MIAMI UNIVERSITY
The Graduate School
Certificate for Approving the Dissertation
We hereby approve the Dissertation
of
Gengxin Zhang
Candidate for the Degree: Doctor of Philosophy
______
Hailiang Dong, Director(Advisor)
______
John Rakovan, Reader
______
Jonathan Levy, Reader
______
Yildirim Dilek, Reader
______
Matthew W. Fields, Graduate School Representative
ABSTRACT
Geomicrobial Processes and Diversity in Ultra-High Pressure Metamorphic Rocks
and Deep Fluids from Chinese Continental Scientific Deep Drilling
By Gengxin Zhang
This dissertation investigates the microbial communities and microbe-mineral interactions in ultra-high pressure metamorphic rocks and deep fluids from the Chinese
Continental Scientific Drilling (CCSD) project by using geochemical, mineralogical, cultivation and molecular microbiology methods. The drilling site is located in the eastern part of the Dabie-Sulu ultra high-pressure metamorphic (UHPM) orogenic belt at the convergent plate boundary between the Sino-Korean and Yangtze Plates. This integrated approach conclusively demonstrates that microbes can survive in the deep continental subsurface (down to 3350 m) and they play important roles in mineral transformations and elemental cycling.
The first half of this study focuses on geochemical conditions and diversity and metabolic functions of microbial community. Characterization of SSU rRNA genes indicated that the bacterial clone sequences shifted form a Proteobacteria-dominated community to a Firmicutes-dominated one with increased depth. From the ground surface to 2030 m, most clone sequences were related to nitrate reducers, with a saline, alkaline, and cold habitat. From 2290 to 3350 m most sequences were closely related to anaerobic, thermophilic, halophilic or alkaliphilic bacteria. The archaeal diversity was low. Most archaeal sequences from the ground surface to 3350m were not related to known cultivated species, but to environmental clone sequences recovered from subsurface marine environments.
An important contribution of this research is an enrichment of a thermophilic
(optimal temperature of 68oC) organism from 2450m with an ability to reduce Fe(III) and oxidize Fe(II) under different conditions. This enriched organism was capable of reducing Fe(III) in aqueous form and in the structure of clay minerals and iron oxides at acidic pH. This organism was also capable of oxidizing Fe(II) in aqueous form and in the structure of pyrite and siderite.
The second half of this dissertation focuses on microbe-mineral interactions by using enriched and isolated cultures to react with clay and iron oxide minerals.
Mesophilic and thermophilic iron-reducing bacteria were incubated with lactate as the electron donor and structural Fe(III) in solid minerals as the sole electron acceptor.
Extensive mineral reaction took place. One important such reaction was the smectite to illite reaction promoted by mesophilic and thermophilic metal reducing bacteria. This particular reaction highlights the significant role of iron-reducing bacteria in promoting the smectite to illite reaction at high temperature.
Geomicrobial Processes and Diversity in Ultra-High Pressure Metamorphic Rocks and Deep Fluids from Chinese Continental Scientific Deep Drilling A DISSERTATION
Submitted to the Faculty of
Miami University in partial
fulfillment of the requirements
for the degree of
Doctor of Philosophy
Department of Geology
by
Gengxin Zhang
Miami University
Oxford, Ohio
2006
Dissertation Director: Hailiang Dong, Ph.D.
TABLE OF CONTENTS
Chapter 1: Introduction 1 References 3
Chapter 2: Microbial Diversity in Ultra-High Pressure Rocks and Fluids 6 From the Chinese Continental Scientific Drilling in China
Abstract 7 Body Text 8 References 31
Chapter 3: Unique Microbial Community in Drilling Fluids From 50 Chinese Continental Scientific Drilling
Abstract 51 Body Text 52 References 71
Chapter 4: Evidence for Microbial-Mediated Iron Redox cycling 90 in the Deep Subsurface Abstract 91 Body Text 92 References 113
Chapter 5: Microbial Reduction of Structural Fe(III) in Nontronite 141 by Thermophilic Bacteria and Their Roles in Promoting the Smectite-Illite Reaction Abstract 142 Body Text 143 References 154
Chapter 6: Microbial Effects in Promoting the Smectite to Illite Reaction: 171 Role of Organic Matter Intercalated in the Interlayer Abstract 172 Body Text 173 References 187
Chapter 7: Summary 204
ii LIST OF TABLES
Chapter 2: Microbial Diversity in Ultra-High Pressure Rocks and Fluids 6 From the Chinese Continental Scientific Drilling in China
1 - Summary of Anions, TOC and 13C isotope compositions for the 36 rocks and drilling fluids
