of his own, two of his pupils pre- onwards. served records of his teaching. 302 Plant Systematics

Gaspard (Caspar) Bauhin (1560- John Ray was the first to group together 1624) ––Legislateur en botanique plants that resembled one another and separated those that differed more. His classifi- A Swiss botanist, Bauhin travelled exten- cation was a great advancement in plant sci- sively and formed a herbarium of 4000 speci- ences. It was evidently ahead of his time, mens. He published Phytopinax (1596), groping at what later developed as natural Prodromus theatri botanici (1620) and, lastly, systems, which were perfected by de Jussieu, Pinax theatri botanici (1623), containing a list de Candolle and Bentham and Hooker. of 6000 species of plants giving synonyms (other names used for a species by earlier J. P. de Tournefort (1656-1708)— authors) and introducing the binomial no- Father of genus concept menclature for several species which he named. He sought to clarify in a single pub- A French botanist, de Tournefort studied un- lication the confusion regarding multiplic- der Pierre Magnol in the University of ity of names for all species known at that Montpellier and later became the professor time. Although he did not describe genera, of botany at Jardin du Roy in Paris and later, he did recognize the difference between spe- Director of Jardin des Plantes in Paris. He cies and genera and several species were published Elements de botanique in 1694, included under the same generic name. His including 698 genera and 10,146 species. A elder brother Jean Bauhin (1541-1613) had Latin translation of this work with additions earlier compiled a description of 5000 plants was published as Institutions rei herbariae in with more than 3500 figures, a work pub- 1700. Tournefort travelled extensively in lished under the name Historia plantarum Greece and Asia Minor and brought back universalis in 1650-51, several years after 1356 plants, which were fitted into his sys- his death. It is tragic that the two brothers tem by his admirers. He was perhaps the never collaborated and rather worked on first to give names and description of gen- identical lines independently. era, merely listing the species. Casper Bauhin, who did recognize genera and species, provided no such description. John Ray (1627-1705) Tournefort was, thus, the first to establish Ray was an English botanist who travelled genera. His system of classification, though extensively in Europe and published numer- inferior to that of Ray, was useful for identi- ous works, the most significant being fication, recognizing petaliferous and apeta- Methodus plantarum nova (1682) and Historia lous flowers, free and fused petals, and regu- plantarum (1686-1704), a three-volume work. lar and irregular flowers. No doubt the sys- The last edition of Methodus, published in tem became very popular in Europe during 1703, included 18000 species. Ray divided the eighteenth century. the plant kingdom as shown in the outline of his classification presented in Table 10.1. SEXUAL SYSTEM Table 10.1 Outline of classification of plants published by John Ray in Historia A turning point in the classification ap- plantarum (1686-1704). proach was establishing the fact of sexuality in flowering plants by Camerarius in 1. Herbae (Herbs) 1694. He concluded that stamens were male A. Imperfectae (Cryptogams) B. Perfectae (Seed plants) sex organs and pollen was necessary for seed i. Monocotyledons set. He showed that the style and ovary form ii. Dicotyledons female sex organs of a flower. The thought 2. Arborae (Trees) regarding sexuality in plants, ridiculed by A. Monocotyledons the church hitherto, once established saw B. Dicotyledons renewal in botanical interest, amply Systems of Classification 303 exploited by Linnaeus for classifying sor Rudbeck. Under the able guidance of Prof. flowering plants. Rudbeck, Linnaeus published his first paper on the sexuality of plants in 1729. Following Carolus Linnaeus—Father of favourable publicity of his paper, he was ap- taxonomy pointed as Demonstrator and subsequently promoted as Docent. In 1730, he published Carolus Linnaeus (1707-1778), was also Hortus upplandicus, enumerating the plants known as Carl Linnaeus, Carl Linne, or Carl in the Uppsala Botanical Garden according Von Linne. Whereas Darwin dominated bo- to the Tournefort’s system. Faced with prob- tanical thinking during the nineteenth cen- lem of increasing numbers of plants which tury, Linnaeus did so during the eighteenth. he found hard to fit in Tournefort’s system, Carl Linne, Latinized as Carl Linnaeus or he published a revised edition of Hortus Carolus Linnaeus (Figure 10.3), born in upplandicus with plants classified according Rashult, Sweden on 23 May 1707, had botany to his own sexual system. attached to him at birth, since Linnaeus is Linnaeus was sent on an expedition to the Latin for Linn or Linden tree (Tilia spp.). Lapland in 1732, a trip that widened his His father, a country Parson, wanted his son knowledge. He brought back 537 specimens. to become a priest, but Linnaeus chose to The results of the expedition were later pub- enter the University of Lund in 1727 to learn lished as Flora Lapponica (1737). Linnaeus medicine. Although he had no money to buy went to the Netherlands in 1735 and ob- books, his dedication impressed Professor tained an M. D. degree from the University Kilian Stobaeus, who not only allowed him of Haderwijk. While in the Netherlands, he full use of his library but also gave him free met several prominent naturalists includ- boarding at his house. Lund not being a suit- ing John Frederick Gronovius and Hermann able place for Medicine, Linnaeus shifted to Boerhaave, the former financing the publi- the University of Uppsala in 1729. In recog- cation of Systema naturae (1735), presenting nition of his enthusiasm for plants, Dean Olaf an outline of the sexual system of Linnaeus. Celsius introduced him to botanist Profes- He became the personal physician of a wealthy person named George Clifford who was the Director of the Dutch East India Company, and this gave Linnaeus an opportunity to study numerous tropical and temperate plants grown by Clifford in his garden. It was at Clifford’s expense that Linnaeus published several manuscripts, including Hortus cliffortianus and Genera plantarum (1737). Linnaeus then went to England, where he met Professor John Jacob Dillen, who initially thought of Linnaeus as ‘this is he who is bringing all botany into confusion’, but he soon became the advocate of the Linnaean system in England. He also met the de Jussieu brothers in France. Following the death of Professor Rudbeck, Linnaeus was appointed Professor of medicine and botany at the University of Uppsala, Figure 10.3 Carolus Linnaeus (1707-1778), the a position he held until his death in 1778. Father of taxonomy (reproduced He published his best known Species with permission from Royal plantarum in 1753. His growing fame and Botanic Gardens Kew). publications attracted large number of 304 Plant Systematics

DIADELPHIA HEXANDRIA. 699 Classis XVII DIADELPHIA.

H E X A N D R I A, FUMARIA. *Corollis bicalcaratis, I. FUMARIA Scapo nudo. Hort. Cliff. 251: * Gron. cucullaria, virg. 171. Rov.lugdb,. 393· Fumaria tuberosa insipida. Corn. canad. 127. Fumaria siliquosa, radice grumosa, flore bicorporeo ad labia conJucto, virginiana. Plak, alam. I62. t. 90. f 3· Raj. suppl. 475· Cucullaria. Juss. act. paris . 1743· Habitat in Virginia, Canada 2: Radix tuberosa;Folium radicale tricompositum. Scapus nudus, Racemo simplici; bracteae vix ullae; Nectarium duplex corollam basi bicornem efficiens. 2. FUMARIA floribus postice bilobis, caule folioso. spectabilis. Habitat in Sibiria. D. Demidoff: Planta eximia floribus speciofissimis, maximis. Habitus Fumariae bulbosae, sed majora omnia. Rami ex alis ra- rioris. Caulis erectus. Racemus absque bracteis. Co- rollae magnitudine extimi articuli pollicis, pone in du- os lobos aequales, rotundatos divisae.

* Corollis unicalcaratis. 3. FUMARIA caule simplici, bracteis longitudine florum bulbosa

Figure 10.4 A portion of a page from Species plantarum of Linnaeus (1753). Specific epithet (trivial name) is indicated towards the margin. students, their number increasing every Among his enthusiastic students were Pe- year and the botanical garden at Uppsala enter Kalm and Peter Thunberg. Kalm collected riched considerably. plants extensively in Finland, Russia and Linnaeus’ botanical excursions every America and when he returned with bundles summer also included an annotator to take of collection from America, Linnaeus was notes, a Fiscal to maintain discipline and bedridden, but forgot his ailment and trans- marksmen to shoot birds. At the end of each ferred his concern to plants. Thunberg col- trip, they marched back to the town with lected extensively in Japan and South Africa. Linnaeus at the head, aided with French Linnaeus first outlined his system in horns, kettledrums and banners. Systema naturae, which classified all known In recognition of his contributions, plants, animals and minerals. In his Gen- Linnaeus was made Knight of the Polar era plantarum, he listed and described all the Star in 1753, the first Swedish scientist to plant genera known to him. In Species get this honour. In 1761, he was granted the plantarum, he listed and described all the patent of nobility and from this date came known species of plants. For each species to be known as Carl von Linne. there was (Figure 10.4): Systems of Classification 305

Table 10.2 Outline of the 24 classes recognized by Linnaeus in his Species plantarum (1753) on the basis of stamens.

Classes 1. Monandria- stamen one 2. Diandria- stamens two 3. Triandria- stamens three 4. Tetrandria- stamens four 5. Pentandria- stamens five 6. Hexandria- stamens six 7. Heptandria- stamens seven 8. Octandria- stamens eight 9. Ennandria- stamens nine 10. Decandria- stamens ten 11. Dodecandria- stamens 11-19 12. Icosandria- stamens 20 or more, on the calyx 13. Polyandria- stamens 20 or more, on the receptacle 14. Didynamia- stamens didynamous; 2 short, 2 long 15. Tetradynamia- stamens tetradynamous; 4 long, 2 short 16. Monadelphia- stamens monadelphous; united in 1 group 17. Diadephia- stamens diadelphous; united in 2 groups 18. Polyadelphia- stamens polyadelphous; united in 3 or more groups 19. Syngenesia- stamens syngenesious; united by anthers only 20. Gynandria- stamens united with the gynoecium 21. Monoecia- plants monoecious 22. Dioecia- plants dioecious 23. Polygamia- plants polygamous 24. Cryptogamia- flowerless plants

(i) a generic name; The system of Linnaeus, very simple in (ii) a polynomial descriptive phrase or its application, recognized 24 classes phrase-name commencing with ge- (Table 10.2), mostly on the basis of stamens. neric name and of up to twelve words, These classes were further subdivided on the intended to serve as description of the basis of carpel characteristics into orders species; such as Monogynia, Digynia, etc. Such a (iii) a trivial name or specific epithet on classification based on stamens and carpels the margin; resulted in the artificial grouping of unre- (iv) synonyms with reference to important lated taxa and separation of relatives. earlier literature; and Linnaeus knew that his system was more (v) habitats and countries. convenient than natural, but it was the need of the day when there was a tremendous in- The generic name followed by the trivial crease in the number of plants known to name formed the name for each species. man, which necessitated quick identifica- Linnaeus thus established the binomial tion and placement. This is exactly what the nomenclature, first started by Caspar sexual system of Linnaeus achieved with Bauhin and the generic concept, started by merit. His Species plantarum (1753) marks Tournefort. the starting point of botanical nomenclature 306 Plant Systematics today. Linnaeus did aim at natural classifi- based on the idea conceived by Adanson and cation and in the 6th edition of his Genera now developed into Neo-Adansonian plantarum (1764), he appended a list of 58 principles. natural orders. It was, however, left to others to carry forward. Linnaeus had done Jean B. P. Lamarck (1744-1829) his job according to the demands of the day. A French naturalist, Jean B. P. Lamarck Following Linnaeus’ death in 1778, his authored Flore Francaise (1778), which in ad- son Carl received the post of Professor as dition to a key for identification of plants, well as the collections at Uppsala. When the contained principles concerning the natu- latter died in 1783, the collections went to ral grouping of species, orders and families. the widow of Linnaeus, whose sole aim was He is better known for his evolutionary to sell it the highest bidder. Fortunately, theory, Lamarckism. this highest bidder of 1000 guineas was J.E. Smith, an English botanist. Smith founded the Linnaean Society of London in de Jussieu family 1788 and handed over the herbarium to this Four well-known botanists belonged to this society. Herbarium specimens have since prominent French family. Of the three broth- been photographed and are available in ers—Antoine (1686-1758), Bernard (1699- microfiche. 1776) and Joseph (1704-1779), the youngest The Linnaean classification remained spent many years in South America, where dominant for a long time. The 5th edition of after losing his collections of five years, he Species plantarum appeared as late as in became insane. The elder two studied at the 1797-1805, greatly enlarged and edited by University of Montpellier under Pierre C.L. Wildenow in four large volumes. Magnol. Antoine succeeded Tournefort as Director de Jardin des Plantes, Paris and later added Bernard to the staff. Bernard NATURAL SYSTEMS started arranging plants in the garden at La Linnaeus had provided a readily referable Trianon, Versailles, according to the classi- cataloguing scheme for a large number of fication that was initially similar to plants, but it soon became evident that Fragmenta methodi naturalis of Linnaeus with unrelated plants came together in such some similarities to Ray’s Methodus groupings. A need was realized for a more plantarum, introducing changes, so that objective classification. France, which was when finally set, it had no resemblance with undergoing an intellectual ferment and the Linnaean system. Bernard based his where the Linnaean system never became classification on the number of cotyledons, popular, took the lead in developing natural presence or absence of petals and their fu- systems of classification. sion. He never published his system and it was left to his nephew Antoine Laurent de Jussieu (1748-1836; Figure 10.5) to publish Michel Adanson (1727-1806) this classification, along with his own A French botanist, unimpressed with artifi- changes in Genera plantarum (1789). cial choice of characters, Michel Adanson In this classification, the plants were di- devised a classification of both animals and vided into three groups, further divided on plants, on the equal use of as many features corolla characteristics and ovary position to as possible. In his two-volume work Familles form 15 classes and 100 orders (till the be- des plantes (1763), he recognized 58 natu- ginning of present century class and order ral orders according to their natural affini- were mostly used as names of categories now ties. Present-day Numerical taxonomy is understood as order and family, respectively). Systems of Classification 307

the most important one being Theorie elementaire de la botanique (1813), wherein he proposed a new classification scheme, outlined the important principles and introduced the term taxonomy.

Table 10.3 Outline of classification proposed by A. P. de Candolle in his Theorie elementaire de la botanique (1813).

I. Vasculares (vascular bundles present) Class 1. Exogenae (dicots) A. Diplochlamydeae Thalamiflorae Calyciflorae Corolliflorae B. Monochlamydeae (also Figure 10.5 Antoine Laurent de Jussieu (1748- including gymnosperms) 1836) the author of Genera Class 2. Endogenae plantarum (1789) largely based on A. Phanerogamae (monocots) the work of his Uncle Bernard de B. Cryptogamae Jussieu (reproduced with permis- II. Cellulares (no vascular bundles) sion from the Royal Botanic Gar- dens, Kew). Class 1. Foliaceae (Mosses, Liverworts) Class 2. Aphyllae (Algae, Fungi, Lichens) An outline of the classification is presented below: From 1816, until his death Augustin de 1. Acotyledones Candolle worked in Geneva and undertook 2. Monocotyledones a monumental work, intended to describe 3. Dicotyledones every known species of vascular plants un- i. Apetalae der the title Prodromus systematis naturalis ii. Monopetalae regni vegetabilis, the first volume appearing iii. Polypetalae in 1824. He published seven volumes him- iv. Diclines irregulares self. His son Alphonse de Candolle and grand- son Casimir de Candolle continued the work. Acotyledones, in addition to cryptogams, Alphonse published ten more volumes, the contained some hydrophytes whose repro- last one in 1873, resulting in revision of sev- duction was not known then. Diclines eral families by specialists. irregulares contained Amentiferae, Nettles, The classification by A. P. de Candolle de- Euphorbias as also the Gymnosperms. limited 161 natural orders (the number was increased to 213 in the last revision of Theorie elementaire…., edited by Alphonse in de Candolle family 1844), grouped primarily on the basis of the The de Candolles were a Swiss family of bota- presence or absence of vascular structures nists. Augustin Pyramus de Candolle (1778- (Table 10.3). 1841) was born in Geneva, Switzerland but Ferns were provided a place co-ordinate took his education in Paris, where he be- with monocots and in contrary to de Jussieu, came the Professor of Botany at Montpellier Gymnosperms were given a place, although (Figure 10.6). He published several books, among dicots. The importance of anatomical 308 Plant Systematics

botanist (Figure 10.7). He was extremely accomplished and wrote many important monographs on families such as Labiatae, Ericaceae, Scrophulariaceae and Polygonaceae. He also published Handbook of British Flora (1858) and Flora Australiensis in 7 volumes (1863-78). Sir J. D. Hooker (1817-1911), who succeeded his father Will- iam Hooker as Director, Royal Botanic Gar- dens in Kew, England was a very well known botanist, having explored many parts of the world (Figure 10.8). He published Flora of British India in 7 volumes (1872-97), Student’s Flora of the British Islands (1870) and also revised later editions of Handbook of British Flora, which remained a major British Flora until 1952. He also supervised the publication of Index Kewensis (2 volumes, 1893), listing the names of all known species and their Figure 10.6 Augustin Pyramus de Candolle (1778-1841) who first introduced synonyms. the term ‘taxonomy’ in his Theorie elementaire de la botanique (1813) (reproduced with permission from the Royal Botanic Gardens, Kew). features was highlighted and successfully employed in the classification. Robert Brown (1773-1858) Robert Brown was an English botanist, who did not propose a classification of his own but demonstrated that Gymnosperms were a group discrete from dicotyledons and had naked ovules. He also clarified the floral morphology and pollination of Asclepiadaceae and Orchidaceae, morphology of grass flower structure of cyathium in Euphorbiaceae and established several families. George Bentham & Sir J.D. Hooker The system of classification of seed plants Figure 10.7 George Bentham (1800-1884), co- presented by Bentham and Hooker, two author of Genera plantarum (with J. D. Hooker, 1862-1883), and the English botanists, represented the most well author of the 7-volume Flora developed natural system. The classification Australiensis and several mono- was published in a three-volume work graphs on major families (repro- Genera plantarum (1862-83). George duced with permission from Royal Bentham (1800-1884) was a self-trained Botanic Gardens, Kew). Systems of Classification 309

Table 10.4 Outline of the system of classification presented by Bentham and Hooker in Genera plantarum (1862-1883).

Phanerogams or seed plants

Class 1. Dicotyledons (Seed with 2 cotyledons, flowers pentamerous or tetramerous, leaves netveined)

14 series, 25 orders and 165 families Subclass 1. Polypetalae (sepals and petals distinct, petals free) Series 1. Thalamiflorae (flowers hypogynous, stamens many, disc absent) 6 orders: Ranales, Parietales, Polygalineae, Caryophyllineae, Guttiferales and Malvales 2. Disciflorae (Flowers hypogynous, disc present below the ovary) 4 orders: Geraniales, Olacales, Celastrales and Sapindales

3. Calyciflorae (flowers perigynous or epigynous) 5 orders: Rosales, Myrtales, Passiflorales, Ficoidales and Umbellales

Subclass 2. Gamopetalae (sepals and petals distinct, petals united) Series 1. Inferae (ovary inferior) 3 orders: Rubiales, Asterales and Campanales

2. Heteromerae (ovary superior, stamens in one or two whorls, carpels more than 2) 3 orders: Ericales, Primulales and Ebenales

3. Bicarpellatae (ovary superior, stamens in one whorl, carpels 2) 4 orders: Gentianales, Polemoniales, Personales and Lamiales

Subclass 3. Monochlamydeae (flowers apetalous; perianth lacking or if present not differentiated into sepals and petals) Series 1. Curvembryeae (embryo coiled, ovule usually 1) 2. Multiovulatae aquaticae (aquatic plants, ovules many) 3. Multiovulatae terrestres (terrestrial plants, ovules many) 4. Microembryeae (embryo minute) 5. Daphnales (carpel 1, ovule 1) 6. Achlamydosporae (ovary inferior, unilocular, ovules 1-3) 7. Unisexuales (flowers unisexual) 8. Ordines anomali (relationship uncertain)

Class 2. Gymnospermae (ovules naked) 3 families

Class 3. Monocotyledons (flowers trimerous, venation parallel) 7 series, 34 families Series 1. Microspermae (ovary inferior, seeds minute) 2. Epigynae (ovary inferior, seeds large) 3.Coronarieae (ovary superior, carpels united, perianth coloured) 4. Calycinae (ovary superior, carpels united, perianth green) 5. Nudiflorae (ovary superior, perianth absent) 6. Apocarpae (ovary superior, carpels more than 1, free) 7. Glumaceae (ovary superior, perianth reduced, flowers enclosed in glumes) 310 Plant Systematics

The system divided Phanerogams or seed plants into three classes: Dicotyledons, Gymnospermae and Monocotyledons. Di- cotyledons were further subdivided into three subclasses: Polypetalae, Gamopetalae and Monochlamydeae based on the presence or absence of petals and their fusion. These subclasses, in turn, were subdivided into series, orders (called cohorts by the two authors) and families (called natural orders). No orders (cohorts) were recognized within Monochlamydeae and Monocotyledons, the series being directly divided into families (natural orders). A broad outline of the classification is presented in Table 10.4. Merits The fact notwithstanding that the system does not incorporate phylogeny and is more than 100 years old, it still enjoys a reputation of being a very sound system of classifi- Figure 10.8 Sir Joseph Dalton Hooker (1817- 1911), the famous British botanist cation, owing to the following merits: who co-authored Genera Plantarum 1. The system has great practical value with George Bentham, besides for identification of plants. It is very authoring the 7- volume Flora of easy to follow for routine identifica- British India and several other pub- tion. lications. He was the Director of 2. The system is widely followed for the the Royal Botanic Gardens, Kew arrangement of specimens in the her- (reproduced with permission from baria of many countries, including Royal Botanic Gardens, Kew). Britain and India. 3. The system is based on a careful comparative examination of actual speci- The Genera plantarum of Bentham and mens of all living genera of seed plants Hooker provided the classification of seed and is not a mere compilation of plants describing 202 families and 7569 gen- known facts. era. They estimated the seed plants to in- 4. Unlike de Candolle, the Gymno- clude 97,205 species. The classification was sperms are not placed among dicots a refinement of the systems proposed by A. but rather in an independent group. P. de Candolle and Lindley, which in turn 5. Although the system is not a were based on that of de Jussieu. The de- phylogenetic one, Ranales are placed limitation of families and genera was based in the beginning of Dicotyledons. The on natural affinities and was pre-Darwinian group Ranales (in the broader sense in concept. The descriptions were based on including families now separated personal studies from specimens and not a under order Magnoliales) is generally mere compilation of known facts, an asset regarded as primitive by most of the which made the classification so popular and leading authors. authentic. Many important herbaria of the 6. Dicotyledons are placed before the world have specimens arranged according to Monocotyledons, a position approved by this system. all present-day authors. Systems of Classification 311

7. The description of families and gen- with Caryophyllaceae. In Bentham and era are precise. Keys to the identifi- Hooker’s system, however, Caryo- cation are very useful. Larger genera phyllaceae are placed in Polypetalae, have been divided into subgenera in and the other two in Mono- order to facilitate identification. chlamydeae. Similarly Podostema- 8. The arrangement of taxa is based on ceae which are placed in a separate overall natural affinities decided on series Multiovulatae aquaticae, better the basis of morphological features, belong to the order Rosales (Cronquist, which can be easily studied with the 1988). Chloran-thaceae placed by naked eye or with a hand lens. Bentham and Hooker under Micro- 9. Although a few important characters embryeae and Laurineae placed under have been chosen to name a few Daphanales are closely allied to the groups, the grouping itself is based on order Magnoliales (Ranales s. l.) and a combination of characters, rather are thus placed in the same subclass than any single character in the ma- Magnoliidae by Cronquist (1988). jority of cases. Thus, although Del- 4. In Monocotyledons, Liliaceae and phinium has fused petals, it has been Amaryllidaceae are generally regarded kept in Ranunculaceae along with the as closely related and often included in related genera and placed in Poly- the same order, some authors, includ- petalae. Similarly, some gamopetalous ing Cronquist merging Amaryllidaceae genera of Cucurbitaceae are retained with Liliaceae. In this system they are along with the polypetalous ones and placed under different series, Amarylli- placed in Polypetalae. daceae under Epigynae and Liliaceae 10. Heteromerae is rightly placed before under Coronarieae. Bicarpellatae. 5. Unisexuales is a loose assemblage of diverse families, which share only one Demerits major character, i.e. unisexual flow- The system being pre-Darwinian in ap- ers. Cronquist (1988) separates these proach, suffers from the following drawbacks: families under two distinct subclasses 1. The system does not incorporate Hamamelidae and Rosidae and phylogeny, although it was published Takhtajan (1987) under Hamame- after Darwin published his evolution- lididae and Dilleniidae. ary theory. 6. Bentham and Hooker did not know the 2. Gymnosperms are placed between Di- affinities of the families placed under cotyledons and Monocotyledons, Ordines anomali, and the families whereas their proper position is be- were tentatively grouped together. fore the former, as they form a group Cronquist (1988) and Takhtajan (1987) independent from angiosperms. place Ceratophyllaceae under sub- 3. Monochlamydeae is an unnatural as- class Magnoliidae and the other three semblage of taxa, which belong else- under Dilleniidae. where. The creation of this group has 7. Many large families, e.g. Urticaceae, resulted in the separation of many Euphorbiaceae, Liliaceae and closely-related families. Caryophylla- Saxifragaceae, are unnatural assem- ceae, Illecebraceae and Chenopodia- blages and represent polyphyletic ceae are closely related families to the groups. These have rightly been split extent that they are placed in the same by subsequent authors into smaller, order in all major contemporary clas- natural and monophyletic families. sifications. Several authors including 8. Orchidaceae is an advanced family Takhtajan (1987) merge Illecebraceae with inferior ovary and zygomorphic 312 Plant Systematics

flowers, but the family is placed towards Cryptogamae and Phanerogamae, the latter the beginning of Monocotyledons. further subdivided into Gymnospermae and 9. In Gamopetalae, Inferae with an in- Angiospermae. Angiospermae was divided ferior ovary is placed before the other into two classes: Monocotyledons and Dicoty- two series having a superior ovary. ledons. Only two groups Choripetalae and The inferior ovary is now considered Sympetalae were recognized in Dicotyledons. to have been derived from a superior Gymnosperms thus found their separate iden- ovary. tity before angiosperms, Monochlamydeae 10. The system divides angiosperms into found itself abolished and dispersed among dicotyledons and monocotyledons, the two groups. Monocotyledons, strangely, whereas the modern phylogenetic sys- found a place before Dicotyledons. tems place paleoherb families and Magnoliids before monocotyledons and Adolph Engler and Eudicots. Karl A Prantl This is a system of classification of the entire plant kingdom, proposed jointly by two PHYLOGENETIC SYSTEMS German botanists: Adolph Engler (1844- The publication of The Origin of species by 1930) (Figure 10.9) and Karl A. E. Prantl (1849- Charles Darwin, with every copy of the first 1893). The classification was published in a edition sold on the first day, 24 November monumental work Die Natürlichen 1859 revolutionized biological thinking. The pflanzenfamilien in 23 volumes (1887-1915). species was no longer regarded as a fixed Engler was Professor of Botany at the Uni- entity having remained unchanged since its versity of Berlin and later Director, Berlin creation. Species were now looked upon as Botanic Garden. The system provided clas- systems of populations, which are dynamic sification and description down to the genus and change with time to give rise to lineages level, incorporating information on morphol- of closely-related organisms. Once the ex- ogy, anatomy and geography. istence of this evolutionary process was ac- The system is commonly known under knowledged, the systems of de Candolle as Engler’s name, who first published classifi- also of Bentham and Hooker were found to cation up to the family level under the title be inadequate and classifications, which Syllabus der pflanzenfamilien in 1892. This made an attempt to reconstruct evolution- scheme was constantly revised by Engler and ary sequence, found immediate takers. continued by his followers after his death, the latest 12th edition appearing in 2 volumes, Transitional systems 1954 (ed. H. Melchior and E. Werdermann) and 1964 (ed. M. Melchior). In this last edi- The early systems were not intended to be tion, however, dicots were placed before phylogenetic. Rather, they were attempts to monocots. rearrange earlier natural systems in the Engler also initiated an ambitious plan of light of the prevalent phylogenetic theories. providing taxonomic monographs of various families up to species level under the title A.W. Eichler Das pflanzenreich. Between 1900 and 1953, Eichler (1839-1887) was a German botanist 107 volumes were published covering 78 who proposed the rudiments of a system in families of seed plants and one family 1875. This was elaborated into a unified sys- (Sphagnaceae) of mosses. tem covering the entire plant kingdom and This system, often considered the begin- finally published in the third edition of Syl- ning in phylogenetic schemes, was not labus der vorlesungen…(1883). The plant strictly phylogenetic in the modern sense. It kingdom was divided into two subgroups: was an arrangement of linear sequence Systems of Classification 313 starting with the simplest groups and the beginning of dicots, also did not find arranged in the order of progressing com- much subsequent support. The system plexity. In doing so, unfortunately, Engler (Table 10.5) became very popular, like that misread angiosperms, where in many of Bentham of Hooker, due to its comprehen- groups, the simplicity is a result of evolu- sive treatment and is still being followed in tionary reduction. many herbaria of the world. Some recent flo- The system, however, had significant im- ras including Flora Europaea (1964-1980) fol- provements over Bentham and Hooker: Gym- low this system. nosperms were placed before angiosperms, In this scheme of classification, the plant group Monochlamydeae was abolished and kingdom was divided into 13 divisions (in its members distributed along with their the 11th edition of Syllabus der pflanzen- polypetalous relatives, and many large un- familien published in 1936, 14 divisions and natural families were split into smaller in the 12th edition edited by Melchior 17 divi- natural families. The placement of mono- sions were recognized), of which the first 11 cots before dicots, another change made by dealt with Thallophytes, the 12th this system did not, however, get subsequent Embryophyta Asiphonogama (embryo support. The placement of the so-called group formed, no pollen tube) included Bryophytes Amentiferae comprising families and Pteridophytes. The 13th and last division Betulaceae, Fagaceae, Juglandaceae, etc. in Embryophyta Siphonogama (embryo formed, pollen tube developing) included seed plants.

Merits The classification of Engler and Prantl has the following improvements over that of Bentham and Hooker: 1. This was the first major system to incorporate the ideas of organic evolution, and the first major step towards phylogenetic systems of classification. 2. The classification covers the entire plant kingdom and provides description and identification keys down to the level of family (in Syllabus der pflanzenfamilien), genus (in Die Natürlichen pflanzenfamilien) and even species for large number of families (in Das pflanzenreich). Valuable illustrations and information on anatomy and geography are also provided. 3. Gymnosperms are separated and placed before angiosperms. 4. Many large unnatural families of Bentham and Hooker have been split Figure 10.9 Adolph Engler (1844-1930), the into smaller and natural families. The famous German botanist who family Urticaceae is thus split into produced the most comprehensive classification of the plant Urticaceae, Ulmaceae and Moraceae. kingdom along with K. Prantl in 5. Abolition of Monochlamydeae has re- a 20-volume work Die Natürlichen sulted in bringing together several pflanzenfamilien (1887-1915). closely related families. Family 314 Plant Systematics

Table 10.5 An outline of the system of classification presented by Engler and Prantl.

Plant Kingdom Division 1. } } ...... Thallophytes Division 11. } Division 12...... Embryophyta Asiphonogama Subdivision 1. Bryophyta Subdivision 2. Pteridophyta Division 13...... Embryophyta Siphonogama Subdivision 1. Gymnospermae Subdivision 2. Angiospermae Class 1. Monocotyledoneae—11 orders, 45 families Order 1. Pandanales (first family Pandanaceae) ...... Order 11. Microspermae (last family Orchidaceae) Class 2. Dicotyledoneae— 44 orders, 258 families Subclass 1. Archichlamydeae (petals absent or free)—33 orders, 201 families Order 1. Verticillatae (family Casuarinaceae only)) ...... Order 33. Umbelliflorae (Last family Cornaceae)

Subclass 2. Metachlamydeae (petals united)— 11 orders, 57 families Order 34. Diapensiales (family Diapensiaceae only) ...... Order 44. Campanulatae (Last family Compositae)

Illecebraceae is merged with 8. Consideration of gamopetalous condi- Caryophyllaceae. Chenopodiaceae tion as advanced over polypetalous con- and Caryophyllaceae are placed in the dition is in line with current phyletic same order, Centrospermae. views. 6. Compositae in dicots and Orchidaceae 9. The classification, being very thorough in monocots are advanced families has been widely used in textbooks, Flo- with inferior ovary, zygomorphic and ras and herbaria around the world. complex flowers. These are rightly 10. The terms cohort and natural order placed towards the end of dicots and have been replaced by the appropriate monocots, respectively. terms order and family, respectively. 7. Several recent systems of classification 11. Closely related families Liliaceae and place monocots before true dicots Amaryllidaceae have been brought (eudicots) under the same order Liliiflorae. Systems of Classification 315

Table 10.6 Comparison of classification system of Bentham and Hooker with that of Engler and Prantl. Bentham and Hooker Engler and Prantl

1. Published in Genera plantarum in 3 volumes 1.Published in Die Natürlichen pflanzenfamilien in 23 (1862-83). volumes (1887-1915). 2. Includes only seed plants. 2. Includes the entire plant kingdom. 3. Gymnosperms placed in between Dicotyledons and 3. Gymnosperms separated and placed before the Monocotyledons. angiosperms. 4. Dicotyledons placed before Monocotyledons. 4. Dicotyledons placed after Monocotyledons. 5. Dicotyledons divided into 3 subclasses: Polypetalae, 5. Dicotyledons divided into 2 subclasses: Gamopetalae and Monochlamydeae. Archichlamydeae and Metachlamydeae. 6. Subclasses are further subdivided into series, cohorts 6. Subclasses are further subdivided into orders and (representing orders) and natural orders families, series not recognized. (representing families). 7. Monocotyledons include 7 series and 34 natural 7. Monocotyledons include 11 orders and 45 families. orders. 8. Pre-Darwinian in concept. 8. Post-Darwinian in concept. 9. Dicotyledons start with Ranales having bisexual 9. Dicotyledons start with Verticillatae with unisexual flowers. flowers. 10. Monocotyledons start with Microspermae, including 10. Monocotyledons start with Pandanales. Microspermae Orchidaceae. are placed towards the end of Monocotyledons.

11. Closely related families Caryophyllaceae, 11. Family Illecebraceae is merged with Caryophyllaceae. llecebraceae and Chenopodiaceae are kept apart, the Chepodiaceae and Caryophyllaceae are placed in the first under Polypetalae and the other two under same order Centrospermae. Monochlamydeae. 12. Closely related families Amaryllidaceae and 12. Liliaceae and Amaryllidaceae placed in the same order Liliaceae placed in separate series Epigynae and Liliiflorae. Coronarieae, respectively. 13. Many larger families, e.g. Urticaceae, 13. Several larger families of Bentham and Saxifragaceae and Euphorbiaceae are unnatural Hooker split into smaller homogeneous families. heterogeneous groups. Urticaceae split into Urticaceae, Ulmaceae and Moraceae.

Demerits 2. Monocotyledons are placed before Dicotyledons. In the recent systems, With better understanding of the phyloge- paleoherbs and sometimes Magnoliids netic concepts in recent years, many draw- are placed before monocots. backs of the system of Engler and Prantl 3. The so called Amentiferae including have come to light. These primarily result such families as Betulaceae, Juglanda- from the fact that they applied the concept ceae and Fagaceae with reduced of ‘simplicity representing primitiveness’ unisexual flowers, having few floral even to the angiosperms, where evolution- members and borne in catkins, were ary reduction is a major phenomenon, not considered primitive. It has been commonly seen in the lower groups. The established from studies on wood major drawbacks of the system include: anatomy, palynology and floral anatomy 1. The system is not a phylogenetic one that Amentiferae is an advanced group. in the modern sense. Many ideas of The simplicity of flowers is due to Engler are now outdated. evolutionary reduction and not 316 Plant Systematics

primitiveness. Cladistic studies of The above two systems of classification Loconte (1996) have shown that tree have been widely followed in different herbaria based on this hypothesis is six steps around the world, as also in various regional longer than the shortest tree. and local Floras. Although based on basically 4. Dichlamydeous forms (distinct calyx different criteria, the two are similar in be- and corolla) were considered to have ing exhaustive in treatment, allowing the evolved from the monochlamydeous placement and identification of various gen- forms (single whorl of perianth). This era with the help of valuable keys and detailed view is not tenable. descriptions. Such a treatment is very nec- 5. Angiosperms were considered a essary for distribution of specimens in a polyphyletic group. Most of the recent herbarium. It is also valuable in preliminary evidence points towards monophyletic identification of a specimen up to the generic origin. level. Most of the contemporary systems of 6. Araceae in Monocotyledons are now classification lack treatment beyond the fam- believed to have evolved from ily level. Such systems of classification may Liliaceae. In this classification, be very sound in the placement of higher Araceae are included in the order groups, but have little practical value for the Spathiflorae which is placed before purpose of actual identification. Liliiflorae, including family Liliaceae. A comparison of the classification of 7. Helobiae (including families Alisma- Bentham and Hooker with that of Engler and ceae, Butomaceae and Potamogetona- Prantl is presented in Table 10.6. ceae) is a primitive group, but in this classification it is placed after Panda- Intentional phylogenetic nales, which is a relatively advanced systems group. 8. Derivation of free central placentation The natural systems rearranged in the light from the parietal placentation, and of of phylogenetic information soon gave way to the latter from axile placentation is systems that reflect evolutionary develop- contrary to the evidence from floral ment. A beginning in this direction was made anatomy. Free central placentation is by an American botanist, Charles Bessey. now believed to have evolved from axile placentation through the disap- Charles Bessey pearance of septa. C. A. Bessey (1845-1915) was an American

9. Ranales (in the broader sense-s. l.) are botanist, who laid the foundations of modern now considered as a primitive group phylogenetic classifications (Figure 10.10). with bisexual flowers, spirally arranged He was a student of Asa Gray and later be- floral parts and numerous floral mem- came Professor of botany at the University of bers. In this classification, they are Nebraska. He was the first American to make placed much lower down, after a major contribution to plant classification, Amentiferae. and also the first botanist to develop inten- 10. Family Liliaceae of Engler and Prantl tional phylogenetic classification. He based is a large unnatural assemblage, his classification on Bentham and Hooker, which has been split into several modified in the light of his 28 dicta and pub- smaller monophyletic families like lished in Ann. Mo. Bot. Gard. under the title Liliaceae, Alliaceae, Asparagaceae, ‘The phylogenetic taxonomy of flowering Asphodelaceae in the recent classifi- plants’ (1915). cation of Judd et al. (2002), APG II Bessey considered angiosperms to have (2003) and Thorne (2006). evolved monophyletically from Cycadophyta Systems of Classification 317

in angiosperms, a theory followed by many subsequent authors. Bessey believed in the strobiloid theory of the origin of the flower, the latter having originated from a vegetative shoot with spiral phyllomes, of which some modified to form sterile perianth, fertile stamens and carpels. Two evolutionary lines from such a flower formed strobiloideae (Ranalian line) with connation of like parts and cotyloideae (Rosalian line) with connation of unlike parts (Table 10.7). Ranales in dicots and Alismatales in monocots were considered to be the most primitive in each group, a fact recognized by most subsequent authors. Ranalian plants were considered to be primitive angiosperms having given rise to monocots, but unfortunately monocots were placed before dicots. Bessey also initiated the representation of evolutionary relationships through an Figure 10.10 Charles Bessey (1845-1915) who evolutionary diagram, a phylogram with initiated the modern phyloge- primitive groups at the base and the most netic systems of classification. advanced at the tips of branches (Figure 10.11). He proposed his ideas in Ann. Mo. Bot. Gdn. (1915). His diagram, resembling a cactus plant is better known as Besseyan cactus. belonging to implied bennettitalean ancestry. He was the pioneer to consider Hans Hallier that the large-sized bisexual flowers of Hallier (1868-1932) was a German botanist Magnoliaceae with spirally arranged floral who developed a classification resembling parts represent the most primitive condition Bessey’s and starting with Ranales. Dicots

Table 10.7 Outline of the classification of angiosperms proposed by Charles Bessey (1915).

Class 1. Alternifoliae (Monocotyledoneae) Subclass 1. Strobiloideae (5 orders) Subclass 2. Cotyloideae (3 orders)

Class 2. Oppositifoliae (Dicotyledoneae) Subclass 1. Strobiloideae Superorder 1. Apopetalae-polycarpellatae (7 orders) Superorder 2. Sympetalae-polycarpellatae (3 orders) Superorder 3. Sympetalae-dicarpellatae (4 orders)

Subclass 2. Cotyloideae Superorder 1. Apopetalae (7 orders) Superorder 2. Sympetalae (3 orders) 318 Plant Systematics

Figure 10.11 Besseyan cactus or Opuntia Besseyi showing the relationship of orders recognized by Bessey were, however, placed before monocots. of his conclusions on phylogeny have been Magnoliaceae were separated from Ranales adopted in subsequent classifications. and placed in a separate order Annonales. Alfred Rendle Wettstein Rendle (1865-1938), an English botanist Wettstein (1862-1931) was an Austrian sys- associated with the British Museum of tematist who published his classification in Natural History, published Classification of Handbuch der systematischen botanik (1930, Flowering Plants (1904, 1925), resembling 1935). The classification resembled that of that of Engler in considering monocots more Engler in considering unisexual flowers primitive than dicots and Amentiferae a primitive but treated monocots advanced primitive group under dicots. He recognized over dicots; and considered Helobiae to be three grades in dicots: Monochlamydeae, primitive and Pandanales advanced. Many Dialapetalae (petals free) and Sympetalae. Systems of Classification 319

In monocots Palmae were separated as a dis- In addition to presenting his system of tinct order and Lemnaceae considered to be classification for angiosperms, Hutchinson advanced over Araceae. also published valuable works such as Flora of West Tropical Africa (1927-29), Common John Hutchinson Wild Flowers (1945), A Botanist in South Af- rica (1946), Evolution and Classification of John Hutchinson (1884-1972) was a British Rhododendrons (1946), British Flowering Plants botanist associated with the Royal Botanic (1948), More Common Wild Flowers (1948), Gardens, Kew, England who also served as Uncommon Wild Flowers (1950), British Wild keeper of Kew herbarium for many years Flowers (1955), Evolution and Phylogeny of (Figure 10.12). Hutchinson first proposed his Flowering Plants (1969) and Key to the Fami- classification of angiosperms in his book The lies of Flowering Plants of the World (1968). Families of Flowering Plants, the first volume Hutchinson also embarked upon an am- on Dicotyledons appearing in 1926 and the bitious plan of revising Genera plantarum of second on Monocotyledons in 1934. The clas- Bentham and Hooker under the title The sification was revised periodically, second Genera of Flowering Plants. Unfortunately he edition in 1959 and the 3rd in 1973, one year could complete only 2 volumes of this work, after his demise. published in 1964 and 1967, the project cut short by his demise. The classification system of Hutchinson dealt only with the flowering plants, included under Phylum Angiospermae as distinct from Phylum Gymnospermae. The classification was based on 24 principles including General principles, Relating to General Habit, Relating to General Struc- ture of Flowering plants and those Relating to Flowers and Fruits. These principles are outlined below: Other things being equal, it may be stated that: 1. Evolution is both upwards (sympetaly, epigyny) and downwards (apetaly, unisexuality). 2. Evolution does not necessarily involve all the organs of a plant at the same time; and one organ or set of organs may be advancing while the other may be stationary or retrograding. 3. Evolution has generally been consistent and when a particular progression Figure 10.12 John Hutchinson (1884-1972), or retrogression has set in, it is per- the British botanist who worked sisted into the end of the phylum. as keeper of Kew Herbarium and Relating to the General Habit of published classification of an- Plants giosperms as Families of Flower- ing Plants (1973), as also the Gen- 4. In certain groups, trees and shrubs are era of Flowering Plants (repro- probably more primitive than herbs. duced with permission from 5. Trees and shrubs are older than Royal Botanic Gardens Kew). climbers, the latter habit having been 320 Plant Systematics

Table 10.8 Outline of the system of classification of flowering plants presented by Hutchinson in 3rd edition of The Families of Flowering Plants (1973).

Phylum I. Gymnospermae

Phylum II. Angiospermae

Subphylum I. Dicotyledones

Division I. Lignosae- 54 orders

Order 1. Magnoliales (first family Magnoliaceae) ...... Order 54. Verbenales (last family Verbenaceae)

Division II. Herbaceae- 28 orders

Order 55. Ranales (first family Paeoniaceae) ...... Order 82. Lamiales (last family Lamiaceae)

Subphylum II. Monocotyledones

Division I. Calyciferae- 12 orders

Order 83. Butomales (first family Butomaceae) ...... Order 94. Zingiberales (last family Marantaceae)

Division II. Corolliferae- 14 orders

Order 95. Liliales (first family Liliaceae) ...... Order 108. Orchidales (family Orchidaceae only)

Division III. Glumiflorae- 3 orders

Order 109. Juncales (first family Juncaceae) ...... Order 111. Graminales (family Poaceae only)

acquired through a particular environ- rate in the members of the same fam- ment. ily or genus), and the same may be said 6. Perennials are older than biennials, and of epiphytes, saprophytes and para- from them annuals have been derived. sites. 7. Aquatic Phanerogams are as a rule Relating to the General Structure of more recent than terrestrial (at any Flowering Plants Systems of Classification 321

8. Plants with collateral vascular bundles 24. Aggregate fruits are more recent than arranged in a cylinder (Dicotyledons) single fruits, and as a rule, the cap- are more primitive in origin than those sule precedes the drupe or berry. with scattered bundles (Mono-cotyle- Following Bessey, Hutchinson considered dons), though it does not necessarily flowering plants to be monophyletic, hav- follow that the latter have been directly ing evolved from the hypothetical cycadeoid derived from the former. ancestral group which he gave the name of 9. Spiral arrangement of leaves on the Proangiosperms. He recognized a number stem and of floral leaves precedes that of smaller groups, bound together by a com- of opposite and whorled types. bination of characters. He established 10. As a rule, simple leaves precede com- Magnoliales as an order distinct from pound leaves. Ranales, as he considered them to have Relating to the Flowers and Fruits of evolved on parallel lines. Hutchinson re- Plants garded Magnoliaceae as the most primitive 11. Bisexual flowers precede unisexual family of the living angiosperms. He consid- flowers, and the dioecious is probably ered Dicotyledones to be more primitive and more recent than the monoecious con- placed them (Table 10.8) before dition. Monocotyledones, giving them a rank of Sub- 12. Solitary flower is more primitive than phylum. the inflorescence. The groups Polypetalae, Gamopetalae and 13. Spirally imbricate floral parts are more Monochlamydeae were totally abolished; in- primitive than whorled and valvate. stead Hutchinson recognized two evolution- 14. Many-parted flowers (polymerous) ary lines: division Lignosae (fundamentally precede, and the type with few parts woody group) and division Herbaceae (fun- (oligomerous) follow from it, being damentally herbaceous group) within accompanied by progressive steriliza- Dicotyledones, the former starting with tion of reproductive parts. Magnoliaceae and ending with 15. Petaliferous flowers precede apetalous Verbenaceae. The Herbaceae started with ones, the latter being the result of Paeoniaceae and ended with Lamiaceae. reduction. Within Monocotyledones he recognized 16. Free petals (polypetaly) are more primi- three evolutionary lines: division tive than connate petals (sympetaly). Calyciferae (calyx bearers), division 17. Actinomorphy of flower is an earlier Corolliferae (corolla-bearers) and division type than zygomorphy. Glumiflorae (glume-bearers). A total of 411 18. Hypogyny is the primitive structure, families are recognized, 342 in and from it perigyny and epigyny were Dicotyledones and 69 in Monocotyledones. derived later. Lignosae includes 54 orders, Herbaceae 29, 19. Free carpels (apocarpy) are more primi- Calyciferae 12, Corolliferae 14 and tive and from them connate carpels Glumiflorae 3. A diagram (appropriately resulted. phylogram) showing phylogeny and evolu- 20. Many carpels (polycarpy) precede few tion within Dicotyledones is presented in carpels (oligocarpy). Figure 10.13 21. The endospermic seed with small Whereas Hutchinson considered the woody embryo is primitive and the non-endo- habit to be primitive in dicots, in monocots he spermic seed more recent. considered the herbaceous habit to be primi- 22. In primitive flowers, there are many tive, and the woody forms derived from the her- stamens; in more advanced flowers few baceous forms. He also considered stamens. Monocotyledones also to be a monophyletic 23. Separate stamens precede connate group derived from Ranales, Butomales hav- stamens. ing a link with Helleboraceae and Alismatales 322 Plant Systematics

Figure 10.13 Hutchinson’s diagram (phylogram) showing phylogeny and relationships of orders of Dicotyledones as presented in his 1973 classification. with Ranunculaceae. The presence of few characters as in earlier systems endosperm in seeds of Ranunculaceae and its is more logical. absence from Butomaceae and Alismataceae, 4. Many large unnatural families have otherwise considered closer, is explained by been split into smaller natural ones. Hutchinson to be the result of aquatic habit in Euphorbiaceae of Bentham and the last two. A diagram (phylogram) showing Hooker is split into Euphorbiaceae, the probable phylogeny of various orders in Ricinaceae and Buxaceae. The family Monocotyledones is presented in Figure 10.14. Urticaceae is similarly split into Urticaceae, Moraceae, Ulmaceae and Merits Cannabinaceae. The system of Hutchinson, being based on a 5. Standards of description are very high. number of sound phylogenetic principles, and Useful keys are provided for the iden- studies of a large number of plants at his dis- tification of families. posal at Kew, shows the following improve- 6. Phylograms for dicots and monocots ments over earlier systems: are more superior to the Besseyan 1. The system is more phylogenetic than cactus. that of Engler and Prantl, as it is based 7. The classification of Monocotyledones on phylogenetic principles, generally is sounder and generally appreciated, recognized by most authors. even keys to the identification of 2. The treatment of Magnoliales as the genera have been provided. starting point in the evolutionary se- 8. The derivation of Monocotyledones ries of Dicotyledones is in agreement from Dicotyledones is widely agreed. with prevalent views. 9. The placement of Alismatales towards 3. The abolition of Polypetalae, Gamo- the beginning of Monocotyledones finds petalae, Monochlamydeae, Archichla- general acceptance. mydeae and Metachla-mydeae and 10. Detailed classification up to the rearrangement of taxa on the combi- generic level, together with identifica- nation of characters and not one or a tion keys and description has been Systems of Classification 323

Figure 10.14 Hutchinson’s diagram (phylogram) showing probable phylogeny and relationship of orders within Monocotyledones.

provided for some families in the two even separate divisions—Herbaceae volumes of The Genera of Flowering and Lignosae, respectively. Plants. 3. Hutchinson did not provide a full explanation for the majority of his evo- Demerits lutionary concepts. The classification of Hutchinson has largely 4. He derives angiosperms from pro- been ignored, as it mostly did not proceed angiosperms, but does not provide beyond family level, and gave much impor- information about the nature of this tance to the habit. The major drawbacks of hypothetical ancestral group. the system are listed below: 5. Although he has split several large un- 1. The system is not useful for practical natural families into natural units, in identification, arrangement in Floras some cases he has even split some fami- and herbaria, as it does not proceed lies which were already natural mono- beyond the family level in the greater phyletic groups. The family Ranuncula- majority of taxa. ceae has been split into Ranunculaceae 2. The division of Dicotyledones into and Helleboraceae on the basis of achene Lignosae and Herbaceae is most arti- and follicle fruit, respectively. Studies on ficial and has resulted in separation of the floral anatomy have shown that evo- closely related families Araliaceae and lutionary stages in the reduction of ovule Apiaceae, in Lignosae and Herbaceae number can be seen in the genera of respectively. Similarly, Lamiaceae and Helleboraceae, and many genera of Verbenaceae are very closely related Ranunculaceae show traces which would and often placed in the same order in have gone to now aborted ovules. Thus, contemporary systems of classification. the Ranuncula-ceae of Bentham and Hutchinson, on the basis of habit, sepa- Hooker represents a monophyletic group rated them under distinct orders and and need not be split. 324 Plant Systematics

6. The family Calycanthaceae is related techniques of the numerical analysis of avail- to Laurales, but placed here in Rosales. able data have helped in developing classifi- 7. Hutchinson regards Magnoliaceae as cations that have several features in com- the most primitive family of living mon, though differing in some basic Dicotyledones, but most contemporary concepts. It is now largely agreed upon that authors consider vessel-less Angiosperms are a monophyletic group with Winteraceae, or paleoherbs be the dicots being more primitive than monocots. most primitive. Vesselless Winteraceae and the paleoherb 8. The monocotyledons are placed after families are now generally regarded as among dicotyledons, whereas the recent clas- the basal living angiosperms. Out of the au- sifications place them between primi- thors of the four major contemporary systems tive angiosperms and the eudicots. of classification, two—A. Cronquist and R. 9. Family Liliaceae of Hutchinson is a Dahlgren—have unfortunately left us during large unnatural assemblage, which has the past decade and a half. There is, how- been split into several smaller mono- ever, a positive trend of frequent updating of phyletic families like Liliaceae, Allia- classification schemes in electronic versions. ceae, Asparagaceae, Asphodelaceae in During the last decade, the Angiosperm the recent classification of Judd et al. Phylogeny Group (APG) has been working (2002), APG II (2003) and Thorne (2003). towards realization of monophyletic groups.

Lyman Benson Armen Takhtajan* Lyman Benson developed a classification de- Armen Takhtajan (1910–2009) was a lead- signed for teaching botany and published in ing Russian plant taxonomist (Figure 10.15) his book Plant classification (1957). Dicotyle- and chief of the Department of higher plants dons are divided into five groups on features in V.L. Komarov Botanic Institute, USSR derived from the classifications of Bentham Academy of Sciences, Leningrad (now and Hooker and Engler and Prantl. Monocoty- named St. Petersburg). He was an interna- ledons are divided directly into 13 orders, tional authority on phytogeography, origin starting with Alismales and ending with and phylogeny of flowering plants. He was the Pandanales. Although several realignments President of the 12th International Botanical have been made by Benson, de Candolle as Congress held in Leningrad in 1975. also Bentham and Hooker have been followed His classification was first published in for grouping in dicots and Bessey’s outline 1954 in Russian, but came to be known out- for classification of monocots: side the Soviet Union only after its English 1. Thalamiflorae (hypogynous, free or no translation Origin of Angiospermous Plants petals) was published in 1958. The system was 2. Corolliflorae (hypogynous, petals fused) elaborated in Die Evolution der Angiospermen 3. Calyciflorae (perigynous or epigynous, (1959), and Systema et Phylogenia petals free or none) Magnoliophytorum (1966), both in Russian. 4. Ovariflorae (epigynous, petals fused) The classification became popular with the 5. Amentiferae (catkin bearing) English translation of the latter as Flower- ing Plants—Origin and Dispersal by Modern phylogenetic systems C. Jeffrey in 1969. The classification was A number of contemporary workers are in- published in a revised form in Botanical volved in improving schemes of classification Review in 1980. A more elaborate revision based on new information from various of this classification appeared in the sources. Recent data from paleobotany, phy- Russian work Sistema Magnoliophytov (Latin tochemistry, ultrastructure and improved facsimile Systema Magnoliophytorum) in *Armen Takhtajan passed away on June 13, 2009, Systems of Classification 325

juvenile characters in the adult plant-also called paedomorphosis). Thus, in Magno- liales, considered most primitive among the living angiosperms, the simple entire, pinnately veined leaves represent the juvenile stage of frond-like leaves of the seed ferns. Takhtajan was of the opinion that angiosperms arose under environmental stress, probably as a result of adaptation to moderate seasonal drought on rocky mountain slopes, in an area with monsoon climate. For many years, Takhtajan considered Winteraceae along with Degeneriaceae to represent the most primitive angiosperms. Finally, however, he chose Degeneriaceae as the most primitive family, placed under the order Magnoliales. He shifted Winter- aceae to a separate order Winterales after Magnoliales (in his earlier 1987, classification he had placed Winteraceae towards the beginning in the phyletic line after orders Figure 10.15 Armen Takhtajan (1910-2009), Eupomatiales and Annonales). This is inter- leading Soviet authority on phy- esting in light of the fact that many contem- togeography and classification of porary authors regard Winteraceae or flowering plants. Published last paleoherbs (mainly Amborellaceae) among version of his classification in the most primitive groups of the living an- 1997, incorporating several modi- giosperms. fications in his system. While deciding the placement of various 1987. Between 1980 and 1987, he proposed groups, Takhtajan has used a number of cri- smaller revisions in 1983 (revision of di- teria based on his understanding of the cots only in Metcalfe and Chalk: Anatomy of available information. His major conclu- Dicotyledons, vol. 2) and 1986 (Takhtajan: sions are summarized below: Floristic Regions of the World). His final com- 1. The most primitive angiosperms are prehensive system of classification was regarded to be the small evergreen published in 1997 (Diversity and Classifica- trees or shrubs, taller trees and decidu- tion of Flowering Plants). Earlier Takhtajan, ous habit being later developments. along with Cronquist and Zimmerman, had 2. Simple leaves with entire margin and also provided a broad classification of pinnate venation are primitive. Embryobionta (1966). Pinnately and palmately lobed leaves Takhtajan, who has provided a classifica- arose subsequently followed finally by tion of angiosperms up to the family level, the pinnate and palmate compound belongs to the Besseyan School and was leaves. strongly influenced by Hutchinson, Hallier 3. Primitive flower is moderate in size, in and the other more progressive German few flowered cymes, as in Degeneria. workers. He believes in the monophyletic The large flowers of Magnolia and origin of angiosperms, the group having Nymphaeaceae are of secondary origin. evolved from seed ferns Lyginopteridophy- 4. Petals have dual origin, from the bracts ta. According to Takhtajan, the angiosperms in Magnoliales (bracteopetals), and are of neotenous origin (retention of from the stamens in Caryophyllales 326 Plant Systematics

(andropetals). Early angiosperms have These are further subdivided into subclasses numerous spirally arranged perianth (ending in -idae, e.g. Rosidae), superorders of modified bracts. Distinct sepals and (ending in -anae, e.g. Rosanae), orders and petals are secondary developments. families. Cronquist, however, does not rec- 5. Primitive stamens were broad, ognize superorders. Also, as against 11 and laminar, 3-veined, not differentiated 6 (8 and 4 in 1987 classification) subclasses into filament and connective. The com- of dicots and monocots respectively in mon ancestral type had marginal Takhtajan’s system, Cronquist recognizes 6 sporangia and later on gave rise to the and 5, respectively. Both systems are devel- abaxial types (extrorse as in Degeneria) oped based on phylogenetic, as well as phe- and the adaxial types (introrse as in netic information from every field of study. Magnolia). However, whereas Cronquist gives more im- 6. Monocolpate pollen grains are primi- portance to phenetic information, Takhtajan tive, from which arose tricolpate and relies more heavily on phylogenetic data. then the polycolpate types. These two systems of classification show 7. Primitive carpels are free, unsealed, a general agreement with the other two conduplicate, containing numerous major classifications of angiosperms, devel- ovules and with laminar placentation oped by Thorne (1981, 1983, 1992,) and (as in Degeneria). Fusion is a later Dahlgren (1981, 1983, 1989), although the development. Fusion of closed carpels recent revisions by Thorne (2000,2003) are laterally resulted in syncarpous in more agreement with APG classifica- gynoecium with axile placentation, the tions, in abandoning traditional division into dissolution of septa subsequently monocots and dicots. resulting in lysicarpous gynoecium Both Takhtajan and Cronquist prefer the with free-central placentation. Lateral name Magnoliophyta for angiosperms and fusion of open conduplicate carpels appropriate names Magnoliopsida and formed paracarpous gynoecium with Liliopsida for dicots and monocots, respec- parietal placentation. tively. An outline of the classification (1997 8. Outer integument arose from the version) is presented in Table 10.9. cupule of ancient gymnospermous As against the classification proposed in ancestor. Unitegmic ovules arose by 1980, the revision proposed in 1987 had one fusion of two integuments or abortion subclass each added to Magnoliopsida (only of one. former superorder Asteranae—now split into 9. Takhtajan (and Cronquist) earlier Asteranae and Campanulanae—retained in regarded monocotyledons as being of Asteridae, all remaining superorders placed aquatic origin from Nymphaeales via in a new subclass Lamiidae) and Liliopsida Alismatales. Later he regarded the (superorder Triuridanae separated from latter only as a lateral side branch of Liliidae into a new subclass Triurididae). Also monocotyledons, and proposed that 17 superorders, 56 orders and 96 families Nymphaeales and Alismatales had a were added to Magnoliopsida and 8 super- common origin from hypothetical ex- orders, 17 orders and 27 families to Liliopsida. tinct terrestrial group of Magnoliidae, In his 1997 revision he added three new sub- the main monocotyledonous stock be- classes Nymphaeidae, Nelumbonidae ing terrestrial in origin. (separated from Magnoliidae) and Cornidae Takhtajan’s classification approaches (separated from Rosidae) to Magnoliopsida and more closely that of Cronquist (1981, 1988) two Commelinidae (separated from Liliidae) in naming angiosperms as division and Aridae (separated from Arecidae) to Magnoliophyta. Dicots and monocots are Liliopsida. He further added 18 superorders, given the rank of a class and named 47 orders and 29 families in Magnoliopsida Magnoliopsida and Liliopsida, respectively. and 20 orders and 27 families in Liliopsida. Systems of Classification 327

Table 10.9 Outline of the system of classification of Angiosperms proposed by Takhtajan in 1997. Subclasses marked* did not exist in 1987 classification.

Division. Magnoliophyta- 2 classes, 17 subclasses, 71 superorders, 232 orders, 589 families (2 classes, 12 subclasses, 53 superorders, 166 orders, 533

families in 1987 classification); estimated genera-13,000, species- 2,50,000

Class 1. Magnoliopsida (Dicotyledons)- 11 subclasses, 55 superorders, 175 orders, 458 families (8 subclasses, 37 superorders, 128 orders, 429 families in 1987

classification); estimated genera- 10,000, species- 1,90,000 Subclass 1. Magnoliidae 2. Nymphaeidae* 3. Nelumbonidae* 4. Ranunculidae 5. Caryophyllidae 6. Hamamelididae 7. Dilleniidae 8. Rosidae 9. Cornidae* 10. Asteridae 11. Lamiidae

Class 2. Liliopsida (Monocotyledons)-6 subclasses, 16 superorders, 57 orders and 131 families (4 subclasses, 16 superorders, 38 orders, 104 families in 1987

classification); estimated genera-3,000, species- 60,000 Subclass 1. Liliidae 2. Commelinidae* 3. Arecidae 4. Alismatidae 5. Triurididae 6. Aridae*

An interesting aspect about the 1987 clas- Balanophoranae. It is interesting to note sification of Takhtajan was uncertainty that Judd et al. (2002), APG II (2003) and about the placement of the family APweb (2003) are uncertain about the place- Cynomoriaceae. The single genus ment of these two families. Cynomorium earlier placed in family A major departure of Takhtajan from ear- Balanophoraceae (Hutchinson, 1973; lier versions is the recognition of Cronquist, 1988), was removed to the family Commelinidae as a distinct subclass in Cynomoriaceae and placed next to agreement with the position taken by Balanophoraceae under the order Cronquist. Takhtajan, however, unlike Balanophorales by Takhtajan (1980), Thorne Cronquist placed Liliidae at the beginning (1983, 1992, 2003) and Dahlgren (1983, of Liliopsida, while the Alismatidae are 1989). In his 1987 classification, Takhtajan placed higher up after Arecidae. had placed this family under the order Like other phylogenetic systems of clas- Cynomoriales, but not being certain about sification, the presumed relationship of vari- its affinities, has inserted this order tenta- ous subclasses and superorders is indicated tively towards the end of Rosidae. In his 1997 with the help of a bubble diagram (Figure classification he has brought Cynomoriales 10.16 for dicots; Figure 10.17 for monocots)— under Magnoliidae within superorder more appropriately a phylogram—, the size 328 Plant Systematics

Figure 10.16 Bubble diagram of Takhtajan showing the probable relationship between different subclasses and superorders of dicotyledons (based on Takhtajan, 1987). 1997 classification does not include a bubble diagram. of each bubble or balloon representing the genetic as well as phenetic informa- relative size of each group, the branching tion for the delimitation of orders and pattern the phylogenetic relationship, and families. The genus Nelumbo was the length of bubble its evolutionary advance- earlier placed in the family Nymphaea- ment (degree of apomorphy). ceae under Nymphaeales. Takhtajan separated it to Nelumbonaceae under Merits the order Nelumbonales on the basis The latest classification of Takhtajan (1997) of the occurrence of tricolpate pollen shows several improvements in light of re- grains, embryo structure, absence of cent information on phylogeny and phenet- laticifers and chromosome morphology. ics. Many merits achieved in the earlier ver- He finally separated it to a separate sions have also been retained in the latest superorder Nelumbonanae under the revision. The major achievements of this distinct subclass Nelumbonidae. system include: Thorne (1983, 1992, 2000, 2003) also 1. A general agreement with the major follows the separation into Nelumbo- contemporary systems of Cronquist, nales (closer to Ranunculales) but Dahlgren and Thorne (earlier versions under superorder Ranunculanae. APG II up to 1992) and incorporation of phylo- (2003) also places Nelumbonaceae Systems of Classification 329

Figure 10.17 Bubble diagram of Takhtajan showing the probable relationship between different subclasses and superorders of monocotyledons (based on Takhtajan, 1987).

closer to Ranunculales (under (unique embryogeny with coenocytic Eudicots), but in order Proteales. Simi- proembryo stage, reticulately pitted larly, the genus Eucommia was earlier exine, large generative cell, thick placed in the family Hamamelidaceae. fleshy carpels, broad stigmas, promi- Takhtajan removed it to the family nent lobed fleshy nectariferous disc Eucommiaceae under the order surrounding the gynoecium). Thorne Eucommiales based on the presence (1983, 1992, 2000, 2003) follows the of stipules, unilacunar nodes, separation of Paeoniaceae under the unitegmic ovule and cellular order Paeoniales. endosperm, a separation followed by 2. The system is more phylogenetic than Cronquist (1988). Thorne (1983, 1992) that of Hutchinson and other earlier gave it a rank of a suborder under the authors and is based on now widely order Hamamelidales (Hamame- accepted phylogenetic principles. lididae), but has now shifted it to 3. The derivation of Monocotyledons Lamiidae under order Garryales, some- from the terrestrial hypothetical ex- what similar to APG II (2003; Garryales tinct group of Magnoliidae (often called of Euasterids I). de Soo (1975) placed it proangiosperms), is largely favoured, under a separate subclass Euco- as also the view that Alismatales and mmiidae. Similarly, the genus Paeonia, Nymphaeales represent ancient side placed under the family Ranuncula- branches and have a common origin. ceae in earlier classifications, was 4. Abolition of artificial group names separated by Takhtajan to the family Polypetalae, Gamopetalae, Lignosae, Paeoniaceae under the order Herbaceae etc. has resulted in more Paeoniales on the basis of evidence natural grouping of taxa. Lamiaceae from chromosomes (5 large chromo- and Verbenaceae are thus brought somes), floral anatomy (centrifugal sta- together under the order Lamiales (as mens, many traces in sepals and pet- against their separation under als, 5 in carpels), and embryology Lamiales and Verbenales and 330 Plant Systematics

placement under separate groups between Malvanae and Euphorbianae Herbaceae and Lignosae, respectively, under Dilleniidae is more appropriate. by Hutchinson). Caryophyllaceae, Dahlgren (1983) had pointed out affini- Chenopodiaceae and Portulacaceae ties of Urticales with Malvales and have similarly been placed under the Euphorbiales. The arrangement agrees order Caryophyllales. with that of Thorne (2003) also. 5. Nomenclature is in accordance with the Cronquist (1988), however, placed International Code of Botanical Nomen- Urticales in Hamamelididae, Malvales clature, even up to the level of division. in Dilleniidae and Euphorbiales in 6. Clifford (1977) from numerical studies Rosidae. has largely supported the division of 11. The placement of Dioncophyllaceae in Monocotyledons into subclasses. a separate order Dioncophyllales is in 7. The placement of Magnoliidae as the line with the opinion presented by most primitive group of angiosperms, Metcalfe and Chalk (1983), who on the Dicotyledons before Monocotyledons, basis of anatomical evidence, proposed Magnoliales at the beginning of Mag- that the family occupied an isolated noliopsida, finds general agreement taxonomic position. Earlier, the family with other authors. had been included in the order Theales 8. Depiction of the putative relationships next to the family Ancistrocladaceae. of major subclasses and superorders 12. Nymphaeales, whose position within with the help of a bubble diagram is the dicots, has been a matter of debate very useful. It gives some idea about have been placed in a distinct subclass the relative size of different groups, Nymphaeidae under Magnoliopsida. point of cladistic divergence and de- 13. The ending -anae, earlier opposed in gree of advancement (apomorphy) favour of -florae has now been accepted reached. Larger groups are repre- by G. Dahlgren (1989) and Thorne sented by larger bubbles, vertical (1992 onwards) since the ending-flo- length the degree of advancement, and rae restricts the usage to angio-sperms the point of separation of a branch its and is not universal in application. cladistic divergence. 14. The separation of Brassicaceae and 9. By splitting Asteridae into two sub- Capparaceae has found support from classes: Lamiidae and Asteridae, a chloroplast sequence data (Hall, more rational distribution of Sytsma and Iltis, 2002), consistent sympetalous families has been with morphological data. achieved. Separation of Asteridae and 15. The merger of Asclepiadaceae with Lamiidae has also been followed by Apocynaceae has been supported by Thorne (2000, 2003) and APG II (2003; molecular analyses by Judd et al., (1994) although under informal groups and Sennblad and Bremer (1998). Euasterids I and Euasterids II). Also Recognition of distinct Asclepiada- Cornanae, which show affinities with ceae would render Apocynaceae as the sympetalous families, have been paraphyletic (Judd et al., 2002) placed in an independent subclass Cornidae (earlier placed under Demerits Rosidae). APG II also places Cornales With the latest revision of his classification in distinct informal group Euasterids, in 1997, Takhtajan attempted to remove de- although Thorne places Cornanae ficiencies in the earlier versions of his sys- under Asteridae. tem. The critical appraisal of his latest ver- 10. Removal of the order Urticales from sion, in future, may bring out some further Hamamelididae and its placement in drawbacks. The following limitations of the an independent superorder Urticanae, system can be recorded: Systems of Classification 331

1. The system, although very sound and and Polygonaceae under the same or- highly phylogenetic, is not helpful for der Polygonales. identification and for adoption in her- 7. Further splitting and increase in the baria, as it provides classification only number of families to 589 (533 in 1987) up to the family level. Also, keys to the has resulted in a very narrow circum- identification of taxa are not provided. scription by the creation of numerous 2. Dahlgren (1980, 1983) and Thorne monotypic families such as (1983,1992, 2003) consider that the Pottingeriaceae, Barclayaceae, angiosperms deserve a class rank Hydrastidaceae, Nandinaceae, equivalent to the main groups of gym- Griseliniaceae, Hypecoaceae, etc., and nosperms such as Pinopsida, numerous oligotypic ones such as Cycadopsida etc. Balanophoraceae, Sarraceniaceae, 3. Clifford (1977) by numerical analysis Peganaceae and Agrophyllaceae. has shown that Arales are closer to 8. Most authors regard the vesselless Liliales. Dahlgren (1983, 1989) placed family Winteraceae or paleoherb Arales next to Liliiflorae (Lilianae). The Amborellaceae the most primitive recent studies have, shown the affini- among living angiosperms, but ties of Araceae with Alismatales. As Takhtajan regarded Degeneriaceae as such, the family is included under most primitive, considering Alismatales in APG II and under Winteraceae as an isolated group and Alismatidae—>Aranae—>Arales by placing it in a separate order Thorne (2003). Winterales. The family Amborellaceae 4. Although the system is based on data finds place under Lauranae. derived from all sources, in final judg- 9. Takhtajan has made substantial ment more weightage is given to changes in his scheme of classifica- cladistic information compared to tion in 1997 over his earlier version of phenetic information. 1987. Unfortunately, however, he has 5. Ehrendorfer (1983) points out that failed to provide a bubble diagram, Hamamelididae do not represent an which was a positive feature of his ear- ancient side branch of Magnoliidae, lier versions and was very useful in but are remnants of a transition from relating affinities between the groups Magnoliidae to Dilleniidae-Rosidae- as also to know the relative sizes of the Asteridae. various groups. This is especially sig- 6. Behnke (1977) and Behnke and nificant, as he has added three new Barthlott (1983) point out that subclasses under dicots and two new Caryophyllales have PIII-type plastids under monocots. whereas Polygonales and 10. Takhtajan suggested that smaller Plumbaginales have S-type plastids, families are more ‘natural’. According and thus advocate their removal from to Stevens (2003), this is incorrect. Caryophyllidae to Rosidae, retaining Monophyletic groups that include fewer only Caryophyllales in the subclass taxa—Takhtajan’s smaller families— Caryophyllidae. Though not agreeing do not necessarily have more on their removal, Takhtajan (1987, apomorphies, even if all members of 1997) partly incorporated Behnke’s such groups are certainly likely to have suggestion by placing all the three or- more features in general in common. ders under separate superorders 11. Family Triuridaceae is removed under Caryophyllanae, Polygonanae and a separate subclass and separate Plumbaginanae, but within the same superorder, but the evidence from 18S subclass, Caryophyllidae. Thorne rDNA sequencing (Chase et al., 2000) (2003, 2006) places Plumbaginaceae justifies its placement under 332 Plant Systematics

Pandanales. Thorne (2003) shifts (monocots). Cronquist includes only six sub- Triuridaceae under Pandananae, but classes in dicots and recognizes five in distinct order Triuridales. monocots. In dicotyledons, the Ranunculidae 12. The monocotyledons are placed after of Takhtajan are merged with Magnoliidae dicotyledons, whereas the recent clas- and Lamiidae are not given a separate rank sifications place them between primi- at subclass level, but retained in Asteridae. tive angiosperms and the eudicots. In monocotyledons, Zingiberidae are 13. The Families Winteraceae and treated separate from Liliidae and Canellaceae, are placed in two sepa- Triuridales kept under Alismatidae. As a rate orders, whereas the multigene major departure from the systems of analyses (Soltis et al., 1999; Zanis et Takhtajan, Dahlgren and Thorne, no super- al., 2002, 2003) have provided 99-100 orders are recognized, the subclasses are di- per cent bootstrap support in their vided into orders directly. Also, as against relationship. The two are accordingly 233 orders and 592 families recognized by placed in the same order in APG II and Takhtajan, Cronquist recognizes 83 orders APweb, and under the same suborder and 386 families. Cronquist agrees with in Thorne (2003). The affinities be- Thorne (earlier versions up to 1992) in keep- tween these two families is also sup- ing the family Winteraceae (and not ported by morphological studies of Doyle Degeneriaceae as done by Takhtajan) at the and Endress (2000). beginning of dicotyledons, and included along with Degeneriaceae, Magnoliaceae, Arthur Cronquist Annonaceae etc. in the same order Arthur Cronquist (1919-1992), a leading Magnoliales. Paeoniaceae, unlike other American taxonomist, associated with the contemporary authors, are not separated by New York Botanical Garden (Figure 10.18), Cronquist into a distinct order Paeoniales, produced a broad classification of but instead shifted to the order Dilleniales Embryobionta along with Takhtajan and under Dilleniidae. Zimmerman (1966). He produced a detailed Another significant departure from classification of angiosperms in 1968 in his Takhtajan’s system is the merger of book The Evolution and Classification of Flow- Amaryllidaceae with Liliaceae, under the or- ering Plants. The classification was further der Liliales. Takhtajan places these two elaborated in 1981 in his book An Integrated families in separate orders Amaryllidales System of Classification of Flowering Plants. and Liliales, respectively. Unlike most re- The final revision was published in the sec- cent authors, Cronquist believed in the ond edition (1988) of The Evolution and Clas- aquatic origin of monocotyledons, from a sification of Flowering Plants. Some realign- primitive vessel-less ancestor resembling ments in Dicotyledons were published in present-day Nymphaeales. Nordic Journal of Botany in 1983. In contrast to Takhtajan’s system, The classification is conceptually similar Nelumbonaceae are placed in Nymphaeales to that of Takhtajan’s system, but differs in (and not a separate order Nelumbonales), details. The classification, like that of Typhales in Commelinidae (and not Takhtajan, is based on evidence derived Arecidae) and sympetalous families of dicoty- from all sources, but in contrast to Takhtajan ledons placed in a large subclass Asteridae who gives more importance to cladistics, (and not three subclasses Asteridae, Cronquist gave more importance to morphol- Cornidae and Lamiidae). Urticales are ogy (Ehrendorfer, 1983). included along with wind-pollinated families Following Takhtajan, the angiosperms are under Hamamelididae (and not with its given the name Magnoliophyta and divided 3related orders Malvales and Euphorbiales), into Magnoliopsida (dicots) and Liliopsida and Malvales and Euphorbiales are kept in Systems of Classification 333

evidence from all sources in arrangement of various groups. Paeonia and Nelumbo are thus placed under Paeoniaceae and Nelumbonaceae, although the orders Paeoniales and Nelumbonales are not recognized. Eucommia is also kept in a separate family Eucommiaceae under a distinct order Eucommiales. 2. The revision of the classification in 1981 and 1988 was presented a in comprehensive form, giving detailed information on phytochemistry, Figure 10.18 Arthur Cronquist (1919-1992) anatomy, ultrastructure and chromo- leading American Plant taxono- somes besides morphology. mist who published 2nd edition 3. The text, being in English, has been of his Evolution and Classification readily adopted in books and floristic of Flowering Plants in 1988. His projects originating in the USA. classification is similar to that 4. The system is highly phylogenetic of Takhtajan in general outline and is based on now largely accepted (photograph courtesy Allen phylogenetic principles. Rokach, The New York Botani- 5. The placement of Winteraceae at the cal Garden, Bronx, New York). beginning of dicotyledons is generally favoured by most authors including Ehrendorfer (1968), Gottsberger (1974) separate subclasses Dilleniidae and Rosidae and Thorne (up to 1992). The family respectively (and not the same subclass has vessel-less wood similar to gym- Dilleniidae). Cronquist has provided a syn- nosperms, great similarity between optic arrangement of taxa, facilitating the micro- and megasporophylls, unifacial process of identification up to the family stamens and carpels, morphology level. An outline of Cronquist’s system is similar to pteridosperms, high chro- presented in Table 10.10. The system is mosome number suggesting long evo- widely used in the USA. lutionary history and less specialized The relationships of various subclasses beetle pollination as compared to the and orders (Figure 10.19) are shown with the genus Magnolia. help of a phylogram which takes the form of 6. Abolition of artificial group names a bubble diagram, like other contemporary such as Polypetalae, Gamopetalae, systems of classification. Lignosae, Herbaceae etc. has resulted Merits in more natural grouping of taxa. The classification of Cronquist is largely Verbenaceae and Lamiaceae are thus based on principles of phylogeny that find ac- brought under the order Lamiales. ceptance with major contemporary authors. Caryophyllaceae, Chenopodiaceae and The system is merited with the following Portulacaceae are similarly placed in achievements over the previous systems of the same order Caryophyllales. classification: 7. Nomenclature is in accordance with 1. It shows general agreement with the International Code of Botanical major contemporary systems of Nomenclature. Takhtajan, Dahlgren and Thorne (ear- 8. Placement of Magnoliidae as the lier versions), and incorporates most primitive group of angiosperms, 334 Plant Systematics

Table 10.10 Broad outline of the classification of angiosperms presented by Cronquist (1988).

Division. Magnoliophyta- 2 classes, 11 subclasses, 83 orders and 386 families; 219,300 species

Class 1. Magnoliopsida (Dicotyledons)- 6 subclasses, 64 orders, 320 families; 169,400 species

Subclass 1. Magnoliidae (12 orders: Magnoliales, Laurales, Piperales, Aristolochiales, Illiciales, Nymphaeales, Ranunculales and Papaverales) 2. Hamamelidae (11 orders: Trochodendrales, Hamamelidales, Daphniphyllales, Didymelales, Eucommiales, Urticales, Leitneriales, Juglandales, Myricales, Fagales and Casuarinales) 3. Caryophyllidae (3 orders: Caryophyllales, Polygonales and Plumbaginales) 4. Dilleniidae (13 orders: Dilleniales, Theales, Malvales, Lecythidales, Nepenthales, Violales, Salicales, Capparales, Batales, Ericales, Diapensiales, Ebenales and Primulales) 5. Rosidae (18 orders: Rosales, Fabales, Proteales, Podostemales, Haloragales, Myrtales, Rhizophorales, Cornales, Santalales, Rafflesiales, Celastrales, Euphorbiales, Rhamnales, Linales, Polygalales, Sapindales, Geraniales and Apiales) 6. Asteridae (11 orders: Gentianales, Solanales, Lamiales, Callitrichales, Plantaginales, Scrophulariales, Campanulales, Rubiales, Dipsacales Calycerales and Asterales)

Class 2. Liliopsida (Monocotyledons)- 5 subclasses, 19 orders, 66 families; 49,900 species

Subclass 1. Alismatidae (4 orders: Alismatales, Hydrocharitales, Najadales, and Triuridales) 2. Arecidae (4 orders: Arecales, Cyclanthales, Pandanales and Arales) 3. Commelinidae (7 orders: Commelinales, Eriocaulales, Restionales, Juncales, Cyperales, Hydatellales and Typhales) 4. Zingiberidae (2 orders: Bromeliales and Zingiberales) 5. Liliidae (2 orders: Liliales and Orchidales)

dicotyledons before monocotyledons, chloroplast sequence data (Hall, Magnoliales at the beginning of Sytsma and Iltis, 2002), consistent Magnoliidae and Butomaceae at the with morphological data. beginning of Liliopsida, finds general agreement with other authors. Demerits 9. Compositae in dicotyledons and The system is becoming increasingly popu- Orchidaceae in monocotyledons are lar, especially in the USA, where many books generally regarded as advanced fami- are following this system. The following draw- lies, and are rightly placed towards the backs, however, may be pointed out: end of each group, respectively. 1. In spite of being a highly phylogenetic 10. The relationship of various groups has and popular in the USA, the system is been depicted with diagrams, which not very useful for identification and provide valuable information on rela- adoption in herbaria since identifica- tive advancement, cladistic relation- tion keys for genera, their distribution ship and size of various subclasses. and description are not provided. 11. The separation of Brassicaceae and 2. Dahlgren (1983,1989) and Thorne Capparaceae has found support from (1981, 2003) considered angiosperms Systems of Classification 335

Figure 10.19 Phylogram showing the relationship between various subclasses and orders as presented by Cronquist (based on Cronquist 1988).

to deserve a class rank, and not that 4. Clifford (1977) on the basis of nu- of a division. merical studies has shown that 3. Asteridae represent a loose assem- Typhales are better placed in blage of several diverse sympetalous Arecidae. Cronquist places Typhales families. in Commelinidae. 336 Plant Systematics

5. Superorder, as a rank above the or- 10. Metcalfe and Chalk (1983), on the der, is not recognized, thus showing a basis of a unique combination of significant departure from the con- anatomical features, suggested that temporary systems of Takhtajan, family Dioncophyllaceae should Thorne and Dahlgren. occupy an isolated taxonomic position, 6. Ehrendorfer (1983) pointed out that but it was placed by Cronquist in Hamamelidae do not represent an order Violales before family ancient side-branch of Magnoliidae Ancistrocladaceae. but are remnants of a transition from 11. Cronquist (1988) recognized Magnoliidae to Dilleniidae-Rosidae- Physenaceae as a family under Order Asteridae. Urticales, but was not sure about its 7. Behnke (1977) and Behnke and exact placement. Barthlott (1983) advocate that 12. The monocotyledons are placed after Polygonales and Plumbaginales, dicotyledons, whereas the recent clas- with S-type plastids, should be re- sifications place them between primi- moved to Rosidae and only tive angiosperms and the eudicots. Caryophyllales with PIII-type plastids 13. The family Winteraceae is placed to- retained in Caryophyllidae. wards the beginning of Magnoliales 8. Urticales are placed in Hamamelidae and Canellaceae towards the end. The together with wind-pollinated families, multigene analyses (Soltis et al., 1999; whereas they are close to Malvales Zanis et al., 2002, 2003) have provided and Euphorbiales (Dahlgren, 99-100 per cent bootstrap support in 1983,1989). Cronquist further sepa- their relationship. The two are accord- rates Malvales in Dilleniidae and ingly placed in a separate order in APG Euphorbiales in Rosidae. II and APweb, and under the same 9. Most recent authors do not believe in suborder in Thorne (2003). The affini- the aquatic ancestry of mono- ties between these two families is also cotyledons. Kosakai et al., (1970) have supported by morphological studies of provided ample evidence to refute the Doyle and Endress (2000). aquatic ancestry of monocotyledons on the basis of study of primary xylem in the roots of Nelumbo (Nymphaeales). Rolf Dahlgren Cronquist believed that mono- Rolf Dahlgren (1932-87), a Danish botanist cotyledons arose from vesselless working in Botanical Museum of the Uni- ancestors resembling presentday versity of Kopenhagen first proposed his sys- Nymphaeales. Dahlgren et al., (1985) tem and a new method of illustrating phylo- point out that Nymphaeales and genetic relationships in a text book in Dan- Alismatales demonstrate a case of ish in 1974. The revised system in English multiple convergence, and only a few and subsequent revisions were published in characters (sulcate pollen grains and 1975, 1980, 1981, 1983. A useful detailed trimerous flowers) are due to shared treatment of Monocotyledons was presented ancestry. The presence of two cotyle- in a book The families of Monocotyledons dons, S-type sieve tube plastids, occur- (Dahlgren et al.,) in 1985. His diagram, a rence of ellagic acid and perispermous cross-section through the top of an imagi- seeds in Nymphaeales argue strongly nary phylogenetic tree became very popular against their position as a starting for mapping the distribution of character- point of monocotyledons, and none of states in various orders of angiosperms, and these attributes occur in Alismatales. is popularly known as Dahlgrenogram. Systems of Classification 337

After Dahlgren’s tragic death in a car ac- cident in 1987, his wife Gertrud Dahlgren (Figure 10.20) continued his work and finally published the ‘last Dahlgrenogram’ for dicotyledons, followed by a classification of monocotyledons, both in 1989, incorporating the latest ideas of Dahlgren, and bringing up an updated classification of angiosperms. She also changed the endings for the superorders from –florae to –anae, since the use of former term restricted its application to only Figure 10.20 Rolf F. Dahlgren and his wife flowering plants, and the change to –anae Gertrud Dahlgren who has was in the interest of nomenclatural uni- continued his work on the classification of Angiosperms since formity. This practice of using –anae was his death in 1987. Gertrud has initially started by Takhtajan, and has now concentrated on evolutionary been incorporated by Thorne (since 1992), botany and species differentia- who earlier like Dahlgren, preferred the end- tion after 1990. (Photographs ing –florae. Gertrud followed this up (1991) courtesy Gertrud Dahlgren.) with the mapping of various embryological character-states. a family in Arales, merging Sparganiaceae The classification is closely similar to the in Typhaceae, Thismiaceae in Burmannia- earlier versions of Thorne in using the ceae, and Geosiridaceae in Iridaceae, plus name Magnoliopsida for angiosperms, shifting of a few families. Gertrud also in- Magnoliidae for dicots, and Liliidae for cluded the position of families in the bubble monocots. The realignments are based on a diagram. A broad outline of the classifica- large number of phenetic characteristics, tion, as presented by Gertrud Dahlgren is mainly phytochemistry, ultrastructure and presented in Table 10.11. embryology. The system includes 25 superorders in dicots and 10 in monocots. Several hundred such maps have been developed by Merits Dahlgren and his associates. Dahlgren The system of classification presented by pointed out that recognition of Dicotyledons Dahlgren has several advancements over and Monocotyledons would not be allowed if the previous systems of classification. The one followed rigid cladistic approaches, but salient advantages of the system include: he nevertheless, considered Monocotyledons 1. The system is a highly phylogenetic as a unique group worthy of subclass rank. one incorporating evidence from The Dahlgrenogram (Figure 10.21) is a morphology, phytochemistry and bubble diagram in which different orders are embryology. represented as bubbles, whose size is rela- 2. The angiosperms are given a more tive to the number of species in the order, agreeable rank of a class like Thorne and their related positions reflect phyloge- and other recent systems. netic affinities. The orders are combined 3. Unlike recent phylogenetic systems, no into superorders, thus forming bubble com- family of angiosperms is left unplaced. plexes. While presenting a revision of 4. The Dahlgrenogram in the form of a Dahlgren’s system in 1989, Gertrud made bubble diagram is very useful in giving significant changes in the superorders an idea about the relationships of Theanae, Malvanae, Rutanae and Cornanae. superorders, orders and even families. Similarly, in monocotyledons, the minor It also gives an idea about the relative changes included recognizing Acoraceae as number of species in each group. 338 Plant Systematics into superorders (Courtesy G. Dahlgren) Two-dimensional diagram of angiosperm classification (both dicots and monocots included) showing orders, combined Figure 10.21 Systems of Classification 339

Table 10.11 Outline of the updated Dahlgren’s classification of angiosperms as presented by his wife Gertrud Dahlgren (1989).

Dicotyledons 25 superorders, 87 orders and 343 families Sperorder Superorder 1. Magnolianae (10 orders) 14. Rutanae (9 orders) 2. Nymphaeanae (2 orders) 15. Vitanae (1 order) 3. Ranunculanae (2 orders) 16. Santalanae (1 order) 4. Caryophyllanae (1 order) 17. Balanophoranae (1 order) 5. Polygonanae (1 order) 18. Aralianae (2 orders) 6. Plumbaginanae (1 order) 19. Asteranae (2 orders) 7. Malvanae (5 orders) 20. Solananae (2 orders) 8. Violanae (7 orders) 21. Ericanae (5 orders) 9. Theanae (4 orders) 22. Cornanae (3 orders) 10. Primulanae (2 orders) 23. Loasanae (1 order) 11. Rosanae (15 orders) 24. Gentiananae (3 orders) 12. Proteanae (2 orders) 25. Lamianae (3 orders) 13. Myrtanae (2 orders)

Monocotyledons 10 superorders, 24 orders and 104 families

1. Alismatanae (2 orders) 6. Zingiberanae (1 order) 2. Triuridanae ( 1 order) 7. Commelinanae (3 orders) 3. Aranae (1 order) 8. Arecanae (2 orders) 4. Lilianae (6 orders) 9. Cyclanthanae (1 order) 5. Bromelianae (6 orders) 10. Pandananae (1 order)

5. The Dahlgrenogram has been widely 8. The merger of Scrophulariales with used for plotting and comparing the dis- Lamiales has been followed in the tribution of various character-states in recent classifications of Cronquist and angiosperms. APG. 6. The use of a superorder rank similar 9. The placement of Cornales closer to to Thorne and Takhtajan has resulted Ericales is justified by Judd et al., in a more realistic arrangement of (2002) and also followed up in Thorne families and orders. The use of ending (2003) and APG II (2003). –anae is in line with other two authors. 10. The separation of Brassicaceae and 7. The separation of genus Acorus from Capparaceae has found support from Araceae into a distinct family chloroplast sequence data (Hall, Acoraceae has been followed by recent Sytsma and Ilt is, 2002), consistent systems of Takhtajan (1997), Thorne with morphological data. (2000, 2003) and APG II, who have even separated the family under a distinct Demerits order Acorales. The genus is distinct Although the system of classification of from Araceae in ensiform leaves, glan- Dahlgren shows several improvements over dular tapetum, and the type of the earlier systems, it suffers from the fol- endothecial cells. lowing drawbacks: 340 Plant Systematics

1. The system covers only flowering 8. Dahlgren had regarded Budlejaceae plants and does not proceed below the and Myoporaceae as distinct from family level, as such is not usefully for Scrophulariaceae but morphological arranging specimens in a herbarium studies of Bremer et al., (2001) and or for following in the Floras. molecular (three gene analysis) by 2. Dahlgren places Asteranae, Cornanae Olmstead et al., (2001) supported their and Aralianae before Lamianae, merger, which was followed by APG II whereas the data from molecular stud- (2003) and Thorne (2003). ies justifies placement of the group (with circumscription somewhat simi- Robert F Thorne lar to Euasterids II) after Lamiidae Robert F. Thorne (b. 1920), an American tax- (Comparable to Euasterids I of APG II). onomist, associated with the Rancho Santa 3. Dahlgren divides angiosperms into di- Ana Botanic Garden, Claremont, California, cotyledons and monocotyledons, where has developed and periodically revised a sys- as the recent classification of APG II tem of classification. Earlier versions of the (2003) and Thorne (2000, 2003), the classification closely approached the system primitive angiosperms are placed sepa- proposed by Dahlgren in giving angiosperms rately. a rank of a class, and dicots and monocots 4. Monocotyledons are placed after dicoty- as subclasses. These were further subdi- ledons, whereas the recent classifica- vided into superorders, orders, suborders and tions place them between primitive families. In general approach of arrange- angiosperms and the eudicots. ment of orders and families, there was a con- 5. The family Ceratophyllaceae is placed siderable parallel development with other under order Nymphaeales, but the three contemporaries Cronquist, Dahlgren studies of Zanis et al. (2002) and and Takhtajan. Whitlock et al., (2002) have shown that Thorne (Figure 10.22) first put forward his the family is a sister group of monocots classification in 1968 and proposed revisions as indicated by microsporogenesis and in 1974, 1976, 1981, 1983, 1992, 1999, 2000, structure of leaf margin. It is accord- 2003 and 2007. He earlier preferred the end- ingly placed just before monocots in ing -florae over -anae of Takhtajan for su- APG II. perorders, but has now (1992 onwards) ac- 6. Family Acoraceae is placed under or- cepted the ending -anae. Dr. Thorne is the der Arales, but according to molecular recipient of the prestigious Asa Gray Award studies of Chase et al., (2000) and Fuse (2001) from the American Society of Plant and Tamura (2000), it deserves place- Taxonomists and the Merit (1996) and Cen- ment before the rest of the monocots. tennial Award (2006) from the Botanical So- 7. Family Winteraceae is placed in a sepa- ciety of America. rate order much after Canellaceae, Thorne incorporated the role of phy- whereas the multigene analyses tochemistry in realignment of taxa, recog- (Soltis et al., 1999; Zanis et al., 2002, nizing subfamilies more frequently and ap- 2003) have provided 99-100 per cent plied the principle of priority up to the class bootstrap support in their relation- rank thus preferring name Annonopsida for ship. The two are accordingly placed in angiosperms, Annonidae for dicots, replac- the same order in APG II and APweb, ing Magnoliflorae by Annoniflorae and and under the same suborder in Magnoliales by Annonales. Since 1992 he Thorne (2000, 2003). The affinities has, however, abandoned this departure from between these two families are also contemporary systems and adopted the gen- supported by morphological studies of erally accepted names Magnoliopsida, Doyle and Endress (2000). Magnoliidae and Magnoliales. Systems of Classification 341

Thorne’s diagram indicating the relationship between different groups, is a phylogenetic shrub viewed from above, with the centre of the diagram left empty to indicate extinct early angiosperms; those nearer the centre being the primitive groups and those nearer the periphery the advanced ones. The relative number of species in different groups is indicated by balloons of different sizes (Fig- ure 10.23). Since 1992, Thorne has been putting up electronic revisions of his classification. The major revision put up in 1999 at: http:/ /www.inform.umd.edu/PBIO/fam/ thorneangiosp99.html made a big departure from 1992 version abandoning traditional division into dicots and monocots thus con- Figure 10.22 Robert Thorne of Rancho Santa Botanic Garden. His latest revi- forming to the current cladistic approach. sion of the classification of An- The classification was published in 2000 in giosperms was published in ‘Botanical Review’. Angiosperms were clas- 2007. sified into 10 subclasses wherein the traditional monocot taxa were distributed in Garden as www.rsabg.org/angiosperms/ three subclasses (Alismatidae, Liliidae angiosperms.pdf . The latest revision pub- and Commelinidae) placed after lished in 2007 (New York Botanical Garden Magnoliidae and before Ranunculidae. Press) recognizes 12 subclasses, 36 super- The ten subclasses somewhat approaching orders, 85 orders and 485 families. The sig- the informal groups of APG included Magno- nificant changes include: liidae, Alismatidae, Liliidae, Commelinidae, 1. The number of subclasses has been Ranunculidae, Caryophyllidae, Dilleniidae, increased to 12 (as against 10 in 2000, Rosidae, Asteridae and Lamiidae. This ar- 2003, and 11 in 2006) by adding rangement brought about a more realistic Chlorandidae (earlier placed under phylogenetic arrangement of different Magnoliidae] at the beginning of clas- taxa, bringing the system much closer to sification and Malvidae (containing five that of Angiosperm Phylogeny Group. The superorders segregated from Rosidae) classification recognized 31 superorders after Rosidae. Certaophyllaceae placed and 74 orders covering 471 families in an- in 2006 under Ranunculidae has been giosperms. There were also 7 uncertain gen- shifted under order Nymphaeales of era, 4 of them assigned tentatively to mono- Chloranthidae. typic families. The classification is also very 2. Magnoliidae now has only one super- elaborate in that orders, where necessary, order Magnolianae (Nymphaeanae have been divided into suborders, and fami- removed to Chloranthidae and lies similarly into subfamilies. Rafflesianae to Malvidae) with four or- The classification has undergone a ma- ders (as against 1 in 2000 and four in jor revision after the publication of APG II, 2003). Winteraceae (like in 2003) loses in 2003 (10 subclasses, 33 superorders, 90 its position as the first family of orders and 489 families), 2006 (11 sub- angiosperms. classes, 35 superorders, 89 orders and 486 3. Superorder Triuridanae in Alismatidae families) classification displayed on the (Takhtajan 1987, 1997 took it to dis- website of the Rancho Santa Ana Botanic tinct subclass Triurididae) has been 342 Plant Systematics

Table 10.12 Outline of the system of classification of Angiosperms proposed by Thorne in 2007.

Class Magnoliopsida

12 subclasses, 36 superorders, 85 orders, 485 families ; estimated genera- 13,372,

species-2,53,300 Subclass 1. Chloranthidae 1 superorder, 2 orders , 9 families, 19 genera, 250 species Superorder 1. Chloranthanae 2. Magnoliidae 1 superorder, 4 orders , 20 families, 276 genera, 8805 species Superorder 1. Magnolianae 3. Alismatidae 3 superorders, 6 orders , 18 families, 235 genera, 3660 species Superorder 1. Acoranae 2. Aranae 3. Alismatanae 4. Liliidae 3 superorders, 5 orders ,51 families, 1261 genera, 29085 species Superorder 1. Pandananae 2. Dioscoreanae 3. Lilianae 5. Commelinidae 2 superorders, 10 orders , 35 families, 1116 genera, 23270 species Superorder 1. Arecanae 2. Commelinanae 6. Ranunculidae 2 superorders, 8 orders , 17 families, 298 genera, 6350 species Superorder 1. Proteanae 2. Ranunculanae 7. Hamamelididae 1 superorder, 4 orders , 22 families, 145 genera, 3870 species Superorder 1. Hamamelidanae 8. Caryophyllidae 5 superorders, 9 orders , 46 families, 889 genera, 13875 species Superorder 1. Berberidopsidanae 2. Caryophyllanae 3. Dillenianae 4. Santalanae 5. Balanophoranae 9. Rosidae 7 superorders, 12 orders , 83 families, 2258 genera, 48127 species 1. Celastranae 2. Violanae 3. Podostemanae 4. Oxalidanae 5. Geranianae 6. Rosanae 7. Myrtanae 10. Malvidae 5 superorders, 8 orders , 61 families, 1430 genera, 20430 species Superorder 1. Malvanae 2. Rafflesianae 3. Capparanae 4. Huerteanae 5. Rutanae 11. Asteridae 4 superorders, 13 orders , 78 families, 2677 genera, 44970 species Superorder 1. Cornanae 2. Ericanae 3. Aralianae 4. Asteranae 12. Lamiidae 2 superorders, 4 orders , 45 families, 2752 genera, 50310 species Superorder 1. Solananae 2. Lamianae Four genera (Haptanthus, Heteranthia, Pottingeria and Pteleocarpa) of uncertain position Systems of Classification 343

abolished, as also the order Triuridales. 9. Subclass Caryophyllidae has seen As in 2003, Family Petrosaviaceae is major revision in 2006, recognising placed order Petrosaviales (under five superorders as against only one in superorder Acoranae). Triuridaceae is 2003. shifted to Liliidae—>Pandananae—> 10. Malvidae has been added as new Pandanales. superorder after Rosidae in 2007, 4. Liliidae contains the same number of including four super Rosidae is the three superorders as 2003 (there were largest subclass with 11 superorders two in 2000) but Taccanae has been Malvanae, Rafflesianae, Capparanae, replaced by Dioscoreanae. The number Huerteanae and Rutanae all segre- of orders in have, however been gated from Rosidae. reduced from 9 in 2003, 2006 to 5 in 11. Rosidae with the removal of 5 super- 2007, all 5 in Pandananae merged into orders from 2006 revision includes the a single order Pandanales. remaining 6 superorders. 5. Subclass Commelinidae has 2 super- 12. Subclass Asteridae has same four orders (same as in 2003) instead of 3 superorders as 2003 (Ericanae was (in 2000), Hydatellanae being abolished. added in 2003 mostly containing the 6. Ranunculidae finds one superorder members of Dillenianae which has added to 2000 classification. Proteanae now been restricted to include only is shifted from Dilleniidae and broad- Dilleniaceae under Rosidae). The new ened to include Platanaceae (shifted version has two orders lesser. from Rosidae—> Rosanae— Hydrangeales has been abolished with >Hamamelidales), Buxaceae and its families distributed between Didymelaceae (shifted from Rosidae— Cornales and newly created order >Rosanae—>Balanopales) and Desfontainiales. Sabiaceae (shifted from Dilleniidae— 13. Subclass Lamiidae has one order >Rutanae—>Rutales). These are Garryales added (to 2000 version) in- recognized under four distinct orders cluding families Garryaceae, Aucuba- Proteales, Platanales, Buxales and ceae, Eucommiaceae, Oncothecaceae Sabiales. The placement broadly and Icacinaceae. The arrangement is remains the same as in 2003 more or less same as in 2003 and 2006. 7. The largest subclass Dilleniidae (with 14. Genus Guametela, which was earlier 10 superorders, 19 orders and 160 listed as genus of uncertain position families in 1999, 2000 version), which has been placed in 2007 revision un- was abolished in 2003 and its contents der a distinct family Guametelaceae distributed mainly under Rosidae (see under superorder Crossosomatales, under Rosidae). Rest of the members Myrtanae, Rosidae; Pottingeria has been are distributed under Caryophyllidae listed as genus of uncertain position. and Asteridae 8. The new subclass Hamamelididae, Many of these changes are in line with established in place of Dilleniidae in APG II. Significant parallels include the 2003, includes orders Hamamelidales, (a) placement of Amborellaceae, Chlorantha- Saxifragales, Juglandales and ceae and Austrobaileyaceae towards the Betulales, all shifted from Rosidae— beginning of angiosperms; (b) recognition >Rosanae (of 2000). The revisions of of Canellales, Piperales, Laurales and 2006 and 2007, however, shift Vitaceae independent orders within Magnoliidae; of Gunnerales to Malvidae, Gunnera- (c) Shifting of Triuridaceae and Stemona- ceae to Asteridae and Berberidopsi- ceae closer to Pandanaceae; (d) Bringing dales to Caryophyllidae. closer families Proteaceae, Platanaceae, 344 Plant Systematics

Figure 10.23 Thorne’s Phylogenetic shrub of Angiospermae (2000 version of classification).

Buxaceae and Didymelaceae; (e) Shifting of groups, and focussing those which need fur- Hamamelidaceae, Saxifragaceae, Vitaceae ther investigation. Salient features of 2007 away from Rosidae to Hamamelididae; (f) version are given in Table 10.12. placement of Ericaceae and related families under Asteridae and away Rosidae (and abol- Merits ished Dilleniidae) and (g) recognition of The classification of Thorne has kept pace Garryales as distinct order including with recent developments, and is being regu- Garryaceae, Aucubaceae and larly updated. The system is merited with the Eucommiaceae. following achievements over the previous Thorne, in his 2003 version had also in- and contemporary systems of classification: troduced the concept of assigning the degree 1. It is a highly phylogenetic system, in- of confidence in hierarchical level, circum- corporating the recent evidence from scription and alignment of taxa, continued molecular systematics and chemotaxo- in 2006 and 2007 revisions. A represents nomy, and balancing it with evidence limited confidence, B for probably correct as- from other sources. signment and C implies considerable confi- 2. The angiosperms are given a more dence in assignment. Such an indication is agreeable rank of a class like Dahlgren very useful for future placements of the and other recent systems. Systems of Classification 345

3. The system is more exhaustive than 12. Family Winteraceae and Canellaceae the contemporary systems in that are brought together under the same families, where necessary have been order. Their affinities are strongly sup- divided into subfamilies. Similarly ported by morphological studies and suborders are recognized under sev- multigene analyses. eral orders. 13. The separation of Brassicaceae and 4. The system, unlike the APG II has Capparaceae has found support from found a place for all unplaced families chloroplast sequence data (Hall, of APG. Sytsma and Iltis, 2002), consistent 5. The placement of Amborellaceae, with morphological data. Chloranthaceae, Austrobaileyaceae, 14. The merger of Budlejaceae in Nymphaeaceae and Cabombaceae (a Scrophulariaceae is supported by mor- major shift from 2006 version) at the phological studies of Bremer et al., beginning of angiosperms is generally (2001) and molecular (three gene favoured in the recent cladistic analysis) by Olmstead et al. (2001). schemes of APG ( and supported by Qui 15. Shifting Triuridaceae and Stemona- et al, 2000; Soltis et al., 2000). These ceae closer to Pandanaceae is in line have been placed under an independ- with recent APG schemes. The ent subclass Chloranthidae. evidence from 18S rDNA sequencing 6. Abolition of traditional groups dicots (Chase et. al., 2000) justifies place- and monocots, and dividing ment under Pandanales. Triurididae angiosperms directly into various sub- as an independent subclass is not jus- classes (with circumscription largely tified as indicated by recent evidence. paralleling informal groups of APG) is 16. The placement of Cornales and Ericales in line with the recent phylogenetic together under Asteridae is in line with thinking. recent thinking of APG. 7. The subclass Magnoliidae placed after 17. Family Liliaceae of Hutchinson and paleoherb families is in line with APG earlier authors has been split into a classification. number of monophyletic families such 8. The system is superior over APG II clas- as Liliaceae, Alliaceae, Asphodelaceae, sification in that formal group names Asparagaceae, etc. in line with the ar- are given for all supraordinal ranks. rangement in APG classifications. 9. The recognition of superorders with 18. The concept of assigning the degree of ending –anae has resulted in more confidence (A, B or C) in hierarchical realistic arrangement of the orders level, circumscription and alignment within subclasses. of taxa is very useful for better under- 10. The monocots families are arranged in standing of phylogenetic affinities. between primitive angiosperms and 19. The merger of Asclepiadaceae with more advanced dicots, and not towards Apocynaceae has been supported by the end of angiosperms, as in previous molecular analyses by Judd et al., systems of Takhtajan, Dahlgren and (1994) and Sennblad and Bremer Cronquist. This treatment is in agree- (1998). Recognition of distinct ment with Angiosperm Phylogeny Asclepiadaceae would render Apocyna- Group. ceae as paraphyletic (Judd et al., 2002). 11. Creation of superorder Malvanae and 20. Placement of Ceratophyllaceae under shifting several families of Rosidae Chloranthidae before monocots is in here has resulted in more realistic line with recent data. Studies of Zanis arrangement. et al. (2002) and Whitlock et al. (2002) 346 Plant Systematics

have shown that the family is a sister monocots; 54 orders in dicots and 14 in group of monocots as indicated by monocots are recognized. microsporogenesis and structure of leaf margin. Zheng-Yi Wu Demerits During the last decades Zheng-Yi Wu (b. 1916) and his associates have developed a In spite of several improvements, the follow- system of classification of angiosperms, ing drawbacks, however, may be pointed out: much different from contemporary systems 1. Although highly phylogenetic the sys- in logic and treatment. Professor Wu , Di- tem is not very useful for identifica- rector Emeritus, Academician of Chinese tion and adoption in herbaria since Academy of Sciences is a leading Chinese identification keys for genera, their taxonomist. He was appointed as a deputy distribution and description are not director of the Beijing Institute of Botany, provided. Chinese Academy of Sciences in 1950, be- 2. Thorne places Asteridae before came a member of the Chinese Academy in Lamiidae, whereas the data from mo- 1955, and the director of the Kunming In- lecular studies justifies placement of stitute of Botany in from 1974 through 1983. the group (with circumscription some- In addition to his numerous publications on what similar to Euasterids II) after Lamiidae (Comparable to Euasterids I of APG II) 3. Thorne is not clear about the affinities of four genera of angiosperms. 4. Grewiaceae (former Tiliaceae with Tilia excluded) is recognized as an independent family, whereas recent APG classifications (Judd. et al., APG II and APweb) place all members of Tiliaceae, Bombacaceae and Sterculiaceae under Malvaceae. 5. Thorne separates Cabomba and Brassenia under Cabombaceae on the basis of trimerous flowers, with distinct sepals and petals, 2-3 free carpels, and fruit a follicle, whereas the cladistic analyses support their placement under Nymphaeaceae as done by APG II, APweb and Judd et al. The separation of Cabombaceae renders Nymphaeaceae as paraphyletic. C. R. de Soo From Budapest, Hungary, C. R. de Soo proposed (1975) a classification essentially similar to Takhtajan’s but preferring the Figure 10.24 Zheng-Yi Wu, a leading Chinese name Angiospermophyta for angiosperms, Taxonomist who spearheaded Dicotyledonopsida for dicots and the publication of Flora of China Monocotyledonopsida for monocots. Five and published his new eightclass subclasses are included in dicots and 3 in classification of angiosperms. Systems of Classification 347 many plant families and genera, Professor polytopic. By “polyphyletic” the authors Wu is credited for 28 major works in tax- meant that during Early Cretaceous explo- onomy, vegetation, floristics, biogeography, sion of angiosperms, there were many Chinese herbals, and diversity. He led or monophyletic groups due to extinction of joined several botanical expeditions, espe- many ancient species. By polytopic, the au- cially to Xizang. He described about 300 new thors did not mean that the same group could species and proposed 11 genera. He has de- have occurred on different continents at the voted himself to the research of the flora of same time, they rather believed that the China and East Asia since 1930s. He is the modern inter-continental disjunctive distri- Chairman of editorial board for the publica- bution patterns of angiosperms can be ex- tion of “Flora of China”, which describes all plained only by using plate tectonics and the diverse species of plants in China, a vicariance biogeography. After their origin large-scale scientific work projected to cover from Pangaea during Late Triassic to the 80 volumes and 125 issues in Chinese. An Early Jurassic, the pro-angiosperms might English version has been published under have undergone a process of differentiation, the co-editorship of Dr. Peter H. Raven, Di- extinction and re-differentiation of several rector of the Missouri Botanical Garden. dozen million years, and then undergone a From a global perspective, Dr. Wu has shown great explosive radiation in the Early Creta- deep involvement with the attempts to pro- ceous. By that time, the major groups of an- tect natural flora, specially the human-in- giosperms might have appeared, forming 8 duced extinction of plant species and their major lineages at early stage of differentia- impact on the global environment. His ef- tion of angiosperms. These eight lineages forts have contributed to the establishment are circumscribed as 8 classes, thus propos- of national parks and natural reserves in ing a new 8-class system of classification. China. The system is outlined in Table 10.13 The ideas for this polyphyletic-polychronic-polytypic classification dividing an- Angiosperm Phylogeny Group giosperms into eight classes, were presented in two papers of Wu et al. (1998a, (APG) 1998b). The synopsis of classification was First serious attempts towards developing a published in 2002, and detailed description cladistic classification were made by of families and genera represented in China Bremer (Figure 10.25) and Wanntorp (1978, in 2003. 1981), who suggested that angiosperms The classification has been developed on should be treated as subclass Magnoliidae the basis of assumption that although an- of class Pinatae (seed plants). They argued giosperms are monophyletic in their earli- that Monocotyledons and Dicotyledons should est origin, yet owing to some intrinsic fac- not be recognized because it will make the tors in plants themselves and different ex- group paraphyletic, suggesting that an- trinsic factors appearing on the Earth after giosperms should be directly divided into a the Early Cretaceous explosion of an- number of superorders. The proposal was not giosperms, some groups might have become taken seriously because monocots and di- isolated and continued to flourish for many cots as separate groups were recognized in generations. These groups might have given all major system of classifications up to the rise to many lineages, just like the situa- last decade of last century. tion that many branches and leaves may There has been a considerable revival of sprout from a single shoot. Thus viewed from the cladistic concepts with the utilization of certain cross section of time, some lineages molecular data and development of powerful are monophyletic-monochronic-monotopic, tools of data handling. During the last whereas others are polyphyletic-polychronic- decade, concept has developed into APG 348 Plant Systematics

Table 10.13 Broad outline of 8-class polyphyletic-polychronic-polytopic classification of angiosperms proposed by Zheng-Yi Wu et al. (2002).

Phylum Magnoliophyta (Angiospermae) (8 classes, 40 subclasses, 202 orders, 572 families) Class Subclass Class Subclass 1. Magnoliopsida (5 subclasses, 11 orders, 17 families) 20. Commelinidae 1. Magnoliidae 21. Juncidae 2. Annonidae 22. Poaoidae 3. Illiciidae 23. Arecidae 4. Ceratophyllidae 6. Ranunculopsida 5. Nymphaeidae (4 subclasses, 9 orders, 17 families) 2. Lauropsida 24. Nelumbonidae (3 subclasses, 4 orders, 9 families) 25. Ranunculidae 6. Lauridae 26. Paeoniidae 7. Calycanthidae 27. Papaveridae 8. Chloranthidae 7. Hamamelidopsida 3. Piperopsida (3 subclasses, 11 orders, 21 families) (2 subclasses, 4 orders, 8 families) 28. Trochodendridae 9. Aristolochidae 29. Hamamelididae 10. Piperidae 30. Betulidae 4. Caryophyllopsida 8. Rosopsida (3 subclasses, 8 orders, 20 families)(10 subclasses, 112 orders, 361 families) 11. Caryophyllidae 31. Dilleniidae 12. Polygonidae 32. Malvidae 13. Plumbaginidae 33. Ericidae 5. Liliopsida 34. Rosidae (10 subclasses, 43 orders, 119 families) 35. Myrtidae 14. Alismatidae 36. Rutidae 15. Triurididae 37. Geraniidae 16. Aridae 38. Cornidae 17. Liliidae 39. Asteridae 18. Bromelidae 40. Lamiidae 19. Zingiberidae

classification by collaborative efforts of a were grouped into 40 putative monophyletic group of dedicated workers of ‘Angiosperm orders under a small number of informal Phylogeny Group’ (K. Bremer, A. Backlund, monophyletic higher groups: monocots, B. Briggs, B. Bremer, M. W. Chase, commelinoids, eudicots, core eudicots, M. H. G. Gustafsson, S. B. Judd, F. A. Kellogg, rosids, eurosids I, eurosids II, asterids, P. F. Stevens, M. Thulin and several others), euasterids I and euasterids II. Under these who published a classification of 462 fami- informal groups there were also listed a num- lies of Angiosperms in 1998. These families ber of families without assignment to order. Systems of Classification 349

ing a total of 51 orders and shifting some families from informal groups where they were placed directly in 1998 classification, to these orders. The book, however, lists only major families and as such nearly 200 families, have been left out. A revision presented in the 2nd edition (2002) has further improvements in line with thinking of APG, and is largely similar to the APG II classification, with minor differences. A recent revision of APG (APG II, 2003), and continuous upgradation on Angiosperm Figure 10.25 Kåre Bremer who first proposed Phylogeny website (APweb) by P. F. Stevens a cladistic classification of an- (Figure 10.25)- http://www.mobot.org/ giosperms, and has played a leading role in development of MOBOT/research/APweb/, have resulted in APG classification along with his considerable refinement in the APG wife Birgitta Bremer. These two, scheme, with more and more families (and along with several colleagues of some orders) coming out of the list of the Angiosperm Phylogeny unplaced taxa. A broad outline of APG II clas- Group, have been working at sification is presented in Table 10.14. The Phylogenetic classification. classification recognizes 45 orders of An- (Published with permission from giosperms, of which 44 are placed in 11 in- Kåre Bremer) formal groups, considered more or less monophyletic. One order is unassigned at the beginning of Angiosperms. A total of 457 fami- Eleven unclassified families were included lies are recognized. in the beginning. Also in the beginning The short history of APG classification under Angiosperms directly were 4 orders makes interesting reading. A few trends are with no supraordinal grouping into informal also emerging fast. The monocots are bet- groups. At the end of the system there was ter placed under two groups, the commelinids an additional list of 25 families of uncertain and the rest of the monocots. These two position for which no firm data existed groups find their place after primitive an- regarding placement anywhere within the giosperms (and possibly the Magnoliids). system. The 1998 edition of APG classification had Recent cladistic analyses are revealing 82 unplaced families, of which 12 where the phylogeny of flowering plants in increas- placed towards the beginning and 25 towards ing detail, and there is support for the mono- the end, and 45 unplaced in the informal ten phyly of many major groups above the fam- groups. In addition, 18 families classified in ily level. four orders, placed in the beginning did not With many elements of the major branch- have any taxon at supraordinal rank. The ing sequence of phylogeny established, a number of these unplaced families has been revised suprafamilial classification of flow- reduced to mere 48 in APG II (in addition to ering plants becomes both feasible and 7 unplaced genera), and the four orders in desirable. Cladistic information strongly the beginning adjusted under Magnoliids points to the realization that simplistic (a combination of non-monocot paleoherbs division of angiosperms into monocots and and Magnoloid complex of Judd et al.), recog- dicots do not reflect phylogenetic history. nizing two unplaced orders in the beginning. Some modifications of APG classification The list of unplaced families at beginning were presented Judd et al. (1999) recogniz- has been reduced to 4 and uncertain 350 Plant Systematics

Table 10.14 Broad outline of APG II (2003) classification of Angiosperm Phylogeny Group.

Magnoliophyta Group Order Group Order

Unplaced families at base: Amborellaceae [+Cabombaceae], Chloranthaceae, Nymphaeaceae

1. Austrobaileyales 6. Rosids 2. Ceratophyllales 1. Crossosomatales 1. Magnoliids 2. Geraniales 1. Canellales 3. Myrtales 2. Laurales 7. Eurosids I 3. Magnoliales 1. Celastrales 4. Piperales 2. Cucurbitales 2. Monocots 3. Fabales 1. Acorales 4. Fagales 2. Alismatales 5. Malpighiales 3. Asparagales 6. Oxalidales 4. Dioscoreales 7. Rosales 5. Liliales 8. Eurosids II 6. Pandanales 1. Brassicales 3. Commelinids 2. Malvales 1. Ericales 3. Sapindales 2. Commelinales 9. Asterids 3. Poales 1. Cornales 4. Zingiberales 2. Ericales 4. Eudicots 10. Euasterids I 1. Proteales 1. Garryales 2. Ranunculales 2. Gentianales 5. Core Eudicots 3. Lamiales 1. Gunnerales 4. Solanales 2. Caryophyllales 11. Euasterids II 3. Santalales 1. Apiales 4. Saxifragales 2. Aquifoliales 3. Asterales 4. Dipsacales

Taxa of uncertain position:Aneulophus, Apodanthaceae, Bdalophyton, Balanophoraceae, Centroplacus, Cynomoriaceae, Cytinaceae, Dipentodontaceae, Gumillia, Hoplestigmataceae, Leptaulus, Medusandraceae, Metteniusaceae, Mitrastemonaceae, Pottingeriaceae, Rafflesiaceae, Soyauxia and Trichostephanus. In addition the unplaced families in groups include 4 in the beginning (listed above),1 in monocots (Petrosaviaceae) 1 in Commelinids (Dasypogonaceae), 5 in Eudicots (Buxaceae, Didymelaceae, Sabiaceae, Trochodendraceae and Tetracentraceae), 3 in core eudicots (Aextoxicaceae, Berberidopsidaceae, Dilleniaceae), 6 in Rosids (Aphloiaceae, Geissolomataceae, Ixerbaceae, Picramniaceae, Strasburgeriaceae, Vitaceae ), 3 in Eurosids I (Zygophyllaceae, Krameriaceae, Huaceae), 1 in eurosids II (Tapisciaceae), 4 in Euasterids I (Boraginaceae, Icacinaceae, Oncothecaceae, Vahliaceae) and 9 in Euasterids II (Bruniaceae, Columelliaceae, Desfontainiacea, Eremosynaceae, Escalloniaceae, Paracryphiaceae, Polyosmaceae, Sphenostemonaceae, Tribelaceae). Systems of Classification 351

Figure 10.26 Interrelationships of orders and some families presented in APG II classification (2003), having bootstrap support of more than 50 per cent. 352 Plant Systematics families towards the end to just 11 (plus 7 unplaced genera). A Cladogram presented by APG II, depicting the relationship of orders, informal higher groups, and some families is presented in Figure 10.26. Stevens in the periodically updated APweb (version 7, June 2008; Table 10.15) has reduced the number of unplaced families to 7, none in the beginning and the end. He has added four orders of gymnosperms in APweb. He has also recognized 16 additional orders of angiosperms (total 61 as against 45 in APG II), of which 3 accommodate unplaced families of APG II in the beginning of angiosperms (Amborellales, Nymphaeales, Chloranthales), 1 in monocots (Petrosaviales), 2 in Commelinids (Ceratophyllalesrathe-rther between commelinids and Magnoliids), 2 in Eudicots (Buxales, Trochodendrales; plus 1 Gunnerales shifted from Core eudicots), 3 Figure 10.27 Peter F. Stevens of Missouri in Core Eudicots (Berberidopsidales, Botanic Garden, who has been Dilleniales, Vitales) , and 1 in Eurosids I upgrading his APweb classifica- (Zygophyllales). The main tree (Figure 10.27) tion at the Angiosperm Phylog- shows relationships of orders (there are no eny website. unplaced families in the beginning). There are also useful tree links which lead to the concept of monophyly, so sacred with the trees for individual orders. Angiosperm Phylogeny Group. A comprehensive treatment of the fami- The true phylogenetic picture of lies of angiosperms based on APG II with angiosperms is still far from clear. There some modifications is presented by Soltis et seems to be considerable unanimity in al. (2005). The number of unplaced families removing some of the primitive herbaceous has been reduced to 26, and three orders (Pet- families of Magnoloid complex such as rosaviales, Dasypogonales, Berberidop- Amborellaceae, Cabombaceae, Paeoniaceae, sidales) added to the APG scheme, and one Austrobaileyaceae, Trimeniaceae, Illiciace- dropped (Ceratophyllales) thus recognising ae, and Schizandraceae and place them a total of 47 orders. An outline of the classi- towards the beginning of the angiosperms. fication is presented in Table 10.16. This renders both monocots and eudicots as Table 10.17 presents a comparison of the truly monophyletic groups. The position of treatment given to the unplaced families (of Magnoliids (after the removal of herbaceous APG or any other system) in five recent sys- families) seems to be settled before mono- tems of classification. The number of cots. Earlier versions of APweb ( up to unplaced families has been drastically re- Version 6) and first edition of Judd et al. duced in recents treatments of Stevens (1999) of their book, had placed Magnoliids (2008) and Judd et al. (2008). Thorne does after monocot, but version 7 of APweb (2008) not belong to the Angiosperm Phylogeny in the second (2002) and Third (2008) edi- Group, but has kept pace with the recent mo- tions of Judd et al., like APG II, Magnoliid lecular developments, and is trying to bal- complex is placed before Monocots. The clas- ance hierarchical classification with the sification of Judd et al., differs from APG II Systems of Classification 353

Table 10.15 Broad outline of APweb (version 7, June 2008) classification of Flowering plants presented on Angiosperm Phylogeny website of P. F. Stevens.

Magnoliophyta Group Order Group Order

1. Amborellales 6. Vitales 2. Nymphaeales 6. Rosids 3. Austrobaileyales 1. Geraniales 4. Chloranthales 2. Myrtales 3. Magnoliids 7. Eurosids I 1. Magnoliales 1. Zygophyllales 2. Laurales 2. Celastrales 3. Canellales 3. Oxalidales 4. Piperales 4. Malpighiales 1. Monocots 5. Cucurbitales 1. Acorales 6. Fagales 2. Alismatales 7. Fabales 3. Petrosaviales 8. Rosales 4. Dioscoreales 8. Eurosids II 5. Pandanales 1. Crossosomatales 6. Liliales 2. Picramniales 7. Asparagales 3. Sapindales 2. Commelinids 4. Huerteales 1. Ericales 5. Brassicales 2. Poales 6. Malvales 3. Commelinales 4. Zingiberales 9. Asterids * Ceratophyllales 1. Cornales 2. Ericales 4. Eudicots 10. Euasterids I 1. Ranunculales 1. Garryales 2. Sabiales 2. Gentianales 3. Proteales 3. Lamiales 4. Trochodendrales 4. Solanales 5. Buxales 11. Euasterids II 6. Gunnerales 1. Aquifoliales 5. Core Eudicots 2. Asterales 1. Berberidopsidales 3. Escalloniales 2. Dilleniales 4. Bruniales 3. Caryophyllales** 5. Apiales 4. Santalales 6. Paracryphiales 5. Saxigragales 7. Dipsacales

Unplaced families: 1 in Commelinids (Dasypogonaceae), 1 in Eudicots (Medusandraceae) and 5 in Euasterids I (Oncothecaceae, Metteniusaceae, Icacinaceae, Boraginaceae, Vahliaceae). *considered closer to monocots, **closer to Asterids. 354 Plant Systematics

Figure 10.28 Main tree showing relationships between various orders of angiosperms and the informal higher clades presented by Stevens in APweb (version 7, 2008). Tree icons link to the trees of the respective orders on the web. (Reproduced with permission from P. F. Stevens) Systems of Classification 355

Table 10.16 Broad outline of APG classification used by Soltis et al. (2005), based on rearrangements of APG II.

Angiosperms Group Order Group Order

1. Basal angiosperms: Amborellaceae, Nymphaeaceae, Ceratophyllaceae, Chloranthaceae

1. Austrobaileyales 1. Magnoliids 7. Eurosids I 1. Magnoliales 1. Rosales 2. Laurales 2. Fabales 3. Piperales 3. Cucurbitales 4. Canellales 4. Fagales 2. Monocots 5. Malpighiales 1. Acorales 6. Oxalidales 2. Alismatales 7. Celastrales 3. Petrosaviales 8. Eurosids II 4. Pandanales 1. Brassicales 5. Dioscoreales 2. Sapindales 6. Liliales 3. Malvales 7. Asparagales 9. Other Rosids 3. Commelinid Monocots 1. Myrtales 1. Ericales 2. Geraniales 2. Dasypogonales 3. Crossosomatales 3. Zingiberales 10. Asterids 4. Commelinales 1. Cornales 5. Poales 2. Ericales 4. Eudicots 11. Euasterids I 1. Ranunculales 1. Garryales 2. Proteales 2. Lamiales 5. Core Eudicots 3. Gentianales 1. Gunnerales 4. Solanales 2. “Berberidopsidales” 12. Euasterids II 3. Saxifragales 1. Aquifoliales 4. Santalales 2. Asterales 6. Caryophyllales 3. Dipsacales 4. Apiales

Unplaced families: In addition to four unplaced families of basal angiosperms listed above there 1 in commelinid monocots (Dasypogonaceae), 3 in eudicots (Sabiaceae, Buxaceae, Trochodendraceae), 3 in rosids (Vitaceae, Picramniaceae, Huaceae), 2 in eurosids I (Zygophyllaceae, Krameriaceae), 1 in eurosids II (Tapisciaceae), 5 in Euasterids I (Oncothecaceae, Metteniusaceae, Icacinaceae, Boraginaceae, Vahliaceae) and 7 in Euasterids II (Escalloniaceae, Eremosynaceae, Bruniaceae, Columelliaceae (incl Desfontainiacea), Polyosmaceae, Tribelaceae, Sphenostemonaceae). 356 Plant Systematics in recognizing 3 orders Amborellales, Nym- 3. Formal group names have been given phaeales and Austrobaileyales for “basal fam- mostly only up to the level of the order, ilies” now known as ANITA Grade and in- where monophyly of the group has been cluding Chloranthaceae (although with un- firmly established. certain placement), shifting Ceratophyllace- 4. The traditional division of angiosperms ae (although with uncertain position) to the has been abandoned and various end of Magnoliid complex, recognizing order monocot taxa placed in between primi- Vitales under Rosid clade (Vitaceae unplaced tive angiosperms and eudicots, thus in Rosids in APG II), recognizing Zygophylla- overcoming the problem of paraphyly les as a distinct order under Eurosids I (Zy- in the earlier recognized two groups gophyllaceae unplaced in Eurosids I in APG monocot and dicots. II) and shifting the sequence of some orders, 5. Although no formal names have been recognising 45 orders of Angiosperms. Some given for groups above the rank of or- informals names have also been introduced: der, there is constant endeavour to ANITA Grade for early angiosperms, Fabids construct supraordinal monophyletic for Eurosids I, Malvids for Eurosids II, Sym- clades. petalae for Asterid Clade, Lamiids for Euas- 6. A number of cladograms are being pre- terids I and Campanulids for Euasterids II. sented for general affinities between Perhaps we have broken the jinx of dicot- various groups of angiosperms based monocot grouping of angiosperms, position on molecular as also on information of Magnoliid complex, which includes some from other fields. of the most primitive representatives of an- 7. The families with several primitive giosperms, also seems to be settled. The po- features are placed towards the begin- sition of Piperales seems to be more or less ning of angiosperms. The family stabilized towards the end of Magnoliids, but Amborellaceae, which is unique in family Ceratophyllaceae has still to find a angiosperms in having granular and stable position. Judd et al., place the family not tectate ectexine is placed at the under order Ceratophyllales after Piperales start. within Magnoliid complex with uncertain po- 8. Although there are four unplaced fami- sition, APG II place it before monocots, to- lies in APG towards the beginning of wards the beginning of angiosperms, and the angiosperms, these have been ac- APweb towards end of Commelinids. commodated under orders in APweb. 9. The number of unplaced families in Merits various informal groups and uncertain This newly emerging system of classifica- families towards the end have been tion, which has undergone dramatic modi- sufficiently reduced in APG II and fication over the last five years and is fast APweb, finding ordinal places for many evolving, due to concerted efforts of a group unplaced families of APG (1998). of dedicated workers has several merits in 10. The merger of Budlejaceae and APG II (and APweb): Myoporaceae with Scrophulariaceae 1. The system is based on the sound has the support of morphological stud- phylogenetic principle of constructing ies of Bremer et al., (2001) and molecu- taxa on the basis of established lar (three gene analysis) by Olmstead monophyly. et al. (2001). 2. The system is based on a synthesis of 11. Winteraceae and Canellaceae are information from mainly morphology, brought together under the same or- anatomy, embryology, phytochemistry der. Their affinities are strongly sup- and more strongly on molecular stud- ported by morphological studies and ies. multigene analyses. Systems of Classification 357

Table 10.17 Comparison of most recent phylogenetic systems of classifications indicating major groups and the number of unplaced taxa.

APG (1998) Modified APG APG II (2003) APweb Thorne 2007 (Judd et al., 2008) (Stevens 2008)

Unplaced at start ANITA Grade * (@ 4 families * ( 4 orders) Chloranthidae *(@ 12 families (@ 1 family + 2 orders) + 4 orders) + 3 orders) Magnoliid complex (@ 1) Magnoliids Magnoliids Magnoliidae

Monocots (@ 5) Monocots Monocots (@ 1) Monocots (@ 1) Alismatidae Liliidae Commelinoids (@ 6) Commelinoid clade Commelinids (@ 1) Commelinids Commelinidae

Eudicots (@ 4) Tricolpates (Eudicots) Eudicots (@ 5) Eudicots (@ 1) Ranunculidae Basal Tricolpates (@ 2) Core Eudicots (@ 6) Core Tricolpates (Core Core Eudicots (@ 3) Core Eudicots Hamamelididae Eudicots) Caryophyllidae Rosids (@ 7) Rosid clade Rosids (@ 6) Rosids Eurosids I (@ 4) Eurosids I Eurosids I (@ 3) Eurosids Rosidae Eurosids II (@ 1) Eurosids II Eurosids II (@ 1) Eurosids II Malvidae

Asterids Asterid clade Asterids Asterids Asteridae Cornanae Ericanae !Aralianae !Asteranae Euasterids I (@ 3) Euasterids I Euasterid s I (@ 3) Euasterids I (@ 5) Lamiidae Solananae Lamianae Euasterids II Euasterids II (@ 1) Euasterids II (@ 10) Euasterids II (!Aralianae, Asteranae)

** (25 families) ** not listed **(10 families, 5 genera) **(none) **(4 genera)

* Unplaced at the start of Angiosperms, orders have no supraordinal grouping. ** families of uncertain position. @ Families unplaced in various groups. ! Thorne includes Aralianae and Asteranae under Asteridae, which cover orders included under Euasterids II, and is placed before Lamiidae, which roughly covers the orders included under Euasterids I.

12. Liliaceae of Hutchinson and earlier karyotype. The placement has been authors has been split to form several adopted by Judd et al., (2002, 2008), monophyletic families such as Thorne and APweb. Liliaceae, Alliaceae, Asparagaceae, 14. Circumscription of Malvaceae has Asphodelaceae, etc. been broadened to also include 13. Circumscription of Agavaceae has Tiliaceae, Sterculiaceae and Bombaca- been further strengthened to include ceae, thus forming monophyletic other genera like Hosta, Camassia and Malvaceae, as supported by morphologi- Chlorogalum, which also have bimodal cal and molecular evidence. 358 Plant Systematics

15. The merger of Asclepiadaceae with 6. Angiosperms have been given the Apocynaceae has been strengthened rank of a division, but there are no by molecular evidence Judd et al., formal taxa between the rank of an (1994) and Sennblad and Bremer order and division, a rather unusual (1998). Recognition of distinct phenomena for classification systems. Asclepiadaceae would render Apocyna- 7. Family Capparaceae has been merged ceae as paraphyletic (Judd et al., with Brassicaceae, but the Chloroplast 2002, 2008). sequence data points to the separation of these two families as also Demerits Cleomacae. Thorne (2006) recognizes Although the system is still evolving and con- Brassicaceae, Capparaceae and tinuously improving, and will take a consid- Cleomaceae as distinct families. erable time before it stabilizes and is tested The developments of the last few years by various parameters, a few shortcomings have seen clear emergence of a few facts. are obvious: The angiosperms are no longer to be divided 1. Classification having not proceeded into traditional dicots and monocots. below the family level, the system is Commelinids are distinct from other mono- not useful in practice and for adoption cots, and these two, forming the traditional in herbaria and floras. monocots are better placed between primi- 2. Although a large number of families tive angiosperms and the Eudicots. Primi- have been assembled into more or tive angiosperms include paleoherbs less monophyletic orders, there still (Nymphaeaceae, Cabombaceae, Piperaceae, exists a large number of unplaced Amborellaceae, Ceratophyllaceae, etc.) and families, and a few unplaced genera true magnoliids (Magnoliales, Laurales, etc.) in both APG II and APweb. are better placed before monocots. Thorne 3. Although most of the orders have been (1999, 2000, 2003, 2006) has come up with assembled into informal groups, no a major revision of his classification, bring- proper names conforming to the Bo- ing it on lines of APG, but maintaining the tanical Code have been given for hierarchical structure, and finding a place these groups. almost all families, with only 4 genera re- 4. Although APG II places all presumed maining unplaced. It is also interesting to primitive families of angiosperms be- note that his eleven subclasses are more or fore monocots, APweb transfers the less complementary to the eleven informal Magniliids to a position after monocots groups of APG-II, the relationship somewhat and commelinids. reversed in Asterids. Chapter 11 Families of Pteridophytes

Pteridophytes, Gymnosperms and Angio- Bold, Alexopoulos and Delevoryas (1987) sperms constitute Tracheophytes, a domi- included the same four group but preferred nant group of green plants, characterized by name Microphyllophyta for Lycopodiophyta the presence of a well developed branched, and Arthrophyta for Equisetophyta. Recent independent and dominant sporophyte, with evidence indicates that Pteridophytes often a vascular system consisting of xylem separated under ‘Ferns and Fern Allies’, form (tracheids-hence the name Tracheophytes, a paraphyletic assemblage of groups, which vessels in angiosperms) and phloem (sieve represent distinct evolutionary lines and are elements, sieve tubes in angiosperms). The lumped together for convenience. Recent group evolved nearly 420 million years ago, genetic data has shown that Lycopodiophyta and is regarded as monophyletic. Pterido- are only distantly related to other vascular phytes, the seedless vascular plants differ plants , having radiated evolutionarily at the from higher Tracheophytes in lacking seed base of vascular plant clade, whereas Psilo- habit and absence of pollen tube, spores de- phyta and Equisetophyta are much closer to veloping freely into gametophytes, although true ferns. Tracheophytes are considered to few members exhibit heterospory and the re- include two major lineages: lycophytes and duction of megaspore number to one, fore- euphyllophytes. Latter in turn comprise two runner of seed habit. major lineages of living plants: ferns (includ- Pteridophytes form a complex heterogenous ing Psilotaceae and Equisetaceae) and sper- group reflecting antiquity and divergent matophytes or seed plants. Spermatophytes evolutionary clades, and have been classified consist of two major lineages: gymnosperms variously. Engler and Prantl recognised Bryo- and angiosperms. A more recent classifica- phyta and Pteridophyta as two subdivisions tion of Smith et al. (2006), based on morphol- of the division Embryophyta Asiphonogama. ogy as well as molecular data as such Cronquist, Takhtajan and Zimmermann excludes Lycopodiophytes from Ferns, divides (1966) recognised four groups within Pterido- ferns into two group: eusporangiate ferns phytes, each given the rank of a division: including Marattiaceae and leptosporangiate 1. Psilophyta ferns, including the rest. The four groups, 2. Lycopodiophyta ranked as classes are listed below: 3. Equisetophyta 1. Psilotopsida 4. Polypodiophyta 2. Equisetopsida 360 Plant Systematics

Consensus phylogeny representing relationships among ferns (after Smith et al., 2006). Families of Pteridophytes 361

3. Marattiopsida etic orders, and 37 families, 32 of which are 4. Pteropsida strongly supported as monophyletic. As a departure from traditional classifi- Peridophytes include nearly 10280 spe- cations, Ophioglossaceae are included un- cies, 1280 belonging to lycophytes and nearly der Psilopsida. The classification recogniz- 9000 to ferns. Latter comprise horsetails, es four monophyletic classes, 11 monophyl- whisk ferns, and all eusporangiate and

Families of Pteridophytes (classification 0f Ferns according to Smith et al., 2006) Division: Tracheophyta- Vascular plants

Lycopodiophytes (Lycophytes) Order: Salviniales • Lycopodiaceae • Marsileaceae • Selaginellaceae • Salviniaceae • Isoetaceae Cyatheales Euphyllophytes • Thyrsopteridaceae Monilophytes- Ferns • Loxomataceae Class: Psilotopsida • Culcitaceae Order: Ophioglossales • Plagiogyriaceae • Ophioglossaceae • Cibotiaceae Psilotales • Cyatheaceae • Psilotaceae • Dicksoniaceae Class: Equisetopsida • Metaxyaceae Order: Equisetales Polypodiales • Equisetaceae • Lindsaeaceae Class: Marattiopsida • Saccolomataceae Order: Marattiales • Dennstaedtiaceae • Marattiaceae • Pteridaceae Class: Pteridopsida • Aspleniaceae Order: Osmundales • Thelypteridaceae • Osmundaceae • Woodsiaceae Hymenophyllales • Blechnaceae • Hymenophyllaceae Gleicheniales • Onocleaceae Dryopteridaceae • Gleicheniaceae • • Dipteridaceae • Lomariopsidaceae • Matoniaceae • Tectariaceae Schizaeales • Oleandraceae • Lygodiaceae • Davalliaceae • Anemiaceae • Polypodiaceae • Schizaeaceae Bold typed families are described and illustrated 362 Plant Systematics leptosporangiate ferns and are character- A brief description of major families of ized by lateral root origin in the endoder- Pteridophytes is presented in the following mis, usually mesarch protoxylem in shoots, pages. a pseudoendospore, plasmodial tapetum, and sperm cells with 30–1000 flagellae.

*************** Lycopodiaceae Mirbel Club Moss Family Cosmopoliton, diverse in tropical montane and alpine regions, rare in arid climate. 3 Genera, 380 species Salient features: Terrestrial or epiphytic dent and reaching up to 2 m, arising from herbs, stems dichotomously branched; creeping rhizome, rarely highly reduced as leaves simple, 1-veined, non-ligulate; spo- in Huperzia drummondii (Phylloglossum drum- rangia in axils of sporophylls, homosporous, mondii) scarcely exceeding 10 cm and all usually aggregated into strobilus; spores aerial parts dying off at the end growing sea- with 3-branched scar. son only underground tuber persisting. Roots dichotomously branched, adventitious, root Genera: Huperzia (300 species), Lycopodiel- hairs paired. Stem dichotomously branched, la (40) and Lycopodium (40). erect, creeping or pendent, slender, protostelic; unequal dichotomy often resulting in Description: Non-woody terrestrial or production of condensed axes forming ‘bul- epiphytic perennial herbs, sometimes pen- bils’ for vegetative propagation (Lycopodium

Figure 11.1 Lycopodiaceae. Lycopodium phlegmaria. A: Pendulous branch with terminal strobili; B: Vegetative leaf; C: Longitudinal section of strobilus; D: Sporophyll in adaxial view; E: Same in abaxial view; F: Vertical section of fetile branch of L. lucidulum showing sporangia in axils of unmodified sporophylls. Families of Pteridophytes 363 selago). Leaves simple, small and 1-veined flash of light. They were used in early (microphylls), nonligulate, up to 2 cm long, Chinese fireworks, by magicians and sor- covering the stem densely, spirally arranged cerers in Middle ages, and as flash in early or opposite, linear or scale-like, appressed photography, and first photocopying ma- or spreading, usually entire, rarely serrate chines. Spores have also been used as in- (Lycopodium serratum). Sporangia large, kid- dustrial lubricants and in surgical gloves and ney-shaped, sessile or short stalked, singly condomes. Plants of several species were ear- in axils (adaxial) of sporophylls which are lier gathered for making Christmas wreaths. similar to foliage leaves (and restricted to distal end of stem or in alternate sterile and Phylogeny: Although the family is well fertile zones) or well differentiated (smaller circumscribed, the generic limits have than foliage leaves and with dentate mar- undergone considerable readjustment. Often gin) forming a strobilus, homosporous, sub- treated under a single genus Lycopodium, or globose to reniform, shortly stalked, open- divided to five genera Lycopodium, Huperzia, ing by transverse slit, sometimes folding Diphasiastrum, Lycopodiella and Phylloglos- back to expose spores; spores subglobose or sum. Last genus includes a single peculiar tetrahedral, with a 3-branched scar. Game- species of reduced plants found in Australia tophyte green when on soil surface, non- New Zealand and Tasmania, but gameto- green when subterranean, irregularly lobed, phyte morphology and rbcL studies support often living up to 25 years; antheridia sunk- the inclusion under Huperzia. Diphasias- en, spermatozoids produced in large num- trum, a genus of nearly 16 species of low gym- bers, biflagellate. nosperm like plants, and often called as Ground-pine or Ground-cedar, is better Economic importance: Family is of little im- placed under Lycopodium. The family is very portance. The spores of Lycopodium contain old in fossil record, dating back to 380 MYA, a highly volatile oil and ignite rapidly into a mostly dominated by lycopod trees.

***************

Selaginellaceae Wilk. Spike Moss Family Worldwide, predominant in tropics, a few species extending to temperate and arctic region. 1 Genus, 750 species

Salient features: Terrestrial or epiphytic in moist habitats, creeping (S. kraussiana) herbs, stems dichotomously branched, or erect (S. rupestris), few in semiarid reproducing rhizophores; leaves simple , 1- gions, rarely epiphytic. Roots dichotomous- veined, ligulate, dimorphic, often 4-ranked; ly branched, arising from distal end of rhizo- sporangia in axils of sporophylls, het- phore, adventitious; rhizophores arising erosporous, aggregated into usually 4-angled from stem. Stem dichotomously branched, strobilus. with both creeping and short erect branches or with only erect branches, protostelic, Genera: Single genus Selaginella (750 spe- with vessels. Leaves simple, small and 1- cies). veined (microphylls), ligulate (ligule axillary or near leaf base; tongue- or fan-shaped with Description: Mainly terrestrial perennial hyaline sheath at base), up to 1 cm long, cov- plants, usually low-growing, mostly growing ering the stem densely, spirally arranged, 364 Plant Systematics

Figure 11.2 Selaginellaceae. Selaginella kraussiana. A: Portion of plant; B: A part of same from upper view showing arrangement of leaves; C: Vertical section of ligule; D: Portion of branch of S. pallescens; E: Small portion of same showing one megasporangium (left) and one microsporangium (right); F: Strobilus of S. watsoni proliferating at apex into vegetative shoot. S. oregana. G: Vertical section of portion of strobilus; H: Vertical section of microsporangium; I: Vertical section of megasporangium. isomorphic (all similar) or dimorphic and 4- spores tetrahedral with prominent triradiate ranked, with two upper or dorsal rows of small- mark and with characteristic ornamentation. er leaves and two lower or lateral rows of larg- Gametophyte unisexual, developed within er leaves. Sporangia borne in axils of well- respective spore walls; spermatozoids biflagel- differentiated sporophylls, usually on 4-angled late, smallest among vascular plants. Sever- terminal strobili, heterosporous, microspo- al species especially those growing in dry rangia and megasporangia occurring on climate can survive long periods of drought same (with megasporangia in upper part of due to small leaves covered with thick strobilus, microsporangia in lower part- S. cuticle, and branches curling up into a ball. helvetica or in two opposite rows- S. oregana) Such plants revive fast with availability of or different strobili; microsporangium with water and are known as resurrection plants more than 100 microspores about 20-60 mm S. bryopteris of India- regarded by some as in diameter; megasporangium with 4 large Sanjeevani booti of Ramayana legend, and megaspores about 200-600 mm in diameter; S. lepidophylla of Mexico and Texas). Families of Pteridophytes 365

Economic importance: Family is of little im- Isoetaceae, it is differentiated by smaller portance. Only a few species are grown as leaves and superficial sporangia, leaves ornamentals. being 2-100 cm long, onion-like and sporangia initially embedded in Isoetaceae. Leaf Phylogeny: The family with single genus is dimorphism is considered as an adaptation well differentiated from Lycopodiaceae in to poor light, as the species commonly ligulate leaves and heterosporous habit. From inhabits forest floor.

***************

Isoetaceae Reichenbach Quillwort Family Widely distributed in tropical and temperate Americas, Europe, Asia, Afri- ca, Australia and New Zealand. 1 Genus, 150 species

Salient features: Terrestrial perennial bundles, ligulate with ligule inserted above herbs of marshy areas, stem short with sporangium, hardened scales and phyllopo- secondary growth, , leaves simple , long, dia surrounding the leaves; all leaves po- quill-like, 1-veined, ligulate; sporangia tential sporophylls. Sporangia solitary, borne singly, sunken at base of leaves, het- borne adaxially embedded in cavity of swol- erosporous. len base of sporophylls, microsporophylls and megasporophylls usually borne in alternate Genera: Single genus Isoetes (150 spe- cycles, sporangium covered partially or com- cies). pletely on adaxial side by velum; megasporangium with 50-300 megaspores; mi- Description: Terrestrial tufted perennial crosporangium with 0.15-1 million mi- plants usually found in marshy areas, often crospores; microspores elongate, about 45 μ in periodically inundated pools. Roots firm, long; megaspores 250-900 μ in diameter; arising from grooves of lobed stem in radi- spores set free by disintegration of sporan- ating rows, unbranched or dichotomously gial wall, dehiscence zone not developed. Ga- branched, containing eccentric vascular metophyte unisexual, developed within re- strand and surrounding lacuna. Stem short, spective spore walls (endosporic); microga- erect, cormose (corm-like), rarely rhizoma- metophyte 9-celled, antheridium single, tous, having secondary growth, protostelic spore wall cracking to release 4 multiflagel- stele anchor-shaped with upturned lobes late spermatozoids each with terminal ves- (near base), lobed by a broad basal groove icle; megagametophyte with 1-several into 2-4 lobes, rough on sides due to slough- archegonia, often with rhizoids, exposed by ing off of cortical tissue. Leaves simple, lin- cracking of spore wall. ear, long, quill-like, resembling narrow- leaved species of Allium , up to 100 cm long, Economic importance: None. swollen at base, 1-veined (microphylls), containing 4 transversely septate longitudinal Phylogeny: The family with single genus lacunae, a central collateral vascular strand is well differentiated from Lycopodiaceae in and frequently several peripheral fibrous ligulate leaves and heterosporous habit. 366 Plant Systematics

Figure 11.3 Isoetaceae. Isoetes engelmanni. A: Plant; B: Corm with attached leaf bases; C: Trans- verse section of leaf; D: Leaf base with ligule and sporangium; E: Same in vertical section; F: Megaspore.

From Selaginellaceae, it is differentiated superficial and stem branched in Selaginel- by much longer linear leaves, short erect laceae. Fossil tree Lepidodendron is more cormose stem and sunken sporangia; closely related to Isoetes among the extant leaves being less than 1 cm long, sporangia lycophytes.

***************

Ophioglossaceae C. Agardh Adder’s-tongue Family Widely distributed in tropical and temperate regions, more abundant in old fields and disturbed pastures. 4 Genera, 73 species

Salient features: Terrestrial perennial branched spike, arising from surface of herbs with tubers or rhizomes, leaves with leaf at the junction of petiole and blade, branched veins, fertile portion a simple or stipules present, sporangia homosporous, Families of Pteridophytes 367

Figure 11.4 Ophioglossaceae. Ophioglossum reticulatum. A: Plant; B: Portion of fertile spike; C: Small portion of same enlarged. Botrychium daucifolium. D: Leaf with fertile branch; E: Portion of fertile branch; F: Small portion of same showing sporangia. aggregated into sporophore, sporangium wall unfolding lengthwise (conduplicate) and not more than one cell thick, annulus absent, circinate, with branched veins (euphyll or gametophytes subterranean. macrophyll), venation reticulate (Ophioglos- sum) or open dichotomous (Botrychium); sin- Major Genera: Botrychium (45 species), gle fertile branched (Botrychium) or simple Ophioglossum (25), Cheiroglossa (1), Mankyua (Ophioglossum) sporophore arising from sur- (1) and Helminthostachys (1). face of leaf (trophophore), more than one sporophore arising in Cheiroglossa; petiole Description: Terrestrial perennial plants, fleshy with expanded sheathing base; very rarely epiphytic. Roots unbranched, stipules present, sheathing, persisting even adventitious, lacking root hairs. Stem short, after decay of leaves. Sporangia aggregated tuberous or rhizomatous, aerial portion per- in fertile portion (sporophore), thick walled ishing after growing season, rarely ever- (eusporangiate-more than one celled thick), green (Botrychium dissectum, B. multifidum). homosporous, not clustered in sori, separat- Leaves simple (Ophioglossum) or more or ed (Botrychium) or forming synangia (Ophio- less palmately compound (and looking like glossum), exposed or embedded in spike- hand-Cheiroglossa) to many times pinnately like sporophore, annulus absent; spores compound (Botrychium), up to 50 cm long, thousands per sporangium, chlorophyllous. 368 Plant Systematics

Gametophyte subterranean, nongreen, alternate ternately compound leaf, open di- mycorrhizal; antheridia and archegonia dis- chotomous venation and baculate spores like tributed over the surface of gametophyte; Helminthostachs; open dichotomous venation antheridia sunken producing multiflagellate and horizontally dehiscent sporangia like spermatozoids in large numbers. Botrychium; fleshy spike, sunken horizontally dehiscent sporangia and vegetative leaf prop- Economic importance: None agation like Ophioglossum; and nearly sessile sporophore like Cheiroglossa. Man- Phylogeny: The family shares apomorphies kyua possesses a fertile spike (sporophore) of unbranched roots and absence of root originating dorsiventrally from the adaxial hairs. The two may represent a transitional side of the vegetative trophophore, eusporan- stage for total absence of these in Psilotace- giate sporangia without annuli, and noncir- ae. The distinctness from other ferns and cinate leaf vernation. These three charac- affinity with Psilotaceae is supported by DNA ters, especially the first, place it in the sequence data, although there is little mor- Ophioglossaceae. Also, recent DNA analyses phological support. The sporophore repre- confirm the placement of Mankyua in Ophio- sents a unique apomorphy of the family. The glossaceae (Sun, 2002). The family Ophio- family represents highest chromosome glossaceae is sometimes divided into two number in plants (n = 621 + 10 fragments). families: Ophioglossaceae and Botrychiace- Mankyua chejuense is a recently discovered ae. The discovery of Mankyua unites the genus and species found in a lowland swampy family. The mixture of character states pre- area on Cheju Island, off the southern coast sents in Mankyua combines the distinguish- of the Korean Peninsula (Sun et al., 2001). ing states for each family, and thus abolish- Its affinities with the Ophioglossaceae are es the taxonomic boundaries between the fairly clear. It has creeping rhizome, two segregate families.

***************

Psilotaceae Kanitz Whisk Fern Family Pantropical and warm tropical regions, mainly in Southeast Asia and South Pacific. 2 Genera, 12 species

Salient features: Perennial rhizomatous producing gemmae for vegetative reproduc- herbs without roots, stems dichotomously tion in Psilotum. Stem erect, pendent or branched, leaves scale-like, 1-veined or creeping ; dichotomously branched, appear- veinless, 2-3 sporangia fused into thick walled ing like bundle of green forking sticks; synangium, homosporous, gametophyte free vascular cylinder protostelic; branch tip living, subterranean. flattened laterally and appearing leaf-like in Tmesipteris. Leaves (euphylls) scale-like, Genera: Tmesipteris (10 species) and spirally arranged, 2-ranked, 1-veined (Tme- Psilotum (2). sipteris) or veinless (Psilotum-termed ena- tions) or nearly so, awl-shaped to lanceolate, Description: Terrestrial or more commonly simple or once forked. Sporangia homo- epiphytic perennial herbs, often pendulous. sporous with 2-3 celled thick wall, two or Roots absent, plant anchored by rhizome three together, fused into 2-3 lobed with rhizoids and mycorrhizal fungi; rhizome synangium (2-lobed in Tmesipteris, 3-lobed Families of Pteridophytes 369

Figure 11.5 Psilotaceae. Psilotum nudum. A: Plant; B: Portion of sterile branch with leaves; C: Portion of fertile branch with 3-lobed synangia; D: Synangium; E: Synangium in cross section. Tmesipteris tannensis. F: Plant; G: Sporophyll; with 2-lobed synangium; H: Longitudinal section of synangium. in Psilotum), yellowish at maturity, subtend- Phylogeny: The phylogeny of the family is a ed by a forked appendage (Sporophyll); spores matter of considerable speculation. Wet- numerous, bean-shaped, pale, in tetrads. tstein (1901) agreed with Engler and Prantl Gametophyte free living, subterranean or in regarding the group as advanced over superficial, often with mycorrhizal fungi, ir- Selaginellales and Isoetales. Eames (1936), regularly branched; antheridia and archego- however, considered the family as the most nia in large numbers all over the gametophyte; primitive of the extant vascular plants, lack- spermatozoids spirally coiled, multiflagellate. ing roots and true leaves. The recent morphological, chemical and molecular studies, Economic importance: Family is of little im- however, support relationship with eusporan- portance, Psilotum nudum often grown as giate group Ophioglossales, and that the greenhouse plant. group lost roots secondarily.

*************** 370 Plant Systematics Equisetaceae Michx. Horsetail Family Almost worldwide except Australia, New Zealand and Antarctica, in temperate and tropical climate. 1 Genus, 15 species

Salient features: Annual or perennial rhi- unbranched or with whorled branches, with zomatous herbs with jointed ribbed aerial swollen jointed nodes, internodes longitu- stems, leaves reduced with single vein, spo- dinally ribbed, with ridges and grooved out- rangia on peltate sporangiophores, homo- side, hollow with central canal, with addi- sporous, spore wall with elaters, gametophyte tional smaller canals under the ridges; green, thallus shaped, spermatozoids mul- growth intercalary; outer surface covered tiflagellate. with silica cells giving plant the texture of sand paper, hence the name ‘scouring rush’. Genus: Single genus Equisetum (15 species). Leaves small, usually less than 1 cm, 1-veined, whorled and fused into a sheath, Description: Terrestrial or aquatic annual latter more or less swollen, each leaf corre- or perennial herbs, sometimes evergreen, sponds to the ridge below, thus the number with subterranean much-branched rhizome. of leaves at each node as the number of ridg- Roots slender, arising from horizontal es, the leaves of the successive nodes as well subterranean rhizome. Stem subterranean as ridges alternating. Sporangia large, as well as aerial, latter erect, green, lacking annulus, homosporous, hanging

Figure 11.6 Equisetaceae. A: Plant of Equisetum arvense showing rhizome, vegetative branch and fertile branches. E. telmateia. B: Portion of plant with sterile and fertile branches; C: Sporangiophore viewed from below; D-E: Spore with coiled elaters; F: Antherozoid. E. hyemale. G: Node with sheath of leaves; H: Strobilus; I: Sporangium. Families of Pteridophytes 371 from lower surface of peltate sporangiophore, species, especially E. hyemale, were used for whorls of sporangiophores aggregated into scouring pots and pans, hence the common strobilus terminating green branches or un- name scouring rush. branched nongreen stems arising separately from rhizome; base of strobilus with collar of Phylogeny: The family is quite distinct in fused sterile appendages; sporangium with its jointed stems with ridges and grooves and 2-layered wall; sporangiophore with slender hollow within, whorled leaves and peltate stalk and hexagonal disc at distal end, 5-10 sporangiophores. Earlier the family was con- sporangia hanging from each disc; spores sidered distinct from ferns, but the molecu- spherical, many thousand per sporangium, lar data and morphological characters such green, wrapped by 4-6 straplike elaters aris- as spermatozoids and root structure, support ing from outer wall, assisting in spore dis- placement with ferns. persal, wall with four apertures. Gameto- The genus is divided into two subgenera: phyte pinhead sized, thallus shaped, green, Equisetum (8 species) with branched stem developing near soil surface; antheridia and and superficial stomata and Hippochaete (7 archegonia developing simultaneously; sper- species) with unbranched stems and sunk- matozoids multiflagellate. en stomata, sometimes recognized as distinct genera. Economic importance: Family is of lesser The family is represented in the fossil importance. Silica covered stems of several record as early as Devonian 408-360 MYA.

***************

Osmundaceae Bercht. & J. Presl Royal Fern Family Worldwide except very cold climates and Pacific Islands. 3 Genera, 18 species

Salient features: Terrestrial plants with xylem strands, latter often conduplicate or wiry roots, persistent stipe bases, dimorphic twice conduplicate in cross section. Leaves fronds, pinnate compound sterile fronds, up to 2 m long, spirally arranged, usually sporangia with many spores, annulus dimorphic with distinct sterile and fertile shield-like, gametophyte green, developing fronds; sterile fronds green, once- thrice- on soil surface. pinnate compound, with expanded petiole base, circinate before unfolding, usually Genera: Osmunda (10 species), Leptopteris (6) leathery, rarely filmy (Leptopteris hymeno- and Todea (2). phylloides), usually covered with hairs especially when young; fertile fronds usually Description: Terrestrial plants common in brown, much narrower; sometimes sterile wetlands and lowland forests, sometimes and fertile segments present on same leaf. tree-like (Leptopteris). Roots wiry, adventi- Sporangia large, shortly stalked, interme- tious, generally two below each leaf base. diate between eusporangiate and leptospo- Stem erect to decumbent, branched, mas- rangiate ferns arising from single initial sive, often covered by persistent leaf bases, (leptosporangiate) or many initials (euspo- ectophloic siphonostele with ring of discrete rangiate) and archesporial cell tetrahedra 372 Plant Systematics

Figure 11.7 Osmundaceae. Osmunda javanica A: Portion of plant with sterile and fertile fronds; B: Portion of fertile frond; C: Fertile frond in cross section; D: Portion of fertile pinna of Todea africana; F: Portion of fertile pinna of Leptopteris hymenophylloides.

(leptosporangiate) or cubical (eusporan- around the sporangium, homosporous, pro- giate), separate or in loose clusters, borne ducing 128-512 spores, sporangia opening on distinct fertile fronds (Osmunda) or on by apical slit; spores green, subglobose, with undersurface of foliage leaves along veins triradiate mark. Gametophyte large green, (crowded in Todea, sparse in Leptopteris), cordate, developing on soil surface; anthe- not forming sori, annulus poorly developed ridia emergent producing up to 100 sper- shield-like plate or broad horizontal band matozoids. Families of Pteridophytes 373

Economic importance: Family is of lesser to leptosporangiate ferns evidenced by nu- importance. A few species like Osmunda cin- merous spores, rudimentary annulus, more namomea (Cinnamon fern) and O. regalis than one celled thick wall, lack of sorus; po- (Royal fern) are grown as ornamentals. sition supported by rbcL sequence data. This conclusion is also supported by long fossil Phylogeny: The family is considered sister record, dating back to Permian 286-245 MYA.

***************

Marsileaceae Mirbel Water-Clover Family Nearly worldwide in warm temperate and tropical areas. 3 Genera, 75 species

Salient features: Aquatic plants with Genera: Marsilea (69 species), Pilularia (5) floating long-petioled leaves, leaflets and Regnellidium (1). 2 to 4, sori enclosed in hard sporocarp, heterosporous, sporangia without annulus, Description: Plants perennial, aquatic or megasporangium with one megaspore, rooted in mud with creeping rhizome, rare- microsporangium with 16-64 microspores. ly xerophytic and developing underground

Figure 11.8 Marsileaceae. Marsilea quadrifolia. A: Plant with sporocarps; B: Vertical section of sporocarp; C: Sporocarp in longitudinal section; D: Spore; E: Spermatozoid; F: Por- tion of plant of M. polycarpa; G: Portion of plant of Regnellidium diphyllum. 374 Plant Systematics tubers from rhizome (M. hirsuta); land forms gyptiaca) to 20 (M. quadrifolia); sorus with with short internodes, branched roots, long large megasporangia along the crest and petiole and stomata on both leaf surfaces; microsporangia along the sides; sporangia aquatic forms with long internodes, un- without annulus; megasporangium with branched roots, flexible petiole and stoma- one megaspore; microsporangium with 16- ta mainly on the upper surface. Roots aris- 64 microspores; sporangia attached to a ge- ing from creeping rhizome, one or two at latinous ring-like structure called soro- each node. Stem a slender rhizome, creep- phore, that swells with water.; microspore ing, growing on soil surface or subterra- small globular, producing 16 spermatozoids, nean, often with hairs, dichotomously latter multiflagellate and corkscrew shaped branched. Leaves floating or emergent, with prominent vesicle; megagametophyte long petioled, blade filiform (Pilularia) or di- producing single archegonium. vided into 2 (Regnellidium) or 4 clover-like (Marsilea) leaflets, circinate before unfold- Economic importance: Family is of little im- ing, leaflets folded together upwards until portance, with Marsilea species often grown nearly mature, veins dichotomously as curiosity. branched but often fusing towards tips. Spo- rangia heterosporous, arranged in sori, lat- Phylogeny: The family is considered sister ter without indusium, enclosed in hard pea- to leptosporangiate ferns due to presence of shaped, bean-shaped or subglobose sporo- numerous spores, rudimentary annulus, carps borne singly on short stalks near or more than one celled thick wall and lack of at base of petioles, sometimes stalk sorus. This conclusion is also supported by branched bearing 2-3 sporocarps (M. quadri- evidence rbcL sequence data and long fossil folia), rarely several sporocarps on one pet- record, dating back to Permian 286-245 MYA. iole (M. polycarpa); each sporocarp with Regnellidium is exceptional non-flowering rows of sori along either side, with 2 (M. ae- plant with latex tubes.

***************

Salviniaceae Martynov Mosquito-fern Family Worldwide in tropical and temperate climates. 2 Genera, 16 species

Salient features: Aquatic free-floating zag stem (Azolla) or absent and represented plants, small simple leaf blades, veins by lower third row of leaves which are mod- branched, sporocarps flattened and soft, spo- ified into root-like structures (Salvinia). rangia large, heterosporous, gametophyte Stem a rhizome, zigzag, horizontal, dichot- endosporous. omously branched, protostelic; stem fragile and readily breaks resulting in proliferous Genera: Salvinia (10 species) and Azolla (6). vegetative propagation, and in often covering entire water surface. Leaves simple, Description: Free-floating aquatic plants sessile, less than 15 mm long, rounded to growing in lakes and ponds, often forming oblong, entire; in Azolla imbricated in two dense floating mats, with slender branch- rows harbouring nitrogen-fixing cyanobac- ing rhizome. Roots hanging down from zig- terium Anabaena azollae in leaf cavities; in Families of Pteridophytes 375

Figure 11.9 Salviniaceae. Salvinia natans. A: Plant; B: Two floating leaves and a submerged leaf. C: Sporocarps of S. rotundifolia with a megasporangium and a microsporangium; D: Vertical section megaspore. Azolla microphylla. E: Plant; F: Microsporocarp split open to show microsporangia; G: Megaspore. whorls of three appearing in three rows in megaspore, microsporangium with several Salvinia with upper two rows floating and cov- microspores (all microspores surrounded by ered with hairs whereas the third lower row hardened tapetal cytoplasm are shed as a submerged and finely dissected into root- single mass known as massula); annulus like structure (hairs septate unlike true absent; spores globose, trilete. Gameto- root hairs); veins of leaf-blades branched, phyte endosporous, megagametophytes and free (Azolla) or anastaomosing (Salvinia). Spo- microgametophytes protruding through sporangia heterosporous, leptosporangiate, ar- rangium wall; megagametophytes floating ranged in sori; In Salvinia megasporangia on water surface with archegonia directed and microsporangia in different sporocarps downward; microgametophytes remaining (megasporocarp with up to 25 megasporan- fixed to sporangium wall. gia; microsporocarp with numerous microsporangia); sporocarps soft; in Azolla spo- Economic importance: Both genera are rangia are enclosed in indusium with ei- invasive weeds in warm climates, often ther one megasporangium or several mi- choking lakes, ponds and drains. Salvinia is crosporangia; megasporangium with single frequently sold as aquarium plant. Azolla is 376 Plant Systematics often used as green manure, owing to the into two distinct families on the basis of presence of nitrogen-fixing cyanobacterium. absence of roots and sori in distinct sporocarps in Salvinia, as against the presence Phylogeny: The family is sometimes split of roots and absence of sporocarps in Azolla.

***************

Cyatheaceae Kaulf. Scaly Tree-fern Family Tropical and subtropical montane forests and cloud forests. 5 Genera, 600 species

Salient features: Tall arborescent palm-like Major Genera: Alsophila (230 species), ferns with thick trunk, leaves covered with Sphaeropteris (120) and Cyathea (110). scales, large, pinnate to bipinnate, circinate before unfolding, homosporous, sporangia in Description: Palm-like ferns with single sori, annulus continuous. erect arborescent trunk. Stem erect,

Figure 11.10 Cyatheaceae. Cyathea spinulosa. A: Portion of frond with fertile (below) and sterile (above) pinnules; B: Sterile pinnules enlarged; C: Portion of fertile frond of Cyathea elegans; D: Portion of fertile frond of C. medullaris. Families of Pteridophytes 377 usually unbranched, reaching 25 m in dral, trilete, variously ornamented. Game- height, rarely decumbent or creeping, dic- tophyte green, cordate. tyostelic, stem and leaves covered with large and small scales. Leaves large often reach- Economic importance: Various members of ing 5 m in length, once to twice pinnate com- the family are often grown as ornamentals, pound, with deeply pinnately lobed leaflets, fibrous rhizomes often used as base for epi- rarely simple, circinate before unfolding; phytes in greenhouses. petioles with obvious, usually discontinuous pneumathodes in two lines; veins free or Phylogeny: The family is well characterised anastomosing. Sporangia homosporous, ar- by uniform chromosome number n = 69. ranged in sori on abaxial surface of fronds, Hymenophyllopsis with small distinct stems annulus continuous, not interrupted by is quite distinct, but shares the presence sporangium stalk, oblique, allowing the of scales with other members of the sporangium to open horizontally; indusium family. There is some molecular evidence completely covering the sorus or absent; supporting the inclusion of this genus in spores usually 64 per sporangium, tetrahe- Cyathea.

***************

Pteridaceae Ching Maidenhair Fern Family Tropical and subtropical montane forests and cloud forests. 50 Genera, 950 species

Salient features: Terrestrial or epiphytic, variously anastomosing and forming a rhizomes covered with scales, leaves all sim- reticulate pattern without included veinlets. ilar, petiole base with persistent scales, sori Sporangia homosporous, leptosporangiate, near margin, indusium absent. arranged in sori on abaxial surface near margin, forming a continuous band and pro- Major Genera: Pteris (200 species), Adian- tected by reflexed leaf margin forming false tum (150) and Cheilanthes (150). indusium (Pteris) or two-lipped indusium with thick upper lip and thin papery lower lip Description: Terrestrial or epiphytic, rarely (Pteridium), true indusium being absent, or aquatic, growing in wide variety of habitats arranged along all leaf veins; sporangium such as deserts, ponds, cultivated stalk with 2-3 rows of cells; sporangia each areas, forest canopies to mangrove swamps. with a vertical, interrupted annulus cover- Root adventitious, arising from lower ing three-fourth of sporangium, a strip of surface of rhizome. Stem represented by 4 cells below free end of annulus forms rhizome, short, creeping to erect, sometimes stomium, receptacles not or only obscurely deeply penetrating, dichotomously branched, raised; spores 64 per sporangium, globose or usually covered with scales, less often with tetrahedral, trilete, variously ornamented. hairs. Leaves all similar (monomorphic), Gametophyte heart-shaped. dimorphic in few genera; petiole with persistent scales near base; blade simple, Economic importance: Some species of Adi- 1-6 pinnate or pedate; veins free or forking, antum and Pteris are grown as ornamentals. 378 Plant Systematics

Figure 11.11 Pteridaceae. Pteris griffithii. A: Portion of frond; B: Petiole of same; C: Portion of a pinnule. Pteris patens. D: Portion of fertile frond; E: Portion of pinnule.

Phylogeny: The family shows a wide base number (x = 38 as against 29 or 30 in diversity due to its adaptation to diverse the family) and in having dimorphic spores habitats. The family contains five clades that (“incipient heterospory”) but nests with could be recognized as distinct families other genera of Pteridaceae, subfam. Parkeriaceae (Acrostichum and Ceratopteris), Pteridoideae. Ceratopteris is distinct from Adiantaceae (Adiantum and the ten vittarioid other members of the family in coarsely genera), Cryptogrammaceae (comprising ridged spores with parallel striations; spores Coniogramme, Cryptogramma, and Llavea;), 32 or fewer per sporangium; sporangia with Sinopteridaceae and Pteridaceae (Pteris and ill-defined annuli; aquatic habitat; x = 38, its immediate allies), or else five subfamilies often placed in distinct family, but nests within Pteridaceae. within Pteridaceae in all molecular Platyzoma, sometimes recognized as an analyses, and it appears to be sister to isolated family, is aberrant in chromosome Acrostichum.

*************** Families of Pteridophytes 379 Aspleniaceae Newman Spleenwort Family Nearly worldwide, most diverse in tropics. 1 Genus, 700 species

Salient features: Terrestrial or epiphytic, sented by rhizome, erect or creeping, usu- rhizomes covered with scales, leaves all sim- ally covered with scales especially towards ilar, sori elongate, indusia linear, laterally apex, dictyostelic. Leaves all similar (mono- attached, sporangium stalk with one row of morphic); petiole with scales near base, with cells, spores bilateral. C-shaped vascular strands fused distally back-to-back to form x-shape; blade simple Genus: Asplenium (700 species). to 5-pinnate, often with glandular hairs and a few linear scales; veins pinnate or fork- Description: Terrestrial or epiphytic peren- ing, usually free, sometimes reticulate with- nials, some members growing on rocks (epi- out included veinlets. Sporangia homo- petric) in moist or wet forests. Stem repre- sporous, arranged in sori on abaxial surface

Figure 11.12 Aspleniaceae. A: Plant of Asplenium ensiforme with simple sterile and fertile leaves; B: Leaf of A. alternans; C: Portion of same enlarged; D: Portion of fertile pinna of A. bulbiferum; E: Sorus. 380 Plant Systematics along veins, linear or curved; indusia lin- 10 genera in the family, although large num- ear, laterally attached; sporangium stalk ber of species fit well under Asplenium. The with one row of cells; spores bilateral, reni- segregate genera Camptosorus and Loxos- form, monolete, with winged perine. caphe , Diellia (endemic to Hawaii), Pleuro- sorus, Phyllitis, Ceterach, and Thamnopteris Economic importance: Some species of clearly nest within Asplenium s.l. Hymenas- Asplenium such as A. scolpendrium (heart’s- plenium, however, with a different chromo- tongue fern) are grown as ornamentals. some base number than nearly all of the other segregates, as well as distinct root Phylogeny: The family is closely related to characters (Schneider et al., 2004), appears Blechnaceae, Onocleaceae and Thelypteri- to represent the sister clade to the rest of the daceae. Some species have variously been species in the family, and this name could be removed to distinct genera to establish up to adopted as a well-supported segregate genus.

***************

Dryopteridaceae Ching Wood Fern Family Nearly worldwide, most diverse in tropics with several representatives in temperate region. 45 Genus, 1700 species

Salient features: Mostly terrestrial, rarely vascular strands arranged in a ring; blade epiphytic, rhizomes covered with scales to- simple to 5-pinnate, sometimes scaly or wards apex, leaves all similar, petioles with glandular, rarely hairy; veins pinnate or persistent scales towards base, sori round, forking, free to variously anastomosing, with covering the leaf surface, indusia round- or without included veinlets. Sporangia ho- reniform shaped, sporangium stalk with mosporous, arranged in sori on abaxial sur- three rows of cells, spores bilateral. face, sori rounded, closely spaced and covering the leaf surface; indusia round-reniform Major Genera: Elaphoglossum (500 species), or peltate, rarely absent; sporangium stalk Polystichum (260), Dryopteris (225) and Cteni- with 3 rows of cells; spore reniform mono- tis (150). lete, perine winged.

Description: Terrestrial, epiphytic or epipet- Economic importance: None. ric ferns. Stem represented by rhizome, erect, ascending or creeping, sometimes Phylogeny: Dryopteridaceae is well defined scandent or climbing, usually covered with clade, except for three genera Didymochlae- non-clathrate scales especially towards apex, na, Hypodematium and Leucostegia, whose in- dictyostelic. Leaves all similar (monomor- clusion renders this family paraphyletic. phic), rarely dimorphic; petiole with persis- Hypodematium, often removed to a distinct tent scales near base, with numerous round family Hypodematiaceae and Leucostegia is Families of Pteridophytes 381

Figure 11.13 Dryopteridaceae. Polystichum auriculatum. A: Plant with fronds; B: Portion of fertile frond with sori; C: Fertile pinna enlarged; D: Sterile pinna enlarged; E: Portion of rachis of P. setiferum with fertile pinna; F: Sorus.

nearly always placed in Davalliaceae be- rugulate perispore. Tsutsumi & Kato (2006) cause of its similar indusia and sori termi- found support for a sister relationship be- nal on the veins, but it differs from mem- tween Hypodematium and Leucostegia, and bers of Davalliaceae in the terrestrial hab- also support for these as sister to the re- it, the more strongly verrucate spores with maining Eupolypods.

*************** 382 Plant Systematics Polypodiaceae Bercht. & J. Presl. Polypod Family Widely distributed in tropics with few representatives in temperate region. 56 Genera, 1200 species

Salient features: Mostly epiphytic, rhizomes usually thick and coriaceous, rarely dimor- covered with scales, leaves all similar, usu- phic; petioles cleanly abscising near their ally simple, petioles without scales, sori bases, leaving short phyllopodia; blade mostly round, indusia absent, sporangium stalk simple to pinnatifid or 1-pinnate; indument with 1- three rows of cells. lacking or of hairs and scales; veins often anastomosing or reticulate, sometimes with Major Genera: Grammitis (400 species), Poly- included veinlets, or veins free. Sporangia ar- podium (150), Pleopeltis (50) and Campyloneu- ranged in sori; sori abaxial, rarely marginal, rum (50). round to oblong or elliptic, occasionally elongate, sometimes deeply embedded; indusium Description: Mostly epiphytic and epipetric, a absent, sori sometimes covered by caducous few terrestrial. Roots thick, wiry. Stem rep- scales when young (Lepisorus, Pleopeltis); resented by rhizome, long- to short-creeping, sporangia with 1–3-rowed, usually long stalks, dictyostelic, bearing scales and hairs, scales frequently with paraphyses on sporangia or on often peltate (Pleopeltis). Leaves all similar, receptacle; spores hyaline to yellowish,

Figure 11.14 Polypodiaceae. Polypodium wallii. A: Plant with fronds; B: Portion of fertile frond with sorus; C: Sorus; D-E: Sporangia in different views. Pleopeltis lanceolata.; F: Prtion of plant with fertile frond; G: Basal portion of fertile frond; H: Portion of leaf showing venation; I: Sorus; J: Peltate scale. Families of Pteridophytes 383 reniform, and monolete, or greenish and Davalliaceae, Oleandraceae and Tectariace- globose-tetrahedral, trilete; perine various, ae. Grammitid ferns often removed as Gram- usually thin, not strongly winged or cristate. mitidaceae (20 genera and 600 species) nest well within Polypodiaceae as evidenced by Economic importance: Species of tropical DNA sequence data (Schneider et al., 2004b), staghorn fern Platycerium, Phlebidium and and share a large number of morphological Aglaomorpha are commonly cultivated in synapomorphies: veins free (mostly); scales greenhouses and gardens for their interest- lacking on blades; setiform, often dark red- ing leaves. brown hairs on leaves; sporangial stalks 1- rowed; spores green, trilete; gametophytes Phylogeny: The family is closely related to ribbon-shaped.

*************** 384 Plant Systematics

Chapter 12 Families of Gymnosperms

Gymnosperms comprise a small group of rangium produces numerous microspores seed plants characterized by naked seeds arranged in tetrads, since each microspore (gymno- naked, sperms- seeds) and absence mother cell undergoes meiosis to produce of vessels (except Gnetopsids), endosperm four haploid microspores. Microspore nu- formation independent of fertilization and cleus undergoes repeated divisions to form commonly resulting in halploid endosperm male gametophyte, which develops wall to (absence of double fertilization), absence of become a pollen grain. The megaspo- sieve tubes and companion cells. Group is rangium, known as ovule, on the other represented by nearly 15 families, 80 gen- hand, develops a single megaspore mother era and nearly 820 species, mostly consist- cell, surrounded by nucellus and integu- ing of evergreen trees and shrubs, distrib- ment, with an opening known as micropy- uted worlwide and forming extensive forests le, at the end of integument. Of the four hap- in North America, Europe and Asia. They loid megaspores resulting after meiosis, represent some of the largest (Sequoiaden- three degenerate, and only one megaspore drod giganteum of California), tallest (Sequoia is functional. Latter, after repeated nuclear sempervirens of California and Oregon) and divisions and wall formations produces a fe- longest living (Pinus aristata) organisms in male gametophyte with several archego- the world. nia, consisting of an enlarged egg cell and Gymnosperms are woody trees or shrubs, two or four neck cells. Pollen grains of gym- herbaceous plants being absent from the nosperms are carried by wind, land on mi- group. The plants have well-developed tap cropyle and adhere to sticky fluid released root system, sometimes with symbiotic ni- by the female gametophyte. The pollen ger- trogen fixing cyanobacterium (coralloid roots minates to produce a pollen tube, that grows of Cycas) or mycorrhizae (Pinus). Vascular through nucellus and releases two sperms. cylinder has xylem with tracheids with bor- One fuses with the egg to form zygote after dered pits and phloem with sieve cells. fertilization. Latter develops into an embryo Leaves lack lateral veins, but are compen- within matured ovule known as seed. sated by transfusion tissue. Sporangia are Gymnosperms have been recognized as heterosporous, microsporangia and me- group distinct from angiosperms since gasporangia borne on microsporophylls and Robert Brown (1827) established their iden- megasporophylls, respectively; latter often tity. Four distinct groups of extant gymno- arranged in distinct cones. Each microspo- sperms viz: Cycads, Conifers, Gnetopsids and Families of Gymnosperms 385 monotypic Ginkgo have, however been treat- female gametophyte. Early studies consid- ed differently by various authors. Chamber- ered Gnetales to be more closely related lain (1935) divided gymnosperms into two (even sister) to angiosperms, making gym- classes: Cycadophytes (Cycadofilicales, Ben- nosperms paraphyletic. Recent studies nettitales and Cycadales) and Conifero- based on molecular evidence, however, point phytes (Cordaitales, Ginkgoales, Coniferales out affinities between Gnetales and conifers. and Gnetales). Arnold (1948) separated Gn- The monotypic genus Ginkgo (placed in etalean members under a separate third monotypic Ginkgoales, Ginkgoaceae) is class, raised to the level of divisions by Pant unique and apparently unrelated to other (1957) recognizing Cyacadophyta, Chlamy- gymnosperms, and often termed as living dospermophyta and Coniferophyta. Cron- fossil, retaining several primitive features quist, Takhtajan and Zimmerman (1966) like dichotomously veined fan-shaped included gymnosperms under Pinophyta, di- leaves, motile sperms and lack of pollen vided into three subdivisions: Cycadicae tubes. The genus is also unique in having (classes Lyginopteridatae, Cycadatae and sex chromosomes: two X chromosomes in Bennettitatae), Pinicae (classes Ginkgoat- female plants and XY in male plants. Recent ae and Pinatae) and Gneticae. molecular studies (Qui et al., 2006; Wu et Gnetales (sometimes treated under three al., 2007) have pointed to close relationship separate orders: Gnetales, Ephedrales and with Cycadales, with which the genus Welwitschiales, and then collectively termed shares features like dioecious habit, as Gnetopsids) are unique among gymno- branched pollen tube growing away from the sperms in presence of vessels and occur- ovule, motile male gametes with several fla- rence of double fertilization in Ephedra, gella and cell wall. wherein one male nucleus fuses with ven- Recent treatments of Gymnosperms fol- tral canal nucleus producing supernumer- lowing the APG tradition, prefer to treat the ary embryos (and not endosperm of an- four distinct groups of extant gymnosperms giosperms); endosperm, however, remaining under distinct orders: Cycadales, Ginkgoal- haploid. Ephedra also depicts flower-like re- es, Coniferales and Gnetales. The same productive structures and highly reduced treatment is followed in the present book.

Families of Gymnosperms

Division: Pinophyta Order: Cycadales 5. Taxaceae Family: 1. Cycadaceae 2. Zamiaceae Gnetales Ginkgoales 1. Ephedraceae 1. Ginkgoaceae 2. Gnetaceae Coniferales 3. Welwitschiaceae 1. Pinaceae 2. Cupressaceae 3. Podocarpaceae 4. Araucariaceae 386 Plant Systematics Cycadaceae Pers. Cycad Family Tropics and subtropics of Africa, Southeast Asia, Malaysia, Phillipines and Polynesia. 1 Genus, 20 species

Salient features: Palm-like, unbranched Description: Palm-like plants with un- stem, leaves fern-like, pinnately compound, branched stem, rarely fern-like with un- thick, young pinnae circinate, with mid- derground rhizome (C. siamensis); bulbils vein but no side-veins, plants dioecious, me- often developing from axils of leaf bases; gasporophylls leaf-like with ovules along mar- plants dioecious. Roots adventitious, large, gin, sperms motile. fleshy; some roots near soil surface become inhabited with nitrogen fixing cyanobacte- Major genera: Single genus Cycas (20 spe- ria, giving coralloid appearance (coralloid cies). roots). Stem unbranched, covered with per-

Figure 12.1 Cycadaceae. Cycas revoluta. A: Leaf; E: Megasporophyll. C. circinalis. B: Male cone; C: Microsporophyll; D: Portion of microsporophyll with sori; F: Megasporophyll; G: Longitudinal section of mature seed; H: Pollen grain.. Families of Gymnosperms 387 sistent leaf bases and scale leaves (cata- shaped, slightly flattened, fleshy, brightly phylls) in alternate spiral bands; outline coloured: orange or red. irregular in section, large pith, numerous small vascular bundles in a ring, a wide Economic importance: Several species no- cortex; parenchyma cells of cortex and pith tably C. revoluta and C. circinalis are common- containing a lot of starch; secondary growth ly grown as ornamentals. Sago starch is ob- initiated very early in life of plant, but pro- tained from stem of C. circinalis and other duced in small amount (manoxylic); muci- species. Seeds may also be utilized for yield- lage canals abundant in stem; leaf traces ing starch, but after the removal of toxins. forming girdle in stem. Leaves large, com- Chamarrow people of Guam who suffer from pound, forming a crown at the apex of stem, fatal neurological disease apparently con- circinate when young, pinnate compound, sume frugivorous bats known as flying fox- spirally arranged, alternately with scale es, who eat Cycas seeds. BMAA (b-methy- leaves; each leaflet with single mid-vein, lamino-L-alanine), a neurotoxic non-protein side veins absent and compensated by amino acid, present in the seeds of Cycas, transfusion tissue; leaf petiole with ome- is produced by nitrogen fixing cyanobacte- ga-like pattern of vascular bundles. Mi- ria in coralloid roots. crosporophylls aggregated into compact large strobilus (cone), arranged spirally, Phylogeny: The family was formerly circum- hard, wedge-shaped with small sterile pro- scribed to include all genera now removed jection coiled at tip; microsporangia borne under Zamiaceae. The genus Cycas is dis- on abaxial surface, in groups of 3-5, sur- tinct from all these genera in circinate young rounded by hairs; male strobilus terminal leaves, leaflets with midvein and no side in position, becoming lateral due to lateral veins, leaf-like megasporophylls not aggregat- bud continuing the stem growth, axis be- ed into strobilus and marginal ovules. Mor- coming pseudopodial; pollen nonsaccate, phological and molecular studies have strong- with a single furrow; sperms motile. Me- ly supported Cycas to be sister genus to the gasporophylls spirally arranged , somewhat rest of cycads. Cycas lineage may already have leaflike, not forming a strobilus, with 2-8 diverged from Zamiaceae by the Permian at large ovules (up to 7 cm-largest in plant least 250 million years before present (Herm- kingdom) along margin; upper sterile por- sen et al. 2006) or as recently as 92 million tion pinnate (C. revoluta) or reduced and ser- years ago with diversification within the clade rated (C. circinalis); seeds elliptic or egg occurring ca 36 million years ago (Wink 2006).

***************

Zamiaceae Horianow Coontie Family Tropical to warm temperate regions of New World, Africa, and Australia. 9 Genera, 111 species

Salient features: Fern-like with rhizome or Major Genera: Encephalartos (35 species), palm-like with unbranched stem, leaves Zamia (35), Macrozamia (12), Ceratozamia (10), fern-like, pinnately compound, thick, flat or Dioon (10) and Bowenia (3). conduplicate but not circinate, veins numerous, plants dioecious, megasporophylls re- Description: Fern-like plants with rhizome duced, forming strobilus, sperms motile. or Palm-like plants with unbranched stem; 388 Plant Systematics

Figure 12.2 Zamiaceae. Zamia floridana. A: Plant with female cone; B: Female cone; C: Megasporo- phyll; D: Male cone; E: Microsporophyll. Macrozamia. F: Microsporophyll; G: Megasporo- phyll. plants dioecious. Roots adventitious, large, pinnate compound or bipinnate compound fleshy; some roots near soil surface become (Bowenia), spirally arranged, alternately with inhabited with nitrogen fixing cyanobacte- scale leaves; each leaflet with numerous ria, giving coralloid appearance (coralloid parallel veins (there being no midvein); mid- roots). Stem unbranched, covered with vein present with dichotomous secondary persistent leaf bases and scale leaves (cata- veins in Stangeria; margin entire, dentate phylls) in alternate spiral bands; outline or with sharp spines; leaf petiole with ome- irregular in section, large pith, numerous ga-like pattern of vascular bundles; petiole small vascular bundles in a ring, a wide and rachis with or without stout spines. cortex; parenchyma cells of cortex and pith Microsporophylls aggregated into compact containing a lot of starch; secondary growth strobilus (cone), arranged spirally, hard, initiated very early in life of plant, but wedge-shaped with minute sterile projec- produced in small amount (manoxylic); mu- tion; microsporangia numerous, borne on cilage canals abundant in stem; leaf traces abaxial surface, often clustered; pollen non- forming girdle in stem. Leaves large, thick, saccate, with a single furrow; sperms leathery, compound, forming a crown at the motile. Megasporophylls aggregated into apex of stem, conduplicate or flat, not circi- strobilus, densely crowded, symmetrical nate when young (circinate in Bowenia), to asymmetrically peltate, valvate or Families of Gymnosperms 389 imbricate, each with two ovules; strobili 1- Cycadaceae in presence of lateral veins, several per plant, globose, ovoid or cylindri- megasporophylls reduced and aggregated into cal, disintegrating at maturity; seeds large, strobili, absence of circinate vernation, and 1-2 cm long, rounded in cross section, often two reflexed ovules per megasporophyll. Stan- brightly coloured with fleshy outer layer and geria is unique in the family with buds aris- hard inner layer; cotyledons 2. ing from roots, absence of scales and with presence of midvein and dichotomously Economic importance: Several species are branched lateral veins. It was removed into commonly grown as ornamentals. Starchy distinct family Stangeriaceae by Johnson underground rhizome of Zamia pumila of trop- (1959). Bowenia, similarly has bipinnate ical America were used by early settlers as leaves, shows circinate vernation in leaflets flour. Seeds of Dioon edule are also ground and removed to Boweniaceae by Stevenson into meal and eaten. Several species are (1981), on subsequent morphological also used for the production of sago starch. evidence included it under Stangeriaceae. Removal of toxic glycosides is however im- Molecular studies, however, include both perative before consumption. This is easily genera under Zamiaceae (Zgurski et al., achieved through boiling. 2008). The relationships of these genera, and other members of the family, however, Phylogeny: The family is distinct from are not clear.

***************

Ginkgoaceae Engler Maidenhair Tree Family Limited to remote mountain valleys of China. Possibly extinct in wild, but planted in temples and gardens in many parts of the world, especially in temperate climate. 1 Genus, 1 species

Salient features: Deciduous tree with sim- ranged, turning bright yellow in autumn, ple fan-like leaves, veins dichotomously widely placed on long shoots, crowded and branched, dioecious, ovules paired on long appearing whorled on stout short shoots, stalks, seed juicy with unpleasant smelling latter arising from old long shoots; veins outer layer. dichotomously branched, without midvein. Plants dioecious. Microsporophylls spirally Major genera: Single genus Ginkgo (1 species). arranged, aggregated in small loose strobili resembling angiosperm catkins, borne on Description: Tall deciduous tree reaching short shoots; microsporophyll with short 30 m. Roots diarch when young, older tet- stalk and knob-like hump, bearing a pair of rarch or hexarch, containing VAM. Stem microsporangia; pollen tube not developed; branched, crown asymmetric with curved sperms motile; pollination by wind. Ovules branches attached to stout trunk; bark fur- paired, on long stalks, on short shoots, hang- rowed, grey; secondary growth profuse in ing like cherries, naked; seeds one per stalk long shoots forming broad wood zone (pycnox- (other ovule not maturing), about 2.5 cm in ylic), whereas short shoots show little of sec- diameter; outer coat fleshy, white-pink, ondary growth (manoxylic). Leaves simple, unpleasant smelling (like rancid butter or fan-shaped, bilobed or entire, spirally ar- human vomit); cotyledons 2-3. 390 Plant Systematics

Figure 12.3 Ginkgoaceae. Ginkgo biloba. A: Shoot with seeds; B: Shoot with male strobilus; C: Shoot with paired ovules; D: Microsporophyll with two microsporangia; E: Pollen grain; F: Pair of ovules; G: Developing seed with aborted ovule near base; H: Longi- tudinal section of mature seed.

Economic importance: The tree has long The seeds boiled or fried, are delicacy in some been grown as ornamental near temples and Chinese dishes. religious institutions in Eastern Asia. Male plants are commonly grown as they do not pro- Phylogeny: Ginkgo biloba is known in fossil duce the unpleasant smell unlike female record in Triassic and Jurassic periods, hav- plants. More recently it has been planted in ing appeared 200 million years ago, and re- Canada, USA and Europe. It is relatively dis- productive structures seem to have changed ease resistant and tolerates high air pollution. little at least for last 120 m years, justifying Families of Gymnosperms 391 its being called as “living fossil”. It is not closely Ginkgo is unique in having sex chromo- related to any extant group, but shares motile somes: XY male and XX female. The leaves sperms with cycads. Absence of pollen tube is resemble Adiantum, the Maidenhair another primitive feature. The short shoots fern, hence the name Maidenhair tree for are manoxylic (like Cycadales), whereas the Ginkgo. long shoots are pycnoxylic (like conifers).

***************

Pinaceae Adanson Pine Family Distributed extensively in Northern Hemisphere, from warm temperate to arctic regions, extending to tree limit in mountains. 10 Genera, 220 species

Salient features: Evergreen resinous trees woody with persistent spirally arranged ovu- with linear to needle-like leaves, male and liferous scales, each with two ovules, each female cones distinct, seeds several in scale in axil of but free from bract scale; bract woody cones hidden by scales, ovuliferous longer or shorter than scales; ovules invert- scales imbricate, flat, distinct from bract ed, on adaxial surface of scale; archegonia scales, seeds winged, 2 per scale. few per ovule, ; seed with long terminal wing derived from scale; embryo straight, cotyle- Major Genera: Pinus (100 species), Abies dons 2-18, seeds shedding after elongation (40), Picea (40), Larix (10), Tsuga (10) and of cone axis, allowing scales to open; female Pseudotsuga (5). cones taking 1-2 years to mature.

Description: Trees, rarely shrubs, ever- Economic importance: The family is the green, rarely deciduous (Larix, Pseudolarix), leading source of timber in the world. The with strong smell from bark and leaves. wood of Pinus (Pines), Pseudotsuga (Douglas Roots containing ectomycorrhiza. Stem fir), Picea (Spruce), Abies (Fir), Tsuga (Hem- branched, trunk elongate with whorled or op- lock) and Cedrus (Cedars) is extensively used posite branches, rarely alternate; resin ca- for timber, fence posts, furniture and paper nals present in wood and leaves, crown py- pulp. Many of these are also grown as orna- ramidal or spreading; wood pycnoxylic; p-plas- mentals. Seeds of several species of Pinus tids in sieve cells. Leaves simple, linear to (pinon pines or pine nuts) particularly P. ger- needle-like, spiral but often appearing 2- ardiana of W. Himalayas (Chilgoza; Neoza) ranked by twisting of leaf base to bring leaves are eaten as nuts. Rosin and turpentine are into one plane, clustered in sheathed fasci- extracted from several species of pines. cles on short shoots of Pinus; sessile or short petioled; buds enclosed in bud scales. Plants Phylogeny: Pinaceae is a well defined fam- monoecious. Male cones small, microsporo- ily. Numerous features such as inverted phylls papery, spirally arranged; microspo- ovule, winged seed, woody cones, p-plastids rangia abaxial, two per microsporophyll; pol- in sieve cells, simple linear or acicular len grains saccate with two saccae (saccae leaves and absence of biflavonoid com- absent in Larix, Pseudotsuga). Female cone pounds strongly support the monophyly of 392 Plant Systematics

Figure 12.4 Pinaceae. Pinus gerardiana. A: Shoot with leaves in spurs; B: Spur with three needles; C: Mature female cone. Pinus wallichiana. D: Male cone E: Microsporophyll with two microsporangia; F: Female cone; G: Megasporophyll with two ovules; H: Microsporo- phyll in lateral view. Pinus roxburghii. I: Microsporophyll; J: Pollen grain; K: Microsporophyll with two ovules; L: Microsporophyll with two seeds; M: Seed with wing. Cedrus deodara. N: Shoot with leaf clusters and mature female cones; O: Male cone; P: Microsporophyll in lateral view; Q: Microsporophyll in dorsal view. Families of Gymnosperms 393 family. The family is sister to rest of the Pinus and Pseudotsuga) and Abietoideae conifers as evidenced by morphological (Abies, Cedrus, Keteleria, Pseudolarix and (Hart, 1987) and molecular evidence Tsuga). The separation is supported by data (Quinn et al., 2002). from chloroplast matK, mitochondrial nad5 The family is commonly divided into two and nuclear 4CL genes, although Cedrus is subfamilies: Pinoideae (Cathaya, Larix, Picea, sister to rest of the family.

***************

Cupressaceae Gray Cypress Family Cosmopoliton distribution, mainly in warm and cold temperate climates, more abundant in Northern Hemisphere. 30 Genera, 133 species

Salient features: Trees or shrubs, leaves attached and flat or peltate, persistent, rare- scale-like or needle-like, persistent on ly deciduous (Taxodium), each with 1-20 branches after dying, cone scales usually ovules, inverted, on adaxial surface of scale, valvate, pollen grains nonsaccate, ovulifer- erect or inverted; archegonia clustered; seed ous scale fused with bract scale, seeds with with 2-3 short lateral wings derived from seed 2-3 lateral wings. coat; embryo straight, cotyledons 2-15; cone maturing in 1-3 years, woody, rarely fleshy Major Genera: Juniperus (68 species), Cal- and berry-like (Juniperus). litropis (18), Callitris (14), Cupressus (12), Chamaecyparis (7), Thuja (5), Taxodium (3), Economic importance: The family is known Sequoia (1) and Sequoiadendron (1). for its ornamental shrubs and trees, particularly Species of Cryptomeria (C. japonica), Description: Trees or shrubs with aromatic Cupressus, Thuja (T. orientalis-arbor vitae) and wood and foliage. Stem branched, trunk usu- Juniperus, the leading source of timber in ally short with diffuse branches, bark fibrous, the world. The wood of Juniperus virginiana shedding in long strings, buds without bud (Eastern red cedar) is used for cedar chests, scales; branches shedding with age. Leaves to line closets, for pencils and for shingles. simple, small, scale-like to needle-like, per- Oil from the cones of J. communis is used to sistent, often closely appressed to branches flavour gin. Juniper pollen is known to cause or spreading and shedding with them, spiral pulmonary allergies in humans. but often appearing 2-ranked, opposite or whorled, with resin canals; often linear leaves Phylogeny: The family has often been con- on leading branches and scale-like on later- sidered distinct from Taxodiaceae (including al branches; scale-like leaves often dimor- Taxodium, Sequoia, Sequoiadendron, etc.) in phic: those towards base and top of branch either opposite and scale-like or whorled and flat, middle ones keeled and folded around linear leaves as against spiral and linear in branch. Plants monoecious, rarely dioecious latter (although Metasequoia has opposite, and (Juniperus). Male cones small, inconspicu- Athrotaxis scale-like leaves). Page (1990) also ous, microsporophylls spiral or opposite; mi- suggested fundamental differences in repro- crosporangia abaxial, 2-10 per microsporo- ductive structures. The two, however, share phyll; pollen grains nonsaccate. Female cones features like fused ovuliferous and bract terminal or lateral on short branches; ovulif- scale, wings derived from seed coat, more erous scale and bract scale fused, basally than 2 microsporangia per microsporophyll, 394 Plant Systematics

Figure 12.5 Cupressaceae. A: Shoot of Cupressus torulosa with female cones; B: Brach of Juniperus indica with berry-like female cones. Thuja orientalis. C: Curved branch with cone; D: Megasporophyll in abaxial view with two ovules; E: Megasporophyll in lateral view; F: Mature male cone; G: Side view of microsporophyll. Sequoiadendron giganteum. H: Portion of shoot with female cone; I: Microsporophyll; J: Female cone of Taxodium distichum; K: Megasporophyll of Sequoia sempervirens with several ovules. more than 2 seeds per scale, shedding of from the paraphyletic assemblage “Taxodi- small branches, wingless pollen grains and aceae” which form a basal clade. The genera clustered archegonia. Eckenwalder (1976) from Northern Hemisphere and Southern suggested the merger of two on the basis of Hemisphere, however, form two distinct phenetic evidence. The merger of two fami- clades, cuppresoid clade and callitroid clade, lies is also supported by molecular evidence respectively. The presence of several teeth (Quinn et al., 2002; Farjon, 2005). Unified on ovuliferous scales of Cryptomeria is per- monophyletic Cupressaceae perhaps arose haps reversal to plesiomorphic condition.

*************** Families of Gymnosperms 395 Podocarpaceae Endlicher Podocarp Family Tropical and subtropical regions of Southern Hemisphere, extending north- wards to Japan, Central America and West Indies. 17 Genera, 170 species

Salient features: Shrubs or trees, leaves Major Genera: Podocarpus (100 species), linear or broader, persistent, microsporophyll Dacrydium (20), Dacrycarpus (9), Afrocarpus with two microsporangia, mature ovulifer- (6) and Phyllocladus (5). ous scale with one ovule, seeds surrounded by specialized scale called epimatium, bracts Description: Shrubs or trees, rarely para- juicy, pollen saccate. sitic (Parasitaxus ustus parasitic on roots of

Figure 12.6 Podocarpaceae. Podocarpus spicatus.A: Vegetative shoot; B: Brach with male cones; C: Single cone showing arrangement of microsporophylls; D: Microsporophyll; E: Pollen grain; F: Vertical section of ovule; G: Mature seed. Phyllocladus alpinus. H: Branch with flattened phylloclads; I: Portion of branch with female cones. 396 Plant Systematics

Falcatifolium taxoides, another podocarp), Phylogeny: The family has been considered slightly resinous. Stem branched, trunk closer to Taxaceae with which it shares short or long. Leaves simple, entire, thick, features of resinous plants, ovuliferous persistent, alternate, rarely opposite (Micro- scale with solitary ovule and cone more or cachrys), variable, scale-like to broadly lin- less fleshy. In two families, however, the ear (sometimes upto 30 cm long and 5 cm nature of fleshy structure is different. It broad). Plants monoecious, rarely dioecious. represents ovuliferous scale in Podocar- Male cones small, cylindical; microsporo- paceae, whereas it represents an aril, an phylls numerous, spirally arranged, each outgrowth from the base of ovule, in with 2 microsporangia, pollen grains with 2 Taxaceae (Quinn et al., 2002). Genus saccae. Female cones with 1-several ovu- Phyllocladus with branches flattened into liferous scales; each scale with single ovule, phylloclads looking like leaves (leaves re- modified into juicy structure called epime- duced to scales) and with aril is often sepa- tium, thus cone appearing like a drupe; seed rated into distinct family Phyllocladaceae. with 2 cotyledons. Recent rbcL studies, however, point to their being sister groups (Quinn et al., 2002), or Economic importance: Species of Podocar- Phyllocladus embedded in Podocarpaceae pus and Dacrydium are valuable sources of (Wagstaff, 2004), latter conclusion also timber.. Podocarpus macrophyllus is widely reached based on nuclear gene XDH (Peery planted as ornamental. et al., 2008).

***************

Araucariaceae Henckel & W. Hochst Monkey-puzzle tree Family Nearly restricted to Southern Hemisphere mainly in S E Asia to Australia, New Zealand, and S. America. 3 Genera, 32 species

Salient features: Large trees with naked to elliptic, persistent, shedding on small buds, highly resinous, leaves needle-like to branches, spiral (Araucaria) or opposite (Ag- lanceolate, persistent, shedding along with athis). Plants monoecious (Agathis) or dioe- small branches, pollen grains nonsaccate, cious (Araucaria). Male cones small, cylin- exine pitted, female cones woody, ovulifer- drical; microsporophylls numerous, spiral- ous scale with single ovule. ly arranged, each with 4-20 microsporangia, pollen grains nonsaccate, exine pitted; Major Genera: Araucaria (18 species), Agathis sperms nonmotile. Female cones solitary, (13) and Wollemia (1). more or less erect, maturing in 2-3 years, disintegrating on tree, ovuliferous scales Description: Tall long-lived trees reaching numerous, spirally arranged, flattened, lin- up to 65 m in height and up to 6 m in diam- ear to peltate, longer than and fused with eter, highly resinous, usually symmetrical bract scale, each scale with single ovule; with conical crown, buds naked. Stem ovule free from scale (Araucaria) or fused branched, trunk stout and thick, small with it (Agathis); seed large, with (Agathis) branches shedding along with leaves. or without (Araucaria) marginal wings, with Leaves simple, entire, varying in shape 2 cotyledons sometimes deeply divided and from awl-shaped, scale-like, linear, oblong appearing 4. Families of Gymnosperms 397

Figure 12.7 Araucariaceae. Agathis australis. A: Shoot with female cone; B: Megasporophyll; C: Shoot of Agathis alba with male cones. Araucaria angustifolia. D-E: Microsporo- phylls in different views; F: Pollen grain.

Economic importance: Species of Araucar- broader leaves, monoecious habit, ovule free ia mainly A. araucana (Monkey-puzzle tree) from scale, winged seeds and latter with with spectacular whorled branches and A. spiral linear leaves, dioecious habit, ovule heterophylla (Norfolk Island pine) of Chile are fused with scale, and wingless seeds. Mono- prized ornamentals grown as avenue trees phyly of two genera is supported by rbcL and house plants. Many species mainly Ag- sequence data. athis australis (Kauri) with massive trees are Wollemia nobilis, discovered only in 1994 utilized for timber. from Wollemi National Park in Australia was earlier known only from fossil record extend- Phylogeny: The family is distinct, restricting to 150 MYA. The species is represented ed to the Southern Hemisphere, fossil by less than 50 trees and has unique dark record of Araucaria extending to Jurassic. brown and knobbly bark described as “bub- Both genera are, Agathis and Araucaria bling chocolate”. It is also multi-trunked are well separated, former with opposite appearing as clumps of trunks.

*************** 398 Plant Systematics Taxaceae Bercht. & J. Presl. Yew Family Largely distributed in Northern Hemisphere, extending south to Guatemala, Java and Caledonia. 6 Genera, 30 species

Salient features: Shrubs to small trees, Description: Shrubs or moderately sized wood without resin canals, leaves linear, flat- trees, not resinous or slightly resinous, tened, persistent, pollen grains nonsaccate, fragrant or not. Stem much branched, wood ovules solitary, not in cones, with fleshy aril without resin canals. Leaves simple, entire, at base surrounding the ovule fully at matu- linear, flattened, with abruptly tapering apex, rity and becoming bright red. persistent for several years, shedding singly, spiral, often twisted at base to appear Genera: Taxus (10 species), Cephalotaxus (8), 2-ranked, leaf base with decurrent petiole. Torreya (5), Amenotaxus (5), Pseudotaxus (1) Plants dioecious or monoecious. Male cones and Austrotaxus (1). with 6-14 microsporophylls, each with

Figure 12.8 Taxaceae. Taxus baccata. A: Shoot with seeds; B: Seed surrounded by aril; C: Portion of branch with male cone; D: Male cone; E: Peltate microsporophyll with microsporangia; F: Pollen grain. Families of Gymnosperms 399

2-9 microsporangia radially arranged or on removed to a distict order Taxales. The fam- abaxial surface; pollen grains nonsaccate, ily, however, shares similar embryology, sperms nonmotile. Ovules solitary, not form- wood anatomy, leaf and pollen morphology ing cones, surrounded by fleshy aril, arising with rest of the conifers. The placement from base, aril brightly coloured at maturity; within Coniferales is supported by evidence seed with hard seed coat, cotyledons 2. from DNA studies (Chase et al., 1993; Price, 2003) and micromorphology (Anderson and Economic importance: Various species of Owens, 2003). Two distinct clades are estab- Taxus, especially T. baccata (English yew) lished within the family: one including Tax- and T. cuspidata (Oriental yew) are commonly us, Austrotaxus and Pseudotaxus (aril partly planted as ornamentals. Wood of yew family enclosing ovule, maturing in 6-8 months and has been popular since Middle Ages for mak- mature seed 5-8 mm long) and the other ing bows, owing to the presence of extra spi- including Torreya, Cephalotaxus and Ameno- ral thickenings on the xylem cells. Wood of taxus (aril completely enclosing ovule, ma- Taxus is used in high grade furniture. The turing in 18-20 months and mature seed 12- presence of taxol, a highly toxic alkaloid hav- 40 mm long). The two are sometimes placed ing antimitotic activity makes it potential in distinct families Taxaceae s. s. and Ceph- agent for anticancer chemotherapeutic alotaxaceae, respectively. There is, howev- treatment. er, strong molecular evidence to support their merger into broadly circumscribed Phylogeny: The family is unique in coni- Taxaceae (Price, 2003; Rai et al., 2008), as fers in the absence of female cone, and in recognition of Cephalotaxaceae renders it having solitary ovules, and has often been para- or polyphyletic.

***************

Ephedraceae Dumort Joint Fir Family Worldwide in temperate regions except Australia, adapted to extremely arid conditions, extending up to 4000 m in Andes and Himalayas. 1 Genus, 60 species

Salient features: shrubs with jointed stems time, but gradually replaced by adventitious with clustered or whorled branches, vessels roots. Stem much branched, aerial stems present, leaves scale-like, fused into sheath, arising from spreading rhizome; branches microsporophylls stalked, pollen furrowed, numerous, whorled or clustered, longitudi- nonsaccate, each ovule surrounded by pair nally grooved, distinctly jointed with long of fused bracts, seed covered. internodes, usually green and photosynthetic, horsetail like, wood with vessels. Leaves Genus: Ephedra (60 species). scale-like, opposite or in whorls of 3-4 leaves, fused at base into a sheath at each node, Description: Small shrubs, often trailing, often shedding early, each leaf with two par- rarely climbing (E. foliata), very rarely al- allel veins; with axillary buds; resin canals most tree-like reaching 30 cm in diameter absent. Plants usually dioecious, rarely mo- and height of several metres (E. triandra). noecious. Male strobili (inflorescence) in Root a tap root in seedling, persisting for long whorls of 1-10 at nodes in axil of scale leaf, 400 Plant Systematics

Figure 12.9 Ephedraceae. Ephedra gerardiana. A: Shoot with strobili; B: Male strobilus; C: Pollen grain; D: Surface of pollen grain with parallel ridges on exine; E: Female strobilus with bracts and two ovules; F: Same with seeds. each with 2-8 successive pairs of cupped around the ovule borne on a stalk (stalk and bracts, lower one or two pairs of bracts ster- ovule constitute female flower); ovule sin- ile rest bearing solitary microsporangiate gle or in pairs, with 2 integuments; seeds 1- shoots (microsporophylls, flowers), each on 2 per strobilus, surrounded by leathery yel- short secondary axis (microsporangiophore) low to dark brown cup; cotyledons 2. arising between each pair of fertile bracts and bearing two opposite scales (perianth) Economic importance: Several species of and into 2-10 microsporangia (stamens with Ephedra were used as beverage by early filamented or sessile anthers), dehiscence Mormon settlers, hence the name Mormon by terminal pores; pollen furrowed, nonsac- tea for the genus. The alkaloid drug ephe- cate, inaperturate, exine shed on germina- drine used as decongestant, treatment for tion, pollen becoming naked. Female stro- cough and circulatory problems is obtained bili opposite or in whorls of 3-4 at branch from several species especially E. sinica (ma nodes, each with 2-10 successive pairs of huang), which has been used in China ear- bracts, uppermost fused to form a fleshy cup lier than 2500 B.C. Families of Gymnosperms 401

Phylogeny: The genus Ephedra shows are sister to a clade including all other seed superficial resemblance to Equisetum and plants based on studies of rbcL (Seider et Casuarina, all three exhibiting “switch habit”, al., 2002) and nuclear genes (Rydin et al., owing to sheathed nodes and scale leaves. 2002), rendering gymnosperms as paraphyl- The presence of vessels, perianth-like etic. The bulk of evidence in recent years, bracts, extremely reduced gametophytes however, points to gymnosperms being and the fusion of second male gamete with monophyletic and Gnetales sister to Pina- venter canal nucleus have been taken as les. The binucleate sperm cells, basic angiosperm affinities, although the ori- proembryo structure, development of poly- gin of vessels in two has been separate and embryony, etc., of Ephedra agree with several primitive angiosperms are vessel- Pinales in general and perhaps Pinaceae less. It has been suggested that Gnetales in particular.

***************

Gnetaceae Lindley Gnetum Family Distributed in tropical regions of W. Africa, Brazil, India and Southeast Asia. 1 Genus, 30 species

Salient features: Evergreen lianas, trees or each pair fused to form a cup known as shrubs, with vessels, leaves opposite, cupule or collar; each bearing several angiosperm-like, net-veined, microsporo- microsporangiophores (microsporophylls, phylls stalked, with bracts, pollen spinose, flowers) in 3-6 rings, with one ring of abor- seeds large, fleshy. tive female flowers or ovules above rings of male flowers; each microsporangiophore with Genus: Gnetum (30 species). two bracts (perianth) at base and two microsporangia (anthers) at top (one microspo- Description: Usually liana, sometimes rangium in G. gnemonoides); perianth con- scadent shrubs (G. contractum), rarely trees taining sclereids and latex tubes; pollen not (G. gnemon). Stem climbing often reaching striate, surface spinose. Female strobili top of tall trees, rarely erect, sometimes with with a pair of opposite sheathing bracts at two types of shoots: long shoots and short base, followed by 5-6 whorls of ovules; each shoots, rarely all shoots similar (G. gnemon), whorl with 4-10 ovules in a single ring above vessels present, phloem with companion the collar, each ovule with two bracts form- cells, arising from cambium cells and not ing perianth which persists in seed, a from mother-cell as in angiosperms. Leaves terminal ovule sometimes present on the large, entire, oblong, elliptic or strobilus; only few ovules maturing into lanceolate, subsessile or short petiolate, seeds, others aborting and falling down; unis- opposite and decussate, net-veined, appear- eriate hairs interspersed among the ovules; ing like a dicot leaf, appearing only on short ovule with 2 integuments, subtended by shoots in lianas, often reduced to scales on perianth forming third outer envelope; peri- long shoots, stipules absent. Plants dioe- anth and outer integument with sclereids cious, rarely monoecious. Male strobili and laticiferous ducts; seed large, fleshy. arising in axils of paired and decussate scale leaves, slender, elongate, with several Economic importance: The tree species (10-25) pairs of decussate bracts, bracts of G. gnemon from Malaya, is widely cultivated 402 Plant Systematics

Figure 12.10 Gnetaceae. A: Shoot of Gnetum latifolium with opposite leaves and male strobili; B: Portion of branch with female strobili; C: Portion of female strobilus showing ovules; D: Portion of female strobilus with two mature seeds; E: Longitudinal section of seed; F: Portion of male strobilus of G. ulva; G: Single microsporophyll of same; H: Microsporophyll of G. gnemon; I: Pollen grain.

as ornamental, and as food, with leaves and reduced gametophytes and presence of strobili cooked in coconut milk, and fibre for perianth like bracts. Gnetum appears more making ropes and fishing nets. The kernels like angiosperms with net-veined leaves and of G. ulva yield an oil used for illumination presence of companion cells, although their and also as a massage in rheumatism. The origin is quite different. The reaction wood plant of G. montanum is used as fish poison. in Gnetum consists of gelatinous extra- xylary (reaction) fibers in the adaxial posi- Phylogeny: The genus Gnetum along with tion—i.e., it is unique among seed plants other members of Gnetales share an- (Tomlinson, 2003) and is unlike tension giosperm features of presence of vessels, wood of angiosperms.

*************** Families of Gymnosperms 403

Figure 12.11 Selaginellaceae. A: Selaginella martensii. Equisetaceae. B: Equisetum telemateia var. braunii, vegetative shoots; C: Portion of stem enlarged. Osmundaceae. D: Osmunda regalis, portion of plant bearing sterile and fertile fronds; E: Portion of fertile frond enlarged; F: Todea barbara, plant with sterile and fertile fronds. Blechnaceae. Woodwardia semicordata. G: portion of leaf with sori; H: Small portion enlarged. 404 Plant Systematics

Figure 12.12 Cycadaceae. Cycas circinalis; A: Plant; B: Young circinate leaves; C: Portion of mature leaf of C. revoluta; Zamiaceae. D: : Macrozamia communis, apex with female cones; E: Plant with leaves and female cones; F: Plant of Zamia integrifolia; G: Encephalartos trispinosus, plant; H: Dioon edule, plant. Families of Gymnosperms 405

Figure 12.13 Ginkgoaceae. Ginkgo biloba. A: Branch with leaves; B: Portion enlarged. Pinaceae. C: Cedrus deodara, branch with leaves and female cones; D: Portion of bark; E: Tsuga canadensis, portion of plant with female cones. Cupressaceae. F: Chama- ecyparis lawsoniana, portion of twig with female cones; G: Sequoia sempervirens, portion of branch enlarged; H: Cryptomeria japonica, portion of branch with female cones. 406 Plant Systematics

Figure 12.14 Podocarpaceae. A: Podocarpus totara; B: Podocarpus gracilior, branch enlarged; C: Dacrydium cupressinum; D: Twig of same showing leaves; E: Twig of Phyllocladus trichmanoides. Taxaceae. F: Taxus baccata, twig.G: Torreya californica, twig with seed enclosed in aril. Ephedraceae. H: Ephedra americana., plant with strobili. Chapter 13 Major Families of Angiosperms

The treatment of major families of he had preferred to retain primitive woody Angiosperms presented in the following pages families Winteraceae, Chloranthaceae, is an attempted integration of the principal Magnoliaceae, Degeneriaceae, Annonaceae, systems of classification. The view that the Calycanthaceae, and Lauraceae before the division of Angiosperms into monocots and paleoherb taxa, followed by monocots. The dicots, renders the latter as paraphyletic, has latest version, however, has Amborellaceae, firmly been established. Views are further Chloranthaceae, Trimeniaceae and consolidating to interpolate monocot taxa Austrobaileyaceae placed before Winteraceae between primitive dicots and the more and other Magnoliids. It is only for the sake advanced ones, because it had long been of convenience of reference, circumscription suggested that monocots arose from primitive of families that would have a direct bearing dicotyledons. The strong workforce of on the number of genera and species within Angiosperm Phylogeny Group is attempting the family, that the arrangement of the to establish monophyletic groups, more families according to his system of consistently up to the family level. The classification has been followed. The number success above the family level is much short of genera and species is based on his 2007 of any level of consistency for any meaningful revision. Nevertheless, the placement of the application. As many as 30 families still have family visa-vis all recent major systems of to find their place. The artificial clades above classification is compared and latest the order level are too arbitrary, and it may phylogenetic position largely based on recent take a long time before the system may have developments in serotaxonomy and a practical approach for the purpose for which molecular systematics discussed. It should the classifications are meant. From the lot be borne in mind that the same group names of contemporary authors Thorne, with his are not always comparable. Thus whereas latest version (2007)—his classification class names Magnoliopsida and Liliopsida having undergone periodic electronic refer to dicots and monocots in the revisions—has attempted to upgrade his classification systems of Cronquist and classification in light of recent developments Takhtajan, the term Magnoliopsida was used in the field of molecular systematics, but for Angiosperms (for which Takhtajan and retaining the hierarchical grouping, so Cronquist had used the division name essential for any working system of Magnoliophyta) by both Dahlgren and Thorne. classification. In his earlier version of 1999, Both of them had used the name Magnoliidae 408 Plant Systematics

Angiosperms roll of honour Top left: Victoria amazonica (Nymphaeaceae), having large floating leaves often reaching 2 m in diameter and can often support the weight of a child. Top right: Wolffia arrhiza (Lemnaceae), the smallest known angiosperm, barely about 1 mm in size, visible as scum on the surface of water. Above left: Eucalyptus regnans (Myrtaceae), the tallest tree, with recorded height of 97 m and girth of 7.5 m. Above right: Rafflesia arnoldii (Rafflesiaceae), a bizarre plant with plant body no more than a fungus mycelium, yet producing largest sized flower sometimes reaching 1 m in diameter. Left: Arabidopsis thaliana (Brassicaceae), the guinea pig of plant kingdom, with most completely known genome. Major Families of Angiosperms 409 for dicots and Liliidae for monocots. However, represents limited confidence, B for probably Thorne has lately abandoned this distinction correct assignment and C implies into traditional dicots and monocots, and considerable confidence in assignment. Only instead used subclass names more or less those with A or B level are indicated here. comparable to Takhtajan and Cronquist (but Rest belong to level C. without the super groups dicots and It is not under the scope of the present book monocots). He has also taken the bold to include all the families of angiosperms, but decision of separating the primitive dicots in addition to the major families, those which from the more advanced ones by inserting have been the subject of considerable monocots in between, thus bringing the phylogenetic interest over the recent years classification system much nearer to the have been especially chosen for treatment. Angiosperm Phylogeny Group, but retaining Angiosperms placed under Class the essence of hierarchical arrangement Magnoliopsida are divided into 12 subclasses, through consistent use of superorders and 36 superorders, 85 orders and 485 families. subclasses above the level of order. Thorne Angiosperms are estimated to include13372 from 2003 onwards has also assigned the genera and 253300 species (10760 genera degree of confidence in hierarchical level, and 196990 species of dicots; 2612 genera and circumscription and alignment of taxa. A 56310 species of monocots).