2 - Chemical composition of the rock samples from CCSD 37
3 - Phylogenetic bacterial rDNA clone-type analysis 38
Chapter 3: Unique Microbial Community in Drilling Fluids From 50 Chinese Continental Scientific Drilling
1 - Anion and cation composition, pH, salinity and in-situ temperature 78 for the drilling fluid samples
Chapter 4: Evidence for Microbial-Mediated Iron Redox Cycling 90 in the Deep Subsurface
1 - Composition of M1 and AG medium 122
2 - Anion and cation composition, pH, salinity and in-situ temperature for 123 the drilling fluid sample
3 - Experimental conditions and employed analysis methods 124
Chapter 5: Microbial Reduction of Structural Fe(III) in Nontronite 141 by Thermophilic Bacteria and Their Roles in Promoting the Smectite-Illite Reaction
1 - Experimental conditions used for nontronite reduction in bacterial 161 cultures and abiotic controls
2 - Change in pH and Eh as a result of Fe(III) bioreduction 162
Chapter 6: Microbial Effects in Promoting the Smectite to Illite 171 Reaction:Role of Organic Matter Intercalated in the Interlayer
iii LIST OF FIGURES
Chapter 2: Microbial Diversity in Ultra-High Pressure Rocks and Fluids 6 From the Chinese Continental Scientific Drilling in China
1 - A map showing general geology in the Dabie-Sulu orogen 43 of central-eastern China
2 - A back-scattered electron image showing fractures in garnet and pyroxene 44
3 - An optical micrograph showing various mineral/fluid inclusions in 45 the UHP rocks
4 - Neighbor-joining tree of nearly full-length sequences (~1400 bp) of 46 isolates and representative examples of bacterial clone sequences
5 - Typical electropherograms of bacterial T-RFLPs 47
6 - Phylogenetic relationships of representative phylotypes of bacterial 48 16S rRNA gene sequences
7 - Phylogenetic relationships of representative phylotypes of archaeal 49 16S rRNA gene sequences
Chapter 3: Unique Microbial Community in Drilling Fluids From 50 Chinese Continental Scientific Drilling
1 - A map showing general geology in the Dabie-Sulu orogen 81 of central-eastern China
2 - PLFA profiles for the drilling fluid samples 82
3 - Neighbor-joining tree of nearly full-length sequences (~1400 bp) 83 of isolates and representative examples of bacterial clone sequences
4 - Ferrihydrite was reduced by CCSD_DF2290_FWA_60_ isolate1 84
5 – Nontronite was reduced by CCSD_DF2450_M1_68_ isolate6 85
6 - Phylogenetic relationships of representative phylotypes of bacterial 87 16S rRNA gene sequences
7 - Phylogenetic relationships of representative phylotypes of archaeal 88 16S rRNA gene sequences
8 - Stacked bar graph showing the contribution of each family of bacteria 89
iv in the clone libraries for the drilling fluid samples
Chapter 4: Evidence for Microbially-Mediated Iron Redox 90 Cycling in the Deep Subsurface
1 - Change in 0.5 N HCl-extractable Fe(II) with time in the first 128 transfer from the enrichment culture in the M1 medium
2 - Changes of Fe(II) concentration, lactate, acetate Eh and pH 129 with time in the second transfer in AG medium
3 - Change in 0.5 M HCl-extractable Fe(II) with time in the 131 third transfer in AG medium with nontronite, ferric citrate or ferrihydrite
4 - Photographs of biological oxidized FeS and abiotic FeS control 133
5 - XRD patterns of bio-oxidized FeS, abiotic control and reference 134
6 – Secondary electron image showing that ferric citrate was reduced 135 to form vivianite and then partially oxidized in the third transfer in AG medium
7 – Secondary electron image showing ferrihydrite as an oxidation 136 products of FeS
8 – TEM micrographs of microbially oxidized FeS 137
9 – Mössbauer spectra of the bioreduced ferric citrate at different temperature 139
10 – Phylogenetic relationships of representative phylotypes of bacterial 140 16S rRNA gene sequences
Chapter 5: Microbial Reduction of Structural Fe(III) in Nontronite 141 by Thermophilic Bacteria and Their Roles in Promoting the Smectite-Illite Reaction
1 - Production of biogenic Fe(II) from bioreduced nontronite samples 165
2 - XRD patterns for of nontronite samples 166
3 - Secondary electron images of bioreduced and nonreduced nontronite 167
4 - Secondary electron image showing evolution of illite crystal morphology 168
5 - TEM micrographs for bioreduced and nonreduced nontronite 169
v
6 - Histograms showing the distribution of layer spacings in bioreduced 170 and nonreduced nontronite
Chapter 6: Microbial Effects in Promoting the Smectite to Illite 171 Reaction:Role of Organic Matter Intercalated in the Interlayer
1 - XRD patterns for oriented specimens of nontronite 194
2 - Comparison of FTIR spectra for nontronite, cysteine 195 and cysteine-NAu-2 complex
3 - Production of biogenic Fe(II) from bioreduced nontronite 196
4 - Secondary electron images of bioreduced and nonreduced nontronite 197
5 - Histograms showing the distribution of layer spacings 200 in the cysteine-NAu-2 complex
6 - TEM micrographs of nonreduced cysteine-nontronite 201 and bioreduced cysteine-nontronite
7 - TEM micrographs of bioreduced cysteine-nontronite 202
8 - TEM micrographs of nonreduced and bioreduced toluene-nontronite 203
vi ACKNOWLEDGEMENTS
I would like to express my sincere gratitude to many people who have helped me during my Ph.D. study. The first and the foremost is my advisor Dr. Hailiang Dong. Hailiang took me on as his Ph.D. student in 2001. If he had not given me the chance to work out my visa application, I would not have pursued my Ph.D. degree. His knowledge as a scientist, and just as importantly, his skills as an advisor, has proven to be invaluable to this project. Throughout the four years here at Miami, Hailiang has consistently shown a confidence in my ability to do research, which has urged me to accomplish more than what I had thought possible. I am grateful to his persistence, patience, and guidance, and I value him as both a mentor and a friend. Hailiang, thank you for all your help! Thank you to everyone who has served on my committees over the years: John Rakovan, Jonathan Levy, Yildirim Dilek, and Matthew W. Fields. John and Matthew: I really have appreciated your advice over the years. I would also like to thank John Morton for his assistance in the labs and Chris Wood for many hours of assistance in the labs. I thank Dr. Jinwook Kim of Naval Research Laboratory for supplying all TEM data and Dr Chuanlun Zhang for supplying PLFA data. I thank David Balkwill for his initial training on phylogenetic analyses during my visit to his laboratory. Thanks also go to Dr. Brian P. Hedlund for the help in his labs during my time spent at the University of Nevada The friendship and insightful conversations provided by my fellow graduate students have been great. I’d like to thank all of my fellow graduate students. During many years at Miami, I made lots of great friendships with lots of different people. I would especially like to thank Hongchen Jiang, Deb Jaisi, Jennifer Seabaugh, and Cynthia Cohen for their advice and encouragement. Finally, I would like to thank my family. I’d like to thank my Mom and Dad for letting me find my own path and always being there for me throughout this entire process. Thanks for always giving me encouragement, listening to me and believing in me. I thank my brothers’ support in taking care of my parents while I am away during these years.
vii These projects were supported by the National Science Foundation (to Hailiang Dong), the Geological Society of America (to Gengxin Zhang) and Clay Mineral Society (to Gengxin Zhang).
viii CHAPTER 1:
INTRODUCTION
It has recently been recognized that a large population of microorganisms inhabit diverse subsurface environments including aquifers in terrestrial igneous rocks sub- seafloor sediments and basement rocks, continental sedimentary rocks, ancient salt deposits and caves (Fish et al., 2002; Fredrickson and Balkwill, 2006; Fredrickson and Onstott, 1996; Krumholz, 2000; Moser et al., 2003; Northup and Lavoie, 2001; Onstott et al., 2003; Pedersen, 1997; Stevens, 1997; Stevens and McKinley, 1995; Stevens et al., 1993). The depth of the Earth’s biosphere has yet to be delineated; however, recent studies have extended the biosphere’s depth limits to≥4.5 km (Lin et al., 2006; Moser et al., 2003; Onstott et al., 2003) Advances in our understanding of the origins, diversity, distributions and functions of microorganisms in deep, often extreme, subsurface environments is rapidly expanding our knowledge of biogeochemical processes on Earth and beyond. The discovery of novel microorganisms from deep accessible subsurface habitats provides opportunities for discovering new pharmaceuticals, studying biosynthetic processes, remediating contaminated environments as well as enhancing energy production. A major obstacle to understanding the subsurface biosphere has been our limited ability to access the deep subsurface environment, to acquire uncontaminated samples and to place our knowledge of microorganisms (functional genes and proteins) into environmental context. Past and current opportunities to address biogeochemical processes have largely been limited to the shallow crust and geographically sparse locations (Colwell, 1997; Fredrickson et al., 1997; Kotelnikova, 1997; Reed et al., 2002). More recently, Onstott et al.(2003) studied microbial diversity, abundance and functions in the metamorphic quartzite and Carbon Leader from South Africa deep mines. Despite the great caution taken, the authors demonstrated that the samples were still contaminated, but they were able to show that indigenous microorganisms were also present at 3250m (< 102 cells/g and ~103 cells/g for the Carbon Leader and quartzite, respectively). Microbes participate in a variety of biogeochemical processes such as element cycling, mineral transformations, and weathering and formation of minerals (Dong et al.,