Arrangement after Thorne (2007)

Subclass 1.Chloranthidae (B) Superorder 1. Chloranthanae Suborder 2. Illiciineae 1. Illiciaceae Order 1.Chloranthales 2. Schisandraceae Suborder 1. Chloranthineae (B) Order 1. Nymphaeales Family 1. Amborellaceae# 1. Cabombaceae 2. Chloranthaceae 2. Nymphaeaceae 3. Trimeniaceae 3. Ceratophyllaceae 4. Austrobaileyaceae # Families in boldface are described in detail.

Amborellaceaee Pichon 1 genus, with a single species Amborella trichopoda Endemic to the Island of New Caledonia in South Pacific Ocean. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Magnoliidae Magnoliidae Chloranthidae Series+/Superorder Microembyeae+ Lauranae Magnolianae Chloranthanae Order Laurales Laurales Laurales Chloranthales Unplaced/ (Amborellales)

B & H under family Monimiaceae. B & H- Bentham and Hooker 1862-1883; Cronquist, 1988; Takhtajan, 1997; Dahlgren- G. Dahlgren, 1989; Thorne, 2007; APG II, 2003; APweb, 2008 (Stevens) 410 Plant Systematics

Figure 13.1 Amborellaceae. Amborella trichopoda. A: A specimen growing at Arboretum of Univer- sity of California, Santa Cruz (Manager of Arboretum Brett Hall is squatting besides the tree) (Photo Tim Stephens); B: Fully opened female flower. C: Close up of a branch; D: Male flower. (photos A and C: courtesy University of California, Santa Cruz; B: photo courtesy Missouri Botanical Garden).

Salient features: Shrubs lacking vessels, primary medullary rays narrow, sieve-tube with simple alternate leaves, stipules lack- plastids S-type. Leaves evergreen, alternate, ing, nodes unilacunar, flowers unisexual, spiral to two-ranked, simple, entire to with multiseriate perianth, stamens nu- pinnately lobed, venation pinnate, stomata merous, pollen with granulate ektexine, anomocytic, stipules absent, mesophyll with- carpel incompletely closed, fruit aggregate out ethereal oils. Inflorescence cymose, of drupes. plants dioecious. Flowers small, unisexual, hypanthium present. Perianth with 5-13 Major genera: Only genus Amborella with 1 tepals, number more in staminate flowers species. than pistillate flowers), slightly united at base, spirally arranged, not differentiated Description: Sprawling shrub; wood with into sepals and petals. Androecium with 12- tracheids but no vessels, nodes unilacunar, 22(-100) stamens, free, in 3-5 whorls, outer Major Families of Angiosperms 411 whorl adnate to tepals at base, anthers an unknown common ancestor of all adnate, dehiscence longitudinal, introrse, angiosperms. The family has traditionally microsporogenesis successive, pollen been placed under Laurales (Cronquist, inaperturate to ulcerate, ektexine granu- Dahlgren, Takhtajan). The multigene late, pistillate flower with 1-2 staminodes. analyses (Qui et al., 1999; Soltis et al., 1999; Gynoecium with 5-8 carpels in a single Zanis et al., 2002), support this family as sister whorl, free, ovary stalked, superior, carpel to all extant angiosperms, with Nymphaea- margins incompletely closed (unsealed at ceae as subsequent sister to the rest of tip), stigma sessile with two expanded angiosperms, which may ultimately result in flanges, ovule 1, placentation marginal, placing these families in separate orders or ovule pendulous, hemianatropous, sessile. in a common order. APG II, for the present Fruit an aggregate of drupes with pock- regards the family unplaced at the beginning marked stones, and pockets of resinous sub- of angiosperms. APweb (2008) places this stances, seeds endospermic, embryo family under monotypic order Amborellales minute, cotyledons 2. at the beginning of Angiosperms. Thorne had earlier (1999, 2000) placed Winteraceae at Economic importance: No economic value the beginning of Angiosperms (and the known. Magnoliidae), and Amborellaceae in the third suborder, shifted (2003) Amborellaceae, like Phylogeny: The family is unique in APG schemes, to the beginning of angiosperms in having granular ektexine, Magnoliidae under order Chloranthales. He lacking tectum. This, combined with the has further (2006, 2007) removed the order absence of vessels, partially closed carpels, together with Nymphaeales under a distinct places this family on the lowest branch of subclass Chloranthidae, superorder angiosperm family tree, having evolved from Chloranthanae.

* * * * * * * * * * *

Chloranthaceae R. Br. Ex Lindl. Chloranthus family 4 genera, 75 species Tropical, subtropical and South Temperate regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Magnoliidae Magnoliidae Chloranthidae Series+/Superorder Microembyeae+ Magnolianae Magnolianae Chloranthanae Order Piperales Chloranthales Chloranthales Chloranthales Unplaced/(Chloranthales)

Salient features: Leaves aromatic, opposite, Major genera: Hedyosmum (25 species), simple with connate petiole bases, stipules Chloranthus (12), Ascarina (3) and small, flowers small, lacking perianth, Sarcandra (3). stamens 1-3, connate in a mass, carpel 1, ovary inferior with a single ovule, fruit a Description: Herbs or evergreen shrubs or small drupe. trees containing essential oils. Vessels 412 Plant Systematics

Figure 13.2 Chloranthaceae. A: Flowering branch of Chloranthus inconspicuous; B: Bisexual flower of C. brachystachys; C: Bisexual flower of C. henryi with single bract, trimerous stamen having bithecous (tetrasporangiate) middle anther and monothecous (bisporangiate) lateral anthers, and a single pistil with tufted stigma. Sarcandra. D: Transverse section of fruit of S. chloranthoides; E: Seed; F: Bisexual flower of S. glabra. Ascarina lanceolata. G: Flowering branch; H: Male flower and I: Fruit. absent in Sarcandra (vessels reported in roots, lateral anthers (Chloranthus), dehiscence but not in stem), present in others but with longitudinal. Gynoecium with 1 carpel, ovary long tapering elements, with scalariform per- inferior, unilocular, ovule 1, orthotropous, foration plates, nodes unilacunar or pendulous, bitegmic, crassinucellate, trilacunar, sieve-tube plastids S-type. Leaves placentation apical, style very short or aromatic, opposite, simple, usually serrate absent. Fruit an ovoid or globose drupe, seed along margin, petioles often connate at base, with abundant oily endosperm and minute stipules small, interpetiolar, leaf mesophyll embryo, perisperm present. with spherical etherial oil cells. Inflorescence a spike, panicle or capitate, ultimate inflo- Economic importance: Chloranthus glaberi rescence units cymose. Flowers usually uni- is grown as an ornamental shrub. The leaves sexual or pseudobisexual due to coherence of C. officinalis are used to make a drink in of male and female flowers, unisexual in parts of Malaya and Indonesia. The infusion Ascarina and Hedyosmum but bisexual in of flowers and leaves of C. inconspicuous are Chloranthus and Sarcandra, flowers minute, used to treat coughs and the flowers used to bracteate, actinomorphic. Perianth absent in flavour tea in various parts of East Asia. Ex- male flowers, rudimentary and calyx-like and tract from the leaves of Hedyosmum adnate to ovary in female flowers, latter some- brasiliense is used locally in tropical South times completely naked (Ascarina) or enclosed America as tonic, to induce sweating and by a cupular bract (Hedyosmum). Androecium also to treat stomach complaints. with a single (Sarcandra) or three stamens connate into single mass with often Phylogeny: The family is traditionally placed bithecous middle anther and monothecous in the magnoloid complex under order Major Families of Angiosperms 413

Piperales (Cronquist), Chloranthales (inflorescences unit) of gnetopsids. (Takhtajan, Dahlgren, Thorne). Donoghue Chloranthaceae has undergone considerable and Doyle (1989) placed Chloranthaceae reduction in its number of parts as well as under Laurales, but this position is not sup- general level of elaborateness. Thorne (1996) ported by DNA-based cladistic analyses. considered Trimeniaceae to be the closest Taylor and Hickey (1996) consider relative of Chloranthaceae. Chloranthaceae as the basic angiosperm The position of this family in APG system family. The family shows several is uncertain. The family is sister to plesiomorphic characters such as flowers in magnoliids + eudicots in the six-gene an inflorescence, plants dioecious, carpels compartmentalized analysis with 84 per cent solitary, placentation apical, and fruit bootstrap support (Zanis et al., 2003), but APG drupaceous with small seeds. The family is II prefers to keep the family unplaced at the the oldest in the fossil record, the fossil ge- beginning of angiosperms, without assign- nus Clavitopollenites being assigned to ing it to any order. APweb places it under Chloranthaceae and closer to the genus Chloranthales, before Magnoliids, but after Ascarina. The stems of Sarcandra are primi- Commelinids. Thorne had earlier (1999) tively vessel-less. In other genera vessels placed family under Magnoliales under sub- are primitive with long vessel-elements, ta- order Chloranthineae after Winterineae and pered and with many barred perforation Illicineae, but in subsequent revision (2003) plates. The family is considered to be earli- placed it (along with Amborellaceae, est to record wind pollination in angiosperms. Trimeniaceae and Austrobaileyaceae) un- Taylor and Hickey believe in the origin of der distinct order Chloranthales at the be- Chloranthaceae from gnetopsids, hypoth- ginning of Magnoliidae (first subclass of esizing that the ovule and the bract subtend- angiosperms), finally removed in 2006, 2007 ing the floral unit in Chloranthaceae are together with Nymphaeales under a distinct homologous with one of the terminal ovules subclass Chloranthidae, superorder and proanthophyll subtending the anthion Chloranthanae.

* * * * * * * * * * *

Austrobaileyaceae (Croizat) Croizat 1 genus, single species Austrobaileya scandens Native to Queensland, Australia. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb

Division Magnoliophyta Magnoliophyta Class Magnoliopsida Magnoliopsida Magnoliopsida Magnolipsida Subclass Magnoliidae Magnoliidae Magnoliidae Chloranthidae Series+/Superorder Magnolianae Magnolianae Chloranthanae Order Not described then Magnoliales Austrobaileyales Annonales Chloranthales Austrobaileyales

Salient features: Climbing shrubs with stamens numerous, laminar, inner modi- Mopposite leaves, flowers solitary in leaf fied into staminodes, carpels several, free, axils, bisexual with numerous tepals gradu- partially unsealed with bilobed style. ally intergrading from sepals to petals, 414 Plant Systematics

Figure 13.3 Austrobaileyaceae. Austrobaileya scandens. A: Flowering branch; B: Stamen, broad and petal-like; C: Carpel with bifid style.

Major genera: Single genus with one spe- gitudinal, introrse, pollen grains mono- cies. Originally, two species Austrobaileya sulcate. Gynoecium with (6–)9(–12) carpels, maculata and A. scandens were described, but free, spirally arranged, ovary superior, 8–14 they have now been combined into a single ovuled, placentation marginal (biseriate), species under the latter name. ovules collateral, anatropous, bitegmic, crassinucellate, style partially unsealed, Description: Large climbing shrubs bearing bilobed. Fruit baccate, seeds with ruminate essential oils, nodes unilacunar, with two endosperm. Pollination by insects. traces, vessel end-walls scalariform, sieve- tube plastids S-type. Leaves evergreen, op- Economic importance: No economic value posite to sub-opposite, leathery, petiolate, known. simple, entire, pinnately veined, stipules intrapetiolar, caducous, small, mesophyll Phylogeny: When first described by C. T. with spherical etherial oil cells. Inflores- White (1933), it was considered to be belong- cence with solitary axillary flowers. Flowers ing to Magnoliales, a Placement also followed bisexual, bracteate, pedicellate, bracteolate. by Cronquist, but due to unique combina- Perianth with tepals nearly sequentially tion of characters, and for want of a better intergrading from sepals to petals, (9–) place, Hutchinson (1973) placed the family 12(–14), free, imbricate. Androecium with in Laurales, near Monimiaceae. According 12–25 stamens, maturing centripetally, free, to Thorne (1996), the family Austrobaileya- outer laminar, petaloid, fertile, inner gradu- ceae is so intermediate between Magno- ally smaller, innermost reduced to liales and Laurales, that Laurales should not staminodes, anthers adnate, dehiscence lon- be recognized as a separate order. He, Major Families of Angiosperms 415 accordingly, placed Magnoliaceae (and re- Chloranthanae, order Chloranthales, subor- lated families), and Lauraceae (and related der Chloranthineae. Dahlgren (1989) placed families) under separate suborders it under the first order Annonales of Magnoliineae, and Laurineae, respectively. Magnolianae. Takhtajan removed it to or- He later (1999, 2000) placed this family closer der Austrobaileyales within Magnolianae. to Monimiaceae and Chloranthaceae under APG II and APweb (2008) place this family suborder Chloranthineae, before suborder together with Trimeniaceae, Schisandra- Magnoliineae under Magnoliales. In his sub- ceae and Illiciaceae under the order sequent revision (2003), however, he recog- Austrobaileyales, but with no informal nized the suborders as independent orders, higher rank, placed towards the beginning Chloranthales (upgraded Chloranthineae) of angiosperms. The combination of these being placed towards the beginning of families under single order received 99 per Magnoliidae. In latest revision (2006, 2007), cent bootstrap support in several multigene however he has shifted this family under a analyses (Soltis, Soltis, and Chase, 1999; distinct Subclass Chloranthidae, superorder Soltis et al., 2000).

* * * * * * * * * * *

Illiciaceae (DC) A. C. Smith Star Anis family 1 genus, 42 species Southeast United States, West Indies, Mexico, China, Japan and South- east Asia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Magnoliidae Magnoliidae Chloranthidae Series+/Superorder Thalamiflorae+ Magnolianae Magnolianae Chloranthanae Order Ranales Illiciales Illiciales Illiciales Chloranthales Austrobaileyales B & H under family Magnoliaceae

Salient features: Trees and shrubs with sclereids. Leaves evergreen, alternate, simple alternate leaves, stipules lacking, often clustered at tips of branches, some- nodes unilacunar, flowers solitary with times subverticillate, entire, gland-dotted, multiseriate perianth, stamens numerous, containing terpenoids, simple with reticu- carpels free, in a single whorl, fruit a star- late venation, stipules absent. Inflorescence like aggregate of follicles. with solitary flowers, axillary or supra-axillary, rarely 2-3 together. Flowers usually Major genera: Only genus Illicium (42 bisexual, actinomorphic, hypogynous. Peri- species). anth with numerous tepals, in several whorls, sepals and petals not differentiated, Description: Shrubs or small trees, contain- outermost somewhat sepal-like, inner ing aromatic terpenoids and branched gradually becoming smaller and petal-like. 416 Plant Systematics

Figure 13.4 Illiciaceae. Illicium floridanum. A: Fruiting branch; B: Flower; C: Stamens with broad filaments, left with almost petaloid filament; D: Tricolpate pollen grain; E: Longitudi- nal section through carpels, all other floral parts removed; F: Two seeds in different view. G: A dehiscing follicetum of I. anisatum.

Androecium with many stamens, free, is used in flavourings. I. verum (star anis) spirally arranged, filaments short and thick, and I. anisatum (Japanese star anis) anthers basifixed, dehiscence longitudinal, are sources of anethole, used in dentistry, connective extending beyond anther lobes, flavourings and perfumes. pollen tricolpate. Gynoecium with 5-20 free ascidiate carpels, in a single whorl, ovary Phylogeny: The family is closely related to superior with a single ovule, placentation Winteraceae, and although the vessels are basal, stigma extending down on style. Fruit present, the elements are long, slender, an- a star-like aggregation of follicles (follice- gular, thin and greatly overlapping end walls tum), embryo minute, endosperm conspicu- with many scalariform perforation plates. ous, seeds glossy. Pollination primarily by The fruit is a primitive whorl of single- flies. Dispersal by elastic opening of folli- seeded follicles. Although the pollen grains cles, shooting out seeds. are tricolpate, but their corpus morphology is different from eudicots. Loconte (1996) Economic importance: The family is impor- considers Illiciales among the most basal lin- tant for producing aromatic oils. Oil from the eages of angiosperms. bark of Illicium parviflorum (yellow star anis) Major Families of Angiosperms 417

The family has been traditionally placed and Schisandraceae through multigene in the Magnoloid complex under order analyses (Soltis, Soltis, and Chase, 1999; Illiciales, but has been removed in APG II and Soltis et al., 2000) having received 99 per cent APweb along with Austrobaileyaceae, bootstrap support. APG II suggests optionally Schisandraceae and Monimiaceae into a including Illiciaceae under Schisandraceae separate order Austrobaileyales placed to- (because the latter is a priority name). wards the beginning of angiosperms without Schisandraceae includes climbing or trail- any informal superclade. Eames (1961) con- ing shrubs. Thorne includes the two fami- sidered Schisandraceae to be the closest fam- lies under suborder Illicineae, which was ily. The family Illiciaceae has been found to earlier (1999) placed under order Magnoliales, be very closely related to Austrobaileyaceae but now shifted to Canellales.

* * * * * * * * * * *

Cabombaceae Richard ex A. Richard 2 genera, 6 species America, India, Australia and tropical Africa. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magniolopsida Subclass Polypetalae Magnoliidae Nymphaeidae Magnoliidae Chloranthidae Series+/Superorder Thalamiflorae+ Nymphaeanae Chloranthanae Nymphaeanae Order Ranales Nymphaeales Hydropeltidales Nymphaeales Nymphaeales Unplaced / (Nymphaeales) B & H under family Nymphaeaceae APG II optionally under Nymphaeaceae

Salient features: Aquatic herbs, leaves ers bisexual, 3-merous, cyclic, or partially floating, long-petioled, peltate, flowers large acyclic. Calyx with 3 sepals, petaloid, in one on long pedicels, stamens numerous, fruit whorl, free. Corolla with 3 petals, in one spongy with several immersed seeds. whorl, free, yellow, or purple, or white, clawed, or sessile. Androecium with 3–6 Major genera: Cabomba (5 species) and (Cabomba) stamens, or 12–18 (Brasenia), Brasenia (1). maturing centripetally, free, filaments slightly flattened, anthers bithecous, dehis- Description: Perennial aquatic herbs, cence by longitudinal slits, extrorse, pollen rhizomatous, secretary cavities present, grains monosulcate, sometimes vessels absent, sieve-tube plastids S-type. trichotomosulcate. Gynoecium with (2–)3– Leaves submerged, or submerged and float- 18 carpels, free, ovary superior, with a lon- ing, similar (Brasenia), or heterophyllous gitudinal stigmatic surface (Brasenia), or with dissected submerged leaves and entire apically stigmatic (Cabomba), (1–)2(-3) floating leaves (Cabomba), alternate or op- ovuled, placentation parietal, ovules pen- posite (submerged leaves of Cabomba), sim- dulous, anatropous, bitegmic, ple or compound, peltate, stipules absent, crassinucellate, outer integument not con- without sclerenchymatous idioblasts. Inflo- tributing to the micropyle. Fruit aggregate rescence with solitary axillary flowers. Flow- of follicles, many seeded spongy berry, some- 418 Plant Systematics

Figure 13.5 Cabombaceae. Cabomba carolinaria. A: Flowering branch with submerged dissected leaves and broad peltate floating leaves; B: Flower: C: Gynoecium with 3 free carpels; D: Longitudinal section of carpel; E: Fruit; F: Seed. Brasenia schreberi. G: Portion of plant with peltate leaves and small flowers; H: Submerged part of plant covered with thick jelly; I: Flower with three sepals and three petals, essentially similar; J: Two- seeded panduraeform nut-like fruit; K: Globose seed. times indehiscent and nut-like (Brasenia primitive lineage among angiosperms. The schreberi); seeds endospermic, perisperm paleoherb complex is characterized by scat- present, cotyledons 2. tered vascular bundles, absence of vascular cambium, leaves alternate, usually Economic importance: None palmately veined, adventitious root system and lack of etherial cells. Judd et al., (2002) Phylogeny: The family is considered to be include genus Cabomba and Brasenia under more strongly linked to monocots rather than Cabomboideae in Nymphaeaceae (APG II, Nymphaeaceae. The family has been located optionally), because their separation would under superorder Nymphaeanae after render Nymphaeaceae paraphyletic. Thorne Magnolianae but Takhtajan has finally (1999, 2003, 2006, 2007) and Stevens (APweb, taken it under distinct subclass 2008), separate them under Cabombaceae Nymphaeidae. During the last decade the on the basis of trimerous flowers, with dis- family has been identified as a constituent tinct sepals and petals, 2-3 free carpels, and of Paleoherb complex, forming the most fruit a follicle.

* * * * * * * * * * * Major Families of Angiosperms 419 Nymphaeaceae Salisbury Water Lily family 6 genera, 62 species (excluding Cabombaceae) Throughout the world forming floating masses in freshwater habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Nymphaeidae Magnoliidae Chloranthidae Series+/Superorder Thalamiflorae+ Nymphaeanae Chloranthanae Nymphaeanae Order Ranales Nymphaeales Nymphaeales Nymphaeales Nymphaeales Unplaced / (Nymphaeales)

Figure 13.6 Nymphaeaceae. A: Leaf and flower of Nymphaea coerulea. B: Longitudinal section of seed of N. alba. C: Transverse section of seed of the same showing plumule lying in the cavity of one cotyledon. D: Longitudinal section of flower of N. odorata; E-H: Successively outer to inner stamens. Nuphar sp. I: Flower; J: Longitudinal section of flower; K: Gynoecium with stigmatic disc; L: Seed.

Salient features: Aquatic herb, leaves float- Description: Perennial aquatic herbs with ing, long-petioled, peltate, flowers large on stout creeping rhizome. Stem with scattered long pedicels, stamens numerous, fruit vascular bundles, numerous air canals and spongy with several immersed seeds. laticifers. Hairs simple, usually producing mucilage. Leaves floating (Nymphaea, Vic- Major genera: Nymphaea (40 species), toria, etc.) or immersed, often very large (up Nuphar (15), and Victoria (3). to 2 m dia. in Victoria amazonica) usually 420 Plant Systematics alternate, rarely opposite or whorled, sim- of a child. The seeds of Victoria, Nymphaea ple, cordate or orbicular, often peltate with and Euryale (Makhana) are often consumed. long petiole emerging from rhizome, stipules absent or present. Inflorescence of soli- Phylogeny: The family has been a subject tary axillary flowers. Flowers floating or of considerable discussion, often strongly raised above water, bisexual, actinomorphic linked with monocots, although traditionally with spirally arranged stamens, classified with dicots. The family has been hypogynous. Calyx with 4-12 sepals, free located under superorder Nymphaeanae af- or connate, often petaloid. Corolla repre- ter Magnolianae but Takhtajan has finally sented by staminodes, absent or many, free taken it under a distinct subclass or connate at base, often passing into sta- Nymphaeidae. During the last decade, the mens. Androecium with many stamens, family has been identified as a constituent free, spirally arranged, filaments flattened of Paleoherb complex, forming the most sometimes poorly differentiated from an- primitive lineage among angiosperms. The thers, sometimes adnate to petaloid paleoherb complex is characterized by scat- staminodes, pollen grains usually tered vascular bundles, absence of vascular monosulcate or inaperturate. Gynoecium cambium, leaves alternate, usually with 3-many free or connate carpels with palmately veined, adventitious root system several locules and parietal placentation, and lack of etherial cells. The family formerly unilocular with single or many ovules, stig- also included genus Nelumbo, which has now mas often elongated and radiating from the been separated under family disc, often surrounding a central bump, Nelumbonaceae because of distinct ovary superior (Nuphar), semi-inferior tricolpate pollen grains and absence of (Nymphaea), or inferior (Euryale). Fruit a laticifers. Takhtajan places it under sepa- spongy berry, rarely an aggregate of nuts or rate subclass Nelumbonidae, whereas in pods; seeds usually operculate, arillate, with APG II classification it is removed under small embryo, endosperm absent but with Tricolpates (Eudicots) clade. APG II (option- a conspicuous perisperm. Pollination by ally) and Judd. et al., (2002) include genus beetles, flies and bees. Flowers of Victoria Cabomba and Brasenia under Cabomboideae and some species Nymphaea have starch- in Nymphaeaceae, because their separa- filled apical appendages of carpels as insect tion would render Nymphaeaceae attraction, providing food, heat and charac- paraphyletic. Thorne (2000, 2003, 2006, teristic smell. The fruit, on maturity, splits 2007) and APweb (2008), separate them un- to separate individual segments (Nuphar) or der Cabombaceae. Earlier placed after the ruptures under water so as to release seeds. Magnoloid complex, Thorne has finally shifted Cabombaceae and Nymphaeaceae in Economic importance: Species of Nymphaea basal angiosperm clades as suggested by (water lily), Nuphar (yellow water lily, molecular studies (Qui et al., 2000; Soltis et spatterdock), and Victoria (Amazon lily) are al., 2000). Wikström et al. (2001) suggest an ornamentals grown in ponds and lakes. The age for the Nymphaeales clade some 171- leaves of Victoria amazonica (Royal water lily) 153 MYA, with divergence occuring 144-111 are so large that they can support the weight MYA

* * * * * * * * * * * Major Families of Angiosperms 421 Ceratophyllaceae S. F. Gray Hornwort family 1 genus, 6 species Widespread, forming floating masses in fresh water bodies.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Liliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Nymphaeidae Magnoliidae Chloranthidae Series+/Superorder Ordines anomali+ Ceratophyllanae Nymphaeaneae Nymphaeanae Order Nymphaeales Ceratophyllales Nymphaeales Nymphaeales Ceratophyllales

Salient features: Submerged aquatic herbs, extrorse, connective prolonged beyond an- roots absent, leaves whorled, often dichoto- thers into two prominent often coloured mously dissected, flowers minute, uni- teeth, staminodes absent in female flower; sexual, perianth with 7-numerous bract-like pollen grains inaperturate, exine reduced, segments, stamens 10 to numerous, anthers pollen tubes branched. Gynoecium with 1 with prolonged connective, carpel 1, ovary carpel, ovary superior, unilocular with 1 superior, placentation apical, fruit an ovule, placentation apical, ovule pendulous, achene with 2 or more projections. style continuous with the ovary, stigma extending along one side of style. Fruit a nut Major genera: Single genus Ceratophyllum tipped by persistent spine-like style and of- (6 species). ten with two or more projections; seed with straight embryo, endosperm absent. Description: Submerged aquatic herbs often forming floating masses, rootless but some- Economic importance:. Floating masses times with colourless root-like branches provide protection to fish fry. The masses anchoring the plant; stems branched but also support bilharzia-carrying snails and with never more than one branch at one malaria- or filaria-carrying mosquito larvae. node, with single vascular strand with cen- Fruits and foliage form food for migratory tral air canal surrounded by starch-contain- waterfowl. It is sometimes troublesome, ing cells, with tannins. Leaves whorled, 3- choking waterways. 10 at each node, once to four times dichotomously dissected, ultimate leaf-segments Phylogeny: The phylogeny of the family has with two rows of minute teeth and tipped by been a matter of great speculation. Bentham two bristles, stomata and cuticle absent, stip- and Hooker placed this family along with oth- ules absent. Inflorescence with solitary ax- ers of uncertain affinities under Ordines illary flowers, usually one flower in a whorl anomali. It is usually considered to be related of leaves. Flowers unisexual (plants to Nymphaeaceae (Lawrence, 1951; Heywood, monoecious), male and female flowers usu- 1978—both include Nelumbo under ally on alternate nodes, actinomorphic, very Nymphaeaceae) particularly genus Nelumbo, small. Perianth with 7 to numerous tepals, which has now been removed to a distinct fam- linear, bract-like, slightly connate at base. ily Nelumbonaceae. Cronquist (1988) places Androecium with numerous stamens, fila- all the three families under the same order ments indistinct, anther oblong-linear, Nymphaeales. G. Dahlgren (1989) includes bithecous, dehiscence longitudinal, Nelumbonaceae under order Nelumbonales of 422 Plant Systematics

Figure 13.7 Ceratophyllaceae. Ceratophyllum submersum. A: Portion of plant; B: Whorl of leaves at node spread out to show dichotomous segments; C: Male flower with perianth and several sessile stamens; D: Young stamen with connective produced into two prominent teeth; E: Dehiscing stamen; F: Fruit with persistent style and spiniscent projections; G: Longitudinal section of fruit with pendulous seed. superorder Magnolianae, whereas Nymphaea- Ceratophyllaceae to Chloranthidae under ceae and Ceratophyllaceae are placed under order Nymphaeales. order Nymphaeales of superorder Nymphae- The family Ceratophyllaceae has attracted anae. Takhtajan (1997) removed Nelumbona- a lot of interest with morphological and fossil ceae under distinct order Nelumbonales, dis- evidence (Les et al., 1991) and molecular evi- tinct superorder Nelumbonanae and even a dence (Chase et al., 1993) suggesting basal distinct subclass Nelumbonidae. Ceratophylla- placement in angiosperms. Hickey and Tay- ceae and Nymphaeaceae are placed under lor (1996), however, suggested that the subclass Nymphaeidae but separate super- aquatic plant with highly reduced vegetative orders Ceratophyllanae and Nymphaeanae, body and pollen wall, tenuinucellate under respective orders Ceratophyllales and unitegmic ovules and problematic fossil Nymphaeales. Thorne (2003) placed record is a poor candidate for basal-most Nymphaeaceae and Cabombaceae under position. Ceratophyllaceae is possibly sister Nymphaeales, superorder Nymphaeanae, to monocots (e.g. Graham & Olmstead, 2000; under subclass Magnoliidae, subsequently Zanis et al., 2002; Whitlock et al., 2002), and (2006) shifting to Chloranthidae. Ceratophylla- accordingly in APG II and Apweb, placed in dis- ceae is taken closer to Nelumbonaceae tinct order Ceratophyllales before monocots under Ranunculanae of subclass Ranun- and Chloranthales, respectively without any culidae but under separate orders Cerato- supraordinal informal group. Nymphaeaceae phyllales and Nelumbonales, respectively. is similarly placed under Nymphaeales but Latest 2007 revisions shows a major shift of Nelumbonaceae removed to Eudicots.

* * * * * * * * * * * Major Families of Angiosperms 423

Subclass 2. Magnoliidae Superorder 1. Magnolianae 4. Hernandiaceae Order 1. Magnoliales 5. Atherospermataceae 6. Gomortegaceae Family 1. Myristicaceae 7. Siparunaceae 2. Magnoliaceae Order 3. Canellales 3. Degeneriaceae 1. Winteraceae 4. Himantandraceae 2. Canellaceae 5. Eupomatiaceae 6. Annonaceae Order 4. Piperales Order 2. Laurales 1. Aristolochiaceae 2. Lactoridaceae 1. Calycanthaceae 3. Hydnoraceae 2. Monimiaceae 4. Saururaceae 3. Lauraceae 5 Piperaceae

Magnoliaceae A. L. de Jussieu Magnolia family 7 genera, 182 species Warm temperate to tropical regions of Southeast, North and Central America, West Indies, Brazil, and East Asia. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Nymphaeidae Magnoliidae Magnoliidae Series+/Superorder Thalamiflorae+ Magnolianae Magnolianae Magnolianae Magnoliids* Order Ranales Magnoliales Magnoliales Magnoliales Magnoliales Magnoliales

Salient features: Trees or shrubs with vestured pits, wood parenchyma apotracheal alternate simple leaves, stipules caducous, (terminal), sieve-tube plastids S-type, or P- leaving a circular scar at the node, nodes type and S-type; when P-type, subtype I (b). multilacunar, flowers usually solitary, Leaves evergreen or deciduous, alternate, bisexual, large, floral parts numerous, spi- spiral, petiolate, simple, dissected (Lirio-den- rally arranged on elongated thalamus, tepals dron), pinnatifid or entire, pinnately veined, gradually passing from outer sepals to inner or palmately veined, stipules large, sheath- petals, stamens laminar, carpels free, seed ing, enclosing the terminal buds, caducous, often suspended by thread like funiculus. leaving a ring-shaped scar at the node, stomata paracytic, or anomocytic, minor leaf Major genera: Magnolia (80 species), Michelia veins without phloem transfer cells (Magno- (40), Talauma (40) and Liriodendron (2). lia). Inflorescence with usually solitary terminal, or axillary flowers. Flowers Description: Trees or shrubs, nodes bracteate (the bracts spathaceous); large, 5-lacunar or multilacunar, vessels-elements regular, bisexual. Perianth with 6-18 tepals, with scalariform ends, vessels without free, sequentially intergrading from sepals 424 Plant Systematics

Figure 13.8 Magnoliaceae. Magnolia virginiana. A: Flowering branch with single terminal flower; B: Stamen, laminar and with apical sterile appendage; C: Longitudinal section of gynoecium, two anatropous ovules in each carpel; D: Seed with fleshy seed coat removed; E: Longitudinal section of seed showing fleshy seed coat, copious endosperm and small embryo. M. grandiflora. F: Flower bud; G: Vertical section of flower; H: Floral receptacle with half of the stamens removed; I: Anther; J: Dehisced fruit with arillate seeds hanging through thread-like funiculus. to petals, or petal-like (usually), usually spi- style, but sometimes terminal. Fruit an ag- rally arranged, rarely 3–4 whorled, white, or gregation of follicles or indehiscent samaras cream, or pink, deciduous. Androecium with (Liriodendron), or united into fleshy syncarp numerous (50–200) stamens, maturing cen- (Aromadendron); seeds endospermic, tripetally, free, spirally arranged, all fertile, endosperm oily, seeds usually large, often usually laminar (the four paired with long thread-like funiculus. Pollination microsporangia embedded, the stamens of- primarily by beetles. The fruits are primarily ten more or less strap-shaped), anthers dispersed by animals, but the samaras of adnate, dehiscence longitudinal, through Liriodendron are wind dispersed. slits or valves, extrorse (Liriodendron), or latrorse to introrse, bithecous, appendaged Economic importance: Various species of often by prolongation of the connective or Magnolia (M. grandiflora, M. kobus, M. stellata) unappendaged, pollen grains monosulcate. and Michelia (M. fuscata, M. champaca Gynoecium with (2–) 20–200 free carpels, —sapu, also source of timber) are grown as ovary superior, carpel fully or incompletely ornamentals. Liriodendron tulipifera (tulip closed, 2 (–20) ovuled, placentation marginal; tree or yellow poplar) is a valuable timber ovules funicled, pendulous, biseriate (on the source in USA. Species of Magnolia ventral suture), anatropous, bitegmic, (M. hypoleuca), and Michelia also constitute crassinucellate; stigma extending down the sources of timber. Major Families of Angiosperms 425

Phylogeny: The family was regarded as the The family is considered to be mono- most primitive of the extant angiosperms for phyletic based on the support from rbcL and several decades in the classification systems ndhF sequences (Qui et al., 1993, Kim et al., of Hallier (1905), Hutchinson (1926, 1973), and 2001). These studies, however, question the earlier versions of Cronquist and Takhtajan. recognition of Talauma, Michelia and The view was first challenged by Smith (1945), Manglietia as distinct genera, as it renders who considered that Magnoliaceae are rela- Magnolia as paraphyletic. Although tively highly specialized both vegetatively and Liriodendron is quite distinct, all other gen- florally, casting some doubt on the assump- era have been merged with Magnolia in the tion of the primitive nature of the family, and recent works. Figlar and Nootebroom (2004) implying that groups such as Winteraceae, divide the enlarged genus Magnolia into etc., may be at least as primitive. The status three subgenera: Magnolia, Yulania and of Magnoliaceae as the most primitive fam- Gynopodium. Two clades are distinguished ily was strongly challenged by Carlquist within the family one represented by (1969), Gottsberger (1974) and Thorne (1976), Liriodendron, and the other by rest of the claiming Winteraceae to be the most primi- genera. Judd et al., (2008), Stevens (2008) tive family. The primitive features of as such recognize only 2 genera Magnolia Magnoliaceae include spirally arranged and Liriodendron within the family. Thorne floral parts, laminar stamens, fruit a follicle, (2003, 2006,2007), places Magnolia and other longer and narrower vessel elements, 5 genera in subfamily Magnolioideae, monosulcate pollen grains and beetle whereas Liriodendron is placed in mono- pollination. generic Liriodendroideae.

* * * * * * * * * * *

Degeneriaceae I.W. Bailey & A.C. Smith Degeneria family 1 genus, 2 species Endemic to Fiji. Placement: B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Magnoliidae Nymphaeidae Magnoliidae Magnoliidae Series+/Superorder Magnolianae Magnolianae Magnolianae Magnoliids* Order Not described then Magnoliales Magnoliales Magnoliales Magnoliales Magnoliales

Salient features: Trees or shrubs with al- Genus: Single genus Degeneria with 2 spe- ternate simple leaves, stipules absent, cies, D. vitiensis and D. roseiflora. nodes 5-lacunar, flowers usually solitary, bisexual, large, sepals and petals distinct, Description: Large trees; bearing essential sepals 3, petals 12-18, stamens many, oils, nodes 5-lacunar, vessel-elements with laminar, 3-veined, inner modified into oblique end walls, sieve-tube plastids P-type, staminodes, carpel single, incompletely pith with diaphragms. Leaves alternate, sealed, fruit leathery with many seeds. petiolate, non-sheathing, gland-dotted, 426 Plant Systematics

Figure 13.9 Degeneriaceae. Degeneria vitiensis. A: Tree growing in natural habitat in Fiji.; B: A branch with flowers; C: Stamen, laminar with undifferentiated filament and anther part; D: Transverse section of carpel; E: Fruit. aromatic, simple, entire, pinnately veined, placentation marginal, ovules 20-30, in two exstipulate, stomata paracytic, mesophyll rows, long funicled, with a conspicuous with spherical etherial oil cells. Inflores- funicular obturator; anatropous, bitegmic, cence with solitary pendulous flowers, (su- crassinucellate, outer integument not con- pra) axillary. Flowers medium-sized to large, tributing to the micropyle. Fruit leathery, regular, polycyclic, thalamus shortly raised, with a hard exocarp, dehiscent, or sepals and petals distinct. Calyx with 3 se- indehiscent, 20–30 seeded; seeds flattened, pals, 1 whorled, free, persistent. Corolla more or less sculptured, with an orange-red with 12-18 petals, larger than the sepals, 3– sarcotesta, embryo well differentiated but 5 whorled, free, fleshy, deciduous, sessile. small, cotyledons 3 (–4), copiously Androecium with about 30–50 stamens, endospermic, endosperm ruminate, oily. maturing centripetally, free, 3–6 whorled, Pollination by beetles. innermost 3–10 modified into staminodes; fertile stamens laminar, flattened, oblong, Economic importance: No economic value 3-veined; anthers bithecous, adnate, de- known. hiscence longitudinal, with slits or valves, extrorse, tapetum glandular, pollen grains Phylogeny: The family was earlier included monosulcate. Gynoecium with single car- under Winteraceae, and was considered pel, ovary superior, single chambered, car- closer to Zygophyllum by Hutchinson (1973). pel incompletely closed (largely unsealed at It is now treated to be an independent fam- anthesis), style absent, stigma running ily, more closely allied to Magnoliaceae and nearly the entire length of carpel, Himantandraceae. Takhtajan (1987, 1997), Major Families of Angiosperms 427 considers Winteraceae and Degeneriaceae simple leaves, numerous laminar stamens, to be more primitive families, but is perhaps partially closed carpel with stigma running is the only one among the recent authors to the entire length of carpel, 3-4 cotyledons, and consider Degeneriaceae as the most primi- monosulcate pollen grains. Thorne (2003, tive family of extant angiosperms. The primi- 2006, 2007) places Degeneriaceae between tive features of the family include alternate Magnoliaceae and Himantandracea.

* * * * * * * * * * *

Annonaceae A. L. de Jussieu Annona or Pawpaw family 128 genera, 2300 species Temperate and tropical regions of Eastern North America and Eastern Asia, and tropical South America. Mainly distributed in Old World tropics, in moist forests. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Thalamiflorae+ Magnolianae Magnolianae Magnolianae Magnoliids* Order Ranales Magnoliales Annonales Annonales Magnoliales Magnoliales

Salient features: Trees or shrubs with al- tire, pinnately veined, stipules absent, ternate distichous leaves, stipules absent, domatia recorded in 3 genera, stomata leaves glaucous or with metallic sheen, flow- paracytic, secretory cavities containing oil, ers fragrant, flowers trimerous with numer- mucilage, or resin. Inflorescence with soli- ous spirally arranged stamens, many car- tary flowers, or racemose. Flowers regular, pels free, fruit an aggregate of berries, seed cyclic, usually bisexual, rarely unisexual, tha- with ruminate endosperm. lamus sometimes elongated (Mischogyne) Calyx usually with 3 sepals, or 6 and 2- Major genera: Guateria (250 species), Xylopia whorled, free, valvate. Corolla with 3-6 pet- (150), Uvaria (100), Artabotrys (100), Annona als, 1–2 whorled, free, imbricate or valvate. (100), and Polyalthia (100). Androecium with 25–100 stamens, maturing centripetally; free, all equal, spirally ar- Description: Trees, or shrubs, or lianas, bear- ranged, rarely 3-6 whorled, rarely outer forming essential oils, nodes unilacunar, or ing staminodes (e.g. in Uvaria), anthers bilacunar, vessel end-walls horizontal, sim- bithecous, adnate, dehiscing by longitudinal ple, vessels without vestured pits, wood dif- slits or valves; extrorse, connective prolonged fuse porous; partially storied, sieve-tube into appendage, tapetum glandular, pollen plastids P-type, subtype I (a), pith commonly shed in aggregates (5 genera), or as single with diaphragms Leaves evergreen, alter- grains; when aggregated, in tetrads (usually), nate, distichous, non-sheathing, simple, en- or in polyads (octads in Trigynaea). Pollen 428 Plant Systematics

Figure 13.10 Annonaceae. Asimina triloba. A: Flowering branch bearing solitary flowers; B: Vertical section of flower ; C: Longitudinal section of carpel showing ovules; D: Pollen grain; E: Fruit. Annona furfuracea. F: Flowering branch; G: Vertical section of receptacle showing male flowers towards the centre and female flowers towards the periphery; H: Longitudinal section of carpel showing basal ovule. grains monosulcate or nonaperturate, or with used in perfumes. The spicy fruits of West two parallel furrows at the equator, or ulcer- African Xylopia aethiopica are the so-called ate. Gynoecium with 10–100 carpels, usu- ‘Negro pepper’ used as a condiment, and ally free, rarely united, placentation of free those of Monodora myristica used as substi- carpels basal, when syncarpous 1 locular, or tute for nutmeg. 2–15 locular, parietal, or basal. Ovules 1-50, apotropous, with ventral raphe, bitegmic, Phylogeny: It is generally agreed upon that crassinucellate, outer integument not contri- the family is derived from Magnoliaceous buting to the micropyle. Fruit fleshy, com- stock. Hutchinson placed the family under monly an aggregate of berries; seeds endo- Annonales after Magnoliales, from which, spermic, endosperm ruminate, oily. Pollination according to him, they were clearly derived. mostly by beetles. Dispersal especially of The primitive features include spirally ar- fleshy fruits by birds, mammals and turtles. ranged numerous stamens and carpels, connective prolonged into an appendage. The Economic importance: Many species of sepals and petals are more advanced than Annona are cultivated for their edible fruits: Magnoliaceae. Most of the recent authors A. squamosa (sweet sop), A. muricata (sour (except Dahlgren and Takhtajan, who place sop), A. reticulata (custard apple), and it under Annonales), however, include this A. cherimola (cherimoya). Flowers of Cananga family under Magnoliales (Stevens, 2008; odorata (ylang-ylang) and Mkilua fragrans are Thorne, 2003, 2006, 2007). The genera with Major Families of Angiosperms 429 connate carpels and with fleshy berries are fication of Annonaceae may have occured considered more advanced than those with (84)82-57 mybp (Doyle et al. 2004; free carpels. It is proposed that the diversi- Scharaschkin & Doyle 2005).

* * * * * * * * * * *

Calycanthaceae Lindley Strawberry shrub family 4 genera, 8 species (including Idiospermaceae) Family with discontinuous distribution, found in North America, East Asia and Queensland.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Thalamiflorae+ Magnolianae Magnolianae Magnolianae Magnoliids* Order Ranales Laurales Calycanthales Laurales Laurales Laurales

Salient features: Shrubs with opposite sim- veins, sequentially intergrading from sepals ple leaves, stipules absent, flowers with nu- to petals, free, inserted along the rim of merous spirally arranged tepals, numerous receptacle. Androecium with 15–55 stamens along the rim of cup-like recepta- stamens, maturing centripetally, free, spi- cle, fruit single-seeded achene. rally arranged at the top of the hypanthium, laminar or linear, bithecous, inner 10-25 Major genera: Calycanthus (3 species), modified into usually nectariferous Chimonanthus (3), Sinocalycanthus (1) and staminodes, anthers adnate, dehiscence by Idiospermum (1). longitudinal slits, extrorse, connective extended into an appendage, pollen grains Description: Small trees, or shrubs with aro- 2(–3) aperturate, sulcate. Gynoecium with matic bark, bearing essential oils, nodes 5–45 free carpels, spirally arranged within unilacunar, vessel-elements with oblique the hypanthium, ovary superior, style end-walls, sieve-tube plastids P-type, subtype distinct, stigma terminal, ovary 2 ovuled I (a). Leaves opposite, leathery, petiolate, (upper often abortive), placentation gland-dotted, simple, entire, pinnately marginal, ovules ascending, apotropous with veined, stipules absent, stomata paracytic, ventral raphe, anatropous, bitegmic, hairs unicellular or absent, mesophyll with crassinucellate, or pseudocrassinucellate, spherical etherial oil cells. Inflorescence outer integument not contributing to the with solitary terminal flowers on specialized micropyle. Fruit an aggregate of achenes leafy short-shoots. Flowers medium-sized to enclosed in the fleshy hypanthium; seeds large, regular, bisexual with spirally ar- nonendospermic, embryo well differentiated ranged floral parts, markedly perigynous. (large), cotyledons 2, spirally twisted. Polli- Perianth with 15-30 tepals, each with 3-4 nation by insects, mainly beetles. 430 Plant Systematics

Figure 13.11 Calycanthaceae. A: Flowering branch of Calycanthus laevigatus. Chimonanthus praecox. B: Flower bud. C: Vertical section of flower; D: Longitudinal section of carpel. Calycanthus floridus. E: Flower; F: Vertical section of flower; G: Longitudinal section of carpel; H: Nut.

Economic importance: Calycanthus floridus Laurales. Loconte and Stevenson (1991), pro- (Carolina allspice) and C. occidentalis jected Calycanthaceae as basic angiosperms are grown as ornamental shrubs. Bark of with a series of vegetative and reproductive C. fertilis and C. floridus yield medicinal ex- angiosperm plesiomorphies such as shrub tracts. Chimonanthus praecox (winter sweet) habit, unilacunar two-trace nodes, vessels is widely cultivated, and is one of the few spe- with scalariform perforations, sieve-tube el- cies flowering in cold winter with snow around, ements with starch inclusions, opposite the flowers used in Japan to make perfumes. leaves, strobilar flowers, leaf-like bracteopetals, poorly differentiated numer- Phylogeny: The family is closely related to ous spirally arranged tepals, and few ovulate Magnoliaceae and Annonaceae in its nu- carpels. Food bodies terminating the stamen merous spirally arranged floral parts and free connectives indicate beetle pollination. It is carpels. Hutchinson included the family interesting to note that genus Idiospermum under Rosales primarily because of (which was recognized as new genus based perigynous flowers and free carpels, a posi- on Calycanthus australiensis by S. T. Blake tion contested by several authors. Thorne in 1972) was considered as the most primi- (1996, 2000) regarded it to be closely related tive flowering plant by these authors. Blake to Monimiaceae and placed under suborder had separated Idiospermum under distinct Laurineae of Magnoliales, but subsequently family Idiospermaceae, also recognized by (2003, 2006, 2007) under independent order Hutchinson, as distinct from Calycantha- Major Families of Angiosperms 431 ceae. Endress (1983) had described ‘In all suggest Calycanthaceae to be basal within respects, Idiospermum gives the impression Laurels, probably sister to all other Laurales of a strange living fossil’. Molecular studies (Doyle and Endress, 2000).

* * * * * * * * * * *

Lauraceae Durande Laurel family 50 genera, 3000 species Throughout tropical and subtropical regions of the world, primarily in rain forests of Southeast Asia and North America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Daphnales+ Lauranae Magnolianae Magnolianae Magnoliids* Order Laurales Laurales Laurales Laurales Laurales B & H as Laurineae

Salient features: Aromatic trees or shrubs, (14 genera) represented by pits, pockets, or leaves alternate, perianth small and undif- hair tufts, stomata, paracytic, hairs mostly ferentiated, stamens in several whorls, fruit unicellular, mesophyll usually with spheri- single seeded drupe or berry. cal etherial oil cells. Inflorescence cymose, or racemose, often umbelliform with Major genera: Litsea (400 species) Ocotea involucral bracts, rarely solitary. Flowers (350), Cinnamomum (250), Cryptocarya (250), small, often fragrant, regular, bisexual, Persea (200), Beilschmeidia (150) and Lindera rarely unisexual, usually 3-merous, cyclic, (100). with well-developed hypanthium. Tepals usually 6, sometimes 4, free, (1–)2(–3) whorled, Description: Aromatic trees and shrubs, similar, sepaloid to petaloid, green, or white, sometimes parasitic climbers (Cassytha) or cream, or yellow. Androecium with (3–)9(– nodes unilacunar with two traces, vessel el- 26) stamens, free, equal, or markedly un- ements with scalariform or simple end-walls, equal, (1–)3(–4) whorled, inner sometimes without vestured pits, wood partially storied, modified into staminodes, somewhat laminar sieve-tube plastids P-type, or S-type; when P- to petaloid by expansion of the filament and type, subtype I(b). Leaves nearly always ev- connective, filaments appendaged or not, an- ergreen, usually alternate and spiral, rarely thers bithecous, basifixed, dehiscence lon- opposite or whorled, leathery, petiolate, non- gitudinal by valves opening from base to apex, sheathing, gland-dotted, aromatic, simple, or dehiscing by pores (in Hexapora), usually entire , sometimes lobed (Sassafras), introrse, sometimes extrorse, tapetum amoe- pinnately veined, stipules absent, domatia boid (mostly), or glandular (in several genera), 432 Plant Systematics

Figure 13.12 Lauraceae. Litsea doshia. A: Flowering branch with flowers in globose axillary clusters; B: Flower; C: Fruit. Cinnamomum tamala. D: Flowering branch with terminal paniculate inflorescence; E: Flower; F: Fruit; G: Anther dehiscing by valves. (After Polunin and Stainton, Flowers of the Himalaya, 1984). pollen grains nonaperturate, exine spiny. Phylogeny: Lauraceae is generally considered Gynoecium with 1 carpel, ovary usually su- to be a more specialized family placed closer perior, sometimes inferior (Hypodaphnis), to Monimiaceae and Calycanthaceae. The style distinct with terminal stigma, order Laurales is generally considered to placentation apical; ovules pendulous, belong to the magnoloid complex, and repre- apotropous, with dorsal raphe, non-arillate, sents an early divergent lineage . The derived anatropous, bitegmic, crassinucellate, outer apomorphies of Lauraceae and Monimiaceae integument not contributing to the micropyle. include ovary with single carpel, and spinose Fruit fleshy, drupaceous, or baccate, enclosed pollen grains. The families also share pollen in the fleshy receptacle, 1 seeded; seeds lacking aperture, stamens with paired nonendospermic, embryo well differentiated, appendages, and anthers opening by valves. cotyledons massive, occasionally ruminate. The family is traditionally divided into two subfamilies Cassythoideae (Cassytha) and Economic importance: The family contrib- Lauroideae (rest of genera). The latter is vari- utes some important spices from plants such ously divided into 3 (Werff and Richter, 1996) as Laurus nobilis (bay leaves), Cinnamomum or 5 tribes (Heywood, 1978). It has been sug- verum (cinnamon), C. camphora (camphor), gested that the perianth in some Lauraceae and Sassafras albidum (sassafras). Persea may represent modified stamens americana (avocado) is an important tropical (Chanderbali et al. 2004) as both the tepals fruit. Aromatic oils are obtained from Lindera and the stamens of Persea have three traces. (benzoin) and Sassafras. Species of Litsea, Hypodaphnis, with an inferior ovary is con- and Ocotea yield fragrant woods used in cabi- sidered to be sister to the rest of the family net-making. (Stevens, 2008).

* * * * * * * * * * * Major Families of Angiosperms 433 Winteraceae R. Br. ex Lindley Winter’s bark family 8 genera, 90 species Tropical, subtropical and temperate regions of Madagascar, South America, Mexico, Australia, New Caledonia and New Guinea.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Thalamiflorae+ Magnolianae Magnolianae Magnolianae Magnoliids* Order Ranales Magnoliales Winterales Winterales Canellales Canellales B & H under family Magnoliaceae * informal clade names, no formal group names given above order in APG II and Apweb

Figure 13-13 Winteraceae. Drimys winteri. A: Flowering branch of var. punctata; B: Vertical section of flower; C: fruits. Tasmannia sp. D: Flower; E: Vertical section of carpel. 434 Plant Systematics

Salient features: Trees and shrubs with tance, used locally in South America as a simple alternate leaves with glaucous under tonic. It was also used once by mariners for surface, stipules lacking, nodes trilacunar, scurvy prevention. Some other species also vessels absent, flower medium sized in have medicinal uses. The fruits and seeds cymes, stamens numerous with flattened of D. lanceolata (mountain pepper) are used filament, pollen grains in tetrads, stigma as pepper and allspice substitute. extending down on style and fruit a follicle. Phylogeny: The family has gained consider- Major genera: Tasmannia (40 species), able phylogenetic significance during the last Bubbia (30), and Drimys (4). three decades and has been regarded as the most primitive living family of angiosperms, Description: Trees or shrubs lacking ves- and Drimys (according to Eames, 1961 the sels and with narrow elongated tracheids, combination of characters suggests Belliolum nodes trilacunar, sieve-tube plastids S-type. as most primitive genus of the family) as the Leaves leathery, alternate, aromatic, gland- most primitive genus in the recent classifi- dotted, containing terpenoids, entire, sim- cations of Thorne (pre-2003 versions) and ple with reticulate venation, under surface Cronquist. Takhtajan also regarded this as a glaucous due to waxy coating, stipules ab- very primitive family but considered sent. Inflorescence cymose or fasciculate, Degeneria (formerly under Winteraceae, but with medium-sized few flowers, solitary ter- now removed to Degeneriaceae) to be the minal in Zygogynum. Flowers usually bi- most primitive genus. The primitive position sexual, rarely polygamous, actinomorphic of Drimys is supported by the absence of ves- with spirally arranged stamens, hypogynous. sels, narrow elongated tracheids, laminar Calyx with 2-6 sepals, free or connate at stamens and more primitive beetle pollina- base (Drimys), valvate, sometimes falling off tion. The fossil records of the family also go as cap. Corolla with 5 or many petals, 2- or back to 100-140 years. Only Chloranthaceae more-seriate, mostly conspicuous in bud, is perhaps as old in fossil history of imbricate. Androecium with many stamens, angiosperms. Thorne (1996) lists other primi- centrifugal, free, filaments flattened or al- tive features of Drimys as alternate, entire, most laminar, poorly differentiated from an- exstipulate leaves, pollen grains in tetrads, thers, anthers bithecous, dehiscing longi- long cambial initials and tracheids, heterog- tudinally, introrse, connective frequently ex- enous rays, and poorly-organized pinnate ve- tending beyond anthers, tapetum amoeboid nation, small medium sized flowers in cymes, or glandular, pollen uniporate, released in style-less carpel, partly sealed stigmatic mar- tetrads. Gynoecium with 1-many carpels, in gins, and follicle fruit. a single whorl, usually free, sometimes The position of Winteraceae at the base slightly connate (Exospermum) or syncarpous of angiosperms, however, has been refuted (Zygogynum), ovary superior with parietal during the last decade, largely due to emer- placentation, ovules 1-many, anatropous, gence of the herbaceous origin hypothesis, bitegmic, crassinucellate, stigma extending and the results of cladistic studies largely down on style or capitate, carpels sometimes based on molecular data. Young (1981) in- partially unsealed (Drimys). Fruit an etaerio terpreted neoteny in the family with a se- of berries or follicles, embryo minute, ries of reversals. It is also suggested that endosperm conspicuous. Pollination by small the family shares common ancestry with beetles (Drimys), flies and moths, some spe- Illiciaceae (Doyle and Donoghue, 1993) and cies wind pollinated (Tasmannia). Dispersal Amborellaceae (Loconte and Stevenson, especially of berries is by vertebrates. 1991). Loconte (1996), on comparison of various hypotheses concluded that the tree based Economic importance: The bark of Drimys on Winteraceae hypothesis is two steps winteri (winter’s bark) is of medicinal impor- longer than one based on Calycanthaceae. Major Families of Angiosperms 435

The family has recently been placed along al., 2002, 2003). The two are characterised with Canellaceae in a separate order by apomorphine alkaloids, trilacunar nodes Canellales (APG II, APweb), not at the begin- and sieve-tube plastids with starch and pro- ning of angiosperms but after tein crystalloids. Thorne earlier (2003) placed Amborellaceae, Chloranthaceae and the two families under suborder Canellineae Austrobaileyaceae. The sister-group rela- of order Canellales, the other suborder be- tionship of Winteraceae and Canellaceae ing Illiciineae. However, With the shifting has received bootstrap support of 99 or 100 of latter under Chloranthales, the two fami- per cent in all recent multigene analyses lies are placed directly under Canellales (Qui et al., 1999; Soltis et al., 1999; Zanis et (Thorne, 2007).

* * * * * * * * * * *

Saururaceae Martynov Lizard-tail family 4 genera, 6 species Temperate or subtropical Coasts of North America and East Asia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Microembryeae+ Piperanae Nymphaeanae Magnolianae Magnoliids* Order Piperales Piperales Piperales Piperales Piperales B & H under family Piperaceae

Salient features: Perennial herbs, leaves end-walls, scalariform, sieve-tube plastids S- alternate, stipules adnate to petiole, flowers type. Leaves alternate; spiral to distichous, reduced, in dense spikes, coloured bracts petiolate, aromatic, simple, pinnately or often surrounding the base of spike, looking palmately veined, stipules intrapetiolar and like petals, the whole inflorescence looking adnate to the petiole, stomata cyclocytic, like a flower, stamens 6, somewhat attached mesophyll with spherical etherial oil cells. to carpels, carpels free or united, fruit a Inflorescence a raceme, or spike, often with capsule. involucral bracts resembling petals (Houttuynia, Anemopsis) and inflorescence Major genera: Saururus (2 species), appearing like a flower, or without involucral Gymnotheca (2), Houttuynia (1), Anemopsis (1) bracts (Saururus, Gymnotheca). Flowers and Circaeocarpus (1). small, regular; bisexual, cyclic Perianth absent. Androecium with 3, or 6, or 8 Description: Perennial aromatic herbs bear- stamens, united with the gynoecium or not, ing essential oils, rhizomatous, nodes free, 1 whorled (when 3), or 2 whorled (when 5-lacunar, or multilacunar, vascular bundles six or eight), with slender filaments, anthers in one ring, vessel elements with oblique basifixed, dehiscence by longitudinal slits, 436 Plant Systematics

Figure 13.14 Saururaceae. Saururus cernuus. A: Flowering branch with elongated spike. B: Flower with subtending bract; C: Vertical section of flower; D: Transverse section of fruit. E: Flowering portion of Anemopsis californica with showy involucre bracts below the spike, and the plant with basal leaves.

extrorse to latrorse to introrse, tapetum glan- Economic importance: Houttuynia cordata dular, pollen grains aperturate, or forms a good ground cover and is commonly nonaperturate, usually monosulcate. cultivated. The leaves of this species are Gynoecium with 3 or 4(–5) carpels, free or used as salad and for treating eye diseases united, semicarpous in Saururus (the in Vietnam. Saururus chinensis is also occa- conduplicate carpels distinct above the sionally cultivated. The aromatic connate base), superior (mostly), or inferior stoloniferous stock of Anemopsis californica (Anemopsis); carpel in Saururus incompletely was once fashioned into cylindrical necklace closed, style with decurrent stigma, (1–)2–4 beads by American Indians, and hence the ovuled, placentation dispersed (laminar-lat- name Apache beads. The stock infused in eral), ovary 1 locular, Styles 3–4(–5); in the water is also a reputed treatment for ma- genera other than Saururus apical, stigmas laria and dysentery. 3–4(–5), placentation parietal, ovules in the single cavity 20–40(–50) (6–10 on each pla- Phylogeny: The family is considered to be centa), orthotropous to hemianatropous, less specialized than Piperaceae in its free bitegmic, tenuinucellate, or crassinucellate, to united carpels and parietal placentation, outer integument contributing to the micro- and is believed to be belonging to paleoherb pyle. Fruit an aggregate (Saururus), or not, complex, early basal branch of angiosperms. indehiscent (Saururus) or dehiscent, fleshy, Hickey and Taylor (1996), who proposed the a capsule, or capsular-indehiscent; seeds herbaceous origin hypothesis, believe that scantily endospermic, perisperm present, the flowers of Piperaceae, as well as of embryo rudimentary. Anemopsis and Houttuynia, arose through Major Families of Angiosperms 437 suppression of the system of inflorescence ultimate pair of anthions. Zeng et al. (2002) axes of gnetopsids and bracts to bring either on the basis of matR gene studies concluded a single distal and one more proximal pair that 4 genera and six species of Saururaceae of anthions together above the subtending form a monophyletic group. Circaeocarpus bract of the second–order inflorescence axis. saurroides C. Y. Wu earlier placed in The four carpelled flowers of Saururus and Saururaceae is conspecific with Zippelia Gymnotheca are the result of the reduction begoniaefolia Blume and belongs to of an inflorescence axis to a penultimate and Piperaceae.

* * * * * * * * * * *

Piperaceae Batsch Pepper family 5 genera, 2,015 species Tropical and subtropical regions, mainly in rain forests.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Magnoliidae Magnoliidae Magnoliidae Magnoliidae Series+/Superorder Microembryeae+ Piperanae Nymphaeanae Magnolianae Magnoliids* Order Piperales Piperales Piperales Piperales Piperales

Salient features: Herbs, shrubs or climbers mesophyll with spherical etherial oil cells. with jointed nodes, vascular bundles scat- Inflorescence spadix or spike. Flowers tered, leaves alternate, petioles sheathing the bracteate; minute to small, usually bisexual, nodes, flowers small in dense spikes, peri- sometimes unisexual. Perianth absent. anth absent, stamens 2-6, ovary with single Androecium with 1–10 stamens, adnate to ovule, embryo very small. the base of ovary or not, free, often more or less monadelphous, staminodes often Major genera: Piper (970 species), Peperomia present, anthers bithecous (monothecous in (961), Ottonia (70) and Pothomorphe (10). Peperomia), dehiscence by longitudinal slits, extrorse, tapetum glandular, pollen grains Description: Herbs, shrubs, or woody climb- monosulcate or nonaperturate. Gynoecium ers, or small trees bearing essential oils, with 2-4 united carpels, or single carpel stems conspicuously jointed, nodes 3-lacunar (Peperomia), ovary superior, unilocular, stig- to multilacunar, vascular bundles scattered, mas 1–5, placentation basal; ovule, ascend- vessel-elements with scalariform or simple ing, orthotropous, bitegmic or unitegmic end-walls, sieve-tube plastids S-type. Leaves (Peperomia), crassinucellate. Fruit fleshy, alternate, spiral, herbaceous or fleshy, sim- usually a drupe; seeds scantily endospermic, ple, entire, pinnately or palmately veined, perisperm copious, embryo minute. petiolate sheathing, stipules intrapetiolar, adnate to petiole, hydathodes commonly Economic importance: Piper nigrum is the present, stomata cyclocytic or anisocytic, source of black and white pepper (ripe and 438 Plant Systematics

Figure 13.15 Piperaceae. Piper guineense. A: Fruiting branch with pendulous spike; B: Paired flowers and their bracts; C: Longitudinal section of female flower. Piper nigrum. D: Fruiting branch; E: Flower; F: Stamen. G: Peperomia griseo-argenteum, a cluster of flowering shoots.

unripe, respectively). The roots of P. methy- Piperales together with Aristolochiaceae, stichum are used for making the famous Hydnoraceae and Lactoridaceae. Piperaceae, national beverage Kava in Polynesia. The like Saururaceae, are also monophyletic leaves (‘Paan’ leaves) of P. betle (betel-vine) (Tucker et al., 1993). Peperomia is are used as masticatory in East Africa, India considered to be the most derived member and Indonesia. Some species of Peperomia (P. of the family with numerous apomorphies caperata, P. hederaefolia, P. magnoliaefolia) are such as single carpel, monothecous grown as ornamental foliage plants. anthers, unitegmic ovule, inaperturate Phylogeny: Piperaceae, together with pollen grains and succulent leaves, and is Saururaceae, constitute a monophyletic often removed to a distinct family group often considered as order Piperales. Peperomiaceae. Thorne (2003, 2006, 2007) Thorne had earlier (1999, 2000) placed these and Stevens (2008) place Peperomia under families under suborder Piperineae of the separate subfamily Peperomioideae, order Magnoliales, but has subsequently whereas the other 4 genera are placed (2003, 2006, 2007) shifted them under under Piperoideae.

* * * * * * * * * * * Major Families of Angiosperms 439

Subclass 3. Alismatidae (B) Superorder 1. Acoranae (A) Order 1. Alismatales 1. Butomaceae Order 1. Petrosaviales (B) 2. Limnocharitaceae Family 1.Petrosaviaceae 3. Alismataceae 2. Nartheciales (B) 4. Hydrocharitaceae 1.Tofieldiaceae (B) 2. Potamogetonales 2. Nartheciaceae (B) 1. Aponogetonaceae 2. Scheuchzeriaceae 3. Acorales 3. Posidoniaceae 1. Acoraceae 4. Cymodoceaceae Superorder 2. Aranae 5. Ruppiaceae 6. Juncaginaceae

Order 1. Arales 7. Potamogetonaceae 1. Araceae 8. Zosteraceae Superorder 3. Alismatanae 9. Zannichelliaceae

Acoraceae Martynov Acorus family 1 genus, 2 species North temperate region, Paleotropical. Frigid zone, temperate, and subtropical. Celebes and New Guinea, Eastern Asia to Norway approaching the Arctic circle, Central and Western North America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Aridae Liliidae Alismatidae Series+/Superorder Nudiflorae+ Aranae Aranae Acoranae Monocots* Order Arales Acorales Arales Acorales Acorales B & H under family Aroideae

Salient features: Marshy herbs with rhi- Description: Aromatic perennial marshy zomes, lacking oxalate crystals, inflores- herbs with rhizomes, bearing essential oils, cence a spadix without spathe, flowers root xylem with vessels with scalariform end- small, bisexual, tepals 6 in two whorls, sta- walls. Leaves alternate, distichous, flat, mens in two whorls, carpels 3, united, fruit sessile, sheathing, entire, parallel-veined, a berry. mesophyll with spherical etherial oil cells, lacking calcium oxalate crystals. Inflores- Major genera: Single genus Acorus with 2 cence scapigerous, spadix without spathe. species. Flowers ebracteate, small, bisexual, 440 Plant Systematics

Figure 13.16 Acoraceae. Acorus calamus. A: Rhizome with basal leaves; B: Spadix with subtending leaf; C: Flower; D: Gynoecium; E: Transverse section of ovary; F: Longitudinal section of ovary; G: Stamen. regular, 3-merous, cyclic. Perianth with 6 Gymnostachys. Grayum (1987) justified tepals, free, in two whorls, concave or hooded, removal of Acorus from Araceae, and this has similar, membranous. Androecium with 6 been followed in all recent classifications. stamens, free, in two whorls, anthers Whereas Dahlgren and Cronquist included the basifixed, dehiscence by longitudinal slits, family under the order Arales, Takhtajan and introrse, tapetum glandular, pollen grains Thorne took it under a separate order Acorales. monosulcate to sub-ulcerate. Gynoecium Thorne (1999) removed the order from Aranae with 3, rarely 2 or 4 carpels, united, ovary and placed it under Acoranae, along with or- superior, 3-locular (rarely with 2 or 4 der Nartheciales. He has now (2003, 2006, locules), placentation axile, ovules 2–4(–5) 2007) added Petrosaviales (family Petrosavia- per locule, pendulous, orthotropous, ceae; regarded unplaced in monocots in APG bitegmic. Fruit fleshy, berry; seeds II ) to Acoranae. Subsequent molecular analy- endospermic, perisperm present, cotyledon ses portray it, alone or with Gymnostachys, as 1, no double fertilization. the sister group of all other Monocotyledons. The rooting of Acoraceae as sister group of Economic importance: ‘Oleum calami’ is monocots is also supported by the studies of distilled from the rhizomes of A. calamus, for Chase et al., (2000), Soltis et al., (2000) and use in perfumery and medicine. Fuse & Tamura (2000), based on multigene analyses. APG II and APweb, accordingly place Phylogeny: The genus was earlier included Acoraceae under a separate order Acorales at under family Araceae. Hutchinson (1973) the beginning of monocots. Stevens (APweb, placed it under tribe Acorae along with 2008), has also recognized Petrosaviales.

* * * * * * * * * * * Major Families of Angiosperms 441 Araceae A. L. de Jussieu Arum family 109 genera, 2,755 species Throughout world but mainly in tropical and subtropical regions, very common in tropical forests and wetlands, a few species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Aridae Liliidae Alismatidae Series+/Superorder Nudiflorae+ Aranae Aranae Aranae Monocots* Order Arales Arales Arales Arales Alismatales B & H as family Aroideae

Salient features: Terrestrial erect or climb- spathe (spathe absent in Gymnostachys, ing or aquatic herbs with rhizomes or corms, Orontium). Flowers very small, sessile, very leaves often large, mucilaginous, inflores- rarely subsessile (Pedicellarum), unisexual, cence scapigerous, a spadix subtended by a or bisexual, ebracteate, often fragrant, or large spathe, flowers very small, reduced, malodorous; regular to very irregular. Peri- usually unisexual, fruit a berry or utricle. anth lacking or with 4-6 tepals (rarely 12), free or connate, usually in two whorls, green. Major genera: Anthurium (900 species), Androecium with 1 (Cryptocoryne) –6(–12) Philodendron (500), Arisaema (150), stamens, free or with connate filaments, Amorphophalus (100), Pothos (55), usually in two whorls, anthers basifixed, Dieffenbachia (40) and Syngonium (30). dehiscence by pores, longitudinal slits, or transversely, extrorse, tapetum amoeboid, Description: Terrestrial or aquatic herbs, pollen grains aperturate, or nonaperturate. sometimes epiphytic or climbing (Pothos, Gynoecium with 2-3 carpels, rarely up to 8 Syngonium), usually with rhizomes, or carpels, united, ovary superior, usually corms, sometimes free floating (Pistia), usu- unilocular, 1–5 ovuled, placentation apical, ally mucilaginous, raphide crystals of cal- or marginal, rarely mutilocular with axile cium oxalate, containing chemicals caus- placentation, ovule orthotropous or ing irritation of mouth (or temporary dumb- anatropous, bitegmic, tenuinucellate (Pistia), ness: Dieffenbachia, the dumbcane), vessels or crassinucellate. Fruit usually a berry or absent in stem and leaves, sieve-tube drupe, rarely a utricle or capsule; seeds plastids P-type, subtype II; roots with vessels endospermic, or nonendospermic, cotyledon having scalariform end-walls, rarely with 1. Pollination mainly by insects, especially velamen Leaves small to very large with beetles, flies and bees. Dispersal of berries sheathing base, alternate, spiral, or by birds and animals.. distichous, petiolate or sessile (Pistia), with parallel, pinnate or palmate venation, often Economic importance: The family furnishes cordate, or hastate, or sagittate; stipules numerous horticultural ornamentals such absent; stomata paracytic, tetracytic, as Pothos, Alocasia, Arum, Dieffenbachia, cyclocytic, or anomocytic. Inflorescence Monstera, Philodendron, Zantedeschia and scapigerous, a spadix consisting of a dense Syngonium. Epipremnum aureum (money spike subtended and enclosed by a large plant) is commonly grown as house plant. 442 Plant Systematics

Figure 13.17 Araceae. Arum maculatum. A: Plant with flowering spadix; B: Vertical section of spadix and spathe; C: Spadix; D: Gynoecium; E: Fruit cut to show seeds; F: Seed. Pistia stratiotes. G: Inflorescence; H: Vertical section of inflorescence; I: Longitudi- nal section of ovary; J: Longitudinal section of orthotropous ovule with placental hairs; K: Portion of androecium; L: Seed. Cala palustris. M: Inflorescence; N: Mature fruits; O: Transverse section of carpel.

The corms of Colocasia esculenta (taro or subclass Aridae; Dahlgren and Cronquist dasheen), Amorphophallus campanulatus (El- also includes Acoraceae under Arales). APG ephant-foot yam), Cryptosperma and II and APweb place Acoraceae under separate Xanthosoma (tanier, yautia) and fruits of order, but include Araceae along with Monstera (Mexican breadfruit) are used as several others under order Alismatales, food. Lemnaceae being merged with Araceae. The family is considered to be a fairly early Phylogeny: The family is considered to be divergent lineage within monocots and monophyletic. Hutchinson believed it had sister to remaining families (as been derived from the tribe Aspidistreae of circumscribed by APG II) of Alismatales. Liliaceae. The bisexual flowers are Thorne (2003) recognized 7 subfamilies considered to be more primitive, while those under Araceae: Gymnostachyoideae (1 with unisexual flowers to be more highly genus), Orontioideae (3 genera), Pothoideae evolved. Most recent classifications place (4 genera), Monsteroideae (12 genera), this family under the order Arales along with Lasioideae (10 genera), Calloideae (1 genus), Lemnaceae, Acoraceae having been and Aroideae (73 genera), treating removed to a separate order Acorales. Arales Lemnaceae as a distinct family. APweb has also been placed under independent (2003, 2008) also recognises 7 subfamilies superorder Aranae in these classifications but Monsteroideae is merged with (Takhtajan shifts Aranae under separate Pothoideae and Lemnoideae (based on Major Families of Angiosperms 443

Lemnaceae) included instead. Thorne (2006, on the analysis of five plastid genes did not 2007) has followed this change, and included find a clear resolution of affinities within the two additional subfamilies Philodendroideae family. However, the basal clade (27 genera) and Schismatoglottidoideae (7 (Gymostachydoideae + Orontioideae) genera), both segragates from Aroideae remains the same, and Lemnoideae are (Keating, 2003a,2003b, 2004a, 2004b), thus strongly supported as sister to the rest of the recognizing nine in all. Mayo et al., (2003) family.

* * * * * * * * * * *

Butomaceae Richard Flowering rush family 1 genus, single species Butomus umbellatus North temperate region, widespread in Asia and Europe, naturalized in tropical America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Alismatidae Alismatidae Liliidae Alismatidae Series+/Superorder Apocarpae+ Alismatanae Alismatanae Alismatanae Monocots* Order Alismatales Butomales Alismatales Alismatales Alismatales B & H under family Alismaceae

Salient features: Aquatic or marsh plants tepals, free, 2 whorled, whorls similar or with linear triquetrous leaves, inflorescence outer sepaloid and inner petaloid, outer of- scapigerous, umbellate cymes, perianth in ten tinged with green. Androecium with 9 two whorls, outer tinged green, stamens 9, stamens, 2 whorled (6+3), anthers basifixed, carpels free, fruit etaerio of follicles. dehiscence by longitudinal slits, latrorse, pol- Gynoecium Major genera: Butomus (1 species). len grains monosulcate. with 6 carpels, free or connate at base, ovary supe- Description: Aquatic or marshy plant with rior, carpel incompletely closed, style short, basal leaves, rhizomatous, secretory cavities with ventral decurrent stigmatic region, present, with latex, root xylem with vessels ovules 20–100, placentation dispersed, with simple and scalariform end-walls, stem stigma papillate. Fruit an aggregate of folli- xylem without vessels, sieve-tube plastids cles, seeds nonendospermic, embryo P-type, subtype II. Leaves emergent, alter- straight (not curved), cotyledon 1. nate, distichous, petiolate or sessile, sheathing, simple, entire, linear, tri- Economic importance: Cultivated as an or- quetrous, parallel-veined, stomata paracytic. namental. The rhizomes are edible when Inflorescence scapigerous, umbellate baked. cymes, involucral bracts three. Flowers medium-sized, on long pedicels, trimerous, Phylogeny: The genus was earlier placed regular, bisexual, cyclic. Perianth with 6 under the family Alismaceae by Bentham 444 Plant Systematics

Figure 13.18 Butomaceae. Butomus umbellatus. A: Rhizome with basal leaves; B: Umbellate cymose inflorescence with involucral bracts; C: Vertical section of flower; D: Car- pels; E: Longitudinal section of carpel showing scattered ovules; F: Stigmas; G: Seed. and Hooker. Buchenau in Engler’s ‘Das Helleboraceae, and the peculiar placentation Pflanzanreich’ (1903), recognized the family of the ovules dispersed all over the surface Butomaceae to include all members of of the carpel more ancient character than Alismaceae (this original name of the fam- found in any herbaceous dicotyledon except ily has now been replaced by Alismataceae) in Cabombaceae, which is similar in this with numerous ovules and parietal respect. Cabombaceae also have trimerous placentation. Pichon (1946) redefined the flowers and aquatic habit, and Butomaceae circumscription of these two families to shift is separated only on the basis of a single all genera with petioled leaves with ex- cotyledon and absence of endosperm. The panded blades, campylotropous ovules, and recent cladistic studies reveal this family seeds with curved embryos, to Alismaceae to be closer to Hydrocharitaceae. Accord- and retaining only genus Butomus under ing to Judd et al., (2002) Butomaceae, Butomaceae, a treatment followed in most Hydrocharitaceae and Alismataceae form of the recent publications. According to one aquatic clade of Alismatales, supported Hutchinson (1973), who retained a broader by the apomorphies of perianth differenti- circumscription of the family, the ated into sepals and petals, stamens more gynoecium of Butomaceae represents prob- than six and carpels more than three, and ably the most ancient type of the the ovules scattered over the inner sur- monocotyledons, the free carpels recalling face of locules.

* * * * * * * * * * * Major Families of Angiosperms 445 Alismataceae Ventenat Water Plantain family 13 genera, 80 species (excluding Limnocharitaceae) Throughout world, plants of fresh water marshes, swamps, lakes, rivers and streams. Majority of the species found in the New World.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Alismatidae Alismatidae Liliidae Alismatidae Series+/Superorder Apocarpae+ Alismatanae Alismatanae Alismatanae Monocots* Order Alismatales Alismatales Alismatales Alismatales Alismatales B & H as family Alismaceae

Salient features: Aquatic or marsh plants with 6 stamens, rarely more with branched with laticifers, leaves petiolate with well- outer stamens, free, anthers bithecous, developed blade, inflorescence scapigerous, dehiscence by longitudinal slits, extrorse, perianth in two whorls, differentiated into pollen grains usually 2–3 aperturate. sepals and petals, stamens 6 to many, car- Gynoecium with 3 carpels, rarely more, free, pels 6 to many, free, ovule usually one per ovary superior, 1 ovuled, placentation ba- carpel, fruit an etaerio of achenes, embryo sal, ovule anatropous, or amphitropous. curved. Fruit etaerio of achenes, seeds nonendospermic, cotyledon 1, embryo Major genera: Echinodorus (35 species), strongly curved. Sagittaria (25), Alisma (9) and Burnatia (3). Economic importance: Sagittaria sagittifolia Description: Aquatic or marshy plant with (arrowhead) is cultivated in China and Ja- basal leaves, rhizomatous, laticifers present pan for its edible corms. Several species of with white latex, root xylem with vessels Sagittaria, Alisma (water plantain), and having scalariform to simple end-walls, ves- Echinodorus (bur-heads) are cultivated as sels absent in stem and leaves. Leaves sub- poolside plants and used as aquarium plants. merged and emergent, often heterophyllous, alternate, petiolate or sessile, sheathing, Phylogeny: The family has been redefined simple, pinnately, palmately, or parallel- (Pichon, 1946) to shift all genera with veined, stomata paracytic or tetracytic, ax- laticifers, petioled leaves with expanded illary scales present. Inflorescence blades, campylotropous ovules, and seeds scapigerous, paniculate, ultimate branches with curved embryos, including several gen- cymose or racemose, sometimes umbellate era formerly included under Butomaceae. or even solitary, with or without involucral According to Judd et al., (2002) Butomaceae, bracts. Flowers bracteate, bisexual or uni- Hydrocharitaceae and Alismataceae form sexual and monoecious, or dioecious one aquatic clade of Alismatales, supported (Burnatia), regular, trimerous, cyclic. Peri- by the apomorphies of perianth differenti- anth differentiated into calyx and corolla. ated into sepals and petals, stamens more Sepals 3, free, imbricate. Petals 3, free, than six and carpels more than three, and white, red, or pink. Androecium usually the ovules scattered over the inner surface 446 Plant Systematics

Figure 13.19 Alismataceae. Alisma plantago-aquatica. A: Basal part of plant with leaves; B: Inflo- rescence; C: Flower; D: Outer tepal; E: Inner tepal; F: Achene. Sagittaria sagittifolia. G: Plant with sagittate leaves and basal part of scape; H: Inflorescence; I: Male flower with petals removed; J: Petal; K: Stamens in different views; L: Achene; M: Carpel.(After Sharma and Kachroo, Fl. Jammu, vol. 2, 1983) of locules. The genera with achenes from ancestral condition of six stamens in (Sagittaria, Alisma, Echinodorus, etc.) may two whorls. According to Hutchinson (1973) form a monophyletic group (Chase et al., the family reminds of Ranunculaceae and 1993). The family is often regarded as primi- but for solitary cotyledon and lack of tive due to numerous stamens and carpels. endosperm, the genus Ranalisma might be The developmental and anatomical studies well be placed in Ranunculaceae. According have, however, indicated that these numer- to Soros & Les (2002) Echinodorus is ous stamens are due to secondary increase, polyphyletic and evidently needs splitting.

* * * * * * * * * * * Major Families of Angiosperms 447

Hydrocharitaceae A. L. de Jussieu Tape Grass family 18 genera, 110 species Throughout the world, mostly tropical and subtropical regions in fresh water and marine habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Alismatidae Alismatidae Liliidae Alismatidae Series+/Superorder Microspermae+ Alismatanae Alismatanae Alismatanae Monocots* Order Hydrocharitales Hydrocharitales Alismatales Alismatales Alismatales B & H as family Hydrocharideae

Salient features: Aquatic fresh water or with connate filaments, anthers bithecous, marine herbs, leaves submerged, usually dehiscence by longitudinal slits, innermost ribbon-like, flowers subtended by paired times modified into staminodes which of- bracts, male flowers often detaching and ten act as sails (Lagarosiphon), pollen grains floating on water, carpels united, ovary in- monosulcate or inaperturate, sometimes ferior with many scattered ovules, fruit a united into thread-like chains (Thalassia, capsule or berry. Halophila). Gynoecium with 3-6 (rarely 15), connate carpels, single in Najas, ovary in- Major genera: Ottelia (32 species), Najas (32), ferior, unilocular, ovules many (1 in Najas), Elodea (12), Vallisneria (8), Hydrocharis (6), scattered over the surface, placentae often Halophila (4) and Hydrilla (1). deeply intruded, styles often divided and twice the number of carpels, stigmas elon- Description: Aquatic herbs, submerged or gate and papillose. Fruit fleshy berry or dry partly emergent, rooted in mud or unat- capsule rupturing irregularly, nut in Najas; tached, in freshwater and marine habitats, seeds without endosperm, embryo straight, annual or perennial. Leaves alternate cotyledon 1. Pollination in some (Vallisneria, (Nechamandra), opposite (Elodea some spe- Enhalus) by water, in others (Egeria, cies) or whorled (Hydrilla, Lagarosiphon), in Limnobium) by insects. Dispersal by water basal rosettes or cauline, simple, entire or or animals. serrate, with parallel or palmate venation, sheathing at base, small scales, at nodes Economic importance: Species of many gen- inner to leaf base, stipules absent. Inflo- era (Hydrilla, Vallisneria, Elodea, Egeria, etc.) rescence with solitary flower (female) or are used as aquarium plants. Some species short cymes (usually male), subtended by like Hydrilla verticillata, Elodea canadensis two often connate bracts. Flowers bisexual have become troublesome weeds in many or unisexual, male flowers often discon- parts of the world. nected and floating on water surface (Vallisneria, Enhalus, Lagarosiphon). Peri- Phylogeny: The family, along with anth often with distinct sepals and petals. Butomaceae and Alismataceae, forms a well- Sepals 3, free, valvate, green. Petals 3, free, defined clade, as indicated by cladistic usually white, imbricate, sometimes lack- analysis. Although monophyletic (Dahlgren ing (Thalassia, Halophila). Androecium with and Rasmussen, 1983), the family is mor- 2 to 3 stamens, rarely more (Egeria), free phologically heterogenous and divided into 448 Plant Systematics

Figure 13.20 Hydrocharitaceae. Vallisneria spiralis. A: Plant with creeping stem, strap-shaped leaves and female flowers on coiled long pedicels; B: Male flower which detaches and floats on water; C: Female flower; D: Vertical section of female flower; E: Male inflorescence subtended by two connate bracts; F: Transverse section of ovary with parietal placentation. Ottelia cordata. G: Plant with leaves and emerging flower bud; H: Male inflorescence with spathe opened out; I: Female flower; J: Male flower with perianth removed, showing stamens and pistillodes; K: Transverse section of ovary.

3 (Hutchinson, 1973; Thorne, 2003: Hydrocharitaceae by Thorne, APG II and Hydrocharitoideae, Thalassioideae and APweb. It is possible Najas may be sister to Halophiloideae) to 5 subfamilies (Dahlgren the rest of Hydrocharitaceae, in which case et al., 1985). Les et al., (1997) concluded that it may probably be recognized as a separate the family forms a well-defined lineage. family. APweb recognises 7 well defined Tanaka et al., (1997) suggest a series of quite groups (lineages) within Hydrocharitaceae well-supported nodes based on analysis of as established by the studies of Les et al., variation in two genes, the ultimate group- (1997). Thorne (2006, 2007) has revised the ings recognized are similar to those of Les classification of the family recognising 4 sub- et al. (1997). The family Najadaceae, though families: Hydrocharitoideae (2 genera), distinct with single carpel, single ovule and Stratiotoideae (1 genus), Anacharidoideae superior ovary, has been included in (7 genera) and Hydrilloideae (8 genera).

* * * * * * * * * * * Major Families of Angiosperms 449 Potamogetonaceae Dumortier Pondweed family 3 genera, 90 species (Excluding Ruppiaceae) Throughout world, in ponds, ditches and lakes.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Alismatidae Alismatidae Liliidae Alismatidae Series+/Superorder Apocarpae+ Alismatanae Alismatanae Alismatanae Monocots* Order Najadales Potamogetonales Najadales Potamogetonales Alismatales B & H under family Naiadaceae

Figure 13.21 Potamogetonaceae. Potamogeton perfoliatus. H: Plant with flowering and fruiting inflorescences; B: Leaves; C: Flower; D: Tepal with attached stamen; E: Carpel; F: Anther in two different views; G: Fruit; H: Seed enclosed in hard endocarp; I: Seed. (After Sharma and Kachroo, Fl. Jammu, vol. 2, 1983).

Salient features: Aquatic herbs, leaves sub- Major genera: Potamogeton (83 species), merged as well as floating, flowers usually Coleogeton (6) and Groelandia (1). in spikes, bisexual, perianth with 4 free tepals, stamens 1-4, carpels 4, free, fruit Description: Perennial or rarely annual etaerio of achenes. fresh water herbs with rhizomes, stems 450 Plant Systematics mostly submerged, with reduced vascular Phylogeny: The affinities of the family are bundles in a ring, with air cavities, tannins not clear. The family is sometimes also in- often present, root xylem with vessels hav- terpreted to include Ruppia and/or ing scalariform end-walls, stem without ves- Zannichelia. The studies of Les et al., (1997) sels, sieve-tube plastids P-type, subtype PII. however, have shown that Zannichelia is Leaves submerged as well as floating, rather weakly embedded in the family, and sheathing at the base, alternate or opposite the inclusion of Ruppia makes family (Groenlandia), simple, entire, venation par- biphyletic. Potamogeton itself is considered allel, submerged leaves thin, without cuti- para- or polyphyletic (Les and Haynes cle and stomata, floating leaves thick, small 1995). Uhl (1947) had earlier supported the scales present at nodes inner to the leaf segregation of Zannichelia into separate sheath. Inflorescence terminal or axillary family by Hutchinson (1934). The tepals are spike, often carried on a long peduncle, often interpreted variously. Uhl suggested raised above water surface, peduncle sur- that so-called perianth parts are in fact in- rounded by sheath at base. Flowers dividual bracts, subtending and adnate to ebracteate, regular, bisexual, hypogynous, stamens and the flower is fundamentally cyclic. Perianth with 4 tepal (often inter- an inflorescence with staminate flowers preted as appendages from connective of the (each represented by a monbracteate peri- anthers and thus perianth absent), free, anth) and naked female flowers, the view fleshy, usually clawed. Androecium with 4 first proposed by Kunth (1841) and sup- stamens, free, adnate to and opposite each ported by Miki (1937). Most of the authors tepal, anther sessile, dehiscence by longi- (Rendle, 1925; Watson and Dallwitz, 2000; tudinal slits, pollen grains globose, Judd et al., 2008) consider tepals to repre- inaperturate. Gynoecium with 4 free carpels, sent appendages from the connective of the ovary superior with basal to apical anther. As per Hutchinson (1973), these placentation, ovule 1, campylotropous, are normal perianth-segments on claws of bitegmic, crassinucellate, style short or which the extrorse anthers are sessile, a lacking, truncate to capitate. Fruit an view also supported by Heywood (1978) and etaerio of achenes or drupes, seeds Woodland (1991). Hutchinson stressed that nonendospermic, with starch, cotyledon 1, in the petaloid monocotyledons the sta- embryo slightly curved. Pollination by wind, mens are always opposite the perianth- dispersal by water or animals. segments, and it is not a great step for those species of Aponogeton with more than Economic importance: The family is of lit- one perianth-segment to Potamogeton. If the tle economic importance but biologically an anther were introrse in Potamogeton, then important source of food for aquatic life. the petal-like organ might be regarded as Many species of Potamogeton are trouble- an outgrowth from the base of the connec- some weeds. Fleshy starchy rootstocks are tive, a very unusual feature indeed in any sometimes used as food. flowering plant.

* * * * * * * * * * * Major Families of Angiosperms 451

2. Asteliaceae Subclass 4. Liliidae 3. Hypoxidaceae (B) Superorder 1. Pandananae 4. Lanariaceae Order 1. Pandanales 5. Blandfordiaceae 6. Orchidaceae Family 1. Velloziaceae 3. Iridales 2. Acanthochlamydaceae (B) Suborder 1. Iridineae 3. Pandanaceae 1. Doryanthaceae 4. Cyclanthaceae 2. Tecophilaeaceae (B) 5. Pentastemonaceae 3. Ixioliriaceae 6. Stemonaceae 4. Iridaceae 7. Triuridaceae 2. Asphodelineae (B) Superorder 2. Dioscoreanae (B) 1. Xanthorrhoeaceae Order 1. Dioscoreales (B) 2. Xeronemaceae (B) 1. Dioscoreaceae 3. Asphodelaceae (B) 2. Burmanniaceae 4. Hemerocallidaceae (B) 3. Thismiaceae (B) 5. Johnsoniaceae Superorder 3. Lilianae (B) 3. Hyacinthineae Order 1. Liliales (B) 1. Anthericaceae (B) 1. Corsiaceae (B 2. Alliaceae 2. Campynemataceae 3. Hyacinthaceae 3. Melanthiaceae 4. Themidaceae 4. Trilliaceae 5. Behniaceae (B) 5. Petermanniaceae (B) 6. Anemarrhenaceae (B) 6. Luzuriagaceae (B) 7. Herreriaceae (B) 7. Alstroemeriaceae (B) 8. Agavaceae 8. Colchicaceae (B) 4. Asparagineae 9. Riponogaceae 1. Aphyllanthaceae 10. Philesiaceae (B) 2. Laxmanniaceae 11. Smilacaceae 3. Asparagaceae 12. Liliaceae 4. Dracaenaceae 5. Nolinaceae 2. Orchidales (B) 6. Eriospermaceae 1. Boryaceae (B)

Pandanaceae R. Brown Screw pine family 4 genera, 910 species Throughout tropics and subtropics of the Old World, mostly in coastal and marshy areas.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Aridae Liliidae Liliidae Series+/Superorder Nudiflorae+ Pandananae Pandananae Pandananae Monocots* Order Pandanales Pandanales Pandanales Pandanales Pandanales 452 Plant Systematics

Figure 13.22 Pandanaceae. Pandanus ceylonicus. A: Plant with leaves and female inflorescence; B: Portion of leaf showing marginal prickles; C: Male inflorescence; D: Male flower with apiculate anthers; E: Female spadix split to show arrangement of flowers; F: Female flower with curved style; G: Longitudinal section of female flower; H: Drupe tipped by persistent style; I: Seed.(After Dassanayake, Fl. Ceylone, vol. 3, 1981).

Salient features: Large shrubs, trees or scalariform end-walls. Leaves forming climbers with annual scars of leaf bases, terminal crown, 3-ranked or 4-ranked, bearing aerial roots, leaves 3-ranked, stiff, sometimes appearing spirally arranged due inflorescence a spadix with unisexual flow- to twisting of stem, long, narrow, usually stiff ers, flowers naked, male flowers with many or sword-like, sheathing at base, keeled, stamens, carpels many, free or united, fruit often spinose along margin and keel, a berry or multilocular drupe, often aggre- sometimes even grass-like. Inflore- gated into a cone appearing like pineapple. scence a spadix subtended by a brightly coloured spathe, and usually containing Major genera: Pandanus (750 species), one type of flowers, male and female flowers Freycinetia (123) and Sararanga (2). being borne on separate plants (plants dioecious), spadix lacking in Sararanga Description: Trees, shrubs or climbing and inflorescence paniculate. Flowers perennials (Freycinetia), supported by aerial sessile, pedicellate in Sararanga, uni- roots, roots often penetrating supporting host sexual, without perianth, hypogynous. (Freycinetia) or even absent (Sararanga), Perianth absent or vestigial, sometimes trunk bearing annual scars of leaf bases, forming a short cupule (Sararanga). stem and leaves also with xylem with Androecium in male flower with numerous Major Families of Angiosperms 453 stamens, filaments free or connate, anthers poutpourris. Freycinetia banksii and erect, bithecous, basifixed, dehiscence by Pandanus veitchii are used as ornamentals. longitudinal slits, staminodes often present (Freycinetia) in female flower. Gynoecium in Phylogeny: Pandanaceae forms a well de- female flower with many carpels, free or fined clade included under Pandanales connate, ovary superior, unilocular (if car- either singly (Thorne, Takhtajan, Dahlgren pels free) or multilocular (if united), ovules 1 and Cronquist, Hutchinson), or together with (Pandanus) to many (Freycinetia), anatropous, Cyclan-thaceae, Stemonaceae Velloziaceae, style short or absent, stigma nearly sessile, and Triuridaceae (APG II, APweb). The posi- rudimentary ovary often present in male tion of Cyclanthaceae does not show much flower. Fruit a berry or multilocular drupe, departure as it has often been placed in the often aggregated to form oblong or globose adjacent order. The placement of Triurida- syncarps resembling a pineapple; seeds ceae within Pandanales is, however, inter- small with fleshy endosperm and minute esting. Takhtajan places it under a separate embryo. subclass, Cronquist under Alismatidae, and Dahlgren under separate superorder Triurid- Economic importance: Several species of anae. The placement of this family in Pandanus (screw pine) are useful sources of Pandanales is supported by the studies of 18S food. P. leram (Nicobar breadfruit) produces a rDNA (Chase et al. 2000). Thorne who had large globose fruit which is boiled in water. earlier (1999) placed Triuridaceae under Alis- Other species also yielding edible fruits in- matidae has finally (2007) shifted it under clude P. utilis and P. andamanensium. The Liliidae—> Pandananae —>Pananales, not leaves of P. odoratissimus are used for thatch- recognizing superorder Triuridanae. He has ing and weaving. Fibres made from aerial also made a major change in shifting Pand- roots are used for cordages and brushes. The ananae to the beginning of Liliidae. He had flowers of this species are used for popular earlier placed it towards the end of the sub- Indian essence Kewra. The fragrant leaves class. Thorne (2003, 2007) recognizes two sub- of P. odorus in Malaya are used in families Pandanoideae and Freycinetioideae.

* * * * * * * * * * *

Dioscoreaceae R. Brown Yam family 4 genera, 400 species Mainly tropical and subtropical, few in the temperate region.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Woody or herbaceous late, inflorescence axillary racemes, spikes climbers, leaves alternate, cordate, petiole or umbels, flowers unisexual, fruit a capsule, with pulvinus at both ends, venation reticu- seeds winged. 454 Plant Systematics

Figure 13.23 Dioscoreaceae. Dioscorea esculenta. A: Male plant with alternate leaves; B: Male flower; C: Male flower opened. D. oppositifolia. D: Male plant with opposite leaves and flowers; E: Female plant with fruits.

Major genera: Dioscorea (375 species), palmate, reticulate, stomata anomocytic, leaf Rajania (20) and Tamana (5). axils often with bulbils. Inflorescence axillary panicles, racemes or spikes, flowers ar- Description: Perennial herbaceous or woody ranged singly or in 2-3 flowered clusters. Flow- climbers with tubers or rhizomes, a few dwarf ers usually unisexual (plants dioecious), shrubs, usually twining over the support, small, sessile or rarely pedicellate, stem with vascular bundles in one or two actinomorphic. Perianth with 6 tepals, in two rings. Leaves usually alternate, sometimes whorls, free or connate at base into tube. opposite (Dioscorea alata) simple, cordate, Androecium with 6 stamens, in two whorls, sometimes palmately lobed or compound (D. attached to the base of perianth, 3 sometimes pentaphylla), petiolate, petiole with pulvinus reduced to staminodes, filaments free or both at base and above, sometimes with stip- slightly connate, anthers bithecous, connec- ule like flanges on both sides, sometimes tive sometimes broad; pollen grains with superficial or internal glands contain- monosulcate or variously porate. Gynoecium ing nitrogen fixing bacteria, venation with 3 carpels, united, ovary inferior, Major Families of Angiosperms 455 trilocular with axile placentation, ovules related families under Dioscoreales. 2 (rarely many) in each locule, styles 3, free Cronquist had earlier included it under or connate. Fruit a 3-valved capsule or broadly circumscribed Liliales. The circum- berry, rarely samara; seeds usually flattened scription of Dioscoreales has been narrowed and winged, with endosperm and small em- in APG II and APweb to include only bryo, often with second scaly cotyledon, seed Nartheciaceae, Dioscoreaceae and coat with yellow-brown to red pigments, and Burmanniaceae, shifting Smilacaceae and crystals. Trilliaceae (latter under Melanthiaceae) to Liliales and Stemonaceae to Pandanales, but Economic importance: Many species of have merged Taccaceae, Stenomeridaceae Dioscorea are cultivated for starchy tubers and Trichopodaceae with Dioscoreaceae (both (Yam). Some species are source of diosgenin, regarded as distinct families by Thorne). The a steroidal sapogenin developed in recent narrowly circumscribed Dioscoreales is years for its use in oral contraceptives. monophyletic as supported by morphological and rbcL sequence evidence (Chase et al., Phylogeny: The family is often placed under 1995), although the Placement of order Dioscoreales. Dahlgren (1985) also in- Nartheciaceae received poor support in the cluded Smilacaceae and Trilliaceae and con- recent studies of Chase et al. (2000) and sidered Dioscoreales to represent primitive Caddick et al., (2002a, 2002b). Thorne who monocots. The primitive position of the or- had earlier (1999, 2000) placed Taccales af- der (also advocated by Stevenson and Loconte, ter Liliales under Lilianae, removed (2003) 1995), is not supported by cladistic analysis under distinct superorder Taccanae placed based on rbcL sequence and morphological before Lilianae, but after Pandananae, which data (Chase et al., 1995). Thorne has included has been shifted to the beginning of Liliidae. Dioscoreaceae along with Taccaceae under In 2006, 2007 he has preferred the name order Taccales, whereas Takhtajan took Dioscoreanae for Taccanae and Dioscoreales Taccaceae under monotypic order Taccales, for Taccales, as he has merged Taccaceae keeping Dioscoreaceae along with closely and Stenomeridaceae with Dioscoreaceae.

* * * * * * * * * * *

Smilacaceae Ventenat Catbrier family 3 genera, 320 species Mainly tropical and subtropical, extending into the temperate region.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Figure 13.24 Smilacaceae. Smilax aspera. A: Portion of plant with leaves, stipule tendrils and inflorescence; B: Male flower; C: Tepal with stamen; D: Female flower; E: Trans- verse section of ovary; F: Infrutescence with berries.

Salient features: Woody or herbaceous Perianth with 6 tepals, equal or subequal, climbers, climbing by stipular tendrils, stems in two whorls, free or united into a tube sometimes prickly, leaves alternate, vena- (Heterosmilax). Androecium with 6 stamens tion reticulate, inflorescence axillary ra- (rarely 3 or 9), free or united, anthers cemes, spikes or umbels, flowers unisexual, monothecous due to confluence of two fruit 1-3 seeded berry. locules, introrse, pollen grains inaperturate or monosulcate, staminodes present in Major genera: Smilax (300 species), female flower. Gynoecium with 3 united Heterosmilax (13) and Rhipogonum (7) carpels, ovary superior, 3-locular, 1-2 ovules in each locule, placentation axile, ovules Description: Herbaceous or woody climbers pendulous, orthotropous or semianatropous, with paired stipular tendrils, stem prickly, stigmas 3. Fruit a berry with 1-3 seeds, with underground rhizomes or tubers. embryo small, endosperm hard. Pollination Leaves alternate or opposite, mostly leath- by insects, dispersal of fruits by birds. ery, petiolate, 3-veined, stipules (or leaf sheath) developing into tendrils (Smilax), ve- Economic importance: Several species of nation reticulate. Inflorescence axillary Smilax are the source of sarsaparilla, used raceme, spike or cyme. Flowers small, uni- for treating rheumatism, and other sexual (plants dioecious) or bisexual (Rhipo- ailments. The dried rhizomes of Smilax china gonum), regular, hypogynous, trimerous. (China root) yield an extract used as a Major Families of Angiosperms 457

Figure 13.25 Amborellaceae. Amborella trichopoda. A: Plant; B: Flower. Cloranthaceae. C: Chloranthus glaber plant in flower. Calycanthaceae. D: Calycanthus occidentalis, plant in flower. Nymphaeaceae. E: Nuphar polysepala, plant; F: Flower of N. lutea; G: Nymphaea odorata, plant in flower; H: Flower enlarged. 458 Plant Systematics

Figure 13.26 Magnoliaceae. Magnolia grandiflora A: Tree in flower; B: Flower; C: Fruit; D: Leaf of Liriodendron chinense. Degeneriaceae. Degeneria vitiensis E: Plant; F: Fruit; G: Flower. Lauraceae. H: Laurus nobilis plant in flower; I: Plant of Neolitsea sericea. Major Families of Angiosperms 459

Figure 13.27 Araceae. A: Amorphophallus titanum, unopened inflorescence; B: Part of fruiting inflorescence; C: Epipremnum aureum, plant; D: Anthurium andreanum, inflorescence. Alismataceae. E: Sagittaria sagittifolia, plant. Hydrocharitaceae. F: Hydrilla verticillata, plant. Liliaceae. G: Tulipa cultivar, flower; H: Stamens and pistil enlarged; I: Lilium longiflorum, plant in flower; J: Flower enlarged. 460 Plant Systematics

Figure 13:28 Iridaceae. A: Dietes grandiflora plant; B: Flower enlarged; C: Iris germanica, flower. Asphodelaceae. D: Kniphofia thomsoni, plant; E: Part of inflorescence.; F: Asphodelus fistulosus, plant; G: Flower and fruit; Alliaceae. H: Clivia chrysanthifolia, plant; I: Part of inflorescence; J: Allium cepa, plant; K: Inflorescence enlarged; L: Agapanthus praecox, inflorescence; M: Basal part with leaves and scapes. Major Families of Angiosperms 461

Figure 13:29 Hyacinthaceae. Eucomis autumnalis plant with inflorescence; B: E. bicolor, inflorescence. Agavaceae. C: Yucca rupicola, plant with inflorescence; D: Part of inflorescence; E: Agave parrii, plant; F: A. wightii, inflorescence. Asparagaceae. G: Ophiopogon planiscaposus, plant; H: Ruscus aculeatus, plant; I: Flower; J: Asparagus racemosus, fruit. Nolinaceae. K: Nolina recurvata, swollen base; L: N. nelsoni, plant. 462 Plant Systematics

Figure 13:30 Arecaceae. A: Roystonea regia, plant; B: Trunk with leaf scars; C: Parajubaea coccoides, portion of plant with fruits; D: Caryota urens, plant; E: Inflorescence; F: Part in Fruit. Musaceae. G: Musa paradisiaca subsp. sapientum, plant with inflorescenc; H: Inflorescence with fruits. Commelinaceae. I: Tradescantia spathacea, plant; J: Tradescantia pallida, plant; K: Flower. Cyperaceae. L: Cyperus alternifolius, plant; M: Part of spike enlaged; N: Scirpoides holoschoenus, plant. Poaceae. O: Triticum aestivum, plant; P: Spike; Q: Portion of spike of Pennisetum glaucum; R: Avena sativa, plant with inflorescence; S: Zea mays, male inflorescence. Major Families of Angiosperms 463

Figure 13:31 Paeoniaceae. A: Paeonia suffruticosa, plant. Berberidaceae. B: Nandina domestica, flowering branch; C: Branch with fruits. Papaveraceae. D: Bocconia glaucifolia, plant; E: Flower; F: Papaver orientale, plant; G: Flower; H: Romneya coulteri, portion of plant; I: Stamens and stigma. 464 Plant Systematics

Figure 13:32 Ranunculaceae. A: Anemone occidentalis, plant; B: Fruit; C: Cimicifuga heracleifolia, plant; D: Clematis viticella, plant; E: Central part of flower. F: Caltha leptosepala, plant; G: Thalictrum polyganum, plant; H: Consolida ajacis; I: Flower; J: Ranunculus muricatus, plant; K: Flower; L: R. sceleratus, flower; M: Plant; N: Helleborus argutifolius, plant; O: H. orientalis, flower. P: Nigella damascena, plant. Major Families of Angiosperms 465

Figure 13.33 Grossulariaceae. A: Ribes menziesii var. leptosmum, plant with fruits; B: Fruit. C: Ribes sanguineum var glutinosum, fruit. Fagaceae. D: Cyclobalanopsis glauca, portion of trunk; E: Vegetative branches. F: Lithocarpus densiflorus, plant in flower. Nothofagaceae. G: Nothofagus obliqua, plant with fruits. Betulaceae. Betula utilis. H: Bark; I: Branch with Fruit; J: Fruiting inflorescence; Branch of Corylus colurna. 466 Plant Systematics

Figure 13.34 Portulacaceae. A: Portulacaria afra, plant. Cactaceae. B: Mammillaria densispina, plant; C: Echinopsis terscheckii, plant; D: Portion of stem. Nyctaginaceae. E: Bouga- invillea glabra, plant; F: flower enclosed in showy bracts; G: Mirabilis jalapa, plant; H: Flower. Aizoaceae. I: Mesembryanthemum criniflorum, plant; J: Flower. Major Families of Angiosperms 467

Figure 13.35 Chenopodiaceae. A: Chenopodium album, plant; B: Flower cluster. Amaranthaceae. C: Amaranthus caudatus, plant with inflorescence; D: Flower cluster; E: Celosia cristata, inflorescence. Caryophyllaceae. F: Stellaria media, plant; G: Flower; H: Dianthus barbatus, plant; I: Part of inflorescence. Polygonaceae. J: Rumex hymenosepalus, plant. K: Eriogonum latifolium, plant; L: Flower cluster; M: Polygonum davisae, portion of plant; 468 Plant Systematics

Figure 13.36 Celastraceae. A: Euonymus grandiflorus, plant; B: Flowers. Violaceae. C: Viola tricolor, plant; D: Flower. Cucurbitaceae. E: Luffa cylindrica, plant; F: Female flower; G: Young fruit. Begoniaceae. H: Begonia foliosa, plant; I: B. sempervirens, flower; J: Begonia ‘Gene Daniels’, flowers. Major Families of Angiosperms 469

Figure 13.37 Clusiaceae. A: Hypericum androsaemum, plant; B: H. monogynum, plant; C: Hyperi- cum sp. , flower; Euphorbiaceae. D: Jatropha panduraefolia, plant; E: Female flower with fruit F: Male flowers G: Ricinus communis, plant; H: Male Flower I: Female flower; J: Euphorbia milii, plant; K: Cyathia with showy bracts; L: E. pulcherrima, plant; M: Phyllanthus emblica, branch in flower; Oxalidaceae. N: Oxalis spiralis, plant; O: Flower. 470 Plant Systematics

Figure 13.38 Geraniaceae. A: Pelargonium zonale, plant; B: Flower. Rosaceae. C: Prunus campanulata, plant; D: Chaenomeles vilmoriana, plant; E: Flower; F: Cotoneaster microphyllus, fruit; G: Fragaria vesca, plant; H: Flower; I: Potentilla fruticosa, plant; J: Rubus trifidus, flower Major Families of Angiosperms 471

Figure 13.39 Fabaceae. A: Lupinus arboreus, plant; B: Clitoria ternatea, flower; C: Parkinsonia aculeata, plant; D: Poinciana pulcherrima, plant; E: Flower; F: Saraca asoka, plant with inflorescence; G: Senna candolleana, plant; H: Flower; I: Calliandra haematocephala, plant; J: Fruit; K: Leucaena leucocephata, plant; L: Fruits. 472 Plant Systematics

Figure 13.40 Myrtaceae. A: Lophostemon confertus, plant; B: Flower; C: Myrceugenella apiculata, branch; D: Metrosideros excelsa, inflorescence; Lythraceae E: Cuphea sp, flowering branch; F: Flower; G: Lagerstroemia speciosa, flowering twig. Onagraceae. H: Fuchsia hatschbachii, flowering branch; I: Flower; J: Fuchsia microphylla, flower. Major Families of Angiosperms 473 stimulant. Young stems and berries are ment under Liliales (Cronquist, 1988; Thorn; sometimes used as food. APG II; APweb). Cronquist also included genera Luzuriaga, Petermannia and Philesia un- Phylogeny: Earlier included under Family der the family Smilacaceae, but according to Liliaceae (Bentham and Hooker; Engler and Chase et al., their inclusion makes Prantl), it was separated as a distinct family Smilacaceae polyphyletic. The monophyly of by Hutchinson (1934, 1973), according to the family (including only genera Smilax, whom, the members are distinct from Heterosmilax and Rhipogonum) is supported by Liliaceae in habit, dioecious flowers and con- morphological as well as molecular evidence. fluent anther loculi. He considered APG II and APweb include Rhipogonum un- Smilacaceae to be considerably advanced der a distinct family Rhipogonaceae (leaves from the general stock of the Liliaceae. opposite, pollen reticulate), whereas Judd et Dahlgren et al., (1985) considered the family al. ,(2002) include it (Ripogonum) under to be related to Dioscoreaceae and included Smilacaceae. Thorne (2003) divided the fam- it under Dioscoreales. The morphological ily into two subfamilies Smilacoideae and studies (Conran, 1989) and rbcL sequences Rhipogonoideae, latter has been elevated to (Chase et al., 1993), however, support place- a distinct family in 2006, 2007 revisions.

* * * * * * * * * * *

Liliaceae M. Adanson Lily family 15 genera, 640 species Widely distributed in the Northern Hemisphere, mainly in the temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Liliidae Liliidae Liliidae Liliidae Series+/Superorder Coronariae+ Dioscoreanae Lilianae Lilianae Monocots* Order Liliales Liliales Liliales Liliales Liliales Cronquist also included Amaryllidaceae, Asparagaceae, Alliaceae and several others under Liliaceae

Salient features: Herbs with alternate or Major genera: Fritillaria (90 species), Gagea whorled leaves, base sheathing, flowers not (80), Tulipa (80) and Lilium (75). subtended by spathaceous bracts, flowers bisexual, trimerous, perianth with 6 petaloid Description: Perennial herbs with under- tepals, stamens 6, filaments free, carpels ground bulb, generally with contractile roots. 3, united, ovary superior, placentation ax- Leaves mostly basal, alternate or whorled, ile, fruit a capsule. usually linear or strap shaped, simple, 474 Plant Systematics

Figure 13.41 Liliaceae. A: Flowering portion of Lilium polyphyllum. B: Longitudinal section of flower of L. canadense. C: Gynoecium of L. lancifolium. D: Transverse section of ovary of L. lancifolium. Gagea pseudoreticulata. E: Flower; F: Gynoecium; G: Transverse section of ovary. (A, after Polunin and Stainton, Fl. Himal., 1984) entire venation parallel, stipules absent. In- coat not black, small embryo, endosperm florescence usually racemose (Lilium), copious. Pollination by insects, especially sometimes solitary (Tulipa) or subumbellate bees, wasps, butterflies. Seeds are dispersed (Gagea). Flowers showy, bisexual, by water or wind. actinomorphic, rarely zygomorphic, trimerous, hypogynous. Perianth with 6 Economic importance: The family is impor- tepals, in two whorls (outer representing se- tant for its valuable ornamentals such as lily pals, inner petals), both whorls petaloid, of- (Lilium), tulip (Tulipa) and Fritillaria (Fritil- ten spotted or with lines, often united into lary). tube, nectary at the base of tepal. Androecium with 6 stamens, in 2 whorls, Phylogeny: The circumscription of the epiphyllous, filaments free. Gynoecium with family has undergone considerable reduction 3 carpels, united, ovary superior, trilocular over the recent years. The genera formerly with many ovules, placentation axile, styles included under the family have now been simple with 3-lobed stigma. Fruit a removed to diverse families: Colchicum loculicidal capsule, rarely a berry; seeds usu- (Colchicaceae—with corm), Trillium (Trillia- ally flat, with well-developed epidermis, seed ceae—rhizome, leaves whorled, perianth Major Families of Angiosperms 475 with sepals and petals), Allium (Alliaceae— bringing about certain changes in circum- bulb, inflorescence umbellate, with scription (Ruscaceae and Convallariaceae spathaceous bracts, smell of onion, seeds included under Asparagaceae). In 2006, 2007 black), Asphodelus and Aloe (Asphodela- revisions he has slightly enlarged the ceae—inflorescence racemose, seeds black, circumscription of family Liliaceae by leaves succulent, often with coloured sap), merging Tricyrtidaceae and Calochorta- Asparagus (Asparagaceae—fruit a berry, ceae, but has divided the family into four sub- leaves rudimentary, seeds black), Ruscus families Medeoloideae (1 genus), Lilioideae (Ruscaceae—leaves scarious, filaments (9 genera), Tricyrtidoideae (4 genera) and connate), the last four were taken under a Calochortoideae (1 genus). The narrow separate order Asparagales along with circumscription of the family was first several other families, in the recent APG II suggested by Dahlgren (1985), and forms a and APweb classifications. Thorne had monophyletic group as confirmed by the earlier (1999, 2000) included these four cladistic studies of Chase et al., (1995a, families (along with other splitters from 1995b). Cronquist, on the other hand, broad- broadly circumscribed Liliaceae) under order ened the circumscription of the family, also Orchidales, but has shifted (2003) these including, in addition to the above families, together with others to order Iridales, also large family Amaryllidaceae within Liliaceae.

* * * * * * * * * * *

Orchidaceae A. L. de Jussieu Orchid family 788 genera, 18,500 species (Second largest family after Asteraceae) Widely distributed, most common in moist tropical forests (where frequently epiphytic), also well distributed in subtropics and temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbaceous perennials, Epidendrum (800), Habeneria (580), Liparis roots with velamen, leaves distichous, flow- (320), Malaxis (280), Oberonia (280), Calanthe ers trimerous, zygomorphic, corolla with 2 (1000), Vanilla (100) and Vanda (60). lateral petals and labellum, pollen in pollinia, ovary inferior, seeds minute. Description: Perennial herbs, terrestrial (Malaxis, Orchis), epiphytic (Oberonia, Major genera: Pleorothallus (1100 species), Dendrobium) or saprophytic (Gastrodia, Bulbophyllum (970), Dendrobium (900), Epigonium), rarely climbers (Vanilla), with 476 Plant Systematics

Figure 13.42 Orchidaceae. A: Cymbidium hookeranum with leaves and flowers. B: Eria muscicola, plant with inflorescences. Oberonia recurva. C: Epiphytic plant with ensiform leaves and pendulous inflorescence; D: Flower ; E: Floral parts separated showing from above downwards bract, three sepals, two lateral petals and anterior labellum. Vanda tessellata. F: Epiphytic plant with inflorescence; G: Floral parts separated; H: Pol- linia from behind with gland and strap; I: Pollinia from front; J: Operculum from inside.(After Dassanayake and Fosberg, Fl. Ceylone, vol 2, 1981) rhizomes, tuberous roots, corms or root- duced to scales, often fleshy, simple, entire, stock, roots mycorrhizal, with multiseriate sheathing at base, sheath closed and en- epidermis of dead cells known as velamen. circling stem, venation parallel, stipules ab- Stems foliate or scapose, base often thick- sent, stomata tetracytic. Inflorescence ened to form pseudobulb, aerial roots racemose, spicate or paniculate, some- present. Leaves usually alternate, times with solitary flowers, rarely distichous, rarely opposite, sometimes re- cleistogamous. Flowers usually bisexual, Major Families of Angiosperms 477 very rarely unisexual, zygomorphic, usually Dendrobium, Cymbidium, Epidendrum, Vanda, showy, often twisted 180o during develop- Coelogyne and Brassia. The only food product ment (resupinate), Perianth differentiated from the family is vanilla flavouring obtained into sepals and petals. Sepals 3, free or from the fruits Vanilla planifolia. connate, usually petaloid, imbricate, similar or dorsal smaller, lateral more or less Phylogeny: The family is generally adnate to the ovary. Petals 3, free; middle considered as a natural group, the monophyly petal forming labellum or lip, often spotted of the family supported by morphology and and variously coloured, sometimes saccate rbcL sequences (Dressler, 1993; Dahlgren et or even spurred at base; lateral petals simi- al., 1985). The family is commonly divided lar to sepals. Androecium with usually 1 sta- into three subfamilies: Apostasioideae, men, sometimes 2 (Apostasia) or 3 Cypripedioideae, and Orchidoideae. The (Neuwiedia), adnate to style and stigma former two include one tribe each, but the forming a column (gynostemium) opposite last one, which includes nearly 99 per cent the lip, anther sessile on column, bithecous, of the orchid species is divided into 4 tribes. dehiscence by longitudinal slit, introrse; Apostasioideae are considered to be sister pollen grains powdery or waxy, agglutinated to the remaining orchids (Dressler, 1993; into pollinia, each pollinium with a sterile Cameron et al., 1999), and monophyletic as portion called caudicle, 2 to 8 pollinia supported by vessel-elements with simple formed in a flower. Gynoecium with 3 perforations and distinctive seed type. united carpels, ovary inferior, unilocular Cypripedioideae are usually considered with parietal placentation, rarely 3-locular clearly monophyletic (Judd et al., 1999) as with axile placentation (Apostasia), stigmas supported by their saccate labellum, two 3, one often transformed into a sterile ros- functional stamens and absence of pollinia. tellum, latter often having a sticky pad Members of Orchidoideae share acute called viscidium attached to the pollinia; anther apex, soft stems and lack silica ovules numerous, minute, anatropous, bodies. More recently however 5 subfamilies tenuinucellate. Fruit a loculicidal capsule are recognized the other two being or a sausage-shaped berry; seeds numer- Vanilloideae and Epidendroideae (APweb, ous, minute, embryo very minute, en- Thorne, 2003, 2006). The recent studies dosperm absent. Pollination mostly by in- have, however, put some uncertainty over sects such as bees, wasps, moths and but- the position of Cypripedioideae. For terflies. Flowers of Ophrys resemble the fe- instance, they may group (albeit weakly) male wasp and the pollination results from with Vanilloideae (Freudenstein & Chase pseudocopulation, male wasp attracted by 2001) or be sister to Orchidaceae minus the shape and smell of the flowers, mistak- Apostasioideae (Cameron 2002; Stevens, ing it for a female wasp. Tiny dust-like 2003). Relation-ships within Orchidoideae seeds are dispersed by wind. are becoming fairly well resolved (Cameron 2004). Thorne (2006, 2007) recognizes 6 Economic importance: The family is known subfamilies: Apostasioideae, Neuwie- for large number of ornamentals reputed for dioideae, Cypripedioideae, Orchidoideae and their showy flowers mainly Cattleya, Epidendroideae.

* * * * * * * * * * * 478 Plant Systematics Iridaceae A. L. de Jussieu Iris family 60 genera, 1,845 species Widely distributed, in tropical and temperate climates, mainly distributed in South Africa, the Mediterranean region, Central and South America. .

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbaceous perennials, rarely 2, filaments free or connate, some- leaves equitant, leaf base sheathing, flow- times adnate to perianth, anthers bithecous, ers bisexual, sepals petaloid, petals often dehiscence by longitudinal slits, extrorse, spotted, ovary inferior, style petaloid, fruit a sometimes sticking to style branches. Gyn- capsule. oecium with 3 carpels, united, ovary inferior, rarely superior (Isophysis), 3-locular Major genera: Iris (240 species), Gladiolus with axile placentation, rarely unilocular (230), Moraea (125), Sisyrinchium (100), Cro- with parietal placentation (Hermodactylus), cus (75), Ixia (45), Freesia (20) and Tigridia ovules few to numerous, anatropous or (12). campylotropous, style three-lobed in upper part, sometimes petaloid. Fruit a loculicidal Description: Perennial herbs with rhizomes capsule, dehiscing by valves, usually with (Iris), corms (Gladiolus) or bulbs, bundle marked circular scar at tip; seeds often with sheaths with styloid crystals of calcium aril, copious endosperm and small embryo, oxalate, tannins and terpenoids present. seed coat usually fleshy. Flowers are prima- Leaves alternate, distichous, usually sessile, rily insect pollinated, especially by bees and equitant (oriented edgewise to the stem), flies, some species by birds (Rigidella), a few simple, entire, sheathing at base, venation being wind pollinated (Dierama). Seeds are parallel, stipules absent. Inflorescence a dispersed by wind or water cyme, raceme, spike or panicle, sometimes solitary, commonly subtended and enclosed Economic importance: The family includes by one or more spathaceous bracts. Flowers some of the most popular garden bisexual, showy, actinomorphic ornamentals such as Gladiolus, Iris, Freesia, (Sisyrinchium) or zygomorphic (Gladiolus), Sparaxis, Tigridia and Sisyrinchium. The stig- trimerous, epigynous. Perianth 6 in two mas of Crocus sativus yield saffron, widely whorls often differentiated into sepals and used as a colouring agent and for flavouring petals. Sepals 3, free or united, imbricate, food stuffs. Orris root, from Iris florentina is sometimes deflexed and with a patch of hairs used in making perfumes and cosmetics. (bearded Irises). Petals 3, free (Moraea) or united (Crocus), adnate to the sepals form- Phylogeny: The family is related to Liliaceae. ing a perianth tube, petals sometimes spot- The genus Isophysis with superior ovary is ted, erect in bearded Irises (forming stand- sometimes removed to a distinct family, but ard). Androecium with usually 3 stamens, according to Hutchinson (1973), it is Major Families of Angiosperms 479

Figure 13.43 Iridaceae. Iris germanica. A: Rhizome and basal leaves; B: Flower; C: Vertical section of flower; D: Capsule dehiscing through valves; E: Longitudinal section of seed. Crocus vernus. F: Flower and leaves; G: Longitudinal section through entire plant.

Iridaceous in all the characters except based on rbcL sequence (Chase et al., 1995a). superior ovary, and hence included here only. The morphological studies, however (Chase The family is often divided into a number of et. Al., 1995b; Stevenson and Loconte) place tribes of which Sisyrincheae with free the family within Liliales. The combined perianth, rhizome and undivided style studies of the two, places the family under branches is considered to be the most Asparagales. Rudall (2001) included an primitive (Hutchinson). Gladioleae and inferior ovary as a synapomorphy of the order, Antholyzeae are more advanced with noting that in ‘higher’ Asparagales (now zygomorphic perianth with curved tube and reduced in APG II to only two families Alliaceae hood-like dorsal lobe. The position of family is and Asparagaceae), there may well be a major uncertain. Whereas Hutchinson removed it reversal to superior ovaries. Thorne earlier to a distinct order Iridales, Takhtajan placed (1999, 2000) included Iridaceae under order it under Orchidales, and Dahlgren and Orchidales but subsequently (2003, 2006, Cronquist under Liliales. In the recent 2007) shifted it along with several other classifications of APG, it is placed under a families to Iridales suborder Iridineae, broadly circumscribed Asparagales primarily restricting Orchidales to just 6 families.

* * * * * * * * * * * 480 Plant Systematics

Asphodelaceae A. L. de Jussieu Aloe family 13 genera, 1070 species Temperate and tropical regions of the Old World, especially South Africa, usually in arid habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Rhizomatous herbs or 3 carpels, united, ovary superior, shrubs, leaves in rosettes, often succulent, placentation axile, ovules many, orthotro- vascular bundles in a ring surrounding mu- pous or anatropous, nectaries in septa of cilaginous central zone, inflorescence race- ovary, stigma discoid or 3-lobed. Fruit a mose, flowers bisexual, perianth not spotted, loculicidal capsule, rarely a berry (Kniphofia); stamens 6, free, not adnate to tepals, ovary seeds flattened, black, usually with dry aril. superior, nectaries in septa of the ovary, Pollination by insects and birds. Seeds fruit a capsule, seeds black. mainly dispersed by wind.

Major genera: Aloe (340 species), Haworthia Economic importance: Several genera in- (55), Kniphofia (50), Bulbine (50) and cluding Aloe, Haworthia, Kniphofia and Asphodelus (12). Gasteria are grown as ornamentals. Several species of Aloe are used in cosmetics and as Description: Rhizomatous herbs (rarely bul- sources of medicine. bous), shrubs or trees often with anomalous secondary growth, anthraquinone present. Phylogeny: The members of Asphodelaceae Leaves in rosettes at base or tips of were earlier included under Liliaceae, but branches, simple, usually succulent, not fi- now placed separately. Dahlgren et al., (1985) brous, vascular bundles in a ring around mu- being the authors of first major classifica- cilaginous parenchyma, phloem with a cap tion to recognize this and several other of aloine cells containing coloured secre- smaller families as indicated above. They tions, leaves sheathing at base, venation recognized two subfamilies Asphodeloideae parallel, stipules absent. Inflorescence ra- and Alooideae. The latter is clearly mono- ceme, spike or panicle. Flowers usually phyletic as evidenced by apomorphies of bracteate, bisexual, hypogynous, often leaves with central gelatinous zone with showy, trimerous. Perianth with 6 tepals, aloine layer and dimorphic karyotype. free or slightly connate, petaloid, not spot- Asphodeloideae includes Kniphofia, which ted. Androecium with 6 stamens, free, not lacks aloine layer and has berry fruit, adnate to tepals, bithecous, basifixed or Bulbine which is closer to Alooideae, and dorsifixed, dehiscence longitudinal, introrse, Asphodelus. The recognition of Alooideae pollen grains monosulcate. Gynoecium with renders Asphodeloideae as such Major Families of Angiosperms 481

Figure 13.44 Asphodelaceae. Asphodelus fistulosus. A: Plant with scapigerous inflorescence; B: Flower; C: Vertical section of flower; D: Flower with perianth removed showing stamens and pistil; E: Outer tepal; F: Inner tepal; G: Pistil showing ovary, simple style and 3-lobed stigma; H: Capsule; I: Seed. J: Eremurus olgae with basal leaves and scapigerous inflorescence. K: Gasteria verrucosa with basal leaves. (A-G, After Sharma and Kachroo, Fl. Jammu, 1983).

paraphyletic (Stevens, 2003). The family is ognizes the two subfamilies under included commonly under Asparagales Asphodelaceae. Treutlein et al., (2003) on (Dahlgren, Takhtajan, APG II, Judd et al., the basis of chloroplast DNA sequences (rbcL, and APweb), but Thorne (2003, 2006, 2007) matK) and from genomic finger-printing places it under order Iridales under subor- (ISSR) concluded that generic limits around der Asphodelineae. He like Dahlgren, rec- Aloe are decidedly unsatisfactory.

* * * * * * * * * * * 482 Plant Systematics Alliaceae Batsch ex Borkh. Onion family 80 genera, 1,586 species Widely distributed in tropical and temperate climates, frequently in semiarid habitats.

Includes five subfamilies: Allioideae (2 genera Allium and Milula; 750 species), Tulbaghioideae (1 genus, 22 species), Gilliesioideae (10 genera, 75 species; incl. Nothoscordum), Agapanthoideae (1 genus, 9 species) and Narcissoideae (Syn: Amaryllidoideae- 66 genera, 730 species). The discussion below includes first four, Narcissoideae, the largest of all is described separately.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Liliidae Liliidae Liliidae Liliidae Series+/Superorder Coronarieae+ Lilianae Lilianae Lilianae Monocots* Order Liliales Amaryllidales Asparagales Iridales Asparagales B & H, Cronquist under family Liliaceae; B & H placed Amaryllidaceae under Epigynae

Salient features: Herbaceous perennials ebracteate, bisexual, usually actinomorphic, with bulbs, latex present, smell of onion or rarely zygomorphic (Gilliesia) trimerous, garlic, leaf base sheathing, inflorescence hypogynous, pedicels often unequal in size. scapigerous, umbellate cyme, subtended by Perianth with 6 tepals, free or connate at spathaceous bracts, flowers bisexual, peri- base, in two whorls, petaloid, outer often with anth not spotted, stamens 6, often adnate to green midvein, sometimes with scale-like perianth, ovary superior, fruit a capsule. appendages forming corona (Tulbaghia). Androecium with 6 stamens, filaments free Major genera: Allium (499 species), or connate, sometimes epitepalous, some- Nothoscrodum (35), Tulbaghia (22), times with appendages, bithecous, dehis- Agapanthus (9), Miersia (5) and Gilliesia (3). cence longitudinal, rarely 3 or 4 stamens without anthers, pollen grains monosulcate. Description: Perennial herbs with bulb and Gynoecium with 3 carpels, united, ovary contractile roots, stem reduced, rarely with superior, placentation axile, ovules 2 or corm (Milula) or rhizome (Agapanthus, more, anatropous or campylotropous, Tulbaghia), vessel-elements with simple per- nectaries in septa of ovary, style simple, forations, laticifers present, with onion or stigma capitate to 3-lobed. Fruit a loculicidal garlic scented sulphur compounds such as capsule; seeds globular or angular, seed coat allyl sulphides, vinyl disulphide, etc. Leaves black, embryo curved. Pollination by insects. mostly basal, alternate, simple, cylindrical Seeds wind or water dispersed. or flat, often fistular, entire with parallel venation, base sheathing and forming tunic of Economic importance: The family is use- bulb, stipules absent. Inflorescence ful contributing garlic (Allium sativum), on- scapigerous, umbellate cyme, subtended by ion (A. cepa), leek (A. porrum), and chives spathaceous bracts, which enclose the flower (A. schoenoprasum), used as important veg- bud, some species producing bulbils instead etables or flavourings. Onion seeds are of- of flowers, rarely spicate (Milula). Flowers ten used as substitute for nigella (‘kalonji’). A Major Families of Angiosperms 483

Figure 13.45 Alliaceae, Subfamily Allioideae. Allium victorialis. A: Plant with bulb covered with reticulate fibres, broadly laceolate leaves and scape; B: Upper part of scape with inflorescence; C: Tepals with stamens; D; Capsule with long style. A. humile. E: Plant with scape and inflorescence; F: Tepals with stamens; G: Capsule. H: Tepal and stamens of A. roylei showing 2-toothed inner filaments. few species of Allium, Tulbaghia, and Gilliesia umbellate inflorescence (Agapanthaceae, are cultivated as ornamentals. Amaryllidaceae and Alliaceae). APG II and APweb have optionally included the other two Phylogeny: Originally included under families under Alliaceae. The clade is Liliaceae, the first major shift was made by characterized by bulbs, flavonols, saponins Hutchinson (1934) who abandoned the , laticifers, inflorescence scapigerous, traditional separation of Liliaceae and umbellate, with scarious spathe, Amaryllidaceae on the basis of superior inflorescence bracts 2 (or more - external), ovary in former and inferior in latter, and pedicels not articulated, free or basally included Allium and its relatives with superior connate perianth, style long, and endosperm ovary under Amaryllidaceae, largely on the nuclear or helobial (Fay et al. 2000). Thorne basis of spathaceous bracts. Cronquist had had earlier (1999) considered Amaryllidaceae subsequently (1981, 1988) merged and Agapanthaceae as distinct families (like Amaryllidaceae with Liliaceae. In the recent Apweb, 2005) but has finally (2003) merged years a number of distinct families have them in Alliaceae, recognizing 5 subfamilies been segregated, as indicated above. The Allioideae, Tulbaghioideae, Gilliesioideae, family is closely related to Amaryllidaceae Agapanthoideae and Amaryllidoideae (in in umbellate inflorescence subtended by 2006, 2007 revisions he changed it to spathaceous bracts, bulbs, and the presence Narcissoideae) under Alliaceae. The of scape. The recent cladistic analysis have monophyly of Alliaceae is supported by resulted in merging all families with morphology, chemistry and rbcL sequences. * * * * * * * * * * * 484 Plant Systematics

Figure 13.46 Alliaceae, subfamily Narcissoideae. Crinum asiaticum. A: Plant with inflorescence; B: Flower with elongated perianth tube without corona. Hymenocallis narcissifolia. C: Inflorescence with a part of scape; D: Longitudinal section of flower showing staminal corona. Ixiolirion tataricum (now Ixiliriaceae). E: Inflorescence; F: Dehisc- ing capsule; G: Seed. H: Vertical section of flower of Narcissus poeticus. Subfamily Narcissoideae Haw. (Syn = Amaryllidoideae Burn.) (Syn = Amaryllidaceae J. St.-Hilaire Amaryllis or Daffodil family) 66 genera, 730 species Widely distributed, in tropical and temperate climates, especially in South Africa, South America and the Mediterranean region.

Salient features: Herbaceous perennials often adnate to perianth, ovary inferior, having bulbs with contractile roots, leaf base 3-chambered, fruit a capsule or berry. sheathing, inflorescence scapigerous, umbellate cyme, subtended by spathaceous bracts, Major genera: Crinum (130 species), flowers bisexual, perianth, not spotted, some- Hippeastrum (65), Zephyranthes (55), times with staminal corona, stamens 6, Hymenocallis (48), and Narcissus (30). Major Families of Angiosperms 485

Description: Perennial herbs having bulb spider lily (Hymenocallis) and amaryllis with contractile roots, stem reduced, vessel- (Hippeastrum). elements with scalariform perforations, Leaves mostly basal, alternate, mostly lin- Phylogeny: The group had been tradition- ear or strap shaped, sometimes petiolate, ally circumscribed to include scapigerous base sheathing, venation parallel, stipules plants with spathaceous bracts in inflores- absent. Inflorescence usually scapigerous, cence and inferior ovary and regarded as cymose, often umbellate clusters or solitary, independent family Amaryllidaceae. Hutch- flowers often subtended by spathaceous inson had also included genera with supe- bracts. Flowers bracteate, showy, bisexual, rior ovary (present Allioideae) under actinomorphic or zygomorphic, epigynous. Amaryllidaceae. Cronquist had subse- Perianth 6, in two whorls (outer represent- quently (1981, 1988) merged Amaryllida- ing sepals, inner petals), both whorls petaloid, ceae with Liliaceae. In the recent years a often united into tube, sometimes with a co- number of distinct families have been seg- rona on throat of perianth tube. Androecium regated, as indicated above. The clade is with 6 stamens, in 2 whorls, epiphyllous, fila- closely related to Alliaceae in umbellate in- ments free, sometimes expanded and florescence subtended by spathaceous connate forming staminal corona bracts, bulbs, and the presence of scape. (Hymenocallis, Pancratium). Gynoecium with Monophyly of the clade is supported by infe- 3 united carpels, ovary inferior, trilocular rior ovary, amaryllid alkaloids and rbcL se- with many ovules, placentation axile, styles quences (Chase et al., 1995a). The recent simple with 3-lobed stigma, nectaries cladistic analysis has resulted in optionally present in septa of ovary. Fruit a loculicidal merging all families with umbellate inflo- capsule, rarely a berry; seeds usually black, rescence (Agapanthaceae, Amaryllidaceae with small curved embryo, endosperm fleshy. and Alliaceae) and choosing Alliaceae as the Pollination by insects and birds. Seeds are priority name in APG II and APweb, as indi- dispersed by wind or water. cated above. Judd et al. (2002) recognize group as independent family. Thorne (2003) Economic importance: The subfamily is includes it under Alliaceae in subfamily important for its valuable ornamentals such Amaryllidoideae, changed to Narcissoideae as daffodils (Narcissus), swamp lily (Crinum), in 2006, 2007 revisions.

* * * * * * * * * * *

Agavaceae S. L. Endlicher Agave family

16 genera, 355 species Throughout tropics and subtropics, mainly in arid climate.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Liliidae Liliidae Liliidae Liliidae Series+/Superorder Coronarieae/Epigynae+ Lilianae Lilianae Lilianae Monocots* Order Liliales Amaryllidales Asparagales Iridales Asparagales B & H Yucca (and others with superior ovary) under Liliaceae (series Coronarieae), Agave (and others with inferior ovary) under Amaryllidaceae (series Epigynae) 486 Plant Systematics

Figure 13.47 Agavaceae. A: Yucca aloifolia with a number of developing inflorescences. B: Part of inflorescence of Y. filamentosa. Agave americana. C: Plant with inflorescence; D: Stamen with versatile anther; E: Vertical section of flower; F: Transverse section of ovary.

Salient features: Large herbs, shrubs or nate, simple in rosettes, succulent, margin trees with usually rosettes of leaves, leaves entire or spinose-serrate, tip with sharp succulent with sharp spine at tip, fibrous, spine, venation parallel, with thick tough inflorescence paniculate, flowers bisexual, fibres, base sheathing. Inflorescence usu- perianth 6, free or connate, stamens 6, of- ally terminal raceme or panicle. Flowers ten adnate to perianth, ovary inferior or su- usually bisexual, actinomorphic, trimerous. perior, 3-chambered, nectaries in septa of Perianth with 6 tepals, free (Yucca) or ovary, fruit a capsule or berry, seed coat connate into tube (Agave), petaloid, not spot- black, bimodal karyotype 5 large and 25 ted, usually white or yellow. Androecium small chromosomes. with 6 stamens, longer than perianth (Agave) or shorter (Furcraea), free, anthers Major genera: Agave (240 species), Yucca bithecous, basifixed (Doryanthes) or (40), Furcraea (20) and Polianthes (13). dorsifixed (Beschorneria), dehiscence by longitudinal slits, introrse. Gynoecium with 3 Description: Large rhizomatous herbs, united carpels, ovary superior (Yucca) or in- shrubs or trees with basal or terminal ro- ferior (Agave), 3-locular with axile settes of leaves, stems with anomalous sec- placentation; ovules many, anatropous, ondary growth, calcium oxalate crystals and nectaries in septa of ovary, style short or long, steroidal saponins present. Leaves alter- stigma minute. Fruit a loculicidal capsule; Major Families of Angiosperms 487 seeds flat, black. Bimodal karyotype with 5 1988) circumscribed the family Agavaceae large and 25 small chromosomes. Pollina- more broadly also to include genera which tion by moths (Yucca by moth Tegeticula), oth- have now been removed to Dracaenaceae, ers by bats (Agave, some species) or birds Nolinaceae, and Laxmanniaceae (incl. (Beschornea). Seed dispersal by wind or ani- Lomandraceae). Such a broadly defined fam- mals. ily is heterogenous, united by woody habit and clearly polyphyletic (Dahlgren et al., Economic importance: Several species such 1985; Rudall et al., 1997). The family is also as Agave sisalana (sisal hemp), A. characterized by bimodal karyotype, also heteracantha (Istle fibre or Mexican fibre), A. shared by genera Hosta (placed in Hostaceae; morrisii (Keratto fibre), are important sources Hesperocallidaceae by Thorne, 1999), of fibre. A few species of Agave are fermented Camassia and Chlorogalum (both placed un- to produce tequila and mescal. The species der Hyacinthaceae by Thorne, 1999). Rudall of both Agave and Yucca are used in the et al., (1997) advocated their transfer to fam- manufacture of oral contraceptives. Several ily Agavaceae, a suggestion incorporated by species of Agave, Yucca and Polianthes (P. Judd et al. (2002) and Thorne (2003, 2006, tuberosa- tube rose) are also used as 2007). Judd et al. have recognized only 2 ornamentals. subfamilies—Yuccoideae and Agavoideae. Thorne recognized 4 subfamilies, adding Phylogeny: The members of the family were Chlorogaloideae (Camassia, Chlorogalum, earlier placed in Liliaceae and Hastingia and Schoenolirion) and Amaryllidaceae and were later removed to a Hesperocallidoideae (Hesperocallis and separate family to include members with su- Hosta). Monophyly of the family is supported perior ovary (removed from Liliaceae) and by phenotypic and DNA characters (Bogler inferior ovary (removed from Amaryllidaceae) and Simpson, 1996). The family is closely representing advanced tribes in the respec- related to Hyacinthaceae. APweb (2008) rec- tive families (Hutchinson, 1973), and lack- ognizes 5 groups (generic groups with no for- ing bulb, having arborescent habit, and in- mal names). This grouping received 100 per florescence racemose (not an umbel). cent support in three- and four-gene trees Hutchinson (1973) and Cronquist (1981, (Chase et al., 2000a; Fay et al., 2000).

* * * * * * * * * * *

Subclass 5. Commelinidae Suborder 1. Musineae Superorder 1. Arecanae 1. Musaceae 2. Lowiineae Order 1. Arecales 1. Lowiaceae Family 1. Arecaceae 3. Strelitziineae Superorder 2. Commelinanae 1. Strelitziaceae Order 1. Commelinales (B) 4. Heliconiineae 1. Commelinaceae (B) 1. Heliconiaceae 2. Hanguanaceae 5. Cannineae 3. Haemodoraceae 1. Cannaceae 4. Pontederiaceae 2. Marantaceae 5. Philydraceae 6. Zingiberineae 2. Cannales 1. Zingiberaceae 488 Plant Systematics

2. Costaceae 7. Juncales 3. Dasypogonales (B) 1. Thurniaceae 1. Dasypogonaceae 2. Juncaceae 4. Bromeliales (B) 3. Cyperaceae 1. Bromeliaceae 8. Restionales 2. Rapateaceae 2. Anarthriaceae 5. Typhales 3. Restionaceae 1. Typhaceae 4. Hopkinsiaceae (B) 6. Xyridales 5. Lyginiaceae (B) 6. Centrolepidaceae Suborder 1. Xyridineae 1. Xyridaceae 9.. Poales 2. Hydatellaceae (B) 1. Flagellariaceae 2. Eriocaulineae 2. Joinvilleaceae 3. Ecdeiocoleaceae 1. Eriocaulaceae 4. Poaceae 2. Mayacaceae

Arecaceae C. H. Schultz Palm family (=Palmae A. L. de Jussieu)

189 genera, 2,350 species Widespread in tropics of both hemispheres, a few in warm temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Commelinidae Liliidae Commelinidae Series+/Superorder Calycinae+ Commelinanae Arecanae Arecanae Commelinids* Order Arecales Commelinales Arecales Arecales Arecales B & H as family Palmae

Salient features: Woody shrubs or trees, (Hyphaene, Nypa), with prominent scars of trunk with scars of fallen leaves, leaves fallen leaves, sometimes spiny due to modi- large, fan-shaped or pinnately compound, fied leaves roots or exposed fibres, some- with sheathing bases, inflorescence times rhizomatous, tannins and polyphenols paniculate, spathes often present, flowers often present, vascular bundles with hard small. fibrous sheath, apical bud well protected by leaf sheaths. Leaves alternate, usually form- Major genera: Calamus (350 species), Bactris ing a terminal crown, petiolate (petiole of- (180), Pinanga (120), Licuala (105), ten with a flap called hastula at base), with Daemonorops (100), Areca (60) and Phoenix pinnate (feather palms) or palmate (fan (17). palms) segments, sometimes pinnately or twice pinnately compound, plicate (folded like Description: Trees or shrubs with a fan), blades rarely entire (Licuala); leaf unbranched trunk, rarely branched segments folded V-shaped (induplicate) or Major Families of Angiosperms 489

Figure 13.48 Arecaceae. Cocos nucifera A: Habit; B: Inflorescence; C: Branch of inflorescence with female flowers towards base, male flowers towards the top; D: Male flower; E: Vertical section of male flower; F: Female flower; G: Vertical section of female flower. Calamus pseudotenuis. H: Vegetative branch; I: Portion of stem showing thorns; J: Male inflorescence; K: Female inflorescence. inverted-V-shaped (reduplicate) in cross sec- whorls, sometimes numerous (Reinhardtia, tion; leaves sometimes very large some- Howea), rarely only 3 (Nypia), free, rarely with times over 20 m (Raphia fainifera with larg- connate filaments (Nypa), anthers est known leaf). Inflorescence axillary or ter- bithecous, basifixed or dorsifixed, rarely ver- minal, often covered with spathes, a repeat- satile, dehiscence by longitudinal slits; pol- edly branched panicle (Calamus) or almost len grains usually monosulcate, smooth or spicate. Flowers bisexual (Licuala, Livistona) echinulate. Gynoecium with usually 3 car- or unisexual with monoecious (Reinhardtia) pels, free or united, only 1 fertile in Phoenix, or dioecious (Borassus, Rhapis) plants, flow- carpels sometimes many, ovary superior, ers small, actinomorphic, usually sessile, placentation usually axile, rarely parietal trimerous, often with bracteoles connate (Gronophyllum), stigma usually terminal, below flowers. Perianth differentiated into sometimes lateral (Heterospatha) or basal sepals and petals, sometimes vestigial (Phloga), ovules usually 1, rarely upto 3, , (Nypa). Sepals 3, free (Arenga) or connate orthotropous or anatropous. Fruit single (Didymosperma), usually imbricate. Petals 3, seeded berry or drupe, exocarp often fibrous free or connate, usually valvate in male or covered with reflexed scales; seeds free flower and imbricate in female flower or adhering to endocarp, endosperm present, (valvate in female flowers of Arenga). embryo small. Largest seed in angiosperms Androecium usually with six stamens in two formed in double coconut (Lodoicea maldivica). 490 Plant Systematics

Economic importance: The family is of great cabbage palm (Sabal). Various species of Ca- economic importance. Most useful member lamus are source of commercial cane used is Coconut palm (Cocos nucifera), with almost in furniture and polo sticks. every part put to use. Mesocarp of the fruit is the source of coir fibre, the seed endosperm Phylogeny: In spite of being very large and (copra) yielding coconut oil, and the leaves diverse, and often divided into numerous used in thatching, basket making and a va- subgroups, the family is distinct, easily rec- riety of toys and decoration articles. Palm oil ognized and monophyletic. APweb (2005) rec- is extracted from Elaeis guineensis). Sago, a ognizes 5 subfamilies: Calamoideae, major source of carbohydrate food is obtained Nypoideae, Coryphoideae, Ceroxyloideae and from Metroxylon sagu (sago palm) and some Arecoideae. Thorne ( 2007) adds sixth species of Arenga and Caryota. Palm wine Phytelephoideae segragated from (toddy) is obtained from species of Borassus Ceroxyloideae. Uhl et al., (1995) carried out and Caryota. Fibre is also extracted from many cladistic analysis of the family using mor- species of palms particularly belonging to phological data as well as cpDNA restriction Raphia (raffia), Caryota (kitul fibre) and site analysis and found support for placement Leopoldinia (Piassava fibre). Dates are ob- of Nypa (Nypoideae) a sister of rest of the tained from Date palm (Phoenix dactylifera). palms. More recent studies of Asmussen et Vegetable ivory is obtained from the seeds of al., (2000) indicated that Nypoideae + ivory nut palm (Phytelephas macrocarpa) and Calamoideae (strong support) + the rest of was once used for buttons and as a substi- the family (moderate support) form a basal tute for real ivory. Waxes are obtained from trichotomy; other characters support these Copernicia (carnauba wax) and Ceroxylon. Be- general relationships. However, other work tel nut are obtained from Areca catechu of Af- suggests that details of the relationships of rica and Southeast Asia. The family also con- Nypoideae and Calamoideae to the rest of tributes a large number of ornamentals such the family are unclear, and some morpho- as Royal palm (Roystonea regia), fishtail palm logical groupings are not supported by mo- (Caryota), Chinese fan palm (Livistona), and lecular data (Hahn 2002).

* * * * * * * * * * *

Commelinaceae R. Brown Spiderwort family 40 genera, 650 species Widespread in tropical, subtropical and warm temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Commelinidae Commelinidae Liliidae Commelinidae Series+/Superorder Coronarieae+ Commelinanae Commelinanae Commelinanae Commelinids* Order Commelinales Commelinales Commelinales Commelinales Commelinales

Salient features: Herbs with succulent stems, (petals) coloured, flowers bisexual, trimerous, nodes swollen, leaves with closed basal sheath, in axils of spathaceous bracts, filaments outer perianth whorl (sepals) green, inner usually hairy, ovary superior, 3-chambered. Major Families of Angiosperms 491

Fifure 13.49 Commelinaceae. Tradescantia virginiana. A: Plant with flowers; B: Vertical section of flower; C: Flower with sepals and gynoecium; D: Stamen with hairy filament; E: Moniliform staminal hair; F: Transverse section of ovary showing one ovule in each chamber; G: Seed with aril. Commelina paludosa. H: Plant with flowers; I: Flower; J: Transverse section of ovary. C. kurzii. K: Flower; L: Stamen with large anther in different views; M: One of the lateral stamens; N: Staminode. (A-E, after Hutchinson, Fam. Fl. Pl, ed. 3, 1973; H-J, after Polunin and Stainton, Fl. Himal, 1984)

Major genera: Commelina (170 species), (blue, violet or white) free (Tradescantia,) or Tradescantia (70), Aneilema (65), Murdannia connate into a tube (Cyanotis, Zebrina), per- (50), Cyanotis (50), Dichorisandra (30) and ishing soon after anthesis, imbricate, crum- Zebrina (4). pled in bud. Androecium with 6 stamens (a few often reduced to staminodes), in Description: Annual or perennial herbs, 2 whorls, filaments free, often hairy with rarely climbers (Streptolirion) with commonly simple or moniliform hairs, sometimes succulent stems and swollen nodes, often adnate to petals, connective often flattened, with mucilage cells or canals containing anthers bithecous, dehiscence by longitu- raphides. Leaves alternate, simple, entire, dinal slits, rarely by apical pores flat or folded V-shaped in cross section, leaf (Dichorisanda), pollen grains monosulcate. sheath closed at base, venation parallel, sto- Gynoecium with 3 carpels, united, ovary mata tetracytic, stipules absent. Inflores- superior, trilocular with 1-few orthotropous cence a helicoid cyme at the end of stem in or anatropous ovules, placentation axile, leaf axil, sometimes solitary, subtended by styles simple with 3-lobed or capitate stigma. spathaceous bracts. Flowers bisexual (rarely Fruit a loculicidal capsule, rarely a berry; unisexual) actinomorphic (zygomorphic in seeds with aril, endosperm present, mealy. Commelina), hypogynous. Perianth 6, in two whorls, outer representing sepals, inner pet- Economic importance: The family is impor- als. Sepals green and free. Petals coloured tant for its valuable ornamentals such as 492 Plant Systematics dayflower (Commelina), spiderwort former is characterized by nonspiny pollen (Tradescantia), Moses-in-the-bulrushes grains, medium to large chromosomes, (Rhoeo discolor, now Tradescantia spathacea) actinomorphic flowers and moniliform hairs. and wandering Jew (Zebrina). In Africa, Commelinoideae is characterized by spiny Aneilema beninense is used as a laxative. Leaf pollen, zygomorphic flowers, and filament sap of Floscopa scandens is used in tropical hairs not moniliform. Monophyly of the fam- Asia to treat inflammation of the eyes. The ily is supported by both morphological and young shoots and leaves of Tradescantia molecular data (Evans et al., 2000). Recent virginiana and Commelina clavata are edible. treatments (APweb, 2008; Thorne, 2003, 2006, 2007) include the basal Cartonema and Phylogeny: The family is commonly divided widely separated Triceratella in subfamily into two subfamilies Tradescantoideae and Cartonemoideae, merging the other two Commelinoideae—well formed clades. The under Commelinoideae.

* * * * * * * * * * *

Musaceae A. L. de Jussieu Banana family 2 genera, 40 species Mainly wet tropical lowlands from West Africa to Pacific (Southern Japan to Queensland).

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Zingiberidae Commelinidae Liliidae Commelinidae Series+/Superorder Epigynae+ Zingiberanae Zingiberanae Commelinanae Commelinids* Order Zingiberales Musales Zingiberales Cannales Zingiberales B & H under family Scitamineae

Salient features: Large herbs with Description: Large usually tree-like peren- pseudostems formed by leaf sheaths, leaves nial herbs with pseudostems formed from large with thick midrib, parallel venation, overlapping leaf sheaths, with laticifers, flowers unisexual, inflorescence subtended rhizomatous. Leaves large, spirally ar- by large spathaceous bracts, corolla 2-lipped, ranged, simple, entire, margin often torn and stamens 5 (sixth rudimentary), carpels 3, blade appearing pinnate, venation parallel ovary inferior, 3-locular, ovules numerous, with stout midrib, sheathing at base. Inflo- fruit fleshy berry with numerous small black rescence a panicle-like cyme with one or seeds. more spathes, axis arising from basal rhizome and growing up through pseudostem. Flow- Major genera: Musa (34 species) and Ensete ers unisexual (plant monoecious), male (6). within upper bracts, female in clusters Major Families of Angiosperms 493

Figure 13.50 Musaceae. Musa Paradisiaca. subsp. sapientum (A-C, F, G) A: Plant with inflorescence and split old leaves; B: Young plant; C: Apical portion of inflorescence; D: Male flower of M. rubra; E: Female flower of M. rubra; F: Vertical section through bisexual flower; G: Fruit partially opened to show edible berry sliced at top. Ensete edule. H: Bisexual flower; I: Fruit; J: Seed; K: Transverse section of seed showing pit of hilum. within lower bracts. Perianth 6 in two whorls, in many tropical countries. Manila hemp or petaloid. Sepals 3, adnate to 2 petals, narrowly Abaca obtained from fibres of M. textilis is tubular, soon splitting on one side, variously used in making ropes and cordage. Inset or toothed at apex. Petals 3, somewhat 2-lipped, Abyssinian banana (Ensete ventricosa) is cul- 2 adnate with sepals, 1 free. Androecium with tivated for its fibre and for food; the stem pulp 5 fertile stamens and 1 forming staminode, and young shoots are eaten cooked. Some adnate to petals, filaments free, anthers dwarf cultivars of Musa (M. acuminata ‘Dwarf linear, bithecous, dehiscence by longitudinal Cavendish’) are often grown as greenhouse slits, pollen sticky. Gynoecium with 3 united plants in temperate climates. carpels, ovary inferior, 3-locular, ovules many, placentation axile, style filiform, Phylogeny: The family is usually placed in stigma 3-lobed. Fruit elongated berry Zingiberales (Cronquist, Dahlgren, APG II, containing numerous seeds, fruits forming APweb) along with Cannaceae, Zingibera- compact bunches; seed with copious and ceae, Marantaceae and other closely related small embryo. families. The genus Heliconia, earlier placed in this family has been removed to a sepa- Economic importance: Banana (Musa rate family Heliconiaceae (Thorne, APG II, paradisiaca subsp. sapientum) is a staple food APweb) or placed under Strelitziaceae 494 Plant Systematics

(Heywood, 1978). Takhtajan included circumscribed order, divided into 6 suborders, Musaceae under distinct order Musales. Musaceae included under Musineae. Fossil Thorne (2003, 2006, 2007) prefers name record has been found in Eocene of W. North Cannales over Zingiberales for the broadly America. * * * * * * * * * * * Zingiberaceae Lindley Ginger family 46 genera, 1,275 species Widespread in tropics mainly under forest shade and wetlands, chiefly distributed in Indomalaysia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Zingiberidae Commelinidae Liliidae Commelinidae Series+/Superorder Epigynae+ Zingiberanae Zingiberanae Commelinanae Commelinids* Order Zingiberales Zingiberales Zingiberales Cannales Zingiberales B & H under family Scitamineae

Figure 13.51 Zingiberaceae. Zingiber officinale. A: Plant with inflorescence; B: Flower; C: Rhi- zome. D: Flower of Roscoea alpina. Aframomum laurentii. E: Inflorescence; F: Leaf. Alpinia nutans. G: Plant with inflorescence; H: Flower; I: Vertical section of flower; J: Transverse section of fruit. K: Longitudinal section of seed of Amomum. Major Families of Angiosperms 495

Salient features: Perennial rhizomatous monosulcate or inaperturate. Gynoecium aromatic herbs, leaves alternate, distichous, with 3 united carpels, ovary inferior, 3-locu- sheathing at base, flowers bisexual, lar, rarely 2-locular, ovules usually many, zygomorphic, perianth 6 in two whorls, one placentation axile, or unilocular with pari- petal often larger than others, fertile sta- etal (Globba) or basal (Haplochorema) men 1, staminodes 3 or 4, petaloid, two placentation, style terminal, undivided, free staminodes forming a lip or labellum, car- or grasped by anther, sometimes 2-lipped or pels 3, united, ovary inferior, placentation dentate, stigma funnel-shaped, nectaries 2, axile, fruit a capsule or berry. on top of ovary. Fruit a fleshy capsule, indehiscent or loculicidal, rarely berry; Major genera: Alpinia (165 species), seeds globose or angular, with large aril, Amomum (130), Zingiber (95), Globba (65), endosperm copious, white, hard or mealy, Curcuma (55), Kaempheria (65), Hedychium perisperm present. Pollination by insects or (66) and Elettaria (7). birds. Fruits are dispersed by birds.

Description: Perennial rhizomatous herbs, Economic importance: Many members of often with tuberous roots, aromatic, contain- the family mainly Hedychium (ginger lily), ing etherial oils, terpenes and phenyl- Kaempheria, Costus, Nicolaia (torch ginger) propanoid compounds, aerial stems short, and Alpinia are widely grown as usually leafless, rarely foliate, vessels ornamentals. The family also contributes present in roots as well as stem. Leaves al- important spices from the rhizome Zingiber ternate, distichous, arising from rhizome, officinale (ginger, ‘adrak’), Curcuma longa with open or closed sheath at base, sessile (turmeric), or fruits of Amomum subulatum ( or petiolate; petiole with air canals separated Bengal cardamon, ‘moti elaichi’) and by diaphragms with stellate cells; blade large, Elettaria cardamomum (Malabar cardamon, venation closely parallel, pinnate, diverging ‘chhoti elaichi’). East Indian arrowroot is ob- obliquely from midrib, stipules absent, a tained from tubers of Curcuma angustifolia. ligule present at the junction of sheath and A perfumed powder abir is obtained from the petiole. Inflorescence usually surrounded rhizomes of Hedychium spicatum. Spice by involucre (Geanthus) or without involucre Melegueta pepper is obtained from (Gastrochilus, Amomum), a dense spicate head Aframomum melegueta. Rhizomes of Alpinia (Amomum) or cyme, sometimes racemose or zedoaria are also sources of spice, tonic and paniculate (Elettaria), even solitary perfume (zeodary), whereas those of A. (Monocostus). Flowers bisexual, often sub- galanga are used in medicine and flavour- tended by a sheathing bract, usually ing (galangal). zygomorphic, early withering, often complicated, epigynous, trimerous. Perianth dif- Phylogeny: The family forms a mono- ferentiated into sepals and petals. Sepals 3, phyletic group along with other families in- green, connate into a tube. Petals 3, showy, cluded under Zingiberales as indicated somewhat united, posterior petal often en- above. Genus Costus sometimes included larged. Androecium with 1 fertile stamen under a separate subfamily within and usually 4 staminodes, in two whorls; Zingiberaceae has been removed to a dis- outer whorl with 2 staminodes often fused tinct family Costaceae. Monophyly of the fam- to form 2-3 lobed lip or labellum (sometimes ily is supported by morphology (Kress, 1990) reduced to a tooth-Rhynchanthus), third be- and DNA information (Kress, 1995). The fam- ing absent; inner whorl with one fertile sta- ily was divided by Loesener (1930) into 2 sub- men and two smaller staminodes which are families Zingiberoideae and Costoideae (lat- free or connate with staminodes of the lip; ter with four tribes Hedychieae, Globbeae and fertile stamen with bithecous anther, Zingibereae). Hutchinson (1934, 1973) grooved and grasping style, pollen grains treated the four groups as four tribes (fourth 496 Plant Systematics being Zingibereae). Kress et al., (2001, 2002) adnate to filament and forming tube), and has redefined the classification of the fam- recognizing two additional subfamilies ily, recognizing four subfamilies: distribut- Siphonochiloideae (single genus ing most genera of the three tribes Siphonochilus—rhizome fleshy, vertical; in- (Costoideae has already been removed as florescence a raceme, bracteoles 0) and distinct family) among two subfamilies Tamijioideae (single monotypic genus— Alpinoideae (rhizome fleshy, lateral stami- Tamijia flagellaris the only species; Rhizome nodes of outer whorl very small or 0, labellum fibrous; placentation parietal). Two genes formed by the two staminodes of the inner analyses by these authors indicated strong whorl alone, fruit usually indehiscent, en- support for Siphonochiloideae being sister dosperm without starch) and Zingiberoideae to other three, and Tamijioideae to the other (rhizomes fibrous, lateral staminodes of two Alpinioideae + Zingiberoideae. Thorne outer whorl also free from labellum, labellum (2006, 2007) and Stevens (2008) follow this .

* * * * * * * * * * *

Cannaceae A. L. de Jussieu Canna family

1 genus, 25 species Mainly tropical and subtropical America, several species having naturalized in Asia and Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Zingiberidae Commelinidae Liliidae Commelinidae Series+/Superorder Epigynae+ Zingiberanae Zingiberanae Commelinanae Commelinids* Order Zingiberales Cannales Zingiberales Cannales Zingiberales B & H under family Scitamineae

Salient features: Herbaceous perennials, distinct midrib containing air canals, alter- leaves broad, sheathing at base, flowers nate, spirally arranged, simple, venation par- showy, bisexual, trimerous, perianth allel, petiole sheathing the stem, stipules petaloid, stamens petaloid, only one fertile, and ligule absent. Inflorescence a terminal ovary inferior, style flat with marginal raceme, panicle, or spike of commonly 2-flow- stigma, fruit covered with warts. ered cincinni; axis 3-angled in section with 3-ranked bracts, each bract associated with Major genera: Single genus Canna (10 spe- each 2-flowered (rarely 1-flowered) cincinnus. cies) Flowers showy, bisexual, zygomorphic, epigynous, with a bract and a bracteole. Peri- Description: Perennial herbs with under- anth 6, in two whorls (outer representing ground rhizome. Stem with mucilage canals. sepals, inner petals). Sepals 3 free, green or Leaves large, spirally arranged, broad, with purple, persistent in fruit. Petals 3, connate Major Families of Angiosperms 497

Figure 13.52 Cannaceae. Canna indica. A: Plant with leaves and inflorescence; B: Open flower showing petaloid staminodes, half anther and tip of style; C: Fertile stamen with half petaloid staminode and half anther; D: Transverse section of ovary showing axile placentation and ovary wall covered with warts; E: Dehiscing capsule covered with warts; F: Seed. at base and adnate to staminal column. brids are grown as garden ornamentals. The Androecium with 6 stamens, in 2 whorls, starch from rhizome of C. edulis (Queensland connate and adnate to petals, three outer Arrowroot) is used as diet for infants as it is modified into petaloid imbricate staminodes, easily digestible. of 3 inner 2 modified into petaloid staminodes and the third with one anther Phylogeny: The family is closely related lobe fertile and other modified into petaloid with other families such as Zingiberaceae, staminode, pollen grains inaperturate. Gyn- Musaceae, Marantaceae and oecium with 3 united carpels, ovary inferior, Strelitziaceae, usually placed under order trilocular with many ovules, placentation Zingiberales, differing from Zingiberaceae axile, styles simple, petaloid with marginal in lacking ligule. Thorne (2003, 2006, 2007) stigma. Fruit a capsule covered with warts, prefers name Cannales for the order, plac- dehiscing by collapse of the pericarp; seed ing the family Cannaceae under suborder spherical, black, with tuft of hairs (modified Cannineae. Takhtajan (1997) has narrowly aril) with straight embryo, endosperm hard, circumscribed Cannales, to include perisperm present. Most species self polli- Cannaceae and Marantaceae (suborder nated. Seeds often dispersed by water. Cannineae of Thorne), Zingiberales restricted to include only Zingiberaceae and Economic importance: Various species of Costaceae. Lowiaceae is removed to Canna especially C. indica and various hy- Lowiales and Musaceae together 498 Plant Systematics

Heliconiaceae and Strelitziaceae to ovule development in the chalaza and Musales. All 4 orders are placed under basal part of the nucellus. This is unlike superorder Zingiberanae. Grootjen and the other Zingiberalean families. The fam- Bouman (1988) described a pachychalaza in ily is monophyletic, as supported by DNA and Cannaceae, with mitosis occurring during morphology (Kress, 1990, 1995).

* * * * * * * * * * *

Juncaceae A. L. de Jussieu Rush family 6 genera, 345 species Worldwide, mostly in cold temperate and montane regions, usually in damp habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Commelinidae Liliidae Commelinidae Series+/Superorder Calycinae+ Juncanae Commelinanae Commelinanae Commelinids* Order Juncales Juncales Cyperales Juncales Poales

Salient features: Tufted herbs, leaves small, trimerous. Perianth with 6 tepals, in grass-like, sometimes reduced to basal two whorls, free, green brown or black, rarely sheath, perianth 6, in two whorls, stamens scarious, inner sometimes smaller 6, pollen in tetrads, ovary superior, (Marsippospermum). Androecium with usu- placentation axile, stigmas 3, fruit a capsule. ally 6 stamens, rarely 3 (Voladeria), opposite the tepals, free, anthers bilocular, basifixed, Major genera: Juncus (260 species), Luzula dehiscence by longitudinal slits, introrse, (65), Oxychloe (7) and Distichia (3). pollen in tetrads, monoporate. Gynoecium with 3 united carpels, ovary superior, Description: Perennial or annual tufted placentation axile, sometimes parietal herbs, often with rhizomes, stems cylindri- (Marsippospermum), ovules many, styles 3 or cal and solid, usually foliate only at base. 1, stigmas 3. Fruit a loculicidal capsule; Leaves alternate, mostly basal, 3-ranked, seeds spherical or flat, sometimes pointed rarely distichous (Distichia), cylindrical or and spindle-shaped (Marsippospermum), with flat, sheathing at base or reduced only to small straight embryo, endosperm present. sheath, sheath open or closed, blade grass- Wind pollinated. like, entire, venation parallel, stipules and ligule absent. Inflorescence with cymes Economic importance: Family is not of clustered in heads or forming panicles, much commercial use. Split rushes used in corymbs or even solitary (Andesia). Flowers basket making are taken from stems of usually bisexual, sometimes unisexual Juncus effusus (soft rush) and J. squarosus (Distichia) and plants dioecious, rarely (heath rush). Juncio, used in binding, is de- monoecious (Rostkovia), actinomorphic, very rived from Juncus maritimus (sea rush). A few Major Families of Angiosperms 499

Figure 13.53 Juncaceae. Juncus articulatus. A: A plant with inflorescences; B: Flower; C: Peri- anth and stamens; D: Gynoecium; E: Capsule; F: Seeds. Luzula albida. G: Plant with inflorescence; H: Flower; I: Vertical section of flower; J: Gynoecium; K: De- hiscing fruit; L: Seed; M: Longitudinal section of seed. N: Flower of Juncus sphacelatus. species of Juncus and Luzula are grown as tives of Juncaceae. The family is connected ornamentals. to Cyperaceae through genus Oreobolus, the most primitive genus of that family. Muasya Phylogeny: Juncaceae are closely related et al., (1998) suggest that Oxychloe to Liliaceae (Hutchinson, 1973; Heywood, (Juncaceae) is sister to Cyperaceae, with 1978) representing reduced forms derived moderate support, other Juncaceae are also from that stock. Prionium which was earlier basal and paraphyletic, but with poor sup- considered to be the most primitive genus port, while Prionium is sister to the whole of the family Juncaceae, linking it to clade, with good support. A study by Plunkett Liliaceae, has now been removed to a dis- et al., (1995) placed Oxychloe within tinct family Prioniaceae (Thorne, 1999, Cyperaceae. The relationships of the latter 2003), or under Thurniaceae (APG II; Apweb, genus in particular are still unclear. Accord- 2008; Judd et al., 2008; Thorne, 2006, 2007). ing to the studies of Bremer (2002) Takhtajan (1997) places Prionium under Thurniaceae (including Prionium) are sister Juncaceae. Restionaceae, which have be- to Juncaceae plus Cyperaceae, (Oxychloe not come totally dioecious, form the closest rela- included) with strong support.

* * * * * * * * * * * 500 Plant Systematics Cyperaceae A. L. de Jussieu Sedge family 104 genera, 5,010 species Worldwide, mostly in cold temperate regions, usually in damp habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Commelinidae Liliidae Commelinidae Series+/Superorder Glumaceae+ Juncanae Commelinanae Commelinanae Commelinids* Order Cyperales Cyperales Cyperales Juncales Poales

Figure 13.54 Cyperaceae. Eleocharis lankana. A: Plant in flower; B: Inflorescence; C: Fruiting gynoecium with hypogynous bristles. Carex ligulata. D: Lower part of plant; E: Part of inflorescence; F: Male spike; G: Female spike; H: Utricle; I: Nut. Major Families of Angiosperms 501

Salient features: Herbs, stems often 3-an- pous, placentation basal, style with 2-3 gled, solid, leaves 3-ranked, containing branches, stigmas 2 or 3. Fruit a nut (often silica bodies, sheaths closed, ligule absent, called achene but the latter is strictly de- glumes present, flower subtended by a sin- rived from a single carpel), sometimes en- gle bract, lodicules absent, perianth repre- closed in a utricle (Carex), with often per- sented by bristles, scale or absent, ovary su- sistent style and associated with persistent perior with single ovule, fruit a nut. perianth bristles, bifacial or trigonous; seed erect, embryo small, endosperm conspicu- Major genera: Carex (1800 species), Cyperus ous, mealy or fleshy. (580), Fimbristylis (290), Scirpus (280), Rhynchospora (240), Scleria (200) and Economic importance: Various species of Eleocharis (190). Cyperaceae are useful in different ways. Stems of Cyperus papyrus (papyrus or paper Description: Annual or perennial herbs, weed) were much used in ancient times for usually rhizomatous, stems mostly 3-angled, making paper, and is now commonly grown solid. Leaves alternate, 3-ranked, often as an ornamental. The stems of Cladium crowded at the base of stem, simple, grass- effusum (saw grass) are also source of cheap like, with silica bodies, entire or serrulate, paper. Stems and leaves of Carex brizoides venation parallel, stipules and ligule absent, and Lepironia mucronata are used for pack- sheath closed, stomata with dumbbell- ing and basket work. Underground organs of shaped guard cells. Inflorescence consist- Cyperus esculentus (tigernut, Zulu nut or ing of small spikes (sometimes called rush nut), Scirpus tuberosus and Eleocharis spikelet but different from spikelet of tuberosa (matai, Chinese water chest nut) grasses which has two basal glumes, and are used as food. The stems of Scirpus totara each floret enclosed in a lemma and a palea) are used for making canoes and rafts and each often subtended by a bract (prophyll) and those of S. lacustris for basketwork, mats and bearing (on the axis called rachilla) spirally chair seats. arranged (Cladium) or distichous (Cyperus) bracts (glumes) , each subtending one flower; Phylogeny: The family is considered to be small spikes (spikelets) aggregated in monophyletic, connected to Juncaceae spikes, panicles or even umbels, the whole through genus Oreobolus, the most primi- inflorescence subtended by one or more usu- tive genus (Hutchinson, 1973). Muasya et ally leaf-like involucral bracts. Flowers very al., (1998) suggest that Oxychloe (Juncaceae) small, bisexual (Cyperus, Scirpus) or uni- is sister to Cyperaceae, with moderate sup- sexual (Scleria), subtended by bract (glume), port. Plunkett et al. (1995) placed Oxychloe female flower often with second bract sur- within Cyperaceae. The relationships of the rounding the pistil and forming sac-like latter genus in particular are still unclear. perigonium. Perianth represented by bris- According to the studies of Bremer (2002) tles, sometimes scales (Oreobolus, Thurniaceae (including Prionium) are sister Lipocarpha), or even absent (Bulbostylis, to Juncaceae plus Cyperaceae, with strong Scirpus). Androecium with 3 stamens, some- support. He did not include Oxychloe under times more (6 in Arthrostylis; 12-22 in Cyperaceae. According to him Cyperaceae, Evandra), free, anthers bithecous, basifixed, Juncaceae and Thurniaceae form a well de- oblong or linear, dehiscence by longitudinal fined cyperid clade. The family is tradition- slits, pollen grains uniporate, in pseu- ally divided into 3 subfamilies (Engler): domonad (out of the four microspores, three Scirpoideae, Rhynchosporoideae and degenerate and form the part of fourth fer- Caricoideae. Thorne (2006, 2007), however tile forming pollen grain). Gynoecium with recognizes only two: Mapanioideae and 2 (Kyllinga) or 3 (Cyperus) united carpels, Caricoideae. Hutchinson divided the family ovary superior, unilocular, ovule 1, anatro- into 8 tribes. Simpson et al., (2003) based on 502 Plant Systematics the pollen and plastid DNA sequence data 2004, 2006). According to Ford et al. (2006), concluded that Mapanioideae (tribe Carex itself includes a few other genera, and Hypolytreae of Hutchinson) are sister to the conventional wisdom in which a highly com- rest of the family, while Carex, sister to pound inflorescence is the plesiomorphic Eriophorum is embedded in the other clade. condition for the genus, taxa with simple Within Caricoideae, especially tribe branches being derived, perhaps several Cariceae, phylogenetic studies are begin- times, seems the exact opposite of what ning to resolve relationships (Starr et al. actually happened.

* * * * * * * * * * *

Poaceae Barnhart Grass family (= Gramineae A. L. de Jussieu) 678 genera, 10,230 species (Fourth largest family after Asteraceae, Orchidaceae and Fabaceae) Worldwide, distributed from poles to equator and from mountain peaks to sea level, in all types of climates and habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Monocotyledons Liliopsida Liliopsida Liliopsida Magnoliopsida Subclass Arecidae Commelinidae Liliidae Commelinidae Series+/Superorder Glumaceae+ Poanae Commelinanae Commelinanae Commelinids* Order Cyperales Poales Poales Poales Poales B & H as Gramineae

Salient features: Herbs or shrubs with Description: Herbs or rarely woody shrubs or hollow internodes and jointed stems, leaves trees (bamboos), often with rhizomes, stolons distichous with distinct sheath enclosing or runners, frequently tillering (branching the stem and linear blade with often a ligule from ground level) to form tufts of stems, stem at their junction, spikelet with two glumes, (culm) with hollow internodes and jointed flowers reduced, enclosed in lemma and swollen nodes, with silica bodies. Leaves palea, perianth represented by lodicules, distichous, alternate, simple, with basal ovary superior, stigma feathery, fruit sheath surrounding internode and free linear caryopsis. blade, a ligule often present at the junction of blade and sheath, margins of sheath Major genera: Poa (500 species), Panicum overlapping but not fused, sometimes united (450), Festuca (430), Paspalum (350), Stipa into a tube, venation parallel, leaf margins (300), Bromus (160), Elymus (150), Sporobolus often rolled especially on drying, stipules (140), Bambusa (125), Setaria (100), absent. Inflorescence of spikelets arranged Arundinaria (50) and Chloris (50). in racemes, panicles (Poa, Avena) or spikes Major Families of Angiosperms 503

Figure 13.55 Poaceae. Zea mays. A: Plant with terminal male inflorescence and axillary female inflorescence (Cob); B: Vertical section of female spikelet; C: Paired male spikelets; D: Male spikelet opened to show two fertile florets. Poa annua. E: Plant in flower; F: Spikelet. Avena sativa. G: Inflorescence; H: Spikelet opened; I: Fertile floret with awned lemma.

(Triticum, Hordeum). Each spikelet with 2 very rarely 1 (Anomochloa), stigmas often (rarely 1 as in Monera) glumes enclosing 1 feathery. Fruit a caryopsis, rarely nut berry (Hordeum, Nardus) or more (Poa, Triticum) or utricle; seed fused with pericarp, embryo florets borne on an axis called rachilla, straight, endosperm starchy. usually in 2 rows. Flowers small, reduced (floret), zygomorphic (due to only 2 lodicules Economic importance: The family is of great displaced on one side), rarely actinomorphic, economic importance, being a source of usually bisexual rarely unisexual (Zea), important cereals such as rice (Oryza hypogynous, enclosed in lemma and palea sativa), wheat (Triticum aestivum) and corn or (prophyll), lemma often bearing dorsal (Avena), maize (Zea mays). The family also includes subterminal (Triticum) or terminal (Hordeum) other food crops such as barley (Hordeum awn, or awn absent (Poa). Perianth absent or vulgare), pearl millet (Pennisetum glaucum), represented by 2 (rarely 3, as in Bambusa and oats (Avena sativa), rye (Secale cereale) and Streptochaeta) lodicules. Androecium with sorghum (Sorghum vulgare). Grasses such as usually 3, sometimes 6 (Oryza) or more Cynodon, Axonopus and Agrostis are (Arundinaria), rarely 1-2 (Leptureae) stamens, extensively used in lawns and turfs. filaments free, anthers bithecous, basifixed, Andropogon, Agropyron, and Phleum are major usually sagittate, dehiscence longitudinal, forage grasses. Sugarcane (Saccharum pollen grains monoporate. Gynoecium officinarum) is the major source of variously interpreted as bicarpellary, commercial sugar. Bamboos are employed tricarpellary (with one reduced style), in big way in construction work, wickerwork syncarpous or monocarpellary, unilocular and thatching in different parts of the world. with 1 ovule, placentation basal, styles 2, Young bamboo shoots are used as food and sometimes 3 (Bamboos and Streptochaeta), often pickled. Lemon grass (Cymbopogon) 504 Plant Systematics leaves are distilled to yield essential oil for Centostecoideae occupies an isolated imparting citronella scent. Grains of Coix position although related to both lacryma-jobi (Job’s tears) are use as necklace Bambusoideae and Panicoideae, and includes beads. Roots of Vetiveria zizanioides (vetivar broad-leaved herbs with single- to several- grass) are used for making fragrant cooling flowered spikelets. Studies of Clark et al., pads and extraction of vetiver oil. (1995) and Soreng and Davis (1998) suggest that Arundinoideae, Chloridoideae and Phylogeny: Although a very large assemblage Panicoideae form a well supported clade (often Poaceae are easily recognized and form a called PACC clade) based on embryological and monophyletic group, as supported by DNA data. Arundinoideae as generally defined morphology (lodicules, spikelets with glumes, are not monophyletic, and many of their lemma and palea, fruit caryopsis) and DNA members such as Aristida, Phragmites, etc. characters( rbcL and ndhF sequences). are spread over in other two subfamilies. Cronquist (1988) places Poaceae and Chloridoideae and Panicoideae are generally Cyperaceae under the same order Cyperales, found to be monophyletic. Stevens (APWeb, but similar morphology of two is believed to 2003) and Thorne (2003) listed 12 subfamilies be due to convergent evolution, Cyperaceae under Poaceae: Anomochlooideae, being more closely related to Juncaceae (Judd Pharoideae, Puelioideae, Panicoideae, et al., 1999). The studies of Bremer (2002), Arundinoideae, Centothecoideae, Chlori- using rbcL and taq analyses found strong doideae, Aristidoideae, Danthonioideae (six support for Cyperaceae, Juncaceae, and forming PACCAD clade), Bambusoideae, Thurniaceae forming cyperid clade and Ehrhartoideae, Pooideae (BEP clade). Poaceae along with other families forming a Subsequently (APWeb 2008, Thorne 2006, graminoid clade. 2007), however, they have added 13th The nature of gynoecium in this family has Micrairoideae, probably sister to the whole been a matter of controversy. Most early clade (Thorne prefers Chondrosoideae to authors including Haeckel (1883), Rendle Chloridoideae). There is great diversity in (1930) and Diels (1936) considered it to the morphology and biochemistry of C4 consist of a single carpel terminated by 2-3 photosynthesis in the family (Kellogg, 2000). branched stigma. Lotsy (1911), Weatherwax Studies based on gene expression (Ambrose (1929) and Arber (1934) considered that it et al., 2000) indicate that the palea and represents tricarpellary ovary having evolved perhaps even lemma are calycine in nature from an ovary with parietal placentation, a and the lodicules are corolline. Clark and view supported by studies on floral anatomy Triplett (2006) discuss relationships within (Belk, 1939). Others believe that gynoecium Bambusoideae, previously divided into the consists of 2-3 carpels (depending on the woody Bambuseae and the herbaceous number of stigmas visible; Cronquist 1988, Olyreae. However, the woody temperate Woodland, 1991). bamboo group may be sister to the rest of the The family is variously classified by family. The duplication of AP1/FUL gene, different authors. Hutchinson (1973) apparently in stem-group Poaceae, may be recognized two subfamilies Pooideae (with 24 involved in the evolution of the spikelet tribes) and Panicoideae (with 3 tribes). (Preston & Kellogg 2006). Malcomber and Heywood (1978) recognized 6 subfamilies Kellogg (2005) suggest that there has been (Bambusoideae, Centostecoideae (should be duplication of LOFSEP genes within Poaceae, Centothecoideae as the genus Centosteca on while there has been a duplication of the which the name is based is listed neither in whole genome in a clade that includes at Willis, 1973 nor Hutchinson, 1973), least Zea, Oryza, Hordeum and Sorghum Arundinoideae, Chloridoideae, Panicoideae (Schlueter et al. 2004). Developmental gene and Pooideae), further subdivided to include duplication and subsequent functional 50 tribes. Of these subfamilies, divergence seem to have played a very Major Families of Angiosperms 505 important role in allowing the development there has been very extensive duplication of of the baroque diversity of inflorescences in genes - API, AG and SEP families - but not in the family (Malcomber et al. 2006). Indeed, the AP3 lineage (Zahn et al. 2005a).

* * * * * * * * * * *

Subclass 6. Ranunculidae (A) 2. Eupteleales (B) Superorder 1. Proteanae (A) l. Eupteleaceae Order 1. Proteales 3. Paeoniales (B) Family 1. Proteaceae 1. Paeoniaceae 2. Platanales (B) 2. Glaucidiaceae 1. Platanaceae 4. Ranunculales 3. Buxales (B) Suborder 1. Ranunculineae 1. Buxaceae 1. Lardizabalaceae 2. Didymelaceae 2. Circaeasteraceae 4. Sabiales (B) 3. Menispermaceae 4. Berberidaceae 1. Sabiaceae 5. Hydrastidaceae Superorder 2. Ranunculanae 6. Ranunculaceae Order 1. Nelumbonales 2. Papaverineae 1. Nelumbonaceae 1. Pteridophyllaceae (B) 2. Papaveraceae

Paeoniaceae Rafinesque Peony family 1 genus, 33 species Mainly temperate regions of Asia and Europe, also in Northwest America

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Liliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Ranunculidae Magnoliidae Ranunculidae Series+/Superorder Thalamiflorae+ Ranunculanae Theanae Ranunculanae Core Eudicots* Order Ranales Dilleniales Paeoniales Paeoniales Paeoniales Saxifragales B & H under family Ranunculaceae

Salient features: Perennial rhizomatous arranged, carpels 5, free, ovules many, fruit herbs or shrubs, leaves alternate, compound etaerio of follicles. or lobed, without stipules, flowers large, bisexual, sepals 5, green and leathery, petals Major genera: Single genus Paeonia 5-10, coloured, stamens many, centrifugally (33 species). 506 Plant Systematics

Figure 13.56 Paeoniaceae. Paeonia emodi. A: Branch with flower; B: Flower bud with leafy bracts; C: Flower magnified to show numerous stamens; D: Petal; E: Stamen; F: Ovary covered with hairs; G: Follicle splitting; H: Follicle dehisced to expose seeds; I: Seed with aril.

Description: Perennial herbs or soft shrubs, etaerio of leathery follicles, dehiscing by adax- with tubers or rhizomes, stem base covered ial suture, seeds globose, with aril, red turn- with scale-like sheaths. Leaves alternate, ing black at maturity, with prominent petiolate, pinnately to ternately compound to umbilicus, embryo small, endosperm copious. highly dissected or lobed, stipules absent. Inflorescence usually with solitary flowers Economic importance: The family contrib- with leafy bracts at base. Flowers Large, utes many ornamentals cultivated for attrac- showy, bisexual, hypogynous, almost globu- tive flowers. The flowers of Paeonia officinalis lar in appearance. Calyx with 5 sepals, free, may reach 15 cm in diameter. green, unequal, imbricate, subfoliaceous, persistent. Corolla with 5 petals, sometimes Phylogeny: The genus Paeonia was once in- 6-10, large, free, orbicular, subequal, imbri- cluded under family Ranunculaceae, from cate. Androecium with numerous stamens, which, however, it is distinct in having 5 large centrifugal, attached to fleshy disc present chromosomes, centrifugal (and not centrip- around the carpels, free, spirally arranged, etal) stamens, persistent sepals, disc and bithecous, basifixed, dehiscence by longitu- seeds with aril. The separation of the genus dinal slits, extrorse. Gynoecium with into a distinct family was first advocated by 5 carpels, sometimes upto 2, borne on fleshy Worsdell (1908) on the basis of anatomical disc, free, fleshy, ovary superior, unilocular, evidence. Corner (1946) considered the cen- ovule 2-many, placentation marginal, stigma trifugal development of stamens of consider- sessile, thick, falcate, 2-lipped. Fruit an able importance in phylogeny and advocated Major Families of Angiosperms 507 placing Paeoniaceae near Dilleniaceae, a order Saxifragales (Core Eudicots) by APG II placement followed by Cronquist (1981, 1988), and APweb. Paeoniaceae and another but not supported by Hutchinson, who in 1969 monogeneric family Glaucidiaceae are often placed Paeoniaceae before Helleboraceae considered related. They are together placed under order Ranales. The placement of in the same order Paeoniales by Dahlgren Paeoniaceae near Dilleniaceae is also con- (1989) and Thorne (2003, 2006, 2007), tradicted by difference in gynoecial develop- whereas as Takhtajan (1997, places them ment, nectary morphology (Stevens in Apweb, under two adjacent orders Paeoniales and 2008). Hutchinson considered Paeonia to be Glaucidiales under superorder Ranun- a link between the Magnoliaceae and culanae of subclass Ranunculidae. Mabberley Helleboraceae, but much more closely related (1997) includes Glaucidium in Paeoniaceae. to latter. Paeonia was linked with moderate Hoot et al., (1998) included Glaucidium and support to the Crassulaceae clade, or, more Hydrastis under Ranunculaceae, being sis- weakly, with the Crassulaceae + Saxifraga- ter to rest of the family, a treatment followed ceae clades in some analyses in Fishbein et in APG II and APweb, the latter under two sub- al., (2001) and accordingly placed under families Glaucidioideae and Hydrastidoideae.

* * * * * * * * * * *

Berberidaceae Durande Barberry family 13 genera, 660 species Widespread chiefly in North Temperate regions and the Andes of South America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Liliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Ranunculidae Magnoliidae Ranunculidae Series+/Superorder Thalamiflorae+ Ranunculanae Ranunculanae Ranunculanae Eudicots* Order Ranales Ranunculales Berberidales Ranunculales Ranunculales Ranunculales

Salient features: Herbs or shrubs, stipules Description: Perennial herbs or shrubs, absent, flowers bisexual, sepals and petals rarely small trees, stem sometimes with similar, stamens 6, outer whorl opposite the scattered vascular bundles, wood usually col- petals, anthers dehiscing by valves, carpel oured yellow by berberine (an isoquinolene 1, ovary superior, fruit a berry. alkaloid). Leaves usually alternate, rarely opposite (Podophyllum), simple (Berberis), or Major genera: Berberis (540 species), palmately lobed (Podophyllum), or pinnate Mahonia (60), Podophyllum (12), Jeffersonia compound (Mahonia), rarely 2-3 times (2) and Nandina (1). pinnately compound (Nandina), leaves of 508 Plant Systematics

Figure 13.57 Berberidaceae. Berberis vulgaris. A: Twig with leaves, flowers and spines; B: Flower; C: Longitudinal section of flower; D: Fruit; E: Seed. B. stenophylla. F: Stamen with anther dehiscing by two valves; G: Ovary; H: Longitudinal section of ovary (F-H after Hutchinson, 1973). longer shoots sometimes modified into style very short, stigma almost sessile, spines (Berberis), leaves entire or spinose- sometimes 3-lobed. Fruit usually a berry, serrate, venation pinnate or palmate, reticu- rarely a dehiscent capsule (Jeffersonia), or late, stipules absent. Inflorescence a ra- an achene (Achlys); seeds with small embryo, ceme, panicle (Nandina) or even solitary endosperm copious, sometimes with aril. (Jeffersonia). Flowers bisexual, Pollination by insects. Dispersal by birds or actinomorphic, hypogynous. Calyx with 3 to animals. Bladder-like capsule of Leontice dis- 6 sepals, free, imbricate, green (Podophyl- persed by wind. In Caulophyllum the fleshy lum) or petaloid (Berberis), rarely absent blue seeds burst through the ovary wall and (Achlys). Corolla with 3-6 petals, sometimes develop in completely exposed state. more, free, inner whorl often in the form of petaliferous nectaries, rarely absent Economic importance: Many species of Ber- (Achlys). Androecium with usually 6 sta- beris (B. buxifolia, B. darwinii), Mahonia (M. mens, opposite the petals, sometimes upto aquifolium) and Nandina (N. domestica) are 18 (Podophyllum) or reduced to 4 (Epimedium), commonly grown as ornamentals. The rhi- anthers bithecous, dehiscence by longitu- zomes of Podophyllum hexandrum (May apple) dinal valves opening from base upwards, yield a resin which is used as a purgative, sometimes by longitudinal slits (Nandina, and incorporated in many laxative pills. Podophyllum), pollen grains usually tricolpate. Gynoecium with 1 carpel, ovary Phylogeny: The family includes genera superior, unilocular with many ovules, which are quite distinct from one another. sometimes with 1 ovule (Nandina), Chapman (1936) on the basis of carpellary anatropous, placentation parietal or basal, anatomy proposed that Berberidaceae and Major Families of Angiosperms 509

Ranunculaceae arose by parallel evolution and included all the 4 families under order from a proranalian complex, and also doubted Berberidales. The recent classifications whether any existing families may be treat them under the same family related as the immediate predecessors of Berberidaceae which is considered to be Berberidaceae. She also demonstrated that monophyletic as supported by morphology single carpel of this family arose from and DNA data. The family is placed under ancestors having 3 carpels with axile order Ranunculales along with placentation, and that two carpels were Ranunculaceae and other related families suppressed and their placentae moved in most of the recent systems. Nandina is towards one side of the ovary, and the locules considered to be sister to rest of the family lost by compression, resulting in a unilocular and often included under separate subfamily condition. According to Kim & Jansen (1998) Nandinoideae, and rest of the genera under the gynoecia of the n = 6 clade alone Berberidoideae. A number of distinct clades (Epimedium, Podophyllum, Jeffersonia) being are recognized within Berberidoideae derived from two carpels. Hutchinson (1973) (Loconte, 1993). Leontice, Gymnospermum and separated the genera included here under Caulophyllum are characterized by three families: Berberidaceae (including petaliferous nectaries (staminodes), pollen woody genera Berberis and Mahonia in which with reticulate sculpturing and basal anthers open by flaps), Nandinaceae (single placentation. Similarly Epimedium, woody genus with 2-3 times pinnate Vancouveria and Jeffersonia are distinct in compound leaves and anthers opening by the sense that large fleshy blue seed slits) and Podophyllaceae (including develops in an exposed condition. Thorne herbaceous genera). Interestingly, whereas (2003, 2006, 2007) recogniszes 4 subfamilies former two were included under order under Berberidaceae: Nandinoideae, Berbe- Berberidales, the last family was included ridoideae, Leonticoideae and Podophylloi- under Ranales along with Ranunculaceae, deae. APweb (2008) recognizes only two, Nymphaeaceae, Ceratophyllaceae, etc. monogeneric Nandinoideae and Berberidoi- Takhtajan also segregated Ranzaniaceae deae including rest of the genera.

* * * * * * * * * * *

Ranunculaceae M. Adanson Buttercup or Crowfoot family 58 genera, 2,505 species Primarily in temperate and boreal regions of the Northern Hemisphere.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Ranunculidae Magnoliidae Ranunculidae Series+/Superorder Thalamiflorae+ Ranunculanae Ranunculanae Ranunculanae Eudicots* Order Ranales Ranunculales Ranunculales Ranunculales Ranunculales Ranunculales 510 Plant Systematics

Figure 13.58 Ranunculaceae. Ranunculus muricatus. A: A portion of plant with flowers and fruits; B: Vertical section of flower; C: Petal with nectary; D: Stamen; E: Achene. Consolida ajacis. F: A branch with young inflorescence and an expanded inflorescence; G: Vertical section of flower; H: Stamen; I: Dehiscing follicle.(A-E, after Sharma and Kachroo, Fl. Jammu, 1983).

Salient features: Herbs, leaves with sheath- (Naravelia). Inflorescence of solitary flowers ing base, blade often divided, flowers bisexual, (Anemone) or cymose, sometimes racemes petals with nectary, stamens and carpels nu- (Delphinium) or panicles (Clematis natans). merous, free and spirally arranged, ovary su- Flowers bracteate (Clematis) or ebracteate perior, fruit a follicle or achene. (Anemone) bisexual (unisexual in Thalictrum), actinomorphic (zygomorphic in Delphinium) Major genera: Ranunculus (400 species), with spirally arranged stamens and carpels, Clematis (200), Delphinium (250), Aconitum hypogynous. Calyx with 5 (4 in Clematis) or (245), Anemone (150) and Thalictrum (100). many sepals, free, one (Delphinium) or all five (Aquilegia) sepals often produced into spur at Description: Mostly herbs, sometimes woody base. Corolla with 5 or many (Helleborus) climbers (Clematis), or shrubs (Xanthorhiza). petals, free, often with nectaries or Stem with scattered or several rings of represented only by nectaries (Delphinium), vascular bundles. Hairs simple. Leaves sometimes produced into spur which enters usually alternate (opposite in Clematis), the spur formed by sepal, sometimes undivided (Caltha) palmately lobed perianth is not differentiated (Anemone, (Ranunculus) or compound (Clematis), stipules Helleborus) into sepals and petals. absent (present in Thalictrum). Tendrils for Androecium with many stamens, free, support may sometimes be formed from spirally arranged, anthers often extrorse, petiole (Clematis) or terminal leaflet dehiscence longitudinal. Gynoecium with Major Families of Angiosperms 511 single (Consolida) or many free (Delphinium) tis, with 3-merous perianth, vessels with carpels (syncarpous in Nigella), unilocular scalariform perforations, ovule with two in- (multilocular in Nigella) with single teguments, and fleshy follicles occupies a (Ranunculus) or many (Delphinium) ovules, unique basal position along with placentation marginal or basal, rarely axile Glaucidium, as evidenced by molecular data. (Nigella), ovary superior, style 1, sometimes Both these genera were removed by feathery (Clematis), stigma 1. Fruit an Takhtajan (1997) into distinct families achene (Ranunculus), follicle (Delphinium), Hydrastidaceae and Glaucidiaceae, under berry (Actaea) or rarely a capsule (Nigella); Hydrastidales and Glaucidiales, respec- seed with small embryo, endosperm present. tively. Thorne (2003) includes Glaucidia- Pollination usually by insects. Clematis and ceae under Paeoniales, but Hydrastidaceae Anemone, which lack nectaries are near Ranunculaceae under Ranunculales. pollinated by pollen-gathering insects. Studies based on cpDNA restriction sites Ranunculus, Delphinium, etc., with nectaries and sequence data (Hoot, 1995) suggest that by usually bees. Some species of Thalictrum these two genera along with other genera are wind pollinated. Achenes may be placed in Thalictroideae form basal provided with hairs for wind dispersal paraphyletic group, thus justifying retain- (Clematis), with tubercles or hooked spines ing all these genera within Ranunculaceae. for dispersal by animals (Ranunculus). These basal genera retain plesiomorphies Berries of Actaea are mainly dispersed by such as presence of berberine, yellow creep- birds. ing rhizomes, small hairs and small chromosomes, linking them to Berberidaceae. Economic importance: Delphinium (Lark- The separation of follicle bearing genera spur), Anemone (windflower), Aquilegia under Helleboraceae by Hutchinson is re- (columbine), Ranunculus (buttercup), and jected by the evidence from floral anatomy. Helleborus (hellebore) are grown as The reduction in the number of ovules per ornamentals. Aconitum napellus yields aco- carpel and the evolution of achenes has oc- nite, whereas A. ferox is source of bikh poi- curred several times within the family. The son. Roots of Hydrastis (removed by separation is also negated by nucleotide se- Takhtajan to Hydrastidaceae) are used for quences (Hoot, 1995). The petals with stomach ailments. Seeds of Nigella sativa nectary are often considered to represent (Nigella, black seed, ‘Kalonji’) are used as fla- petaliferous nectaries, the petals being ab- vouring, medicinally to treat asthma, bron- sent. According to Erbar et al., (1999) they chitis and rheumatism. Thymoquinone ex- are interpreted as being derived from sta- tracted from the seeds of this species have mens, and that stamens are secondarily recently been found to be useful in treatment spiral. Thorne (2003, 2006) divides family of cancer. Ranunculaceae into 3 subfamilies: Coptidoideae, Isopyroideae (Thalictroideae Phylogeny: The family is largely considered in 2007 revision) and Ranunculoideae. to be a monophyletic group as supported by Stevens (APweb, 2006) recognizes 5, adding morphology and molecular evidence. Hydras- Hydrastidoideae and Glaucidioideae.

* * * * * * * * * * * 512 Plant Systematics Papaveraceae A. L. de Jussieu Poppy family 50 genera 830 species Widely distributed, primarily in temperate regions of the Northern Hemi- sphere, also in Southern Africa and Eastern Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Magnoliidae Ranunculidae Magnoliidae Ranunculidae Series+/Superorder Thalamiflorae+ Ranunculanae Ranunculanae Ranunculanae Eudicots* Order Parietales Papaverales Papaverales Papaverales Ranunculales Ranunculales

Salient features: Herb, sap usually milky merous stamens (Papaver), sometimes 4 and or coloured, flowers bisexual, sepals opposite the petals (Corydalis) or 6 in two bun- caducous, petals crumpled in bud, stamens dles of 3 each (Dicentra), anthers bithecous, numerous in several whorls, ovary superior, (in Fumaria of the 6 stamens 2 are with unilocular, fruit a capsule. bithecous anthers, 4 with monothecous anthers) dehiscence longitudinal, pollen grains Major Genera: Corydalis (380 species), Pa- tricolpate to polyporate. Gynoecium with paver (100), Fumaria (50), Argemone (30) and usually 2 united carpels, sometimes loosely Eschscholzia (10). united and becoming free in fruit (Platystemon), ovary superior, unilocular Description: Annual or perennial herbs, with parietal placentation, sometimes be- rarely soft-wooded shrubs (Dendromecon), or coming multilocular due to intrusion of pla- small trees (Bocconia), vascular bundles of- centae, ovules numerous, sometimes 1 ten in several rings, white or coloured la- (Baccopia), anatropous, stigma discoid or tex. Hairs simple, sometimes barbellate lobed, sometimes capitate. Fruit a capsule (Cathcartia). Leaves usually alternate, floral dehiscing by valves or splitting into 1-seeded leaves sometimes subopposite (Platystemon), segments, sometimes nut (Fumaria); seeds simple, often much dissected, sometimes small, sometimes with aril, embryo minute, entire (Dendromecon) or spinose (Argemone), endosperm copious, fleshy or oily. Pollina- venation reticulate, stipules absent. Inflo- tion usually by insects, rarely wind rescence usually with solitary flowers, (Bocconia). Seeds are dispersed by explosive scapigerous in Sanguinaria, racemose in opening of capsules, those with aril often by Eomecon, paniculate in Bocconia. Flowers ants. bisexual, actinomorphic, sometimes zygomorphic (Fumaria, Corydalis). Calyx with Economic importance: Many species of Pa- 2 sepals, sometimes 3, caducous or paver (poppy), Eschscholzia (Californian calyptrate, free, usually enclosing bud. Co- poppy), Argemone (Prickly poppy), Corydalis rolla with usually 4 petals, sometimes 6 or (harlequin), Sanguinaria (blood-root) and even 8-12 (Sanguinaria), free, usually in two Dicentra (Dutchman’s breeches, bleeding whorls, two outer sometimes saccate or heart) are grown as ornamentals. Opium spurred containing nectary (Fumaria, Cory- poppy (Papaver somniferum) is the most valu- dalis), inner sometimes connivent at tip able member yielding opium (obtained from (Fumaria), imbricate, often crumpled in bud, the latex of capsules) and its derivatives absent in Bocconia. Androecium with nu- heroin, morphine and codeine. Seeds of this Major Families of Angiosperms 513

Figure 13.59 Papaveraceae. Papaver nudicaule. A: Plant with flowers; B: Fruit with bristly hairs. P. rhoeas. C: Vertical section of flower; D: Gynoecium with one stamen still attached, others having shed; E: Transverse section of ovary with intruded placentae; F: Fruit with glabrous surface and broad stigmatic disc. G: Argemone ochroleuca with flowers and a fruit towards the base with conspicuous style; H: Fruit of A. mexicana with sessile style; I: Seed of A. mexicana.. (A-B after Polunin and Stainton, Fl. Himal., 1984). species do not contain opium and as such sometimes treated under distinct family are used in baking, and also yield a drying Fumariaceae (Hutchinson, 1926, 1973; oil. Seeds of Glaucium flavum and Argemone Lawrence, 1951; Cronquist, 1988; Dahlgren, mexicana also yield oils used in the manu- 1989 and Takhtajan) but morphological and facture of soaps. nucleotide sequence data supported the monophyly of the family including these Phylogeny: The family is considered to be genera, which are better placed under related backwards to Helleboraceae subfamily Fumarioideae (Thorne, 2003; Judd (Hutchinson, 1973) but with syncarpous et al., 2002). APG II also optionally include gynoecium and parietal placentation, and Fumariaceae under Papaveraceae. There is, very clearly forwards to Brassicaceae, which however, difference of opinion regarding basal also has parietal placentation but with false genera. Loconte et al., (1995) proposed Platy- septum. Genera with zygomorphic flowers, stemonoideae (Platystemon and relatives) and with saccate or spurred petals are with numerous slightly fused carpels and free 514 Plant Systematics stigmas as the basal clade. Hoot et al., (1997) Papaveroideae, Eschscholzioideae, Chelidon- on the other hand, on the basis of morphology ioideae, Hypecoideae and Fumarioideae. and nucleotide sequence, regarded The family was earlier placed closer to Pteridophyllum as sister to the remaining Brassicaceae and Capparaceae, due to the genera. This monotypic genus has been parietal placentation, but has now been removed to a distinct family Pteridophyllaceae shifted closer to (or under) Ranunculales, by Takhtajan (1997), Thorne ( 2003, 2006, the shift supported by chemical evidence— 2007) APG II and APWeb. Thorne (2007) absence of glucosinolates and the presence divides Papaveraceae into 5 subfamilies: of alkaloid benzylisoquinolene.

* * * * * * * * * * *

Subclass 7. Hamamelididae (B) 6. Iteaceae 7. Pterostemonaceae Superorder 1. Hamamelidanae 8. Grossulariaceae Order 1. Hamamelidales 9. Haloragaceae (B) Suborder 1. Trochodendrineae 3. Juglandales Family 1. Trochodendraceae 1. Juglandineae 2. Cercidiphyllaceae 1. Rhoipteleaceae 2. Hamamelidineae 2. Juglandaceae 1. Altingiaceae 2. Myricineae 2. Hamamelidaceae 1. Myricaceae 3. Daphniphyllaceae 4. Betulales 2. Saxifragales 1. Nothofagaceae 1. Tetracarpaeaceae 2. Fagaceae 2. Crassulaceae 3. Ticodendraceae 3. Penthoraceae 4. Betulaceae 4. Saxifragaceae 5. Casuarinaceae 5. Aphanopetalaceae (B)

Saxifragaceae A. L. de Jussieu Saxifrage family 30 genera 525 species Widespread but best represented in the Northern Hemisphere, mainly in the temperate and arctic climate.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb) Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Hamamelididae Series+/Superorder Calyciflorae+ Saxifraganae Rosanae Hamamelidanae Core Eudicots* Order Rosales Rosales Saxifragales Saxifragales Saxifragales Saxifragales B & H as Saxifrageae Major Families of Angiosperms 515

Figure 13.60 Saxifragaceae. Bergenia ciliata. A: Plant with basal leaves and corymbose panicle carried on a long scape; B: Flower with petals distinctly larger than nearly cup- shaped calyx. Saxifraga flagellaris. C: Plant with thick stolons, small leaves and few flowers; D: Flower with almost free sepals, both pedicel and sepals glandular. E: Flower with calyx and gynoecium, petals and stamens removed; F: Stamen; G: Transverse section of ovary with axile placentation. Astilbe rivularis. H: Portion of bipinnate leaf and a paniculate inflorescence alongside; I: Flower lacking petals, with 5 stamens and 2 carpels; J: Seed, tailed at both ends.

Salient features: Perennial herbs, leaves Description: Perennial herbs, vessel ele- alternate, gland-toothed, stipules absent, ments with simple perforations, often with flowers actinomorphic, usually perigynous, tannins, sometimes cyanogenic. Leaves sepals and petals 5 each, stamens 5 to 10, alternate, usually in basal rosette, simple carpel 2, united, ovary superior, placentation or pinnately or palmately compound, vena- axile, fruit a capsule. tion pinnate or palmate, reticulate, stipules absent or represented by expanded margins Major genera: Saxifraga (310 species), of petiole base. Inflorescence racemose or Heuchera (50), Chrysoplenium (45), Mitella cymose, rarely with solitary flowers. (18), Astilbe (18) and Bergenia (6). Flowers bisexual, rarely unisexual, (plants 516 Plant Systematics monoecious or dioecious), actinomorphic, Asterids. Similarly separation of rarely zygomorphic, usually perigynous with Parnassiaceae is in agreement with data distinct hypanthium, rarely epigynous. from floral anatomy (Bensel & Palser 1975b, Calyx usually with 5 sepals, rarely 4, free c). The family has long been considered as or connate, often persistent. Corolla usu- closely related to Rosaceae. Astilbe of ally with 5 petals, free, often clawed, imbri- Saxifragaceae can be confused with Aruncus cate or convolute, sometimes reduced or of Rosaceae but the former quite often have absent. Androecium with 5 to 10 stamens, opposite leaves, their carpels are usually two free, anthers bithecous, dehiscence longi- and connate at the base, and their stamens tudinal, pollen grains tricolporate. are fewer. These resemblances are mainly Gynoecium with usually 2 carpels, rarely superficial. There are two major clades in up to 5, united, free or adnate to Saxifragaceae, Saxifraga s. str. and the hypanthium, ovary superior or inferior, Heuchera clade, members of the latter con- placentation axile or parietal, ovules nu- taining the bulk of the floral variation in the merous, styles free, stigmas free, capitate. family (Soltis et al., 2001). Generic limits are Fruit a septicidal capsule or follicle; seed unclear; hybridization is extensive and there with small straight embryo surrounded by are various combinations of chloroplast and endosperm. Pollination mainly by insects. nuclear genomes. For example, the Seeds dispersed by wind or passing animals. chloroplast genome of Tellima is also found in Mitella (Soltis et al., 1993). However, the Economic importance: The family has lit- unitegmic Darmera with scapigerous inflores- tle economic importance with a few genera cence is properly to be retained in Saxifraga, and Astilbe grown in rock gardens Saxifragaceae (Gornall 1989). Thorne had or perennial borders. earlier placed Saxifragales under Rosidae but has subsequently (2003, 2006, 2007) shifted Phylogeny: The family was earlier broadly it to newly created subclass Hamamelididae, circumscribed to include genera, which have under superorder Hamamelidanae, order now been separated to different families such Saxifragales. The family is monophyletic as as Grossulariaceae (Ribes), Hydrangeaceae evidenced by data from cpDNA restriction (Hydrangea—separated by Thorne (2003) to sites, rbcL, matK, and 18S sequences and Asteridae—>Cornanae—>Hydrangeales morphology. The members, in addition share (Cornales in 2007); Asterids—>Cornales in an rpl2 intron deletion. Recent studies have APG II), Parnassiaceae (Parnassia—under shown that genera like Saxifraga and Mitella Rosidae—>Celastranae—>Celastrales by are not monophyletic. In addition hybridiza- Thorne; Eurosids I—>Celastrales by APG II tion often causes taxonomic problems. and APweb), etc. Hydrangeaceae are woody, Thorne (2006, 2007) recognizes two sub- tenuinucellate and unitegmic and related to families Astilboideae and Saxifragoideae.

* * * * * * * * * * * Major Families of Angiosperms 517 Fagaceae Dumortier Oak family 9 genera 990 species Widespread in tropical and temperate regions of the Northern Hemi- sphere.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Hamamelidae Hamamelididae Magnoliidae Hamamelididae Series+/Superorder Unisexuales+ Faganae Rosanae Hamamelidanae Eurosids I* Order Fagales Fagales Fagales Betulales Fagales B & H under Cupuliferae

Salient features: Trees or shrubs with tan- in female flower. Gynoecium with usually 3 nin, leaves alternate, simple, entire or ser- carpels, rarely upto 12, united, ovary infe- rate, stipules present, inflorescence cymose, rior, locules as many as carpels, placentation female flowers usually in groups of 1-3, as- axile, ovules 2 in each chamber but only one sociated with scaly cupule, carpels usually in whole ovary developing, pendulous, 3, ovary inferior, placentation axile, fruit a bitegmic, outer integument vascularized, nut, closely associated with cupule. styles free, stigmas porose or expanded along upper side of style, fertilization porogamous. Major genera: Quercus (430 species), Fruit a nut (acorn) closely associated with Lithocarpus (280), Castanopsis (100), Casta- and surrounded at base (Quercus) or com- nea (12) and Fagus (8). pletely (Castanea) with cupule, cupule often hardened and woody, sometimes spiny (Cas- Description: Trees or shrubs, deciduous or tanea), indehiscent (Quercus) or dehiscent evergreen, tannins present, hairs simple or by splitting of cupule like pericarp into stellate, sometimes glandular. Leaves sim- valves (Castanea); seed single, without ple, alternate, sometimes lobed, entire or endosperm. Flowers of Fagus and Quercus are serrate, venation pinnate, reticulate, stip- wind pollinated, those of Castanea and ules present, early deciduous, often narrowly Castanopsis produce strong odour and are pol- triangular. Inflorescence cymose, male flow- linated by flies, beetles and bees. Fruits are ers in slender catkins or spikes, females dispersed by birds and rodents. flowers solitary or in groups of upto three, associated with a scaly cupule formed of sev- Economic importance: Species of Castanea eral imbricate scales, male and female flow- (chestnut) yield nuts which are eaten after ers sometimes in the same inflorescence roasting, but have a very short shelf life, (Castanea, Lithocarpus). Flowers small, uni- turning rancid within a few days. Fruits of sexual (plants monoecious), actinomorphic. some species of Quercus (oak) and Fagus Perianth with 4-6 tepals, reduced, free or (beech) are also occasionally eaten. Cork is slightly connate, imbricate. Androecium made from the bark of Quercus suber. Wood with 4-numerous stamens, filaments free, of several species is a source of timber used filiform, anthers erect, bithecous, loculi of- for construction, furniture, barrels and ten contiguous, dehiscence longitudinal, cabinetry. Several species of Quercus, Fagus, pollen grains usually tricolporate or Castanea and Castanopsis are grown as tricolpate, staminodes sometimes present ornamentals. 518 Plant Systematics

Figure 13.61 Fagaceae. Quercus robur. A: Branch with lobed leaves and long peduncled female flower; B: Young shoot with male catkin; C: Male flower; D: Fruit enclosed upto nearly half by cupule. E: Branch of Castanea sativa with long spikes each bearing single female flower at base and numerous male flowers above, cupule spiny. Castanopsis indica. F: Branch with several spikes; G: Fruiting spike. Lithocarpus pachyphylla. H: Portion of branch with leaves; I: Portion of fruiting branch with nuts in groups of three.

Phylogeny: The family is closely related to cupule has been a subject of considerable dis- Betulaceae and the two are usually placed cussion. It is generally regarded to represent under the same order, although Takhtajan a cymose inflorescence in which outer axes places only Fagaceae and Nothofagaceae un- of the cyme are modified into cupule valves der Fagales and separates Betulaceae and which bear scales or spines (Manos et al., others under Corylales. The family is mono- 2001). The cupules of Nothofagus (which was phyletic as supported by morphology, cpDNA earlier placed (Hutchinson, 1973, Cronquist, restriction sites (Manos et al., 1993) and matK 1981) under Fagaceae but now separated sequences (Manos and Steele, 1997). Casta- under Nothofagaceae) are composed of clus- nea, Lithocarpus and Chrysolepis have re- tered bracts and stipules and not homologous tained numerous plesiomorphic morphologi- with the cupule of Fagaceae. Heywood (1977) cal characters such as monoecious inflores- recognized three subfamilies under cences, perianth better developed, exserted Fagaceae: Fagoideae, Quercoideae and stamens and minute stigmas. The nature of Castanoideae. Fagus is sister to rest of the Major Families of Angiosperms 519

Fagaceae and placed singly under subfamily Thorne. Thorne had earlier (1999) placed Fagoideae. Trigonobalanus is considered sis- Betulales under Rosidae—>Rosanae but has ter to the rest of family (excluding Fagus) and subsequently (2003, 2006, 2007) shifted it to as such removed together with Hamamelididae—>Hamamelidanae. APG II Colombobalanus and Formanodendron under and AP web prefer order name Fagales placed fourth subfamily Trigonobalanoi-deae by under the clade Eurosids I.

* * * * * * * * * * *

Betulaceae S. F. Gray Birch family 6 genera 140 species Widespread in temperate and boreal regions, Alnus being distributed in South America in Andes and Argentina.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Hamamelidae Hamamelididae Magnoliidae Hamamelididae Series+/Superorder Unisexuales+ Faganae Rosanae Hamamelidanae Eurosids I* Order Fagales Corylales Fagales Betulales Fagales B & H under Cupuliferae

Salient features: Trees or shrubs with tan- secondary veins running into serrations, nin, bark sometimes exfoliating in thin lay- stipules present. Inflorescence a catkin, ers, leaves alternate, simple, doubly serrate, with separate male and female inflores- stipules present, inflorescence a catkin, cences but plant monoecious, male inflores- male and female inflorescences distinct, cence usually pendulous, female short and tepals 2-4, stamens 2-4, perianth absent in erect, flowers borne singly at each node of female flower, carpels usually 2, catkin or in cymose cluster of 2-3, adhering placentation axile, fruit a nut, surrounded to involucre of bracts and bracteoles. In by fused bract and bracteoles. Alnus, female inflorescence has each cymose cluster with 2 flowers associated Major genera: Betula (55 species), Alnus (30), with 1 bract, two secondary bracteoles and 2 Carpinus (28), Corylus (15), Ostrya (10) and tertiary bracteoles all connate into woody per- Ostryopsis (2). sistent involucre. In Betula, there are 3 female flowers in the cluster with 1 bract, 2 Description: Trees or shrubs, deciduous, bracteoles, all fused into a 3-lobed ‘bract’ or tannins present, bark smooth or scaly, with involucre. Flowers small, unisexual (plants prominent horizontal lenticels, sometimes monoecious), actinomorphic. Perianth with exfoliating in thin layers, hairs simple, glan- usually 2-4 tepals, rarely 1 or upto 6, reduced, dular or peltate. Leaves simple, alternate, free, imbricate, absent in male (Coryloideae) doubly serrate, venation pinnate, reticulate, or female flower (Betuloideae). Androecium 520 Plant Systematics

Figure 13.62 Betulaceae. Betula utilis. A: Portion of branch with male catkins, appearing before or along with leaves; B: Branch with female spikes; C: Single stamen (second one removed) with bracteole and forked filament separating anthers; D: Bract and lateral bracteoles of male flower; E: Fused bract and bracteoles of female flower; F: Young winged carpel; G: Nut with 2 wings and persistent styles. Alnus nitida. H: Branch with slender male catkins towards top and ovoid female spikes lower down; I: Male flower with 4 tepals and 4 stamens; J: Nut with 2 wings. (A-B, after Polunin and Stainton, Fl. Himal, 1984). with 2 (Betula) or 4 (Alnus) stamens, rarely 1 times bladder-like (Ostrya); seed solitary pen- or upto 12 (Coryloideae), sometimes appear- dulous, embryo straight, cotyledons large, ing many due to close association of three endosperm absent. Flowers are wind polli- flowers, filaments free or connate at base, nated, and emerge before leaves. Winged anthers bithecous, loculi distinct or contigu- fruits of Betula and Alnus are dispersed by ous, dehiscence longitudinal, pollen grains wind. Large nuts of Corylus are dispersed by usually 2-multiporate, staminodes absent in rodents. female flower. Gynoecium with 2 united carpels, ovary inferior, bilocular, Economic importance: Papery bark of Betula placentation axile, ovules 2 in each cham- utilis (birch) was used as a writing surface ber but only one in whole ovary developing, (bhojpatra) in place of paper in ancient Vedic pendulous, unitegmic, styles free, cylindri- manuscripts; also used for roofing and um- cal, stigma running along adaxial side of brella covers. B. lutea and B. lenta are im- style, pistillode absent in male flower. Fruit portant hardwoods in North America provid- a single-seeded nut or 2-winged samara of- ing wood used for plywood, boxes and turn- ten with persistent styles, involucre of bract ery. Alnus rubra (alder) provides a valuable and bracteoles deciduous or persistent, scaly timber which is a good imitation of ma- and woody or enlarged and foliaceous, some- hogany. Nuts such as hazelnuts, filberts Major Families of Angiosperms 521 from species of Corylus are edible. Many spe- winged samara) and Coryloideae (male flower cies of Betula, Alnus, Corylus, Ostrya are without perianth, female with perianth, sta- grown as ornamentals. mens usually more than 3, involucre foliaceous, nut not flattened). Nuclear ribosomal Phylogeny: The family is closely related to ITS and rbcL sequences also support these Fagaceae and the two are usually placed two subfamilies (Chen et al., 1999). under the same order, although Takhtajan Hutchinson treated them as distinct fami- places only Fagaceae and Nothofagaceae lies, also proposing that as the female flow- under Fagales and has separated ers of Betulaceae lack perianth, the ovary Betulaceae and others under Corylales. The is superior, and that of Corylaceae with peri- family is usually divided into two sub- anth and ovary is inferior, a contention not families: Betuloideae (male flowers with supported by other authors. Both groups are perianth, female lacking perianth, stamens monophyletic, although monophyly of Ostrya 2 or 4, involucre scaly or woody, fruit 2- and Carpinus is doubtful (Yoo & Wen, 2002).