1 2000; Fredrickson et al., 1998; Kim et al., 2004; Lovley et al., 1991; Nealson and Stahl, 1997). Microbial iron respiration and mineral formation and dissolution not only plays an important role in cycling of metals, microbial nutrients in natural and contaminated subsurface environments (Lovley, 1993; Nealson and Saffarini, 1994), but also impacts on the speciation and the fate of a variety of heavy metals and organic contaminant in subsurface environments (Fredrickson et al., 2000; Fredrickson et al., 2002). Microbe- mineral interactions have been widely studied but only a few studies have focused on microbial-mineral interactions in deep subsurface (Hama et al., 2001; Tuck et al., 2006). A unique opportunity became available to us from the Chinese Continental Scientific Drilling (CCSD) Project, the world’s deepest ongoing drilling in China (http://www.icdp-online.de/sites/donghai/news/news.html). Employing the most recent drilling technologies, the CCSD project, sponsored by the International Continental Drilling Program (ICDP) and the Chinese government, is to drill a 5000 m deep borehole in the eastern part of the Dabie-Sulu ultra high-pressure metamorphic (UHPM) orogenic belt that is located at the center of the convergent plate boundary between Sino-Korean Plate and Yangtze Plate. The CCSD project provides a unique opportunity to study the deep subsurface microbiology by offering 1) 5,000 meter long, continuous drill core across a wide range of environmental gradients; 2) a truly multidisciplinary international research team that ensures measurements of geological, geochemical, and hydrological parameters that are essential to interpretations of microbial studies. The goals of this study were to systematically investigate microbial diversity, abundance and metabolic functions in UHPM rocks and deep fluids from surface to 3350 meters by culture dependent and independent approaches. The goals of this research are to: 1) Characterize the microbial community by culture independent techniques from the ground surface to 3350 m depth; 2) Examine how complex and heterogeneous geological media (rocks, fractures, minerals, fluids and gases) control microbial diversity, abundance, distribution and their functions; 3) Culture and isolate unique microorganisms based upon geochemical, hydrological, and 16S rRNA gene data;
2 4) Test the possible effects of deep subsurface microbes on geological processes. Our results suggest the existence of a unique microbial community in these deep rocks and geological fluids, and measured and inferred functions of cloned sequences are consistent with the geochemical environments. Novel metabolic functions, such as microbial-mediated iron redox cycling, may play important roles in mineral precipitation, dissolution and transformation in the deep subsurface. Our study extends the current investigations of the subsurface microbiology into high-pressure metamorphic rocks in a unique tectonic setting. REFERENCES Colwell, F.S., T. C. Ontott, M. E. Delwiche, D. Chandler, J. K. Fredrickson, Q.-J. Yao, J. P. McKinley, D. R. Boone, R. Griffiths, T. J. Phelps, D. Ringelberg, D. C. White, L. LaFreniere, D. Balkwill, R. M. Lehman, J. Konisky, and P. E. Long. (1997) Microorganisms from deep, high temperature sandstones: constraints on microbial colonization. FEMS Microbial Reviews, 20, 425-435. Dong, H.L., Fredrickson, J.K., Kennedy, D.W., Zachara, J.M., Kukkadapu, R.K., and Onstott, T.C. (2000) Mineral transformation associated with the microbial reduction of magnetite. Chemical Geology, 169(3-4), 299-318. Fish, S.A., Shepherd, T.J., McGenity, T.J., and Grant, W.D. (2002) Recovery of 16S ribosomal RNA gene fragments from ancient halite. Nature, 417(6887), 432-436. Fredrickson, J.K., and Balkwill, D.L. (2006) Geomicrobial processes and biodiversity in the deep terrestrial subsurface. Geomicrobiology Journal, 23(6), 345-356. Fredrickson, J.K., McKinley, J.P., Bjornstad, B.N., Long, P.E., Ringelberg, D.B., White, D.C., Krumholz, L.R., Suflita, J.M., Colwell, F.S., Lehman, R.M., Phelps, T.J., and Onstott, T.C. (1997) Pore-size constraints on the activity and survival of subsurface bacteria in a late Cretaceous shale-sandstone sequence, northwestern New Mexico. Geomicrobiology Journal, 14(3), 183-202. Fredrickson, J.K., and Onstott, T.C. (1996) Microbes deep inside the Earth. Scientific American, 275(4), 68-73. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Dong, H.L., Onstott, T.C., Hinman, N.W., and Li, S.M. (1998) Biogenic iron mineralization accompanying the