* * * * * * * * * * *

Casuarinaceae R. Brown She-Oak family 4 genera 96 species Widespread in Southeast Asia and Australia, naturalized in the coastal regions of tropical and subtropical Africa and America. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Hamamelidae Hamamelididae Magnoliidae Hamamelididae Series+/Superorder Unisexuales+ Casuarinanae Rosanae Hamamelidanae Eurosids I* Order Casuarinales Casuarinales Casuarinales Betulales Fagales

Salient features: Usually trees with jointed jointed with circular sheath at nodes (switch stems, appearing like conifers, leaves scale- habit), branches grooved, photosynthetic, like, whorled at nodes, inflorescence catkin, sometimes aromatic (Allocasuarina), sieve- flowers unisexual, subtended by bracts, peri- tube plastids S-type, nodes unilacunar, roots anth absent, stamen 1, carpels 2, united, with nodules containing nitrogen-fixing bac- ovary superior, fruit a samara, fruits aggre- teria, tannins present . Leaves whorled (4- gated like cones. 20 in a whorl), scale-like, connate forming a toothed sheath at each node, stipules ab- Major genera: Allocasuarina (55 species), sent. Inflorescence forming catkins at tips Casuarina (25), Gymnostoma (14) and of lateral branches. Flowers small, uni- Ceuthostoma (2), often combined into single sexual (plants monoecious or dioecious), genus Casuarina. actinomorphic, solitary in axil of each bract of inflorescence, associated with Description: Trees or shrubs with a weep- 2 bracteoles. Perianth absent in female ing habit due to long slender branches, stems flower, sometimes represented by 522 Plant Systematics

Figure 13.63 Casuarinaceae. Casuarina suberba. A: Branch with male inflorescences; B: Portion of male inflorescence; C: Male flower with single stamen; D: Portion of branch with female inflorescences; E: Part of female inflorescence showing 3 flowers; F: Female flower with bract, 2 small bracteoles and gynoecium with 2 long stylar branches; G: Fruits; H: Seed with broad wing; I: Longitudinal section of seed.

1-2 vestigial scales in male flower (often in- Economic importance: The wood of several terpreted as inner bracteoles). Androecium species is extremely hard and valued for fur- with single stamen, anthers bithecous, niture making. Casuarina equisetifolia (red incurved in bud, dehiscence longitudinal, beefwood) is most widely cultivated as orna- pollen grains usually triporate. Gynoecium mental tree. with 2 united carpels, ovary superior, bilocular with axile placentation, one often reduced Phylogeny: The family is monophyletic, as and ovary appearing unilocular, ovules 2 but are the four genera recognized independ- only one developing, orthotropous, bitegmic, ently or combined into Casuarina. The fam- crassinucellate, style short with 2 linear ily is considered to be a part of the branches. Fruits crowded into cones with Hamamelid complex, now included along persistent bracts, fruit an indehiscent with the broadly circumscribed Rosalean samara associated with 2 woody bracteoles complex Rosanae (Dahlgren) or Rosidae which open like a capsule; seed with straight (Thorne, 1999 under order Casuarinales; embryo, without endosperm. Wind polli- subsequently shifted to Hamamelididae— nated. Fruits are also dispersed by wind. >Hamamelidanae—>Betulales in 2003, Major Families of Angiosperms 523

2006 and 2007). APG II and APweb include derived from Ephedraceae. The studies of the family under Fagales (under Eurosids), wood anatomy and floral anatomy have shifting Hamamelidaceae and some other shown that it is sufficiently advanced, families of the complex to Saxifragales. having undergone considerable reduction Fagales are the core of the old ‘Englerian, in floral features and vegetative morphol- Amentiferae which have since been demol- ogy. The genus was split into four genera ished, several members shifted to otherwise indicated above (Johnson and Wilson, 1993). entirely unrelated groups within the Eudicots Gymnostoma is sister to the rest of the (Qiu et al., 1998). The family Casuarinaceae family and has many plesiomorphous was once considered to be the most primi- features (both carpels fertile, with 2 ovules tive among dicots (Engler and Prantl) in each carpel).

* * * * * * * * * * *

Subclass 8. Caryophyllidae (B) 1. Achatocarpaceae 2. Chenopodiaceae Superorder 1. Berberidopsidanae 3. Amaranthaceae Order 1. Berberidopsidales 4. Caryophyllineae 1. Aextoxicaceae 1. Caryophyllaceae 2. Berberidopsidaceae 3. Polygonales Superorder 2. Caryophyllanae 1. Polygonaceae Order 1. Physenales 2. Plumbaginaceae 1. Physenaceae (B) 4. Tamaricales 2. Asteropeiaceae (B) 1. Tamaricaceae 2. Caryophyllales 2. Frankeniaceae 1. Cactineae 5. Nepenthales (B) 1. Portulacaceae 1. Ancistrocladaceae 2. Halophytaceae 2. Dioncophyllaceae 3. Cactaceae 3. Drosophyllaceae (B) 5. Basellaceae 4. Droseraceae 6. Didiereaceae 5. Nepenthaceae 2. Phytolaccineae Superorder 3. Dillenianae 1. Rhabdodendraceae (A) Order 1. Dilleniales 2. Simmondsiaceae (B) 1. Dilleniaceae 3. Stegnospermataceae 4. Limeaceae (B) Superorder 4. Santalanae 5. Nyctaginaceae Order 1. Santalales 6. Sarcobataceae (B) 1. Olacaceae 7. Petiveriaceae 2. Medusandraceae 8. Agdestidaceae 3. Misodendraceae 9. Phytolaccaceae 4. Loranthaceae 10. Gisekiaceae 5. Opiliaceae 11. Lophiocarpaceae (B) 6. Santalaceae 12. Aizoaceae 7. Viscaceae 13. Barbeuiaceae Superorder 5. Balanophoranae 14. Molluginaceae (B) Order 1. Balanophorales 3. Chenopodiineae 1. Balanophoraceae 524 Plant Systematics Portulacaceae A. L. de Jussieu Purslane family 28 genera, 440 species Widely distributed in tropical and temperate regions, mainly North and South America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Caryophyllidae Caryophyllidae Magnoliidae Caryophyllidae Series+/Superorder Thalamiflorae+ Caryophyllanae Caryophyllanae Caryophyllanae Core Eudicots* Order Caryophyllineae Caryophyllales Caryophyllales Caryophyllales Caryophyllales Caryophyllales

Figure 13.64 Portulacaeae. Portulaca oleracea. A: Portion of plant with flowers; B: Flowers seen from above; C: Flower enlarged in vertical section; D: Stamen; E: Transverse section of ovary with free central placentation;. F: Seed; G: Embryo. Major Families of Angiosperms 525

Salient features: Usually succulent herbs, (Portulaca oleracea) commonly growing wild mucilaginous, roots somewhat tuberous, is frequently cultivated as pot herb. Many leaves simple, flowers in cymes or solitary, species of Montia (Miner’s lettuce) were used bisexual, sepals 2, carpels united with unilo- earlier as green salad in America. Root cular ovary, fruit a capsule, embryo curved. stalks of Lewisia rediviva are also eaten in America. Rose moss (Portulaca grandiflora), Major Genera: Calandrinia (120 species), Flame flower (Talinum spp.) and Rock purs- Portulaca (100), Claytonia (35), and Talinum lane (Calandrinia spp.) are grown as (30). ornamentals. Description: Annual or perennial herbs, Phylogeny: The family Portulaceae has tra- somewhat succulents, Mucilage cells very ditionally been considered closely related to common, containing betalains, often exhib- Caryophyllaceae and Basellaceae, although iting CAM metabolism, hairs usually simple. the presence of betalains has often taken Stems erect or prostrate, herbaceous. Leaves this family away from Caryophyllaceae. alternate or opposite, simple, usually fleshy, Phylogeny of Portulacaceae has been a mat- entire, often clustered at ends of branches, ter of considerable speculation. The separa- stipules scarious or setose, rarely absent. tion of Basellaceae and Didiereaceae is sup- Inflorescence cymose with few or of solitary ported by morphological data. Cactaceae is flowers, sometimes racemose. Flowers showy, considered as more closely related to bisexual, usually actinomorphic, with short Cactaceae (although separation is supported or elongated hypanthium. Calyx of 2 sepals, by ITS sequence data) and Thorne (2006) has antero-posterior, green, free or united at accordingly shifted family under suborder base. Corolla with usually 5 petals, rarely 4 Cactineae. Applequist and Wallace (2001) on or 6, free, rerely united at base, imbricate, the basis analysis of chloroplast gene ndhF falling early. Androecium with usually as in Portulacaceae, Basellaceae, Cactaceae, many stamens as petals, opposite petals, fila- and Didiereaceae concluded that the group ments free from petals or epipetalous, dehis- forms a monophyletic group with two major cence longitudinal, pollen tricolpate, clades. The first included Portulaca, polycolpate or polyporate. Gynoecium with 2 Anacampseros and its relatives, much of to 3 (rarely more) united carpels, ovary supe- Talinum, Talinella, and Cactaceae; the sec- rior or half-inferior, single chambered, with ond, weakly supported, included the remain- single basal ovule or several ovules on free- ing genera of Portulacaceae, Basellaceae, central placenta attached at the base of ovary, and Didiereaceae. The separation of these style simple or split above, stigma minute. families from Portulaceae renders it Fruit a loculicidal or circumscissile capsule; paraphyletic. Subsequent studies of these seeds lens-shaped, smooth, shining, embryo authors (2006) resulted in Stevens (2007) curved, endosperm absent, perisperm placing only genus Portulaca in the family present, aril sometimes developed. Pollina- Portulaceae, separating 10 genera (incl. tion by insects like bees, flies and beetles, Montia, Lewisia and Phemeranthus) to flowers opening briefly in full sunlight. Seeds Montiaceae and two (Talinum, Talinella) to with aril dispersed by ants, smaaler ones by Talinaceae. Thorne who earlier (2003, 2006) wind or water. recognized Hectorellaceae as a distinct fam- Economic importance: The family is of ily has in the latest revision (2007) merged little economic importance. Purslane it with Portulacaceae.

* * * * * * * * * * * 526 Plant Systematics Cactaceae A. L. de Jussieu Cactus family 122 genera, 1,810 species Mainly in arid climate, in deserts regions of North and South America, several species introduced in Africa, India and Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Caryophyllidae Caryophyllidae Magnoliidae Caryophyllidae Series+/Superorder Calyciflorae+ Caryophyllanae Caryophyllanae Caryophyllanae Core Eudicots* Order Ficoidales Caryophyllales Caryophyllales Caryophyllales Caryophyllales Caryophyllales B & H as Cacteae

Salient features: Succulents, fleshy habit, Androecium with numerous stamens, free usually spiny herbs or shrubs, spines ar- or adnate to the base of petals, bithecous, ranged in areoles, flowers solitary, petals dehiscence longitudinal, introrse, pollen many, stamens numerous, ovary inferior, grains tricolpate to polycolpate or polyporate. fruit a berry. Gynoecium with 2 to numerous carpels, united, ovary inferior, rarely semi-inferior Major Genera: Opuntia (250 species), (Pereskia) or even superior (some species of Mammillaria (190), Echinopsis (75), Cereus Pereskia), unilocular with numerous ovules, (55), Rhipsalis (50) and Cleistocactus (50). placentation parietal, sometimes divided by false septa or nearly basal (Pereskia), stig- Description: Spiny stem succulents, herbs, mas 2 to numerous, spreading, ovules sometimes tree-like, rarely non-succulent campylotropous, bitegmic, crassinucellate. (but with fleshy leaves-Pereskia) or epiphytic Fruit a berry, often covered with spines and/ (Rhipsalis), stem cylindrical or angled, some- or glochids; seeds numerous, immersed in times flattened, or even jointed, usually pho- pulp, testa often black, endosperm usually tosynthetic, usually with vessels, some- absent, embryo usually curved. Pollination times without vessels, usually without by insects, birds or bats. Berries are dis- laticifers, rarely with laticifers (Coryphantha), persed by animals or birds. plastids PIII-A type. Leaves usually borne on long shoots and readily falling, alternate sim- Economic importance: The family is known ple, entire with pinnate or obscure venation, for large number of ornamentals (cacti) such leaves sometimes represented by spines, or as Opuntia (prickly pear), Mammillaria (pin- absent, short shoots (areoles) with clusters cushion cactus), Cereus (hedge cactus), of spines and tufts of hairs (glochids); stip- Echinopsis (sea-urchin cactus), Epiphyllum ules absent. Inflorescence with solitary flow- (orchid cactus), Schlumbergera (Christmas ers, usually sunk at the apex of branch and cactus) and Rhipsalis (mistletoe cactus). thus appearing axillary, rarely in clusters Fruits of several species of Opuntia are eaten (Pereskia). Flowers bisexual, usually raw or made into jams or syrups. Spines of actinomorphic, with short or elongated cacti are often used as gramophone needles. hypanthium. Perianth sequentially Lophophora contains mescaline alkaloids intergrading from sepals to petals or all and is hallucinogenic. Cochineal dye is de- petaloid, spirally arranged, numerous, in- rived from small insects living on members nermost slightly coherent at base. of this family. Major Families of Angiosperms 527

Figure 13.65 Cactaceae. Opuntia rafinesqui. A: Portion of plant with flowers and spines; B: Verti- cal section of flower showing many stamens, inferior ovary and parietal placentation; C: Ovules with long funiculus; D: Longitudinal section of fruit; E: Longitudi- nal section of seed. F: Carnegiea gigantea with characteristic branched habit and ribbed stem.

Phylogeny: The family is unique in com- other two subfamilies form a well-defined bining unspecialized floral characters with clade with solitary flowers sunken into stem highly advanced vegetative organs. The fam- apices, inferior ovary and parietal ily is commonly divided into three sub- placentation. Opuntioideae are mono- families: Pereskioideae, Opuntioideae and phyletic based on synapomorphies of pres- Cactoideae (Heywood, 1978). Thorne (1999, ence of glochids on the areoles, seeds coat 2003, 2006, 2007) places the two genera of with bony aril and cpDNA characters. Pereskoideae under two separate sub- Cactoideae similarly has monophyly sup- families Pereskioideae (Pereskia) and ported by extreme reduction of leaves and a Maihuenioideae (Maihuenia), thus recogniz- deletion of the rpoCl intron in chloroplast ing 4 subfamilies in all. Pereskia retains genome (Wallace and Gibson, 2002). The af- several plesiomorphic features such as non- finities of Cactaceae have largely remained succulent stems, well-developed persistent uncertain. It is now considered to be closely leaves, cymose inflorescence, superior ovary related to Portulacaceae, Phytolaccaceae, (in some species) with basal placentation, Basellaceae, Halophytaceae, Didiereaceae and is sister to rest of the Cactaceae. The and Aizoaceae. Phylogenetic relationships 528 Plant Systematics within Cactaceae are still rather unclear, for the basal Pereskia. The distinctive with chloroplast and nuclear genes some- Blossfeldia was sister to the other times suggesting different major clades. A Cactoideae. Edwards et al. (2005) confirm recent study by Nyffeler (2002) found rather that Pereskia s.l. is probably paraphyletic, weak support for the subfamilies and per- which allows them to shed new light on the haps rather distressingly no clear monophyly evolution of the cactus habit

* * * * * * * * * * *

Nyctaginaceae A. L. de Jussieu Four O’Clock family 31 genera, 400 species Widely distributed in tropical and subtropical regions, mainly in the New World.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Caryophyllidae Caryophyllidae Magnoliidae Caryophyllidae Series+/Superorder Curvembryeae+ Caryophyllanae Caryophyllanae Caryophyllanae Core Eudicots* Order Caryophyllales Caryophyllales Caryophyllales Caryophyllales Caryophyllales

Salient features: Swollen nodes, wood to reddish-brown when cut. Roots branched quickly turning reddish-brown when cut, taprrot, sometimes thick and tuberous leaves usually opposite, sometimes unequal, (Mirabilis) or fusiform (Boerhavia). Leaves without stipules, vascular bundles in con- opposite, leaves of a pair equal or unequal, centric rings, flowers bisexual with con- simple, usually entire, net-veined, without spicuous bracts, bracts often enlarged, peri- stipules. Inflorescence with usually cymose anth 5 with long tube, stamens usually 5, clusters, usually dichasial, subsequently carpel single, ovule single, basal, fruit an monochasial. Flowers bisexual, complete, achene or nut. actinomorphic, subtended by an involucre of 3 (Bougainvillea) to 5 (Mirabilis) bracts which Major genera: Neea (80 species), Guapira are often enlarged and coloured (70), Mirabilis (45), Pisonia (40), Abronia (30), (Bougainvillea), sometimes reduced to small Boerhavia (20) and Bougainvillea. teeth (Boerhavia), hypogynous, flowers rarely unisexual (Pisonia). Perianth with 5 united Description: Herbs (Boerhavia, Mirabilis) of- tepals, campanulate (Boerhavia) or more ten with swollen nodes, shrubs (Pisonia) or commonly tubular, lower part of tube persist- woody climbers (Boungainvillea), rarely small ent and surrounding fruit (and known as trees (Pisonia alba), usually with concentric anthocarp), distal part usually petal-like and rings of vascular bundles, containing falling off. Androecium with 3-5 (Mirabilis), betalains and raphide crystals of calcium 5-10 (Bougainvillea) , or more, filaments free oxalate, woody oxidising, i.e., turning orange or connate, equal or unequal, anthers Major Families of Angiosperms 529

Figure 13.66 Nyctaginaceae. Bougainvillea glabra A: Portion of plant with flowers; C: Carpel; B: Longitudinal section of flower of B. spectabilis showing perianth and stamens. Mirabilis jalapa D: A portion of branch with flowers; E: Longitudinal section of of ovary with subtending bracts; F: Anthocarp. Boerhavia repens G: Portion of branch with flowers and fruits; H: Longitudinal section of flower to show perianth, stamens and ovary; I: Anthocarp. bithecous, basifixed or dorsifixed, dehiscence linated by bees, butterflies, moths and birds. longitudinal or by lateral slits, pollen grains Dispersal in species with fleshy perianth tricolpate or polyporate. Gynoecium with occurs by birds, those with glands and single carpel, ovary superior, but often ap- hooked hairs by exozoochory. pearing inferior due to closely associated persistent part of perianth tube, placentation Economic importance: Species Bougainvillea basal, ovule single, anatropous or are commonly grown as hedges and for cov- campylotropous, style long and filiform, ering walls and fences. Species of Mirabilis stigma capitate, nectar disc present. Fruit (Four O’Clock) are grown as garden an achene or nut, usually enclosed in leath- ornamentals. Boerhavia repens is used as ery or fleshy persistent perianth tube, lat- medicinal plant as a diuretic. Fisonia ter winged or or ribbed, often covered with aculeata is used as hedge plant. glandular hairs; seed small with unequal cotyledons, curved embryo, endosperm ab- Phylogeny: Hiemerl (1934) divided the sent, replaced by perisperm. Flowers are pol- family into 5 tribes: first four with glabrous 530 Plant Systematics ovary and stamens connate at base, and the (Aizoaceae) were confirmed by the studies fifth Leacastereae with hairy ovary and of D. Soltis et al. (2000). Monophyly of the distinct stamens. Of the first four, Miralileae family found moderate support in the studies has straight embryo and large cotyledons, of Douglas and Manos (2007). Stevens (2008) Pisoneae with shrubby habit, Boldoeae with recognises three more or less monophyletic herbaceous habit and alternate leaves, and groups within the family: Leucasterae (4 Colignoneae with herbaceous habit and genera), Boldoeae (3 genera) and the Rest opposite leas; all three have curved embryo. (24-25 genera). The South American The family is closely related to Phytolacca- Leucastereae and Mexican-Central ceae in anatomical features, and ovary with American Boldoeae are successively sister single carpel. The close affinities of the two taxa to the remainder of the family, positions families together with genus Delosperma that have moderate to strong support.

* * * * * * * * * * *

Aizoaceae Martynov Stone Plant family 122 genera, 1,790 species Widely distributed in tropical and subtropical regions, mainly in arid and coastal regions of South Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Caryophyllidae Caryophyllidae Magnoliidae Caryophyllidae Series+/Superorder Calyciflorae+ Caryophyllanae Caryophyllanae Caryophyllanae Core Eudicots* Order Ficoidales Caryophyllales Caryophyllales Caryophyllales Caryophyllales Caryophyllales B & H as Ficoideae

Salient features: Succulent herbs or small from base, sometimes mat-forming, vascu- shrubs, usually with many stems, leaves lar bundles in concentric rings, with with large bladder-like cells in epidermis, betalains, alkaloids and raphide crystals of petals several of staminodal origin, stamens calcium oxalate, usually with CAM metabo- usually many, carpels 2 or more, united, fruit lism. Leaves alternate or opposite, leaves of a capsule, embryo curved, surrounded by a pair equal (Sesuvium) or strongly unequal mealy endosperm. (Trianthema) with branches arising from axil of smaller leaf, simple, usually entire and Major genera: Conophytum (250 species), succulent, veins somewhat obscure, stipules Delosperma (150), Lapranthus (150), scarious or fringed, rarely absent, epidermis Drosanthemum (100), Antimima (60), Lithops with large bladder-like cells. Inflorescence (40) Mesembranthemum (30), Trianthema (20), of cymose axillary cymes, in pairs or solitary, Sesuvium (8), . terminal or axillary. Flowers bisexual, subtended by a pair of laciniate bracts often fused Description: Succulent herbs or small with calyx tube, regular, with hypanthium. shrubs, commonly with numerous stems Calyx with 5 connate sepals, imbricate, Major Families of Angiosperms 531

Figure 13.67 Aizoaceae. Trianthema portulacastrum. A: Portion of plant with flowers; B: Flower with two bracts and horned calyx lobes; C: Capsule; D: Seed with papilae. Sesuvium verrucosum E: Portion of plant with flowers F: Flower with horny calyx. G: Seed of S. maritimum.(A,B after Maheshwari, Fl. Delhi, 1963; D-G after Godfrey & Wooten, Aq.Wetland Pl. SE US, Vol. 2, 1981). often with horny protuberance on back below Dorotheanthus and Carpobrotus are grown as tip, persistent in fruit, margin scarious. Co- garden ornamentals. Some like Lithops rolla absent, represented by petaloid (stone plant) and Titanopsis are grown as staminodes, numerous. Androecium with 5 curiosities. Tetragonia is used as vegetable. to numerous stamens, many outer modified Some species help stabilize sand dunes and into petaloid staminodes, fertile stamens 5 road banks. or more, free or with connate filaments, arising from hypanthium, pollen tricolpate. Phylogeny: The family is monophyletic, Gynoecium with 2-5 united carpels, ovary represented by distinct clades, often superior or inferior, 2-5 locular, with axile, recognised as four subfamilies Aizooideae, parietal or basal placentation, ovules 1 to Mesembranthemoideae, Sesuvioideae and many, anatropous to campylotropous, disc Ruschioideae (Klak et al., 2004; Stevens, usually present. Fruit a capsule, loculicidal, 2008; Thorne, 2007). Members with septicidal, or circumscissile, sometimes numerous petaloid staminodes, placed in berry, rarely a nut; seed with large curved Mesembryanthemoideae and Ruschioideae embryo, sometimes with aril, endosperm ab- form a monophyletic group (Hartmann, sent, replaced by perisperm. Flowers are pol- 1993). Sesuvioideae (Sesuvium and related linated by bees, wasps, butterflies and bee- genera) probably form a clade based on tles. Seeds are dispersed by wind or water. circumscissile capsules and arillate seeds. Genus Mesembryanthemum was previously Economic importance: Species of circumscribed to include more than 1000 Mesembranthemum (ice plant), Lapranthus, species, but has subsequently been split into 532 Plant Systematics numerous genera, a bulk of genera shifted to divide the genus further into much to Ruschioideae. Brown (1920) had originally smaller genera, an attempt that would result split the genus into more than 100 genera, in many poorly characterized genera. A a suggestion not incorporated by Pax and detailed phylogenetic analysis of the family Hoffmann (1934), but subsequently followed by Klak et al. (2007) has resulted in better by authors as more material became resolution affinities within the the avalable. There have been further attempts subfamily Mesembryanthemoideae. * * * * * * * * * * *

Chenopodiaceae Ventenat Goosefoot family 97 genera, 1,305 species Widely distributed in temperate and tropical climates but common in arid and semiarid saline habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbs or small shrubs usu- unilacunar, vascular bundles in concentric ally in saline habitats, often covered with rings, included phloem usually present, white bloom, stipules absent, cuticle waxes sieve-tube plastids PIII-C type, containing with platelets, flowers small often greenish, betalains instead of anthocyanins, cuticle bracts and perianth herbaceous, stamens waxes with platelets. Leaves minute to large, opposite perianth lobes, all fertile and simi- alternate, rarely opposite (Salicornia, lar, carpels 2, ovary superior, fruit a nut Nitrophila), petiolate to sessile, simple, entire enclosed in persistent perianth, embryo or variously lobed, sometimes fleshy or recurved. duced to scales, stipules absent. Inflores- cence cymose, spikes or panicles, sometimes Major genera: Atriplex (300 species), Salsola catkins. Flowers small, greenish, bisexual, (120), Chemnopodium (105), Suaeda (100) and rarely unisexual and plants dioecious (Grayia) Salicornia (35). or monoecious, actinomorphic, hypogynous. Perianth (represented by sepals petals absent) Descriptiomn: Herbs or small shrubs, rarely with 2-5 united tepals, rarely free (Salsola), small trees (Haloxylon), usually in saline habi- herbaceous, usually persistent and tats, sometimes succulent (Salicornia), often accrescent in fruit, and appendaged with tu- covered with whitish bloom, nodes bercles, spines or wings, sometimes absent. Major Families of Angiosperms 533

Figure 13.68 Chenopodiaceae. Chenopodium album. A: Portion of plant in flower; B: Flower partially opened with stamens still included; C: Fruit from above; D: Seed. Beta vulgaris. E: Flower; F: cluster of Fruits. Suaeda maritima. G: Portion of plant in flower; H: Flower.

Androecium with 5 stamens, rarely 3, a source of sugar), spinach (Spinacea opposite the perianth lobes, filaments free, oleracea) and lambs quarters (Chenopodium anthers inflexed in bud, bithecous, dehis- album; bathoo in Hindi). Chenopodium cence longitudinal, pollen grains multiporate, ambrosioides is source of wormseed used as spinulose. Gynoecium with 2 carpels, united, a vermifuge. Seeds and leaves of C. quinoa rarely carpels upto 5, ovary superior, unilo- are eaten by Peruvians and Andes. cular, ovule 1, placentation basal, styles 2 (rarely upto 5). Fruit a nut or utricle (when Phylogeny: The family has been considered enclosed in membranous perianth); seed lens distinct from Amaranthaceae in its shaped with curved or spiral embryo, herbaceous perianth, all fertile stamens endosperm absent, perisperm present. equal in length, and free filaments, but has been merged with Amaranthaceae in recent Economic importance: The family includes APG classifications (Judd et al., 2002; APG II; a few food plants such as beet (Beta vulgaris: APweb) because their separation leads to used as leafy vegetable {often confused with paraphyletic Chenopodiaceae (Downie et al., spinach}; root vegetable mainly for salad and 1997; Rodman, 1994; Pratt et al., 2001). 534 Plant Systematics

Cuénoud et al. (2002) found Chenopodiaceae al. (2002), however, consider it sister to were perhaps monophyletic, but the branch Nyctaginaceae, although with weak support. collapsed in a strict consensus tree; the Thorne (2003) placed Sarcobataceae near sampling was moderately good, but only one Nyctaginaceae under suborder Phyto- gene - matK - was sequenced and analysed. laccineae, whereas Chenopodiaceae along Sarcobatus has long been acknowledged an with Amaranthaceae placed under Chenopo- anomalous member of this family, e.g. by diineae. Subsequently (2006) he enlarged the Bentham and Hooker (1880), who presented latter order by including the third family it as a monogeneric tribe. Behnke (1997) Achatocarpaceae, earlier included under proposes raising it to family rank, because monotypic suborder Achatocarpineae. He sieve-element plastid form supports recent earlier (2006) divided Chenopodiaceae into chloroplast DNA sequencing studies in four subfamilies: Chenopodioideae, Micro- portraying it nearer Phytolaccaceae than teoideae, Salicornioideae and Salsoloideae, Chenopodiaceae. The studies of Cuénoud et adding fifth .Suaedoideae in 2007 revision.

* * * * * * * * * * *

Amaranthaceae M. Adanson Amaranth family 72 genera, 1,020 species Cosmopolitan, mainly tropical, centred in Africa and America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/(APweb)

Salient features: Herbs or small shrubs, nodes unilacunar, vascular bundles in con- stipules absent, flowers small often green- centric rings, included phloem usually ish, subtended by scarious or papery bracts, present, sieve-tube plastids PIII-A type, con- perianth papery, stamens opposite perianth taining betalains instead of anthocyanins. lobes, slightly connate at base, staminodes Leaves alternate or opposite, herbaceous, present, carpels 2-3, ovary superior, fruit a sometimes aggregated at base (Ptilotus), peti- capsule or utricle or nutlet, enclosed in per- olate to sessile, simple, entire, stipules ab- sistent perianth, embryo curved. sent. Inflorescence cymose, spikes or panicles, with conspicuous persistent bracts and Major genera: Gomphrena (120 species), bracteoles. Flowers small, greenish, bi- Alternanthera (100), Iresine (80), Amaranthus sexual (rarely unisexual), actinomorphic, (60) and Celosia (55). hypogynous, cyclic. Perianth (represented by sepals petals absent) with 3-5 free or united Description: Herbs or small shrubs, very tepals, usually persistent, sometimes rarely climbing, often with swollen nodes, accrescent (Ptilotus) in fruit, usually dry and Major Families of Angiosperms 535

Figure 13.69 Amaranthaceae. Amaranthus spinosus. A: Part of plant in flower; B: Cymose cluster with one male and several female flowers; C: Female flower with 3 carpels; D: Mature fruit of same with enlarged persistent perianth; E: Mature utricle developed from flower with 2 carpels, perianth removed; F: Seed. Achyranthes aspera. G: Part of plant in flower; H: Flower with bract and perianth removed; I: Androecium showing stamens and staminodes; J: Bract; K: Bracteoles; L: Utricle with persistent style. (A, G-L, after Sharma and Kachroo, Fl. Jammu, 1983). scarious. Androecium with 5 stamens, Economic importance: The family includes rarely 3 or even 6-10, opposite the tepals, several ornamentals such as Celosia filaments slightly connate at base, often (Cockscomb), Amaranthus (amaranth), adnate to tepals, anthers inflexed in bud, Gomphrena (globe amaranth) and Iresine bithecous (Amaranthus) or monothecous (bloodleaf). Species of Alternanthera and (Gomphrena), dehiscence longitudinal, pollen Tilanthera are grown as edge plants and have grains multiporate, spinulose, staminodes ornamental leaves. Seeds and leaves of sev- often present, usually 1-3. Gynoecium with eral species of Amaranthus are edible, as are 2-3 united carpels, ovary superior, unilocu- also the leaves of Alternanthera sessilis. lar, ovule usually 1, placentation basal, rarely many (Celosia), styles 1-3. Fruit a Phylogeny: The family is closely related to circumscissile capsule, or nut or utricle Chenopodiaceae (which is placed within (when enclosed in membranous perianth); Amaranthaceae in APG classifications) but seed lens shaped with curved or spiral em- differentiated in scarious bracts and bryo, endosperm absent, perisperm present. perianth, connate stamens and presence of 536 Plant Systematics staminodes. Hutchinson (1926, 1973) seems to be arbitrary. Others like Pratt et believes the family to have evolved from al. (2001) consider Amaranthaceae to be caryophyllaceous ancestors. Cuénoud et al., polyphyletic. Thorne (2003, 2006, 2007) (2002) found Amaranthaceae s. str. to be treats Amaranthaceae as distinct from monophyletic, with very strong (97 per cent) Chenopodiaceae and including three support. The family, in the broader sense subfamilies: Polycnemoideae, Amaran- (including Chenopodiaceae), is monophyletic thoideae and Gomphrenoideae. In analysis as supported by morphology, chloroplast DNA of Müller and Borsch (2005; 2005b) from restriction sites and rbcL sequences. Pollen analysis of matK/trnK sequences concluded structure is also similar with thickened tecta, that Polycnemum and Nitrophila (100% apertures with reduced pointed flecks of support) were sister to the rest; they have exine underlain by lamellar plates, and a ordinary secondary thickening, imperfect thickened endexine. The separation of flowers, basally connate filaments, and Chenopodiaceae and Amaranthaceae unithecate anthers.

* * * * * * * * * * *

Caryophyllaceae A. L. de Jussieu Pink family 93 genera, 2,395 species Distributed mainly in all temperate parts of the world.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbs with swollen nodes, (Paronychia), secondary veins often obscure. leaves opposite, inflorescence usually a Inflorescence typically a dichasial cyme, dichasial cyme, corolla caryophyllaceous, rarely solitary flowers. Flowers bisexual, stamens ten or lesser, obdiplostemonous, rarely unisexual (Lychnis alba), actino- ovary unilocular with free central morphic, hypogynous. Calyx with 5 sepals, placentation, superior, fruit a capsule open- free (Stellaria) or connate (Dianthus, Silene). ing by valves or teeth. Corolla with 5 petals, usually differentiated into a distinct claw and a limb, with an Major genera: Silene (700 species), Dianthus appendaged joint between the two, often (300), Arenaria (200), Gypsophila (150), notched or deeply bilobed at tip. Androecium Minuartia (150), Stellaria (150) and Cerastium with 10 or lesser number of stamens, (100). obdiplostemonous, free, anthers bithecous, dehiscence longitudinal, pollen grains Description: Annual or perennial herbs with tricolpate to polyporate. Gynoecium with 2-5 swollen nodes, anthocyanins present. Leaves (2 Dianthus, 3 Silene, 4 Sagina, 3-5 Stellaria) opposite, simple, bases of opposite leaves of- united carpels (syncarpous), unilocular with ten connected, stipules absent or scarious many ovules, placentation free central, ovary Major Families of Angiosperms 537

Figure 13.70 Caryophyllaceae. Stellaria media. A: A part of plant in flower; B: Flower showing hairy sepals and deeply bilobed petals; C: Flower with sepals and petals removed to show stamens and pistil; D: Bilobed petal; E: Mature capsule with persistent calyx; F: Capsule dehiscing through valves; G: Seed. Silene conoidea. H: A portion of plant in flower; I: Capsule with half of calyx removed to show dehiscence through teeth and remnants of petals and stamens; J: Seed. (After Sharma and Kachroo, Fl. Jammu, 1983). superior, styles 2-5. Fruit a loculicidal cap- have been the subject of considerable debate, sule opening by valves or teeth, rarely a utri- several authors (Mabry, 1963) advocating cle (Paronychia). Seeds many, ornamented on separation of betalain containing families surface, embryo curved, endosperm absent, into a separate order, and those lacking often replaced by perisperm. betalains (but containing anthocyanins as in Caryophyllaceae and Plumbaginaceae) Economic importance: The family is rep- into another. Ultrastructure studies of sieve resented by several ornamentals such as tube plastids (Behnke, 1975, 1977, 1983) carnation, pinks, sweet william (different showed that all members ( those with and species of Dianthus), baby’s breath without betalains) contained unique PIII (Gypsophila) and corn cockle (Agrostemma). plastids, affinity reinforced by studies of Species of Arenaria, Cerastium and Stellaria DNA/RNA hybridization (Mabry, 1975), are troublesome weeds. throwing up a compromise of including all families within the same order, but sepa- Phylogeny: The family Caryophyllaceae rate suborders, a trend being followed by along with other members of the order Takhtajan upto 1987 but finally discarded in Caryophyllales (Centrospermae of Engler) 1997. Thorne (1999, 2003)had established 538 Plant Systematics

5 suborders (Achatocarpineae, Cactineae, The family forms a well defined mono- Phy-tolaccineae, Chenopodineae and Caryo- phyletic clade, as evidenced by morphology, phyllineae) within Caryophyllales, Caryo- and rbcL sequence. True petals are lacking phyllaceae being placed under monotypic in the family, and in most cases outer 4 to 5 suborder Caryophyllineae. In subsequent stamens are transformed into petals. revision (2006, 2007) he merged Achato- Centrospermae is a classical case of prov- carpineae with Chenopodiineae, thus rec- ing a point that there should not be too much ognising only 4 suborders. He recognises reliance on any single character, and con- two subfamilies Illecebroideae and Caryo- clusions should be drawn only after the find- phylloideae within the family. ings are reinforced by studies from other fields.

* * * * * * * * * * *

Polygonaceae Durande Buckwheat family 52 genera, 1,105 species Distributed mainly in all temperate parts of the Northern Hemisphere, a few species in tropics, arctic region and the Southern Hemisphere.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Caryophyllidae Caryophyllidae Magnoliidae Caryophyllidae Series+/Superorder Curvembryeae+ Polygonanae Polygonanae Caryophyllanae Core Eudicots* Order Polygonales Polygonales Polygonales Polygonales Caryophyllales

Salient features: Mostly herbs with swollen simple, usually entire, venation pinnate, re- nodes, stipules forming ochrea at nodes, flow- ticulate, stipules connate to form ochrea at ers in spikes, heads or panicles, perianth node (ochrea absent in Eriogonum). Inflores- usually petaloid, stamens 3-8, carpels 3, cence in axillary cymose clusters or form- united, ovule solitary, fruit a nut. ing spikes, heads or panicles. Flowers bisexual, rarely unisexual (Rumex), Major genera: Eriogonum (250 species), actinomorphic, hypogynous, showy Rumex (200), Persicaria (150), Coccoloba (120), (Antigonon) or inconspicuous (Rumex). Peri- Polygonum (60), Rheum (50) and anth with 6 tepals, in two whorls, usually Fagopyrum (15). petaloid, sometimes 5 due to fusion of 2 tepals (Polygonum), free or slightly connate, Description: Annual or perennial herbs, imbricate, persistent, inner whorl often shrubs, small trees (Triplaris) or climbers enlarged in fruit and tubercled (Rumex) or with tendrils (Antigonon), with swollen nodes, not (Oxyria), perianth often 4 in two whorls usually with tannins, without laticifers, (Oxyria). Androecium with usually nodes pentalacunar or multilacunar, sieve- 6 stamens, 8 in Fagopyrum, 9 in Rheum, fila- tube plastids S-type. Leaves usually alter- ments free or slightly connate, anthers nate, rarely opposite (Pterostegia) or whorled bithecous, dehiscence longitudinal, pollen (Eriogonum), sometimes reduced (Coccoloba) grains tricolpate to polyporate. Gynoecium Major Families of Angiosperms 539

Figure 13.71 Polygonaceae. Rumex nepalensis. A: Portion of plant in flower; B: Flower with partially emergent anthers; C: Fruit with broad wings and hooked teeth. Polygonum tortuosum. D: Portion of plant in flowers; E: Flower with included stamens; F: Flower from top; G: Seed. (After Polunin and Stainton, Fl. Himal., 1984). with 2-3 united carpels, ovary superior, salad. Species of Coccoloba, Antigonon, unilocular with 1 ovule, orthotropous, place- Muehlenbeckia, and Polygonum are often cul- ntation basal, sometimes partially divided by tivated as ornamentals. Fruits of Coccoloba false septa, styles 2-3, a nectary surround- are often used to make jellies. Leaves of Rumex ing the base of ovary, or paired glands asso- acetosa and R. crispus are eaten as vegetables. ciated with filaments. Fruit a trigonous or bifacial nut; seed with straight or curved Phylogeny: The basic floral pattern of the embryo, endosperm copious, mealy. Pollina- family according to Laubengayer (1937) is tion mostly by bees and flies. Fruits are trimerous and whorled and the apparent spi- usually dispersed by wind or water. ral condition in some members is actually whorled as shown by anatomical study. In Economic importance: A few species of the members with 5 tepals, one outer and one family are of economic importance. Buck- inner tepal are fused. Laubengayer believed wheat (Fagopyrum) is an important source of the family to be allied and more advanced food (millets) in some areas. The petioles of than Caryophyllaceae and the seemingly rhubarb (Rheum rhaponticum) are used as basal placentation of the family is derived 540 Plant Systematics from free central placentation, the funicu- sheathing ochrea and Eriogonoideae with lus representing the greatly reduced free opposite leaves and more or less cymose and central placenta. Studies of Lamb Frye & involucrate inflorescence. Thorne (1999, Kron (2003) suggest that five petals is basic 2003) recognized third subfamily Coccolo- condition in the family. boideae characterized by reduced leaves, The family is easily recognized and clearly stems flattened and photos-ynthetic, for monophyletic. The family is considered which, however, he subsequently (2006, closer to Plumbaginaceae and according to 2007) preferred the name Brunnichioideae. Williams et al., (1994) although no plumbagin The members of Eriogonoideae have had been reported from the family, other generally 6 tepals and may form a basal quinones were found. Two subfamilies are paraphyletic complex (Cuénoud et al., 2002; commonly recognized in Polygonaceae: Lamb Frye & Kron 2003), thus justifying Polygonoideae with spiral leaves with merger with polygonoideae.

* * * * * * * * * * *

Droseraceae Salisbury Sundew family 3 genera, 110 species Widely distributed, mainly in marshy places low in nutrients, more commonly represented in Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Caryophyllidae Series+/Superorder Thalamiflorae+ Nepenthanae Theanae Caryophyllanae Core Eudicots* Order Parietales Nepenthales Droserales Theales Caryophyllales Caryophyllales

B & H under Sarraceniaceae; Dahlgren under Nepenthaceae

Salient features: Insectivorous plants, (Aldrovanda), annual or perennial. Leaves leaves in rosettes, covered with sticky in- usually in basal rosette, upper alternate, sect-catching hairs, circinate in bud, flow- circinate in bud, simple, blade modified into ers bisexual, pentamerous, inflorescence hinged trap (Dionaea) or covered with sticky determinate, stamens 5-many, carpels 3-5, glandular hairs (often called tentacles) for fruit a capsule. trapping insects (Drosera), venation obscure, stipules absent or present, petiole winged Major genera: Drosera (108 species), Dionaea in Dionaea. Inflorescence scapigerous, (1) and Aldrovanda (1). determinate, cymose, often appearing like umbel, raceme or panicle, rarely solitary. Description: Insectivorous herbs of bogs and Flowers bisexual, actinomorphic, hypo- wetlands, or submerged aquatic plant gynous, pentamerous. Calyx with 5 sepals, Major Families of Angiosperms 541

Figure 13.72 Droseraceae. Dionaea muscipula. A: Plant with flowers; B: Leaf with winged petiole and hinged leaf blade with marginal bristles; C: Flower; D: Ovary cut open to show ovules; E: Pollen tetrad; F: Seed. Drosera intermedia G: Plant with flowers; H: Leaf blade with glandular hairs; I: Flower, top view; J: Seed covered with papillae. (After Godfrey and Wooten, Aq. Wetland Pl SE US, 1981). rarely 4, slightly connate at base, imbricate, talline-granular, seed variously reticulated persistent. Corolla with 5 petals, rarely 4, or ornamented. Pollination usually by in- free, convolute, mostly white or pinkish. sects, protoandy resulting in outcrossing, but Androecium with usually 5 stamens selfing may result when flowers close by the (Drosera), 10-20 in Dionaea, free or slightly end of the day. Small seeds are dispersed by connate at base, anthers bithecous, dehis- wind or water. Detached leaves and inflorescence longitudinal, pollen grains triporate cences may also produce new plants. to multiporate, released in tetrads. The hinged leaves of Dionaea have two Gynoecium with 3 united carpels, rarely halves, each with marginal sensitive bris- upto 5, ovary superior, unilocular with 3- tles. When an insect touches the bristles, many ovules, placentation parietal or basal, the two halves close, entrapping the insect. style single (Dionaea) or 3-5, each divided The small glands on the leaf surface secrete upto the base thus appearing 6-10 in number. enzymes, which digest the insect. In Drosera, Fruit a loculicidal capsule; seed small, with the gland-tipped sticky hairs when stimu- straight embryo, endosperm present, crys- lated, entangle the insect by bending 542 Plant Systematics inwards, pressing the insect against the leaf in order parietales near Violaceae and blade. Ochnaceae on the basis of parietal placentation. Insectivorous habit and Economic importance: The family is of lit- aquatic habit exhibit homoplasy with fam- tle ecomic importance. Venus flytrap ily Lentibulariaceae. Earlier the family (Dionaea muscipula) and various species of also included 4th subwoody genus Drosera (Sundew) are grown as novelties. Drosophyllum, which has now been sepa- Leaves of Drosera yield a violet dye, but is rated into a distinct family no longer of commercial importance. Drosophyllaceae (APG-II, 2003; Thorne, 2006, 2007; APWeb, 2007), being sister to Phylogeny: The family was earlier in- Dioncophyllaceae + Ancistrocladaceae. cluded under Sarraceniaceae (Bentham & Within Droseraceae, Dionaea and Hooker), but is now recognised independ- Aldrovanda with snap-trap leaves and n=6 ently. Wettstein (1907) placed Droseraceae may be sister to rest of taxa.

Subclass 9. Rosidae (B) 2. Podostemales 1. Bonnetiaceae Superorder 1. Celastranae (B) 2. Clusiaceae Order 1. Celastrales 3. Elatinaceae 1. Celastraceae 4. Podostemaceae (B) 2. Parnassiaceae 3. Euphorbiales (B) 3. Lepidobotryaceae (B) 1. Humiriaceae Superorder 2. Violanae 2. Ctenolophonaceae Order 1. Violales 3. Hugoniaceae 4. Irvingiaceae (B) Suborder 1. Violineae 5. Ixonanthaceae (B) 1. Violaceae 6. Corynocarpaceae (B) 2. Flacourtiaceae 7. Coriariaceae (B) 3. Achariaceae (B) 8. Linaceae 4. Salicaceae 9. Rhizophoraceae 5. Passifloraceae 10. Erythroxylaceae 6. Turneraceae 11. Euphorbiaceae 7. Malesherbiaceae 12. Putranjivaceae (B) 8. Lophopyxidaceae (B) 13. Goupiaceae (B) 2. Begoniineae 14. Malpighiaceae 1. Cucurbitaceae 15. Peridiscaceae (B) 2. Begoniaceae 16. Chrysobalanaceae (A) 3. Datiscaceae 17. Balanopaceae 4. Tetramelaceae 18. Trigoniaceae Superorder 3. Podostemanae (B) 19. Dichapetalaceae (B) Order 1. Ochnales 20. Euphroniaceae (B) 1. Ochnaceae Superorder 4. Oxalidanae (B) 2. Quiinaceae Order 1. Oxalidales 3. Medusagynaceae 1. Huaceae 4. Caryocaraceae 2. Oxalidaceae Major Families of Angiosperms 543

3. Connaraceae 4. Surianaceae (B) 4. Anisophylleaceae (A) 5. Cunoniaceae Superorder 7. Myrtanae 6. Brunelliaceae Order 1. Myrtales 7. Cephalotaceae (B) 1. Melastomatineae 8. Elaeocarpaceae 1. Penaeaceae 9. Tremandraceae 2. Oliniaceae Superorder 5. Geranianae (B) 3. Rhynchocalycaceae 4. Alzateaceae 1. Zygophyllales (B) 5. Crypteroniaceae 1. Zygophyllaceae 6. Melastomataceae 2. Krameriaceae 2. Myrtineae (B) 2. Geraniales 1. Myrtaceae 1. Geraniaceae 2. Vochysiaceae 2. Hypseocharitaceae 3. Lythrineae (B) 3. Ledocarpaceae (B) 1. Lythraceae 4. Francoaceae 2. Onagraceae 5. Greyiaceae 3. Combretaceae 6. Melianthaceae Superorder 6. Rosanae 2. Crossosomatales (B) 1. Staphyleaceae Order 1. Rosales 2. Guamatelaceae (B) 1. Rosaceae 3. Stachyuraceae 2. Fabales 4. Crossosomataceae 1. Quillajaceae (B) 5. Geissolomataceae 2. Fabaceae 6. Aphloiaceae (B) 3. Polygalaceae 7. Ixerbaceae (B) 8. Strasburgeriaceae (B)

Celastraceae R. Brown Spindle-Tree family 98 genera, 1210 species Widely spread, mainly in tropical and subtropical regions, a few species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)

Salient features: Trees, shrubs or climbers, ovary superior with large fleshy disc at base leaves simple often leathery, stipules usu- fused with the base of stamens, carpels 2-5, ally small, falling early or absent, flowers seeds with brightly coloured coat or aril. small, greenish, pentamerous, in clusters, 544 Plant Systematics

Figure 13.73 Celastraceae. Euonymus hamiltonianus. A: Portion of plant in flower; B: Flower from above; C: Flower from base; D: Fruit . Celastrus paniculatus. E: Portion of plant in flower; F: Flower; G: Fruit. (A-D, after Polunin and Stainton, Fl. Himal, 1984).

Major genera: Maytenus (200 species), solitaryor racemose. Flowers small, green- Salacia (150), Euonymus (130), Hippocratea ish or greenish-white, regular, bisexual or (120), Cassine (60) and Crossopetalum (50). unisexual, hypogynous pergynous or epigynous. Calyx with usually 4-5 small se- Description: Trees, shrubs or climbers pals, distinct or connate at base, rarely 3, (Hippocratea), stem smooth or with spines, imbricate, rarely valvate. Corolla with 4-5 with or withour laticifers, juice not coloured, free petals, rarely 3, somewhat similar to nodes unilacunar, vessels with simple or sepals, rarely absent. Androecium with usu- scalariform end-walls, vestured pits absent. ally 3-5 stamens rarely many (Plagiopteron), Leaves alternate (Maytenus) or opposite free, often attached at base to enlarged disc, (Euonymus), simple, usually leathery, ser- rarely connate at base, anthers bithecous, rate, pinnately veined, stipules small and dehiscence longitudinal, pollen grains caducous or absent. Inflorescence of flat- aperturate or colporate. Gynoecium with 2- topped axillary or terminal clusters, rarely 5 united carpels, ovary superior, sometimes Major Families of Angiosperms 545 inferior (Empleuridium) due to elarged disc, (2003) placed Celastales under superorder Cela- placentation axile with 2-6 ovules in each stanae of Rosidae. Thorne had earlier placed chamber, style short, terminal, stigma this superorder as fifth after Rosanae, stigma capitate or lobed, dry type non-papil- subsequently (2006, 2007) bringing it to the late. Fruit a berry, drupe, capsule or samara; begining of Rosidae. Celastales of Thorne (2006) seed usually surrounded by brightly coloured included 4 families Celastaceae, Parnassia- aril, embryo large and straight, endosperm ceae, Lepidobotryaceae and Huaceae. Zhang & present. Simmons (2006) found that Huaceae were sister to Oxalidales, with quite strong support Economic importance: Economically the fam- (jacknife values over 80%); they suggest that ily is of lesser importance, a few used as Huaceae should be included in Oxalidales. ornamentals. Climber Celastrus scandens is Thorne (2007) and Stevens( APWeb, 2008), as grown for its attractive coloured fruits and such exclude Huaceae from the order seeds. Various swpecies of Euonymus are Celastrales. Whereas Stevens keeps it un- grown for their attractive foliage, E. japonicus placed within Eurosids I, Thorne has shifted it with shiny leathery leaves very popular as under order Oxalidales of superorder hedge plant along pathways in temperate cli- Oxalidanae. Thorne (2007) recognizes 4 sub- mate. The toxic alkaloid maytansine (from families with Celastraceae: Celastroideae, Maytenus), when delivered by antibodies, may Hippocrateoideae, Macgregorioideae and have application in treating colon cancers. Stackhousioideae (Siphonodontoideae recognized as 5th subfamily in 2006 version Phylogeny: The family was earlier placed having been merged with Celastroideae). closer to Rhamnaceae, latter removed along The family appears to be more uniform with with a few other families to Rhamnales by the removal of Bhesa to Malpighiales (Zhang Hutchinson (1973). Dahlgren (1989) placed & Simmons 2006) and Perrottetia to Stakhousiaceae, Lophopyxidaceae Card- Huerteales (Crossosomatales of Thorne) iopteridaceae, Corynocarpaceae and Celas- near Tapiscia (M. Simmons in Matthews & traceae under Celastales under superorder Endress 2005b). Interestingly, the inclusion Rutaneae. Both Takhtajan (1997) and Thorne of both these genera.

* * * * * * * * * * *

Violaceae Batsch Violet family 23 genera, 900 species Distributed widely, mainly in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb)

Figure 13.74 Violaceae. Viola canescens. A: Plant with flowers; B: Vertical section of flower; C: Gynoecium; D: Fruit with persistent calyx; E: Seed. V. tricolor. F: Portion of plant with flowers; G: Vertical section of flower showing spurred lower petal; H: Stamen with spurred anther; I: Ovary with style and enlarged stigma; J: Transverse section of ovary with parietal placentation.

Salient features: Herbs, leaves serrate, entire to serrate, venation pinnate or pal- stipules present, flowers zygomorphic, mate, veins often conspicuous, stipules bisexual, petals 5, anterior spurred, anthers present, sometimes foliaceous (Viola). Inflo- with spur-like nectaries, carpels 3, united, rescence usually with solitary axillary flower, placentation parietal, fruit a loculicidal sometimes in racemes or spikes. Flowers capsule, seeds large dispersed explosively as bisexual, rarely unisexual, actinomorphic the fruit wall closes round them and (Rinorea) or zygomorphic (Viola), hypogynous, squeezes them out. pentamerous, sometimes cleistogamous. Calyx with 5 sepals, usually free, sometimes Major genera: Viola (450 species), Rinorea slightly connate to form a ring around ovary, (280), Hybanthus (110), Anchietia (8) and imbricate, persistent. Corolla with 5 petals, Leonia (6). free, imbricate or convolute, unequal, anterior usually largest and spurred or saccate. Description: Herbs (Viola) shrubs (Rinorea) or Androecium with 5 stamens, filaments trees (Rinorea maingayi), rarely climbers short, free or slightly connate at base, an- (Anchietia) with often saponins or alkaloids. thers erect, somewhat connivent forming a Leaves alternate rarely opposite (Hybanthus), ring around ovary, 2 anterior anthers often mostly basal, simple, sometimes lobed, with spur-like nectaries, connective often Major Families of Angiosperms 547 with triangular appendage, dehiscence lon- Phylogeny: The family is clearly defined and gitudinal, introrse, pollen grains usually uniformly placed in most classifications tricolpate. Gynoecium with 3 united carpels, under Violanae of Dilleniid complex. Hutch- carpels rarely 2-5 (Melicystus), ovary superior, inson who had largely separated dicotyledons unilocular with parietal placentation, ovules into woody (Lignosae) and herbaceous many, anatropous, style 1, stigma often ex- (Herbaceae) lineages, had especially chosen panded but with small receptive region, some- to justify the position of largely herbaceous times lobed. Fruit a loculicidal capsule; seeds Viola in the predominantly woody clade, and with straight embryo, endosperm and aril considered the herbaceous habit in this present. Pollination by insects, attracted by genus to be derived from woody ancestors. nectar in the spur. Seeds are often dispersed APG II and APweb, however place this fam- explosively as the fruit wall closes round them ily in a broadly circumscribed order and squeezes them out. Ants also disperse Malpighiales. Two tribes are commonly seeds, attracted by oily aril. recognized: Rinoreae with mainly actinomorphic flowers and Violeae with Economic importance: The family is mainly zygomorphic flowers. Although the family is known for ornamental pansy flowers (Viola) clearly monophyletic, rbcL sequences suggest and green-violet (Hybanthus). Flowers of Viola that neither tribe is monophyletic. Violaceae odorata is largely grown in France for essen- are weakly associated with Acharaciaceae tial oil used in the manufacture of perfumes, (and Goupiaceae, Lacistemataceae and flavourings and toiletries. The flowers are also Ctenolophonaceae) in Chase et al., (2002). preserved in sugar (‘banafsha’). Hybanthus Thorne, who had earlier (1999, 2000) placed ipecacuanha has been used as substitute for Violanae under subclass Dilleniidae has now true ipecac (Psychotria ipecacuanha) as (2003) shifted it to Rosidae, Dilleniidae hav- emetic. Roots of Anchietia salutaris are used ing been dismantled. He (2006, 2007) recog- as an emetic and to treat sore throats and nizes three subfamilies Violoideae, lymphatic tuberculosis. The roots of Leonioideae and Fusispermoideae under Corynostylis hybanthus are used as an emetic. Violaceae.

* * * * * * * * * * *

Salicaceae Mirbel Willow family 2 genera, 485 species Distributed widely, mainly in north temperate to arctic regions, in moist open habitats.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/ (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Dilleniidae Dilleniidae Magnoliidae Rosidae Series+/Superorder Ordines anomali+ Violanae Violanae Violanae Eurosids I* Order Salicales Salicales Salicales Violales Malpighiales 548 Plant Systematics

Figure 13.75 Salicaceae. Populus ciliata. A: Portion of a vegetative branch; B: Branch with male catkins; C: Fruiting female catkin. Salix alba. D: Portion of a shoot with female catkins; E: Portion of shoot with male catkins; F: Male flower with hairy bract and 2 stamens; G: Female flower with bract and stipitate ovary; H: Longitudinal section of ovary with basal placentas. S. caroliniana. I: Male flower with bract, 2 nectar glands and many stamens; J: Transverse section of ovary with parietal placentation.

Salient features: Deciduous trees and salicoid (vein entering tooth and associated shrubs, leaves with salicoid teeth, stipules with glandular seta), venation pinnate to conspicuous, flowers unisexual, inflores- palmate, reticulate, stipules present, some- cence a catkin, flowers naked, carpels 2, times foliaceous and persistent. Inflores- ovules many, seeds with hairs. cence erect or pendulous catkins, on short branches. Flowers unisexual (plants Major genera: Salix (445 species; incl. dioecious), actinomorphic, reduced, usually Chosenia) and Populus (40). subtended by hairy bracts. Calyx reduced to a glandular disc (Populus) or 1 to 2 fringed Description: Deciduous trees and shrubs nectar gland (Salix). Corolla absent. containing phenolic heterosides salicin and Androecium with 2 to numerous stamens, populin, containing tannins. Leaves alter- filaments free or slightly connate at base, nate, simple, serrate to dentate, teeth anthers bithecous, dehiscence by Major Families of Angiosperms 549 longitudinal slits, pollen grains usually appropriate to designate them as perianth. tricolpate or triporate, rarely inaperturate. He also separated the family under order Gynoecium with 2-4 carpels, united, ovary Salicales. This treatment has been followed superior, unilocular with parietal by Hutchinson (1973; placing Salicales af- placentation or with 2-4 basal placentas, ter Hamamelidales), Cronquist (1988; plac- ovules many, unitegmic, styles 2-4, stigmas ing Salicales under Dilleniidae after Violales 2-4, capitate, often expanded and lobed. Fruit and not in Hamamelidae), Dahlgren (1989; a loculicidal capsule; seeds with a basal tuft under Violanae after Violales and of hairs, endosperm scanty or absent. Polli- Cucurbitales), Takhtajan (1997; Dilleniidae- nation by wind, flowers of salix are pollinated Violanae after Violales, Passiflorales and by insects attracted by nectar. Seeds are of- Caricales). Thorne (1999) placed it under ten dispersed by wind aided by hairs. Dilleniidae—>Violanae—>Violales after Violaceae and Flacourtiaceae, subsequently Economic importance: The family is impor- (2003, 2006, 2007) placing it under Rosidae tant for several species grown as owing to the abolition of Dilleniidae. APG II ornamentals, usually avenue trees. Cricket and APweb include this family under bats and polo balls are usually made from Malpighiales (Eurosids I) towards the begin- willow (Salix spp.) wood. Twigs of willow are ning after Achariaceae and Violaceae commonly used in basket making. The bark (APweb) or nearly towards the end (APG II). of Salix contains salicylic acid, which re- The family is clearly monophyletic, having duces swellings and fever, and is constitu- affinities with Flacourtiaceae, which also ent of aspirin. exhibit salicoid teeth, presence of salicin and apetalous flowers in some genera. Phylogeny: The affinities of this family were Molecular data also support close affinities. not known to Bentham and Hooker who The family Salicaceae as such has been placed it along with other uncertain fami- broadly circumscribed in APG II and APweb lies under Ordines anomali of (55 genera, 1,010 species) to include larger Monochlamydeae. The reduced flowers of part of Flacourtiaceae and smaller diverse Salicaceae (and other members of families such as Bembiciaceae, Homalia- Amentiferae) were considered to represent ceae, Poliothyrsidaceae, Prockiaceae, Samy- primitive dicots by Engler (1892) and Rendle daceae and Scyphosteg-iaceae. Broadly (1904, 1930). Fisher (1928) on the basis of circumscribed Salicaceae is defined by extensive studies concluded that the sim- leaves with salicoid teeth, cocarcinogens plicity of flowers is largely due to extreme and flowers in which sepals and petals if reduction and not a representation of ar- present are equal in number, those with chaic features, and that flowers in the an- sepals and petals not equal shifted to cestral form possessed a perianth of 1 or 2 Achariaceae. The genus Casearia (formerly series, which is now represented by a in Flacourtiaceae), which may lack salicoid cupule-like gland. Hutchinson (1926), placed leaf teeth and has apetalous flowers with the the family under Hamamelidales, treating disc on the basal-adaxial surface of the calyx, it as the most primitive within the group. is sister to the rest of Salicaceae, although Hjelmquist (1948) was of the opinion that the this position is weakly supported by cup or finger like gland in the flower was rbcL (Chase et al., 2002) but strongly formed by the reduction of an undifferenti- supported by data based on three genes ated bracteal envelope and that it is not quite (Soltis et al., 2000a).

* * * * * * * * * * * 550 Plant Systematics Cucurbitaceae A. L. de Jussieu Cucurbit or Gourd family 122 genera, 780 species Mainly distributed in tropics and subtropics, in temperate regions often found in cultivation. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Figure 13.76 Cucurbitaceae. Luffa cylindrica. A: Branch with male flowers on peduncle towards the base and solitary axillary female flowers towards the top; B: Vertical section of female flower; C: Vertical section of male flower. Coccinia cordifolia. D: Branch with male flower; E: Branch with female flowers. Stamen types. F: Lagenaria with 3 stamens, 2 with bithecous anthers and 1 with monothecous anther; G: Cucurbita with anthers united into a column; H: Cyclanthera with anthers united into 2 rings running around the top; I: Sicyos with filaments as well as anthers united. Major Families of Angiosperms 551

Salient features: Tendril climbing plants, Economic importance: The family is eco- leaves palmately veined, flowers unisexual, nomically important for its food plants such stamens 5, variously united, carpels usually as cucumber (Cucumis sativus), water melon 3, united, ovary inferior, fruit a berry or pepo. (Citrulus vulgaris), loofah (Luffa acutangula, L. cylindrica), bottle gourd (Lageneria Major Genera: Cayaponia (60 species), siceraria), melon (Cucumis melo) and red Momordica (45), Gurania (40), Sicyos (40), pumpkin (Cucurbita maxima). The dried fruit Cucumis (30) and Cucurbita (27). of Luffa yields bathroom sponge loofah. Spe- cies of Bryonia, Cucumis, Momordica are of Description. Climbing annuals with coiled medicinal importance. tendrils, sometimes trailing (Ecballium), rarely xerophytic shrubs (Acanthosicyos Phylogeny: The family was earlier horrida) or even trees (Dendrosicyos), vascu- considered closely related to Passifloraceae lar bundles usually bicollateral, often in two and included under the same order. rings. Leaves alternate, simple, palmately Hutchinson (1973) placed them under veined, lobed or compound, rarely absent separate orders, Cucurbitales derived from (Acanthosicyos horrida), stipules absent. In- Passiflorales through formation of unisexual florescence cymose (Bryonia) or flowers soli- flowers, parietal placentation, inferior ovary, tary axillary (Luffa female flower), rarely in and modification of stamens. The separation short racemes (Luffa male flowers), plants is followed by Takhtajan, Dahlgren, and APG monoecious or dioecious. Flowers bracteate group. Cronquist and Thorne preferred to or ebracteate, unisexual, rarely bisexual retain these and other families under the (Schizopepon), actinomorphic, epigynous, same order Violales. Thorne (1999) placed with long hypanthium. Calyx with 5 sepals, Cucurbitaceae along with Begoniaceae and more or less united, fused to ovary wall. Co- Datiscaceae under a separate suborder rolla with 5 petals, free (Luffa, Lagenaria, Begoniineae. Subsequently (2003, 2006, Benincasa) or united (Cucurbita, Cucumis), 2007) he has added Tetramelaceae (earlier imbricate, commonly yellow or white. included under Datiscaceae). It is interesting Androecium with 5 stamens, anthers to note that order Cucurbitales of APG II and monothecous, filaments free (Luffa) or APweb include the same four families along connate, sometimes 4 of these fused in two with a few more. Cucurbitaceae and pairs thus two stamens bithecous and third Begoniaceae share the apomorphies of monothecous giving appearance of 3 sta- inferior ovary, strongly intruded placentae and mens (Coccinia), rarely all five fused imperfect flowers. Monophyly of Cucurbitales (Cucurbita), pollen grains with 3 to many fur- is supported by serological data and rbcL rows. Gynoecium with 3 united carpels sequences. Cucurbitaceae is easily reco- (syncarpous), unilocular with many ovules, gnized and monophyletic, but of the two sub- placentation parietal, placentae enlarged families commonly recognized only intruding and often meeting in centre form- Cucurbitoideae is monophyletic, Nhandiro- ing pseudo-axile placentation, ovary inferior, boideae (Zanonioideae) being paraphyletic. styles simple or 3-partite. Fruit a berry, pepo Renner et al., (2002) from the molecular or capsule; seeds many, embryo straight, studies multiple chloroplast loci. p. 169, endosperm absent. Pollination mostly by in- concluded that Nhandiroboideae form an sects. Dispersal by animals, capsules of unresolved basal group. Echinocystis open explosively.

* * * * * * * * * * * 552 Plant Systematics Clusiaceae LindleySt. John’s Wort family 45 genera, 1010 species Distributed widely, mainly in moist tropics, some in temperate regions of New as well Old World.Hypericum and Triadenum distributed in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb)

Salient features: Leaves opposite or times 4, rarely 3 or 6, free, imbricate, per- whorled, dotted with resin or secretary cavi- sistent below fruit or shedding from mature ties or canals, margin entire, stipules ab- fruit. Corolla with 5 petals, sometimes 4, sent, sepals and petals free, stamens many rarely 3 or 6, orange-yellow in Hypericum, in bundles, ovary 3-5 chambered, superior, free, imbricate, often persisting as withered styles free, stigma papillate, fruit a capsule remains, nectar glands alternating with pet- or berry. als or absent. Androecium with many stamens, filaments free or united in 3-5 bun- Major Genera: Hypericum (350 species), dles (rarely 6-8 bundles), opposite the pet- Garcinia (210), Calophyllum (180), Clusia als, filaments often persisting in fruit, an- (150), Kayea (7), Mammea (65), Vismia (55), thers bithecous, dehiscence longitudinal, Chrysochlamys (55), Kielmeyera (50), staminodes often present in female flower, Harungana (50) and Triadenum (10). pollen grains tricolporate. Gynoecium with 3-5 united carpels, rarely many, ovary su- Description. Herbs (Hypericum), shrubs or perior, placentation axile, rarely unilocular trees (Garcinia), rarely as woody lianas or with parietal placentation with deeply in- epiphytes (some species of Clusia) behav- truded placentas, ovules 2-many in each ing like strangling figs, with clear, black or locule, anatropous, styles 3-5, free or coloured resin or secretion in cavities or connate at base, stigmas lobed or capitate. canals; hairs simple, multicellular, some- Fruit usually a capsule, sometimes berry or times stellate. Leaves opposite or whorled, drupaceous; seeds many, embryo straight, simple, often with pellucid or black dots endosperm absent, aril often present. Polli- (punctate) or canals, margin entire, nation mostly by bees and wasps. Dispersal unicostate reticulate venation, stipules ab- by animals for fleshy fruits those with sent but sometimes with paired glands at arillate seeds, capsular fruits disperse seeds nodes. Inflorescence of terminal cymes or by wind or water. with solitary flowers, sometimes thyrsoid. Flowers with usually two bracteoles below Economic importance: The family is known calyx, bisexual (Hypericum) or unisexual for edible fruits mangosteen (Garcinia (Clusia, Garcinia) and polygamous or mangostana) and mammey apple (Mammea dioecious, actinomorphic, hypogynous, americana). Fats and oils are obtained from pentamerous. Calyx with 5 sepals, some- the seeds of species of Calophyllum, Major Families of Angiosperms 553

Figure 13.77 Clusiaceae. Hypericum calycinum. A: Branch with terminal flower. H. lobbii B: Por- tion of branch showing one flower; C: Androecium D: Flower with petals and stamens removed; E: Transverse section of ovary. Clusia purpurea. F: Branch with inflorescence; G: Flower. Garcinia mangostana. H: Branch with fruit; I: flower; J: Vertical section of flower; K: Fruit with rind from top removed. Hypericum myrtifolium. L: Portion of branch with flowers; M: Flower top view, enlarged. (L-M, after Goodfrey and Wooten, Aq. Wetland Pl. SE US, vol. 2, 1981; H-K, after Bailey, Man. Cult. Pl., 1949)

Pentadesma, etc. The species of Harungana, from the stems of Garcinia (source of gam- Calophyllum yield hard and durable wood. boge) and Clusia (source of healing gums). Drugs and cosmetics are obtained from the Species of Vismia, Psorospermum and leaves of Hypericum spp. and Harungana Harungana yield drugs and dyes from bark. madagascariensis, and flowers of Mesua Species of Clusia and Hypericum with showy ferrea. Gums and pigments are extracted flowers are often grown as ornamentals. 554 Plant Systematics

Phylogeny: The family Hypericaceae was sopioideae and Hypericoideae. APG II and treated as distinct from Guttiferae APweb treat the two as distinct families, (Clusiaceae) by Bentham and Hooker (1862). latter recognising two subfamilies Engler and Prantl (1887) combined the two Kielmeyeroideae and Clusioideae (including families under Clusiaceae, a treatment Calophylloideae) under Clusiaceae. Broadly followed by Heywood (1978) and Cronquist circumscribed family (under name (1988). Hutchinson (1973) justified separation Clusiaceae or Hypericaceae) is assumed to of Hypericaceae on the basis of constantly be monophyletic on the basis of anatomical bisexual flowers and gland-dotted leaves, as and chemical evidence. The affinities within against unisexual flowers, close veins and the group are not clearly resolved as secretary canals. He argued that ‘Hyperica- suggested by the studies of Chase et al., ceae is fairly well circumscribed, and there (2002) and Gustafsson et al., (2002). Thorne seems little to be gained, in these days of (2003, 2006), placed Bonnetiaceae, smaller family concepts , by including them Hypericaceae, Elatinaceae and Podostem- in Clusiaceae (Guttiferae), as in Engler and aceae under order Hypericales, prefering Prantl system’. The two are combined in name Podostemales in 2007 revision. The treatments of Judd et al. (2002, 2008; under monophyly of this clade was not supported by Clusiaceae) and Thorne (1999, 2000 and 2007 the studies of Savolainen et al., (2000). as Clusiaceae; 2003, 2006, prefered priority Bonnetiaceae + Clusiaceae + Hypericaceae name Hypericaceae). Thorne (2007) divides seem to be a distinct group with several Clusiaceae into five subfamilies Kielmeye- potential synapomorphies, of which some are roideae, Calophylloideae, Clusioideae, Chry- lost or highly modified in Podostemaceae.

* * * * * * * * * * *

Euphorbiaceae A. L. de Jussieu Spurge family 321 genera, 7,770 species (including Phyllanthaceae) Distributed widely in tropical and subtropical regions, with few species in temperate regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/ APweb

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Rosidae Dilleniidae Magnoliidae Rosidae Series+/Superorder Unisexuales+ Euphorbianae Malvanae Podostemanae Eurosids I* Order Euphorbiales Euphorbiales Euphorbiales Euphorbiales Malpighiales

Salient features: Plants usually with milky Major genera: Euphorbia (2100 species), Cro- latex, leaves alternate, flowers unisexual, ton (720), Phyllanthus (500), Acalypha (350), carpels 3, ovary superior, 3-chambered, Glochidion (300), Antidesma (140), Manihot ovule with a caruncle. (160) and Jatropha (140). Major Families of Angiosperms 555

Description: Herbs (some species of cal regions. The leaves of Cnidoscolus Euphorbia, Phyllanthus) shrubs (Acalypha) or chayamansa are used as vegetable. The trees (Hevea) with often milky or coloured fruits of Antidesma bunias are also edible. latex, sometimes succulent and cactus-like, Aleurites moluccana (candlenut tree) and A. usually poisonous. Leaves alternate rarely fordii (Tung tree) are sources of oils used in opposite (some species of Euphorbia; the manufacture of paints and varnishes. Excoecaria) or whorled (Mischodon), some- Oil similar to tung is also obtained from the times modified into spines, simple or pal- species of Vernicia. Castor oil obtained from mate compound, venation pinnate or pal- Ricinus communis is used as purgative. The mate, reticulate, stipules present, some- common ornamentals include Euphorbia times modified into spines (Euphorbia milii) pulcherrima, E. milii, Acalypha hispida, Jat- or glandular, rarely absent. Inflorescence of ropha panduraefolia and Codiaeum variegatum. various types, commonly a cup shaped The fruit of Phyllanthus emblica (‘amla’) is cyathium (Euphorbia) having a cup-shaped very rich source of vitamin C. The greasy involucre with usually 5 nectaries along the tallow surrounding the seeds of Sapium rim and enclosing numerous male flowers sebiferum (Chinese tallow tree) is used for (arranged in scorpioid cymes, without peri- making soaps and candles. anth and represented by a single stamen) and single female flower in the centre; Phylogeny: The family was earlier broadly sometimes a raceme (Croton) or panicle (Rici- circumscribed (Bentham and Hooker) to in- nus). Flowers unisexual (monoecious or clude genera which have now been separated dioecious), actinomorphic, hypogynous. Peri- under Buxaceae. Earlier considered related anth usually with 5 tepals (representing to Euphorbiaceae the family Buxaceae has sepals, petals absent), rarely 6 in two whorls been far removed to Sapindales (Engler and (Phyllanthus) or absent (Euphorbia), petals Prantl), Hamamelidales (Hutchinson), usually absent but present in Jatropha and Buxales (Takhtajan: under Caryophyllidae— Aleurites, free or connate. Androecium with >Buxanae), or Balanopales (Thorne: under 1 stamen (Euphorbia), 3 with fused filaments Rosidae—>Rosanae near Hamamelidales), (Phyllanthus), 5 (Bridelia) or many (Trewia), Proteales (Judd et al., : under core tricolpates), sometimes polyadelphous (or with repeatedly Buxales (APweb) or unplaced at the beginning branched filaments) as in Ricinus, anthers of Eudicots (APG II). Cronquist is the only re- bithecous (sometimes monothecous in Rici- cent author to include Buxaceae next to nus due to splitting of filament), dehiscence Euphorbiaceae under Euphorbiales (Rosidae). longitudinal. Gynoecium with 3 united car- The genus Ricinus is sometimes included pels, carpels rarely 4-many, ovary superior, under a separate family Ricinaceae but is trilocular with 1-2 ovules in each chamber, more appropriately included under placentation axile, styles usually 3. Fruit a Euphorbiaceae. Webster (1967, 1994), who schizocarpic capsule, a regma (Ricinus), studied this family extensively recognized rarely a berry or drupe (Bridelia); seed often five subfamilies: Phyllanthoideae, Oldfield- with conspicuous fleshy outgrowth called ioideae, Acalyphoideae, Crotonoideae and caruncle, embryo curved or straight, en- Euphorbioideae. These five are also recog- dosperm abundant or absent. nized by Thorne (1999, 2003; 2007 prefers Hyaenanchoideae over Oldfieldioideae). The Economic importance: The family includes former two on the basis of evidence from rbcL a number of valuable plants. Hevea sequences have been separated into a dis- brasiliensis (Para rubber tree) is the source tinct family Phyllanthaceae by APG II and of natural rubber. Rubber is also obtained APweb, as they do not seem to form a clade from Manihot glaziovii (ceara rubber). Thick with other members of Euphorbiaceae. Putra- roots of Manihot esculentus (cassava or tapi- njiva, Lingelsheimia and Drypetes have been oca) are important source of starch in tropi- removed to Putranjivaceae, and Paradrypetes 556 Plant Systematics

Figure 13.78 Euphorbiaceae. Euphorbia milii. A: Branch with umbellate cyathia and spines; B: Vertical section of cyathium to depict showy scarlet bracts, single female flower and numerous male flowers, and nectaries along the rim of cyathium. E. hirta. C: Portion of plant showing opposite leaves and cyathia in heads; D: Cyathium with female flower protruding out and only 4 nectaries, showy bracts absent; E: Vertical section of cyathium. Phyllanthus fraternus. F: Portion of plant with flowers; G: Male flower with monadelphous stamens; H: Female flower; I: Vertical section of female flower. Croton bonplandianum. J: Portion of plant with flowers and fruits; K: Male flower with many stamens; L: Female flower; M: Vertical section of female flower. shifted to Rhizophoraceae. Rest of the Euphor- recognized Putranjivaceae as distinct fam- biaceae including last three subfamilies form ily. Sutter and Endress (1995) advocate a a well-defined clade with single ovule in each broadly delimited Euphorbiaceae (inc. both chamber. Thorne (2003, 2006, 2007) has also Phyllanthaceae and Putranjivaceae) but Major Families of Angiosperms 557

Huber (1991) for a narrower circumscription, changes may be needed in the groupings rec- with the biovulate taxa being considered to ognized. Thorne had earlier (2003, 2006) in- be closer to Linales. Within Euphorbiaceae cluded Euphorbiaceae under superorder s. str., molecular analyses by Wurdack and Geranianae, but in his latest revision (2007) Chase (2002), suggest that substantial shifted it under Podostemanae

* * * * * * * * * * *

Oxalidaceae R. Brown Wood sorrel family 6 genera, 700 species Distributed mainly in tropical and subtropical regions, a few species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II /(APweb)

Salient features: Herbs or shrubs, leaves oles forming phyllodes), leaflets often folding usually compound, with a sour taste, leaflets in cold or at night, entire, often emarginate, pulvinate at base, entire, stipules usually with pinnate or palmate reticulate venation, absent, flowers pentamerous, heterostylus, leaflets often with prominent pulvinus, stip- petals clawed, stamens united, outer sta- ules small or absent. Inflorescence cymose mens shorter, styles 5, seeds with conspicu- umbel, rarely solitary. Flowers bisexual, ous endosperm, arillate. actinomorphic, usually heterostylus, sometimes cleistogamous and apetalous (Oxalis Major genera: Oxalis (600 species), acetosella). Calyx with 5 sepals, free, green, Biophytum (70) and Eichleria (2). persistent. Corolla with 5 petals, free or connate at base, often clawed, usually Description: Herbs with bulbous tubers or convolute, absent in cleistogamous flowers. fleshy rhizome, or shrubs, rarely trees, of- Androecium with 10 stamens, usually in two ten with soluble and crystalline oxalates. whorls, usually connate at base, outer Leaves alternate or all basal, pinnately filaments usually shorter than inner, (Biophytum) or palmately compound or anthers bithecous, dehiscence by longitudi- trifoliate (some species of Oxalis), rarely re- nal slits, pollen grains tricolpate or triporate, placed by phyllode (Oxalis bupleurifolia, peti- nectar glands at the base of filaments or 558 Plant Systematics

Figure 13.79 Oxalidaceae. Oxalis martiana. A: Plant with trifoliate leaves and umbellate inflorescence; B: Flower with calyx and corolla removed; C: Calyx; D: Petal. O. corniculata. E: Portion of plant rooting at nodes and umbellate inflorescence; F: Flower; G: Flower with calyx and corolla removed; H: Transverse section of ovary; I: Fruit with persistent calyx. (A-D, after Sharma and Kachroo, 1983) alternating with petals. Gynoecium with 5 that of O. crenata boiled and eaten in Peru. united carpels, rarely free (Biophytum), ovary The leaves of O. acetosella are some- superior, placentation axile, 1 or more times used as salad. The bulbous stem of ovules in each loculus, styles 5, free, per- O. pescaprae (Bermuda buttercup) are some- sistent, stigmas capitate or shortly divided. times used as vegetable in France and North Fruit a loculicidal capsule or berry, often Africa. Averrhoa carambola (carambola or star angled; seeds usually with an aril, embryo fruit) is cultivated widely for its edible fruit. straight, endosperm copious, testa often elastic turning inside out and ejecting seed. Phylogeny: The family was earlier included Pollination by insects, heterostyly result- under Geraniaceae (Bentham and Hooker) ing in outcrossing. Mostly self dispersed by but now separated into a distinct family and explosive inversion of testa and aril. separable by 5 distinct styles, possession of arillate seeds and absence of stipules. Economic importance: The family is of Phylogenetic studies based on rbcL sequences little importance. The tubers of Oxalis tuberosa (Chase et al., 1993) indicate that Oxalidaceae (oca) are eaten in Andean South America, and are more closely related to Cunoniaceae and Major Families of Angiosperms 559

Cephalotaceae (and related families) and in- Hypseocharitaceae by Takhtajan. Thorne cluded under Oxalidales (Judd et al., APG II, who had earlier (1999) included Hypseocharis APweb), distinct from Geraniales. The family under Geraniaceae and placed both is also related to Linaceae with it was placed Oxalidaceae and Geraniaceae closer together by Dahlgren under Linales. Woody genera in- under Dilleniidae—>Geranianae— cluding Averrhoa are sometimes placed in a >Geraniales has subsequently (2003, 2006, distinct family but are better placed here. The 2007) placed Oxalidaceae under Rosidae— genus Hypseocharis with united style, in- >Oxalidanae—>Oxalidales whereas cluded here by Hutchinson and Cronquist has Hypseocharitaceae and Geraniaceae are been optionally shifted to Geraniaceae (APG placed under Rosidae—>Geranianae— II, APweb), and to a distinct family >Geraniales, far removed from Oxalidaceae.

* * * * * * * * * * *

Zygophyllaceae R. Brown Creosote Bush family 20 genera, 250 species Widespread in tropics and subtropics, especially in arid mainly in arid regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Rosidae Series+/Superorder Disciflorae+ Geranianae Rutanae Geranianae Eurosids I * Order Geraniales Sapindales Zygophyllales Geraniales Zygophyllales /Zygophyllales B & H as Zygophylleae; APG II unplaced in Eurosids I

Salient features: Leaves usually opposite, simple or 2-foliate, strongly resinous, leaflets pinnate compound, stipules paired persist- entire, venation reticulate, pinnate or pal- ent, flowers with disc, stamen with gland or mate, stipules paired, commonly spiny. In- appendage at base, ovary 4-5 locular, syle 1. florescence cymose, sometimes reduced to single flower. Flowers bisexual, rarely uni- Major genera: Zygophyllum (80 species), sexual (Neoleuderitzia), actinomorphic, rarely Fagonia (40), Tribulus (20), Balanites (20), zygomorphic, hypogynous, usually Guaiacum (6), and Larrea (5). pentamerous. Calyx with 5 sepals, rarely 4, free or slightly connate at base. Corolla with Description: Herbs (Tribulus), shrubs or trees 5 petals, rarely 4 or absent, free, often clawed, (Guaiacum) with often jointed nodes, xylem imbricate. Androecium with 10 stamens, elements arranged in horizontally aligned rarely 15, usually in whorls of 5, outer whorl tier, with steroidal or triterpenoid saponins opposite the petals, free, each filament with and alkaloids. Leaves opposite, 2-ranked, a gland or appendage at base, anthers rarely alternate, usually paripinnate, rarely bithecous, basifixed, dehiscence by longitu- 560 Plant Systematics

Figure 13.80 Zygophyllaceae. Tribulus terrestris. A: Part of plant with flowers and fruits; B: Flower; C: Vertical section of flower; D: Flower with sepals and petals removed; E: Ovary covered with hairs, short style and stigma; F: Transverse section of ovary; G: Fruit; H: One of the cocci enlarged showing sharp spines. (A-B, D-E, after Sharma and Kachroo, Fl. Jammu, 1983)

dinal slits, pollen grains usually tricolporate. stigma capitate or lobed, nectar disc present Gynoecium with 5 united carpels, rarely 2- at the base of ovary. Fruit a usually a cap- 6, ovary superior, usually furrowed or winged, sule, septicidal or loculicidal, rarely placentation axile, locules as many, ovules schizocarpic, berry or drupe, somtimes one to many in each locule, pendulous, winged; seeds usually with aril, embryo anatropous or orthotropous, style 1, short, curved or straight, endosperm usually absent Major Families of Angiosperms 561 or scanty. Pollination by insects. Arillate Phylogeny: The family is usually placed un- seeds (Guaiacum) are dispersed by wind, der order Geraniales, although more recently schizocarpic winged fruits by wind and spiny shifted to order Zygophyllales (Takhtajan fruits (Tribulus) by exozoochory. 1997, Thorne 2007, Stevens 2008). The family is considered to be monophyletic after the Economic importance: The family is of mi- exclusion of a few genera to Peganaceae and nor economic importance. Wood of Guaiacum Nitrariaceae (Thorne to order Rutales) or officinale (lignum vitae), being the strong- Nitrariaceae (Sapindales of Eurosids II by est and heaviest wood, is highly prized tim- APG II, APWeb of Stevens). Monophyly of ber in tropical Central America and West Zygophyllaceae supported by morphology and Indies.The tree also yields medicinal resin DNA characters. The family is sister to guaiacum, once used to treat syphilis. Spe- Krameriaceae as supported by rbcL se- cies of Bulsenia (B. arborea: Maracaibo lig- quences (Soltis et al., 1998; Savolainen et num vitae; B. sarmienti: Paraguay lignum al., 2000). The family is divided into 5 sub- vitae) yield valuable timber and perfume oil. families: Morkillioideae, Tribuloideae, Seeds of Peganum harmala are the source of Seetzenioideae, Larreoideae and Zygoph- dye turkey red. Tribulus terrestris is a trou- ylloideae. Balanites is very different from ble some weed whose spines on fruit are other Zygophyllaceae in floral, vegetative similar to sharp iron caltrops once used in and seed anatomy, although tentatively battlefields to stab the feet of men and included under Tribuloideae. Hilu et al. horses. They also often puncture cycle tyres; (2003) reported Larrea to be weakly associ- hence the names caltrops, puncture vine ated with Fabaceae in their rbcL analysis; and goat head for the weed. Species of they note that the possession of anthro- Zygophyllum are used as spices: buds of quinones is a possible synapomorphy Z. fabago used in sauces and fruits of between Zygophyllaceae and the N-fixing Z. coccinium as substitute for black pepper. clade Fabaceae.

* * * * * * * * * * *

Geraniaceae A. L. de Jussieu Geranium family 5 genera, 760 species Widespread mainly in temperate and subtropical regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Rosidae Series+/Superorder Disciflorae+ Geranianae Rutanae Geranianae Rosids * Order Geraniales Geraniales Geraniales Geraniales Geraniales Geraniales 562 Plant Systematics

Figure 13.81 Geraniaceae. Geranium rotundifolium. A: Plant with palmately lobed leaves and umbellate inflorescence; B: Flower; C: Petal; D: Flower with sepals and petals removed to show androecium and gynoecium; E: Gynoecium with 5 carpels; F: One segment of capsule; G: Seed. Erodium cicutarium. H: Plant with pinnate leaves and umbellate inflorescence; I: Sepal; J: Petal; K: Stamen; L: Staminode; M: Gynoecium; N: One mericarp with long coiled beak. Monsonia senegalensis. O: Flower having 15 stamens; P: Portion of flower to show stamens with filaments united in groups of 3, the androecium being pentadelphous.

Salient features: Usually herbs, stems swol- pound, venation palmate, reticulate, stipules len at nodes, leaves usually deeply lobed, conspicuous. Inflorescence cymose umbel, stipules conspicuous, flowers pentamerous, rarely solitary. Flowers bisexual, petals clawed, stamens united, styles 1, fruit actinomorphic, rarely zygomorphic (Pelargo- with elastic dehiscent schizocarps that curl nium), hypogynous, pentamerous. Calyx with on the beak, aril absent. 5 sepals, free, green, persistent, sometimes spurred (Pelargonium). Corolla with 5 petals, Major genera: Geranium (300 species), Pel- rarely 4 or absent, free, often clawed, imbri- argonium (250), Erodium (80) and Monsonia cate, nectar glands alternating with petals (25). or absent. Androecium with 10 (Geranium) or 15 (Monsonia) stamens, rarely 5 (other 5 ster- Description: Usually herbs, rarely ile- Erodium), usually connate at base, some- undershrubs, sometimes aromatic (Pelargo- times pentadelphous (Monsonia), rarely free, nium), stems swollen at nodes, usually with anthers bithecous, dehiscence by longitudi- stalked glandular hairs. Leaves alternate or nal slits, pollen grains tricolpate or triporate. opposite, simple or palmately lobed, or com- Gynoecium with 5 united carpels, ovary Major Families of Angiosperms 563 superior, usually lobed, placentation axile, Phylogeny: The family is consistently placed ovules usually 2 in each loculus, anatropous under order Geraniales, sometimes along with or campylotropous, style 1, slender and beak- Oxalidaceae. The recent DNA based studies like. Fruit a capsular dehiscent schizocarp (Chase et al., 1993), however, suggest that it with 5 1-seeded segments that separate elas- is related to Crossosomataceae, Staphylea- tically from central column, and often open- ceae, in a narrowed circumscribed order. ing to release seeds (Geranium), or Geraniaceae are well-defined monophyletic indehiscent schizocarp (Biebersteinia); seeds group based on rbcL sequences and loss of usually without aril, pendulous, embryo intron in the plastid gene rpl16 (Price and curved, endosperm usually absent or scanty. Palmer, 1993). Hypseocharis, with capsular Pollination by insects. Mostly self dispersed fruits and formerly placed under Oxalidaceae by explosive opening of schizocarps throwing is sister to rest of the family. Takhtajan places seeds several metres away. it under a distinct family Hypseocharitaceae. APG II optionally include Hypseocharitaceae Economic importance: The family is known under Geraniaceae. APweb treats Hypseo- for Pelargonium (often marketed as Gera- charis as distinct group within Geraniaceae. nium), grown as ornamental in pots and also Thorne who had earlier (1999) included both for geranium oil extracted from the leaves Geraniaceae and Oxalidaceae adjacent to and shoots of mainly P. odoratissimum. Spe- each other under Geraniales, has subse- cies of Geranium (crane-bill) and Erodium quently (2003, 2006, 2007) shifted Oxalida- (storckbill) are also grown as ornamentals. ceae under distinct superorder Oxalidanae, The persistent dry style of Erodium, which order Oxalidales. He has also removed is hygroscopic, is often used to indicate Hypseocharis to a distinct family Hypseo- changes in humidity. charitaceae, placed next to Geraniaceae.

* * * * * * * * * * *

Rosaceae A. L. de Jussieu Rose family 110 genera, 3,100 species Widespread but best represented in the Northern Hemisphere, mainly in the temperate and arctic climate.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbs shrubs or trees, with hypanthium, sepals and petals 5 each, leaves usually serrate, stipules conspicuous, petals usually clawed, well-developed nectary flowers actinomorphic, usually perigynous and on hypanthium or base of stamens, stamens 564 Plant Systematics numerous, carpel single or numerous and free, aggregate (etaerio of achenes in Potentilla, rarely united, fruit usually fleshy. etaerio of drupes in Rubus); seed with straight embryo, without endosperm. Pollina- Major genera: Rubus (750 species), Potentilla tion mainly by insects. Dispersal by birds, (500), Prunus (430), Crataegus (240), animals or wind. Cotoneaster (230), Sorbus (230), Rosa (225), Alchemilla (220), Spiraea (100), Pyrus (60), Economic importance: The family is largely Malus (55) Geum (40) and Fragaria (15). known for its temperate fruits: apple (Malus domestica), pear (Pyrus), plums (Prunus- Description: Herbs (Alchemilla, Fragaria), several species), cherries (Prunus avium, shrubs (Rosa, Rubus) or trees (Prunus, Malus, P. cerasus) peaches (Prunus persica), almonds Pyrus), rarely climbing (some species of Rosa), (Prunus dulcis), apricots (Prunus armeniaca), sometimes with runners (Fragaria), often with strawberry (Fragaria vesca), loquots prickles and thorns, without latex, nodes (Eriobotrya), raspberries (Rubus), quince trilacunar, rarely unilacunar. Leaves alter- (Cydonia), etc. Popular ornamentals include nate, rarely opposite (Rhodotypos), simple species of Rosa, (rose) Rubus (raspberry), (Malus, Prunus), palmately compound Chaenomeles (flowering quince), Potentilla (Fragaria) or pinnate compound (Sorbaria), leaf (cinquefoil), Geum (avens), Cotoneaster, blade often with gland-tipped teeth, usually Crataegus (hawthorn), Pyracantha (firethorn), serrate, venation pinnate or palmate, reticu- and Sorbus (mountain ash). Flowers of Rosa late, stipules present, often adnate to peti- damascena are used for extracting attar of ole. Inflorescence with solitary flowers (some roses. The bark of Quillaja (soap-bark tree) species of Rosa), racemes (Padus), panicles contains saponin used as substitute for soap or cymose umbels (Spiraea), sometimes in cleaning textiles, and also yield tannin. corymbs (Crataegus), rarely catkin-like Bark of Moquilla utilis (pottery tree) of (Poterium). Flowers bisexual, rarely unisexual Amazon is used in making heat-resistant (Poterium; plants monoecious or dioecious), pots. The wood of Prunus serotina is used for actinomorphic, rarely zygomorphic making furniture and cabinets. Several (Parinarium), usually perigynous with distinct species are also valuable sources of timber. hypanthium (flat, cup-shaped or cylindrical); hypanthium free from or adnate to carpels, Phylogeny: In spite of great morphological often enlarging in fruit, with nectar ring on diversity the family Rosaceae is a well inside, rarely epigynous (Malus). Calyx usu- recognized group whose monophyly has been ally with 5 sepals, united at base, sometimes supported by rbcL sequences (Morgan et al., with 3-5 epicalyx (Fragaria) on outside, often 1994). More than 27 family names have been persistent. Corolla usually with 5 petals, free, proposed for groups of different genera taken often clawed, imbricate. Androecium with out from Rosaceae, but according to numerous stamens, free , 4 in Sanguisorba, Hutchinson (1973) if one or two tribes of the 2 in Parastemon urophylla, anthers bithecous, family are taken out, at least 18 or 19 should rarely monothecous (Alchemilla), dehiscence follow suit, and the Rosaceae would be longitudinal, pollen grains tricolporate. Gyn- reduced to the genus Rosa only. He like most oecium with 1 (Prunus), 2-3 (Crataegus) to recent authors follows a broader many carpels (Rosa), usually free, rarely circumscription of the family, but does not connate (Crataegus, Pyrus), sometimes recognize separation of Chrysobalanaceae adnate to hypanthium, ovary superior or in- and Neuradaceae (established as distinct in ferior, usually unilocular, ovules 1,2 or more, 12th edition of the Engler’s Syllabus published unitegmic or bitegmic, crassinucellate, in 1964). These two last families have been placentation basal, lateral or apical, rarely recognized as distinct in all major class- axile (Pyrus). Fruit a follicle (Spiraea), achene ifications. Cronquist places them together (Rosa), drupe (Prunus), pome (Malus), or with Rosaceae under Rosales. Dahlgren places Major Families of Angiosperms 565

Figure 13.82 Rosaceae. Prunus domestica. A: Portion of a flowering twig; B: Flower from above; C: Vertical section of flower, petals removed. Rubus ellipticus. D: Branch with terminal inflorescence; E: Vertical section of flower with petals removed; F: Petal; G: Fruit covered with persistent calyx. Duchesnia indica. H: Portion of a branch with trifoliate leaves and flower; I: Vertical section of flower with petals removed, 3- lobed bracteoles (epicalyx) present outside calyx; J: Calyx and 5 3-lobed bracteoles. Rosa pimpinellifolia. K: Branch with fruits; L: Flower and bud; M: Vertical section of flower showing cup shaped hypanthium and numerous free carpels; N: Fruit (hip) enclosing achenes and with persistent calyx.

Chrysobalanaceae under Theanae— Chrysobalanaceae under Rosidae— >Theales, but Neuradaceae along with >Podostemanae—>Euphorbiales. APG II and Rosaceae in Rosales. Takhtajan places APweb have shifted Chrysobalanaceae to Neuradaceae in Rosales along with Rosaceae, Eurosids I—>Malpighiales and Neuradaceae but Chrysobalanaceae in distinct order to Eurosids II—>Malvales, retaining Rosaceae Chrysobalanales. Thorne (1999) shifted both in Eurosids I—>Rosales. The family has often families from Rosidae to Dilleniidae, been considered closely related to Chrysobalanaceae under Dillenianae— Saxifragaceae and Crassulaceae but the rbcL >Dilleniales and Neuradaceae under data identify Ulmaceae, Celtidaceae, Malvanae—>Malvales. In later revisions Moraceae, Urticaceae and Rhamnaceae as (2003, 2006, 2007), however, he has abolished sister groups (Savolainen et al., 2000a). Dilleniidae. in his latest revision (2007) he Usually 4 subfamilies are recognized within placed Rosaceae under Rosidae—>Rosanae— Rosaceae: Maloideae (fruit a pome), >Rosales, Neuradaceae under Malvidae— Amygdaloideae (syn: Prunoideae; fruit a >Malvanae—>Malvales—>Cistineaeand drupe, carpel 1, nectaries on petiole and 566 Plant Systematics lamina), Rosoideae (fruit achenes or et al., 2002a, b). The position of Dryadeae drupelets) and Spiraeoideae (follicle or (inc. Cercocarpus, Dryas, Cowania and capsule). Although Rosoideae and Maloideae Chamaebatia) included in Rosoideae is are reasonable clades, little can yet be said uncertain, they lack phragmidiaceous rusts; of larger patterns of relationship in the rest their roots are associated with N-fixing of the family (Potter et al., 2002). Porteranthus Frankia and their fruits are achenes with is sister to Maloideae; Gillenia is sister to that hairy styles. They are rather basal (Potter et whole clade (Potter et al., 2002; Evans al., 2002; Evans et al., 2002).

* * * * * * * * * * *

Fabaceae Lindley Bean or Pea family (=Leguminosae A. L. de Jussieu) 630 genera, 18,000 species (Third largest family after Asteraceae and Orchidaceae) Cosmopolitan in distribution, primarily in warm temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Rosidae Series+/Superorder Calyciflorae+ Fabanae Rutanae Rosanae Eurosids I* Order Rosales Fabales Fabales Fabales Fabales Fabales B & H as Leguminosae Takhtajan, Thorne, APG II and APweb as Fabaceae. Cronquist and Dahlgren recognize three independent families Fabaceae, Caesalpiniaceae and Mimosaceae, thus restricting the name Fabaceae to include only papilionaceous (members of Papilionoideae) members, for which the alternate name is Papilionaceae and not Leguminosae.

This large family has traditionally been di- for family sensu lato as well as for Papilionoi- vided into three subfamilies Papilionoideae deae upgraded as family. Leguminosae is the (Faboideae), Caesalpinioideae and Mimosoi- alternate name only for former whereas deae. These have been recognized as inde- Papilionaceae is the alternate name for lat- pendent families Fabaceae (Papilionaceae), ter. Common features of the family include Caesalpiniaceae and Mimosaceae in several leaves usually compound with pulvinate recent systems of classification, a trend that base, odd sepal anterior, flowers perigynous, tends to be reversing in last decade or so. It carpel 1 with marginal placentation and fruit must be noted that name Fabaceae is valid commonly a pod or lomentum. Major Families of Angiosperms 567 Subfamily Faboideae DC. (=Papilionoideae L. ex A. DC.) B & H as Papilionoideae Takhtajan, Thorne, APG II and APweb as Faboideae Cronquist and Dahlgren as family Fabaceae (Papilionaceae).

440, genera 12,800 species Cosmopolitan in distribution, primarily in warm temperate regions.

Figure 13.83 Fabaceae, subfamily Faboideae. Medicago polymorpha. A: Portion of plant with trifoliate leaves, laciniate stipules and few flowered axillary clusters on long peduncles; B: Flower; C: Standard; D: Wing; E: Keel; F: Androecium with diadelphous (1 free, 9 with united filaments) stamens; G: Fruit covered with tubercles; H: Seed. Dalbergia sissoo. I: Flowering shoot with a fruiting twig; J: Flower; K: Androecium with 9 monadelphous stamens. Sophora mollis. L: Branch with flowers; M: Moniliform pod. Lathyrus odoratus. N: Portion of a flowering branch, upper leaflets modified into tendrils; O: Vertical section of flower; P: Diadelphous andoecium; Q: Pod. 568 Plant Systematics

Salient features: Trees, shrubs or herbs, stamens, diadelphous (1 posterior free and leaves usually pinnate compound with filaments of nine fused into a tube which is pulvinate base, flowers zygomorphic with open posteriorly), sometimes 5+5 as in papilionaceous corolla, sepals united, odd Smithia, rarely monadelphous (Ononis), or sepal anterior, stamens 10, usually free (Sophora, Thermopsis) anthers diadelphous (1+(9)), carpel 1, ovary superior, bithecous, dehiscence longitudinal. Gyn- fruit a pod. oecium with a single carpel, unilocular with many ovules, placentation marginal, ovary Major genera: Astragalus (2000 species), superior, style single, curved. Fruit a leg- Indigofera (700), Crotalaria (600), Desmodium ume or pod, rarely a lomentum (Desmodium), (400), Tephrosia (400), Trifolium (300), sometimes indehiscent (Melilotus), rarely Dalbergia (200), Lathyrus (150), Lotus (100), spirally coiled (Medicago); seeds 1-many, seed and Milletia (100). coat hard, endosperm minute or absent, food reserves in cotyledons. Pollination primarily Description: Trees (Dalbergia, Erythrina), by insects, mostly bees. Dispersal is com- shrubs (Tephrosia, Alhagi, Indigofera) or herbs monly by wind, but often exozoochorus (Medicago, Melilotus), sometimes woody (Medicago), or by mammals (Tamarindus). climbers (Wisteria), commonly with root nodules. Leaves alternate, pinnately (Pisum, Economic importance: The subfamily is of Vicia) or palmately compound (Trifolium), major economic importance, ranking sec- sometimes simple (Alysicarpus, Alhagi), ond to Poaceae. It is the source of several whole leaf (Lathyrus aphaca) or upper leaf- pulse crops such as kidney bean (Phaseolus lets (Vicia, Pisum) sometimes modified into vulgaris), green gram (P. aureus), black gram tendrils, leaf base (sometimes also the base (P. mungo), lentil (Lens esculenta), chick pea of leaflets) pulvinate, stipules present. Inflo- (Cicer arietinum), pea (Pisum sativum) and pi- rescence racemose, in racemes, heads (Tri- geon pea (Cajanus cajan). Soybean (Glycine folium) or spikes (Ononis), sometimes in max) and peanut (Arachis hypogaea) yield oil clusters (Lotus, Caragana). Flowers bracteate and high-protein food. Indigo dye is obtained (bracts often caducous), bisexual, from Indigofera tinctoria. The seeds of Abrus zygomorphic, perigynous. Calyx with 5 se- precatorius are used in necklaces and rosa- pals, more or less united, usually ries, but are extremely poisonous and can campanulate, odd sepal anterior. Corolla be fatal if ingested. The important fodder with 5 petals, free, papilionaceous consist- plants include alfalfa (Medicago sativa) and ing of a posterior standard or vexillum, two clover (Trifolium). Common ornamentals in- lateral wings or alae and two anterior petals clude lupin (Lupinus), sweet pea (Lathyrus fused along margin to form keel or carina odoratus), Wisteria (Wisteria), Laburnum, which encloses stamens and pistil, poste- coral tree (Erythrina), false acacia (Robinia) rior petal outermost. Androecium with 10 and broom (Cytisus).

Subfamily Caesalpinioideae DC. B & H, Takhtajan, Thorne, APG II and APweb as Caesalpinioideae Cronquist and Dahlgren as family Caesalpiniaceae.

150 genera, 2,700 species Distributed mainly in tropics and subtropics, a few species in the temperate regions. Major Families of Angiosperms 569

Salient features: Trees, shrubs or herbs, woody climbers (Pterolobium, Bauhinia). leaves usually pinnate compound with Leaves alternate, pinnately or palmately com- pulvinate base, flowers zygomorphic corolla pound, sometimes simple (Bauhinia), leaf not papilionaceous, posterior petal inner- base (sometimes also the base of leaflets) most, sepals free, odd sepal anterior, stamens pulvinate, stipules present. Inflorescence 10, usually free, in two whorls , ovary supe- racemose, in racemes or spikes (Dimor- rior, carpel 1, fruit a pod. phandra). Flowers bracteate (bracts usually caducous) bisexual, zygomorphic, perigynous. Major genera: Chamaecrisia (260 species), Calyx with 5 sepals, rarely 4 (Amherstia), free Bauhinia (250), Senna (250), Caesalpinia (120) or rarely connate (Bauhinia), odd sepal ante- and Cassia (30). rior. Corolla with 5 petals, rarely 3 (Amherstia), 1 (Pahuda) or even absent Description: Trees (Delonix), shrubs (Cassia (Tamarindus), free, not papilionaceous, pos- occidentalis) or herbs (Cassia obtusa), rarely terior petal innermost. Androecium with

Figure 13.84 Fabaceae, subfamily Caesalpinioideae. Cassia occidentalis. A: Portion of plant with flowers and paripinnate leaves; B: Flower with sepals and petals removed, showing gynoecium and stamens of three different sizes; C: A pair of pods. Caesalpinia decapetala. D: Portion of plant with bipinnate leaves and racemose inflorescence; E: Flower; F: One of the four large petals; G: Gynoecium; H: Pod; I: Seed. 570 Plant Systematics

10 stamens, sometimes lesser (3 in Economic importance: The Subfamily in- Tamarindus), rarely more, free, sometimes cludes several ornamentals such as pride of unequal in size (Cassia), anthers bithecous, Barbados (Caesalpinia pulcherrima), paulo dehiscence longitudinal or by apical pores. verde (Parkinsonia), red bud (cercis Gynoecium with a single carpel, unilocular canadensis), Gul-mohar (Delonix regia), and with many ovules, placentation marginal, several species of Cassia and Senna. Many ovary superior, style single, curved. Fruit a species of Senna are cultivated for leaves legume or pod, rarely a lomentum; seeds that yield drug senna. The heartwood of Hae- 1-many, seed coat hard, endosperm minute matoxylon campechianum (logwood) yields the or absent, food reserves in cotyledons. dye hematoxylin.

Subfamily Mimosoideae DC. B & H, Takhtajan, Thorne, APG II and APweb as Mimosoideae Cronquist and Dahlgren as family Mimosaceae.

40 genera, 2,500 species Distributed mainly in tropical and subtropical regions.

Salient features: Trees, shrubs or herbs, bracteate (bracts usually caducous), sessile, leaves usually pinnate compound with or short-pedicelled, bisexual, actinomorphic, pulvinate base, flowers actinomorphic, co- perigynous. Calyx with 5 sepals (4 in Mi- rolla not papilionaceous, petals valvate, se- mosa), connate, odd sepal anterior, usually pals united, odd sepal anterior, stamens 4- valvate, teeth small. Corolla with 5 petals many, free or connate, filaments often long (4 in Mimosa), free or united (Acacia, Albizia), exserted and showy, ovary superior, carpel valvate. Androecium with 4-many (4 in Mi- 1, fruit a pod or lomentum. mosa, 10 in Prosopis, numerous in Acacia and Albizia) stamens, free (Acacia, Prosopis) or Major genera: Acacia (1300 species), Mimosa filaments connate (Albizia), anthers (500), Inga (250), Pithecellobium (170), bithecous, dehiscence longitudinal, fila- Calliandra (150) and Albizia (150). ments long and anthers usually exserted. Gynoecium with a single carpel, unilocular Description: Trees (Acacia, Albizia), shrubs with many ovules, placentation marginal, (Calliandra) or herbs (Mimosa pudica), rarely ovary superior, style single, curved. Fruit a climbers (Entada), or aquatic plants legume or lomentum (Mimosa, Acacia); seeds (Neptunia). Leaves alternate, pinnately or 1-many, seed coat hard, endosperm minute palmately compound, sometimes simple, or absent. leaf base (sometimes also the base of leaflets) pulvinate, petiole sometimes modified Economic importance: The subfamily is of into phyllode (Acacia auriculiformis), stipules lesser economic importance. Sensitive plant present, sometimes spiny and hollow inside touch-me-not (Mimosa pudica) is grown as a sheltering ants (Acacia sphaerocephala), curiosity. Various species of Acacia (A. leaves of Mimosa pudica sensitive to touch senegal, A. stenocarpa) yield gum arabic. The and showing sleeping movements. Inflores- pods and seeds of mesquite (Prosopis juliflora) cence racemose, in racemes (Adenanthera) are used as animal feed, wood in cooking or spikes (Prosopis), sometimes in cymose meats. Wood of Xylia is hard and used in ship heads (Mimosa, Acacia). Flowers small, building. Calliandra, Dichrostachys are grown Major Families of Angiosperms 571

Figure 13.85 Fabaceae, subfamily Mimosoideae. Mimosa pudica. A: Branch with inflorescence heads; B: Lomentum fruits constricted between and splitting into 1-seeded segments. Acacia nilotica. C: Branch with long spines and inflorescence heads; D: Flower bud; E: Moniliform pod. A. farnesiana. F: Portion of a branch with spines, leaf and inflorescence heads; G: Flower with numerous stamens; H: Pod. Albizia julibrissin. I: Part of a bipinnate leaf; J: Flower with monadelphous stamens; K: Part of a stamen showing anther. as ornamentals, Pithecellobium as a useful Dahlgren (1989). Takhtajan who also began hedge plant. with the same treatment, has in his last two versions (1987, 1997) included all the three Phylogeny of Fabaceae: The family is com- under broadly circumscribed Fabaceae, giv- monly circumscribed to include all the three ing these three the rank of subfamily. Thorne subfamilies. Hutchinson as early as 1926 had has consistently included all the three sub- recognized these as independent families families under broadly circumscribed Fabaceae, Caesalpiniaceae and Mimosaceae, Fabaceae, a position also justified by APG II. a position that he maintained even in his Thorne had earlier (1999) included Fabaceae last revision in 1973, regarding along with 21 other families in a broadly cir- Caesalpiniaceae as the most primitive of the cumscribed order Rutanae—>Rutales under three, Mimosaceae relatively advanced and suborder Fabineae (containing Fabaceae, Fabaceae to be the climax group. The trend Surianaceae and Connaraceae). In his was followed and maintained in their latest latest revision (2003) he has placed Fabaceae, classifications by Cronquist (1988) and Surianaceae, Polygalaceae (earlier placed in 572 Plant Systematics

Dilleniidae—>Geranianae—>Polygalales) times bilobed; vestured pits, which they lack, and Quillajaceae (earlier with uncertain are also absent in Cassieae. The flowers of position) in separate order Fabales, a treat- Cercis are only superficially similar to those ment similar to APG II and APweb. Affinities of Faboideae (Tucker 2002). with Rutales have been supported on the Mimosoideae are largely monophyletic, basis of wood anatomy and embryology Faboideae are monophyletic, Caesalpin- (Thorne, 1992). Thorne (2006, 2007) shifted ioideae are paraphyletic and basal. the family under Rosanae—>Fabales. Wojciechowski et al., (2003) on basis of stud- Recognition of broadly circumscribed ies on sequences of the plastid matK gene note Fabaceae, is supported by its monophyly as than non-protein amino acids seem to have evidenced by common morphological fea- originated once in this clade. Fabaceae s. l. tures, and the results of rbcL sequence data are often referred to their own order, as in (Chappill 1994; Doyle 1994). Studies also in- both Cronquist (1981) and Takhtajan (1997), dicated that Caesalpinioideae are former placing it closer to Rosales and latter paraphyletic with some genera more closely closer to Sapindales. They can be confused related to Mimosoideae, and others to with Connaraceae (Oxalidales), although the Faboideae than they are to one another. It is latter lack stipules, their flowers are radially now established that Swartzia and Sophora symmetrical and have stamens of two dis- (and relatives) represent basal clades of tinctly different lengths, and their gynoecium Faboideae lack a 50kb inversion in the trnL is frequently multi-carpellate. However, in intron that is found in other members of the both the RP122 chloroplast gene has moved subfamily. Studies of Doyle et al., (2001) and to the nucleus! Also, the ovaries of both have Bruneau et al., (2001) suggest that Cercis and adaxial furrows (cf. the ventral slit: Matthews Bauhinia are basal in Fabaceae and as such & Endress, 2002). Fabaceae have also been discussed under distinct group Cercideae in linked with Sapindaceae, in the Eurosid II APweb, characterized by simple leaves, some- group in APG II and APweb.

* * * * * * * * * * *

Myrtaceae A. L. de Jussieu Myrtle family 137 genera, 2,050 species Mainly distributed in tropics and subtropics, abundant in Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Figure 13.86 Myrtaceae. Eucalyptus tereticornis. A: Portion of branch with axillary umbellate inflorescences; B: Vertical section of flower bud; C: Open flower with cap shed; D: Transverse section of ovary with 4 axile placentas. Callistemon viminalis. E: Branch with spike proliferating into vegetative shoot; F: Flower with long exserted numerous stamens; G: Vertical section of flower; H: Stamen with dorsal fixation; I: Trans- verse section of ovary with 3 axile placentas. Syzygium cuminii. J: Branch with inflorescences borne on peduncles; K: Vertical section of flower; L: Fruits.

Salient features: Shrubs or trees, bark erating into vegetative shoots, giving appear- flaky, leaves gland-dotted, entire, inframar- ance of a bottle-brush). Flowers bracteate ginal venation, stamens numerous, ovary in- (Eugenia) or ebracteate (Eucalyptus), bi- ferior often united with hypanthium. sexual, actinomorphic, epigynous (sometimes perigynous). Calyx with 4-5 sepals, Major genera: Eugenia (600 species). Euca- more or less connate into a tube, imbricate, lyptus (500), Myrcia (300), Syzygium (300), sometimes united into a cap (calyptra or Psidium (100), Melaleuca (100) and operculum) which drops off as flower opens. Callistemon (25). Corolla with 4 (Eugenia) to 5 (Psidium) petals, (rarely absent), usually fugacious, free, Description: Evergreen Shrubs (Myrtus) or rarely united with calyx to form cap like oper- large trees (Eucalyptus) often with flaky bark, culum (Eucalyptus) that falls off as the flower terpenes present. Leaves alternate opens. Androecium with many stamens, (Barringtonia, Callistemon), opposite (Eugenia) filaments free or slightly connate at base or whorled, simple, entire, gland-dotted, usu- (Callistemon), attached higher up on ally coriaceous, venation often inframar- hypanthium, anthers bithecous, dehiscence ginal, stipules absent. Inflorescence cymose longitudinal or by apical pores, pollen grains (umbellate cyme in Eucalyptus) or racemose usually tricolpate with fused furrows Gyn- (Barringtonia), flowers sometimes solitary oecium with 2-5 united carpels (syncarpous), (Psidium), or in spikes (Callistemon—prolif- multilocular (locules as many as carpels) 574 Plant Systematics with 2-many ovules, placentation axile, thors). Monophyly of the family, together rarely parietal (Rhodamnia) with intruded with the morphological data, is evidenced by placentae, ovary inferior, or semi-inferior molecular analysis through rbcL (Conti, (Melaleuca) style long with capitate stigma. 1994), matK (Wilson et. al., 1996), and ndhF Fruit a fleshy berry (Eugenia), drupe (Sytsma. et al., 1998) sequences. Heteropyxis (Barringtonia) or capsule (Eucalyptus), rarely and Psiloxylon are basal taxa with perigynous one-seeded nut (Calycothrix); seeds 1-many, flowers and stamens in two whorls. The fam- embryo curved or twisted, endosperm absent. ily is considered to be closely related to Ro- saceae, and probably the order Myrtales is Economic importance: The family is the derived from Rosales. The family is tradi- source of important oils such as eucalyptus tionally divided into two subfamilies: oil (Eucalyptus) used as flavouring and inha- Leptospermoideae (leaves spiral to opposite; lant, clove oil (Syzygium aromaticum) used as fruit dry, dehiscent) and Myrtoideae clearing agent and in tooth aches, and oil of (polyhydroxyalkaloids common; leaves oppo- bay rum (Pimenta racemosa). Callistemon is site; terpenoid-containing glands in the apex commonly grown as ornamental with its of the connective, stigma dry; fruit fleshy, beautiful bottlebrush like inflorescence indehiscent). The latter are largely derived. (hence the name). Guava fruit is obtained Leptospermoideae are basal and paraphyletic from Psidium guajava. Clove and allspice (Wilson et al., 2001; Salywon et al., 2002) as (Pimenta dioica) include important spices. evidenced by molecular and morphological Fruits of Syzygium cuminii (jambolan; ‘jamun’) data. Genus Syzygium, sometimes included are edible and grown in India and China. under Eugenia, represents an independent acquisition of the fleshy fruit from that in Phylogeny: The family presents least taxo- Eugenia and the bulk of Myrtoideae. Thorne nomic conflicts, almost universally placed (2003, 2006, 2007), places the family along under Myrtales under Rosids (whether rosid with other two in suborder Myrtineae, clade, Rasanae, or Rosidae depending upon Lythraceae and Onagraceae being placed the nomenclature followed by different au- under Lythrineae.

* * * * * * * * * * *

Lythraceae J. St.-Hilaire Loosestrife family 31 genera, 460 species (including Trapaceae) Widely distributed mainly in tropics, more widespread in America, a few herbaceous species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Figure 13.87 Lythraceae. Trapa bispinosa. A: Portion of plant with leaves (showing swollen petioles) and flowers; B: Flower with front sepals and petals removed; C: Pistil with disc; D: Fruit. E: Fruit of T. natans. Lythrum salicaria F: Branch with flowers; G: Flower; H: Vertical section of flower; I: Transverse section of ovary. Ammania coccinia. J: Branch with flowers and fruits; K: Flower; L: Cluster of fruits at node. (F-I, after Bailey, Man. Cult. Pl., 1949. J-L, after Godfrey and Wooten, Aq. wetland Pl. SE US, 1981) 576 Plant Systematics

Salient features: Leaves opposite, simple, (Cuphea), sometimes by bats (Sonneratia). entire, flowers in racemes or panicles, Cleistogamy prevalent in Peplis and Ammania. bisexual, hypanthium present, petals crum- Dispersal of seeds occurs through wind or pled, stamens unequal in length, in two water. whorls, ovary superior, fruit dry, indehiscent or dehiscent capsule.7 Economic importance: The family is known for various ornamentals such as Crepe myr- Major genera: Cuphea (280 species), Diplu- tle (Lagerstroemia), Mexican heather sodon (70), Lagerstroemia (55), Nesaea (50), (Cuphea) and loosestrife (Lythrum). Migonette Rotala (45), Lythrum (35), Ammania (20), and tree (Lawsonia inermis) is the source of Trapa (3, sometimes split into up to 30). henna, obtained from leaves. Leaves of Woodfordia fruticosa yield red colour, and the Description: Herbs, shrubs or trees (with bark of Lafoensia pacari a red dye. Fleshy flaky bark), rarely spinescent (Lawsonia), seeds of Pomegranate (Punica granatum) are rarely aquatic herbs (Trapa). Leaves opposite edible, and also used as condiment after dry- or whorled , rarely alternate, simple, entire, ing and powdering. toothed and with swollen petiole in Trapa, venation pinnate, stipules absent or repre- Phylogeny: The family is commonly placed sented by minute hairs . Inflorescence of soli- under Myrtales although Hutchinson in- tary flowers or raceme, panicle or cymose. cluded it under order Lythrales. The genus Flowers bisexual, actinomorphic, rarely Trapa formerly included in Onagraceae was zygomorphic (Cuphea), perigynous with well separated to Trapaceae, but has now been developed ribbed hypanthium, epicalyx of shifted to Lythraceae (APG-II, 2003; APWeb, connate pair of bracts sometimes present be- 2007; Thorne, 2006, 2007). Onagraceae and low hypanthium (Lythrum). Calyx with 4-8 Lythraceae share features of tannins scarce, sepals, free or connate, valvate, often thick. soluble oxalate present, wood with vessels Corolla with usually 4-8 petals, free, imbri- in groups, petiole bundle arcuate, inflores- cate, usually attached along the inner rim of cence racemose and clawed petals. The fam- hypanthium, crumpled in bud and wrinkled ily Lythraceae broadly circumscribed to in- at maturity, sometimes lacking (Peplis, clude Trapaceae, Sonneratiaceae and Rotala). Androecium with usually twice as Punicaceae is monophyletic as supported by many stamens as petals, in two whorls, outer rbcL sequences. Two well defined clades are whorl alternating with petals, sometimes recognised within the family: one contain- only in one whorl, usually unequal in length, ing Sonneratia, Duabanga, Punica, Lager- filaments free, anthers bithecous, dorsifixed, stroemia and Lawsonia is characterised by deiscence longitudinal, introrse. Gynoecium determinate inflorescence, and wet stigmas; with usually 2-6 united carpels, ovary supe- second containing the remaining genera rior, locules as many as carpels, rarely uni- racemose inflorescence, reduced number of locular, placentation axile, septa sometimes carpels and dry stigmas. Thorne (2006) incomplete and disappearing in upper part of recognises five subfamilies: first Lythroideae ovary, ovules 2-several, anatropous, ascend- containing bulk of genera (27), and the rest ing, nectaries at base of hypanthium, style monogeneric Duabangoideae, Sonneratioi- simple, stigma discoid or capitate. Fruit a deae, Punicoideae and Trapoideae. Subse- capsule, indehiscent or dehiscent, rarely quently (2007) he has merged Punicoideae berry; seeds usually flattened or winged, seed with Lythroideae and combined the other coat often with hairs becoming mucilaginous three under Lagerstroemioideae, thus on wetting, embryo straight, endosperm lack- recognizing only two subfamilies. ing. pollination by bees, beetles, flies or birds

* * * * * * * * * * * Major Families of Angiosperms 577 Onagraceae A. L. de Jussieu Evening Primrose family 17 genera, 650 species Widely distributed mainly in temperate and subtropical regions, very diverse in western North America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Herbs and shrubs, leaves petaloid, caducous, rarely persistent simple, flowers usually 4-merous, sepals, (Ludwigia). Corolla with usually 4 petals, petals and stamens inserted on rim of rarely 2-7, free, sometimes clawed, imbri- hypanthium, carpels 4, united, placentation cate, convolute or rarely valvate, rarely ab- axile, ovary inferior. sent. Androecium with usually 4 stamens, mostly as many as petals, sometimes twice Major genera: Epilobium (180 species), as many, rarely only one fertile and one Oenothera (120), Fuchsia (110), Ludwigia (80), staminode (Lopezia), filaments free, inserted Camisonia (60), Clarkia (45), Gaura (18, some- on inner rim of hypanthium, anthers times merged with Oenothera), Lopezia (17) bithecous, sometimes with cross partitions, and Circaea (12). Although Oenothera is the dehiscence logitudinal; pollen grains usually type genus of the family, the name triporate, sometimes tricolporate or biporate, Oenotheraceae Warming, 1879 is antedated with paracrystalline beaded outer exine, as- by Onagraceae, 1829 and adopted by A. L. de sociated with viscin threads, which help pol- Jussieu. len to adher together. Gynoecium with usually 4 united carpels, rarely 2 or 5, ovary in- Description: Usually herbs, sometimes ferior, usually 4 chambered with axile shrubs (Fuchsia), rarely aquatic herbs placentation, septa sometimes incomplete, (Jussiaea) or trees (Hauya), raphides present, or with parietal placentation, ovules 1-many stems with internal phloem, often with epi- in each locule, anatropous, with monosporic dermal oil cells. Leaves alternate, opposite 4-nucleate megagametophyte (Oenothera- or whorled , simple, rarely pinnate, entire type), nectary near or at base of hypanthium, or toothed, sometimes lobed, venation pin- style slender, stigma capitate or 4-lobed. nate, stipules usually absent, if present Fruit a loculicidal capsule, rarely berry (Fuch- caducous (Fuchsia, Circaea). Inflorescence sia), bristly 1-2 seeded nutlet (Circaea), or 1- of solitary flowers in leaf axils, sometimes seeded nut (Gaura); seeds commonly with spike or raceme, rarely panicle (Fuchsia). hairy tufts (Epilobium) or wings (Hauya), Flowers bisexual, actinomorphic, rarely rarely smooth, embryo straight, endosperm zygomorphic (Lopezia), epigynous with well lacking. Pollination by bees, moths, flies and developed hypanthium often prolonged above birds. Dispersal of winged and hairy-tuft ovary, . Calyx with usually 4 sepals, rarely seeds by wind, fleshy fruits of Fuchsia by birds, 2-7, free, rarely connate, valvate, sometimes and hooked fruits of Circaea by exozoochory. 578 Plant Systematics

Figure 13.88 Onagraceae. Oenothera rosea. A: Portion of plant with flowers and fruits; B: Flower; C: Stamen; ; D: Transverse section of ovary; E: Fruit. Ludwigia alternifolia F: Branch with flowers and fruits; G: Flower from above. L. linearis H: Flower, side view; I: Fruit. (A-E, after Sharma and Kachroo, Fl. Jammu, 1983. F-I, after Godfrey and Wooten, Aq. wetland Pl. SE US, 1981).

Epilobium commonly colonises burned areas, Phylogeny: The family is commonly placed hence the name fireweed. Oenothera flow- under Myrtales although Hutchinson (1973) ers often open in late afternoon and thus included it under order Lythrales. The known as Evening primrose. genus Trapa formerly included in this family was separated to Trapaceae Economic importance: The family is known (Cronquist, 1988; Dahlgren, 1989; for showing flowers. Species of Oenothera Takhtajan, 1997), but has now been shifted (Evening pirmrose) and Clarkia are grown as to Lythraceae (APG-II, 2003; APWeb, 2008; ornamentals in flower beds. Fuchsia shrubs Thorne, 2006, 2007). Onagraceae and are grown in greenhouses or in open warm Lythraceae share features of tannins scarce, regions. soluble oxalate present, wood with vessels Major Families of Angiosperms 579 in groups, petiole bundle arcuate, inflores- Lythraceae found strong support for cence racemose and clawed petals. monophyly of Onagraceae, with Ludwigia as Pentamerous members Decodon and the basal lineage and a sister-taxon relation- Ludwigia are sister to the respective fami- ship between Megacorax and Lopezia. Most lies Lythraceae and Onagraceae. Two well relationships within Onagreae are weakly defined subfamilies, Ludwigioideae (4-5 resolved, suggesting a rapid diversification merous flowers, hypanthium absent, pollen of this group in western North America. Nei- in tetrads, stigma capitate) and Onagroideae ther Camissonia nor Oenothera appears to be (flowers 4-merous, hypanthium long, stigma monophyletic. The study also showed that divided) are commonly recognised in APWeb the small genus Gongylocarpus previously (2008), although it is conventional to divide included in tribe Onagreae is strongly sup- the family into number of tribes. Raimann ported as sister to the rest of Onagreae + (1893) recognised 8 tribes within the family: Epilobieae, and should be placed in its own Jussieae, Epilobieae, Hauyeae, Onagreae, tribe, Gongylocarpeae. Subsequent studies Gaureae, Fuchsieae and Circeae. Gaureae of Levin et al. (2004) on two biggest tribes is often included under Onagreae. Despite based on DNA sequence data from one intensive morphological and molecular stud- nuclear region (ITS) and two chloroplast ies of Onagraceae, relationships within the regions trnL-trnF and rps16 strongly suggest family are not fully understood. Levin et al. that tribe gongylocarpeae is sister to tribes (2003) on the basis of parsimony and maxi- Epilobieae + Onagreae, both of which are mum likelihood analyses with rbcL and ndhF monophyletic. Within Onagreae, Camissonia sequence data for 24 taxa representing all seems to be broadly paraphyletic, and 17 Onagraceae genera and two outgroup Oenothera is also paraphyletic.

* * * * * * * * * * *

Subclass 10. Malvidae (B) 3. Muntingiaceae (B) Superorder 1. Malvanae 4. Dipterocarpaceae Order 1. Vitales 5. Sarcolaenaceae Family 1. Vitaceae 4. Thymelaeineae 2. Malvales 1. Thymelaeaceae 2. Tepuianthaceae Suborder 1.Malvineae 1. Malvaceae (B) 3. Rhamnales 2. Grewiaceae (B) 1. Rhamnaceae 3. Byttneriaceae 2. Elaeagnaceae 2. Cochlospermineae 3. Dirachmaceae (B) 4. Barbeyaceae (B) 1. Bixaceae 2. Diegodendraceae (B) 4. Urticales 3. Cochlospermaceae 1. Ulmaceae 4. Sphaerosepalaceae (B) 2. Moraceae 3. Cistineae 3. Urticaceae 1. Neuradaceae (A) 4. Celtidaceae 2. Cistaceae 5. Cannabaceae 580 Plant Systematics

Superorder 2. Rafflesianae 17. Tropaeolaceae Order 1. Rafflesiales 18. Akaniaceae 1. Apodanthaceae 19. Bretschneideraceae 2. Rafflesiaceae Superorder 4. Huerteanae 3. Cytinaceae Order 1. Huerteales 4. Mitrastemonaceae 1. Gerrardinaceae Superorder 3. Capparanae (B) 2. Tapisciaceae Order 1. Capparales 3. Dipentodontaceae 1. Capparaceae Superorder 5. Rutanae 2. Cleomaceae Order 1. Rutales 3. Brassicaceae 4. Setchellanthaceae 1. Rutineae 5. Stixaceae 1. Rutaceae 6. Resedaceae 2. Simaroubaceae 7. Gyrostemonaceae 3. Kirkiaceae 8. Pentadiplandraceae (B) 4. Picramniaceae 9. Tovariaceae (B) 5. Biebersteiniaceae (B) 10. Emblingiaceae (B) 6. Tetradiclidaceae (B) 11. Koeberliniaceae (B) 7. Nitrariaceae (B) 12. Bataceae 8. Meliaceae 13. Salvadoraceae 2. Anacardiineae 14. Limnanthaceae 1. Burseraceae 15. Caricaceae 2. Anacardiaceae 16. Moringaceae 3. Sapindineae 1. Sapindaceae

Malvaceae A. L. de Jussieu Mallow family 197 genera, 2,865 species (excluding Grewiaceae) Distributed in tropical and temperate climates, mainly in the South American tropics.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta

Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Malvanae Malvanae Malvanae Eurosids II* Order Malvales Malvales Malvales Malvales Malvales Malvales APG II Malvaceae includes Tiliaceae, Sterculiaceae and Bombacaceae Thorne under suborder Malvineae; Malvaceae, includes Sterculiaceae and Bombacaceae and trun- cated Tiliaceae (2 genera) but excludes Grewiaceae (majority genera of former Tiliaceae) Major Families of Angiosperms 581

Salient features: Herbs and shrubs with Economic importance: The family is repre- stellate pubescence, often mucilaginous, sented by several ornamentals such as leaves palmately veined, stipules prominent, China rose (Hibiscus rosa-sinensis), hollyhock flowers usually with epicalyx, stamens nu- (Althaea rosea) and rose of Sharon (Hibiscus merous with united filaments, anthers syriacus), Young fruits of okra (Hibiscus monothecous, carpels five or more, ovary esculentus; ‘bhindi’) are used as vegetable. superior, placentation axile. Cotton is obtained from different species of Gossypium. Cocoa (chocolate source) is ob- Major genera: Hibiscus (300 species), Ster- tained from seeds of Theobroma cacao, Cola culia (300), Dombeya (300), Sida (200), nitida (both formerly under Sterculiaceae) Pavonia (200), Abutilon (100), Tilia (50), Adan- yields cola. Seed hairs from Ceiba and sonia (10), Gossypium (20) and Bombax (8). Bombax (kapok) are used as stuffing. Tilia is a tree valuable as timber (Basswood). The Description. Herbs or shrubs, rarely small wood of T. cordata is particularly good for (Thespesia) or large (Tilia) trees. Plants of- making furniture and musical instruments, ten mucilaginous. Leaves alternate, simple, also grown as ornamental tree. sometimes palmately lobed (Gossypium), palmately veined, pubescence stellate or of Phylogeny: The family has been considered peltate scales, stipules present. Inflores- quite distinct on the basis of monadelphous cence cymose (Pavonia) or flowers solitary stamens with monothecous anthers, axillary. Flowers bracteate (Abutilon) or though it had been considered quite closer ebracteate (Hibiscus) bisexual, to Tiliaceae, Bombacaceae and actinomorphic, hypogynous. Calyx with 5 Sterculiaceae by Cronquist (1988) and sepals, more or less united, often subtended Takhtajan (1997). These families share the by epicalyx (bracteoles), epicalyx 3 (Malva), features of presence of stellate hairs, mu- 5-8 (Althaea) or absent (Sida). Corolla with 5 cilaginous cells, pericycle strands above petals, free, imbricate, often adnate at base phloem, similar size and pitting of vessels, to staminal tube. Androecium with many and the distribution of xylem parenchyma. stamens, filaments united into a tube According to Judd et. al., (1999, 2002) the (monadelphous), epipetalous, anthers traditional distinctions between these fami- monothecous, dehiscence transverse, pollen lies are arbitrary and inconsistent, and the grains large with spinous exine, triporate or merger of four would form a monophyletic multiporate, tricolpate in Abutilon. Gyn- Malvaceae. They however, concede that oecium with 2-many (usually 5) united car- genera such as Grewia, Corchorus, pels (syncarpous), multilocular (locules as Triumfetta , etc., form a clade which has many as carpels) with many ovules, lost calyx fusion, also suggesting that placentation axile, ovary superior, styles Grewioideae and Byttnerioideae form branched above, stigmas as many as carpels distinct clades within Malvaceae. Tradi- or twice as many (Malvaviscus). Fruit a tional Tiliaceae was circumscribed by free loculicidal capsule or schizocarp (Malva), stamens and bithecous anthers. Thorne follicles (Sterculia), rarely a berry (Malva- (1999, 2000), obviously had kept Tiliaceae viscus); seeds 1-many, embryo curved, distinct, merging the other two families endosperm absent. Flowers are insect polli- with Malvaceae. Recent molecular nated, nectar usually produced by inner evidence (Alverson et al., 1998) suggests surface of calyx. Dispersal may occur by that half-anthers of the traditional wind, water, or animals. Large indehiscent Malvaceae are transversely septate pods of Adansonia are dispersed by large bithecous anthers that are strongly mammals. connate. Earlier Hutchinson (1973) had pro- 582 Plant Systematics

Figure 13.89 Malvaceae. Malva parviflora. A: Plant in flower; B: Portion of flower with 2 petals and longitudinally split androecium; C: Gynoecium; D: Fruit with persistent calyx. Abutilon indicum. E: Plant with flowers and fruits on long peduncles; F: Calyx; G: Gynoecium with several carpels; H: One fruiting carpel split to show seeds. posed that the monothecous anthers arose Brownlowioideae, Helicteroideae, Grewioi- from splitting (chorisis) of the filaments. deae and Byttnerioi-deae. Thorne who had Restriction site analysis of cpDNA has earlier recognized Tiliaceae as distinct fam- established that genera with loculicidal ily has finally (2003, 2006) shifted Tilia and capsules and numerous seeds (Hibiscus, Craigia to Malvaceae under Tilioideae, the Gossypium), form a basal paraphyletic remaining genera of family Tiliaceae be- complex. Genera with schizocarpic fruits, ing put under new family Grewiaceae. He more than five carpels, and ovules one or recognizes 7 subfamilies under Malvaceae, two per carpel depict synapomorphies. recognizing Grewioideae and Byttnerioi- APweb recognises following 9 subfamilies deae as independent families Grewiaceae under the broadly circumscribes and Byttneriaceae, respectively. A major Malvaceae: Malvoideae, Bombacoideae, shift in his 2007 revision puts Malvanae Sterculioideae, Tilioideae, Dombeyoideae, under new subclass Malvidae.

* * * * * * * * * * * Major Families of Angiosperms 583 Grewiaceae (Dippel) Thorne Grewia family 31 genera, 390 species Widely distributed in tropics and subtropics.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II/(APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Malvanae Malvanae Malvanae Eurosids II* Order Malvales Malvales Malvales Malvales Malvales Malvales B & H, Cronquist, Takhtajan, and Dahlgren under family Tiliaceae. APG II and APweb do not recognize Tiliaceae or Grewiaceae as separate family, merge with Malvaceae. Thorne under suborder Malvineae

Figure 13.90 Grewiaceae. Grewia tenax. A: Portion of plant with flowers and fruits; B: Flower with sepals and petals removed; C: Stamen; D: Transverse section of ovary. Corchorus capsularis. E: Portion of plant with flowers and fruits; F: Flower from above; G: Fruit. H: Corchorus aestuans, portion of plant with fruit. 584 Plant Systematics

Salient features: Shrubs or trees, leaves placentation axile, ovary superior, style sin- with asymmetrical base, pubescence of gle, stigma lobed or capitate. Fruit a capsule branched hairs, stamens numerous with or fleshy. Seeds 1-many, embryo straight, free or united filaments, anthers bithecous, endosperm present. carpels five or more, ovary superior, placentation axile. Economic importance: Jute is obtained from stem fibres of Corchorus capsularis and C. Major Genera: Grewia (150 species), olitorius. Leaves of C. olitorius are used for Triumfetta (70) and Corchorus (50). food in many eastern Mediterranean countries. Description: Shrubs or trees, rarely herbs (Corchorus, Triumfetta). Leaves alternate, sim- Phylogeny: The family has been considered ple, deciduous, bases asymmetrical, pubes- to be distinct for a long time, with removal cence of branched hairs, stipules present. of genera of the family Tiliaceae to Inflorescence cymose, usually in small clus- Flacourtiaceae by Engler and Prantl (1887- ters in leaf axils. Flowers bisexual, rarely uni- 1915). The family is distinct from now en- sexual, actinomorphic, hypogynous. Calyx larged Malvaceae in free stamens and with 3-5 sepals, free or connate, valvate. Co- bithecous anthers. APG classifications (APG rolla with 3-5 petals, free, imbricate or II, APweb) have merged Tiliaceae with valvate, sometimes with glandular hairs at Malvaceae. Thorne (1999), treated Tiliaceae their bases, rarely absent. Androecium with as distinct family (including subfamilies of many stamens, sometimes only 5 (Triumfetta Malvaceae: Tilioideae and Grewioideae in pentandra), filaments free or united into APweb). Subsequently (2003) he has merged groups of 5 or 10 (polyadelphous), adnate to Tilioideae (Tilia and Craigia) with Malvaceae, base of petals, anthers bithecous, dehiscence recognizing Grewioideae as independent longitudinal, or by apical pores. Gynoecium new family Grewiaceae (new name neces- with 2-many united carpels, multilocular sitated due to shifting of Tilia, the type of fam- (locules as many as carpels) with many ovules, ily Tiliaceae).

* * * * * * * * * * *

Dipterocarpaceae Blume Meranti family 17 genera, 550 species Distributed mainly in tropical Asia and Indomalaysia, also represented in Africa and South America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Malvanae Malvanae Malvanae Eurosids II* Order Guttiferales Theales Malvales Malvales Malvales Malvales B & H as Dipterocarpeae. Thorne under suborder Cistineae Major Families of Angiosperms 585

Figure 13.91 Dipterocarpaceae. Dipterocarpus trinervis. A: Branch with flower; B: Calyx and corolla; C: Vertical section of flower; D: Longitudinal section of ovary; E: Stamen with sterile tip above anther; F: Transverse section of ovary. G: Fruit of D. pilosus with two long wings. H: Fruit of Parashorea stellata with five wings.

Salient features: Small or large trees with bisexual, actinomorphic, often showy, buttressed bases, leaves evergreen, alter- fragrant, hypogynous. Calyx with 5 sepals, nate, often with domatia, flowers perigynous free or slightly connate, sometimes enlarged or epigynous, in racemes or panicles, sepals and winged in fruit. Corolla with 5 petals, becoming winged in fruit, petals 5, often free or connate at base, spirally twisted, leathery, anthers with sterile tips, carpels often leathery. Androecium with 5-numer- 3, fruit a winged nut. ous stamens, filaments free or connate at base, anthers bithecous, dorsifixed (Monotoi- Major genera: Shorea (150 species), Hopea deae), or basifixed (Dipterocarpoideae), (110), Dipterocarpus (80), Vatica (60) and dehiscence longitudinal, anthers with Monotes (26). sterile tip formed by extension of connective, pollen grains tricolpate or triporate. Description: Small or large trees, often but- Gynoecium with 3 united carpels, ovary tressed at the base, trunk very long and superior or partly inferior (Anisoptera), smooth, branched at top with cauliflower- 3-locular with 2 ovules in each chamber, shaped crown, usually with special resin placentation axile, ovules pendulus, canals exuding aromatic dammar from anatropous, bitegmic, crassinucellate, only wounds, nodes trilacunar or pentalacunar, one ovule develops further. Fruit a single roots with ectomycorrhiza. Leaves alternate, seeded nut with winged and membranous distichous, coriaceous, simple, evergreen, calyx; seeds without endosperm, cotyledons covered with fasciculate or stellate hairs, often twisted, enclosing radicle. stipules present and frequently containing domatia housing insects, usually early shed- Economic importance: Many species of ding. Inflorescence racemose, axillary or Dipterocarpus, Shorea, Hopea and Vatica usu- terminal racemes or panicles. Flowers ally grow together in tropical rain forests and 586 Plant Systematics are principal sources of hardwood timber. The clade having plant with secretory canals, wood is pale in colour and in great demand calyx imbricate, two outer members often for plywood and block wood. Dammar resin different from the rest, filaments not articu- obtained from the tree is used for special lated, ovules both anatro-pous and atropous; varnishes. exotegmen curved inwards in chalazal region, and there is a strong case for merging Phylogeny: The family is related to former two in Dipterocarpaceae. Phylogenetic Ochnaceae, Elaeocarpaceae, Grewiaceae and studies on family Dipterocarpaceae based on other members of Malvales. Cronquist con- morphological and rbcL sequence data siders it closer to Guttiferae and Theaceae (Dayanandan et al., 1999) have shown that in addition to Ochnaceae. The family is usu- Monotoideae and Pakaraimaeoideae are ally divided into 3 subfamilies: Monotoideae, cladistically basal, representing primitive Pakaraimaeoideae and Dipterocarpoideae. members of the family. Thorne (2003) had Molecular studies of Kubitzki & Chase, (2002) earlier included the family (and the order have shown that Sarcolaenaceae, Cistaceae Malvanae) under superorder Rosanae, but and Dipterocarpaceae form a well defined subsequently (2006) shifted to Malvanae.

* * * * * * * * * * *

Rhamnaceae A. L. de Jussieu Buckthorn family 53 genera, 875 species Distributed worldwide but more common tropical and subtropical regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Malvidae Series+/Superorder Disciflorae+ Rutanae Rutanae Malvanae Eurosids I* Order Rhamnales Rhamnales Sapindales Sapindales Rhamnales Rosales

Salient features: Trees and shrubs, leaves Description: Erect or climbing shrubs, trees, toothed with strong secodary veins, stipu- rarely herbs, sometimes thorny, sometimes late, flowers perigynous, petals strongly con- associated with nitrogen-fixing cave, stamens opposite the petals, Actinomycetes bacteria, stems often modi- hypanthium with nectary inside, ovules on fied into thorns, tendrils or hooks. Leaves basal placentas. usually opposite, sometimes alternate, simple, toothed, venation reticulate with strong Major genera: Rhamnus (150 species), secondary veins, stipules usually present Phylica (150), Ziziphus (100), Ceanothus (40), and often modifies into spines, leaves some- Gouania (35), Colubrina (15), Berchemia (10) times rudimentary. Inflorescence axillary and Sageretica (10). corymb or cymose clusters, rarely solitary. Major Families of Angiosperms 587

Figure 13.92 Rhamnaceae. Rhamnus purpurea. A: Branch with flowers; B: Flower; C: Vertical section of flower; D: Transverse section of ovary; E: Fruit. F: Fruiting shoot of Zizyphus mauritiana. G: Flowering shoot of Z. nummularia. (A, B and E, after Polunin and Stainton, Fl. Himal., 1984; F and G, after Maheshwari Illus. Fl. Del., 1966).

Flowers small, usually inconspicuous, inferior (Gouania) due to adnation with disc, actinomorphic, bisexual, rarely unisexual, ovule 1 in each locule on basal placenta, perigynous, hypanthium present. Calyx pendulus, anatropous, style one, often lobed with 5 sepals, rarely 4, free or united, lobes or cleft. Fruit a drupe with 1-many valvate. Corolla with 5 petals, rarely 4, free, endocarps, capsule or samaroid nut; seed sometimes absent, often concave and hooded large, usually straight, sometimes curved, (cucullate) over anthers, usually clawed. without or with scanty endosperm. Androecium with as many as petals and opposite them, arising from outside disc that Economic importance: The family yields lines the rim of hypanthium, anthers important fruits from species of Ziziphus bithecous, dehiscence longitudinal, anthers (Z. jujuba, the jujube or Chinese date; with sterile tip formed by extension of con- Z. mauritiana, the Indian jujube; Z. lotus, nective, pollen grains tricolpate or triporate. lotus fruit), also used to make jelly-like Gynoecium with 2-4 united carpels, rarely candy. Plants of the family yields dyes 5, locules as many, ovary superior or partly include Rhamnus cathartica (green dye from 588 Plant Systematics sap), R. tinctoria (yellow dye from fruits), R. Elaeagnaceae, Dirachmaceae and Barbeya- chlorophora (Chinese green indigo from bark) ceae under Rhamnales, but shifts Vitaceae obtained from the members of this family to independent order Vitales under Malvanae. include. Several species are also used me- APG -II includes Vitaceae unplaced in Rosids, dicinally: fruits of R. cathartica and R. whereas APWeb included it under Vitales but purshiana are strongly laxative; extract of towards end of Core Eudicots. Takhtajan Gouania bark are used as woud dressing in (1997) also separated two families under Africa; Ventilago oblongifolia is used to treat distinct orders. The family Rhamnaceae cholera in Malaya. Many species of shows affinities with Rosales, under which Ceanothus (tea bush) with beautiful panicles it is placed in both APG-II and APWeb. There of blue, pink or white flowers are grown as are three main clades in the family are ornamentals. Other members used as orna- recognised by APWeb, the rhamnoids, which mental include Hovenia (raisin tree), include Maesops and Ventilago (three tribes), Berchemia (supplejack), Poliurus (Jerusalem the ziziphoids (five tribes), which include most thorn) and Reynosia. of the rest of the family, and the ampelo- ziziphoids (three tribes). The four families Phylogeny: Family is often placed closer to included under the order by Thorne (2006) Vitaceae, in the same order Rhamnales form a well defined clade (Sytsma et al. 2002), (Rendle, Cronquist, Hutchinson but he also with dense curly hairs on abaxial surface of included Elaeagnaceae and Heteropyxida- leaf, a possible synapomorphy. Rhamnaceae ceae). Thorne (2006) retains Rhamnaceae, is sister to this clade.

* * * * * * * * * * *

Ulmaceae Mirbel Elm family 7 genera, 40 species Mainly distributed in temperate region, also tropics and subtropics.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Hamamelidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Unisexuales+ Urticanae Malvanae Malvanae Eurosids I* Order Urticales Urticales Urticales Urticales Rosale B & H under family Urticaceae

Salient features: Trees or shrubs with wa- Major genera: Ulmus (20 species), Zelkova tery sap, sieve-tube plastids P-type, leaves (6), Phyllostylon (3) and Planera (1). simple, serrate or biserrate, vascular bundles entering teeth, leaf base oblique, vena- Description: Shrubs or trees without tion pinnate, flowers often bisexual, fruit a laticifers, often with tannins, cystoliths winged samara or drupe. present, branching profusely and often Major Families of Angiosperms 589

Figure 13.93 Ulmaceae. Ulmus chumlia. A: Short shoot, lower surface & corky bark; B: Leaf of coppice shoot, upper surface; C: Normal adult short shoot, upper surface; D: Leaf margin; E: Indumentum of midrib portion, lower surface; F: Flowering shoot; G: Fruiting shoot; H: Flower; I: Slightly older flower; J: Gynoecium; K: Bract; L: Inner bud scale; M: Mature winged fruit. (After Melville and Heybroek, 1971)

spreading. Leaves alternate, rarely opposite, Perianth with 4-9 tepals, free or connate, simple, serrate or biserrate, base often ob- representing sepals (petals absent), imbri- lique, venation pinnate, reticulate, vascu- cate. Androecium with 4-9 stamens, as lar bundles entering teeth, stipules present many as tepals and opposite them, some- but falling early. Inflorescence consisting of times adnate to tepals, pollen grains 4-6- axillary cymose clusters. Flowers small, porate. Gynoecium with 2 united carpels, actinomorphic, bisexual or unisexual and ovary superior, unilocular, ovule 1, monoecious, hypogynous or perigynous. placentation apical, stigmas 2, decurrent on 590 Plant Systematics style. Fruit a nut or samara; seed flat with fruit a samara or nut. The family was earlier straight embryo, endosperm forming a sin- divided into two subfamilies: Celtidoideae gle layer and appearing absent. Pollination (drupe-like fruit, three palmate veins, sieve by wind. Winged fruits are also dispersed by tube plastids S-type; style with single vascu- wind, nut-like fruits of Planera dispersed by lar bundle, embryo curved) and Ulmoideae water. (fruit samara, veins pinnate; sieve tube plastids P-type, style with 3 vascular bundles, Economic importance: Various species of embryo straight). The former has now been Ulmus (elm) and Zelkova provide timber used separated as a distinct family Celtidaceae. for furniture, posts and under water pillings. The family is often placed in order Urticales. Ulmus americana and other species are grown Cronquist places it under Hamamelid com- as ornamentals and important shade trees. plex but others including Dahlgren and Mucilaginous inner bark of U. rubra has me- Thorne place them along with other dicinal importance. Malvanean groups. Takhtajan also places them closer to Malvales but under superorder Phylogeny: The family was earlier included Urticanae. APG classifications place them under Urticaceae (Bentham and Hooker) but closer to Rosaceae, and Rhamnaceae under now separated due to veins of leaves running order Rosales, Rosaceae being considered directly into teeth, flowers often bisexual and sister to rest of the families.

* * * * * * * * * * *

Moraceae Link Mulberry family 37 genera, 1,100 species Distributed mainly in tropics and subtropics with some species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Trees and shrubs with Description: Trees or shrubs, sometimes milky latex, leaves alternate, flowers uni- lianas, rarely epiphytic in early stage (stran- sexual, small, carpels usually 2, ovary supe- gling species of Ficus), often with milky la- rior, single chambered, ovule 1. tex distributed in all parenchymatous tissues, cystoliths present, usually globose, Major genera: Ficus (600 species), Dorstenia tannins often present. Leaves alternate (110), Artocarpus (50), Morus (15) Maclura (12) (rarely opposite), usually distichous, simple and Broussonetia (8). with entire or lobed margin, with pinnate or Major Families of Angiosperms 591

Figure 13.94 Moraceae. Ficus cunia. A: Branch with leaves; B: Branch bearing figs; C: Longitudi- nal section of hypanthodium (fig, receptacle); D: Female flower; E: Gynoecium; F: Male flower with single stamen; G: Stamen. H: Twig of Ficus religiosa. Morus alba. I: Male branch; J: Female branch; K: Female flower with closely appressed perianth; L: Longitudinal section of female flower; M: Male flower with four tepals and 4 stamens; N: Multiple fruit (Sorosis). palmate reticulate venation, stipules thers bithecous or monothecous, dehiscence present and leaving a circular scar when longitudinal, pollen grains multiporate or shed. Inflorescence of various types, erect with 2-4 pores. Gynoecium with 2 united car- or pendulous (catkin) spike (Morus), pels, ovary superior, unilocular, ovule 1, hypanthodium (Ficus), or raceme. Flowers anatropous to campylotropous, placentation small, unisexual (monoecious or dioecious), apical, styles usually 2. Fruit usually a mul- actinomorphic, hypogynous. Perianth usu- tiple fruit sorosis (Morus), syconium ally with 4-6 tepals, (representing sepals, (syconus; Ficus), sometimes etaerio of petals absent), free or united, often persist- drupes or a berry; seed with curved or straight ing and becoming fleshy in fruit, sometimes embryo, endosperm present or absent. absent. Androecium with 4-6 (as many as tepals) stamens, opposite the tepals, fila- Economic importance: The family is impor- ments free, incurved in bud or straight, an- tant for its fruits such as mulberry (Morus 592 Plant Systematics alba, M. nigra), fig (Ficus carica) and bread- being considered sister to rest of the fami- fruit (Artocarpus altilis). Fruits of Artocarpus lies. Cecropia and related genera earlier in- heterophyllus (‘kathal’) are cooked as vegeta- cluded under Moraceae (Hutchinson and ear- ble, whereas those of A. lakoocha (‘dheon’) lier authors), and separated under are pickled. Leaves of Morus are also used Cecropiaceae by APG (1998), Thorne (1999, for raring silkworms. Various species of Ficus 2000) and Judd et al. (1999, 2002) are inter- including F. elastica (Indian rubber tree or mediate between Moraceae and Urticaceae, rubber plant) are grown as ornamentals. but closer to Urticaceae in restriction of laticifers to bark, basal ovule, straight em- Phylogeny: The family was earlier placed bryo and with one carpel aborted (pseudo- in Urticaceae (Bentham and Hooker) but now monomerous). The family Cecropiaceae has considered distinct in woody habit with milky appropriately been merged with Urticaceae latex, 2 carpels, ovary with single apical ovule by APG II (2003), APweb (2003) and Thorne and usually curved embryo. Cronquist places (2003). The family Moraceae as narrowly cir- Urticales (including Urticaceae and related cumscribed here is monophyletic as sup- families) under Hamamelid complex but oth- ported by rbcL sequences (Sytsma et al., ers including Dahlgren and Thorne place 1996). The reduction of one carpel is also in- them along with other Malvanean groups. dicated in slightly or strongly unequal styles Takhtajan also places them closer to Malvales in Artocarpus, Dorstenia and Ficus. A complete but under superorder Urticanae. APG classi- loss of one of the two styles probably occurred fications place them closer to Rosaceae, and in common ancestor of Cecropiaceae Rhamnaceae under order Rosales, Rosaceae +Urticaceae clade.

* * * * * * * * * * *

Urticaceae A. L. de Jussieu Nettle family 44 genera, 1080 species Widespread in tropics and temperate climates, poorly represented in Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Usually herbs with sting- Major genera: Pilea (370 species), Elatostema ing hairs, leaves with stipules, flowers (170), Boehmeria (80), Urtica (50) Parieteria (30) small, unisexual, tepals and stamens usu- and Laportea (20). ally 4 each, carpel 1, style 1, fruit achene or fleshy drupe. Description: Usually herbs, rarely trees or Major Families of Angiosperms 593

Figure 13.95 Urticaceae. Urtica hyperborea. A: Plant with axillary clusters of flowers; B: Male flower with four tepals and four stamens; C: Female flower with unequal tepals; D: Achene surrounded by persistent perianth. Boehmeria platyphylla. E: Plant with interrupted spikes; F: Female flower with bristly perianth and hairy style; G: Verti- cal section of female flower; H: Gynoecium; I: Transverse section of achene. shrubs, sometimes climbers, with often or opposite, usually distichous, simple with milky latex restricted to bark or reduced entire or lobed margin, with pinnate or with clear sap, cystoliths present, usually palmate venation, reticulate, stipules elongated, tannins often present, hairs present, leaf base cordate or assymetrical. simple, usually stinging. Leaves alternate Inflorescence cymose or heads, sometimes 594 Plant Systematics with solitary flowers. Flowers small, uni- elongate cystoliths, laticifers restricted to the sexual (monoecious or dioecious), bark, with clear sap, incurved stamens, actinomorphic, hypogynous. Perianth usu- pseudomonomerous gynoecium and basal ally with 4 tepals (representing sepals, pet- ovule. Thorne (1999) and the APG classifica- als absent), rarely only 3 or upto 6, free or tions (APG, 1998; Judd et al., 1999, 2002) also united, imbricate or valvate. Androecium included in Urticaceae the genus Poikilo- with 4-5 (as many as tepals) stamens, op- spermum, formerly placed in Cecropiaceae. posite the tepals, filaments free, incurved Cronquist places Urticales (including Urtica- in bud, reflexed at anthesis, anthers ceae and related families) under Hamamelid bithecous, dehiscence longitudinal, pollen complex but others including Dahlgren and grains multiporate or with 2-3 pores. Thorne place them along with other Gynoecium with single carpel (actually 2 Malvanean groups. Takhtajan also places but with one reduced: pseudo-monomerous), them closer to Malvales but under superorder ovary superior, unilocular, ovule 1, Urticanae. APG classifications place them orthotropous, placentation basal, style 1, closer to Rosaceae, and Rhamnaceae under stigmas 1 or 2, extending on style or capi- order Rosales, Rosaceae being considered tate. Fruit usually an achene, embryo sister to rest of the families. Single carpel in straight, endosperm sometimes lacking. the family has been derived through abortion of the second carpel, as borne out by the Economic importance: In addition to being aborted vascular bundles in the ovary of a noxious weed, Urtica dioica (common sting- Urtica and Laportea. The basal placentation ing nettle) yields silky bast fibre. Fibre is also has similarly been derived from apical extracted on the commercial scale from placentation of Moraceae. This is inferred Boehmeria nivea (ramie or china grass). from the fact that in Boehmeria cylindrica Species of Pilea and Soleirolia (baby’s tears) the vascular bundle supplying the ovule provide important ornamentals. ascends the carpel wall for a short distance and then reverses direction to enter the Phylogeny: The family was earlier broadly ovule at the base of the ovary. The family circumscribed (Bentham and Hooker) to Cecropiaceae, which was formerly recog- include families which have now been sepa- nized (APG, 1998; Judd et al., 1999,2002; rated as Moraceae, Ulmaceae, Celtidaceae, Thorne, 1999) as distinct family has finally etc. The family is now circumscribed to been merged with Urticaceae (Thorne, 2003; include mainly herbaceous species with APG II, 2003; APweb, 2003).

* * * * * * * * * * * Major Families of Angiosperms 595 Rafflesiaceae Dumortier Rafflesia family 3 genera, 20 species Southeast Asia, from India to Indonesia. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Monochlamydeae Rosidae Magnoliidae Magnoliidae Malvidae Series+/Superorder Multiovulatae Terrestres+ Rafflesianae Magnolianae Rafflesianae Order Rafflesiales Rafflesiales Rafflesiales Rafflesiales Uncertain B & H as family Cytinaceae

Salient features: Parasitic on stem and roots, with 4–8 carpels, ovary inferior, unilocular plant body filamentous like a fungal myc- with 4-14 parietal placentas, or 3–10(–20) elium, flowers usually unisexual, with fleshy locular by deep intrusion of the placentas petaloid calyx, stamens in a column, ovary (Rafflesia), ovules 50–100 per locule, non- inferior, carpels fused, placentation parietal, arillate, hemianatropous to anatropous, fruit fleshy. bitegmic, tenuinucellate, united, style expanded into an often large, complex disk, with Major genera: Rafflesia (16 species), Sapria stigmatal projections. Fruit usually fleshy (2) and Rhizanthes (2). berry, seeds endospermic, minute, embryo rudimentary. Description: Total parasites on stems and roots of angiosperms, vegetative part Economic importance: None. filamentous, like fungal mycelium, rootless, permeating the host tissues, with only the Phylogeny: The family is closely related to flowers or the flowering stems emerging from Hydnoraceae, often placed in Magnoloid com- the host tissue, xylem without vessels. plex under a distinct order Rafflesiales. Leaves much reduced, present at the bases Cronquist, however, placed this order under of flowering stems, or beneath the flower, or Rosidae. The family is often considered closer absent, alternate, opposite, or whorled, of to Aristolochiaceae because of similar peri- membranous scales, stomata absent. Inflo- anth. The recent cladistic studies, however, rescence with solitary flowers. Flowers small place Hydnoraceae and Aristolochiaceae un- to very large (Rafflesia arnoldii, with the larg- der Piperales based on multigene analyses. est known flowers in angiosperms, up to 1 m The position of Rafflesiaceae still remains in diameter), regular, usually unisexual, cy- uncertain in APG II and APweb. Nickrent clic. Perianth with tepal green or petaloid, 4, (2002) considers this family to be closer to or 5(–10), free, or united into tube, usually Malvales. Thorne had earlier (1999) broadly fleshy, imbricate, rarely valvate. Androecium circumscribed the family Rafflesiaceae, di- with 5–100 stamens, united with the vided into 4 subfamilies: Mitrastemonoideae gynoecium, free or filaments united into a (Mitrastemon-flowers bisexual and solitary, tube round the stylar column, 1 whorled, fila- ovary superior), Cytinoideae (Cytinus and ments slender, or reduced, anthers Bdallophyton-flowers unisexual, in racemes, monothecous or bithecous, dehiscing by lon- stamens in one ring, ovary inferior with 8- gitudinal slits, pores, or transversely, pollen 14 placentas), Apodanthoideae (Apodanthes, grains usually nonaperturate. Gynoecium Pilostyles and Berlinianche- flowers small, 596 Plant Systematics

Figure 13.96 Rafflesiales. Rafflesiaceae (A-C). A: Fully opened flower of Rafflesia speciosa (photo courtesy Julie Barcelona, Manilla, Philippines). B: Seed of R. arnoldii. C: Partial section of seed showing undivided embryo. Cytinaceae (D-G). Cytinus hypocistis. D: Plant in flower; E: Vertical section of male flower; F: Vertical section of female flower; G: Portion of transverse section of ovary. Apodanthaceae (H-J) Pilostyles berterii. H: Host twig with flowers of Pilostyles emerging out; I: Vertical section of male flower; J: A head of stamens.

unisexual, solitary, stamens in 2 or 4 rings, unplaced towards the end of angiosperms, the ovary inferior with 4 placentas or 1 continu- family placement of Bdallophyton being ous placenta) and Rafflesioideae (Flowers soli- uncertain. According to Judd et al. (2002), tary and unisexual, large, stamens in 1 ring, Rafflesiaceae (also Balanophoraceae and ovary inferior with many irregular chambers). Hydnoraceae) look so different from other These have now (2003) been recognized as flowering plants that no one has been sure independent families Mitrastemonaceae, where to place them. Hydnoraceae appear to Cytinaceae, Apodanthaceae and Rafflesia- belong in Piperales, the other two, according ceae, respectively. APG II and APweb also to them are apparently dicots, but are no recognize them as independent families but more precisely placed than that.

* * * * * * * * * * * Major Families of Angiosperms 597 Capparaceae A. L. de Jussieu Caper family 13 genera, 450 species Widespread in tropical and subtropical regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Violanae Violanae Capparanae Eurosids II* Order Parietales Capparales Capparales Capparales Capparales Brassicales B & H as Capparidaceae Cronquist, Thorne and Takhtajan as Capparaceae APG II and APweb do not recognize as separate family, rather merge with Brassicaceae

Figure 13.97 Capparaceae. A: Capparis decidua with flowers, leaves absent on branches. C. sepiaria. B: Portion of flowering branch; C: Small portion of fruiting branch; D: Flower with numerous stamens. E: Transverse section of ovary with intruded placentae. 598 Plant Systematics

Salient features: Shrubs or trees, sepals and (‘dela’) is pickled and also given to heart pa- petals 4 each, free, stamens many, ovary tients. The dried floral buds of C. spinosa are unilocular with parietal placentation, called capers and are used in seasoning. superior, sometimes with gynophore, fruit a capsule or berry. Phylogeny: Heterogeneity of broadly circumscribed Capparaceae was long recognized. Major Genera: Capparis (350 species), Hutchinson (1973), on the basis of extensive Maerua (100), Boscia (37), Cadaba (30) and studies at Kew concluded that the family Crataeva (20 species) consisted of two distinct groups which are not really phylogenetically related. True Description. Shrubs (Capparis), rarely trees Capparids, according to him are woody plants (Crataeva) or climbers (Maerua). Leaves al- with indehiscent fruits, without a replum, ternate, rarely opposite, simple, stipules and fairly closely related to Flacourtiaceae, present, sometimes reduced to glands or whereas Cleome and its relatives are herbs spines (Capparis). Inflorescence typically with dehiscent fruits with replum, as in fam- racemose, corymbose (Crataeva), or in um- ily Brassicaceae. This view was confirmed bels (Capparis). Flowers bracteate (bracts by morphological studies (Judd et. al., 1994) often leafy), actinomorphic or zygomorphic and rbcL sequences (Rodman et al., 1993) as (Capparis), bisexual, rarely unisexual or po- mentioned under Brassicaceae, ultimately lygamous (Crataeva), hypogynous, thalamus leading to the merger of Capparaceae with often prolonged into androgynophore. Calyx Brassicaceae in APG classifications. Al- with 4 sepals, rarely 2-8, free or connate though position was kept up in the APG II, (Maerua), in two whorls, sometimes in one but was pointed out that ‘resurrection of whorl. Corolla with 4 petals, cruciform (ar- Capparaceae and Cleomaceae may be appro- ranged in a cross), rarely 8 or even lacking priate in the future’. This change in posi- (Maerua), clawed. Androecium with 4 or tion has largely been on account of the re- more stamens, free, often arising from sults of the studies by Hall, Sytsma and Iltis androphore (lower portion of andro- (2002), who on the basis of chloroplast DNA gynophore), dehiscence longitudinal, sequence data, concluded that the three form nectaries often present near base of sta- distinct strongly supported monophyletic mens. Gynoecium with 2-12 united carpels groups, as is also supported by morphologi- (syncarpous), unilocular with one-many cal data. According to Puri (1950), ovules, replum absent, placentation parietal, bicarpellary syncarpous unilocular ovary ovary superior, often on a gynophore (upper with parietal placentation is derived from part of androgynophore), style 1, stigma capi- tetracarpellary condition with axile tate or bilobed. Fruit a berry, capsule, drupe, placentation. Thorne who had earlier (1999) or nut, often stalked; seeds 1-many, embryo recognized Capparaceae (also including curved, endosperm usually absent. Cleome and its relatives) and Brassicaceae as distinct families, has subsequently (2003) Economic importance: The family contrib- separated Cleome and relatives under dis- utes a few ornamentals such as Capparis tinct family Cleomaceae, as suggested in and Crataeva. The fruit of Capparis decidua APG II.

* * * * * * * * * * * Major Families of Angiosperms 599 Cleomaceae Horaninow Spider plant family 11 genera 300 species Widespread in tropical, subtropical and warm temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Violanae Violanae Capparanae Eurosids II* Order Parietales Capparales Capparales Capparales Capparales Brassicales B & H under Capparidaceae Cronquist, Dahlgren and Takhtajan under Capparaceae APG II and APweb under Brassicaceae

Figure 13.98 Cleomaceae. Cleome gynandra. A: Lower part of the plant with palmately compound leaves; B: Inflorescence with flowers having conspicuous androgynophore; C: Se- pal; D: Petal; E: Stamen; F: Gynoecium with distinct gynophore; G: Transverse section of ovary with parietal placentation; H: Seed. 600 Plant Systematics

Salient features: Herbs, sepals and petals capsule or siliqua, often stalked; seeds 4 each, free, stamens many, ovary unilocu- 1-many, embryo curved, endosperm usually lar with parietal placentation, superior, absent. sometimes with gynophore, replum present, fruit a capsule or follicle. Economic importance: The family contributes a few ornamentals such as Cleome and Major Genera: Cleome (200 species), Polanisia. The decoction of Cleome chelidonii Podandrogyne (10) and Polanisia (7). is used to cure scabies.

Description. Annual or perennial Herbs. Phylogeny: Members of the family are gen- Leaves alternate, rarely opposite, simple or erally included under family Capparaceae. palmately compound, stipules present. Hutchinson (1973) on the basis of extensive Inflorescence typically racemose, corymbose studies at Kew concluded that Cleome and (Cleome). Flowers bracteate, bracts often its relatives are distinct from capparids. APG leafy, actinomorphic, bisexual, hypogynous, II classification included Capparaceae (in- thalamus often prolonged into androgyno- cluding Cleomaceae) under Brassicaceae, phore. Calyx with 4 sepals, rarely 2-8, free, but was pointed out that ‘resurrection of in two whorls, sometimes in one whorl. Capparaceae and Cleomaceae may be appro- Corolla with 4 petals, cruciform (arranged in priate in the future’. This change in posi- a cross), clawed. Androecium with 4 or more tion has largely been on account of the re- stamens, free, often arising from androphore sults of the studies Hall, Sytsma and Iltis (lower portion of androgynophore), dehiscence (2002), who on the basis of chloroplast DNA longitudinal, nectaries often present near sequence data, concluded that the three form base of stamens. Gynoecium with 2-12 distinct strongly supported monophyletic united carpels (syncarpous), unilocular groups, as is also supported by morphologi- (usually bilocular due to false septum and with cal data. Thorne who had earlier (1999) indistinct replum) with one -many ovules, cluded this family under Capparaceae, has placentation parietal, ovary superior, often on subsequently (2003) separated Cleome and a gynophore (upper part of androgynophore), relatives under distinct family Cleomaceae, style 1, stigma capitate or bilobed. Fruit a as suggested in APG II.

* * * * * * * * * * *

Brassicaceae Burnett Mustard family (=Cruciferae A. L. de Jussieu) 340 genera, 3,350 species A cosmopolitan family mainly distributed in North Temperate Zone, particularly the Mediterranean region. Major Families of Angiosperms 601

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Dilleniidae Dilleniidae Magnoliidae Malvidae Series+/Superorder Thalamiflorae+ Violanae Violanae Capparanae Eurosids II* Order Parietales Capparales Capparales Capparales Capparales Brassicales B & H as Cruciferae others as Brassicaceae APG II and APweb Brassicaceae includes Capparaceae

Figure 13.99 Brassicaceae. Brassica campestris. A: Upper part of plant with inflorescence; B: Lower leaf; C: Vertical section of flower; D: Siliqua with persistent style forming a long beak. Capsella bursa-pastoris. E: Plant with inflorescence; F: Flower; G: Flower with sepals and petals removed; H: Silicula with apical notch having persistent style, fruit flattened at right angles to the septum and as such replum appearing as vertical rim. Coronopus didymus. I: Plant with highly dissected leaves and axillary racemes; J: Flower from above showing minute petals and 2 stamens; K: Stamen; L: Silicula, deeply bilobed and prominent replum. M: Silicula of Lobularia maritima flattened parallel to the false septum and as such replum forming a ring around the fruit. N: Siliqua of Brassica nigra dehisced with valves separating and seeds attached to false septum. 602 Plant Systematics

Salient features: Herbs, sap watery, sepals width), at dehiscence valves break away from and petals 4 each, free, stamens below upward leaving seeds appressed to tetradynamous, ovary with false septum and false septum, fruit moniliform lomentum on a thickened placental rim called replum, Raphanus; seed with large embryo, ovary superior, placentation parietal, fruit a endosperm scant or absent. Pollination by siliqua or silicula. insects, failure of cross pollination may result in self pollination. Seeds are usually Major Genera: Draba (350 species), Erysi- dispersed by wind. mum (180), Lepidium (170), Cardamine (160), Arabis (160), Alyssum (150), Sisymbrium (90) Economic importance: The family contrib- and Brassica (50). utes a number of food plants such as radish (Raphanus sativus), cabbage (Brassica Description. Annual, biennial or perennial oleracea var. capitata), cauliflower (B. oleracea herbs (rarely undershrubs: Farsetia) with var. botrytis), Brussels sprouts (B. oleracea watery sap, containing glucosinolates (mus- var. gemmifera), kohlrabi (B. oleracea var. tard oils) and with myrosin cells. Hairs sim- caulorapa) and turnip (B. rapa). Seeds of B. ple, branched, stellate or peltate. Leaves al- campestris yield cooking oil those of black ternate or in basal rosettes, simple, often mustard (B. nigra) are used as condiment. dissected, rarely pinnate compound (Nastur- Woad was formerly used a blue dye obtained tium officinale) sometimes bearing bulbils in from leaves of Isatis tinctoria. Common axil (Dentaria bulbifera) or leaf surface ornamentals include stock (Mathiola), candy (Cardamine pratensis), stipules absent. Inflo- tuft (Iberis amara), alyssum (Alyssum), wall rescence typically racemose, corymbose ra- flower (Erysimum) and sweet alyssum ceme, or flat topped corymb (Iberis), (Lobularia). Cardamine also produces subterranean cleistogamous flowers. Flowers ebracteate, Phylogeny: The family is regarded as mono- rarely bracteate (Nasturtium montanum), biphyletic, supported by evidence from mor- sexual, actinomorphic or rarely zygomorphic phology ( gynophore, exserted stamens), (Iberis), hypogynous (perigynous in Lepidium). glucosinolates, dilated cisternae in endoplas- Calyx with 4 sepals, free, in two whorls, se- mic reticulum and rbcL sequences. The or- pals of lateral pair sometimes saccate at der Brassicales (others prefer Capparales) base, green or slightly petaloid. Corolla with had long been treated as a well defined group, 4 petals, cruciform (arranged in a cross), with Brassicaceae and Capparaceae consid- clawed, sometimes absent in Coronopus and ered to be fairly close as suggested by evi- Lepidium. Androecium with 6 stamens (2 in dence from morphology, dilated cisternae, Coronopus, 4 in Cardamine hirsuta, 16 in but have been treated as distinct largely Megacarpaea), free, tetradynamous (2 short because of several stamens and very long 4 long), dehiscence longitudinal, nectaries gynophore in Capparaceae. often present near base of stamens, pollen Judd et al., (1994) on the basis of mor- grains tricolporate or tricolpate. Gynoecium phological studies, and Rodman et al., (1993) with two united (thus pistil single) carpels on the basis rbcL sequences, concluded that (syncarpous), rarely carpels 3 (Lepidium) or out of the traditional Capparaceae, 4 (Tetrapoma), unilocular but becoming Capparoideae and Cleomoideae do not form bilocular due to false septum that is sur- a monophyletic group, as also concluded ear- rounded by a thick placental rim called lier by Hutchinson (1973). Capparoideae ac- replum, ovules many, rarely single ovules, cording to these authors form basal placentation parietal, ovary superior, paraphyletic group within Brassicaceae. gynophore distinct, style 1, stigmas 2. Fruit Cleomoideae and Brassicoideae (traditional a siliqua (long: length thrice width or more) Brassicaceae) form monophyletic group or silicula (short: length less than thrice based on synapomorphies of herbaceous Major Families of Angiosperms 603 character, replum in fruit and rbcL se- Soltis et al., (2000) and Hall et al., (2002), quences. The merger of Capparaceae with Brassicaceae (Brassicoideae) and Brassicaceae avoids arbitrarily delimited Cleomaceae (Cleomoideae) are more closely paraphyletic taxa, and thus forms mono- related and form a monophyletic group phyletic group with broadened circumscrip- based on synapomorphies of herbaceous tion. The two have been merged in APG II habit, rbcL sequences and presence of and APweb classifications. APweb recog- replum. nizes 3 subfamilies under broadly circum- It is interesting to record that although scribed Brassicaceae: Capparoideae, Hutchinson had indicated heterogeneity Cleomoideae and Brassicoideae. It is perti- within Capparaceae, and reasoned that nent to note that Thorne (1999), who has Cleome and its relatives were much closer been updating his classification in light of to Brassicaceae, he had placed Capparaceae recent advances, has preferred to retain and Brassicaceae in two distinct orders Cap- Brassicaceae and Capparaceae as distinct parales (in his diagram he used name Cap- families, also separating Cleomaceae in paridales) and Brassicales, even further recent revisions (2003, 2007), thus recog- separating them under Lignosae and Herba- nizing three subfamilies as independent ceae respectively, as he was obsessed with the families. According to the recent studies of distinction of woody and herbaceous habits.

* * * * * * * * * * *

Rutaceae A. L. de Jussieu Citrus or Rue family 162 genera, 1,650 species Distributed in warm temperate and tropical regions with the greatest diversity in Australia and South Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Malvidae Series+/Superorder Disciflorae+ Rutanae Rutanae Rutanae Eurosids II* Order Geraniales Sapindales Rutales Rutales Rutales Sapindales

Salient features: Trees or shrubs, leaves Description. Shrubs or trees, sometimes usually compound and gland dotted, stamens armed with thorns or spines, rarely herbs free or polyadelphous, sometimes (Boenninghausenia), often aromatic, contain- obdiplostemonous, ovary superior, seated on ing alkaloids and phenolic compounds. a nectary disc, fruit a berry. Leaves alternate, rarely opposite (Evodia), usually pinnate compound, sometimes Major Genera: Zanthoxylum (200 species), unifoliate due to reduction of lower two leaf- Agathosma (180), Citrus (65), Ruta (60) and lets (Citrus), less frequently simple (Evodia), Murraya (12). gland dotted, stipules absent. Inflorescence 604 Plant Systematics

Figure 13.100 Rutaceae. Murraya paniculata. A: Branch with pinnate compound leaves and flowers; B: Vertical section of flower; C: Flower with petals removed showing 10 stamens in 2 whorls; D: Gynoecium with nectary at base. Citrus paradisi. E: Portion of branch with unifoliate leaf having broadly winged petiole and cluster of flowers with polyadelphous stamens; F: Fruit. Zanthoxylum armatum. G: Branch with pinnate compound leaves, spines and inflorescences; H: Male flower with 6 free stamens and abortive ovary, the sepals are small and petals absent; I: Schizocarpic fruit splitting into 2 segments. Haplophyllum acutifolium. J: Portion of plant with flowers; K: Flower with large petals, stamens with flattened filaments; L: Capsule covered with glands and deeply 5-lobed. cymose or flowers solitary (Triphasia), rarely sometimes ovaries free (Zanthoxylum) and racemose (Atlantia). Flowers ebracteate, bi- only styles united, multilocular (locules as sexual or rarely unisexual (Zanthoxylum) many as carpels) with 1-many ovules, actinomorphic or rarely zygomorphic placentation axile, rarely parietal (Feronia), (Dictamus), hypogynous. Calyx with 4-5 se- ovary superior and lobed, style 1, stigma pals, rarely 3 (Lunasia) free or more or less small. Fruit a berry (Murraya), drupe united, gland dotted. Corolla with 4-5 pet- (Spathelia), hesperidium (Citrus), samara als, rarely 3 (Triphasia) free, rarely united (Ptelea), capsule (Ruta) or follicle (Zanthoxy- (Correa) valvate or imbricate, sometimes lum); seeds 1-many, embryo curved or absent. Androecium with 8-10 rarely 5 straight, endosperm absent or present. Pol- (Skimmia), or many (Citrus) stamens, free lination mainly by insects, chiefly bees and (Murraya), or polyadelphous (Citrus), rarely flies. Dispersal usually by animals, rarely monadelphous (Atlantia) sometimes birds or even wind (Ptelea). obdiplostemonous, anthers bithecous, dehiscence longitudinal, pollen grains 3-6-colpate. Economic importance: The family is impor- Gynoecium with 2-5 united carpels tant for its citrus fruits such as lemon (Cit- (syncarpous), rare monocarpellary (Teclea), rus limon), lime (C. aurantifolia), sweet orange Major Families of Angiosperms 605 or ‘mousmi’ (C. sinensis), orange, tangerine ported by data from rbcL and atpB sequences. or ‘santra’ (C. reticulata) and grapefruit (C. Subfamilies are characterized by carpel paradisi). Aegle marmelos (Bel tree), Fortunella number, extent of fusion and fruit type. (kumquat), and Casimiroa (white zapote) are Whereas Dahlgren (1989) and Takhtajan grown for fruits. Murraya paniculata is culti- (1997) preferred to separate order Sapindales vated as an ornamental shrub, whereas from order Rutales, others like Cronquist M. koenigii is cultivated for its curry leaves. (1988), Thorne (1999, 2003, 2007), and APG Leaves of Skimmia laureola are burnt in II prefer to merge the two. Cronquist and order to purify air. Ruta (rue), Zanthoxylum APG II use name Sapindales whereas (toothache tree), and Casimiroa are medici- Thorne prefers the priority name Rutales. nal. Boenninghausenia (‘Pisu-mar-buti’) is Thorne, however, places Sapindaceae and used as an insecticidal. Ravenia spectabilis Rutaceae under separate suborders. Earlier (Syn: Limonia spectabilis) is grown as orna- Hutchinson (1973) had also separated the mental shrub. two orders, also separating Meliaceae under Meliales, and placing between the two Phylogeny: Although the family presents a orders. The affinities of Meliaceae, Rutaceae variety of fruit types, it is a well circum- and Sapindaceae have been long recognized. scribed monophyletic taxon characterized by Thorne (2007) recognizes 3 subfamilies: oil cavities appearing as pellucid dots, sup- Rutoideae, Aurantioideae and Cneoroideae.

* * * * * * * * * * *

Meliaceae A. L. de Jussieu Mahogany family 52 genera, 600 species Distributed mainly in tropical and subtropical regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Malvidae Series+/Superorder Disciflorae+ Rutanae Rutanae Rutanae Eurosids II* Order Geraniales Sapindales Rutales Rutales Rutales Sapindales

Salient features: Trees or shrubs contain- Major genera: Aglaia (95 species), Trichilia ing bitter triterpenoid compounds, leaves (60), Turraea (60), Dysoxylum (58), Guarea alternate, pinnate compound, flowers uni- (32), Toona (15), Melia (15), Cedrela (6) and sexual, sepals 4-5, petals 4-5, stamens with Azadirachta (2). connate filaments, ovary with axile placentation, stigma capitate, seeds dry and Description: Shrubs or trees, rarely herbs winged. (Naregamia), commonly producing bitter 606 Plant Systematics

Figure 13.101 Meliaceae. Melia azedarach. A: Bipinnate leaf; B: Inflorescence; C: Flower with long staminal tube; D: Drupe. Aglaia apiocarpa. E: Fruiting branch with pinnate compound leaf; F: Portion of male inflorescence; G: Female inflorescence; H: Vertical section of male flower; I: Vertical section of female flower. Dysoxylum championii. J: Flowering branch; K: Vertical section of male flower; L: Tetrad of pollen grains; M: Transverse section of ovary.

triterpenoid compounds, usually with scat- valvate. Androecium with 3 (some species tered secretary cells, wood sometimes yel- of Amoora), 4-6 (Cedrela), 5 (Aglaia) or upto low (Chloroxylon) or red (Cedrela), nodes 12 (Melia), free (Walsura) or monadelphous pentalacunar, vessels with simple end-walls. (Melia), usually inserted on a nectariferous Leaves alternate, once (Azadirachta) or twice disc, anthers bithecous, dorsifixed or versa- pinnate (Melia), sometimes trifoliate tile, introrse, dehiscence longitudinal, pol- (Sandoricum) or unifoliate (Turraea), venation len grains 2- to 5-colporate, sometimes in pinnate, reticulate, stipules absent. Inflo- tetrads (Dysoxylum championii). Gynoecium rescence axillary or terminal panicles, usu- with 2-6 united carpels, ovary superior, 2-5 ally cymose. Flowers ebracteate, bisexual or chambered with 1 or 2 (or more in Swietenia) rarely unisexual (Amoora), actinomorphic, ovules in each loculus, ovule orthotropous trimerous to pentamerous, cyclic. Calyx or anatropous (Dysoxylum), placentation ax- with 3 (Amoora), 4 (Dysoxylum) or 5 (Melia, ile, style 1, stigma capitate. Fruit a drupe, Cedrela) sepals, free or united (Amoora, (Melia azedarach), berry (Walsura), or a cap- Melia), valvate or imbricate, green. Corolla sule (Amoora); seeds winged or with an aril with 3-5 petals, usually as many as sepals, (Melioideae), embryo curved or straight, en- free, rarely united (Munronia), imbricate or dosperm present or absent. Major Families of Angiosperms 607

Economic importance: The family is highly or Sapindales (Cronquist, APG II, APweb) or prized for its true mahogany woods: Swietenia narrowly circumscribed Rutales (Takhtajan, mahogani of the West Indies; Dahlgren). Thorne (1999,2003) combines Entandrophragm, Khaya and Lovoa of Africa; Rutales with Sapindales but prefers name Cedrela odorata and Toona of Australia. These Rutales for the broadly circumscribed order. are renowned for their excellent colour, Hutchinson (1926, 1973) segregated the fam- working properties and finish. Oils for soap- ily to a distinct order Meliales primarily on making are extracted from the seeds of the basis of leaves usually not gland-dotted Trichilia emetica in Uganda. The oil from and stamens connate. The family is distinct Malayan Chisocheton macrophyllus has been and monophyletic as supported by morphol- used as an illuminant. The flowers of Aglaia ogy and rbcL sequences (Gadek et al., 1996). odorata are used in the East for flavouring Two subfamilies are commonly recognized: tea. Species of Melia, Aglaia, Chisocheton and Melioideae (seeds not winged, naked buds) Turraea are grown as ornamentals. and Swietenioideae (flattened or winged Azadirachta indica (neem) from India has seeds, and scaly buds. Thorne had earlier gained considerable importance in the re- (1999) merged these two under Melioideae cent years as a bioinsecticide and a compo- and recognized two more Quivisianthoideae nent of several medicines and also tooth (single genus Quivisiantha) and Capuroni- pastes. The tree, for a long time, has been anthoideae (single genus Capuronianthus). grown as a shade tree and twigs used to In subsequent revision (2003) he resur- brush teeth (datun). rected Swietenioideae, thus recognizing four subfamilies under the family. The ge- Phylogeny: The family is generally included nus Cedrela is distinct in its free stamens closer to Rutaceae in broadly circumscribed and erect petals, included by thorne under Geraniales (Bentham and Hooker, Bessey) Swietenioideae.

* * * * * * * * * * *

Anacardiaceae R. Brown Cashew family 70 genera, 845 species Distributed mainly in tropics but several species extending to north temperate regions of Asia, Europe and America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Malvidae Series+/Superorder Disciflorae+ Rutanae Rutanae Rutanae Eurosids II* Order Sapindales Sapindales Burserales Sapindales Rutales Sapindales 608 Plant Systematics

Figure 13.102 Anacardiaceae. Rhus wallichii. A: Branch with inflorescence; B: Portion of inflorescence in fruit. Mangifera indica C: Branch with inflorescence; D: Flower; E: Ver- tical section of flower showing conspicuous disc; F: Single stamen. G: Longitudi- nal section of fruit, reduced view. H: Fruit of Anacardium occidentale. (A-B, after Polunin and Stainton, Fl. Himal., 1984). Salient features: Trees or shrubs with resin tissue; resin clear when fresh but drying canals, alternate exstipulate leaves, flowers black and often causing dermatitis (Toxi- pentamerous, stamens inserted at the base codendron, some species of Rhus). Leaves of a disc, ovary unilocular, ovule one, fruit alternate, rarely opposite (Dobinea), usually commonly a drupe. pinnate compound (Rhus, Schinus), rarely simple (Mangifera), entire or serrate, vena- Major genera: Rhus (100 species), tion pinnate, stipules absent or vestigial. In- semecarpus (50), Lannea (40), Toxicodendron florescence paniculate, axillary or terminal, (30), Schinus (30) and Mangifera. usually thyrse with cymose branches. Flow- ers bracteate, bisexual or unisexual due to Description: Trees, shrubs or lianas, rarely reduction of stamens or carpels, receptacle perennial herbs, resin canals in bark, big- often swollen and fleshy, actinomorphic, ger veins of leaves and in parenchymatous small, hypogynous. Calyx with 5 sepals Major Families of Angiosperms 609

(rarely 3-7), free or connate at base, imbri- of Cotinus (smoke tree), Rhus (Sumac) and cate, rarely much enlarged (Parishia). Co- Schinus (Brazilian pepper). Commercial sup- rolla with 5 petals (rarely 3-7), free, imbri- ply of tannins is obtained from quebracho cate, rarely much enlarged (Swintonia). (Schinopsis lorentzii), Sicilian sumac (Rhus Androecium with 5-10 stamens, sometimes coriaria) and species of Cotinus and Pistacia. more or reduced to single fertile stamen The first turpentine used by artists came (Mangifera, Anacardium), filaments usually from terebinth tree (Pistacia terebinthus). glabrous, distinct, rarely connate at base, arising along outer (most genera) or inner Phylogeny: Anacardiaceae is closely related margin (Mangifera) of rim of the disc, dehis- to Burseraceae (Thorne, 2006 places two cence longitudinal, pollen grains tricolporate families separately under suborder Anar- or triporate. Gynoecium with usually 3 car- cardiineae) as supported by rbcL sequences pels, sometimes 5 (Buchanania) or only 1 (Gadek et al., 1996). The two share resin ca- (Mangifera), united, rarely free (Buchanania), nals and biflavones. The family is usually ovary superior, locule usually 1 with basal placed under Sapindales, but shifted by Thorne or apical placentation, rarely multilocular under Rutales. Two clades (subfamilies) are with 1 ovule in each locule, styles 1-3, free recognised within the family (Thorne; ApWeb): or connate, stigma capitate, disc present Anacardioideae and Spondoideae, latter hav- between stamens and petals. Fruit a drupe ing retained many plesiomorphic features with resinous mesocarp, rarely berry or nut such as five carpels, multilocular ovary and (Anacardium), or samara (Loxopterygium); fruit with thick endocarp having lignified and seed with straight or curved embryo, absent irregularly oriented sclereids, and sister to or scanty. Pollination by insects, dioecious rest of the family i.e., Anacardioideae (Aguilar- habit promoting outcrossing. Fruits are dis- Ortigosa & Sosa 2004). Anacardioideae persed by birds and mammals. clade has 3 carpels, unilocular ovary with apical placenta and endocarp with regularly Economic importance: The family contrib- arranged cells. wind-pollinated taxa of this utes important fruits such as mango subfamily, however, do not form a single group (Mangifera indica), yellow mombin or Hog (Pell & Mitchell 2007). Buchanania in some plum (Spondias mombin), Indian Hog plum (S. analyses is quite well supported as sister to indica), Red mombin or Jamaica apple (S. Anacardioideae (Aguilar-Ortigosa & Sosa purpurea), Otaheite apple (S. cytherea) and 2004; Wannan, 2007), consistent with its Kaffir plum (Harpephyllum caffrum). Nuts of chemistry, endocarp anatomy and carpel Cashew (Anacardium occidentale) and Pista- number. Phylogeny of the family has been chio (Pistacia vera) are eaten after roasting. studied by Pell (2004) who covers the Species of Rhus and Toxicodendron cause der- morphology of the whole family and Mitchell matitis due to the phenolic compound 3-n- et al. (2006), who focus more on Spondoi- pentadecycatechol and should be touched deae. Rhus and Toxicodendron, are distinct with care. Lacquer is obtained from Varnish in former having red glandular-pubescent tree (Toxicodendron vernicifera) and Mastic fruits and latter glabrous greenish or white tree (Pistacia lentiscus). Important ones. These are often combined, but the ornamentals are contributed by the species resultant genus won’t be monophyletic.

* * * * * * * * * * * 610 Plant Systematics Sapindaceae A. L. de Jussieu Soapberry family 145 genera 1490 species Distributed mainly in tropical and subtropical regions, a few genera in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Malvidae Series+/Superorder Disciflorae+ Rutanae Rutanae Rutanae Eurosids II* Order Sapindales Sapindales Sapindales Sapindales Rutales Sapindales

Salient features: Usually trees or shrubs, zygomorphic (Cardiospermum). Calyx with leaves alternate, pinnately-compound or usually 4 or 5 sepals, free or united. Corolla palmately-compound, strongly swollen peti- with 4 or 5 petals, usually as many as sepals, ole base, inflorescences paniculate, flowers sometimes absent (Dodonaea), free, usually often borne in congested groups along the clawed, with basal appendages inside, imbri- axis, flowers small and conspicuously hairy cate. Androecium with usually 4 (Glenniea)- inside, nectar disc between petals and sta- 10 stamens, rarely more (Deinbollia), usually mens, fruit with only one or two seeds in borne on a nectar disc present between pet- each chamber, often deeply lobed, seeds with als and stamens, filaments free and usually aril. hairy, anthers bithecous, dehiscence by longitudinal slits, pollen grains tricolpate, fur- Major genera: Serjania (200 species), rows often fused. Gynoecium with 2-3 united Paullinia (140), Acer (100), Allophyllus (95), carpels, rarely upto 6, ovary superior, Dodonaea (60), Sapindus (18), Aesculus (13), placentation axile, 1 or 2 ovules in each locu- Cardiospermum (12), Koelreuteria (10) and lus, ovule orthotropous or anatropous, funicu- Litchi (2). lus lacking and ovule broadly attached to obturator (projection from placenta), style 1, Description: Shrubs or trees, herbaceous or stigma usually lobed. Fruit a drupe, berry, woody lianas with tendrils (Serjania), rarely capsule (3-winged-Bridgesia), samara (Acer) or herbs (Cardiospermum), often with tannins, schizocarp; seeds often with an aril, embryo usually with triterpenoid saponins in secre- curved, endosperm absent. Pollination by tary cells. Leaves alternate, rarely opposite birds and insects, Dodonaea and some spe- (Velenzuelia, Acer), once or twice pinnate, cies of Acer being wind pollinated. Dispersal sometimes palmately compound (Aesculus) often by birds attracted by aril, but inflated trifoliate (Billia) or simple (Litchi), leaflets fruits and winged fruits are often dispersed entire or serrate, venation pinnate, reticu- by wind. late, base of petiole strongly swollen, stipules absent, rarely present (Urvillea, Serjania). Economic importance: The family is impor- Inflorescence usually cymose, aggregated in tant primarily for its fruits: Litchi sinensis panicles, often quite congested along the axis. (Litchi, lychy), Nephelium lappaceum Flowers unisexual (plants monoecious, (rambutan) and Euphoria (logan). The aril of dioecious or polygamous), actinomorphic or the fruits of Blightia sapida (akee), a native Major Families of Angiosperms 611

Figure 13.103 Sapindaceae. Dodonaea viscosa. A: Flowering twig of female plant; B: Flowering twig of male plant; C: Male flower with 5 sepals and 8 stamens, petals absent; D: Female flower with sepals and gynoecium; E: Gynoecium. F: Fruit with with 2 wings. Acer caesium. G: Portion of a fruiting branch; H: Portion of flowering branch; I: Flower. Aesculus indica. J: Portion of flowering branch with palmately compound leaf; K: Flower with long-clawed petals and exserted stamens; L: Capsule opening by 3 valves.(G-I after Fl. Himal., 1984) of West Africa are also eaten cooked, tast- Acer saccharum (sugar maple) and some other ing like scrambled egg, but poisonous if eaten species yield maple sugar. when unripe. The fruits of different species of Sapindus (soapberry) are often used as a Phylogeny: Sapindaceae is sometimes natural soap due to the presence of narrowly circumscribed to exclude Hippo- saponins. Paullinia cupana is the source of castanaceae and Acerceae (Hutchinson, drink guarana, popular in Brazil. Schleichera Takhtajan, Cronquist and Dahlgren), but trijuga is the source of macassar oil, used in their separation leads to paraphyletic ointments and for illumination. The species Sapindaceae (Judd et al., 1994). The family of Aesculus have various medicinal uses, and is as such broadly circumscribed to include extracts from some have been used by North both Aceraceae and Hippocastanaceae American Indians to stupefy fish. The fam- (Thorne, Judd et al., APG II and APweb). ily also contributes a number of ornamentals Monophyly of the family is supported by such as Koelreuteria (goldenrain tree), morphology and rbcL sequences. Xantho- Cardiospermum (balloon vine), Xanthoceras, ceras, with simply 5-merous, polysymmetric Acer (maple) and Aesculus (horse chestnut). flowers and complex, golden nectaries borne The trees of maple are prized for their beau- outside the eight stamens, is sister to rest tiful foliage and spectacular autumn colours. of Sapindaceae, and the genera included in 612 Plant Systematics

Aceraceae and Hippocastanaceae are immediately related. Thorne (1999, 2003) monophyletic sister taxa (Savolainen et al., recognizes 5 subfamilies: Dodonaeoideae 2000). Sapindaceae are chemically similar (Dodonaea), Koelreuterioideae, Sapindoi- to Leguminosae, and both have compound deae, Hippocastanoideae (Aesculus, Billia) leaves, but they are unlikely to be and Aceroideae (Acer, Dipteronia). * * * * * * * * * * *

Subclass 11. Asteridae (B) Superorder 1. Cornanae (B) 4. Samolaceae Order 1. Bruniales (B) 5. Primulaceae Family 1. Bruniaceae 6. Ericales 2. Geissolomataceae 1. Theaceae 3. Grubbiacerae 2. Pentaphylacaceae 4. Curtisiaceae 3. Ternstroemiaceae 5. Myrothamnaceae (B) 4. Sladeniaceae 6. Gunneraceae 5. Symplocaceae 7. Hydrostachyaceae (B) 6. Styracaceae (B) 2. Cornales 7. Diapensiaceae 1. Hydrangeaceae 8. Sarraceniaceae 2. Loasaceae 9. Roridulaceae (A) 3. Alangiaceae 10. Actinidiaceae 4. Cornaceae 11. Clethraceae 5. Nyssaceae 12. Cyrillaceae 2. Desfontainiales 13. Ericaceae 1. Escalloniaceae Superorder 3. Aralianae 2. Eremosynaceae Order 1. Aquifoliales (A) 3. Vahliaceae 1. Aquifoliaceae 4. Columelliaceae 2. Helwingiaceae 5. Desfontainiaceae 3. Phyllonomaceae (B) Superorder 2. Ericanae (B) 4. Cardiopteridaceae (B) 5. Stemonuraceae (B) Order 1. Balsaminales 6. Sphenostemonaceae (B) 1. Marcgraviaceae 7. Paracryphiaceae (B) 2. Balsaminaceae 2. Dipsacales 3. Tetrameristaceae (B) 1. Adoxaceae 2. Polemoniales 2. Caprifoliaceae 1. Fouquieriaceae 3. Diervillaceae (B) 2. Polemoniaceae 4. Linnaeaceae (B) 3. Lecythidales 5. Morinaceae 1. Lecythidaceae 6. Dipsacaceae 4. Sapotales 7. Triplostegiaceae (B) 1. Ebenaceae 8. Valerianaceae 2. Sapotaceae 3. Araliales 5. Primulales Suborder 1. Aralidiineae 1. Maesaceae 1. Torricelliaceae 2. Theophrastaceae 2. Aralidiaceae 3. Myrsinaceae 3. Melanophyllaceae (B) Major Families of Angiosperms 613

4. Griseliniaceae (B) 2. Campanulaceae 5. Pennantiaceae (B) 3. Stylidiaceae 2. Apiineae 2. Asterineae 1.Pittosporaceae 1. Rousseaceae (B) 2. Apiaceae 2. Alseuosmiaceae 3. Araliaceae 3. Argophyllaceae (B) 4. Myodocarpaceae (B) 4. Phellinaceae (B) 5. Menyanthaceae

Superorder 4. Asteranae 6. Goodeniaceae Order 1. Asterales 7. Calyceraceae 1. Campanulineae 8. Asteraceae 1. Pentaphragmataceae

Hydrangeaceae Dumortier Hydrangea family 17 genera, 250 species Mainly distributed in Northern Hemisphere from Himalayas to Japan to North America and tropical Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Cornidae Magnoliidae Asteridae Series+/Superorder Calyciflorae+ Cornanae Cornanae Cornanae Asterids* Order Rosales Rosales Hydrangeales Cornales Cornales Cornales B & H under Saxifragaceae

Salient features: Mostly shrubs, leaves sim- Iridoids and raphide crystals. Leaves usu- ple, usually opposite, stipules absent, flow- ally opposite, rarely alternate (Cordiandra), ers bisexual, sepals often enlarged and simple, sometimes lobed, usually deciduous, petaloid, ovary inferior or semi-inferior, rarely evergreen (Pileostegia), venation pin- placentation axile or deeply intruded pari- nate or palmate, reticulate, stipules absent. etal, nectary present at top of ovary, fruit a Inflorescence terminal racemes, cymes or capsule. corymbose, rarely solitary flowers. Flowers usually bisexual, sometimes unisexual Major genera: Philadelphus (65 species), (Broussaisia, polygamo-dioecious) outer usu- Deutzia (40), Hydrangea (30), Dichroa (13) and ally sterile with enlarged petaloid sepals, Fendlera (4). actinomorphic, perigynous or epigynous. Calyx with 4-5 sepals , united, calyx tube Description: Herbs (Cordiandra), soft-wooded often adnate to ovary, sepals of outer sterile shrubs (Hydrangea) or rarely small trees or flowers often large and petaloid. Corolla with climbers (Decumeria), often with tannins and 4-5 petals, free, imbricate, convolute, rarely 614 Plant Systematics

Figure 13.104 Hydrangeaceae. Hydrangea heteromalla. A: Branch with corymbose inflorescence with outer sterile flowers having 4 enlarged petaloid sepals. Kirengeshoma palmata. B: Terminal part of flowering branch; C: Petal with adnate stamens; D: Flower with stamens and petals removed; E: Stamens with dorsifixed anthers; F: Trans- verse section of ovary. (B-F after Hutchinson, 1973) valvate (Platycrater), usually white. styles free, rarely united (Carpenteria), stig- Androecium with many stamens, some- mas free, nectar disc usually present at top times 8-10 (Hydrangea), free or slightly of ovary. Fruit usually a loculicidal connate at base, anthers bithecous, (Hydrangeae) or septicidal (Philadelpheae) basifixed or dorsifixed, filaments often lobed capsule, rarely a berry (Dichroa); seeds nu- or toothed, connective sometimes app- merous, small, sometimes winged, with endaged at tip (Fendlera), pollen grains fleshy endosperm and straight embryo. Pol- tricolpate or triporate. Gynoecium with 2-7 lination by insects aided by epigynous disc. united carpels, ovary semi-inferior (Dichroa, Small seeds are dispersed by wind. Broussaisia), inferior (Philadelphus, Deutzia, Hydrangea) or superior (Jamesia), 1-7 locu- Economic importance: The family is known lar, ovules numerous, placentation axile or for ornamental shrubs with showy flowers parietal with deeply intruded placentas, including Hydrangea, Decumeria (climbing Major Families of Angiosperms 615

Figure 13.105 Malvaceae. A: Hibiscus rosasinensis, flowering branch; B: stamens and stigmas; C: Malvaviscus arboreus, flowering branch; D: Flower; E: Lavatera assurgentiflora, flowering branch; F: Flower; G: Gossypium hirsutum, flowering branch; H: Flower; I: Fruit. Rhamnaceae. J: Colletia paradoxa, plant. Moraceae. K: Morus alba, plant with male catkins; L: Male catkin enlarged; M: Plant with female inflrescences. N: Ficus religiosa, twig with young hypanthodia. 616 Plant Systematics

Figure 13.106 Rafflesiaceae. A: Rafflesia speciosa, flower.Brassicaceae. B: Coronopus didymus, plant; C: Cheiranthus cheiri, plant; D: Mathiola incana, plant; E: Brassica oleracea, flowering branch; F: Fruits; G: B. campestris, flowering branch; H: Fruits; I: Flow- ers; J: Iberis amara, flowering branch; K: Cakile maritima, flowering branch. Major Families of Angiosperms 617

Figure 13.107 Rutaceae. A: Citrus limon, flowering branch; B: Fruit; C: Murraya paniculata, flowering branch; D: Flower. E: Citrus medica, flower; F: Ravenia spectabilis, plant in flower; G: Flower. H: Murraya koenigii, flowering branch; I: Flowers. Anacardiaceae. J: Mangifera indica, flowering branch; K: Portion of inflorescence enlarged; L: Female flower. Meliaceae. M: Melia azedarach, flowering branch. N: Flower; O: Fruits. 618 Plant Systematics

Figure 13.108 Sapindaceae. A: Acer japonicum, branch; B: A. griseum, bark; C: Fruit; D: Aesculus californica, flowering branch; E: Flowers; F: Ungnadia speciosa, fruiting branch; G: Fruit. Major Families of Angiosperms 619

Figure 13.109 Hydrangeaceae. A: Hydrangea macrophylla, flowering branch; B: Flowers. Polemoniaceae. C: Phlox diffusa, flowering branch; D: Flowers. Cornaceae. E: Cornus capitata, flowering branch; F: Flower. Primulaceae. G: Primula florindae, inflorescence; H: Dodecantheon meadia, inflorescence; I: Flower. 620 Plant Systematics

Figure 13.110 Ericaceae. A: Colluna vulgaris, flowering branch; B: Erica blanda, flowering branch; C: Arbutus unedo, flowering branch; D: Fruit; E: Rhododendron giersonianum, flower cluster; F: R. occidentale, flowering branch. G: Phyllodoce breweri, flowering branch; H: Adoxaceae. E: Sambucus nigra, flowering branch; I: Viburnum cotinifolium, branch with young fruits; J: Branch with mature fruits. Major Families of Angiosperms 621

Figure 13.111 Apiaceae. A: Astrantia major, plant; B: Umbel; C: Eryngium paniculatum, plant with inflorescences; D: Angelica pachycarpa, inflorescence; E: Foeniculum vulgare, plant; F: Part of inflorescence; G: Coriandrum sativum, plant; H: Part of inflorescence. Araliaceae. I: Pseudopanax crassifolium, flowering branch; J: Inflorescence; K: Hedera helix, plant. 622 Plant Systematics

Figure 13.112 Asteraceae. A: Viguieria helianthoides, plant; B: Capitulum; C: Achillea millefolium, plant; D: Taraxacum officinale, plant with capitula; E: Pachystegia insignis, plant with capitula; F: Haplopappus macrocephalus, plant with capitula and fruiting heads; G: Centaurea solstitialis, plant with inflorescence; H: Artemisia pycnocephala, plant; I: Calendula officinalis, capitulum; J: Sonchus oleraceous, plant. Major Families of Angiosperms 623

Figure 13.113 Solanaceae. A: Cestrum elegans, flowering branch; B: flowers; C: Solanum hispidum, flowering branch; D: Atropa belladonna, flowering branch; E: Datura suaveolens, flowering plant; F: Solanum melanogena, flowering branch; G: Flower; H: Fruit; I: Solanum nigrum, plant in flower; J: Young fruits. Convolvulaceae. K: Ipomoea cairica, plant in flower; L: Flower; M: Jacquemontia pentantha, plant in flower; N: Flowers. Boraginaceae. O: Ehretia laevis, plant; P: Flowers. 624 Plant Systematics

Figure 13.114 Rubiaceae. A: Ixora fulgens, flowering branch; B: Inflorescence C: Hamelia patens, flowering branch; D: Flowers and young fruits; Apocynaceae E: Plumeria alba, flowering branch; F: Allamanda catharatica, branch with flowers; G: Catharanthus roseus, flowering branch; H: Flower; I: Nerium oleander, flowering branch; J: Flower; K: Asclepias syriaca, flowering plant; L: A. fascicularis, flowering branch; M: Flowers; N: Calotropis procera, flowering branch.. Major Families of Angiosperms 625

Figure 13.115 Plantaginaceae. A: Plantago lanceolata, plant; B: Mimulus cardinalis, plant; C: M. guttatus, flower cluster; D: M. puniceus, flowering branch; E: Digitalis purpurea, flowering branch; F: Flowers enlarged. Lamiaceae. G: Salvia muelleri, flower; H: S. mexicana, flowering branch; I: Flower; J: Origanum calcaratum, flowers; K: Salvia splendens, plant; L: Flower; M: S. scorodonifolia, flower; N: Lavandula angustifolia, flowering twig. 626 Plant Systematics

Figure 13.116 Verbenaceae. A: Lantana camara, plant; B: Flowers. Bignoniaceae. C: Incarvillea arguta, flowering branch; D: Tecoma stans, flowering branch. Acanthaceae. E: Justicia brandegeana, plant; F: Acanthus spinosus, flowering branch; G: Flowers; H: Adhatoda vasica, flowering branch; I: Flowers; J: Thunbergia grandiflora, flower. Scrophulariaceae. K: Bowkeria gerardiana, flowering branch; L: Part of inflorescence; M: Vebascum thapsus, plant. Major Families of Angiosperms 627 hydrangea), Schizophragma (climbing hydran- rate subclass Cornidae (superorder Cornanae, gea), Philadelphus (mock orange) and Deutzia. order Hydrangeales), while Saxifragaceae was Some species of Hydrangea are used as source retained in Rosidae. The recent classifications of hydrangin, a compound used in medicine. of APG II, APweb and Thorne (2003, 2007) place family under Asterid complex (Thorne in Phylogeny: The family was earlier included Asteridae—>Cornanae—>Cornales; APG clas- under Saxifragaceae (Bentham and Hooker; sifications in Asterids—>Cornales). The sepa- Engler and Prantl). It was separated as dis- ration of Hydrangeaceae away from Saxifra- tinct family by Hutchinson (1927), who also gaceae has been supported by cladistic analy- treated Philadelphaceae as distinct family in sis, indicating that the two are distantly related, his The Genera of Flowering Plants (1964) and Hydrangeaceae is closer to Cornaceae. followed up in his last revision of classifica- The family Hydrangeaceae is divided into tion (1973). Philadelphaceae was merged with two subfamilies: Jamesioideae (2 genera Hydrangeaceae in classifications of Cronquist Jamesia and Fendlera) and Hydrangeoideae (1988) retaining the family in Rosales (placed (rest of genera). Hufford et al., (2001) on the under Rosidae) along with Saxifragaceae. The basis of analysis of sequences of matK and merger of Philadelph-aceae with Hydrangea- their combination with rbcL and evidence ceae is supported by morphology and DNA from morphology concluded that Jamesioi- characteristics (Albach et al, 2001; Soltis et deae may be sister to the rest of the family. al., 1995; Hufford, 1997) and the treatment They also divide Hydrangeoi-deae into two has been followed in recent classifications. tribes Hydrangeae (conspicuous sterile Dahlgren (1983, 1989) shifted the family away marginal flowers, valvate petals, loculicidal from Rosanae to superorder Cornanae. capsule) and Philadelpheae (sterile flowers Takhtajan (1997) placed family under sepa- absent, petals imbricate, capsules septicidal).

* * * * * * * * * * *

Cornaceae Dumortier Dogwood family 2 genera, 83 species (including Alangiaceae DC.) Widely spread, mainly in north temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Cornidae Magnoliidae Asteridae Series+/Superorder Calyciflorae+ Cornanae Cornanae Cornanae Asterids* Order Umbellales Cornales Cornales Cornales Cornales Cornales

Salient features: Mostly shrubs, leaves sim- Major genera: Cornus (65 species) and ple, usually opposite, stipules absent, flow- Alangium (20). ers bisexual, sepals often enlarged and petaloid, ovary inferior or semi-inferior, Description: Trees and shrubs, rarely placentation axile or deeply intruded pari- stoloniferous subshrubs, glabrous or hairy, etal, nectary present at top of ovary, fruit a usually with iridoids. Leaves usually oppo- capsule. site, sometimes alternate or distichous, 628 Plant Systematics

Figure 13.117 Cornaceae. Cornus macrophylla. A: Portion of plant with flowers; B: Flowertop, view; C: Transverse section of fruit.D: Flower head of C. capitata subtended by four bracts. C. stolonifera E: Flower; F: Vertical section of flower. (A-D, after Nasir and Ali, Fl. W. Pak.No. 88, 1975; E-F, Bailey, Man. Cult. Pl., 1949). simple, entire, venation pinnate, secondary laterally. Gynoecium with 2 united carpels, veins usually smooth arching towards rarely 1-4, ovary inferior, usually 2-locular, margin or forming a series of loops, stipules single ovule in each locule, placentation absent. Inflorescence terminal branched axile, axis lacking vascular bundles and the cymes or heads, usually subtended by large ovules attached to vascular bundles that showy bract, often forming involucre in arch over the top of each septum (apical heads. Flowers usually bisexual, rarely axile placentation), style simple, stigma unisexual, actinomorphic, epigynous. Calyx capitate or lobed, disc present on top of ovary; with 4-5 sepals , united, valvate, lobes . Fruit usually a drupe, 1-2 seeded, ridged or rounded, sometimes represented by small winged; seeds small, endosperm present. teeth, rarely absent. Corolla with 4-5 Pollination by bees, flies and beetles. Drupes petals, free, imbricate, imbricate or valvate. are dispersed by birdsand mammals. Androecium with 4-5 stamens, alternating with petals, rarely up to 10, filaments free, Economic importance: Species of Cornus arising from the edge of disc, anthers (Dogwood) and Alangium are grown as orna- bithecous, basifixed or dorsifixed, dehiscing mental trees and shrubs. Major Families of Angiosperms 629

Phylogeny: The family has undergone a lot Cornaceae, Alangiaceae, whereas rest of the realignment in recent years. Bentham and genera are united under Nyssaceae, divided Hooker placed it under Araliaceae, but sub- into subfamilies Davidioideae, Nyssoideae sequently recognised as independent family and Mastixioideae. APWeb (2007) united under Umbelliflorae (Engler and Prantl). Alangiaceae and Cornaceae, thus including Hutchinson (1948) shifted Cornaceae along two genera under Cornaceae. Analysis of a with Araliaceae to order Cunoniales on the combined matK and rbcL sequence data set basis of woody habit and stem anatomy. The by Xiang et al. (1998) established Cornus- family was earlier broadly circumscribed to Alangium as distinct clade within Cornales, include 10-15 genera (Hutchinson, 1973; results confirmed by 26S rRNA and combined Cronquist, 1988), but was split into a number 26S rDNA-matK-rbcL sequence data of Fan of families (Takhtajan, 1997) such as Davi- and Xiang (2003) establishing Grubbiaceae diaceae, Nyssaceae, Mastixiaceae, Curtisia- (Grubbia and Curtisia), Cornaceae (Cornus and ceae, Cornaceae and Alangiaceae. APG- II Alangium) and Nyssaceae (Nyssa, Davidia, recognises only Curtisiaceae and Cornaceae, Camptotheca, Mastixia and Diplopanax) as dis- Nyssaceae optionally merged with latter. tinct clades; Hydrangiaceae and Loasaceae Thorne (2006, 2007) recognizes monogeneric forming indepedent clade.

* * * * * * * * * * *

Balsaminaceae Bercht. & J. Presl. Balsam family 2 genera, 1000 species Widely distributed but more common in subtropics and tropics of Africa and Asia, and temperate regions New and Old world.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Rosidae Magnoliidae Asteridae Series+/Superorder Disciflorae+ Geranianae Rutanae Ericanae Asterids* Order Geraniales Geraniales Balsaminales Balsaminales Balsaminales Ericales B & H under Geraniaceae

Salient features: Somewhat succulent Description: Herbs, rarely evergreen herbs, flowers bisexual, zygomorphic, subshrubs, often with fleshy translucent spurred, anthers connate, fliaments closely stems, sometimes aquatic, rarely epiphytes. surrounding ovary, succulent capsule with Leaves alternate, opposite or in whorls of elastic dehiscence. three, simple, usually toothed, stipules as paired glands or absent. Inflorescence of soli- Major genera: Impatiens (997 species) and tary flowers, cymes, racemes or panicles, on Hydrocera (3). axillary peduncles. Flowers bisexual, 630 Plant Systematics

Figure 13.118 Balsaminaceae. Impatiens glandulifera. A: Portion of plant with flowers and fruits; B: Flower, top view; C: Longitudinal section of flower with sepals and petals removed; D: Lateral sepal; E: anterior petal; F: Lateral fused petals; G: Trans- verse section of ovary; H: Seed. spurred, nodding, often resupinate, hypo- many in each locule, anatrpous, pendulous, gynous, pentamerous, some flowers cleisto- placentation axile, style simple, often very gamous and self pollinating. Calyx with usu- short, stigmas 1-5. Fruit a fleshy 5-valved ally 3 sepals , sometimes upto 5, free, capsule, dehiscing explosively, valves coil- petaloid, imbricate, posterior (lower in ma- ing elastically and on splitting the tension ture flower) largest and with nectar spur or forcibly distributing the seeds, rarely a berry- pouch on back. Corolla with 5 petals, free, like drupe; seeds with straight embryo, or lateral pairs connate and appear as endosperm absent. Pollination by insects. 3 petals, lower pair larger than upper. Andro- Capsules dehiscing explosively by autochory ecium with 5 stamens, filaments flattened, or when touched slightly, hence the name short, closely covering the ovary, free below, ‘touch me not’. connate towards top with connate anthers (syngenesious) forming lid (calyptra) over Economic importance: The family is known the ovary, anthers bithecous, dehiscence for its ornamental herbs with showy flowers. longitudinal. Gynoecium with 5 united car- Garden balsam (Impatiens balsamina), pels, ovary superior, 5-locular, ovules 3- Himalayan balsam (I. glandulifera), Busy Major Families of Angiosperms 631 lizzie (I. holstii) and several hybrid cultivars et al. (2004). Latter authors concluding that are widely grown in temperate as well as Balsaminaceae and Marcgraviaceae are sis- tropical climates. ter taxa, although there are no obvious synapomorphies. Balsaminaceae show the Phylogeny: The family was formerly placed combination of leucoanthocyanins and under Geraniaceae, but differes in raphides, rarely seen in herbs (Fischer, zygomorphic flowers, spurred sepal and 2004). The family is vegetatively very uni- connate anthers. It is often allied to form although florally diverse and duplication Tropaeolaceae, but the spur in latter family and probable subfunctionalisation of the class is derived from recepacular tissue and not B DEF gene has occured in this clade calyx as in Balsaminaceae. Balsaminaceae, (Janssens et al. 2006; Geuten et al. 2006). Marcgraviaceae and Tetrameristaceae form Hydrocera and Impatiens are clearly sister taxa a well defined clade and probably sister to rest (Yuan et al. 2004; Janssens et al. 2006). Spe- of Ericales. Monophyly of these three fami- cies of Impatiens with five sepals are scat- lies is well supported by the studies of Nandi tered through the genus, so that condition is et al. (1998), Soltis et al. (2000) and Geuten apparently at least sometimes derived.

* * * * * * * * * * *

Polemoniaceae Bromehead Phlox family 20 genera, 360 species Widely distributed, more common in temperate climate, especially western North America.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Asteridae Series+/Superorder Bicarpellatae+ Solananae Solananae Ericanae Asterids* Order Polemoniales Solanales Polemoniales Solanales Polemoniales Ericales

Salient features: Mostly herbs, leaves alter- Description: Annual or perennial herbs, nate, stipules absent, sepals 5, united, pet- rarely shrubs or trees (Cantua) or climbers als 5, united, stamens 5, epipetalous, carpels (Cobaea), often with glandular hairs, nodes 3, united, placentation axile, ovules many, unilacunar. Leaves usually alternate, rarely style 1, stigmas 3, fruit a capsule. opposite or whorled (Gymnosteris), usually simple, sometimes dissected or pinnate Major genera: Gilia (110 species), Phlox (75), compound (Polemonium), venation reticulate, Polemonium (40), Limnanthus (40), Ipomopsis stipules absent. Inflorescence terminal or (25), Collomia (15) and Cantua (12). axillary, often crowded into corymbs or heads, 632 Plant Systematics

Figure 13.119 Polemoniaceae. Polemonium caeruleum. A: Basal part of plant; B: Upper leaves and inflorescence; C: Flower from above; D: Vertical section of flower; E: Fruit enclosed in persistent calyx. Phlox nivalis. F: Plant in flower; G: Vertical section of flower ; H: Seed. rarely solitary. Flowers bisexual, actino- ous, seed-coat mucilaginous when mois- morphic, rarely zygomorphic, hypogynous, tened. Pollination mostly by bees and flies. usually showy. Calyx with 5 sepals, united, Seeds are dispersed aided by mucilaginous green. Corolla with 5 petals, united, often coat, sometimes by wind or water. with a narrow tube, lobes plicate or convolute . Androecium with 5 stamens, adnate Economic importance: The family is known to corolla tube (epipetalous; inserted), alter- for its ornamentals Phlox (P. drummondii be- nating with lobes, filaments free, anthers ing most popular), Gilia and Polemonium with bithecous, dehiscence longitudinal, pollen showy flowers. grains 4-many aperturate, colpate or porate. Gynoecium with 3 united carpels, rarely 2, Phylogeny: The family is considered to be ovary superior, seated on a nectary disc, 3- closely related to Hydrophyllaceae, the two locular, rarely 2-locular, ovules 1 or more, having closer affinities with group consist- unitegmic, placentation axile, style single, ing of Solanaceae, Nolanaceae and elongated, branched above, stigmas 3, rarely Convolvulaceae. Hutchinson, who places 2. Fruit a loculicidal capsule; seed with Cuscutaceae under the order Polemoniales, straight or curved embryo, endosperm copi- considers it to be most highly evolved within Major Families of Angiosperms 633 the order. Thorne (1999) shifted this family classes, has also placed Polemoniaceae un- to Dilleniidae (Dillenianae) under separate der Ericales (superorder Ericanae) under order Polemoniales (in accordance with the Asteridae. Traditionally two subfamilies findings of DNA sequence studies), retain- Cobaeoideae and Polemonioideae are recog- ing other families under Lamiidae, order nized. Acanthogilia with dimorphic leaves Solanales. Takhtajan places all families in- and short shoots has been placed in its own cluding Polemoniaceae under Lamiidae, su- subfamily (Porter et al., 2000). Thorne (2006, perorder Solananae, but under separate or- 2007) accordingly recogniszes 3 subfamilies ders. Judd et al., (1999) had placed Cobaeoideae, Acanthogilioideae and Polemoniaceae under Solanales because of Polemonioideae. Studies based on actinomorphic flowers, and united plicate chloroplast gene ndhF (Prather et al., 2000), corolla. The studies of Porter and Johnson however, indicate that the genus (1998), based on morphology and DNA se- Acanthogilia may be basal in the Cobaea lin- quences, however, indicate that the family eage. Studies of Porter and Johnson (1998) belongs to Ericales. The family has accord- have also indicated that woody tropical gen- ingly been shifted to Ericales under Aterids era of Cobaeoideae form a paraphyletic ba- in APG II, Judd et al., (2002) and APweb. sal complex, and the herbaceous genera of Thorne (2003), who has brought about ma- Polemonioideae mainly Ipomopsis, jor realignments, and abolished Dilleniidae, Linanthus, Polemonium, Phlox and Gila con- distributing its members among various substitute a monophyletic group.