3 dissimilatory reduction of hydrous ferric oxide by a groundwater bacterium. Geochimica Et Cosmochimica Acta, 62(19-20), 3239-3257. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Duff, M.C., Gorby, Y.A., Li, S.M.W., and Krupka, K.M. (2000) Reduction of U(VI) in goethite (alpha-FeOOH) suspensions by a dissimilatory metal-reducing bacterium. Geochimica et Cosmochimica Acta, 64(18), 3085-3098. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Liu, C., Duff, M.C., Hunter, D.B., and Dohnalkova, A. (2002) Influence of Mn oxides on the reduction of Uranium(VI) by the metal-reducing bacterium Shewanella putrefaciens. Geochimica et Cosmochimica Acta, 66(18), 3247-3262. Hama, K., Bateman, K., Coombs, P., Hards, V.L., Milodowski, A.E., West, J.M., Wetton, P.D., Yoshida, H., and Aoki, K. (2001) Influence of bacteria on rock-water interaction and clay mineral formation in subsurface granitic environments. Clay Minerals, 36(4), 599-613. Kim, J.W., Dong, H., Seabaugh, J., Newell, S.W., and Eberl, D.D. (2004) Role of microbes in the smectite-to-illite reaction. Science, 303(5659), 830-832. Kotelnikova, S., and K. Pedersen. (1997) Evidence for methanogenic Archea and homoacetogenic Bacteria in dee granitic rock aquifers. FEMS Microbiology Reviews, 20, 339-349. Krumholz, L.R. (2000) Microbial communities in the deep subsurface. Hydrogeology Journal, 8(1), 4-10. Lin, L.H., Wang, P.L., Rumble, D., Lippmann-Pipke, J., Boice, E., Pratt, L.M., Lollar, B.S., Brodie, E.L., Hazen, T.C., Andersen, G.L., DeSantis, T.Z., Moser, D.P., Kershaw, D., and Onstott, T.C. (2006) Long-term sustainability of a high-energy, low-diversity crustal biome. Science, 314(5798), 479-482. Lovley. (1993) Dissimilatory Metal Reduction. Annual Review of Microbiology, 47, 263-290. Lovley, D.R., Phillips, E.J.P., Gorby, Y.A., and Landa, E.R. (1991) Microbial reduction of uranium. Nature, 350, 413-416. Moser, D.P., Fredrickson, J.K., Geist, D.R., Arntzen, E.V., Peacock, A.D., Li, S.M.W., Spadoni, T., and McKinley, J.P. (2003) Biogeochemical processes and microbial
4 characteristics across groundwater-surface water boundaries of the Hanford Reach of the Columbia River. Environmental Science & Technology, 37(22), 5127-5134. Nealson, K.H., and Saffarini, D. (1994) Iron and manganese in anaerobic respiration: environmental significance, physiology, and regulation. Annual Review of Microbiology, 48, 311-343. Nealson, K.H., and Stahl, D.A. (1997) Microorganisms and biogeochemical cycles: What can we learn from layered microbial communities? Geomicrobiology: Interactions between Microbes and Minerals, 35, p. 5-34. Northup, D.E., and Lavoie, K.H. (2001) Geomicrobiology of caves: A review. Geomicrobiology Journal, 18(3), 199-222. Onstott, T.C., Moser, D.P., Pfiffner, S.M., Fredrickson, J.K., Brockman, F.J., Phelps, T.J., White, D.C., Peacock, A., Balkwill, D., Hoover, R., Krumholz, L.R., Borscik, M., Kieft, T.L., and Wilson, R. (2003) Indigenous and contaminant microbes in ultradeep mines. Environmental Microbiology, 5(11), 1168-1191. Pedersen, K. (1997) Microbial life in deep granitic rock. Fems Microbiology Reviews, 20(3-4), 399-414. Reed, D.W., Fujita, Y., Delwiche, M.E., Blackwelder, D.B., Sheridan, P.P., Uchida, T., and Colwell, F.S. (2002) Microbial communities from methane hydrate-bearing deep marine sediments in a forearc basin. Applied and Environmental Microbiology, 68(8), 3759-3770. Stevens, T. (1997) Lithoautotrophy in the subsurface. Fems Microbiology Reviews, 20(3- 4), 327-337. Stevens, T.O., and McKinley, J.P. (1995) Lithoautotrophic microbial ecosystems in deep basalt aquifers. Science, 270, 450-454. Stevens, T.O., McKinley, J.P., and Fredrickson, J.K. (1993) Bacteria associated with deep, alkaline, anaerobic groundwaters in Southeast Washington. Microbial Ecology, 25, 35-50. Tuck, V.A., Edyvean, R.G.J., West, J.M., Bateman, K., Coombs, P., Milodowski, A.E., and McKervey, J.A. (2006) Biologically induced clay formation in subsurface granitic environments. Journal of Geochemical Exploration, 90(1-2), 123-133.