* * * * * * * * * * *

Ebenaceae Gürcke Ebony family 5 genera, 600 species Widely distributed in tropics and subtropics, with a few species in temperate regions of North America and Australia.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Dilleniidae Dilleniidae Magnoliidae Asteridae Series+/Superorder Heteromerae+ Primulanae Primulanae Ericanae Asterids* Order Ebenales Ebenales Styracales Ebenales Sapotales Ericales

Salient features: Trees and shrubs without Description: Shrubs and trees with black milky latex, bark blackish, leaves charcoal-like bark, heartwood black, red or distichous, simple, unisexual flowers, mul- green, lacking milky latex, buds covered tilocular superior ovary, bitegmic ovules in with adpressed hairs. Leaves alternate, pairs. distichous, simple, entire, coriaceous, venation reticulate, lower surface with dark Major genera: Diospyros (472 species), coloured glands, turning blackish on drying Euclea (20) and Lissocarpa (8). due to presence of napthoquinones, stipules 634 Plant Systematics

Figure 13.120 Ebenaceae. Diospyros paniculata. A: Flowering branch. D. virginiana B: Staminate flower; C: Same in vertical section; D: Pistillate flower; E: Same enlarged in vertical section; F: Transverse section of ovary. (A, after Brandis, Ind. Trees, 1918; B-F, after Bailey, Man. Cult. Pl., 1949). absent. Inflorescence axillary cymes or with united carpels, ovary superior, rarely infe- solitary flowers; plants usually monoecious, rior (Lissocarpa), locules many, placentation male flowers in larger numbers. Flowers axile, each locule with usually 2 ovules at- unisexual, actinomorphic, male flowers with tached from the top but each ovule separated pistillode, female with staminodes, by partition, thus ovary with twice as many hypogynous, two bracteoles below flower in chambers and apical-axile placentation, Lissocarpa. Calyx with 3-7 sepals, united, ovule pendulous, anatropous, integuments persistent and often enlarged in fruit two, styles anatropous to campylotropous, (accrescent). Corolla with 3-7 petals, united, styles and stigmas 3-8, styles free or connate urceolate, lobes imbricate and contorted, at base. Fruit a berry with often enlarged coriaceous. Androecium with same number calyx; seed with straight embryo, endosperm of stamens as petals or twice as many, and copious, hard and irregularly grooved or as many whorls, free or united in pairs, ridged. epipetalous or free from petals, anthers bithecous, dehiscence longitudinal, introrse, Economic importance: The family is im- rarely by apical pores. Gynoecium with 3-8 portant source of durable timber Macassar Major Families of Angiosperms 635 ebony (Diospyros ebenum) and Black ebony ovary) removed to a distinct unassigned fam- (D. reticulata). Other species of the genus are ily Lissocarpaceae in APG (1998), has been sources of common fruits such as Japanese merged with Ebenaceae in APG-II (2003), persimon (D. kaki), American persimon (D. Thorne (2006, 2007) and APWeb (2007). Lat- virginiana), and Date plum (D. lotus). ter places it under subfamily Lissocarpoi- deae, other two genera under Ebenoideae. Phylogeny: Family is closely related to Savolainen et al. (2000) suggested removal Sapotaceae but distinct in the absence of of Lissocarpa to Rutaceae, but rbcL studies milky latex, unisexual flowers, multilocular supported it as sister to Ebenaceae s. str. superior ovary, ovules in pairs and with 2 (Berry et al. 2001). Euclea and Royena (rec- integuments. From Styracaceae it is dis- ognised as 4th genus within Ebenaceae by tinct by unisexual flowers and septate ovary. APWeb) were sister to Diospyros, and within Lissocarpa (with large bracteoles, corolla latter there were a number of well-supported with 8-lobed corona, connate filaments, an- clades, although relationships between them ther with prolonged connective and inferior are unclear (Duangjai et al., 2006a, b).

* * * * * * * * * * *

Sapotaceae A. L. de Jussieu Sapodilla family 52 genera, 1250 species Widely distributed in tropics of New World as well as Old World, especially in wet lowland forests, with a few species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Salient features: Mostly trees with milky (110), Sideroxylon (75), Chrysophyllum (75), latex, small terminal naked buds with Manilkara (70) and Mimusops (60). appressed T-shaped hairs, leaves simple, coriaceous, bisexual flowers, multilocular Description: Mostly trees, rarely shrubs superior ovary, single ovule in each cham- (Reptonia), with milky latex, with sympodial ber, unitegmic ovules, seeds with shiny branches or thorns, silica bodies, testa. triterpenoids and cyanogenic compounds often present, small naked buds brownish hairs, Major genera: Pouteria (325 species), latter T-shaped but one branch often reduced. Palaquium (110), Planchonella (100), Madhuca Leaves alternate, sometimes clustered at 636 Plant Systematics

Figure 13.121 Sapotaceae. A: Flowering branch of Mimusops hexandra. B: Fruiting branch of Pouteria sapota. Chrysophyllum olivaeforme. C: Flowering branch; D: Flower; E: Vertical section of ovary; F: Transverse section of ovary. (A, after Brandis, Ind. Trees, 1918; B-F, after Bailey, Man. Cult. Pl., 1949). shoot apices, simple, entire, coriaceous, ve- longitudinal, pollen grains tricolpate or nation reticulate, stipules usually absent, tetracolpate. Gynoecium with 2-many united rarely present (Madhuca), fresh petioles bot- carpels, ovary superior, locules many, tle-shaped. Inflorescence axillary cymes, placentation axile, each locule with 1 ovule, rarely terminal cymes (Madhuca) or with soli- ovule anatropous with single integument, tary flowers. Flowers bisexual, ebracteate style single, protruding, stigma capitate or (Manilkara zapota) or bracteate (Madhuca), lobed. Fruit a berry with often leathery bony actinomorphic, hypogynous. Calyx with 4- layer; seed with hard shiny testa and large 12 sepals, free or connate at base, sometimes hilum, endosperm usually fleshy, rarely ab- in two whorls or spirally arranged, imbricate, sent. Pollination by insects. Dispersal of ber- persistent. Corolla with 4-12, as many as ries by birds and animals. sepals, united, sometimes with paired petaloid appendages and as such corolla lobes Economic importance: The family provides appear 18-24 in number, usually imbricate, several delicious tropical fruits like sapodilla rarely valvate. Androecium with usually (Manilkara zapota), mamey sapote (Pouteria 8-16 stamens, in two or 3 whorls but only in- sapota), eggfruit or yellow sapote (P. ner whorl fertile opoosite petals, others re- campechiana) and star apple (Chrysophyllum duced to staminodes, epipetalous, anthers cainito). Latex of Manilkara zapata provides bithecous, basifixed or dorsifixed, dehiscence chicle, the elastic substance in chewing Major Families of Angiosperms 637 gum. Species of Palaquium provide gutta- genera having same number of stamens as percha, a latex substance used in golf balls corolla lobes constitute a well defined clade, and submarine telephone cables as insula- those with twice as many stamens form a tion and in dental stoppings. Several species heterogenous complex, which is probably are used for timber in Malaya. paraphyletic and basal. Thorne (2006, 2007) and APWeb (2008) recognise three sub- Phylogeny: Family is closely related to families in Sapotaceae: Sarcospermatoi- Ebenaceae but distinct in the presence of deae, Sapotoideae and Chrysophylloideae. milky latex, bisexual flowers, ovules singly Above three clades are supported by com- in chambers and with single integument. bined morphological molecular analysis of The family is closer to Hoplestigmataceae in Swenson and Anderberg (2005). They also single ovule in chamber and single integu- concluded that the staminodes common in ment (Lawrence, 1951), but the latter family Chrysophylloideae, but derived within the has been shifted to Lamiidae by Thorne (2006, clade, are perhaps not immediately compa- 2007), whereas APG-II places Hoplestigma rable with the staminodes of other members among unplaced genera, and APWeb (2007) of the family; the former are outside the the family as unplaced eudicot. The studies staminal whorl, the latter in the same whorl of Pennington (1991) from the study of corolla as the stamens. Sarcosperma is regarded as lobes and stamens concluded that whereas sister to rest of family.

* * * * * * * * * * *

Primulaceae Batsch ex Borkh. Primrose family 18 genera, 955 species Largely distributed in north temperate regions, mainly in the Mediterra- nean region, Alps, and Asia Minor.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Dilleniidae Dilleniidae Magnoliidae Asteridae Series+/Superorder Heteromerae+ Primulanae Primulanae Ericanae Asterids* Order Primulales Primulales Primulales Primulales Primulales Ericales

Salient features: Herbs, leaves opposite or Description: Perennial herbs, usually with whorled or basal, petals united, ovary supe- sympodial rhizomes (Primula) or tubers rior, stamens opposite the petals, carpels (Cyclamen) rarely annuals (Anagallis) or more than 2, seeds numerous. subshrubs, sometimes aquatic (Hottonia), nodes unilacunar, sieve-tube plastids Major genera: Primula (500 species), S-type. Leaves opposite, whorled or alternate, Lysimachia (200), Androsace (90), sometimes all basal, simple, sometimes dis- Dodecantheon (50), Anagallis (28) and sected (Hottonia), venation reticulate, stipules Cyclamen (15). absent, rarely present (Coris). Inflorescence 638 Plant Systematics

Figure 13.122 Primulaceae. Primula longiscapa. A: Plant with basal rosette of leaves and scapigerous inflorescence; B: Vertical section of flower to show long corolla tube and epipetalous stamens; C: Transverse section of ovary with free-central placentation; D: Fruit dehiscing by recurved apical teeth. Anagallis arvensis. E: Part of plant with opposite and whorled leaves and axillary flowers; F: Flower from above; G: Vertical section of flower; H: Fruit with persistent calyx and style; I: Pyxidium fruit dehiscing by terminal cap; J: Seed. with solitary axillary flowers (Anagallis), to ecium with 5 stamens (rarely 4 or 6, depend- paniculate (Lysimachia) or umbellate ing on the number of petals), free, opposite (Primula), often scapigerous (Primula). Flow- the petals, epipetalous, anthers bithecous, de- ers bisexual, actinomorphic, rarely zygo- hiscence longitudinal, sometimes with api- morphic (Coris), hypogynous, rarely partly cal pores, sometimes with staminodes alter- epigynous (Samolus), usually pentamerous. nating the petals. Gynoecium with 5 united Calyx with 5 sepals, rarely 6 (Lysimachia) or carpels, ovary superior or half-inferior, even 9 (Trientalis), united, inflated or tubu- unilocular, ovules many, anatropous to lar, imbricate or twisted. Corolla with 5 pet- campylotropous, placentation free central, als, rarely 4 (Centunculus), 6 (Lysimachia) or style simple, stigma capitate or minute, 9 (Trientalis), or absent (Glaux), united, the heterostyly is prevalent in the genus Primula. tube often short, rotate (Anagallis) or tubular Fruit a capsule, variously dehiscent, (Primula), lobes imbricate or twisted. Andro- pyxidium in Anagallis, opening by a cap like Major Families of Angiosperms 639 cover; seeds with straight embryo, endosperm Portulacaceae being a connecting link. Over present, sometimes with aril. Pollination by the recent years, there have been attempts various insects. Small seeds are often dis- to shift Anagallis, Lysimachia and other gen- persed by wind or water, some by ants at- era to Myrsinaceae, separation of Maesa from tracted by the oily aril. Myrsinaceae into a distinct family Maesa- ceae and shifting of Samolus from Primula- Economic importance: The family is impor- ceae to Theophrastaceae (Anderberg et al., tant for several ornamental species of 2000, 2001). On the basis of phylogenetic Primula and Cyclamen. Anagallis arvensis is analysis based on DNA sequences of rbcL and of medicinal importance. ndhF Kallesjo et al., (2000) concluded that genera of tribe Lysimachieae (Anagallis, Phylogeny: The family is well defined and Cyclamen, Gaux, Lysimachia and Trientalis) as usually placed under Primulales along with also the genera Coris and Ardisiandra should other groups of Dillenianae or Dilleniidae be placed within expanded Myrsinaceae, re- (whichever is recognized). In some genera stricting Primulaceae to herbaceous mem- such as Samolus, there are five staminodes bers with campanulate corolla and capsule alternating with petals, in addition to 5 nor- fruits, a treatment followed in APweb. Judd mal stamens opposite the petals, suggest- et al. (2002) and Thorne (2003), however, ing that antipetalous condition has resulted have followed broader circumscription of fam- during course of evolution from the loss of ily Primulaceae retaining these genera. Re- the outer whorl (represented in some gen- cent studies have indicated resemblances era by staminodes). The family is mostly of the family Primulaceae with Ericalean placed closer to Myrsinaceae. Hutchinson, complex under Asterids. As such Thorne in however, advocated that the two are not re- his recent revision (2003, 2006, 2007) has lated and their free central placentation and shifted Primulales to Asteridae (under stamens opposite the petals are due to par- Ericanae), and Judd et al., (2002), APG II and allel evolution. He considers Primulaceae to APweb have placed the family under order have evolved from Caryophyllaceae with Ericales of Asterids.

* * * * * * * * * * *

Ericaceae A. L. de Jussieu Heath family 140 genera, 2,990 species Widely distributed throughout temperate and subtropical regions, and to some extent in subarctic and alpine regions, mainly on acidic soils.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Dilleniidae Dilleniidae Magnoliidae Asteridae Series+/Superorder Heteromerae+ Ericanae Ericanae Ericanae Asterids* Order Ericales Ericales Ericales Ericales Ericales Ericales 640 Plant Systematics

Figure 13.123 Ericaceae. Rhododendron glaucophyllum. A: Portion of plant with flowers; B: Anther; C: Transverse section of ovary; Vaccinium vacillans D: Branch with flowers; E: Flower; F: Vertical section of flower; G: Anther. H: Flowering branch of Lyonia villosa. (A, H, after Polunin and Stainton, Fl. East. Himal., 1984; rest, after Bailey, Man. Cult. Pl., 1949).

Salient features: Mainly shrubs, leaves al- herbs lacking chlorophyll (Monotropa). ternate, flowers campanulate to urceolate, trichomes unicellular or multicellular, glan- stamens twice the number of corolla lobes, dular or scaly, never stellate. Leaves alter- arising from nectariferous disc, anthers nate, sometimes opposite or whorled, sim- opening by terminal pores, ovary 4 or more ple, entire or serrate, often coriaceous, per- chambered. sistent, sometimes reduced to needles or scales, margin sometimes revolute, vena- Major genera: Rhododendron (850 species), tion reticulate, usually pinnate, sometimes Erica (600), Vaccinium (450 incl. Agapetes: 90), palmate, blade sometimes reduced to Gaultheria (160), Leucopogon (150), mycoparasite, stipules absent. Inflores- Cavendishia (110), Arctostaphylos (70), cence with solitary axillary flowers, cymes, Dracophyllum (50), Epacris (45), Pyrola (20), racemes or panicles. Flowers bisexual, Cassiope (12) and Monotropa (5). rarely unisexual (Empetrum), actinomorphic, sometimes slightly zygomorphic (Rhododen- Description: Shrubs, sometimes small, dron), hypogynous, . Calyx with 5 sepals, rarely lianas, epiphytes or mycoparasitic rarely 4-7, distinct or slightly connate at Major Families of Angiosperms 641 base, persistent. Corolla with 5 petals, widely grown as ornamentals. Oil of winter- rarely 4-7, united, corolla tubular, green (methyle salicylate) is obtained from campanulate or urceolate, lobes short, im- Gaultheria procumbens. Foliage of Gaultheria bricate or convolute. Androecium with 5 sta- shallon is sold as ‘lemon leaf’. mens sometimes twice the number of corolla lobes, arising from nectar disc, free, Phylogeny: The broadly circumscribed filaments flattened at base, sometimes Ericaceae includes Empetraceae, Epacrida- connate at base (Vaccinium), straight or S- ceae, Monotropaceae, Pyrolaceae and curved, free from corolla or epipetalous, Vacciniaceae, sometimes recognized as in- anthers bithecous, sometimes with paired dependent families, or included under two appendages (spurs) near base, dehiscence families Ericaceae (ovary superior, fruit cap- by apical pores, rarely small slits near tip, sule) and Vacciniaceae (ovary semi-inferior pollen in tetrads. Gynoecium with 5 united or inferior, fruit a berry). Segregation these carpels, rarely 2-10, ovary usually superior, families would render Ericaceae as para- rarely half-inferior (Gaultheria) or inferior phyletic. Monophyly of broadly circumscribed (Vaccinium), disc present, placentation axile Ericaceae is supported by evidence from or parietal with deeply intruded placentae, morphology, rbcL and 18S rDNA sequences unilocular, ovules many, anatropous, style (Kron, 1996; Soltis et al, 1997). Engler and simple, conical or filiform, rarely split above, Diels (1936) included four subfamilies: stigma simple. Fruit a capsule, berry Rhododendroideae (septicidal capsule, seed (Vaccinium, Cavendishia) or drupe (Arctosta- winged or ribbed, anthers without append- phylos, Styphelia); seeds small, embryo ages), Arbutoideae (fruit berry or loculicidal straight, endosperm present, seed coat thin. capsule, seed not winged, anthers app- Pollination mostly by bees and wasps, aided endaged, ovary superior), Vaccinioideae by nectar. Viscin threads present in Rhodo- (ovary inferior, rest similar to Arbutoideae) dendron and related genera help insects to and Ericoideae (fruit loculicidal capsule or pull out pollen tetrads. Capsule fruits are nut, ovary superior, seeds not winged, calyx dispersed by wind, species with berries or persistented, anthers with apically spread- drupes are usually dispersed by birds. ing lobes). Thorne (2006) recognized eight subfamilies, merging Rhododendoideae with Economic importance: The family provides Ericoideae, and adding Enkianthoideae, edible fruits blueberry (Vaccinium spp.), cran- Monotropoideae, Cassiopoideae, Styphelioi- berry (V. macrocarpum) and huckleberry deae and Empetroideae, subsequently (2007) (Gaylussacia; sometimes included in adding ninth Harrimanelloideae segregated Vaccinium). Several species of Rhododendron from Cassiopoideae. APWeb (2008) also rec- (rhododendrons, azaleas), Calluna (heather), ognises 8, but includes Empetroideae under Kalmia (K. latifolia, mountain laurel), Erica Ericoideae, recognising Harrimanelloideae as (heath), Oxydendrum (sourwood), Arbutus additional subfamily. Monotropa uniflora has (madrone) and Leucothoe (fetterbush) are smallest embryo, just two-celled (Olson 1991)

* * * * * * * * * * * 642 Plant Systematics Adoxaceae E. Meyer Elderberry family 5 genera, 245 species (Inc. Sambucaceae Borkh.) Distributed mainly in northern temperate region, a few in montane tropical and subsubtropics.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Cornidae Magnoliidae Asteridae Series+/Superorder Inferae+ Dipsacanae Cornanae Aralianae Euasterids II* Order Rubiales Dipsacales Adoxales Cornales Dipsacales Dipsacales B & H under Caprifoliaceae,

Figure 13.124 Adoxaceae. Viburnum mullaha. A: Branch with inflorescence; B: Flower, top view; C: Vertical section of flower; D: Transverse section of ovary. Sambucus nigra. E: Branch with inflorescence; F: Flower, side view; G: Flower, top view; H: Fruit; I: Seed. (A-B, after Polunin and Stainton, Fl. Himal, 1984) Major Families of Angiosperms 643

Salient features: Mainly shrubs or lianas, crassinucellate. Fruit a small drupe, or leaves opposite, usually simple. drupaceous berry with 3-5 stones, the embryo minute, straight, endosperm oily. Polli- Major genera: Viburnum (200 species), Sam- nation by insects, musky flowers of Adoxa bucus (40), Adoxa (1), Sinadoxa (1), tetradoxa attract flies. Dispersal mostly by birds and (1). animals.

Description: Usually shrubs or small trees Economic importance: The family is known (Viburnum), tall herbs (some species of Sam- for its well known ornamentals belonging to bucus), or small geophytic herbs with creep- Sambucus and Viburnum. Black elder (S. ni- ing rhizome (Adoxa), sometimes with storied gra) is widely cultivated in temperate as well cambium and crystal sand (Sambucus). tropical regions, whereas snow ball (Vibur- Leaves opposite or rarely verticillate, in ba- num opulus) is mainly grown in temperate sal rosette and alternate in Adoxa, simple, climates. entire to variously toothed or lobed, with or without small stipules (Viburnum), or Phylogeny: The genera included here were pinnately or bipinnately compound, the leaf- originally placed in broadly circumscribed lets mostly with serrate margins, and large Caprifoliaceae, which has now been reduced foliaceous stipules (Sambucus), stipules to mere 5 genera, including well known ge- sometimes reduced to glandular appendages nus Lonicera. The genus Adoxa (and recently or absent. Inflorescence usually flat-topped, recognised Sinadoxa and Tetradoxa) has tra- arranged in terminal cymes, corymbs or ditionally been considered distinct from panicles, or small head (Adoxa). Flowers caprifoliaceae in absence of calyx, divided small, bisexual or rarely unisexual, occa- filaments with monothecous anthers, split sionally with some marginal flowers neutral styles and fruit with more than one stones, and a greatly enlarged corolla, slightly but now two major genera Viburnum and Sam- zygomorphic. Calyx with 5 sepals, rarely 3 bucus have been included in expanded (Adoxa; usually interpreted to represent Adoxaceae. Donoghue et al. (2001) studies bract + 2 bracteoles, calyx treated as absent) the taxonomy of Dipsacales especially or 4, imbricate. Corolla with 5 petals, rarely Adoxaceae using rbcL and nuclear ribosomal 3-4, united, rotate to campanulate, occasion- internal transcribed spacer (ITS) sequences. ally tubular, imbricate, lobes sometimes with They concluded that the 5 genera formed a nectary (Adoxa). Androecium with as many clearly defined clade with Viburnum being stamens as petals, epipetalous, alternating sister to rest of the four genera, followed by with petals, anthers bithecous, in Adoxa, Sambucus, which is sister to remaining Sinadoxa and Tetradoxa the stamens appear three. Data established Adoxaceae and to be divided into two half stamens, each Caprifoliaceae as two major clades within with a separate filament and monothecal the order. Within Adoxaceae Adoxa, Sinadoxa anther, half anther being peltate in and Tetradoxa form Adoxina clade marked Tetradoxa, dehiscence by longitudinal slits. by herbaceous habit, reduction in the Gynoecium with 3-5 united carpels, 1 in number of perianth parts, nectaries of mul- Sinadoxa, ovary semi-inferior, rarely supe- ticellular hairs on the perianth, and bifid rior (Tetradoxa), 3-5 locular, the style soli- stamens. Thorne (2006, 2007) recognizes two tary and terminal, divided in Adoxa, Sinadoxa subfamilies Adoxoideae (4 genera) and and Tetradoxa, the stigma mostly capitate, Opuloideae (Viburnum). APWeb also recog- the ovule 1 per locule, pendulous, nizes these two clades as Adoxa clade and anatropous, unitegmic and tenuinucellar or Viburnum clade, respectively.

* * * * * * * * * * * 644 Plant Systematics Apiaceae Lindley Carrot family (=Umbelliferae A. L. de Jussieu) 440 genera, 3,590 species Mainly distributed in north temperate regions. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Cornidae Magnoliidae Asteridae Series+/Superorder Calyciflorae+ Aralianae Aralianae Aralianae Euasterids II* Order Umbellales Apiales Aralialales Araliales Araliales Apiales B & H as Umbelliferae, others as Apiaceae

Figure 13.125 Apiaceae. Coriandrum sativum. A: Upper portion of plant with compound umbels in flower and fruit; B: Part of lower leaf with broader segments; C: Inner actinomorphic flower; D: Outer zygomorphic flower; E: Vertical section of flower; F: Cremocarp with persistent stylopodium at tip. Foeniculum vulgare. G: Portion of branch with compound umbels without bracts; H: Flower; I: Vertical section of flower; J: Cremocarp with forked carpophore separating 2 mericarps. Bupleurum candollii. K: upper portion of plant with simple entire leaves (rare situation in this family) and umbels; L: Cremocarp. M: Upper portion of plant of Eryngium biebersteinianum with spiny leaves and sessile head-like umbels. Major Families of Angiosperms 645

Salient features: Aromatic herbs with called vittae inside. Seeds with small embryo, hollow internodes, leaves compound with endosperm oily. sheathing base, inflorescence umbel, petals incurved in bud, yellow or white, Economic importance: The family is the stamens 5, inflexed in bud, ovary inferior, source of food plants, spices and condiments. fruit a cremocarp with stylopodium at apex. Carrot (Daucus carota) and parsnip (Pastinaca sativa) are important root crops. Important Major genera: Eryngium (230 species), Ferula flavouring plants include fennel (Foeniculum (150), Pimpinella (150), Bupleurum (100), vulgare), coriander (Coriandrum sativum), Heracleum (60), Sanicula (40), and caraway (Carum carvi), anise (Pimpinella Chaerophyllum (40). anisum) and celery (Apium graveolens). Cicuta, Conium (hemlock, which Socrates is said to Description. Herbs with hollow internodes, have used for suicide) and Oenanthe include commonly aromatic, rarely shrubs (Eryngium poisonous plants. giganteum), or even climbers (Pseudocarpum), sometimes forming huge cushions (Azorella). Phylogeny: Apiaceae and Araliaceae have Stems often fistular, with secretary canals been considered as closely related families containing ethereal oils and resins, for a long time, often included in the same coumarins, and terpenes, plants character- order (Bentham and Hooker, Engler and istically containing umbelliferose, a trisac- Prantl), a trend continued by almost all re- charide storage product. Leaves alternate, cent authors, though Hutchinson (1926, 1973) rarely opposite (Apiastrum), lobed or com- had separated the two under distinct orders, pound, rarely simple (Bupleurum), petioles and even under different groups Lignosae and with sheathing base, stipules absent. Inflo- Herbaceae. This separation was arbitrary and rescence of simple or compound umbels, of- as such in most recent classifications they ten subtended by involucre of bracts (involu- are placed closer together under Araliales cre—bracts of umbel branches and (Dahlgren; Takhtajan, Thorne) or Apiales involucel— bracts of flowers; absent in (Cronquist, APG II, APweb), Monophyly of the Foeniculum), sometimes like a head family is supported by morphology, secondary (Eryngium). Flowers small, bracteate or metabolites, rbcL and matK sequences (Judd ebracteate (Foeniculum), usually pedicelled, et al., 1994; Plunkett et al., 1997). Earlier rarely sessile (Eryngium) bisexual, rarely uni- studies (Judd et al., 1999) had indicated that sexual (Echinophora), actinomorphic (rarely Apiaceae are most closely related to zygomorphic), epigynous. Calyx with 5 sepals, Pittosporaceae, but recent data (APweb; adnate to ovary, 5-lobed, lobes often very Plunkett, 2001) points to Pittosporaceae be- small. Corolla with 5 petals, free, valvate or ing sister taxon of the whole group or slightly imbricate, incurved in bud, notched Pittosporaceae may be embedded in Apiaceae at tip. Androecium with 5 stamens, free, + Araliaceae + other taxa. The family inflexed in bud, exserted in open flower, rarely Apiaceae is usually divided into two sub- included, anthers bithecous, dehiscence lon- families: Saniculoideae (Leaves often broad, gitudinal, pollen grains usually tricolpate. Gy- with hairy or thorny leaf teeth, stylopodium noecium with 2 united carpels (syncarpous), separated from style by groove, fruit scaly or with inferior ovary, bilocular with 1 ovule in spiny, vittae often poorly developed) and each chamber, placentation axile, style sur- Apioideae ( umbels compound, stylopodium rounded at base by bilobed nectary, the basal lacking groove, carpophore free, bifid, portion of style along with nectary persisting mericarps attached at apex). Recent molecu- in fruit as stylopodium. Fruit schizocarpic lar studies (Downie et al., 2000a, 2000b) have known as cremocarp splitting at maturity into indicated that traditional division into tribes two mericarps attached by a common stalk and genera may undergo substantial rear- carpophore, mericarp containing oil canals rangement. The genera formerly included in 646 Plant Systematics

Hydrocotyloideae (including genera were recognized, they would be poorly char- Hydrocotyle, Centella, etc. ) form a polyphyletic acterized morphologically, and certain gen- group and as such have been segregated era would have no well-supported familial to Araliaceae (Hydrocotyle) and Mackinlaya- placement. They accordingly merge Aralia- ceae (Centella, Trachymene, etc.) by Downie ceae and Mackinlayaceae with Apiaceae, rec- et al., (2000) and Chandler & Plunkett (2003; ognizing three subfamilies Aralioideae, 2004, quoted in APweb). Stevens (APweb, Apioideae and Saniculoideae. Thorne (2003) 2003) points out that sampling must improve and APG II (2003) treat all the three families to resolve affinities especially with regard to as independent. APweb (2003 onwards) rec- Hydrocotyle and Trachymene. Thorne (2003), ognizes Araliaceae as an independent fam- has shifted Centella and 5 other genera to ily, but relegates Mackinlayaceae to subfamily Mackinlayaceae but placed Hydrocotyle and Mackinlayoideae, recognizing additional sub- Trachymene in Araliaceae, recognizing only family Azorelloideae (some former members two subfamilies—Apioideae and Saniculoi- of Hydrocotyloideae), thus recognizing a total deae— under Apiaceae. Judd et al., (1999, of 4 subfamilies (other two being Apioideae 2002) argued that if Apiaceae and Araliaceae, and Saniculoideae), treatment followed by in close to their traditional circumscriptions, Thorne (2006, 2007).

* * * * * * * * * * *

Araliaceae A. L. de Jussieu Aralia family 54 genera, 1325 species Widely distributed with most species in tropics and subtropics.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Polypetalae Rosidae Cornidae Magnoliidae Asteridae Series+/Superorder Calyciflorae+ Aralianae Aralianae Aralianae Euasterids II* Order Umbellales Apiales Aralialales Araliales Araliales Apiales

Salient features: Leaves often large, alter- (50), Trachymene (45), Eleutherococcus (38), nate, compound, leaving large scars on fall- and Hedera (15). ing, flowers small, actinomorphic, pentamerous, usually in umbels, ovary inferior, Description. Herbs, shrubs, trees or lianas each locule with single ovule, fruit a berry. with prickly or stellate hairs, sometimes palm-like, a few root-climbers (Hedera). Major genera: Schefflera (650 species), Leaves alternate, rarely opposite or whorled, Polyscias (150), Hydrocotyle (130), Oreopanax large, lobed or more commonly pinnately or (85), Dendropanax (70), Aralia (65), Osmoxylon palmately compound, rarely simple, petioles Major Families of Angiosperms 647

Figure 13.126 Araliaceae. Eleutherococcus cissifolius. A: Portion of plant with inflorescence B: Flower; C: Fruit. Hedera nepalensis D: Branch with inflorescence; E: Flower; F: Transverse section of ovary; G: Fruit. (A-C, after Polunin and Stainton, Fl. Himal., 1984) often with sheathing base usually formed by rim. Corolla with 5 petals, rarely 3-10, free, membranous stipules, leaving large scar on broader at base, arising from disc, valvate, stem after falling. Inflorescence usually caducous, falling separately or as calyptra- umbellate, rarely corymbose, racemose or like cap. Androecium with 5 stamens, rarely panicled, spikes or heads. Flowers small, 3-10, as many as petals and alternating usually pedicelled, greenish or whitish, bi- them, free, anthers bithecous, dorsifixed, sexual, rarely unisexual and dioecious, dehiscence longitudinal. Gynoecium with epigynous, rarely hypogynous, bracts very usually 5 united carpels, sometimes 2-15, small. Calyx with 5 sepals, adnate to ovary, rarely 1, ovary inferior, locules as many as lobes reduced to small teeth or seam-like carpels, ovule one in each locule, on apical- 648 Plant Systematics axile placentas, anatropous, raphe ventral, The genera formerly included in Hydrocotyloi- styles as many as carpels, free and recurved deae of Apiaceae (including genera Hydro- or connate into a column or cone (stylopo- cotyle, Centella, etc. ) form a polyphyletic group dium), rarely absent and stigmas sessile. and as such have been segregated to Fruit a berry or drupe, rarely schizocarpic Araliaceae (Hydrocotyle) and Mackinlaya- and splitting into pyrenes or mericarps; seed ceae (Centella, Trachymene, etc.) by Downie with small embryo at one end, endosperm et al., (2000) and Chandler and Plunkett copious, sometimes ruminate. (2003; 2004). Stevens (APweb, 2003) points out that sampling must improve to resolve Economic importance: The family is known affinities especially with regard to Hydrocotyle for its ornamental foliage plants such as and Trachymene. Thorne (2003, 2006), has Schefflera, Fatsia japonica, Eleutherococcus, shifted Centella and 5 other genera to Aralia and Hedera. Many cultivars of Hedera Mackinlayaceae but placed Hydrocotyle and helix (Ivy) are used as house plants. Roots of Trachymene in Araliaceae. Judd et al., (1999, Ginseng plant (Panax ginseng) from China 2002) argued that if Apiaceae and Aralia- and Korea yield drug Ginseng used medici- ceae, in close to their traditional circumscrip- nally as stimulant and aphrodisiac. Ameri- tions, were recognized, they would be poorly can Ginseng (P. quinquefolia) is also being characterized morphologically, and certain used as substitute for true ginseng. Aralia genera would have no well-supported cordata and A. racemosa are also used me- familial placement. They accordingly merge dicinally. Araliaceae and Mackinlayaceae with Apiaceae, recognizing three subfamilies Phylogeny: Apiaceae and Araliaceae have Aralioideae, Apioideae and Saniculoideae. been considered as closely related families Thorne (2003) and APG II (2003) treated all for a long time, often included in the same the three families as independent, but Thorne order (Bentham and Hooker, Engler and subsequently (2006, 2007) merged Sani- Prantl), a trend continued by almost all re- culoideae and Mackinlayaceae with Apiaceae cent authors, though Hutchinson (1926, and divided Araliaceae into two subfamilies 1973) had separated the two under distinct Aralioideae and Hydrocotyloi-deae. APweb orders, and even under different groups (2003, 2008) follows the same treatment. Lignosae and Herbaceae. This separation Basal Araliaceae may well be bicarpellate and was arbitrary and as such in most recent clas- have simple leaves. Both these are features sifications they are placed closer together of the herbaceous Hydrocotyloideae, sister to under Araliales (Dahlgren; Takhtajan, the rest of the family (Chandler & Plunkett Thorne) or Apiales (Cronquist, APG II, APweb). 2004; Plunkett et al. 2004a).

* * * * * * * * * * * Major Families of Angiosperms 649 Asteraceae Martinov Sunflower or Aster family (= Compositae Giseke)

1,532 genera, 23,790 species (largest family of flowering plants) Worldwide in distribution mainly in temperate and subtropical climates, mainly in mountain regions, also common in tropics. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Asteridae Magnoliidae Asteridae Series+/Superorder Inferae+ Asteranae Asteranae Asteranae Euasterids II* Order Asterales Asterales Asterales Asterales Asterales Asterales B & H as Compositae; others as Asteraceae

Salient features: Usually herbs, lacking ple, sometimes compound (Dahlia, Artemisia), Iridoids, leaves usually alternate, stipules rarely opposite (Dahlia) or whorled, stipules absent, inflorescence a capitulum with ray absent. Inflorescence a capitulum with florets and disc florets (one type or both in a broad receptacle containing disc florets (dis- head), surrounded by involucre bracts coid head- Ageratum, Vernonia), ray florets (phyllaries), calyx represented by pappus, (ligulate head- Sonchus, Launaea) or both anthers united forming a cylinder around type of florets with latter towards the periph- style, style with two branches, fruit a cypsela ery (radiate head- Helianthus, Aster), all types (commonly called achene, although typical of heads having florets surrounded by involu- achene is formed from single carpel and cre bracts (phyllaries), rarely capitulum with superior ovary), ovary inferior. single floret (Echinops) with capitula arranged into globose heads. Flowers bisexual Major genera: Senecio (1470 species), Ver- (usually disc florets and ray florets of a nonia (1050), Cousinia (600), Eupatorium (590), ligulate head) or unisexual (commonly ray Centaurea (590), Hieracium (470), Helichrysum florets in a ligulate head, which may even (460), Saussurea (300), Cirsium (270), Aster be sterile), actinomorphic (usually disc flo- (240), Bidens (210), Chrysanthemum (200), rets) or zygomorphic (usually ray florets), Crepis (200), Inula (200), Gnaphalium (140), epigynous. Calyx absent or represented by Solidago (110), Helianthus (100), Carduus (90), pappus in the form of scales (Helianthus), Lactuca (90), Taraxacum (80), Tragopogon (70), bristles (Bidens), simple hairs (Sonchus) or Sonchus (50) and Calendula (30). plumose (Carduus). Corolla with 5 petals, united, tubular and 5-lobed (disc floret) or Description: Usually herbs or shrubs, rarely ligulate with 3-5 teeth (ray floret: sometimes trees (Vernonia arborea; Leucomeris) or lianas also bilabiate). Androecium with 5 stamens (Vernonia scandens), sometimes producing with free filaments and united anthers tubers (Dahlia, Helianthus tuberosus), usually (syngenesious) forming a tube around the storing inulin, laticifers usually present, style, epipetalous, anthers bithecous, dehis- rarely lacking, terpenoids usually present, cence longitudinal. Gynoecium with 2 usually sesqueterpene lactones, Iridoids united carpels, unilocular a single ovule, absent. Leaves usually alternate and sim- placentation basal, ovary inferior, style with 650 Plant Systematics

Figure 13.127 Asteraceae. Helianthus annuus. A: Portion of plant with inflorescences, the capitulum with both ray florets and disc florets (radiate head); B: Vertical section of ray floret lacking androecium; C: Vertical section of disc floret. Ageratum houstonianum. D: Portion of plant with capitula in clusters, each with only disc florets (discoid head); E: Vertical section of disc floret; F: Achene with pappus consisting of 5 scales. G: Plant of Sonchus oleraceous with auricled leaves and capitula with only ray florets (ligulate head). H: Plant of Launaea nudicaulis with ligulate heads. Carthamus lanatus. I: Portion of plant with spinose leaves and discoid heads; J: Capitulum with spiny involucre bracts. Bidens chinensis. K: Lower part of plant with pinnate leaves; L: Upper part with one flowering and one fruiting capitulum; M: Ray floret with three-toothed corolla; N: Disc floret; O: Disc floret with corolla partly removed to show androecium; P: Achene. Major Families of Angiosperms 651 two branches. Fruit a cypsela (often called Calyceraceae, Goodeniaceae and their sis- achene which typically, however, is formed ter group Menyanthaceae form a mono- from single carpel with superior ovary) usu- phyletic group. All the four families are placed ally with pappus at tip. Seeds 1, embryo under Asterales by Thorne (1999, 2003). The straight, endosperm usually absent. relationships between the first three families are not very clear. The rbcL and ndhF Economic importance: Compared to the (Kårehed et al., 1999) and ndhF data number of species included, the family is of (Olmstead et al., 2000) support Asteraceae lesser economic importance. Common and Calyceraceae as sister families whereas valuable ornamentals include species of rbcL together with atpB and 18S rDNA (Soltis Aster, Dahlia, Chrysanthemum, Gerbera, et al., 2000) support Goodeniaceae and Helichrysum, Tagetus and Zinnia. A few food Calyceraceae as sister taxa. A combination plants include Lactuca (lettuce), Cynara of morphological data, and rbcL, ndhF and (artichoke), Helianthus (sunflower oil), and atpB sequences provided a strong support for Cichorium (chicory, added to coffee). Safflower Calyceraceae and Asteraceae as sister a red dye is obtained from Carthamus groups (Lundberg and Bremer, 2002). Simi- tinctorius. Latter is now more commonly lar conclusion was also reached by the analy- cultivated for its seeds yielding safflower oil, sis of six DNA regions (Bremer et al., 2002). used in cooking. Chrysanthemum cinerarie- The family Asteraceae is usually divided folium is the source of natural insecticide into three subfamilies: Barnadesioideae pyrethrum. (style papillate, stigma lobed; cypsela with spines; lacks chloroplast DNA inversion Phylogeny: Interestingly Asteraceae in found in other two subfamilies), Cichorioi- spite of huge size form a well-defined clade, deae (Latex present, style branches long with easily recognizable and evidently mono- inner surface stigmatic, acute; those with phyletic. The family is often considered re- ray florets often separated into a distinct sub- lated to Rubiaceae, Caprifoliaceae, family Lactucoideae) and Asteroideae (latex Dipsacaceae, Valerianaceae, Campanul- absent, both disc and ray florets). Thorne aceae and a few others. The first four are (2006, 2007) recognizes Carduoideae includ- basically cymose and also differ in biochemi- ing Cichorioideae and Lactucoideae. He sub- cal features. Stylidiaceae, Goode-niaceae divides these three subfamilies further to and Brunoniaceae resemble the Asteraceae include a total of 25 tribes in Asteraceae. in being mostly racemose and in possess- Heywood had earlier (1978) recognized ing inulin, but differ in biochemical features 17 tribes under two subfamilies Lactu- of taxonomic significance. Recent molecu- coideae and Asteroideae. APweb (2003) lar studies (Bremer et al., 2002; Lundberg recognizes 11 subfamilies including one and Bremer, 2002) indicate that Asteraceae, undefined ‘The Stifftia group’.

* * * * * * * * * * * 652 Plant Systematics

3. Tetrachondraceae (B) Subclass 11. Lamiidae 4. Plocospermataceae (B) Superorder 1. Solananae 5. Gratiolaceae (B) 6. Calceolariaceae (B) Order 1. Garryales (B) 7. Gesneriaceae Family 1. Garryaceae 8. Plantaginaceae (B) 2. Eucommiaceae 9. Pedaliaceae 3. Aucubaceae 10. Linderniaceae 4. Oncothecaceae (B) 11. Byblidaceae 5. Icacinaceae (B) 12. Lamiaceae (B) 2. Solanales 13. Paulowniaceae (B) Suborder 1. Solanineae 14. Orobanchaceae (B) 1. Solanaceae 15. Phrymaceae 2. Convolvulaceae 16. Nesogenaceae (B) 3. Hydroleaceae (B) 17. Schlegeliaceae (B) 4. Sphenocleaceae 18. Verbenaceae (B) 5. Montiniaceae (B) 19. Martyniaceae 2. Boraginineae 20. Petraeaceae (B) 1. Boraginaceae 21. Trapellaceae (B) 2. Hydrophyllaceae 22. Bignoniaceae 3. Lennoaceae 23. Lentibulariaceae 4. Hoplestigmataceae (B) 24. Acanthaceae Superorder 2. Lamianae 25. Stilbaceae Order 1. Rubiales 26. Scrophulariaceae l. Gentianaceae 2. Loganiaceae Taxa Incertae Sedis 3. Gelsemiaceae Haptanthus Goldberg & Nelson (1). Hondu- 4. Rubiaceae ras. 5. Apocynaceae Heteranthia Nesse & C.Mart. (1) Brazil. 2. Lamiales *Pottingeria Prain (1) Pteleocarpa Oliver (1) W. Malesia. 1. Oleaceae 2. Carlemanniaceae (B) * Under Hydrangeales-> Pottingeriaceae by Takhtajan

Solanaceae A. L. de Jussieu Nightshade or Potato family 98 genera, 2,715 species Cosmopolitan in distribution, found both in temperate and tropical climates with largest concentration in Central and South America. Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnolipsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Solananae Solananae Solananae Euasterids I* Order Polemoniales Solanales Solanales Solanales Solanales Solanales Major Families of Angiosperms 653

Figure 13.128 Solanaceae. Solanum nigrum. A: Branch with extra-axillary rhipidium infloresences and fruits; B: Vertical section of flower. Withania somnifera. C: Branch with axillary cymose clusters of flowers; D: Flower; E: Vertical section of flower with bell-shaped corolla; F: Fruit enclosed in enlarged urceolate calyx. Datura inoxia. G: Branch with axillary funnel-shaped flowers; H: Transverse section of ovary, tetralocular due to false septum; I: Capsule covered with tubercles and basal persistent portion of calyx. Physalis minima. J: Portion of plant with flowers; K: Flower; L: Vertical section of flower; M: Transverse section of ovary with swollen placentae; N: Fruit with inflated calyx removed from one side; O: Seed; P: Flowering branch of Atropa belladona.

Salient features: Leaves alternate, stipules (110), Physalis (95), Lycium (90), Capsicum absent, flowers actinomorphic, stamens 5, (50), Hyoscyamus (25) and Datura (10). carpels 2, ovary superior, 2-chambered, placenta swollen, septum oblique, ovules nu- Description: Herbs, shrubs (Brunfelsia, merous, fruit a berry or capsule. Cestrum) or small trees (Solanum verbasci- folia; Dunalia), rarely lianas, often poison- Major genera: Solanum (1350 species), ous, sometimes with prickles, underground Lycianthus (190), Cestrum (160), Nicotiana tubers in Solanum tuberosum (potato), 654 Plant Systematics vascular bundles with both outer and inner ated in vascular bundles having outer and phloem. Leaves alternate, simple, rarely inner phloem, actinomorphic flowers and ob- pinnately compound (potato), stipules absent, lique septum of the ovary. Schizanthus with paired leaves adjacent on the stem are com- zygomorphic flowers is borderline genus. The mon. Inflorescence cymose (Solanum) or of family also has close affinities with Convol- solitary flowers (Datura). Flowers bisexual, vulaceae, Boraginaceae and Gesneriaceae. actinomorphic, hypogynous. Calyx with 5 Nolanaceae with gynobasic style and lobed sepals, united, persistent, sometimes en- ovary has been merged with Solanaceae. The larged and swollen in fruit (Withania, Physa- following 7 subfamilies are recognized lis). Corolla with 5 petals, united, rotate (Olmstead et al., 1999; APweb, 2003): (Solanum) or tubular (Cestrum), rarely funnel Schwenckioideae (pericycle fibres present, shaped (Datura) or bilabiate (Schizanthus). stamens 4, didynamous, or 3 staminodes; Androecium with 5 stamens epipetalous, embryo straight, short), Schizanthoideae inserted in corolla tube, filaments free, (pericycle fibres absent, flowers zygomorphic, bithecous, anthers introrse, dehiscence lon- anterior petals connate, forming a keel, sta- gitudinal or by apical pores. Gynoecium with mens 2, staminodes 3, embryo curved), 2 carpels, rarely 3-5 (Nicandra), united, ovary Goetzeoideae (Fruit often a drupe, embryo superior, bilocular, axile placentation, pla- curved: Takhtajan as family Goetzeaceae), centa swollen, septum oblique, ovary often Cestroideae (pericyclic fibres present, sta- further divided by false septa, style 1, rarely mens 4 or 5, often didynamous), Petunioideae gynobasic (Nolana), stigma bilobed, ovary (flowers bisymmetric, embryo slightly curved), seated on a nectary. Fruit berry or capsule Solanoideae (seeds flattened, embryo curved, (Datura); seeds many, embryo straight, often coiled), and Nicotianoideae (Cork su- endosperm present. Pollination mostly by perficial pericyclic fibres present or absent, insects. Dispersal mostly by birds. stamens 4 or 5, of two lengths, embryo straight or curved). The grouping (Petunioi- Economic importance: The family includes deae (Solanoideae + Nicotianoideae)) is well a number of food plants such as tomato supported, although the relationships be- (Lycopersicon esculentum), potato (Solanum tween the more basal branches have only tuberosum), egg plant or brinjal (S. weak support, but Schwenkia is probably sis- melongena), ground cherry (Physalis peruvi- ter to the rest of the family (Olmstead et al., ana). Peppers (Capsicum annuum) are used 1999). Family Sclerophylacaceae has been both as a food source (young) and spices variously included under Solanaceae (ripe). Many poisonous species are impor- (Hutchinson, Cronquist, APG II), treated as tant drug plants such as Atropa belladona distinct family (Takhtajan, Dahlgren), or con- (atropine), Hyoscyamus niger (henbane-hyp- sidered unplaced (APweb) has been treated notic drug), Datura stramonium (stramonium) as subfamily Sclerophylacoideae of and Mandragora officinarum (mandrake). To- Solanaceae by Thorne (2003), who recognizes bacco (Nicotiana tabacum and N. rustica) con- Browallioideae, Solanoideae and Goetzeoi- tains toxic alkaloid nicotine and is grown for deae as other three subfamilies In subse- chewing, smoking and snuff. Some orna- quent revisions in 2006 and 2007, he recog- mental genera include Brunfelsia (lady-of- nises 7 subfamilies, adding Schizanthoideae, the-night; yesterday-today-and tomorrow), Petunoideae and Nicotianoideae. APweb Cestrum (‘Rat ki Rani’; night blooming jessa- (2008) likewise recognises 7 subfamilies, tak- mine), Petunia, Physalis (ground cherry) and ing out Schwenckioideae doubtfully placed in Solanum (nightshade). Browallioideae by Thorne, Sclerophylaceae still unplaced. Olmstead et al. (1999) consid- Phylogeny: The family is closely related to ered Schwenckia sister to rest of family, but Scrophulariaceae from which it is differenti- Martins and Barkman (2005) using the Major Families of Angiosperms 655 nuclear gene SAMT (salicylic acid methyl with Cestroideae. Furthermore, Wu et al. transferase), found Schizanthus to be sister (2006) found a strongly supported grouping of to the rest of the family, and with rather [Solanoideae [Petunioideae + Nicotianoi- strong support, with Schwenkia weakly linked deae].

* * * * * * * * * * *

Convolvulaceae A. L. de Jussieu Morning glory family 59 genera, 1,830 species Widely distributed, mostly in tropical and subtropical regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Solananae Solananae Solananae Euasterids I* Order Polemoniales Solanales Convolvulales Solanales Solanales Solanales

Salient features: Usually twining or climb- base, persistent. Corolla with 5 petals, ing herbs, commonly with latex, leaves united, funnel-shaped, usually plicate. alternate, venation palmate, stipules absent, Androecium with 5 stamens, epipetalous, flowers actinomorphic, corolla funnel-shaped, inserted in corolla tube, often unequal, stamens 5, carpels 2, ovary superior, 2-cham- filaments free, bithecous, anthers introrse, bered, , ovules 1 or 2, fruit a capsule. dehiscence longitudinal or by apical pores, pollen grains tricolpate or multiporate. Major genera: Ipomoea (550 species), Con- Gynoecium with 2 united carpels, ovary volvulus (240), Cuscuta (140), Jacquemontia superior, entire or deeply bilobed, bilocular, (110), Evolvulus (95) and Calystegia (25). axile placentation, style 1, terminal or gynobasic, stigma bilobed, capitate or linear, Description: Twining or climbing herbs, of- ovary seated on a nectary. Fruit a capsule; ten rhizomatous, latex usually present, seeds 1 or 2 in each chamber, embryo sometimes parasitic (Cuscuta), rarely tree straight or curved, cotyledons folded. (Humbertia), vascular bundles with both outer Pollination mostly by insects. and inner phloem, sometimes with alkaloids, branching usually sympodial. Leaves Economic importance: Ipomoea batatas alternate, simple, rarely lobed or compound, (sweet potato) is important for its edible sometimes absent (Cuscuta), venation pal- roots. Important ornamentals include mate, reticulate, stipules absent. Inflores- Ipomoea (morning glory), Porana (Christmas cence cymose or with solitary flowers. Flow- vine) and Dichondra (ponyfoot). Roots of ers bisexual, actinomorphic, rarely Convolvulus scammonia (scammony) and of zygomorphic (Humbertia), hypogynous. Calyx Ipomoea purga (jalap) yield a drug used with 5 sepals, free or slightly connate at medicinally as cathartic. 656 Plant Systematics

Figure 13.129 Convolvulaceae. Convolvulus arvensis. A: Branch with flowers and fruits; B: Flower from above. Ipomoea arachnosperma. C: Branch with flowers; D: Flower. Rivea hypocrateriformis. E: Portion of plant with leaves; F: Flower; G: Fruit with persistent calyx. H: Flower of Seddera latifolia.

Phylogeny: The family is closely related to Convolvuloideae, but restored in 2006 and Solanaceae, Boraginaceae and Polemonia- 2007 revisions. APweb recognizes only two ceae. Cuscutaceae and Dichondraceae, some- Humbertioideae and Convolvuloideae (includ- times recognized as distinct families, are ing both Cuscutoideae and Dichondroideae). better placed in Convolvulaceae, their sepa- On the basis of DNA sequences of multiple ration leading to paraphyly of Convolvulaceae. chloroplast loci, Stefanovic et al., (2002) con- Monophyly of the family is supported by mor- cluded that Poranae (including Porana, itself phological characters. Thorne (1999, 2000) polyphyletic) and Erycibeae successively form recognized 4 subfamilies: Humbertioideae basal clades in Convolvuloideae. The basal (Humbertia; tree), Dichondroideae (2 genera Poraneae have foliaceous bracts and fruits Dichondra, Falkia), Convolvuloideae and that are utriculate. Erycibe (Erycibeae) has Cuscutoideae (Cuscuta; without leaves), subsessile stigmas. sequently (2003) merging Dichondroideae in

* * * * * * * * * * * Major Families of Angiosperms 657 Boraginaceae A. L. de Jussieu Borage family 117 genera, 2,435 species Widely distributed in temperate, tropical and subtropical regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Solananae Solananae Solananae Euasterids I* Order Polemoniales Lamiales Boraginales Boraginales Solanales Unplaced in Euasterids I

Salient features: Bristly herbs, stems cy- truncate, ovary seated on a nectary. Fruit a lindrical, leaves alternate, inflorescence drupe with one 4-seeded, two 2-seeded or four helicoid cymes, flowers pentamerous, 1-seeded pits or schizocarp with four 1- actinomorphic, carpels 2, ovary 4-lobed, style seeded nutlets; seeds with embryo straight gynobasic, fruit with 4 nutlets. or curved. Pollination mostly by insects. Drupaceous fruits are dispersed by birds, Major genera: Cordia (300 species), whereas corky ones (Argusia, Cordia) are Heliotropium (250) Tournefortia (240), Onosma carried away by water. (140), Myosotis (90), Cynoglossum (75) and Ehretia (75). Economic importance: Several species of Heliotropium (heliotrope), Mertensia (virgin Description: Herbs, shrubs or trees (Cordia), bluebells), Myosotis (forget-me-not), Cordia sometimes lianas, inner phloem lacking, (Geiger tree), Cynoglossum (hound’s tongue) hairs with basal cystolith and often calcified and Pulmonaria (lungwort) are grown as or silicified and as such plants bristly, rough ornamentals. Several species such as Borago to touch. Leaves alternate, simple, entire, officinalis (borage), Symphytum officinalis venation pinnate, reticulate, stipules ab- (comphrey) and Lithospermum spp. (pucoon) sent. Inflorescence usually of helicoid have been used as medicinal herbs. Alkanna cymes, rarely scorpioid. Flowers bisexual, tinctoria (alkanet) is a source of red dye used actinomorphic, rarely zygomorphic (Echium), to stain wood and marble and to colour medi- hypogynous, pentamerous. Calyx with 5 se- cines, wines and cosmetics. pals, free or slightly connate at base, persistent. Corolla with 5 petals, united, rotate, Phylogeny: The family is closely related to tubular or funnel shaped, usually plicate. Solanaceae, Convolvulaceae and Polemonia- Androecium with 5 stamens, epipetalous, ceae with which it shares alternate leaves inserted in corolla tube, filaments free, and actinomorphic flowers and mostly in- bithecous, anthers introrse, dehiscence lon- cluded under Boraginales next to Solanales gitudinal, pollen grains tricolporate or (Dahlgren) or Solanales, Convolvulales and multiporate, filaments often with nectar Polemoniales (Takhtajan), or under discs at base. Gynoecium with 2 united car- Solanales (Thorne). The family also shows pels, ovary superior, deeply 4-lobed, bilocu- close affinities with Lamiaceae and lar, axile placentation, becoming 4-locular Verbenaceae in having gynobasic style, due to false septa, style 1, terminal or 4 lobed ovary becoming 4-locular by false gynobasic, stigma 1 or bilobed, capitate or septum and usually schizocarpic fruit. 658 Plant Systematics

Figure 13.130 Boraginaceae. Cynoglossum glochidiatum. A: Plant with terminal inflorescences; B: Flower. Heliotropium eichwaldii. C: Portion of plant with terminal helicoid cymes; D: Flower with bristly calyx; E: Vertical section of flower; F: Fruit with persistent calyx; G: Fruit. Trichodesma indicum. H: Portion of plant in flower; I: Flower with corolla cut away to show androecium; J: Transverse section of ovary, 4-locular due to false septum; K: Fruit with two of the sepals removed; L: Seed.

Cronquist accordingly places Boraginaceae ceae (Lundberg, 2001). Relationships be- under Lamiales closer to Lamiaceae and tween Gentianales, Lamiales and Solanales Verbenaceae. Although a number of mutigene are also unclear (Albach et al., 2001). APweb analyses have been carried out the results recognizes 6 groups within Boraginaceae: are not conclusive and as such the family four subfamilies Boraginoideae, Heliotropioi- Boraginaceae is still unplaced under deae, Cordioideae and Ehretioideae and two Asterids I in APG II and APweb. The position family groups Hydrophyllaceae and of both Vahliaceae and Boraginaceae in Lennoaceae. Thorne (2003, 2006, 2007) Euasterids I is uncertain. Vahlia is placed treats last two as independent families and sister to Lamiales, but with only 63 per cent recognizes 5 subfamilies under Boragina- bootstrap support (Albach et al., 2001), or is ceae, adding Wellstedioideae as fifth associated more specifically with Boragina- subfamily.

* * * * * * * * * * * Major Families of Angiosperms 659 Rubiaceae A. L. de Jussieu Madder family

650 genera, 13,000 species Worldwide in distribution, but mainly distributed in the tropics and subtropics, especially the woody members.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Inferae+ Gentiananae Loasanae Lamianae Euasterids I* Order Rubiales Rubiales Rubiales Gentianales Rubiales Gentianales

Salient features: Mainly shrubs and trees, brightly coloured (Mussaenda). Corolla with leaves opposite or whorled, often turning 4-5 petals, (rarely 8-10), united, tubular, ro- blackish when dry, stipules interpetiolar, tate or funnel-shaped, valvate, imbricate or colleters present in leaf axils, inflorescence twisted. Androecium with 4-5 stamens, free, cymose, flowers pentamerous, stamens 5, epipetalous, anthers bithecous, dehiscence ovary inferior. longitudinal, introrse, pollen grains usually tricolporate. Gynoecium with 2 (rarely Major genera: Psychotria (1450 species), 1-many) united carpels, ovary inferior, rarely Galium (410), Ixora (370), Pavetta (360), superior (Pugama) or semi-inferior Hedyotis (360), Tarenia (350), Randia (240), (Synaptantha), bilocular (rarely 1-many Gardenia (240) and Mussaenda (190). locules) with 1-many ovules in each chamber, placentation axile (rarely apical or Description: Trees (Adina, Neolamarckia) or basal), nectar disc usually present above the shrubs (Ixora, Gardenia), rarely herbs ovary, style slender, stigma capitate or lobed. (Galium), sometimes climbing (Rubia) with Fruit a berry, capsule, drupe or schizocarp; hooked hairs, rarely epiphytic (Myrmecodia) seeds 1-many, with small embryo, curved or with large swellings on roots inhabiting ants, straight, endosperm present or absent. usually with Iridoids, raphide crystals common. Leaves opposite, with interpetiolar Economic importance: The family is eco- stipules which often become as large a nomically important for being the source of leaves and thus forming whorled arrange- coffee, quinine and a large number of ment of leaves, simple, entire, often turn- ornamentals. Coffee is obtained from ing blackish when dry, with colleters in leaf roasted seeds of Coffea arabica and C. axils. Inflorescence cymose, sometimes canephora. Quinine, a remedy for malaria is capitate (Adina), or solitary (Gardenia). Flow- derived from several species of Cinchona. ers bisexual, actinomorphic, rarely Madder (Rubia tinctoria) was formerly culti- zygomorphic (Posoqueria) epigynous, some- vated for its red dye alizarin. Important times dimorphic (Randia). Calyx with 4-5 ornamentals include Gardenia, Ixora, sepals, adnate to ovary, 5-lobed, lobes often Hamelia, Neolamarckia (cadamb tree) and very small, one sometimes enlarged and Mussaenda. 660 Plant Systematics

Figure 13.131 Rubiaceae. Rubia manjith. A: Portion of plant with axillary inflorescences; B: Flower. Randia spinosa. C: Twig showing spines and flowers; D: Flower with corolla removed and calyx opened to show gynoecium; E: Corolla opened to show epipetalous stamens; F: Transverse section of ovary; G: Fruit. Coffea arabica. H: Portion of twig with fruits; I: Flower. Mitragyna parvifolia. J: Twig with globose inflorescences. K: Flower with mitraeform (head-gear) stigma; L: Corolla opened to show androecium; M: Flower with corolla removed to show style and stigma.

Phylogeny: Rubiaceae form a well-defined leaves and 2 carpels. The separation exclu- group which is clearly monophyletic as sup- sively on the basis of ovary being inferior or ported by morphology (Bremer and Struwe, superior, is slowly being abandoned as has 1992) and rbcL sequences (Bremer et al., also been done in the case of certain 1995). Affinities of the family lie with monocots such as Alliaceae, Agavaceae and Gentianales (Dahlgren, APG II, APweb; Amaryllidaceae. The family is commonly di- Thorne places under Rubiales also contain- vided into three subfamilies (Thorne, ing Gentianaceae and related families; APweb): Cinchonoideae (mainly woody, Takhtajan under Rubiales next to Gentia- raphides absent, seeds with endosperm, nales under Lamiidae—>Gentiananae) or heterostyly absent), Ixoroideae (woody, Dipsacales (Cronquist—next to Dipsacales raphides absent, pollination plunger-mecha- towards the end of Asteridae, Gentianales nism as in Asteraceae), Rubioideae (mainly towards the beginning), both having opposite herbaceous, raphides present in leaves, Major Families of Angiosperms 661 seeds with endosperm, heterostyly common). 2007). Recent molecular studies based on Molecular data (Fay et al., 2000a) provide trnL-F and cpDNA data (Rova et al., 2002) and support for including Dialy-petalanthus (for- broadly based molecular data involving merly placed under Dialy-petalanthaceae- several taxa (Bremer et. al., 1999) suggest Thorne, 1999) in Rubiaceae, under sub- that Cinchonoideae and Ixoroideae are family Ixoroideae (Thorne, 2003, 2006, sister taxa.

* * * * * * * * * * *

Apocynaceae A. L. de Jussieu Dogbane family 480 genera, 4,800 species (including Asclepiadaceae Borkh.) Mostly tropical and subtropical with a few species in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Gentiananae Loasanae Lamianae Euasterids I* Order Gentianales Gentianales Apocynales Gentianales Rubiales Gentianales

Salient features: Herbs shrubs or climbers, latex usually milky, Iridoids often present. latex milky, leaves opposite or whorled, throat Leaves simple, reduced or absent in some of corolla tube with scales, pollinia absent, succulent species, opposite (Calotropis, ovary superior, fruit a follicle, seed with a tuft Catharanthus) or whorled (Nerium), simple, of hairs (Asclepiadoideae, formerly entire, venation pinnate, reticulate, stipules Asclepiadaceae separated by pollinia, anthers absent, colleters often present at the base of adnate to stigmatic disc, stigmas united into petiole. Inflorescence dichasial or gynostegium). monochasial cyme, racemose or umbellate (Calotropis), sometimes solitary (Vinca), or ax- Major genera: Asclepias (220 species), illary cymose pairs (Catharanthus). Flowers Tabernaemontana (220), Cynanchum (200), bisexual, actinomorphic, hypogynous, Ceropegia (140), Hoya (140), Rauvolfia (105), pentamerous, often coronate. Calyx with Ervatamia (80), Allamanda (15) and 5 sepals, distinct or basally connate, imbri- Catharanthus (5). cate or valvate, often with glands (colleters) at base. Corolla with 5 united petals, the tube Description: Perennial herbs (Catharanthus), often short campanulate (Calotropis), salver- vines (Cryptostegia, Daemia), shrubs shaped (Catharanthus) or funnel-shaped (Calotropis, Nerium), rarely trees (Alstonia), (Thevetia) and with contorted or valvate lobes. often fleshy (Hoya) or cactus-like (Stapelia), Corona of usually 5 scales or appendages 662 Plant Systematics

Figure 13.132 Apocynaceae. Catharanthus roseus. A: Portion of plant with flowers and fruits; B: Flower bud showing twisted corolla with a long tube; C: Vertical section of flower from corolla throat showing free epipetalous stamens and calyptrate stigma; D: Anther with dorsal fixation; E: Transverse section of flower passing through ovary showing sepals, corolla tube 2 lateral nectaries and 2 free ovaries; F: Pair of follicles; G: Seed. Nerium indicum. H: Branch with whorled leaves and terminal inflorescence; I: Corolla opened to show corona of scales and anthers with tailed appendages forming single twisted hairy appendage; J: Pair of follicles. Thevetia nerifolia. K: Branch with subopposite and alternate leaves and large funnel-shaped flowers; L: Drupe fruit. Rauvolfia serpentina. M: Portion of plant with inflorescences in flower and fruit; N: Flower buds with twisted corolla; O: Seed. arising from corolla throat (corolline corona: nated within the anther sacs to form waxy Nerium, Cryptostegia), or from stamens pollinia (corpusculum or gland joining to- (staminal corona: Calotropis, Asclepias), coro- gether two pollinia one each from adjacent nal appendages nectariferous. Androecium anthers with the help of caudicles to form with 5 stamens, filaments free (Apocynaceae translator, an adaptation for insect pollina- sensu str.) or connate (Asclepiadoideae except tion); pollen grain tricolporate or biporate or Cry-ptostegia) anthers free with separate pol- triporate. Gynoecium bicarpellary of two len grains (Apocynaceae sensu str.). In apically united carpels, unilocular ovaries, Asclepiadoideae anthers adherent to the marginal placentation, ovules 2 or more, stigmatic area forming a 5 angled disc unitegmic, styles 2, stigma 1, calyptrate gynostegium (gynandrium), pollen aggluti- (Catharanthus), dumb-bell shaped (Nerium), or Major Families of Angiosperms 663

Figure 13.133 Apocynaceae, Subfamily Asclepiadoideae. Cryptostegia grandiflora. A: Branch with terminal inflorescence; B: Vertical section of flower with corolloin corona and gynostegium. Calotropis procera. C: Portion of plant with umbellate inflorescences on axillary peduncles; D: Flower with purple-tipped corolla; E: Vertical section of flower with staminal corona and broad gynostegium and free ovaries; F: Translator with 2 pollinia joined by caudicles to common corpusculum; G: Pair of follicles. Pergularia daemia. H: Portion of plant with inflorescence; I: Flower; J: Flower with calyx removed and corolla lobes cut to show corona and staminal tube; K: Stamen and corona in side view; L: Pair of follicles covered with bristles.

5 lobed and fused with anthers to form (carrion flower), Plumeria (frangipani) and gynostegium (Calotropis), carpels sometimes Tabernaemontana are grown as ornamentals. united by ovaries with axile placentation Nerium and Thevetia are poisonous (can be (Thevetia, Allamanda, Carissa). Fruit etaerio fatal). Roots of Rauvolfia serpentina yield re- of 2 follicles (Nerium, Calotropis), sometimes serpine used as tranquillizer for patients suf- drupe (Thevetia), capsule or berry; seeds usu- fering from schizophrenia and hypertension. ally numerous, flattened and comose with Catharanthus provides antileukaemic drugs. long silky hairs. Pollination by insects, helped Latex from Plumeria used for healing tooth- by special translators in Asclepiadoideae. ache. Low quality down is obtained from seeds Dispersal mostly by wind, aided by hairs. of several species. Pitcher like leaves and roots of Dischidia chewed with betel. Economic importance: Nerium (oleander), Rubbervine (Cryptostegia) is also as caout- Catharanthus (Madagascar periwinkle), Ascle- chouc or rubber source. Tubers of Ceropegia pias (milkweed), Hoya (wax plant), Stapelia are edible. Stem fibre of Calotropis and 664 Plant Systematics

Leptadaenia is used for cordage. Asclepias is 5 subfamilies (Thorne, 2000, 2006, 2007): a livestock poison. Rauvolfioideae (Plumerioideae), Apocynoi- deae, Periplocoideae, Secamonoideae and Phylogeny: For a long time Apocynaceae was Asclepiadoideae. The generic limits are not considered to be closely related but distinct clearly resolved. According to Sennblad and from Asclepiadaceae, latter with pollinia, Bremer (2002), both Rauvolfioideae and gynostegium and usually staminal corona Apocynoideae may be quite wildly para- (Bentham and Hooker, Engler and Prantl, phyletic. The position of the Periplocoideae Hutchinson, Cronquist, Dahlgren). The as sister to Secamonoideae + Asclepiadoideae family Asclepiadaceae was merged with is also uncertain (Potgeiter & Albert, 2001; Apocynaceae by Thorne (1983) and practice Sennblad & Bremer, 2002). was followed by Takhtajan (1987, 1997), Judd The family is usually placed in Gentianales, et al., (2002), APG II and APweb. The separa- but Thorne has merged this order with tion of Asclepiadaceae as distinct family broadly circumscribed Rubiales. Dahlgren would lead to paraphyletic Apocynaceae (Judd and APG II classification prefer the name et al., 1994; Endress et al., 1996). The family Gentianales for the broadly circumscribed Apocynaceae is appropriately divided into order.

* * * * * * * * * * *

Plantaginaceae A. L. de Jussieu Snapdragon family 110 genera 2,000 species Widely distributed from temperate to tropical regions, more diverse in temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Personales Scrophulariales Scrophulariales Lamiales Lamiales Lamiales B & H, Cronquist, Takhtajan and Dahlgren under Scrophulariaceae

Salient features: Leaves alternate or oppo- (130), Linaria (110), Antirrhinum (40), site, stipules absent, flowers zygomorphic, Limnophila (32), Globularia (25), Gratiola (20), stamens 4 or 2, anther opening by 2 distinct Scoparia (20) and Digitalis (20). slits, anthers more or less sagittate at base, carpels 2, ovary superior, 2-chambered, Description: Herbs or small shrubs, rarely many, fruit a capsule. climbers (Antirrhinum cirrhosum), often with phenolic glycosides and triterpenoid Major genera: Veronica (350 species), saponins, and sometimes with cardiac Penstemon (250), Plantago (210), Mimulus glycosides, hairs usually simple, when Major Families of Angiosperms 665

Figure 13.134 Plantaginaceae. Veronica persica. A: Portion of plant with axillary flowers; B: Flower with 4 sepals and petals each and 2 stamens; C: Gynoecium; D: Fruit with persistent calyx and style; E: Seed. Digitalis purpurea. F: Branch with inflorescence; G: Vertical section of flower; H: Transverse section of ovary with axile placentation; I: Young anther; J: Anther dehisced through 2 slits. glandular with short discoid head lacking anther bilocular, locules distinct, opening vertical partitions. Leaves alternate or by two longitudinal slits, pollen sacs diver- opposite, rarely whorled (Russelia), simple, gent (anther sagittate), pollen grains entire or dentate, venation pinnate, reticu- tricolporate. Gynoecium with 2 united late, stipules absent. Inflorescence race- carpels, rarely only 1 carpel developed mose: racemes or spikes. Flowers bisexual, (Globularia), ovary superior, bilocular, ovules zygomorphic, hypogynous. Calyx with several in each chamber, rarely 1 or 5 sepals, rarely 4 (Veronica), connate, per- 2 (Globularia) unitegmic, axile placentation, sistent. Corolla with 5 petals, rarely 4 (due style 1, stigma bilobed, ovary seated on a to fusion of 2 petals as in Veronica), united, nectary. Fruit a septicidal capsule; seed usually bilabiate, sometimes with nectar sac angular or winged, with curved or straight or spur, lower lip sometimes with a bulge embryo, endosperm present. Pollination by obscuring the throat (personate), lobes insects. Seeds or nutlets dispersed by wind. imbricate or valvate. Androecium with usually 4 stamens, didynamous, fifth Economic importance: The family contrib- stamen sometimes present as a staminode utes a number of ornamentals such as (Penstemon), rarely 2 (Veronica), epipetalous, Digitalis (Foxglove), Mimulus (monkey flower), inserted in corolla tube, filaments free, Antirrhinum (snapdragon), Penstemon 666 Plant Systematics

(beardtongue), Veronica (speedwell) and dehiscing by 2 slits and absence of vertical Russelia (firecracker plant). Species of Digi- partitions in heads of glandular hairs. talis, mainly D. purpurea and D. lanata, are Thorne had earlier (1999, 2000) removed all used for the extraction of drugs digitalin and three Plantago, Callitriche, and Hippuris to digoxin used as cardiac stimulants and ton- separate families Plantaginaceae, ics. The juice of Limnophila indica is used in Callitrichaceae and Hippuridaceae, respec- fevers, tonic and as stomachic. Various spe- tively, and used the name Antirrhinaceae cies of Veronica yield glucoside rhinanthis for the family. Judd et al., (1999, 2002), APG and used for ulcers and burns. II and APweb had, however, combined all the four families under Plantaginaceae, a place- Phylogeny: The family is closely related to ment also followed subsequently (2003) by Scrophulariaceae and Acanthaceae sharing Thorne. Monophyly of the family is supported the features of zygomorphic flowers, by cpDNA characters. Olmstead (2001) sug- pentamerous flowers, stamens less than 5, gested the removal of Calceolaria (with highly bicarpellate superior ovary and fruit a cap- saccate corolla) and related genera to sepa- sule. The genera were originally included rate family Calceolariaceae, a change that under Scrophulariaceae from which they has been incorporated in APG II, APweb and differ in having distinct bithecous anthers Thorne (2003, 2007).

* * * * * * * * * * *

Lamiaceae Martinov Mint family (=Labiatae A. L. de Jussieu) 264 genera, 6,990 species Worldwide in distribution, largely concentrated in the Mediterranean Region.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Lamiales Lamiales Lamiales Lamiales Lamiales Lamiales B & H as Labiatae, others as Lamiaceae

Salient features: Plants aromatic, stem 4- chambered, finally 4 chambered due to false angled, nonglandular hairs multicellular, septum, ovules 4, attached to the sides of leaves opposite, stipules absent, inflores- false septa, ovary deeply 4-lobed, style usu- cence with cymose lateral clusters, com- ally gynobasic, forked apically with incon- monly verticillaster, flowers zygomorphic, spicuous stigmatic region at the tip of each stamens 2-4, pollen exine not thickened style branch, fruit schizocarpic breaking into near apertures, carpels 2, ovary superior, 2- 4 nutlets. Major Families of Angiosperms 667

Figure 13.135 Lamiaceae. Salvia splendens. A: Branch with axillary and terminal inflorescences; B: Vertical section of flower to show bilabiate corolla and stamen with turn-pipe mechanism, gynobasic style and nectary below ovary. Ocimum basilicum. C: Portion of plant with inflorescences; D: Flower with bilabiate corolla and 4 didynamous stamens; E: Corolla spread out to show epipetalous stamens of 2 sizes; F: Gyno- ecium with gynobasic style and bifid stigma, nectary below the ovary. G: Lamium rhomboideum, plant with inflorescences. Clerodendrum viscosum. H: Branch with terminal spreading inflorescence; I: Fruit with persistent calyx.

Major genera: Salvia (700 species), suckers (Mentha) or stolons (Ajuga), some- Clerodendrum (400), Thymus (340), times green and assimilatory (Hedeoma), Plectranthus (300), Scutellaria (300), Stachys usually with glandular hairs, nonglandular (300), Nepeta (260), Teucrium (200), Calli- hairs when present multicellular. Leaves carpa (150), Ocimum (150), Lamium (50), opposite (rarely alternate), simple or pinnate Marrubium (40), Mentha (30), Lavandula (30) compound, usually aromatic, sometimes and Tectona (3). reduced (Hedeoma), stipules absent. Inflores- cence verticillaster [two opposite whorls Description: Aromatic herbs or shrubs (verticels) of cymose clusters initially bipa- (Rosmarinus, Teucrium), sometimes small rous and subsequently uniparous], arranged (Hyptis) or large (Tectona) trees, rarely climb- in raceme, spike or panicle. Flowers ers (Scutellaria), stem 4-angled, often with bracteate (Coleus) or ebracteate (Salvia), iridoids, phenolic glycosides, sometimes with bisexual, zygomorphic, hypogynous, often 668 Plant Systematics bilabiate. Calyx with 5 sepals, united, often species of Stachys are edible. Teak (Tectona bilabiate 1/4 (Ocimum) or 3/2 (Salvia), per- grandis) is valuable timber, known for its hard sistent. Corolla with 5 petals, united, usu- and durable wood and extensively cultivated ally bilabiate 4/1 (Ocimum) or 2/3 (Salvia), in India and Burma. upper lip sometimes absent (Ajuga), rarely corolla 4-lobed (Pogostemon). Androecium Phylogeny: The family Lamiaceae is gener- with 2 (Salvia) to 4 (Ocimum) stamens, ally considered to be one of the most highly epipetalous, usually didynamous, inserted evolved of all dicotyledonous families, and in corolla tube, sometimes with turn-pipe closely related to Vebenaceae. The circum- mechanism (lever mechanism) as in Salvia scription of the family has undergone con- (anther lobes separated by a long connective siderable revision with several genera (nearly and swinging like a lever, one anther-lobe two-thirds) from older Verbenaceae such as sterile, another fertile), filaments free, de- Clerodendrum, Callicarpa, Vitex and Tectona hiscence longitudinal, pollen grains transferred to Lamiaceae (Judd et al., 2002; tricolpate or 6-colpate. Gynoecium with 2 Thorne, 2000, 2003; APG II, APweb). The fam- united carpels, ovary superior, bilocular, ily Lamiaceae is distinguished from ovules 2 in each chamber, finally 4-locular Verbenaceae in cymose lateral whorls, ovules due to false septa with 1 ovule in each cham- attached on sides of false septa, bilobed style ber, anatropous, axile placentation, ovules with small stigmatic region, pollen exine not attached to the sides of the false septa, ovary thickened near apertures, hairs multicellu- 4-lobed, style 1, gynobasic, rarely terminal lar, strongly bilabiate corolla and usually (Ajuga), forked apically with inconspicuous gynobasic style. According to Wagstaff et al., stigmatic region at the tip of each style 1998 the following 5 clades (subfamilies) are branch, ovary seated on a nectary disc. Fruit distinct: Nepetoideae (pollen trinucleate, a schizocarp (carcerulus) splitting into 4 hexacolpate, style gynobasic; myxocarpy; nutlets or a drupe or indehiscent 4-seeded endosperm absent, embryo investing), pod; seed with straight embryo, endosperm Lamioideae (laballenic acid in seed oils, em- minute or absent. Pollination by insects, bryo sac with micropylar lobe longer and lower lip providing landing platform. Disper- broader than chalazal lobe, style gynobasic), sal by birds, wind or water. Pogostemonoideae (stamens 4, about the same length), Scutellarioideae (style Economic importance: The family includes bilabiate, with rounded lips; seeds tubercu- several plants used in cooking and flavour- late), and Teucrioideae [(inc. Ajugoideae) ing such as spearmint (Mentha spicata), pep- exine with branched to granular columellae]. permint (M. piperita) thyme (Thymus vulgaris), Bootstrap support for the family as circum- sweet basil ‘niazbo’ (Ocimum basilicum), pot scribed is 100 per cent (Wagstaff et al., 1998); marjoram (Origanum vulgare) and sage (Salvia Congea may be sister to the rest, but some officinalis). The family is also source of popu- relationships are still in a state of flux. Thorne lar perfumes such as lavender (Lavandula (2000, 2003, 2007) adds two more subfamilies angustifolia) and rosemary (Rosmarinus Symphorematoideae (Congea, Sphenodesme, officinalis). Basil (Ocimum sanctum) is sacred Symphorema) and Prostantheroideae (17 gen- in India. Common ornamentals include sage era incl. Chloanthoideae, Tectona), establish- (Salvia), horsemint (Monarda), Molucella, ing Ajugoideae (instead of Teucrioideae) thus Clerodendrum and Coleus. The tubers of few recognizing a total of seven subfamilies.

* * * * * * * * * * * Major Families of Angiosperms 669 Verbenaceae Jaume St.-Hilaire Verbena family 36 genera, 1,035 species (including only Verbenoideae) Widely distributed, mainly in tropical regions, also in temperate regions, prominent in new world.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Lamiales Lamiales Lamiales Lamiales Lamiales Lamiales

Salient features: Plants aromatic, leaves gitudinal, pollen grains tricolpate, exine opposite, serrate, stem often angular, non- thickened near apertures. Gynoecium with glandular hairs if present unicellular, flow- 2 united carpels, ovary superior, bilocular, ers zygomorphic, in racemes, spikes or heads, ovules 2 in each chamber, finally 4-locular pollen exine thickened near apertures, style due to false septum with 1 ovule in each simple with bilobed stigma, stigmatic area chamber, unitegmic, axile placentation, conspicuously swollen and glandular, ovary ovary not or slightly 4-lobed, style 1, termi- with four ovules, ovules attached to the nal, style simple with bilobed stigma, margin of false septa. stigmatic area conspicuously swollen and glandular, ovary seated on a nectary disc. Major genera: Verbena (200), Lippia (180) Fruit a drupe with 2 or 4 pits, or schizocarp Lantana (140), Citharexylum (65), Glandu- splitting into 2 or 4 nutlets; seed with laria (55), Duranta (28) and Phyla (10). straight embryo , endosperm absent. Polli- nation by insects. Dispersal by birds, wind Description: Aromatic herbs (Lippia), shrubs or water. (Lantana), sometimes trees, rarely lianas, sometimes with prickles or thorns, stem Economic importance: The family contrib- usually 4-angled, often with iridoids and phe- utes some ornamentals such as Verbena, nolic glycosides, usually with glandular Lantana, Duranta, and Glandularia. Lippia hairs, nonglandular hairs if present unicel- (lemon verbena) and Privea are used as lular. Leaves opposite, sometimes whorled, herbal teas or yield essential oils. Verbena simple or sometimes lobed, usually aro- officinalis (vervain) is used for a number of matic, entire to serrate, stipules absent. In- herbal remedies including treatment of skin florescence racemose: racemes, spikes or diseases. heads. Flowers bisexual, zygomorphic, hypogynous. Calyx with 5 sepals, united, Phylogeny: The family is closely related to tubular to campanulate, persistent, some- Lamiaceae. The circumscription of the fam- times enlarged in fruit. Corolla with 5 pet- ily has undergone considerable revision with als, sometimes appearing 4 due to fusion of several genera (nearly two-thirds) from older two posterior petals, united, weakly bilabiate, Verbenaceae such as Clerodendrum, lobes imbricate. Androecium with 4 sta- Callicarpa, Vitex and Tectona transferred to mens, epipetalous, didynamous, inserted in Lamiaceae (Judd et al., 2002; Thorne, 2000, corolla tube, filaments free, dehiscence lon- 2003; APG II, APweb). The family is now 670 Plant Systematics

Figure 13.136 Verbenaceae. Lantana camara. A: Branch with ovoid compact inflorescences on long peduncles; B: Flower with long corolla tube and zygomorphic limb; C: Corolla spread out to show epipetalous stamens; D: Cluster of fruits; E: Fruit. Verbena officinalis. F: Plant with terminal spikes; G: Corolla with shorter broader tube and zygomorphic limb; H: Corolla spread out to show epipetalous stamens; I: Gyno- ecium; J: Transverse section of ovary with 4 one-seeded chambers. Phyla nodiflora. K: Portion of plant with pedunculate globose inflorescences; L: Flower with short broad tube and zygomorphic limb; M: Corolla spread out to show epipetalous stamens; N: Fruit with persistent calyx; O: Longitudinal section of fruit. circumscribed to include only subfamily apertures, hairs unicellular, weakly bilabiate Verbenoideae. The traditionally delimited corolla and usually terminal style. Phryma Verbenaceae are paraphyletic and Lamia- (Phrymaceae) with one carpel aborted and ceae polyphyletic. With narrowly defined ovary with single basal ovule may be closely Verbenaceae and broadly defined Lamiaceae, related to Verbenaceae (Chadwell et al., both become monophyletic. The family is dis- 1992). Avicennia often included in distinct tinguished from Lamiaceae in racemose family or broadly circumscribed Verbenaceae inflorescence, ovules attached on margins of is more appropriately included in Acantha- false septa, style simple with conspicuous ceae (APweb). Thorne (2003) treats Phryma- bilobed stigma, pollen exine thickened near ceae and Avicenniaceae as distinct families.

* * * * * * * * * * * Major Families of Angiosperms 671 Bignoniaceae A. L. de Jussieu Trumpet creeper family 113 genera, 800 species (excluding Paulownia) Widely distributed in tropical and subtropical regions, a few species in temperate regions, most diverse in northern South America from temperate to tropical regions, especially diverse in Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Personales Scrophulariales Scrophulariales Lamiales Lamiales Lamiales

Salient features: Usually woody lianas or epipetalous, inserted in corolla tube, fila- trees, leaves usually opposite, often comments free, anther bithecous, sagittate, de- pound, sometimes with tendrils, stipules hiscence longitudinal, pollen grains some- absent, nectaries on leaves, flowers times in tetrads or polyads. Gynoecium with zygomorphic, showy, stamens 4, carpels 2, 2 united carpels, ovary superior, bilocular ovary superior, 2-chambered, ovules many, with axile placentation, rarely unilocular fruit a woody capsule, seeds often winged. with free-central placentation, ovules many, anatropous, style short, stigma with unequal Major genera: Tabebuia (100 species), lobes. Fruit a woody capsule, occasionally a Arrabidaea (70), Adenocalyma (45), Jacaranda berry or pod; seed winged or fringed with (40), Spathodia (20), Catalpa (11), Campsis (2) hairs, endosperm absent, cotyledons deeply and Kigelia (1). bilobed. Pollination by insects. Seeds dispersed by wind. Description: Shrubs, trees or lianas (Bignonia, Campsis), lianas often with char- Economic importance: The family contrib- acteristic secondary growth resulting in utes several ornamentals such as Spathodia lobed or furrowed xylem cylinder, usually with (African tulip tree), Kigelia (sausage tree), iridoids and phenolic glycosides. Leaves usu- Tabebuia (poui, gold tree), Crescentia (cala- ally opposite or whorled, pinnately or bash tree) and Tecoma. Common climbers palmately compound, sometimes simple include Bignonia (cross vine), Campsis, (Catalpa), venation pinnate to palmate, re- Tecomaria (Cape honeysuckle) and Pyrostegia ticulate, some leaflets often modified into (flame vine). Tabebuia and Catalpa are tendrils, stipules absent but glands often exploited as timbers, mostly for fence posts. present at the base of petiole. Inflorescence cymose, raceme or panicle, rarely solitary. Phylogeny: The family is closely related Flowers bisexual, zygomorphic, hypogynous, to Scrophulariaceae sharing the features usually showy. Calyx with 5 sepals, connate. of zygomorphic flowers, pentamerous Corolla with 5 petals, united, showy, usu- flowers, stamens less than 5, bicarpellate ally bilabiate, sometimes with sac or spur superior ovary and fruit a capsule. The on the lower lip, imbricate. Androecium with family is monophyletic as evidenced by usually 4 stamens, fifth represented by a morphology. Pinnate compound leaves are staminode, rarely 5 (Oroxylum) or 2 (Catalpa), considered to be ancestral. The genus 672 Plant Systematics

Figure 13.137 Bignoniaceae. Incarvillea emodi. A: Plant with terminal raceme and long linear capsules; B: Calyx with minute lobes; C: Stamen with arched filaments and spreading villous anther lobes; D: Portion of corolla spread to show stamens; E: Seed, linear and fibrillate at both ends. Campsis radicans. F: Branch with flowers; G: Fruit ; H: Winged seed.

Paulownia and Schlegelia often included in respectively by Thorne, APG II and APweb. Bignoniaceae are intermediate between Paulownia is superficially like Catalpa but this family and the Scrophulariaceae and it has endosperm and lacks the ovary and as such treated under distinct families seed anatomy of Bignoniaceae (Armstrong, Paulowniaceae and Schlegeliaceae 1985; Manning, 2000).

* * * * * * * * * * * Major Families of Angiosperms 673 Acanthaceae A. L. de Jussieu Acanthus family 222 genera, 3,565 species Cosmopolitan in distribution, mainly in tropics and warm temperate regions.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Personales Scrophulariales Scrophulariales Lamiales Lamiales Lamiales

Salient features: Leaves opposite, stipules equal in size, sometimes one lobe aborted, absent, flowers zygomorphic, with prominent dehiscence longitudinal, tapetum glandular, bracts and bracteoles, stamens 2-4, anther pollen grains 2-8 aperturate or colpate. Gyn- lobes unequal in size, carpels 2, ovary supe- oecium with 2 united carpels, ovary superior, rior, 2-chambered, ovules 4 or more, fruit a bilocular, ovules 2 in each chamber, axile capsule, seeds with jaculators. placentation, style 1, stigma bilobed, ovary seated on a nectary. Fruit a loculicidal cap- Major genera: Justicia (400), Beloprone (300), sule; seed with jaculator or retinaculum a Barleria (240), Strobilanthus (230), Ruellia hook-shaped projection of funiculus, embryo (190), Dicliptera (140), Thunbergia (140) and large, curved or straight, endosperm absent. Adhatoda (20). Economic importance: The family includes Description: Herbs or shrubs (Adhatoda), a large number of ornamentals such as sometimes small trees (Strobilanthus) or Barleria, Thunbergia, Pachystachys, lianas (Thunbergia), a rarely aquatic herbs Eranthemum and Acanthus. Extract from (Cardentha), sometimes spiny (Barleria), usu- Adhatoda vasica is component of some cough ally with anomalous secondary growth, often syrups. An extract from the boiled leaves of with Iridoids, alkaloids and diterpenoids, Acanthus ebracteatus (sea holy) is used as a cystoliths often present, nodes unilacunar, cough medicine in parts of Malaya, whereas vessels with simple end-walls. Leaves oppo- the roots of A. mollis (bear’s breech) are used site, rarely alternate (Nelsonia, Elytraria), to treat diarrhoea in some parts of Europe. simple, entire or dentate, stipules absent. Inflorescence cymose, racemose (usually Phylogeny: The family is closely related to spike) or of solitary flowers (Bontia). Flowers Scrophulariaceae sharing the features of bisexual, zygomorphic, hypogynous, with zygomorphic flowers, pentamerous flowers, prominent bracts and bracteoles. Calyx with stamens less than 5, bicarpellate superior 4 (Acanthus) to 5 (Adhatoda) sepals, free or ovary and fruit a capsule. The Acanthaceae united. Corolla with 5 petals, united, usu- are distinct in absence of endosperm, anthers ally bilabiate, sometimes nearly regular opening by two slits and the presence of reti- (Acanthus). Androecium with 2 (Adhatoda) or naculum. Thorne had earlier (1999, 2000) 4 (Acanthus, Ruellia) didynamous stamens, recognized 5 subfamilies: Nelsonioideae, rarely 5 (Pentstemon), epipetalous, inserted in Thunbergioideae, Mendoncioideae, Acan- corolla tube, filaments free, anther lobes un- thoideae and Ruellioideae. The first two 674 Plant Systematics

Figure 13.138 Acanthaceae. Adhatoda vasica. A: Branch with flowers in spikes; B: Flower with bilabiate corolla; C: Longitudinal section of flower showing 2 epipetalous stamens; D: Capsule with persistent calyx. Peristrophe bicalyculata. E: Branch with flowers; F: Flower with bilabiate corolla; G: Vertical section of flower. Barleria prionitis. H: portion of branch with spines at nodes and axillary clusters of flowers; I: Corolla tube opened to show stamens, corolla limb cut away; J: Spiny calyx and bracteoles; K: Transverse section of ovary. Blepharis maderaspatensis. L: Portion of branch with flowers; M: Flower; N: Corolla tube opened to show epipetalous stamens, corolla limb partly cut away; O: Longitudinal section of gynoecium. include aberrant genera. Nelsonoideae with (2000), the absence of retinacula or cystoliths, sometimes alternate leaves, presence of descending cochlear aestivation (i.e. the endosperm and absence of retinacula may adaxial petals overlapping the abaxial petals represent a paraphyletic basal group within in bud) are likely to be plesiomorphies. the family. Nelsonioideae have often been Acanthoideae are clearly monophyletic (Scot- placed in Scrophulariaceae s. l. or considered land, 1990) and characterized by the absence ‘intermediate’ between Scrophulariaceae of cystoliths, nodes not swollen, colpate pol- and Acanthaceae, but they are placed sister len and monothecous anthers. In Mendo- to rest of Acanthaceae s. l. in Hedren et al., ncioideae, one of the carpels is often aborted, (1995). According to Scotland and Vollesen fruit is a drupe and style bifid. Mendoncioideae Major Families of Angiosperms 675 and Ruellioideae have subsequently been McDade, 2002). This placement based on merged under Thunbergioideae and molecular evidence is also supported by ar- Acanthoideae, respectively (APweb and ticulated nodes, inflorescence structure, flow- Thorne, 2003). APweb includes Avicennioi- ers with bract and 2 bracteoles, a reduction deae as fourth subfamily, stressing that the in number of ovules and absence of en- position of Avicenniaceae within Acantha- dosperm (Judd et al., 2002). Thorne who had ceae s.l. is fairly well established; it shows a earlier (2000, 2003) treated Avicenniaceae rather weakly supported sister group relation- as distinct family has also finally (2007) rel- ship with Thunbergioideae (Schwarzbach & egated it to the subfamily level like APweb.

* * * * * * * * * * *

Scrophulariaceae A. L. de Jussieu Figwort family 42 genera, 1,460 species Widely distributed from temperate to tropical regions, especially diverse in Africa.

Placement:

B & H Cronquist Takhtajan Dahlgren Thorne APG II / (APweb)

Division Magnoliophyta Magnoliophyta Class Dicotyledons Magnoliopsida Magnoliopsida Magnoliopsida Magnoliopsida Subclass Gamopetalae Asteridae Lamiidae Magnoliidae Lamiidae Series+/Superorder Bicarpellatae+ Lamianae Lamianae Lamianae Euasterids I* Order Personales Scrophulariales Scrophulariales Lamiales Lamiales Lamiales

Salient features: Leaves alternate or oppo- whorled, simple, entire or dentate, venation site, stipules absent, flowers zygomorphic, pinnate, reticulate, stipules absent. Inflo- anther commonly opening by single slit, car- rescence racemose: racemes or spikes. pels 2, ovary superior, 2-chambered, ovules Flowers bisexual, zygomorphic, or almost many, fruit a capsule. actinomorphic, hypogynous. Calyx with 3-5 sepals, connate, persistent. Corolla with 4- Major genera: Verbascum (360 species), 5 petals, united, usually bilabiate, or with Scrophularia (230), Selago (150), Sutera (140), narrow tube broadening upwards, some- Budleja (100), Manulea (55) and Nuxia (30). times with nectar sac or spur, imbricate. Androecium with usually 5 stamens, rarely Description: Herbs or small shrubs (Budleja), 4 or 2, epipetalous, inserted in corolla tube, often with Iridoids, hairs usually simple, filaments free, sometimes hairy (Verbascum), when glandular with short discoid head com- anther bilocular, anther sac confluent and posed of many cells and with vertical parti- opening by single slit right angles to fila- tions. Leaves alternate or opposite, rarely ment, anther base not sagittate, pollen 676 Plant Systematics

Figure 13.139 Scrophulariaceae. Scrophularia elatior. A: Portion of plant with terminal inflorescence; B: Flower with long-exserted stamens and style. Verbascum chinense. C: Lower part of plant with basal and lower cauline leaves; D: Upper part of inflorescence; E: Flower; F: Corolla spread to show epipetalous stamens; G: Stamen with glandular hairy filament; H: Flower after removal of corolla and one lobe of calyx to show gynoecium; I: Capsule with persistent calyx. grains tricolporate. Gynoecium with 2 and Nuxia are commonly grown as united carpels, ovary superior, bilocular, ornamentals. ovules several to 1 (Selago) in each chamber, axile placentation, style 1, stigma Phylogeny: The family is closely related to bilobed, ovary seated on a nectary. Fruit a Acanthaceae sharing the features of septicidal capsule, or schizocarp with two zygomorphic flowers, pentamerous flowers, nutlets (Selago); seed with curved or straight stamens less than 5, bicarpellate superior embryo, endosperm present. Pollination by ovary and fruit a capsule. Scrophulariaceae insects. Seeds or nutlets dispersed by wind. are distinct in presence of endosperm, anthers opening by single slit and the absence Economic importance: The family has lit- of retinaculum. The genera including tle economic importance. Verbascum is Veronica, Linaria, Antirrhinum, Digitalis, etc. sometimes grown as ornamental. Budleja formerly included under Scrophulariaceae Major Families of Angiosperms 677 have been variously separated under clade characterised by hairy filaments, en- Antirrhinaceae (Thorne, 1999, 2000) or dosperm development and distinctive seeds Plantaginaceae (Judd et al., 2002, APG II and and are sister to rest of genera. Selago and APweb, Thorne, 2006, 2007). The relatives (former Selaginaceae) form a clade Budlejaceae and Selaginaceae have been based on uniovulate locules and achene-like merged with Scrophulariaceae in these sys- fruits. Budleja is very much paraphyletic, but tems. Monophyly of Scrophulariaceae is several lines of evidence place it here clearly supported by morphology, rbcL and (Maldonado de Magnano, 1986b); Teedia and ndhF sequences (Olmstead and Reeves, Oftia have strong support as the sister group 1995). Verbascum and Scrophularia form a to Budleja s. l. (Wallick et al. 2001, 2002).

* * * * * * * * * * *

References

Abrams, L. (1923-1960). An Illustrated Flora of Anderberg, A. A., C.-I. Peng, I. Trift and the Pacific States. 4 vols Vol. 4 by Roxana M. Källersjö. (2001). The Stimpsonia problem; Ferris). Stanford Univ. Press, Stanford, CA. evidence from DNA sequences of plastid Adanson, M. (1763). Familles des plantes, Paris, genes atpB, ndhF and rbcL. Bot. Jahrb. Syst. 2 vols. 123: 369-376. Aguilar-Ortigoza, C. J. and V. Sosa. 2004. The Anderson, E. (1940). The concept of the genus. evolution of toxic phenolic compounds in a II. A survey of modern opinion. Bull. Torrey group of Anacardiaceae genera. Taxon Bot. Club 67: 363-369. 53: 357-364. APG [= Angiosperm Phylogeny Group] II. 2003. Albach, D. C., P. S. Soltis, D. E. Soltis and An update of the Angiosperm Phylogeny R. G. Olmstead. (2001). Phylogenetic analy- Group classification for the orders and sis of Asterids based on sequences of four families of flowering plants: APG II. Bot. J. genes. Ann. Missouri Bot. Gard. 88: 163-212. Linn. Soc. 141: 399-436. 2001. Applequist, W. L. and R. S. Wallace. (2001). Albert, V. A., A. Backlund, K. Bremer, M. W. Phylogeny of the Portulacaceous Cohort Chase, J. R. Manhart, B. D. Mishler and K. Based on ndhF Sequence Data. Syst. Bot. C. Nixon. (1994). Functional constraints and 26: 406-419. rbcL evidence for land plant phylogeny. Ann. Applequist, W. L., W. L. Wagner, E. A. Zimmer, Missouri Bot. Gard. 81: 534-567. and M.Nepokroeff. (2006). Molecular evidence Alston, R. E. and B. L. Turner. (1963). Natural resolving the systematic position of Hectorella hybridisation among four species of Baptisia (Portulacaceae). Syst. Bot. 31: 310-319. ( Leguminosae). Amer. J. Bot. 50:159-173. APG [= Angiosperm Phylogeny Group]. 1998. An Alverson, W. S., B. A. Whitlock, R. Nyffeler, and ordinal classification for the families of D. A. Baum. (1998). Phylogeny of Core flowering plants. Ann. Missouri Bot. Gard. Malvales: Evidence from ndhF sequence data. 85: 531-553. Amer. J. Bot. 86(6) Suppl.: 112. Arber, E. (1934). The Gramineae: a study of cereal, Ambrose, B. A., D. R. Lerner, P. Ciceri, C. M. bamboo, and grass. Cambridge, England. Padilla, M. F. Yanofsky and R. J. Schmidt. Arber, E. (1938). Herbals: Their Origin and Evolu- (2000). Molecular and genetic analyses of the tion (2nd ed.). Cambridge Univ. Press. Silky1 gene reveal conservation in floral or- Arber, E. and J. Parkins. (1907). On the Origin gan specification between eudicots and of Angiosperms. Bot. J. Linn. Soc. 38: 29-80. monocots. Molecular Cell 5: 569-579. Armstrong, J. E. (1985). The delimitation of Anderberg, A. A., X. Zhang and M. Källersjö. Bignoniaceae and Scrophulariaceae based on (2000). Maesaceae, a new primuloid family floral anatomy, and the placement of prob- in the order Ericales s. l. Taxon 49: 183-187. lem genera. Amer. J. Bot. 72: 755-766. 680 Plant Systematics

Arnold, C. A. (1948). Classification of gymno- Bate-Smith, E.C. (1962). The phenolic constitu- sperms from the point of view of ents of plants and their taxonomic signifi- Palaeobotany. Bot. Gaz. 110: 2-12. cance. J. Linn. Soc. Bot. 58: 95-173. Ashlock, P. H. (1971). Monophyly and related Bate-Smith, E.C. (1968). The phenolic constitu- terms. Syst. Zool. 20: 63-69. ents of plants and their taxonomic signifi- Ashlock, P. H. (1979). An evolutionary cance. J. Linn. Soc. Bot. 60: 325-383. Systematits’s view of classification. Syst. Bauhin, C. (1596). Phytopinax seu enumeratic Zool. 28: 441-450. plantarum..... Basel. Asmussen, C. B., W. J. Baker, and Dransfield. Bauhin, C. (1623). Pinax theatri botanici. Basel. (2000). Phylogeny of the palm family Baum, B. R. (1977). Oats: Wild and Cultivated. A (Arecaceae) based on rps16 intron and trnL- Monograph of the Genus Avena L. (Poaceae). trnF plastid DNA sequences. Pp. 525-535, Minister of Supply and Services, Ottawa. in K. L. Wilson and D. A. Morrison (Eds.), Baum, H. (1949). Der einheitliche Bauplan der Monocots: Systematics and Evolution. CSIRO, Angiospermen gynözeen und die Homologie Collingwood. ihrer fertilen Abschnitte. Bot. Jahrb. Syst. Axelrod, D. I. (1970). Mesozoic paleogeography Pflanzen. 96: 64-82. and early angiosperm history. Bot. Rev. 36: Baum, H. and W. Leinfellner. (1953). Die 277-319. Peltationsnomeklatur der Karpelle. Bot. Babcock, E. B. (1947). The genus Crepis pt. 1. Jahrb. Syst. Pflanzen. 100: 424-426. The taxonomy, phylogeny distribution and Bayer, C., M. F. Fay, A. Y. De Bruijn, V. evolution of Crepis. Univ. Calif. Publs. Bot. Savolainen, C. M. Mortan, K. K. Kubitzki, 21: 1-197. W. S. Alverson and M. W. Chang. (1999). Sup- Bailey, I. W. (1944). The development of vessels port for an expanded family concept of in angiosperms and its significance in mor- Malvaceae within a recircumscribed order phological research. Am. J. Bot. 31: 421-428. Malvales: a combined analysis of plastid atpB Bailey, L.H. (1949). Manual of Cultivated Plants and rbcL DNA sequences. Bot. J. Linn. Soc. (rev. Ed.). Macmillan, New York. 129: 267-303. Bailey, I. W. and B. G. L. Swamy. (1951). The Behnke, H. D. (1965). Über das phloem der conduplicate carpel of dicotyledons and its Dioscoreaceen unter besonderer initial trend of specialization. Amer. J. Bot. Berücksichtigung ihrer phloembecken. II. 38: 373-379. Mitteilung:Elektronenoptische Barber, H. N. (1970). Hybridization and evolu- untersuchungen zur feinstruktur des tion of plants. Taxon 19: 154-160. phloembeckens. Z. Pflanzenphysiol. 53: 214- Barthlott, W. (1981). Epidermal and seed sur- 244. face characters of plants: Systematic appli- Behnke, H. D. (1976). Ultrastructure of sieve- cability and some evolutionary Aspects. Nor- element plastids in Caryophyllales dic J. Bot. 1: 345-355. (Centrospermae); evidence for the delimita- Barthlott, W. (1984). Microstructural features of tion and classification of the order. Plant Syst. seed surfaces. In V. H. Heywood and D. M. Evol. 126: 31-54. Moore (Eds.). Current concepts in Plant Tax- Behnke, H. D. (1977). Transmission electron onomy. Systematic Association special microscopy and systematics of flowering

Volume No. 25: 95-105. plants. In: K. Kubitzki. Flowering Plants- Evo- Barthlott, W. and D. Froelich. (1983). lution and Classification of Higher Categories. Mikromorphologie und Orientierungsmuster Plant Syst. Evol. Suppl. 1, 155-178.

epicuticularer Wachs-Kristalloide: Ein neues Behnke, H. D. (1997). Sarcobataceae- a new fam- systematisches Merkmal bei Monocotylen. ily of Caryophyllales. Taxon 46: 495-507. Pl. Syst. Evol. 142: 171-185. Behnke, H. D. and W. Barthlott (1983). New Barthlott, W. and G. Voit. (1979). Mikromorpho- Evidence from the ultrastructural and mi- logie der Samenschalen und Taxonomie der cromorphological fields in Angiosperm clas- Cactaceae Ein raster-elektronem-microsco- sification. Nordic. J. Bot. 1: 341-460. pischer uberblick. Pl. Syst. Evol. 132: 205-229. Belfod, H. S. and W. F. Thomson (1979). Single Bate-Smith, E.C. (1958). Plant phenolics as copy DNA homologies and phylogeny of taxonomic guides. Proc. Linn. Soc. Lond. 169: Atriplex. Carnegie Inst. Wash Year Book 78: 198-211. 217-223. References 681

Belk, E. (1939). Studies in the anatomy and mor- Bordet, J. (1899). Sur l’agglutination et la disso- phology of the spikelet and flower of the lution des globules rouges par le serum Gramineae. Thesis (Ph.D.). Cornell Univ. d’animaux injectes de sang defibriné. Ann. Bell, G. A. (1971). Comparative Biochemistry of Inst. Pasteur 13: 225-250. non-protein amino acids. In: J. B. Harborne, Boulter, D. (1974). The use of amino acid D. Boulter and B. L. Turner (Eds.) Chemotax- sequence data in the classification of higher onomy of Leguminosae. Academic Press, Lon- plants. In: G. Bendz and J. Santesson (Eds.). don, pp. 179-206. Chemistry and Botanical Classification, Nobel Bensel, C.R. and B. F. Palser. (1975a). Floral Symposium, 25, pp. 211-216. Acad. Press, anatomy in the Saxifragaceae sensu lato. II. London/New York. Saxifragoideae and Iteoideae. Amer. J. Bot. Bramwell, D. (1972). Endemism in the Flora of 62: 661-675. Canary Islands. In D. H. Valentine (ed.) Tax- Bensel, C.R. and B. F. Palser. (1975b). Floral onomy, Phytogeography and Evolution 141-159. anatomy in the Saxifragaceae sensu lato. III. Academic Press, London. Kirengeshomoideae, Hydrangeoideae and Bremer, B. and L. Struwe. (1992). Phylogeny of Escallonioideae. Amer. J. Bot. 62: 676-687. the Rubiaceae and Loganiaceae: Congruence Benson, L. (1957). Plant Classification. Oxford and or conflict between morphologican and mo- IBH Co., New Delhi. lecular data? Amer. J. Bot. 79: 1171-1184. Bentham, G. (1858). Handbook of British Flora. Bremer, B., K. Andreasen and D. Olsson. (1995). (7th ed., revised by A. B. Rendle in 1930). Subfamilial and tribal relationships in the Ashford, Kent. Rubiaceae based on rbcL sequence data. Ann. Bentham, G. (1863-1878). Flora Australiensis. Missouri Bot. Gard. 82: 383-397. London, 7 volumes. Bremer, B., R. K. Jansen, B. Oxelman, Bentham, G. and J. D. Hooker (1862-83). Gen- M. Backlund, H. Lantz, and K. -J Kim. (1999). era Plantarum. London, 3 vols. More characters or more taxa for a robust Berry, P. E., V. Savolainen, K. J. Sytsma, J. C. phylogeny-case study from the coffee family Hall, and M. W. Chase. (2001). Lissocarpa is (Rubiaceae). Syst. Bio. 48: 413-435. sister to Diospyros (Ebenaceae). Kew Bull. Bremer, B., K. Bremer, N. Heidari, P. Erixon, 56: 725-729. A. A. Anderberg, R. G. Olmstead, M. Bessey, C. E. (1915). Phylogenetic taxonomy of Kållersjö, and E. Barkhordarian (2002). flowering plants. Ann. Mo. Bot. Gard. Phylogenetics of asterids based on three 2: 109-164. coding and three non-coding chloroplast DNA Bhandari, M. M. (1978). Flora of the Indian Desert. markers and the utility of non-coding DNA Sc. Publ., Jodhpur. at higher taxonomic levels. Molecular Bhattacharya, B. and B. M. Johri. 1998. Flower- Phylogenetics and and Evolution 24: 274-301. ing Plants: Taxonomy and Phylogeny. Narosa Bremer, K. (2002). Gondwanan evolution of the Publishing House, New Delhi. grass alliance of families (Poales). Evolution Blackith, R. E. and R. A. Reyment. (1971). Multi- 56: 1374-1387 variate Morphometrics. Acad. Press, London. Bremer, K. and H. -E. Wanntorp. (1978). Phylo- Blake, S. F. (1961). Geographical Guide to the Flo- genetic systematics in botany. Taxon 27: ras of the World. Part II. Misc. Publ. 797. U. 317-329. S. Dept. Agr., Washington, D. C. Bremer, K. and H. -E. Wanntorp. (1981). The cla- Blake, S. F. and A. C. Atwood. (1941). Geographi- distic approach to plant classification. In cal Guide to the Floras of the World. Part I. Advances in Cladistics, 1, V. A. Funk and D. Misc. Publ. 401. U. S. Dept. Agr., Washing- R. Brroks (eds), 87-94, New York Botanical ton, D. C. Garden, New York. Blakeslee, A. F. , A. G. Avery, S. Satina and J. Bremer, K., A. Backlund, B. Sennblad, Rietsama. (1959). The genus Datura. Ronald U. Swenson, K. Andreasen, M. Hjertson, J. Press, New York. Lundberg, M. Backlund, and B. Bremer. Bogler, D. J. and B. B. Simpson. (1996). Phylog- (2001). A phylogenetic analaysis of 100+ gen- eny of Agavaceae based on ITS rDNA se- era and 50+ families of euasterids based on quence variation. Amer. J. Bot. 83: 1225-1235. morphological and molecular data with notes Bonnett, H. T. and E. H. Newcomb. (1965). Polyri- on possible higher level morphological bosomes and cisternal accumulations in root synapomorphies. Plant Syst. Evol. 229: cells of radish. J. Cell Biol. 27: 423-432. 137-169. 682 Plant Systematics

Brenner, G. H. and I. Bickoff. (1992). Palynology Caesalpino, A. (1583). De plantis libri. Florentiae. and age of the Lower Cretaceous basal Cain, A. J. and G. A. Harrison. (1958). An analy- Kurnub Group from the coastal plain to the sis of the taxonomists’ judgement of affin- northern Negev of Israel. Palynology 16: 137- ity. Proc. Zool. Soc. Lond. 131: 85-98. 185. Cain, A. J. and G. A. Harrison. (1960). Phyletic Brenner, G. J. (1963). Spores and Pollen of weighting. Proc. Zool. Soc. Lond. 135: 1-31. Potomac Group of Maryland. Maryland Depart- Cameron, K. M. (2002). Intertribal relationships ment of Geology, Mines, Water Resouces Bulle- within Orchidaceae as inferred from analy- tin 27:1-215. ses of five plastid genes. P. 116, in Botany Brenner, G. L. (1996). Evidence for the earliest 2002: Botany in the Curriculum, Abstracts. stage of angiosperm pollen evolution. A [Madison, Wisconsin.]. paleoequatorial section from Israel. In: D. Cameron, K. M. . (2004). Utility of plastid psaB W. Taylor and L. J. Hickey (Eds.) Flowering gene sequences for investigating intrafmilial Plant Origin, Evolution and Phylogeny. relationships within Orchidaceae. Mol. Phyl. Chapman & Hall Inc., New York, pp. 91-115. Evol. 31: 1157-1180. Brown, R. (1827). Character and description of Cantino, P. D. (2000). Phylogenetic nomencla- Kingia, a new genus of plants found on the ture: addressing some concerns. Taxon southwest coast of New Holland with obser- 49: 85-93. vations on the structure and its Carlquist, S. (1987). Presence of vessels in unimpregnated ovulum on female flower of Sarcanda (Chloranthaceae); comments on Cycadeae and Coniferae in P. P. King’s nar- vessel origin in angiosperms. Amer. J. Bot. rative of a survey of Intertropical and westerns 64: 1765-1771. coasts of Australia, performed between 1818 Carlquist, S. (1996). Wood anatomy of primitive and 1822, p 534-565. John Murray, London. Angiosperms: New perspective and synthe- Brown, N. E. (1920). New and old species of ses. In: D. W. Taylor and L. J. Hickey (Eds.) Mesembranthemum, with critical notes. Journ. Flowering Plant Origin, Evolution and Phylog- Linn. Soc. Bot. 45: 53-140. eny. Chapman & Hall Inc., New York, pp. Brown, R. W. (1956). Palmlike plants from the 68-90. Delores Formation (Triassic) in southwest- Carpenter, J. M. (2003). Crique of pure folly. Bot. ern Colorado. U. S. Geological Survey Profes- Rev. 69(1): 79-92. sional Paper 274: 205-209. Catalán, P, E. A. Kellogg and R. G. Olmstead. Brunfels, O. (1530). Herbarium vivae eicones. (1997). Phylogeny of Poaceae subfamily Argentorati, 3 tomes. Pooideae based on chloroplast ndhF gene Bruneau, A., F. Forest, P. S. Herendeen, B. B. sequences. Mol. Phylog. Evol. 8: 150-166. Klitgaard and G. P. Lewis. (2001). Phyloge- Cavalier-Smith, (1981). Eukaryotic kingdoms, netic relationships in the Caesalpinioideae seven or nine? BioSystems 14: 461-481. (Leguminosae) as inferred from chloroplast Cavalier-Smith, (1998). A revised six-kingdom trnL intron sequences. Syst. Bot. 26: 487- system of life. Biol. Rev. 73: 203-266. 514. Cavalier-Smith, (2000).A revised six kingdom Caddick, L. R. C. A. Furness, P. Wilkons and system of life. Biological Reviews. M. W. Chase. (2000). Yams and their allies: Cavalier-Smith, . (2004). Only six kingdoms of Systematics of Dioscoreales. Pp. 475-487, in life. Proceedings of the Royal Society B: Wilson, K. L., & Morrison, D. A. (eds), Mono- Biological Sciences 271: 251-1262. cots: Systematics and Evolution. CSIRO, Chamberlain, C. J. (1935). Gymnosperm structure Collingwood. and evolution. University of Chicago Press, Caddick, L. R. C. A. Furness, P. Wilkons, T. A. Chicago. J. Hedderson and M. W. Chase (2002a). Chandra, S. and K. R. Surange. (1976). Cuticular Phylogenetics of Dioscoreales based on com- studies of the reproductive organs of bined analyses of morphological and molecu- Glossopteris, Part I: Dictyopteridium lar data. Bot. J. Linnean Soc. 138: 123-144. feismanteli sp. Nov. attached on Glossopteris Caddick, L. R. , P. Wilkin,P. J. Rudall, T. A. J. tenuinervis. Palaeontographia B156: 87-102. Hedderson and M. W. Chase. (2002b). Yams Chandler, G. T, and G. M. Plunkett. (2003). The reclassified: A recircumscription of phylogenetic placement and evolutionary sig- Dioscoreaceae and Dioscoreales. Taxon 51: nificance of the polyphyletic subfamily 103-114. Hydrocotyloideae (Apiaceae). P. 75 in Botany References 683

2003: Aquatic and Wetland Plants: Wet and Clark, P. J. (1952). An extension of the coeffi- Wild. [Mobile, Alabama.] cient of divergence for use with multiple Chandler, G. T, and G. M. Plunkett. (2004). Evo- characters. Copeia 2: 61-64. lution in Apiales: Nuclear and chloroplast Clark, L. G., W. Zhang and J. F. Wendel. (1995). markers together in (almost) perfect har- A phylogeny of grass family (Poaceae) based mony. Botanical J. Linnean Soc.(cited in on ndhF sequence data. Syst. Bot. 20: 436- APweb) 460. Chapman, M. (1936). Carpel anatomy of Clark, L. G. & J. K. Triplett. (2006). Phylogeny of Berberidaceae. Amer. J. Bot. 23: 340-348. the Bambusoideae (Poaceae): An update. P. Chappill, J. A. (1994). Cladistic analysis of 212, in Botany 2006 - Looking to the Future, Leguminosae. The development of an explicit Conserving the Past. [Abstracts: Botanical So- hypothesis. In M. D. Crisp and J. J. Doyle ciety of America, etc.] (Eds.) Advances in legume systematics, part Clifford, H. T. (1977). Quantitative studies of in- 7., 1-9. Royal Botanic Gardens, Kew. ter-relationships amongst the Liliatae. In:

Chase, M. W., D. E. Soltis, R. G. Olmstead et K. Kubitzki. Flowering Plants-Evolution and al. (1993). Phylogenetics of seed plants: an Classification of Higher categories. Pl. Syst. analysis of nucleotide sequences from the Evol. Suppl. 1, 77-95. plastid gene rbcL. Ann. Missourie. Bot. Gdn. Colless, D. H. (1967). An examination of certain 80: 528-580. concepts in phenetic taxonomy. Syst. Zool. Chase, M. W., M. R. Duvall, H. G. Hills, et al. 16: 6-27. (1995a). Molecular systematics of Lilianae: Collett, H. (1921). Flora Simlensis, 2nd ed. Thacker, In M. J. Rudall et al. (Eds.) Monocotyledons: Spink, Calcutta. Systematics and Evolution, 109-137. Royal Constance, L. (1964). Systematic Botany- an Botanic Gardens, Kew. unending synthesis. Taxon. 13: 257-273. Chase, M. W. , D. W. Stevenson, P. Wilkin and Coode, M. J. E. (1967). Revision of Genus P. Rudall. (1995b). Monocot systematics: A Valerianella in Turkey. Notes Roy. Bot. Gard. combined analysis. In M. J. Rudall et al. Edinb. 27: 219-256. (Eds.) Monocotyledons: Systematics and Evo- Copeland, H. F. (1938). “The kingdoms of organ- lution, 685-730. Royal Botanic Gardens, Kew. isms”. Quart. Rev. Biol. 13: 383–420. Chase, M. W., D. E. Soltis, P. G. Rudall, M. F. Copeland, (1956). The Classification of Lower Or- Fay, W. J. Hahn, S. Sullivan, J. Joseph, M. ganisms, Palo Alto: Pacific Books. Molvray, P. J. Kores, T. J. Givnish, K. J. Core, E. L. (1955). Plant Taxonomy. Prentice-Hall, Sytsma, and J. C. Pires. (2000). Higher level Englewood Cliffs. systematics of monocotyledons: An assess- Corner, E. J. H. (1946). Centrifugal Stamens. ment of current knowledge and a new clas- Journ. Arn. Arbor. 27: 423. sification. In K. L. Wilson and D. A. Morrison Cornet, B. (1986). Reproductive structures and (Eds.) Systematics and evolution of monocots. leaf venation of Late Triassic angiosperm, Proceedings of the 2nd International monocot Sanmiguelia lewisii. Evol. Theory 7: 231-309. symposium. Melbourne: CSIRO, 3-16. Cornet, B. (1989). Reproductive morphology and Chase, M. W., S. Zmarzty, M. D. Lledó, K. J. biology of Sanmiguelia lewisii and its bearing Wurdack, S. M. Swensen, and M. F. Fay. on angiosperm evolution in Late Triassic. (2002). When in doubt, put it in Evol. Trends Plants 3: 25-51. Flacourtiaceae: A molecular phylogenetic Cornet, B. (1993). Dicot-like leaf and flowers from analysis based on plastid rbcL DNA se- the Late Triassic tropical Newark Supergroup quences. Kew Bull. 57: 141-181. rift zone, U. S. A. Modern Geol. 19: 81-99. Chatton, E. 1937. Titres et travaux scientifiques, Cornet, B. (1996). A New Gnetophyte from the Sette, Sottano, Italy. Late Carnian (Late Triassic) of Texas and its Cheadle, V.I. (1953). Independent origin of ves- bearing on the origin of the angiosperm car- sels in the monocotyledons and dicotyle- pel and stamen. In: D. W. Taylor and L. J. dons. Phytomorphology 3: 23-44. Hickey (Eds.) Flowering Plant Origin, Evolu- Chen, Z.-D., S. R. Manchester, & H. -Y. Sun. tion and Phylogeny. Chapman & Hall Inc., (1999). Phylogeny and evolution of New York, . pp. 32-67. Betulaceae as inferred from DNA sequences, Couper, R. A. (1958). British Mesozoic morphology, and paleobotany. Amer. J. Bot. microspores and pollen grains. Palaeonto- 86: 1168-1181. graphica, Abt. B, 103: 75-179. 684 Plant Systematics

Crane, P. R., E. M. Friis and K. R. Pedersen. Dahlgren, G. (1991). Steps towards a natural (1995). The origin and early diversification system of the dicotyledons: embryological of angiosperms. Nature 374: 27-33. characters. Aliso 13 (1): 107-165. Crawford, D. J. and E. A. Julian. (1976). Seed Dahlgren, R. (1975). A system of classification protein profiles in the narrow-leaved species of angiosperms to be used to demonstrate of Chenopodium of the Western United the distribution of characters. Bot. Notiser States: Taxonomic value and comparison 128: 119-147. with distribution of flavonoid compounds. Dahlgren, R. (1977). Commentary on a Diagram- Am. J. Bot. 63: 302-308. matic Presentation of the Angiosperms. In: Crepet, W. L. (1974). Investigations of North K. Kubitzki (ed.). Flowering Plants: Evolution American Cycadeoides. The Reproductive bi- and Classification of Higher Categories. Plant ology of Cycadeoidea Palaeontographia 148: Systematics and Evolution Suppl. 1. 144-169. Springer-Verlag Wien/New York, pp. 253-283. Crepet, W. L., K. C. Nixon & M. A. Gandolfo. Dahlgren, R. (1980). A revised system of classi- (2004). Fossil evidence and phylogeny: The fication of angiosperms. Bot. J. Linn. Soc. 80: age of major angiosperm clades based on 91-124. mesofossil and macrofossil evidence from Dahlgren, R. (1983). General aspects of an- Cretaceous deposits. American J. Bot. 91: giosperm evolution and macrosystematics. 1666-1682 Nordic. J. Bot. 3: 119-149 Cronquist, A. (1968). Evolution and Classification Dahlgren, R. and F. N. Rasmussen. (1983). Mono- of Flowering Plants. Houghton Mifflin, New cotyledon evolution: characters and phyloge- York. netic estimation. Evol. Biol. 16: 255-395. Cronquist, A. (1977). On the taxonomic signifi- Dahlgren, R., H. T. Clifford and P. F. Yeo (1985). cance of secondary metabolites in An- The Families of Monocotyledons. Springer- giosperms. Plant Syst. Evol., Suppl. 1: 179- Verlag, Berlin. 189. Dahlgren, R., S. Rosendal-Jensen and B. J. Cronquist, A. (1981). An Integrated System of Clas- Nielsen (1981). A revised classification of sification of Angiosperms.Columbia Univ. the angiosperms with comments on the cor- Press, New York. relation between chemical and other char- Cronquist, A. (1988). Evolution and Classification acters, In: D. A. Young and D. S. Seigler of Flowering Plants. (2nd ed.). New York Bo- (Eds.). Phytochemistry and Angiosperm tanical Garden, Bronx, New York. Phylogeny. Praeger, New York, pp. 149-199. Cronquist, A., A. L. Takhtajan and W. Dahlgren, R. in cooperation with B. Hansen, Zimmerman (1966). On the higher taxa of K. Jakobsen and K. Larsen. (1974). Angiosper- Embryobionta. Taxon 15: 129-134. mernes taxonomi, 1. (2 & 3 in 1975, 4 in 1976). Cuénoud, P. (2002). Introduction to expanded In Danish. Kobenhsvn: Akademisk Forlag. Caryophyllales. pp. 1-4, in Kubitzki, K. (ed.), Darlington, C. D. and A. P. Wylie (1955). Chro- The Families and Genera of Vascular Plants. mosome Altas of Flowering Plants. Allen and IV. Flowering Plants. Dicotyledons. Malvales, Unwin, London. Capparales and Non-betalain Caryophyllales. Darlington, C. D. and E. K. Janaki-Ammal. Springer, Berlin. (1945). Chromosome Atlas of Cultivated Plants. Cuénoud, P, V. Savolainen, L. W. Chatrou, M. Allen and Unwin, London. Powell, R. J. Grayer, & M. W. Chase. (2002). Darwin, C. (1859). The Origin of Species. London. Molecular phylogenetics of Caryophyllales Daugherty, L. H. (1941). The Upper Triassic Flora based on nuclear 18S rDNA and plastid rbcL, of Arizona with a Discussion on its Geological atpB, and matK DNA sequences. American J. Occurrence. Contributions to Paleontology Bot. 89: 132-144. 526, Carnegie Institution of Washington. Dahlgren, G. (1989). An updated angiosperm Davis, J. I., and R. Soreng. (1993). Phylogenetic classification. Bot. J. Linn. Soc. 100: 197-203. structure in grass family (Poaceae) as in- Dahlgren, G. (1989). The last Dahlgrenogram. ferred from chloroplast DNA restriction site System of classification of dicotyledons, pp. variation. Am. J. Bot. 80: 1444-1454. 249-260. In: K. Tan [ed.]. The Davis and Hedge Davis, P. H. (1960). Materials for the Flora of Festschrift. Edinburgh Univ. Press, Turkey. IV. Ranunculaceae, II. Notes Roy. Edinburgh, pp. 249-260. Bot. Gard. Edinburgh, 23: 103-161. References 685

Davis, P. H. and V. H. Heywood. (1963). Principles lution within the apioid superclade. Canad. of Angiosperm Taxonomy. Oliver and Boyd, J. Bot. 78: 506-528. London. Doyle, J. A. (1969). Cretaceous angiosperm pol- de Candolle, A. P. (1813). Theorie elementaire de len of Atlantic Coastal Plain and its evolu- la botanique. Paris. tionary significance. J. Arnold Arboretum. 50: de Candolle, A. P. (1824-73). Prodromus systematis 1-35. naturalis regni vegetabilis. Paris, 17 vols. Doyle, J. A. (1978). Origin of angiosperms. Ann. de Jussieu, A. L. (1789). Genera plantarum. Paris. Rev. Ecol. Systematics. 9: 365-392. de Queiroz, K. and J. Gauthier. (1990). Phyloge- Doyle, J. A. (2001). Significance of molecular netic taxonomy. Ann. Rev. Ecol. Syst. 23: 449- phylogenetic analyses for paleobotanical in- 480. vestigations on the origin of angiosperms. de Queiroz, K. and J. Gauthier. (1992). Phylog- Palaeobotanist 50: 167-188. eny as central principle in taxonomy: Phylo- Doyle, J. A. and Donoghue. (1987). The origin of genetic definitions of taxon names. Syst. angiosperms: a cladistic approach. In: E. M. Zool. 39: 307-322. Friis, W. G. Chaloner and P. R. Crane (Eds.). de Soo, C. R. (1975). A review of new classifica- The Origins of Angiosperms and Their Biologi- tion system of flowering plants cal Consequences. Cambridge University (Angiospermatophyta, Magnoliophytina). Press, U. K, pp. 17-49. Taxon 24(5/6): 585-592. Doyle, J. A. and Donoghue. (1993). Phylogenies Delavoryas. (1971). Biotic provinces and the Ju- and angiosperm diversification. Paleobiology rassic-Cretaceous floral transition. Proc. N. 19: 141-167. Aer. Paleontol. L: 1660-1674. Doyle, J. A., M. Van Campo and B. Lugardon. Dilcher, D. L. (1979). Early angiosperm repro- (1975). Observations on exine structure of ductions: An introductory report. Rev. Eucommiidites and Lower Cretaceous an- Palaeobot. Palynol. 27: 291-328. giosperm pollen. Pollen and Spores 17: 429- Dilcher, D. L. and P. L. Crane. (1984). An early 486. Angiosperm from the Western Interior of Doyle, J. A. and P. K. Endress. (2000). Morpho- North America. Ann. Missouri Bot. Gard. 71: logical phylogenetic analysis of basal an- 380-388 giosperms: comparison and combination Donoghue, M. J. and J. A. Doyle. (1989). Phylo- with molecular data. International Journal of genetic analysis of angiosperms and the re- Plant Sciences. 161 (6 suppl.): S121-S153. lationships Hamamelidae. In: Pr. R. Crane Doyle, J. A., H. Sauquet, T. Scharaschkin & A. and S. Blackmore (Eds.). Evolution, Systemat- Le Thomas. (2004). Phylogeny, molecular and ics and Fossil History of the Hamamelidae. fossil dating, and biogeographic history of Claredon Press, Oxford, pp. 17-45. Annonaceae and Myristicaceae (Magnoliales). Donoghue, M. J., T. Eriksson, P. A.Reeves and Int. J. Plant Sci. 165(4 Suppl.): S55-S67. R. G. Olmstead. (2001). Phylogeny and phy- Doyle, J. J. (1994). Phylogeny of legume family: logenetic taxonomy of Dipsacales, with spe- An approach to understanding the origins of cial reference to Sinadoxa and Tetradoxa nodulation. Ann. Rev. Ecol. Syst. 25: 325-349. (Adoxaceae). Harvard Papers Bot. 6: 459-479. Doyle, J. J., J. A. Chappill, C. D. Bailey and T. Doweld, A. B. (2001). Tentamen Systematis Kajita. (2000). Towards a comprehensive Plantarum Vascularium (Tracheophytorum). Mos- phylogeny of legumes: Evidence from rbcL cow: GEOS. sequences and non-molecular data. Pp. 1- Downie, S, R., D. S. Katz-Downie, and M. F. 20, in Herendeen, P. S., & Bruneau, A. (eds), Watson, (2000a). A phylogeny of the flower- Advances in Legume Systematics, Part 9. Royal ing plant family Apiaceae based on chloro- Botanic Gardens, Kew. plast rpl16 and rpoC1 sequences: Towards a Downie, S. R. , D. S. Katz-Downie and M. F. suprageneric classification of subfamily Watson. (2000). A phylogeny of the flowering Apioideae. Amer. J. Bot. 87: 273-292. plant family Apiaceae based on chloroplast Downie, S. R., M. F. Watson, K. Spalik and D. S. rpl16 and rpoC1 sequences: Towards a Katz-Downie. (2000b). Molecular systemat- suprageneric classification of subfamily ics of Old World Apioideae (Apiaceae): Rela- Apioideae. American J. Bot. 87: 273-292. tionships among some members of tribe Du Rietz. (1930). Fundamental units of biologi- Peucedaneae sensu lato, the placement of cal taxonomy. Svensk bot. Tidskr. 24: 333- several island-endemic species, and reso- 428. 686 Plant Systematics

Duangjai, S., B. Wallnoeffer, R. Samuel, F. Engler, A. and Diels, L. (1936). Syllabus der Munzinger and M. W. Chase, M. W. (2006a). pflanzenfamilien. 11th ed. Berlin. Phylogenetic relationships and infrafamilial Engler, A. and Prantl, K. (1887-1915). Die classification of Ebenaceae s.l. based on six naturlichen pflanzenfamilien. Leipzig, 23 vols. plastid markers. Pp. 218-219, in Botany 2006 Erbar, C., S. Kusma and P. Leins. (1999). De- - Looking to the Future - Conserving the Past. velopment and interpretation of nectary or- [Abstracts: Botanical Society of America, etc.] gans in Ranunculaceae. Flora 194: 317-332. Duangjai, S., B. Wallnoeffer, R. Samuel, F. Erdtman, G. (1948). Did dicotyledonous plants Munzinger and M. W. Chase, M. W. (2006b). exist in Early Jurrassic time? Geol. Fören. Generic delimitation and relationships in Stockholm Förh. 70: 265-271. Ebenaceae sensu lato: Evidence from six Erdtman, G. (1966). Pollen Morphology and Plant plastid DNA regions. American J. Bot. 93: Taxonomy. Angiosperms. (An Introduction to 1808-1827. Palynology. I.). Hafner Publ. Co., London. Dykes, W. R. (1913). The Genus Iris. Evans, R. C. and T. A. Dickinson. (2002). How do Eames, A. J. (1961). Morphology of Angiosperms. studies of comparative ontogeny and mor- McGraw-Hill Book Co., New York. phology aid in elucidation of relationships Eckenwalder, J. E. (1976). Re-evaluation of within the Rosaceae? P. 108, in Botany 2002: Cupressaceae and Taxodiaceae: A proposed Botany in the Curriculum, Abstracts. [Madi- merger. Madroño 23: 237-256. son, Wisconsin.] Ehrendorfer, F. (1968). Geographical and ecologi- Evans, R. C., C. Campbell, D. Potter, D. Mor- cal aspects of infraspecific diiferentiation . gan, T. Eriksson, L. Alice, S. -H Oh, E. Bortiri, In: V. H. Heywood (ed.). Modern Methods in F. Gao, J. Smedmark and M. Arsenault. Plant Taxonomy Acad. Press, New York, pp. (2002a). A Rosaceae phylogeny. P. 108, in 261-296. Botany 2002: Botany in the Curriculum, Ab- Ehrendorfer, F. (1983). Summary Statement. stracts. [Madison, Wisconsin.] Nord. J. Bot. 3: 151-155. Evans, R. C., T. A. Dickinson, T. A., and C. Eichler, A. W. (1883). Syllabus der Vorlesungen Campbell. (2002b). The origin of the apple über Specielle und Medicinisch-Pharmaceutische subfamily (Maloideae; Rosaceae) is clarified Botanik. Leipzig. by DNA sequence data from duplicated Endress, M. E., B. Sennblad, S. Nilsson, L. GBSSI genes. American J. Bot. 89: 1478-1484. Civeyrel, M. W. Chase, S. Huysmans, E. Fairbrothers, D. E. (1983). Evidence from nucleic Grafröm and B. Bremer. (1996). A phylogenetic acid and protein chemistry, in particular se- analysis of of Apocynaceae s. str. And some rology, in angiosperm classification. Nordic. related taxa in Gentianales: A multidis- J. Bot. 3: 35-41. ciplinary approach Opera Bot. Belg. 7: 59-102. Farjon, A. (2005). A Monograph of Cupressaceae Endress, P. K. (1977). Evolutionary Tends in and Sciadopitys. Royal Botanic Gardens, Kew. Hamamelidales-Fagales-Group. In H. Fan, C. and Q.-Y. Xiang. (2003). Phylogenetic Kubitzki, Flowering Plants: Evolution and clas- analyses of Cornales based on 26S rRNA and sification of higher categories. Plant. Syst. Evol. combined 26S rDNA-MATK-RBCL sequence Suppl. 1, 321-347. data. American J. Botany 90: 1357-1372. Engler, A. (1892). Syllabus der Pflanzenfamilien. Farr, E. R., J. A. Leussink and F. A. Stafleu (Eds.). Berlin. (1979). Index Nominum Genericorum (Plantarum). Engler, A. (ed.). (1900-1953). Das Pflanzenreich. Regnum Veg. 100-102: 1-1896. Regni vegetabilis conspectus Im Auftrage der Farr, E. R., J. A. Leussink and G. Zijlstra (Eds.). Preus. Akademie der Wissenschaften, (1986). Index Nominum Genericorum (Plantarum) Leransgegeben von A. Engler, Berlin. (after Supplementum I. Regnum Veg. 113: 1-126. Engler’s death subsequent volumes, continu- Fassett, N. C. (1957). A Manual of Aquatic Plants. ing upto 1953 were edited by other authors) Univ. Wisconin Press, Madison. Engler, A. (H. Melchior and E. Werdermann, Faust, W. Z. and S. B. Jones. (1973). The sys- Eds.). (1954). Syllabus der pflanzen- tematic value of trichome complements in a familien.12th ed., vol. 1. Gebruder Borntraeger, North American Group of Vernonia Berlin. (Compositae). Rhodora 75: 517-528. Engler, A. (H. Melchior, ed.). (1964). Syllabus der Fay, M. F., P. J. Rudall, S. Sullivan, K. L. Stobart, pflanzenfamilien.12th ed., vol. 2. Gebruder A. Y. de Bruijn, G. Reeves, M. Qamaruz- Borntraeger, Berlin. Zaman, W.-P. Hong, J. Joseph, W. J. Hahn, References 687

J. G. Conran, and M. W. Chase. (2000). Phy- Sarcopus abberans Gagnepain. Bull. Soc. Bot. logenetic studies of Asparagales based on Fr. 94: 182-185. four plastid DNA regions. Pp. 360-371, in Garcke, A. (1972). Illustrierte Flore von K. L. Wilson and D. A. Morrison (Eds.), Deutschland und Angrenzende Gebiete, Monocots: Systematics and Evolution. CSIRO, 23rd ed. (revised by K. von Weihe ed.). Parey, Collingwood. Berlin. Fay, M. F., B. Bremer, G. T. Prance, M. van der Garnock-Jones, P. J. and C. J. Webb. (1996). The Bank, D. Bridson and M. W. Chase. (2000a). requirement to cite authors of plant names Plastid rbcL sequence data show Dialypeta- in botanical journals. Taxon, 45: 285-286. lanthus to be member of Rubiaceae. Kew Gaussen, H. (1946). Les Gymnosperms actuelles Bull. 55: 853-864. et fossiles. Pt. 3. Travaux du Laboratoire Federov, A. A. (ed.). (1969). Chromosome Numbers Forestier, Toulouse. of Flowering Plants. Akad. Nauk SSSR, Gershenzon, J. and T. J. Mabry. (1983). Second- Leningrad. ary metabolites and the higher classification Fiori, A. and G. Paoletti. (1896). Flora analitica of angiosperms. Nordic J. Bot. 3: 5-34. d’Italia 1: 1-256. Padova. Geuten, K. E. Smets, P. Schols, Y. -M. Yuan, S. Fishbein, M., C. Hibsch-Jetter, D. E. Soltis and Janssens, P. Küpfer, and N. Pyck. (2004). L. Hufford. (2001). Phylogeny of Saxifragales Conflicting phylogenies of balsaminoid fami- (Angiosperms, Eudicots): Analysis of a rapid, lies and the polytomy in Ericales: Combin- ancient radiation. Syst. Biol. 50: 817-847. ing data in a Bayesian framework. Mol. Phyl. Fisher, M. J. (1928). Morphology and anatomy of Evol. 31: 711-729. flowers of Salicaceae. I. Amer. J. Bot. 15: 307- Geuten, K., A. Becker, K. Kaufmann, P. Caris, 326. S. Janssens, T. Viaene, G. Theißen and E. Fisher, R. A. (1930). Genetical Theory of Natural Smets. (2006). Petaloidy and petal identity Selection. Oxford: Claredon Press. MADS-box genes in the balsaminoid genera Fischer, E. (2004). Balsaminaceae. Pp. 20-25, in Impatiens and Marcgravia. Plant J. 47: 501-518. Kubitzki, K. (ed.), The Families and Genera of Gifford, E. M. and A. S. Foster. (1988). Morphol- Vascular Plants. VI. Flowering Plants. Dicoty- ogy and evolution of vascular plants, 3rd ed. ledons. Ceslastrales, Oxalidales, Rosales, W. H. Freeman, New York. Cornales, Ericales. Springer, Berlin. Gleason, H. A. (1963). The New Britton and Brown Ford, B. A., M. Iranpour,R. F. C. Naczi, J. R. Starr Illustrated Flora. 3 Vols. Hafner, New York. & C. A. Jerome. (2006). Phylogeny of Carex Gornall, R. J. 1989. Anatomical evidence and the subg. Vignea (Cyperaceae) based on non- taxonomic position of Darmera (Saxifra- coding nrDNA sequence data. Syst. Bot. 31: gaceae). Bot. J. Linnean Soc. 100: 173-182. 70-82. Gottsberger, G. (1974). Structure and function

Freudenstein, J. V, and M. W. Chase. (2001). of primitive angiosperm flower-A Discussion. Analysis of mitochondrial nad1b-c intron se- Acta Bot. Neerl. 23: 461-471. quences in Orchidaceae: Utility and coding Gower, J. C. (1966). Some distance properties of of length-change characters. Syst. Bot. 26: latent root and vector methods used in mul- 643-657. tivariate analysis. Biometrika 53: 325-338. Friedrich, H. C. (1956). Studien über die Graham, S. W. and R. G. Olmstead. (2000a). natürliche verwandtschaft der Plumbaginales Evolutionary significance of an unusual und Centrospermae. Phyton (Austria) 6: 220- chloroplast DNA inversion found in two basal 263. angiosperm lineages. Curr. Genet. 37: Frodin, D. G. (1984). Guide to the Standard Floras 183-188. of the World. Cambridge Univ. Press. Graham, S. W. and R. G. Olmstead. (2000b). Frost, F. H. (1930). Specialization in secondary Utility of 17 chloroplast genes for inferring xylem in dicotyledons. I. Origin of vessels. the phylogeny of the basal angiosperms. Botanical Gazette 89: 67-94. American J. Bot. 87: 1712-1730. Fuse, S. and M. N. Tamura. (2000). A phyloge- Grant, V. (1957). The plant species in theory netic analysis of the plastid matK gene with and practice. In: E. Mayr (Ed.). The Species emphasis on Melanthiaceae sensu lato. Plant Problem. Amer. Assoc. Adv. Sci. Washington, Biology 2: 415-427. D. C., pp. 39-80. Gagnepain, F. And Boureau. (1947). Nouvelles Grant, V. (1981). Plant Speciation (2nd ed.). considerations systématische á propos du Columbia Univ. Press, New York. 688 Plant Systematics

Grayum, M. (1987). A summary of evidence and Harris, T. M. (1932). The fossil flora of Scorseby arguments supporting the removal of Acorus Sound East Greenland. Part 3: Caytoniales from Araceae. Taxon 36: 723-729. and Bennettitales. Meddelelser om Grônland Gregory, W. C. (1941). Phylogenetic and cytologi- 85(5): 1-133. cal studies in the Ranunculaceae. Trans. Am. Hart, J. A. (1987). A cladistic analysis of Phil. Soc. 3: 443-520. conifers: Preliminary results. J. Arnold Greuter, W., D. L. Hawksworth, J. Mcneill, Arbor. 68: 269-307. M. A. Mayo, A. Minelli, P. H. A. Sneath, B. J. Hartl, D. L. and E. W. Jones. (1998). Genetics: Tindall, P. Trehane, and P. Tubbs. (1998). Principles and Analysis. 4th ed. Jone and Draft BioCode (1997): the prospective inter- Bartlett Publishers, London. national rules for the scientific names of Hartmann, H. E. K. (1993). Aizoaceae. In: K. organisms. Taxon 47: 127-150. Kubitzki, J. G. Rohwer and V. Bittrich (Ed.) Greuter, W., J. Mcneill, F. R. Barrie, H. M. The Families and Genera of vascular plants, Burdet, V. Demoulin, T. S. Filgueiras, D. H. Vol. 2, Magnoliid, Hamamelid and Caryophy- Nicolson, P. C. Silva, J. E. Skog, P. Trehane, llid families, p 37-69. Springer-Verlag, Berlin. N. J. Turland and D. L. Hawksworth (editors Haszprunar, G. (1987). Vetigastropoda and sys- & compilers). (2000). International code of tematics of Streptpneuros Gastropoda (Mol- botanical nomenclature (St Louis Code) lusca). Journal of Zoology 211: 747-770. adopted by the Sixteenth International Bo- Hawksworth, D.L. (1995). Steps along the road tanical Congress St. Louis, Missouri, July - to a harmonized bionomenclature. Taxon, 44: August 1999. Regnum Veg. Vol 138. 447-456. Greuter, W., R.K. Brummitt, E. Farr, N. Kilian, Hedge, I. C. and J. M. Lamond. (1972). P. M.Kirk and P.C. Silva. (1993). Names in Umbelliferae. Multi-access key to the Turk- current use for extant plant genera. Koeltz, ish genera. In: P. H. Davis (ed.). Flora of Tur- Königstein, Germany. xxvii + 1464 pp. Regnum key. Edinburgh Univ. Press, Edinburgh, vol. veg. Vol. 129. 4, pp. 171-177. Gunderson, A. (1939). Flower buds and phylog- Hedrén, M., M. W. Chase, and R. G. Olmstead. eny of dicotyledons. Bull. Torrey Bot. Club (1995). Relationships in the Acanthaceae and 66: 287-295. related families as suggested by cladistic Gustafsson, M. H. G. (2002). Phylogeny of analysis of rbcL nucleotide sequences. Plant Clusiaceae based on rbcL sequences. Int. Syst. Evol. 194: 93-109. J. Plant Sci. 163(6): 1045-1054. Hegi, G. (1906-1931). Illustrierte Flora Von Haeckel, E. 1866. Generelle Morphologie der Mitteleuropa. Ed. I, Munchen. Organismen. Reimer, Berlin. Heimerl, A. (1934). Nyctaginaceae in Engler and Haeckel, E. (1887). Echte Gräser. Engler and Prantl Prantl, Die naturlichen pflanzenfamilien, Die natürlichen Pflanzenfamilien, II, 2. ed. 2, Bd. 16c, 86-134. Hahn, W. J. 2002. A molecular phylogenetic study Henderson, D. M. (1983). International Directory of the Palmae (Arecaceae) based on atpB, rbcL of Botanical Gardens IV. Koeltz, Koenigstein. and 18s nrDNA sequences. Syst. Biol. 51: Hennig, W. (1950). Grundzüge einer Theorie der 92-112. phylogenetischen Systematik. Deutscher Hall, D. W. (1981). Microwave: a method to con- Zentralverlag, Berlin. trol herbarium insects. Taxon, 30: 818-819. Hennig, W. (1957). Systematik und Phylogenese. Hanelt, P. and J. Schultze-Motel. (1983). Pro- Ber. Hundertjahrfeier Deutsch. Entomol. Ges., posal (715) to conserve Triticum aestivum L. pp. 50-70. (1753) against Triticum hybernum L. (1753) Hennig, W. (1966). Phylogenetic Systematics. (Gramineae). Taxon 32: 492-498. Translated by D. D. Davies and R. Zangerl. Hansen, A. (1920). Die Pflanzendecke der Erde. Univ. Illinois Press, Urbana. Leipzig. Hermsen, E. J., T. N. Taylor, E. L. Taylor and Harborne, J. B. and B. L. Turner. (1984). Plant D. W. Stevenson. (2006). Cataphylls of the Chemosystematics. Acad. Press, London. Middle Triassic cycad Antarcticycas schopfii Harris, J. G. and M. W. Harris. (1994). Plant and new insights into cycad evolution. Ameri- identification terminology: An illustrated glos- can J. Bot. 93: 724-738. sary. Spring Lake, Publishing, Spring Lake, Heslop-Harrison, J. (1952). A reconsideration of UT. plant teratology. Phyton 4: 19-34. References 689

Heslop-Harrison, J. (1958). The unisexual flower- Pooideae (Poaceae) based on nuclear rDNA a reply to criticism. Phytomorphology 8: 177- (ITS) sequences. Theor. Appl. Genet. 90: 389- 184. 398. Heywood, V. H. (ed.). 1978. Flowering Plants of Huber, H. (1991). Angiospermen. Leitfaden durch the World. Oxford University Press, London. die Ordnungen und Familien der Bedektsamer. Hibbett, D. and M. J. Donoghue. (1998). Inte- Gustav Fischer, Stuttgart. grating phylogenetic analysis and classifica- Hughes, N. F. (1961). Further interpretation of tion in fungi. Mycologia 90: 347-356. Eucommiidites Erdtman, 1948. Palaeontology Hickey, L. J and D. W. Taylor. (1996). Origin of 4: 292-299. angiosperm flower. In: D. W. Taylor and L. J. Hufford, L. (1997). A phylogenetic analysis of Hickey (Eds.) Flowering Plant Origin, Evolu- Hydrangeaceae based on morphological data. tion and Phylogeny. Chapman & Hall Inc., Int. J. Plant Sci. 158: 652-672. New York, pp. 176-231. Hufford, L. (2001). Ontogeny and morphology of Hickey, L. J. and D. W. Taylor. (1992). the fertile flowers of Hydrangea and allied Paleobiology of early angiosperms: evidence genera of tribe Hydrangeeae from sedimentological associations in Early (Hydrangeaceae). Bot. J. Linn. Soc. 137: 139- Cretaceous Potomac Group of eastern U. S. 187. A. Paleontological Soc. Spec. Publ. 6: 128. Hutchinson, J and J. M. Dalzeil. (1927-1929). Hickey, L. J. and J. A. Doyle. (1977). Early Cre- Flora of West Tropical Africa. London, 2 vols. taceous fossil evidence for angiosperm evo- Hutchinson, J. (1946). A Botanist in South Africa. lution. Bot. Rev. 43: 1-104 London. Hill, S. R. (1983). Microwave and the herbarium Hutchinson, J. (1948). British Flowering Plants. specimens: potential dangers. Taxon 32: 614- London. 615. Hutchinson, J. (1964-67). The Genera of Flower- Hilu, K. , T. Borsch, K. Muller, D. E. Soltis, P. S. ing Plants. Claredon, Oxford, 2 vols. Soltis, V. Savolainen, M. W. Chase, M. P. Hutchinson, J. (1968). Key to the Families of Flow- Powell, L. A. Alice, R. Evans, H. Sauquet, C. ering Plants of the World. Clarendon, Oxford, Neinhuis, T. A. B. Slotta, J. G. Rohwer, C. 117 pp. S. Campbell, and L. W. Chatrou. (2003). An- Hutchinson, J. (1969). Evolution and Phylogeny giosperm phylogeny based on matK sequence of Flowering Plants. Acad. Press, London. information. American J. Bot. 90: 1758-1766. Hutchinson, J. (1973). The Families of Flowering Hjelmquist, H. (1948). Studies on the floral mor- Plants. (3rd ed.). Oxford Univ. Press. (2nd ed. phology and phylogeny of the Amentiferae. 1959; Ist ed. 1926, 1934) Bot. Notiser, Suppl. 2: 1-171. Index Kewensis plantarum phanerogamarum. (1893- Holmgren, P. K., N. H. Holmgren and L. C. 95), 2 vols. Oxford. 16 supplements up to Barnett. (1990). Index herbariorum. Part I: 1971. The Herbaria of the World (8th ed.). Regnum Jaccard, P. (1908). Nouvelles recherches sur la Veg.120. distribution florale. Bull. Soc. Vaud. Sci. Nat. Hooker, J. D. (1870). Student’s Flora of British 44: 223-270. Isles. Macmillan and Co., London. (3rd ed. Janesen, R. K. and J. D. Palmer. (1987). A chlo- in 1884). roplast DNA inversionmarks an ancient evo- Hooker, J. D. (1872-97). Flora of British India.. L. lutionary split in sunflower family Reeve and Co., London, 7 vols. (Asteraceae). Proc. Nat. Acad. Sc., USA 84: Hoot, S. B. (1995). Phylogeny of Ranunculaceae 5818-5822. based on epidermal preliminary atpB, rbcL Janssens, S., K. Geuten, Y. M. Yuan, Y. Song, and 18S nuclear ribosomal DNAsequence P. Küpfer and E. Smets. (2006). Phylogenetics data. Plant Syst. Evol. Suppl. 9: 241-251. of Impatiens and Hydrocera (Balsaminaceae) Hoot, S. B., J. W. Kadereit, F. R. Blattner, K.B. using chloroplast atpB-rbcL spacer Jork, A. E. Schwarzbach and P. R. Crane. sequences. Syst. Bot. 31: 171-180. (1998). Data congruence and phylogeny of Jardine, N. and R. Sibson. (1971). Mathematical the Papaveraceae s.l. based on four data Taxonomy. Wiley, London. sets: atpB and rbcL sequences, trnK restric- Ji, Q., L. M. Bowe, Y. Liu, & D. W. Taylor. (2004). tion sites, and morphological characters. Early Cretaceous Archaefructus eoflora sp. Syst. Bot. 22: 575-590. nov., with bisexual flowers from Beipiao, Hsiao, C. , N. J. Chatterton, K. H. Asay and K. Western Liaoning, China. Acta Geol. Sinica 78: B. Jensen. (1994). Molecular phylogeny of 883-896. 690 Plant Systematics

Johnson, B. L. (1972). Seed protein profiles and Keating, R. C. (2004b). Systematic occurrence the origin of the hexaploid wheats. Amer. J. of raphide crystals in Araceae. Ann. Missouri Bot. 59: 952-960. Bot. Gard. 91: 495-504. Johnson, L. A. S. (1959). The Families of Cycads Keller, R. (1996). Identification of tropical woody and Zamiaceae of Australia. Proc. Linn. Soc. plants in the absence of flowers and fruits: A 84: 64-117. field guide. Birkauser, Basel. Johnson, L. A. S. and K. L. Wilson. (1993). Keller, R. A., R. N. Boyd & Q. D. Wheeler. (2003). Casuarinaceae. Pp. 237-242, in Kubitzki, K., Illogical basis of Phylogenetic nomenclature. Rohwer, J. G. and V. Bittrich. (eds), The Fami- Bot. Rev. 69(1): 93-110. lies and Genera of Vascular Plants. II. Flower- Kellogg, E. A. 2000. The grasses: A case study in ing Plants: Dicotyledons, Magnoliid, Hamamelid macroevolution. Ann. Rev. Ecol. Syst. 31: 217- and Caryophyllid Families. Springer, Berlin. 38. Jones, S. B. Jr. and A. E. Luchsinger. (1986). Kerguélen, M. (1980). Proposal (68) on article 57.2 Plant Systematics, 2nd ed. McGraw-Hill Book to correct the Triticum example. Taxon 29: Co., New York. 516-517. Jordan, A. (1873). Remarques sur le fait de Kimura, M. (1968). Evolutionary rate at the mo- l’existence en société à l’état sauvage des lecular level. Nature 217: 624–626. espéces végétales affines. Bull. Ass. Fr. Kimura, M. (1983). The Neutral Theory of Molecu- Avanc. Sci. 2, session Lyon. lar Evolution. Cambridge University Press, Judd, W. S., C. S. Cambell, E. A. Kellogg, P. F. Cambridge. Stevens and M. J. Donoghue. (2002). Plant Klak, C., A. Khunou, G. Reeves, and T. A. J. Systematics: A Phylogenetic Approach. 2nd ed. Hedderson. (2003). A phylogenetic hypoth- Sinauer Associates, Inc., USA (Ist ed., 1999). esis for the Aizoaceae (Caryophyllales) based Judd, W. S., R. W. Sanders, and M. J. Donoghue. on four plastid DNA regions. American J. Bot. (1994). Angiosperm family pairs: Preliminary 90: 1433-1445. cladistic analyses. Harvard Pap. Bot. No. 5: Klak, C., P. V. Bruyns and T. A. J. Hedderson. 1-51. (2007). A phylogeny and new classification Kallersjo, M., G. Bergqvist & A. A. Anderberg for Mesembryanthemoideae (Aizoaceae). (2000). Generic realignment in primuloid Taxon 56: 737-756. families of the Ericales s.l. (Angiosperms): Kluge, A. G. and J. S. Farris. (1969). Quantita- A phylogenetic analysis based on DNA tive phyletics and the evolution of anurans. sequences of rbcL and ndhF. American J. Bot. Syst. Zool. 18: 1-32. 87: 1325-1341 Komarov, V. L. And B. K. Shishkin. (1934-1964). Kårehed, J., J. Lundberg, B. Bremer and K. Flora SSSR. AN SSSR Press, Moscow/ Bremer. (1999). Evolution of the Australian Leningrad, 30 vols. Australasian families Alseuosmiaceae, Kosakai, H., M. F. Moseley and V. I. Cheadle. Argophyllaceae and Phellinaceae. Systematic (1970). Morphological studies in the Botany 24: 660-682. Nymphaeaceae. V. Does Nelumbo have ves- Karp, G. (2002). Cell and Molecular Biology: con- sels?. Amer. J. Bot. 57: 487-494. cepts and experiments. 3rd ed. John Wiley and Kramer, K. U. and P. S. Green (Eds.). (1990). Vol. Sons, New York. I, Pteridophytes and Gymnosperms; in K. Keating, R. C. (2003a). Anatomy of the Monocoty- Kubitzki (ed.) Families and Genera of Vascular ledons. IX. Acoraceae and Araceae (ed. Gre- Plants. pp. 284-391, Springer-Verlag, Berlin. gory, M., & Cutler, D. F.). Oxford University Krassilov, V. A. (1977). Contributions to the Press, Oxford. knowledge of the Caytoniales. Rev. Paleobot. Keating, R. C. (2003b). Vegetative anatomical data Palynology 24: 155-178. and its relationship to a revised classifica- Kraus, R. (1897). Über Specifishe Reactionin in tion of the genera of Araceae. Missouri Bot. Keimfreien Filtraten aus Cholera, Typhus Gard. Monogr. Syst. Bot. [in press; cited in und Pestbouillon Culturen erzeugt durch APweb]. homologes Serum. Weiner Klin. Wechenschr. Keating, R. C. (2004a). Vegetative anatomical 10: 136-138. data and its relationship to a revised classi- Kron, K. A. (1996). Phylogenetic relationships of fication of the genera of Araceae. Ann. Mis- Empetraceae, Epacridaceae, Ericaceae, souri Bot. Gard. 91: 485-494. Monotropaceae and Pyrolaceae. Evidence References 691

from nucleotide ribosomal 18S sequence Les, D. H. and R. R. Haynes. (1995). Systemat- data. Ann. Bot. 77: 293-303. ics of subclass Alismatidae: A synthesis of Kubitzki, K. (ed.) (1993). ‘The Families and Gen- approaches. Pp. 353-377, in Rudall, P. J., era of Vascular Plants’, Vol. II. Flowering Plants, Cribb, P. J., Cutler, D. F., & Humphries, C. Dicotyledons: Magnoliid, Hamamelid and J. (Eds.), Monocotyledons: Systematics and Caryophyllid Families. Springer-Verlag, New Evolution, vol. 2. Royal Botanic Gardens, Kew. York. Les, D. H., M. A. Cleland, and M. Waycott. (1997). Kubitzki, K. and M. W. Chase. (2002). Introduc- Phylogenetic studies in Alismatidae, II: Evo- tion to Malvales. Pp. 12-16, in Kubitzki, K. lution of marine angiosperms (seagrasses) (ed.), The Families and Genera of Vascular and hydrophily. Syst. Bot. 22: 443-463. Plants. IV. Flowering Plants. Dicotyledons. Levin, R. A., W. L. Wagner, P. C. Hoch, M. Malvales, Capparales and Non-betalain Nepokroeff, J. C. Pires, E. A. Zimmer and K. Caryophallales. Springer, Berlin. J. Sytsma. (2003). Family-level relationships Lam, H. J. (1961). Reflections on angiosperm of Onagraceae based on rbcL and ndhF data. phylogeny. I and II. Facts and theories. Amer. J. Bot. 90(1): 107-115. Koninklijke Akademie van Wetenschappen te Levin, R. A., W. L. Wagner, P. C. Hoch, W. J. Amsterdam, Afdruunken Natuurkunde, Hahn, A. Rodriguez, D. A. Baum, L. Katinas, Procesverbaal 64: 251-276. E. A. Zimmer and K. J. Sytsma. (2004). Lamarck, J. B. P. (1778). Flore Francaise. Paraphyly in Tribe Onagreae: Insights into Imprimerie Royale, Paris, 3 vols. Phylogenetic Relationships of Onagraceae Lamarck, J. B. P. (1809). Philosophie Zoologique. Based on Nuclear and Chloroplast Sequence Paris. Data. Systematic Botany. 29(1): 147-164. Lamb Frye, A. S. and K. A. Kron. (2003). RbcL Linnaeus, C. (1730). Hortus uplandicus. phylogeny and character evolution in Stockholm. Polygonaceae. Syst. Bot. 28: 326-332. Linnaeus, C. (1735). Systema naturae. (2nd ed.). Lance, G. N. and W. T. Williams. (1967). A gen- Lugduni Batavorum. Stockholm. eral theory of classificatory sorting strate- Linnaeus, C. (1737). Critica botanica. Leyden. gies. 1. Hierarchical systems. Computer J. 9: Linnaeus, C. (1737). Flora Lapponica. Amsterdam. 373-380. Linnaeus, C. (1737). Genera plantarum. Lugduni Lapage, S.P., P.H.A. Sneath, E.F. Lessel, V.B.D. Batavorum. Skerman, H.P.R. Seeliger, and W.A. Clark Linnaeus, C. (1737). Hortus Cliffortianus. (Eds.). (1992). International Code of Nomencla- Amsterdam. ture of Bacteria (Bacteriological Code 1990 Linnaeus, C. (1751). Philosophica botanica. Revision). Amer. Soc. Microbiol., Washing- Stockholm, 362 pp. ton, D.C. xlii + 189 pp. Linnaeus, C. (1753). Species plantarum. Laubengayer, R. A. (1937). Studies in the Stockholm, 2 vols. anatomy and morphology of the Linnaeus, C. (1762). Fundamenta fructificationis. polygonaceous flower. Amer. J. Bot. 24: 329- Stockholm. 343. Loconte, H. (1993). Berberidaceae. In K. Kubitzki, Lawrence, G. H. M. (1951). Taxonomy of Vascular J. G. Rohwer and V. Bittrich (Eds.) The fami- Plants. Macmillan, New York. lies and Genera of vascular plants, vol. 2, Lee, T. B. (1979). Illustrated Flora of Korea. Magnoliid, hamamelid and caryophyllid families. Hyangmunsa, Seoul. 147-152. Springer-Verlag, Berlin. Lee, Y. S. (1981). Serological investigations in Loconte, H. (1996). Comparison of Alternative Ambrosia (Compositae: Ambrosieae) and rela- Hypotheses for the Origin of Angiosperms. tives. Syst. Bot. 6: 113-125. In D. W. Taylor and L. J. Hickey (Eds.) Flow- Lemesle, R. (1946). Les divers types de fibres a ering Plant Origin, Evolution and Phylogeny, ponctuations areolees chez les 267-285. Chapman and Hall, Inc, New York. dicotyledones apocarpiques les plus Loconte, H. and D. W. Stevenson. (1991). Cla- archaiques et leur role dans la phylogenie. distics of Magnoliidae. Cladistics 7: 267-296. Ann. Sci. Nat. Bot. et Biol. Vegetal 7: 19-40. Löve, A., D. Löve and R. E. G. Pichi-Sermolli. Les, D. H., D. K. Garvin and C. F. Wimpee. (1977). Cytotaxonomic Atlas of Pteridophytes. (1991). Molecular evolutionary history of Cramer, Koenigstein. ancient aquatic angiosperms. Proc. Nat. Acad. Lundberg, J. (2001). A well resolved and sup- Sc. USA 88: 10119-10123. ported phylogeny of Euasterids II based on 692 Plant Systematics

a Bayesian inference, with special empha- bers and their taxonomic significance. Bot. sis on Escalloniaceae and other incertae J. Linn. Soc. (London) 60: 411-417. sedis. Chapter V, in Lundberg, J. Phyloge- Markham, K. R., L. J. Porter, E. O. Cambell, J. netic studies in the Euasterids II with particu- Chopin and M. L. Bouillant. (1976). Phy- lar reference to Asterales and Escalloniaceae. tochemical support for the existence of two Acta Universitatis Upsaliensis, Uppsala. species in the genus Hymenophyton. Phy- Lundberg, J. and K. Bremer. (2002). A phyloge- tochemistry 15: 1517-1521. netic study of the order Asterales using one Martin, W., D. Lydiate, H. Brinkmann, G. large morphological and three molecular data Forkmann, H. Saedler and R. Cerff. (1993). sets. International Journal of Plant Sciences. Molecular phylogenies in angiosperm evolu- Mabberley, D. J. (1997). The Plant Book. Ed. 2. tion. Mol. Biol. Evol. 10: 140-162. Cambridge University Press, Cambridge. Mason, H. L. (1936). The principles of geographic Mabry, T. J. (1976). Pigment dichotomy and DNA- distribution as applied to floral analysis. RNA hybridization data for Centrospermous Madrono 12: 161-169. families. Pl. Syst. Evol. 126: 79-94. Mason-Gamer, R. J., and E. A. Kellogg. (1996). Maheshwari, J. K. (1963). Flora of Delhi. CSIR, Chloroplast DNA analysis of the New Delhi. monogenomic Triticeae: Phylogenetic impli- Maheshwari, P. (1964). Embryology in relation cations and genome-specific markers. In P. to taxonomy. In: W. B. Turril (ed.). Vistas in Jauhaur (ed.) Methods of genome analysis in Botany. Pergamon Press, London, vol. 4, pp. plants: Their merits and pitfalls. 301-325. CRC 55-97. Press, Boca Raton, FL. Malcomber, S. T., & E. A. Kellogg. (2005). Mason-Gamer, R. J., C. F. Weil and E. A. Kellogg. SEPALLATA gene diversification: Brave new (1998). Granule bound starch synthase: whorls. Trends Plant Sci. 10: 427-435. Structure, function and phylogenetic utility. Malcomber, S. T., J. C. Preston, R. Reinheimer, Mol. Biol. Evol. 15: 1658-1673. J. Kossuth E. A. & Kellogg. (2006). Develop- Mathew, K. M. (1983). The Flora of the Tamil Nadu mental gene evolution and the origin of grass Carnatic. The Rapinat Herbarium, St. Joseph’s inflorescence diversity. Adv. Bot. Res. 44: College, Tirucherapalli, India, 3 vols. 425-481. Mathews, S. and R. A. Sharrock. (1996). The phy- Maldonado de Magnano, S. (1986). Estudios tochrome gene family in grasses (Poaceae): embriologicos en Buddleja (Buddlejaceae) I: A phylogeny and evidence that grasses have Endosperma y episperma. Darwiniana 27: 225- a subset of loci found in dicot angiosperms. 236. Mol. Biol. Evol. 13: 1141-1150. Meng, Shao-Wu, Zhi-Duan Chen, De-Zhu Li and Matthews, M. L. and P. K. Endress. (2002). Com- Han-Xing Liang (2002). Phylogeny of Saururaceae parative floral morphology and systematics based on mitochondrial matR gene sequence in Oxalidales (Oxalidaceae, Connaraceae, Data. J. Plant Res. 115:71-76. Brunelliaceae, Cephalotaceae, Cunoniaceae, Manning, S. D. (2000). The genera of Elaeocarpaceae, Tremandraceae). Bot. J. Bignoniaceae in the Southeastern United Linn. Soc. 140: 321-381. States. Harvard Papers Bot. 5: 1-77. Mauseth, J. D. (1998). Botany: An Introduction to Manos, P. S., K. C. Nixon and J. J. Doyle. (1993). Plant Biology. 2/e multimedia enhanced edi- Cladistic analysis of restriction site variation. Jones and Bartlett Publishers, Massa- tion within the chloroplast DNA inverted chusetts. repeat region of selected Hamamelididae. Mayo, S. J., L. Cabrera, G. Salazar and M. Chase. Syst. Bot. 18: 551-562. (2003). Aroids and their watery beginnings. Manos, P. S. and K. P. Steele. (1997). Phyloge- Ms. (cited in APweb) netic analysis of “higher” hamamelididae Mayr, E. (1942). Systematics and the Origin of Spe- based on plastid sequence data. Syst. Bot. cies. Columbia Univ. Press, New York. 84: 1407-1419. Mayr, E. (1957). The Species Problem. Amer. Manos, P. S. , Z.-K. Zhou, and C. H. Cannon. Assoc. Adv. Sci. Pub. No. 50. (2001). Systematics of Fagaceae: Phyloge- Mayr, E. (1963). Animal Species and Evolution. netic tests of reproductive trait evolution. Belknap Press, Harvard Univ. Press, Cam- Int. J. Plant Sci. 162: 1361-1379. bridge. Marchant, C. J. (1968). Evolution in Spartina Mayr, E. (1966). The proper spelling of taxonomy. (Gramineae) III. Species chromosome num- Systematic Zool. 15: 88. References 693

Mayr, E. (1969). Principles of Systematic Zoology. Mirov, N. T. (1961). Composition of Gum Terpentines McGraw-Hill, New York. of Pines. U. S. Dept. Agric. Tech. Bull. 1239. Mayr, E. and P. D. Ashlock (1991). Principles of Mirov, N. T. (1967). The Genus Pinus. Ronald Systematic Zoology. 2nd. ed. McGraw-Hill, Press, New York. New York. Mitchell, J. D., D. C. Daly, S. K. Pell, and A. Mayr, E. (1998). “Two empires or three?”. Pro- Randrianasolo. (2006). Poupartiopsis gen. nov. ceedings of the National Academy of Science and its context in Anacardiaceae classifica- 95: 9720–9723. tion. Syst. Bot. 31: 337-348. McMillan, C., T. J. Mabry and P. I. Chavez. (1976). Moore, G., K. M. Devos, Z. Wang and M. D. Gale. Experimental hybridization of Xanthium (1995). Current Opinion Genet. Devel. 5: 737. strumarium (Compositae) from Asia and Muasya, A. M., D. A. Simpson, M. W. Chase, America, II.Sesquiterpene lactones of F1 and A. Culham. (1998). An assessment of hybrids. Amer. J. Bot. 63: 317-323. suprageneric phylogeny in Cyperaceae using McMinn, H. E. and E. Maino. (1946). Illustrated rbcL DNA sequences. Plant Syst. Evol. Manual of Pacific Coast Trees, 2nd ed. Univ. 211: 257-271. of Calif. Press, Berkeley, CA. Muhammad, A. F. and R. Sattler. (1982). Vessel McNeill, J., Barrie, F. R. et al. (Eds.). (2006). In- structure of Gnetum and the origin of an- ternational Code of Botanical Nomenclature giosperms. Amer. J. Bot. 69: 1004-1021. (Vienna Code) 2006. Adopted by the Seven- Müller, K., & T. Borsch. (2005a). Phylogenetics teenth International Botanical Congress, of Amaranthaceae based on matK/trnK se- Vienna, Austria, July 2005. Series: Regnum quence data - evidence from parsimony, like- Vegetabile Vol. 146. 568 pages. Gantner lihood, and Bayesian analysis. Ann. Missouri Verlag Bot. Gard. 92: 66-102. Meeuse, A. J. D. (1963). The multiple origins of Müller, K., & T. Borsch. (2005b). Multiple the angiosperms. Advancing Frontiers of Plant origins of a unique pollen feature: Stellate Sciences, 1: 105-127. pore ornamentation in Amaranthaceae. Grana Meeuse, A. J. D. (1972). Facts and fiction in flo- 44: 266-281. ral morphology with special reference to the Naik, V. N. (1984). Taxonomy of Angiosperms. Tata Polycarpicae. Acta Bot. Neerl. 21: 113-127, McGraw Hill, New Delhi. 235-252, 351-365. Nandi, O. I. M. W. Chase and P. K. Endress. Meeuse, A. J. D. (1990). All about Angiosperms. (1998). A combined cladistic analysis of an- Eburon, Delft. giosperms using rbcL and non-molecular data Meglitsch, P. A. (1954). On the nature of spe- sets. Ann. Missouri Bot. Gard. 85: 137-212. cies. Zyst. Zool. 3: 49-65. Neumayer, H. (1924). Die Geschichte der Blûte. Melville, R. (1962). A new theory of the an- Abhandlung Zoologischen Botanische giosperm flower, I. The gynoecium. Kew Bull. Gesellschaft 14: 1-110. 16: 1-50. Nickrent, D. L. (2002). Orígenes filogenéticos de Melville, R. (1963). A new theory of the an- las plantas parásitas. Pp. 29-56 in López- giosperm flower, II. Kew Bull. 17: 1-63. Sáez, J. A., Catalán & Sáez, L. (eds), Plantas Melville, R. (1983). Glossopteridae, Angiosper- Parásitas de la Península Ibérica e Islas midae and the evidence of angiosperm ori- Baleares. Mundi-Prensa, Madrid. gin. Bot. J. Linn. Soc. 86: 279-323. Nicolson, D. H. (1974). Paratautonym, a com- Melville, R. and H. M. Heybroek. (1971). The Elms ment on proposal 146. Taxon 24: 389-390. of the Himalayas. Kew Bull. 26(1): 5-28. Nixon, K. C. and J. M. Carpenter. (2000). On Mérat, F. V. (1821). Nouvelle flore des environs de the other “Phylogenetic Systematics”. Cla- Paris ed. 2, 2 Paris, 107 pp. distics 16: 298-318. Metcalfe, C. R. and L. Chalk. (Eds.) (1983). Nixon, K. C., J. M. Carpenter and D. W. Anatomy of Dicotyledons.(2nd ed.). Claredon Stevenson. (2003).The PhyloCode is fatally Press, Oxford. (Takhtajan’s classification, flawed, and the “Linnaean” System can be vol., 2 pp. 258-300). easily fixed. Bot. Rev. 69 (1): 111-120. Michener, C. D. and R. R. Sokal. (1957). A quan- Nyananyo, B. L and S. I. Mensah. (2004). Distri- titative approach to a problem in classifica- bution and origins of members of the family tion. Evolution 11: 130-162. Portulaceae (Centrospermae). Journal of Miki, S. (1937). The origin of Najas and Applied Sciences & Environmental Management, Potamogeton. Bot. Mag. Tokyo 51: 290-480. 8 (2): 59-62 694 Plant Systematics

Nyffeler, R. 2002. Phylogenetic relationships in Pell, S. K. 2004. Molecular Systematics of the the cactus family (Cactaceae) based on Cashew Family (Anacardiaceae). Ph. D. The- evidence from trnK/matK and trnL-trnF sis, Louisiana State University. sequences. American J. Bot. 89: 312-326. Pell, S. K. and J. D. Mitchell. (2007). Evolution- Olmstead, R. G. and P. A. Reeves. (1995). ary trends in Anacardiaceae inferred from Evidence for polyphyly of Scrophulariaceae nuclear and plastid molecular data and based on chloroplast rbcL and ndhF morphological evidence. P. 178, in Plant Biol- sequences. Ann. Missouri Bot. Gard. 82: ogy and Botany 2007. Program and Abstract 176-193. Book. Chicago. Olmstead, R. G., J. A. Sweere, R. E. Spangler, Pennington, T. D. (1991). The genera of Sapotaceae. L. Bohs, and J. D. Palmer. (1999). Phylogeny Royal Botanic Gardens, Kew and New York and provisional classification of the Solan- Botanic Gardens, Bronx. aceae based on chloroplast DNA. Pp. 111-137, Petersen, G. and O. Seberg. (1997). Phylogenetic in Nee, M., Symon, D., Lester, R. N., & analysis of Triticeae (Poaceae) based on rpoA Jessop, J. P. (Eds.), Solanaceae IV: Advances sequence data. Mol. Phylog. Evol. 7: 217-230. in Biology and Utilization. Royal Botanic Gar- Pichon, H. (1946). Sur les Alismatacées et les dens, Kew. Butomacées [includes Albidella, gen. nov., Olmstead, R. G., K. -J Kim, R. K. Jansen and key to genera of redefined Alismaceae]. Not. S. J. Wagstaff. (2000). The phylogeny of the Syst. [Paris] 12: 170-183. Asteridae sensu lato based on chloroplast Plunkett, G. M., D. E. Soltis, and P. S. Soltis. ndhf gene sequences. Molecular Phylog. Evol. (1995). Phylogenetic relationships between 16: 96-112. Juncaceae and Cyperaceae: Insights from Olmstead, R. G., C. W. dePamphilis, A. D. Wolfe, rbcL sequence data. American J. Bot. N. D. Young, W. J. Elisens and P. A. Reeves. 82: 520-525. (2001). Disintegration of the Scrophularia- Plunkett, G. M., D. E. Soltis, and P. S. Soltis. ceae. American J. Bot. 88: 348-361. (1997). Clarification of the relationship be- Olson, A. R. (1991). Postfertilization changes in tween Apiaceae and Araliaceae based on matK ovules of Monotropa uniflora L. and rbcL sequence data. Amer. J. Bot. (Monotropaceae). American J. Bot. 78: 99-107. 84: 567-580. Owen, R. (1848). Report on the archetype and Plunkett, G. M. (2001). Relationship of the or- homologies of vertebrate skeleton. Rep. 16th der Apiales to subclass Asteridae: A re-evalu- Meeting Brit. Assoc. Adv. Sci. 169-340. ation of morphological characters based on Owenby, M. (1950). Natural hybridisation and insights from molecular data. Edinburgh J. amphiploidy in the genus Tragopogon. Amer. Bot. 8: 183-200. J. Bot. 37(10): 487-499. Plunkett, G. M., J. Wen, and P. P. Lowry ( 2004). Page, C. N. (1979). The herbarium preservation Infrafamilial classifications and characters of Conifer specimens. Taxon 28: 375-379. in Araliaceae: Insights from the phylogenetic Page, C. N. (1990). Pinata. Pp. 290-361, in analysis of nuclear (ITS) and plastid (trnL- Kubitzki, K. (Ed.), The Families and Genera of trnF) sequence data. Plant Syst. Evol. Vascular Plants. Volume 1. Pteridophytes and 245: 1-39. Gymnosperms. Springer, Berlin. Porter, C. L. (1959). Taxononomy of Flowering Pant, D. D. (1957). Classification of gymnosper- Plants. W. H. Freeman, San Francisco. mous plants. Palaeobotanist 6: 65-70. Porter, E. A. and L. A. Johnson. (1998). Phyloge- Pant, D. D. and P. F. Kidwai. (1964). On the di- netic relationships of Polemoniaceae: Infer- versity in the development and organisation ences from mitochondrial nad1b intron se- of stomata in Phyla nodiflora Michx. Curr. Sci. quences. Aliso 17: 157-188. 33: 653-654. Porter, E. A., E. Nic Lughadha and M. S. J. Pax, F. and K. Hoffmann. (1934). Aizoaceae in Simmonds. (2000). Taxonomic significance of Engler and Prantl, Die naturlichen pflanzen- polyhydroxyalkaloids in the Myrtaceae. Kew familien, 2ed, Bd. 16c, 179-233. Bull. 55: 615-632. Peery, R., K. R. Wilcox, C. Morton and L. A. Potgeiter, J. and V. A. Albert. (2001). Phyloge- Raubeson. (2008). Exploring the utility of the netic relationships within Apocynaceae s.l. nuclear XDH gene for gymonsperm phylo- based on trnL intron and trnL-F spacer se- genetics. Pp. 196-197, in Botany 2008. Botany quences and propagule characters. Ann. without Borders. Botanical Society of America. Missouri Bot. Gard. 88: 523-549. References 695

Potter, D., F. Gao, P. E. Bortiri, S. –H. Oh and S. Stech, W. Frey, D. Quandt, & C. C. Davis. Baggett. (2002). Phylogenetic relationships (2006). The deepest divergences in land in Rosaceae inferred from chloroplast matK plants inferred from phylogenomic evidence. and trnL-trnF nucleotide sequence data. Plant Proc. National Acad. Sci. U.S.A. 103: 15511- Syst. evol. 231: 77-89. 15516. Prat, W. (1960). Vers une classification Quinn, C. J., R. A. Price, and P. A. Gadek. (2002). naturelles des Graminées. Bull. Soc. Bot. Fr. Familial concepts and relationships in the 107: 32-79. conifers based on rbcL and matK sequence Prather, C. A., C. J. Ferguson and R. K. Jansen. comparisons. Kew Bull. 57: 513-531. (2000). Polemoniaceae phylogeny and clas- Radford, A. E. (1986). Fundamentals of Plant Sys- sification: Implications of sequence data tematics. Harper and Row, New York. from the chloroplast gene ndhF. Amer. J. Bot. Radford, A. E., W. C. Dickison., J. R. Massey 87: 1300-1308. and C. R. Bell. (1974). Vascular Plant Pratt, D. B., L. G. Clark and R. S. Wallace. (2001). Systematics. Harper and Row, New York. A tale of two families: Phylogeny of the Rai, H. S., P. A. Reeves, R. Peakall, R. G. Chenopodiaceae-Amaranthaceae. P. 135, in Olmstead and S. W. Graham. (2008). Infer- Botany 2001: Plants and People, Abstracts. ence of higher-order conifer relationships [Albuquerque.]. from a multi-locus plastid data set. Botany Preston, J. C., & E. A. Kellogg. (2006). Recon- 86: 658-669. structing the evolutionary hiistory of Raimann, R. (1893). Onagraceae. in Engler and paralogous APETALA1?FRUITFULL-like genes Prantl, Die naturlichen Pflanzenfamilien in Grasses (Poaceae). III(7): 199-223. Price, R. A. (2003). Generic and familial relation- Ram, Manasi. (1959). Morphological and embryo- ships of the Taxaceae from rbcL and matK logical studies in the family Santalaceae II. sequence comparisons. Pp. 235-238, in Mill, Exocarpus, with a discussion on its system- R. R. (ed.), IV International Conifer Conference. atic position. Phytomorphology 8: 4-19. [ISIS Acta Horticulturae 615.] Raven, P. H. (1975). The bases of angiosperm Qui, Y-L, M. W. Chase, D. H. Les and C. R. phylogeny: cytology. Ann. Miss. Bot. Gard. Parks. (1993). Molecular phylogenetics of the 62: 725-764. Magnoliidae: Cladistic analyses of nucle- Ray, J. (1682). Methodus plantarum nova. otide sequences of plastid gene rbcL. Ann. London, 3 vols. Missouri Bot. Gard. 80: 587-606. Ray, J. (1686-1704). Historia plantarum. London, Qiu, Y.-L., M. W. Chase, S. B. Hoot, E. Conti, P. 3 vols. R. Crane, K. J. Sytsma and C. R. Parks. Rechinger, K. H. (1963). Flora Iranica. (1998). Phylogenetics of the Hamamelidae Reeves, R. G. (1972). Flora of Central Texas. and their allies: Parsimony analyses of Prestige Press, Ft. Worth, TX, 320 pp. nucleotide sequences of the plastid gene Rehder, A. (1940). Manual of Cultivated Trees and rbcL. Int. J. Plant Sci. 159: 891-905. Shrubs Hardy in North America, (2nd ed). Qui, Y-L, J. Lee, F. Bernasconi-Quadroni, D. E. Macmillan, New York. Soltis, P. S. Soltis, M. Zanis, E. A. Zimmer, Rendle, A. B. (1904). Classification of flowering Z. Chen, V. Savolainen and M. W. Chase. plants. Cambridge, England. Vol. 2 1925; (1999). The earliest angiosperms: evidence 2nd ed. Vol. 1 1930. from mitochondrial, plastid and nuclear ge- Renner, S. S., A. Weerasooriya and M. E. Olson, nomes. Nature 402: 404-407. (2002). Phylogeny of Cucurbitaceae inferred Qui, Y-L, J. Lee, F. Bernasconi-Quadroni, D. E. from multiple chloroplast loci. P. 169, in Soltis, P. S. Soltis, M. Zanis, E. A. Zimmer, Botany 2002: Botany in the Curriculum, Z. Chen, V. Savolainen and M. W. Chase. Abstracts. [Madison, Wisconsin.] (2000). Phylogeny of basal angiosperms: Retallack, G. and D. L. Dilcher. (1981). A coastal Analyses of five genes from three genomes. hypothesis for the dispersal and rise of domi- Int. J. Plant Sci. 161(6: suppl.): S3-S27. nance of flowering plants. In: K. J. Niklas Qiu, Y.-L., L. Li, B. Wang, Z. Chen, V. Knoop, M. (Ed.). Paleobotany, Paleoecology and Evolution. Groth-Malonek, O. Dombrovska, J. Lee, L. Praeger, New York, Vol 2. Pp. 27-77. Kent, L., J. S. Rest, G. F. Estabrook, T. A. Riesberg, L. H., B. Sinervo, C. R. Linder, M. Hendry, D. W. Taylor, C. M. Testa, M. Ungerer and D. M. Arias. (1996). Role of gene Ambros, B. Crandall-Stotler, R. J. Duff, M. interactionsin hybrid speciation:Evidence 696 Plant Systematics

from ancient and experimental hybrids. (2000). Phylogenetics of flowering plants Science 272: 741-745. based on combined analysis of plastid atpB Rise, K. A., M. J. Donoghue and R. G. Olmstead. and rbcL sequences. Syst. Biol. 49: 306-362. (1997). Analyzing large data sets: rbcL 500 Salywon, A., N. Snow & L. R. Landrum. (2002). revisited. Syst. Biol. 46: 554-563. Phylogenetic relationships in the berry-fruited Rodman, J. E., R. A. Price, K. Karol, E. Conti, K. Myrtaceae as inferred from ITS sequences. J. Sytsma and J. D. Palmer. (1993). Nucle- P. 149, in Botany 2002: Botany in the otide sequences of rbcL gene indicate mono- Curriculum, Abstracts. [Madison, Wisconsin.] phyly of mustard oil plants. Ann. Missouri Bot. Scamardella , J. M. (1999). “Not plants or ani- Gard. 80: 686-699. mals: a brief history of the origin of King- Rogers, D. J. (1963). Taximetrics, new name, old doms Protozoa, Protista and Protoctista”. In- concept. Brittonia 15: 285-290. ternational Microbiology 2: 207–221. Rollins, R. C. (1953). Cytogenetical approaches Scharaschkin, T., & J. A. Doyle. (2005). Phylog- to the study of genera. Chronica Botanica eny and historical biogeography of Anaxagorea 14(3): 133-139. (Annonaceae) using morphology and non- Ross, K. L. (2004). All Living Things: In Seven coding chloroplast sequence data. Syst. Bot. Kingdoms.The Proceedings of the Friesian 30: 712-735. School, Fourth Series. http://www.friesian. Schlueter, J. A., P. Dixon, C. Granger, D. Grant, com/life-1.htm#one. L. Clark, J. J.Doyle & R. C. Schoemaker. Rousi, A. (1973). Studies on the cytotaxonomy (2004). Mining EST databases ro resolve evo- and mode of reproduction of Leontodon lutionary events in major crop species. Ge- (Compositae). Ann. Bot. Fenn. 10: 201-215. nome 47: 868-876. Rova, J. H. E., P. G. Delprete, L. Andersson, and Schneider, H. A. W. and W. Liedgens. (1981). An V. A. Albert. (2002). A trnL-F cpDNA sequence evolutionary tree based on monoclonal an- study of the Condamineeae-Rondeletieae- tibody-recognised surface features of plas- Sipaneeae complex with implications on the tid enzume (5-aminolevulinate dehydratase). phylogeny of the Rubiaceae. Amer. J. Bot. Z. Naturforsch. 36(c): 44-50. 89: 145-159. Schneider, H., S. J. Russell, C. J. Cox, F. Bakker, S. Rudall, P., C. A. Furness, M. W. Chase and M. Henderson, M. Gibby & J. C. Vogel. (2004). F. Fay. (1997). Microsporogenesis and pol- Chloroplast phylogeny of asplenioid ferns based len sulcus type in Asparagales (Lilianae). on rbcL and trnL-F spacer sequences (Poly- Canad. J. Bot. 75: 408-430. podiidae, Aspleniaceae) and its implications Rudall, P. (2001). Floral morphology of for the biogeography. Syst. Bot. 29: 260–274. Asparagales: unique structures and iterative Schneider, H., A. R. Smith, R. Cranfill, T. E. evolutionary themes. P. 16, in Botany 2001: Hildebrand, C. H. Haufler & T. A. Ranker. Plants and People, Abstracts. [Albuquerque.] (2004b). Unraveling the phylogeny of Rydin, C., M. Källersjö, and E. M. Friis. (2002). polygrammoid ferns (Polypodiaceae and Seed plant relationships and the systematic Grammitidaceae): exploring aspects of the position of Gnetales based on nuclear and diversification of epiphytic plants. Molec. chloroplast data: Conflicting data, rooting Phylog. Evol. 31: 1041–1063. problems, and the monophyly of conifers. Schubert, I., H. Ohle and P. Hanelt. (1983). Phy- Internat. J. Plant Sci. 163: 197-214. logenetic conclusions from Geisma banding Sahasrabudhe, S. and C. A. Stace. (1974). De- and NOR staining in Top Onions (Liliaceae). velopmental and structural variation in the Pl. Syst. Evol. 143: 245-256. trichomes and stomata of some Schulz, O. E. (1936). Cruciferae. In: E. Engler, Gesneriaceae. New Botanist 1: 46-62. Die Naturlichen Pflanzenfamilien, ed. 2, Sahni, B. (1925). Ontogeny of vascular plants and 17B: 227-658. theory of recapitulation. J. Indian Bot. Soc. Schwarzbach, A. E. and L. A. McDade. (2002). 4: 202-216. Phylogenetic relationships of the mangrove Sahni, B. (1948). Pentoxyleae: A new group of family Avicenniaceae based on chloroplast Jurassic gymnosperms from the Rajmahal and nuclear ribosomal DNA sequences. Syst. Hills of India. Bot. Gaz. 110: 47-80. Bot. 27: 84-98. Savolainen, V., M. W. Chase, S. B. Hoot, C. M. Scotland, R. W. (!990). Palynology and systemat- Morton, D. E. Soltis, C. Bayer, M. F. Fay, A. ics of Acanthaceae. Ph. D. Thesis, University Y. de Bruijn, S. Sulllivan, and Y.-L. Qiu. of Reading, England. References 697

Scotland, R. W. and K. Volleson. (2000). Classifi- Sneath, P. H. A. and R. R. Sokal. (1973). Numeri- cation of Acanthaceae. Kew Bull. 55: 513-589. cal Taxonomy. W. H. Freeman and Company, Sennblad, B and B. Bremer. (2002). Classifica- San Francisco. tion of Apocynaceae s.l. according to a new Snustad, D. P. and M. J. Simmons. (2000). Prin- approach combining Linnaean and phyloge- ciples of Genetics. 2nd ed. John Wiley and netic taxonomy. Syst. Biol. 51: 389-409. Sons, New York. Seward, A. C. (1925). Arctic vegetation past and Sokal, R. R. (1961). Distance as a measure of present. J. Hort. Soc. 50, i. taxonomic similarity. Systematic Zool. 10: Shukla, P. and S. P. Misra. (1979). An introduc- 70-79. tion to Taxonomy of Angiosperms. Vikas Pub- Sokal, R. R. and C. D. Michener. (1958). A sta- lishing House, New Delhi. tistical method for evaluating systematic Simpson, G. G. (1961). Principles of Animal Tax- relationships. Univ. Kansas Sci. Bull. 44: onomy. New York/London. 467-507. Simpson, D. A., Furness, C. A., Hodkinson, T. Sokal, R. R. and P. H. A. Sneath. (1963). Prin- R., Muasya, A. M., and M. W. Chase. (2003). ciples of Numerical Taxonomy. W. H. Freeman Phylogenetic relationships in Cyperaceae and Company, San Francisco. subfamily Mapanioideae inferred from pol- Solsbrig, O. T. (1970). Principles and Methods of len and plastid DNA sequence data. Ameri- Plant Biosystematics. Macmillan, London. can J. Bot. 90: 1071-1086. Soltis, D. E., D. R. Morgan, A. Grable, P. S. Soltis Simpson, M. G.. (2006). Plant Systematics. 590 and R. Kuzoff. (1993). Molecular systemat- pp. Elsevier Academic Press, San Diego, CA. ics of Saxifragaceae sensu stricto. Amer. J. Singh, G. (1999). Plant Systematics. Science Pub- Bot. 80: 1056-1081. lishers, New York. Soltis, D. E., P. S. Soltis, D. L. Nickrent, L. A. Singh, G. (1999). Plant Systematics- Theory and Johnson, W. J. Hahn, S. B. Hoot,J. A. practice. Oxford & IBH Publishing Co. Pvt. Sweere, R. K. Kuzoff, K. A. Kron,M. W. Ltd., New Delhi. Chase, S. M. Swensen, E. A. Zimmer, S.-M. Singh, G., Bimal Misri and P. Kachroo. (1972). Chaw, L. J. Gillespie, W. J. Kresss and K. J. Achene morphology: An aid to the taxonomy Sytsma. (1997). Angiosperm phylogeny of Indian Plants.1. Compositae, Liguliflorae. inferred from 18S ribosomal DNA sequences. J. Indian Bot. Soc. 51(3-4): 235-242. Ann. Missouri Bot. Garden 84: 1-49. Sinnot, E. W. and I. W. Bailey. (1914). Investiga- Soltis, D. E., P. S. Soltis, M. E. Mort, M. W. tions on the phylogeny of angiosperms. Part Chase, V. Savolainen, S. B. Hoot, and C. M. 3. Amer. J. Bot. 1: 441-453. Morton. (1998). Inferring complex phylog- Sinnott, Q. P. (1983). A Solar Thermoconvective enies using parsimony: An empirical plant drier. Taxon 32: 611-613. approach using three large DNA data sets Sivarajan, V. V. (1984). Introduction to Principles for angiosperms. Syst. Biol. 47: 32-42. of Plant Taxonomy. Oxford & IBH, New Delhi. Soltis, D. E., P. S. Soltis, M. W. Chase, M. E. Smith, A. C. (1970). The Pacific as a key to flower- Mort, D. C. Albach, M. Zanis, V. Savolainen, ing plant history. Harold L. Lyon Arboretum W. H. Hahn, S. B. Hoot, M. F. Fay, M. Axtell, Lecture Number 1. S. M. Swensen, L. M. Prince, W. J. Kress, K. Smith, A. R., M. K. Pryer, E. Schuettpelz, P. C. Nixon and J. A. Farris. (2000). Angiosperm Korall, Harald Schneider & P. G. Wolf. (2006). phylogeny inferred from 18S rDNA, rbcL, and Classification of extant Ferns. Taxon 55(3): atpB sequences. Bot. Journ. Linn. Soc. 133: 705-731. 381-461. Smith, P. M. (1972). Serology and species rela- Soltis, D. E., R. K. Kuzoff, M. E. Mort, M. Zanis, tionship in annual bromes (Bromus L sect. M. Fishbein, L. Hufford, J. Koontz and Bromus). Ann. Bot. 36: 1-30. M. Arroyo. (2001). Elucidating deep-level Smith, P. M. (1983). Protein, mimicry and micro- phylogenetic relationships in Saxifragaceae evolution in grasses. In: U. Jensen and D. using sequences for six chloroplastic and E. Fairbrothers (Eds.). Proteins and Nucleic nuclear DNA regions. Ann. Missouri Bot. Gard. Acids in Plant Systematics. Springer-Verlag, 88: 669-693. Berlin, pp. 311-323. Soltis, P. S., D. E. Soltis and M. W. Chase. Sneath, P. H. A. (1957). The application of com- (1999). Angiosperm phylogeny inferred from puters to taxonomy. J. Gen. Microbiol. 17: multiple genes as a tool for comparative 201-226. biology. Nature 90: 461-470. 698 Plant Systematics

Soltis, P. S., D. E. Soltis , M. J. Zanis and S. Veg. 132 publ. 1995; suppl. 1 (Aa-Ba) Regnum Kim. (2000). Basal lineages of angiosperms: Veg. 125 publ. 1992). Relationships and implications for floral evo- Stanier, R. Y. & C. B. van Niel (1962). “The lution. International Journal of Plant Sciences concept of a bacterium”. Arch. Microbiol. 161 (6, suppl.): S97-S107. 42: 17–35. Soltis, P. S., D. E. Soltis , M. W. Chase, M. E. Starr, J. R., S. A.Harris & D. A.Simpson. (2004). Mort, D. C. Albach, M. Zanis, V. Savolainen, Phylogeny of the unispicate taxa in Cypera- W. H. Hahn, W. H. Hoot, M. F. Fay, M. Axtell, ceae tribe Cariceae I: Generic relationships S. M. Swensen, L. M. Prince, W. J. Cress, K. and evolutionary scenarios. Syst. Bot. C. Nixon and J. A. Farris. (2000a). An- 29: 528-544. giosperm phylogeny inferred from 18S rDNA, Starr, J. R., V. Teoh, E. Roalson, A. M. Muasya rbcL, and atpB sequences. Bot. J. Linn. Soc. & D. A. Simpson. (2006). Towards a phyloge- 133: 381-461. netic classification of sedges (Cyperaceae): Soltis, D. E., P. S. Soltis, P. K. Endress, and M. chloroplast (rbcL, matK, NdhF) and nuclear W. Chase.(2005). Phylogeny and Evolution of (ADC) data. Pp. 258-259, in Botany 2006 - Angiosperms. 370 pp. Sinauer Associates, Looking to the Future, Conserving the Past. [Ab- Sunderland, MA. stracts: Botanical Society of America, etc.]. Soreng, R. J. and J. I. Davis. (1998). Phylogenetics Stebbins, G. L. (1950). Variation and Evolution in and character evolution in the grass family Plants. Columbia Univ. Press, NY. (Poaceae): Simultaneous analysis of morpho- Stebbins, G. L. (1974). Flowering Plants; Evolu- logical and chloroplast DNA restriction site tion above the Species Level. The Belknap character sets. Bot. Rev. 64: 1-85. Press, Harvard Univ. Press, Cambridge. Soros, C. L. and D. H. Les. (2002). Phylogenetic Steenis, C. G. G. J. van (Ed.). (1948). Flora relationships in the Alismataceae. P. 152, Malesiana. Series I: Spermatophyta. in Botany 2002: Botany in the Curriculum, Ab- Groninger, Jakarta. stracts. [Madison, Wisconsin.] Stefanovic, S., L. Krueger and R. G. Olmstead. Sosef, M. S. M. (1997). Hierarchical models, (2002). Monophyly of the Convolvulaceae and reticulate evolution and the inevitability of circumscription of their major lineages based paraphyletic supraspecific taxa. Taxon 46: on DNA sequences of multiple chloroplast 75-85. loci. American J. Botany 89: 1510-1522. Speta, F. (1979). Weitere untersuchungen über Stevens, P. F. (1994). The development of biologi- proteinkörper in Zellkernen und ichre cal systematics. Columbia University Press, taxonomische Bedentung. Plant Syst. Evol. New York. 132: 1-126. Stevens, P. F. (1998). What kind of classifica- Sporne, K. R. (1971). The mysterious origin of flow- tion should the practicing taxonomist use ering plants. Oxford Biology Readers 3, F. F. to be saved? in Plant diversity in Malesia III, Head and O. E. Lowenstein (Eds.). Oxford J. Dransfield, M. J. E. Coode and D. A. Univ. Press, Oxford. Simpson (Eds.) , 295-319. Royal Botanical Sporne, K. R. (1974). Morphology of Angiosperms. Gardens, Kew. Hutchinson Univ. Library, London. Stevens, P.F. (2003). Angiosperm Phylogeny Sporne, K. R. (1976). Character correlation among Website. Version 6, May 2005 [and more or angiosperms and the importance of fossil less continuously updated since]. http:// evidence in assessing their significance. In: www.mobot.org/MOBOT/research/APweb. C. B. Beck (Ed.). Origin and Early Evolution of Website developed and maintained by Hilary Angiosperms. Columbia Univ. Press, New York. Davis (last updation incorcorated 03/04/ Stace, C. A. (1973). Chromosome numbers in 2006). British Species of Calystegia and Convolvu- Stevenson, D. W. (1981). Observations on ptyxis, lus. Watsonia 9:363-367. phenology and trichomes in the Cycadales Stace, C. A. (1980). Plant Taxonomy and Biosys- and their systematic implications. Am. J. Bot. tematics. Edward Arnold, London. 68: 1104-1114. Stace, C. A. (1989). Plant Taxonomy and Biosys- Stevenson, D. W. and H. Loconte. (1995). Cla- tematics. (2nd ed.) Edward Arnold, London. distic analysis on monocot families. In M. Stafleu, F. A. and E. A. Mennega. (1997). Taxo- J. Rudall et al. (Eds.) Monocotyledons: nomic literature, 2nd ed., suppl. 4 (Ce-Cz). Systematics and Evolution, 543-578. Royal Regnum Veg. 134. (suppl. 3 (Br-Ca) Regnum Botanic Gardens, Kew. References 699

Stewart, W. N. and G. W. Rothwell. (1993). Pa- (Thunb.) Nakai (Chloranthaceae): additional leobotany and the evolution of plants. 2nd ed. evidence for the occurrence of vessels. Bot. Cambridge University press, Cambridge. Mag. (Tokyo) 101: 387-395. Steyermark, J. A. (1963). Flora of Missouri. Iowa Takhtajan, A. L. (1958). Origin of Angiospermous State Univ. Press, Ames, IA, 1725 pp. Plants. Amer. Inst. Biol. Sci. (Translation Strahler, A. N. and A. H. Strahler. (1977). Geog- Russian edition of 1954). raphy and Man’s Environment. John Wiley and Takhtajan, A. L. (1959). Die Evolution Der Sons, New York. Angiospermen. Gustav Fischer Verlag, Jena. Stuessy, T. F. (1990). Plant Taxonomy. Columbia Takhtajan, A. L. (1966). Systema et Phylogenia Univ. Press, New York. Magnoliophytorum. Soviet Publishing Institu- Sun, B.-Y. (2002). Characteristics of fern flora of tion, Nauka.

Korea with emphasis on the endemic genus Takhtajan, A. L. (1969). Flowering Plants-Origin and Mankyua (Ophioglossaceae) from Cheju Island, Dispersal.(English translation by C. Jeffrey). Korea. First Korean Academy of Science and Smithsonian Institution Press, Washington. Technology/Hungary Academy of Science Takhtajan, A. L. (1980). Outline of classification Bilateral Symposium Proceedings 1: 62-68. of flowering plants (Magnoliophyta). Bot. Rev. Sun, B.-Y., M.H. Kim, C.H. Kim, and C.-W. Park. 46: 255-369. (2001). Mankyua (Ophioglossaceae): a new Takhtajan, A. L. (1986). Floristic Regions of the fern genus from Cheju Island, Korea. Taxon World. Berkeley. 50: 1019-1024. Takhtajan, A. L. (1987). Systema Magnolio- Sun G., G. L. Dilcher, S. Zheng and Z Zhou. phytorum. Nauka, Leningrad. (1998) In search of the first flower: A jurassic Takhtajan, A. L. (1991). Evolutionary Trends in angiosperm, archaefructus, from northeast Flowering Plants. Columbia Univ. Press, New china Science. 282: 1692-1695. York. Sun, G., Q. Ji, D. L. Dilcher, S. Zheng, K. C. Takhtajan, A. L. (1997). Diversity and Classifica- Nixon and X. Wang. (2002). Archaefru- tion of Flowering Plants. Columbia Univ. ctaceae, a new basal angiosperm family. Sci- Press, New York, 642 pp. ence 296: 899-904. Tanaka, N[orio], H. Setoguchi and J.Murata. Surange, K. R. and S. Chandra. (1975). Morphol- (1997). Phylogeny of the family Hydro- ogy of gymnospermous fructifications of the charitaceae inferred from rbcL and matK gene Glossopteris flora and their relationships. sequence data. J. Plant Res. 110: 329-337. Palaeontographia 149: 153-180. Taylor, D. W. (1981). Paleobotany: An Introduction Sutter, D. and P. K. Endress. (1995). Aspects of to Fossil Plant Biology. McGraw Hill, New York. gynoecial structure and macrosystematics in Taylor, D. W. and G. Kirchner (1996). Origin and Euphorbiaceae. Bot. Jahrb. Syst. 116: 517- evolution of angiosperm carpel. In: D. W. Tay- 536. lor and L. J. Hickey (Eds.). Flowering Plant Swain, T. (1977). Secondary compounds as protec- Origin, Evolution and Phylogeny. Chapman & tive agents. Ann. Rev. Pl. Physiol. 28: 479-501. Hall Inc., New York, pp. 116-140. Swenson, U., & Anderberg, A. A. 2005. Phylogeny, Taylor, D. W. and L. J. Hickey. (1992). Phyloge- character evolution, and classification of netic evidence for herbaceous origin of an- Sapotaceae (Ericales). Cladistics 21: 101-130. giosperms. Plant Systematics and Evolution Sytsma, K. J. and D. A. Baum. (1996). Molecular 180: 137-156. phylogenies and the diversification of the Taylor, D. W. and L. J. Hickey. (1996). Evidence angiosperms. In: D. W. Taylor and L. J. for and implications of an Herbaceous Ori- Hickey (Eds.) Flowering Plant Origin, Evolu- gin of Angiosperms. In: D. W. Taylor and L. tion and Phylogeny. Chapman & Hall Inc., J. Hickey (Eds.). Flowering Plant Origin, Evo- New York, pp. 314-340. lution and Phylogeny. Chapman & Hall Inc., Sytsma, K. J., J. Morawetz, J. C. Pires, M. New York, pp. 232-266. Nepokroeff, E. Conti, M. Zjhra, J. C. Hall, Terrell, E. (1983). Proposal (695) to conserve the and M. W. Chase. (2002). Urticalean rosids: name of the tomato as Lycopersicon Circumscription, rosid ancestry, and esculentum P. Miller and reject the combina- phylogenetics based on rbcL, trnL-F, and ndhF tion Lycopersicon lycopersicum (L.) Karsten sequences. American J. Bot. 89: 1531-1546. (Solanaceae). Taxon 32: 310-313. Takahashi, A. (1988). Morphology and ontogeny Theophrastus. De causis plantarum Translated of stem xylem elements in Sarcandra glabra by R. E. Dengler. Philadelphia (1927). 700 Plant Systematics

Theophrastus. Enquiry into plants. Translated by Treutlein, J., G. F. Smith, B. -E. van Wyk, and A. Hort. W. Heinemann, London (1916), M. Wink. (2003). Phylogenetic relationships 2 vols. in Asphodelaceae (subfamily Alooideae) Thorne, R. F. (1968). Synopsis of a putative phy- inferred from chloroplast DNA sequences logenetic classification of flowering plants. (rbcL, matK) and from genomic finger-print- Aliso 6(4): 57-66. ing (ISSR). Taxon 52: 193-207. Thorne, R. F. (1974). A phylogenetic classifica- Troitsky, A. V., Y. F. Melekhovets, G. M. tion of Annoniflorae. Aliso 8: 147-209. Rakhimova, V. K. Bobrova, K. M. Valiegoroman Thorne, R. F. (1976). A phylogenetic classifica- and A. S. Antonov. (1991). Angiosperm ori- tion of angiosperms. Evol. Biol. 9: 35-106. gin and early stages of seed plant evolution Thorne, R. F. (1981). Phytochemistry and an- deduced from rRNA sequence comparison. giosperm phylogeny: A summary statement, J. Molecular Evolution 32: 253-261. In D. A. Young and D. S. Seigler (Eds.). Phy- Tsutsumi, C. & M. Kato. (2006) Evolution of tochemistry and Angiosperm Phylogeny. epiphytes in Davalliaceae and related ferns. Praeger, New York, pp. 233-295. Bot. J. Linn. Soc. Thorne, R. F. (1983). Proposed new realignments Tucker, S. C. and W. Douglas. (1996). Floral in angiosperms. Nordic J. Bot. 3:85-117. structure, Development and Relationships Thorne, R. F. (1992). An updated classification of Paleoherbs: Saruma, Cabomba, Lactoris, of the flowering plants. Aliso 13: 365-389. and selected Piperales. In: D. W. Taylor and Thorne, R. F. (1992b). Classification and geogra- L. J. Hickey (Eds.) Flowering Plant Origin, Evo- phy of the flowering plants. Bot. Rev. 58: 225- lution and Phylogeny 141-175. Chapman and 348. Hall, Inc., New York. Thorne, R. F. (1996). The least specialized an- Tucker, S. C. (2002). Floral ontogeny of Cercis giosperms. In: D. W. Taylor and L. J. Hickey (Leguminosae: Caesalpinioideae: Cercideae): (Eds.). Flowering Plant Origin, Evolution and Does it show convergence with Papilionoids? Phylogeny. Chapman & Hall Inc., New York, Int. J. Plant Sci. 163: 75-87.) pp. 286-313. Tutin, T. G. et al. (ed.) (1964-1980). Flora Thorne, R. F. (1999). An Updated Classification of Europaea.. Cambridge University Press, Cam- the Class Angiospermae.http:// bridge, 5 vols. www.inform.umd.edu/PBIO/fam/ Uhl, N. W. (1947) Studies in the floral morphol- thorneangiosp99.html. Website maintained ogy and anatomy of certain members of Helo- (with nomenclatural additions) by Dr. J. L. biae. Ph.D. Thesis (Cited by Lawrence, 1951). Reveal of University of Maryland. Uhl, N. W., J. Dransfield, J. I. Davis, M. A. Thorne, R. F. (2000). The classification and Luckow, K, H. Nansen and J. J. Doyle. geography of the monocotyledon subclasses (1995). Phylogenetic relationships among Alismatidae, Liliidae, and Comelinidae. Pp. palms: Cladistic analysis of morphological 75-124, in Nordenstam, B., El Ghazaly, G., and chloroplast DNA restriction site varia- & Kassas, M. (Eds.), Plant Systematics for the tion. In: P. J. Rudall, P. J. Cribb., D. F. Cut- 21st Century. Portland, Oregon. ter and C. J. Humphries (Eds.). Monocotyle- Thorne, R. F. (2000) [2001]. The classification dons: Systematics and Evolution. 623-661. and geography of flowering plants: Dicotyle- Upchurch, G. R. Jr. and J. A. Wolfe. (1987). Mid- dons of the class Angiospermae (subclasses Cretaceous to Early Tertiary vegetation and Magnoliidae, Ranunculidae, Caryophyllidae, climate: evidence from fossil leaves and Dilleniidae, Rosidae, Asteridae, and woods. In: E. M. Friis, W. G. Chaloner, and Lamiidae). Bot. Rev. 66: 441-647. P. R. Crane (Eds.). The Origin of Angiosperms Thorne, R. F. (2003). An Updated Classification of and their Biological Consequences. Cambridge the Class Angiospermae. www.rsabg.org/pub- Univ. Press, Cambridge, pp. 75-105. lications/angiosp.htm. Valentine, D. H. and A. Love. (1958). Taxonomic Tournefort, J. P. de. (1696). Elements de botanique. and biosystematic categories. Brittonia 10: Paris, 3 vols. 153-166. Tournefort, J. P. de. (1700). Institutiones rei Vegter, I. H. (1988). Index herbariorum: a guide herbariae. Imprimerie Royale, Paris, 3 vols. to the location and contents of the world’s Trehane, P., et al. (1995). International code of public herbaria. Part 2(7). Collectors T-Z. nomenclature for cultivated plants. Regnum Regnum Veg. 117. (Part 2(6). Collectors S. Veg. 133. Regnum Veg. 114 publ. 1986). References 701

Wallace, R. S. and A. C. Gibson. (2002). Evolu- Wiley, E. O. (1978). The evolutionary species con- tion and systematics. Pp. 1-21 in Nobel, P. cept reconsidered. Syst. Zool. 27: 17-26. S. (ed.), Cacti: Biology and Uses. University Wiley, E. O. (1981). Phylogenetics-The Theory and of California Press, Berkeley Practice of Phylogenetic Systematics. John Wallick, K., W. Elisens, P. Kores and M. Molvray. Wiley and Sons, New York. (2001). Phylogenetic analysis of trnL-F se- William, W. T., J. M. Lambert and G. N. Lance. quence variation indicates a monophyletic (1966). Multivariate methods in plant ecol- Buddlejaceae and a paraphyletic Buddleia. ogy. V. Similarity analyses and information- Pp. 148-149, in Botany 2001: Plants and analysis. J. Ecol. 54: 427-445. People, Abstracts. [Albuquerque.] Willis, J. C. (1922). Age and Area. Cambridge. Wallick, K., W. Elisens, P. Kores and M. Molvray. Willis, J. C. (1973). A. Dictionary of Flowering Plants (2002). Phylogenetic analysis of trnL-F se- and Ferns, 8th ed. (revised by H. K. Airy-Shaw). quence variation indicates a monophyletic Cambridge Univ. Press, Cambridge, 1245 pp. Buddlejaceae and a paraphyletic Buddleia. Wilson, P. G., M. M. O’Brien, P. A. Gadek and Pp. 156-157 in Botany 2002: Botany in the Cur- C. J. Quinn (2001). Myrtaceae revisited: A riculum, Abstracts. [Madison, Wisconsin.] reassessment of infrafamilial groups. Ameri- Walters, D. R. and D. J. Keil. (1995). Vascular can J. Bot. 88: 2013-2025. Plant Taxonomy, 4th ed. Kendall?Hunt, Woese, C. R., W. E. Balch, L. J. Magrum, G. E. Dubuque, IA. Fox and R. S. Wolfe (1977). “An ancient Wannan, B. S. (2006). Analysis of generic rela- divergence among the bacteria”. Journal of tionships in Anacardiaceae. Blumea 51: 165- Molecular Evolution 9: 305–311. 195. Woese, C. R. O. Kandler and M. L. Wheelis Watson, L. and M. J. Dallwitz. (2000). The fami- (1990). “Towards a Natural System of Organ- lies of flowering plants: Descriptions and isms: Proposal for the Domains Archaea, illustrations.Website:http:// Bacteria, and Eucarya”. Proceedings of the biodiversity.uno.edu/delta/’. National Academy of Sciences 87: 4576–4579. Webster, G. L. (1967). The genera of Wojciechowski, M. F., M. Lavin and M. J. Euphorbiaceae in the southeastern United Sanderson (2003). A phylogeny of legumes States. J. Arnold Arbor. 48: 303-430. based on sequences of the plastid matK gene, Webster, G. L. (1994). Classification of the P. 99 in Botany 2003: Aquatic and Wetland Euphorbiaceae. Ann. Missouri Bot. Gard. 81: Plants: Wet and Wild. Abstracts. [ Mobile, 3-32. 1994. Alabama.] Wendel, J. F., A. Schnabel and T. Seelanan. Wolfe, K. H., M. Gouy, Y. -W. yang, P. M. Sharp (1995). An unusual ribosomal DNA dequence and W. -H. Li. (1989). Date of monocot-dicot from Gossypium gossypioides reveals divergence estimated from Choloroplast DNA ancient, cryptic, intergenomic, introgression. sequence data. Proc. Nat. Acad. Sci. USA Mol. Phylog. Evol. 4: 298-313. 86: 6201-6205. Wettstein, R. R. von. (1907). Handbuch der Woodland, D. W. (1991). Contemporary Plant Sys- systematischen Botanik (2nd ed.) Franz tematics. Prentice Hall. New Jersey. Deuticke, Leipzig. Worsdell, W. C. (1908). The affinities of Paeonia. Williams, S. E., V. A. Albert and M. W. Chase. J. Bot. (London) 46: 114 (1994). Relationships of Droseraceae: A cla- Wu, Z-Y, A. M. Lu, $ Y. C. Tang. (1998a). A Com- distic analysis of rbcL sequence and morpho- prehensive study of “Magnoliidae” sensu lato logical data. American J. Bot. 81: 1027-1037. - with special consideration on possibility and Whitlock, B. A., J. Lee, O. Dombrovska and Y. L. necessity for proposing a new” polyphyletic- Qiu. (2002). Effects of rate heterogeneity on polychronic-polytopic” system of angio- estimates of the age of angiosperms. P. 158, sperms. In: Zhang, A. I & S. G. Wu (Eds.) in Botany 2002: Botany in the Curriculum, Floristic Characteristics and Diversity of East Abstracts. [Madison, Wisconsin.] Asian Plants. Beijing & Berlin: China Higher Whittaker, R. H. (1969). “New concepts of king- Education Press & Springer Verlag, p. 269-334. doms of organisms”. Science 163: 150–160. Wu, Z-Y, Y. C. Tang, A. M. Lu et al. (1998b).On Wieland, G. R. (1906). American fossil cycads. primary subdivisions of the Magnoliophyta- Carnegie Institute, Washington, D. C. towards a new scheme for an eight-class Wieland, G. R. (1916). American fossil cycads vol. system of classification of the angiosperms. II. Carnegie Institute, Washington, D. C. Acta. Phytotax Sinica. 36: 385-402. 702 Plant Systematics

Wu, Z-Y, A. M. Lu, Y-C Tang, Z-D Chen and D-Z Young, D. A. (1981). Are the angiosperms primi- Li. (2002). Synopsis of a new ‘polyphyletic- tively vesselless? Syst. Bot. 6: 313-330. polychronic-polytopic’ system of the an- Young, D. J. and L. Watson. (1970). The classifi- giosperms. Acta Phytotax. Sinica 40: 289-322. cation of the dicotyledons: A study of the Wu, Z-Y, A. M. Lu, Y-C Tang, Z-D Chen and D-Z upper levels of hierarchy. Aust. J. Bot. 8: 387- Li. (2003). The Families and Genera of An- 433. giosperms in China: A Comparative Analysis. Zahn, L. M., J. H. Leebens-Mack, C. W. Science Press, Beijing. dePamphilis, H. Ma & G. Theissen. (2005). Wu, H.-C., H.-J. Su, & J.-M. Hu. (2007). The To B or not to B a flower: The role of identification of A-, B-, C-, and E-class DEFICIENS and GLOBOSA orthologs in the MADS-box genes and implications for peri- evolution of the angiosperms. J. Hered. 96: anth evolution in the basal eudicot 225-240. Trochodendron aralioides (Trochodendraceae). Zanis, M. J., D. E. Soltis, P. S. Soltis, Y-L Qiu Internat. J. Plant Sci. 168: 775-799. and E. A. Zimmer. (2003). Phylogenetic analy- Wurdack, K. J. and M. W. Chase. (2002). ses and perianth evolution in basal an- Phylogenetics of Euphorbiaceae s. str. giosperms. Ann. Missouri Bot. Gard. using plastid (rbcL and trnL-F) sequences. Zanis, M. J., D. E. Soltis, P. S. Soltis,Y-L Qiu, P. 160, in Botany 2002: Botany in the Curricu- S. Mathews, and M J. Donoghue. (2002). The lum, Abstracts. [Madison, Wisconsin.] root of the angiosperms revisited. Proc. Nat. Xiang, Q.-Y., D. E. Soltis, and P. S. Soltis. (1998). Acad. Sci. 99: 6848-6853. Phylogenetic relationships of Cornaceae and Zgurski, J. M., H. S. Rai, Q. M. Fai, D. J. Bogler close relatives inferred from matK and rbcL and J. Francisco-Ortega. (2008). How well sequences. Amer. J. Bot. 85: 285-297. do we understand the overall backbone of Yuan, Y.-M., Y. Song, K. Geuten, E. cycad phylogeny? New insights from a large, Rahelivololona, S. Wohlhauser, E. Fischer, multigene plastid data set. Mol. Phyl. Evol. E. Smets, and P. Küpfer. (2004). Phylogeny 47: 1232-1237. and biogeography of Balsaminaceae inferred Zhou, Z.K., P. M. Barrett, & J. Hilton . (2003). from ITS sequences. Taxon 53: 391-403. An exceptionally preserved Lower Creta- Yoo, K.-O. and J. Wen. (2002). Phylogeny and ceous ecosystem. Nature 421: 807-814. biogeography of Carpinus and subfamily Zomlefer, W. B. (1994). Guide to flowering plant Coryloideae (Betulaceae). Int. J. Plant Sci. families. University of Carolina Press, Chapel 163: 641-650. Hill.