5 Microbial Diversity in Ultra-High Pressure Rocks and Fluids From the Chinese Continental Scientific Drilling in China Running title: Microbial Communities in Rocks and Fluids From Deep Drilling
Gengxin Zhang1, Hailiang Dong1*, Zhiqin Xu2, Donggao Zhao3, and Chuanlun Zhang4
1: Department of Geology Miami University Oxford, OH 45056
2: Chinese Academy of Geological Sciences Institute of Geology, Beijing, China
3: Department of Geological Sciences University of South Carolina, Columbia, SC 29208
4: Savannah River Ecology Laboratory and Marine Sciences Department University of Georgia P.O. Box Drawer E Aiken, SC 29802
*Corresponding author: Hailiang Dong Department of Geology Miami University Oxford, OH 45056 Tel: 513-529-2517 Fax: 513-529-1542 Email: [email protected]
Published in Applied and Environmental Microbiology, (2005), p. 3213–3227
6 ABSTRACT
Microbial communities in ultra-high pressure (UHP) rocks and drilling fluids from Chinese Continental Scientific Drilling (CCSD) were characterized. The rocks had porosity of 1-3.5% and permeability of ~0.5 mDarcy. Abundant fluid/gas inclusions were present in minerals. The rocks contained a significant amount of Fe2O3, FeO, P2O5 and nitrate (3-16 ppm). Acridine orange direct count and phospholipid fatty acid analysis indicated that total counts in the rocks and the fluids were 5.2 x 103 to 2.4 x 104 cells/g and 3.5 x 108 to 4.2 x 109 cells/g, respectively. Enrichment assays indicated the successful growths of thermophilic and alkaliphilic bacteria from the fluids, some of which reduced Fe(III) to magnetite. 16S rRNA gene analyses indicated that the rocks were dominated by sequences similar to Proteobacteria and most were related to nitrate reducers, with a saline, alkaline, and cold habitat, but some phylotypes were either members of a novel lineage or closely related to uncultured clones. The bacterial communities in the fluids were more diverse, including Proteobacteria, Bacteroidetes, Gram-positive, Planctomycetes, and Candidate. The archaeal diversity was lower, and most sequences were not related to any known cultivated species. Some archaeal sequences were 90-95% similar to those recovered from ocean sediments or other subsurface environments. Some archaeal sequences from the drilling fluids were >93% similar to Sulfolobus solfataricus and its thermophilic nature was consistent with the in- situ temperature. We infer that microbes in the UHP rocks reside in fluid/gas inclusions, whereas those in the drilling fluids may be derived from subsurface fluids.
7 INTRODUCTION Advances in our understanding of the origins, diversity, distributions and functions of microorganisms in deep, often extreme, subsurface environments is rapidly expanding our knowledge of biogeochemical processes on Earth and beyond.. The discovery of novel microorganisms from deep accessible subsurface habitats provides opportunities for discovering new pharmaceuticals, studying biosynthetic processes, remediating contaminated environments as well as enhancing energy production. A major obstacle to understanding the subsurface biosphere has been our limited ability to access the deep subsurface environment, to acquire uncontaminated samples and to place our knowledge of microorganisms (functional genes and proteins) into environmental context. Past and current opportunities to address biogeochemical processes have largely been limited to the shallow crust and geographically sparse locations (Colwell, 1997; Krumholz et al., 1997; Pedersen, 1997; Reed et al., 2002). More recently, Onstott et al. (Onstott et al., 2003) studied microbial diversity, abundance and functions in the metamorphic quartzite and Carbon Leader from South Africa deep mines. Despite the great caution taken, the authors demonstrated that the samples were still contaminated, but they were able to show that indigenous microorganisms were also present (< 102 cells/g and ~103 cells/g for the Carbon Leader and quartzite, respectively). A unique opportunity became available to us from the Chinese Continental Scientific Drilling (CCSD) Project, the world’s deepest ongoing drilling in China (http://www.icdp-online.de/sites/donghai/news/news.html). Employing the most recent drilling technologies, the CCSD project, sponsored by the International Continental Drilling Program (ICDP) and the Chinese government, is to drill a 5000 m deep borehole in the eastern part of the Dabie-Sulu ultra high-pressure (UHP) metamorphic orogenic belt that is located at the center of the convergent plate boundary between Sino-Korean Plate and Yangtze Plate. The CCSD project provides a unique opportunity to study the deep subsurface microbiology by offering 1) 5,000 meter long, continuous drill core across a wide range of environmental gradients; 2) a truly multidisciplinary international research team that ensures measurements of geological, geochemical, and hydrological parameters that are essential to interpretations of microbial studies.
8 The goals of this study were to systematically investigate microbial diversity and abundance in UHP rocks from the 529 meters to 2026 meters by culture dependent and independent approaches. Our results suggest the existence of a unique microbial community in these deep rocks and geological fluids, and measured and inferred functions of cloned sequences are consistent with the geochemical environments. Our study extends the current investigations of the subsurface microbiology into high- pressure metamorphic rocks in a unique tectonic setting.
MATERIALS AND METHODS Site description and geology. The CCSD drilling site is located in Donghai County, Lianyungang City, Jiangsu Province, in the eastern part of the Dabie-Sulu ultra- high pressure metamorphic (UHPM) belt (Fig. 1). The Dabie-Sulu UHPM belt was formed by collision between Sino-Korean Plate and Yangtze Plate about 240 Ma years ago. Occurrence of diamond and coesite in the rocks reveals temperature-pressure conditions of 700 to 850°C and 2.8 GPa for the UHP metamorphism (Zheng et al., 2003). Current geothermal gradient at the site is approximately 25 oC/km.The UHP rocks were subducted to at least 100-km depth and experienced UHP metamorphism before being rapidly exhumed to the surface about 220 Ma ago. By drilling to a depth of 5 km, it is possible to study rocks that used to be at a depth of 100 km. The products of plate tectonics of this region, i.e., UHP rocks and minerals, along with abundant fluids, radioactivity (U and Th), gases (H2, CO2, CO, and CH4), have provided a unique environment for subsurface microbes. The UHP rocks are typically separated by a series of structurally weak shear zones and faults. These shear zones and faults are potential storage space for large pockets of fluids/gases and they may serve as a potential microbial habitat. Many rocks also contain fluid/gas inclusions, and they are also potential habitats for microbes, especially when they contain carbon source and essential nutrients such as P and N. Sample collection and preparation. Using a diamond wireline coring system, samples of rock cores and drilling fluids (from the same depth) were collected every 50 meters using sterile tools, purged in an anaerobic glove box, and immediately preserved in a –80oC freezer at the drilling site. Exceptions in sampling intervals were made when
9 geochemical anomalies were encountered, such as structure shear zones and certain depth intervals with high amounts of fluid/gas. In such cases, sampling intervals were more frequent. The extent of surface contamination was assessed using strict quality control protocols (see below). Rock cores were 156 mm in diameter and variable in length. Twelve pairs of frozen samples of rock cores and drilling fluids covering the depth from 529 to 2026 meters below the surface were shipped to the US in dry ice, five of which (CCSD_RK529, CCSD_RK730, CCSD_RK1080, CCSD_RK1930 and CCSD_RK2026 from 529, 730, 1080, 1930, and 2026 meters below the ground surface, respectively) were analyzed for geochemistry and microbiology. Given the measured geothermal gradient, the in-situ temperature for these rocks is 38, 43, 52, 73, 95oC, respectively. The names of the samples are as follows, with CCSD_RK529 as an example: CCSD, Chinese continental scientific drilling; RK, rock; 529, depth in meters where the rock is from. The names of the drilling fluids are the same as those for the rocks except that RK is replaced by DF (drilling fluid). Quality control. To estimate the extent of the drilling fluid intrusion into the rock cores, multiple approaches were used to address contamination issues: 1) Chemical tracer: the drilling fluid contained abundant chloride and sulfate tracers and they were used as chemical tracers to detect possible contamination of the rock cores by the drilling fluid; 2) Microbiological tracer: selected rock cores were immersed into suspensions of positive control microorganisms (108 cells/mL, Escherichia coli and Shewanella putrefaciens CN32) for one week at 25oC and their DNA was extracted and amplified; 3) Isotope tracer: the total carbon and total organic carbon (TC and TOC) concentrations as well as their respective 13C values in the rock and drilling fluid samples were compared; 4) Phospholipid fatty acid (PLFA) analyses of one eclogite sample (S17 from 1179 m) and several drilling fluid samples to compare their PLFA profiles; 5) Contamination possibly introduced in the laboratory procedures was tested using 70% ethanol- and oven- sterilized rock cores (500oC overnight); 6) Surface soil sample was collected as a possible contaminant source and their microbial communities were determined along with the rock samples. Similarity or difference between the contamination source and the rock cores would be indicative of the extent of contamination.
10 Drill-site petrophysical and geochemical analyses. Rock porosity, permeability, electrical resistivity, and magnetic susceptibility were measured using various instruments in a petrophysics laboratory at the drilling site. A small subcore with two polished ends was used for determination of porosity and permeability with a gas (N2 or
Ar) source. Gas concentrations (CO2, CH4, H2, and He) in subsurface fluids from shear zones/faults at various depths were determined by real-time gas chromatography (GC). Because circulating drilling fluid was used for drilling, any gases or fluids from geological shear zones/faults were mixed with the drilling fluid. Their concentrations were therefore determined by subtraction of the background noise from measured signal. Peaks significantly above the background level were considered to reflect gases from geological environments, most likely from structurally weak shear zones and faults in the borehole. Laboratory geochemical analyses. To identify mineralogy of the rock samples, powder XRD patterns were obtained with a Scintag X1 powder diffractometer system using CuKα radiation with a variable divergent slit and a solid-state detector. The routine power was 1400 W (40 kV, 35 mA). Low-background quartz XRD slides (Gem Dugout, Inc., Pittsburgh, Pennsylvania) were used. For analysis, powder samples were tightly packed into the well of the slides. Mineral identification was made using the search- match software. Well-polished thin sections were made for the rock samples to perform optical microscopy observations to reveal textural relationships of various minerals and to observe fractures/fluid inclusions. Electron microprobe analyses were performed on individual minerals of two samples (CCSD_RK529 and CCSD_RK730) for quantitative determination of chemical composition, especially for P2O5 content and Fe(III)/Fe(II) ratio. Chemical compositions of minerals were determined from thin sections of the two rock samples on a Cameca SX50 electron microprobe (wavelength dispersive system) at the University of South Carolina. Standards used included: omphacite as standard for Na, garnet for Mg, Al, Si, Ca and Fe, apatite for P, ilmenite for Ti, chromite for Cr, MnO2 for Mn, and microcline for K. Minerals were analyzed with a focused beam in spot mode at an accelerating voltage of 15 kV and a beam current of 10 nA. For P, peak and background counting times were set at 60 and 30 seconds, respectively. For other elements, peak and background counting times were set at 20 and 10 seconds, or at 50
11 and 25 seconds. Back-scattered electron images were taken to show fractures and various mineral phases. All five samples were analyzed for whole rock chemistry by wet chemistry method. Selected samples of the rocks and the drilling fluids were analyzed for the total carbon (TC) and total organic carbon (TOC). The total carbon and 13C analyses were performed on powdered samples by the combustion method with an Isochrom Continuous Flow Stable Isotope Mass Spectrometer (Micromass) coupled to a Carlo Erba Elemental Analyzer (CHNS-O EA1108) at the University of Waterloo. The amount of carbon needed for accurate analysis was in the range of 0.03 to 0.2 mg, which was equivalent of approximately 100 mg of rock powder. For the total organic carbon analyses, powdered samples were treated with 5% HCl at 50oC over night to remove inorganic carbonates followed by the same procedure. The precision for 13C analyses was better than ±0.3‰.. The pore water chemistry of the rock samples, most likely from fluid inclusions, was determined by extraction with distilled water of 1 g rock powder over night. The rock leachate and supernatant of the drilling fluid samples were analyzed for - 2- F, Cl, NO 3, and SO 4 by high performance liquid chromatography (HPLC). The pH of the drilling fluids was also measured with a pH probe. Direct microscopic counts. The rock cores were split using a sterile hydraulic splitter and the external surfaces of the cores were removed. Internal fresh nuggets (200- 500 g) were recovered (representing ~20% mass recovery) and they were manually ground in a sterile mortar in the presence of liquid N2. The resulting rock powder was divided into two aliquots: one for direct count and the other for DNA extraction. Microbial cells were first detached from the rock powder by strong agitation in 0.6% NaCl solution for 10 min (Bottomley, 1994) followed by acridine orange staining and counting by a epifluorescene microscope. PLFA analyses. PLFA were analyzed for one eclogite sample from the intermediate depth (CCSD_RK1179 from 1179 m) and two drilling fluids (CCSD_DF730 from 730 m and CCSD_DF1080 from 1080 m). All the samples were shipped frozen to Microbial Insights, Inc. (Rockford, TN) and the University of Georgia. Prior to analysis, the surfaces of the core were removed. The total lipid was extracted (White et al., 1979) followed by separation of the polar lipids by column chromatography (Guckert et al.,
12 1985). The polar lipid fatty acids were derivatized to fatty acid methyl esters, which were quantified using gas chromatography (Ringelberg et al., 1994). Fatty acid structures were verified by chromatography/mass spectrometry and equivalent chain length analysis. Enrichment. Based on the similarity of cloned sequences (see below) to cultured bacteria, various media were prepared to determine whether microorganisms could be cultured from the rock and drilling fluid samples. Enrichments were set up for one representative rock (eclogite from 2000 meters) in minimal medium M1 (Kostka and Nealson, 1998) and FWA-Fe(III) medium (Lovley and Philips, 1988) under strictly anaerobic conditions at incubation temperature of 37oC, 60oC, 80oC and 100oC. Fe(III) in hydrous ferric oxide (HFO) was provided as the sole electron acceptor and acetate or lactate the sole electron donor. Enrichments were also prepared for one drilling fluid sample from 2030 meters depth (CCSD_DF2030) using 3 media for anaerobic, thermophilic, and alkaliphilic bacteria from various subsurface environments. Two incubation temperatures were used at 37oC and 68oC. The first one was an enrichment medium (designated as AG medium hereafter) for Anaerobranca gottschalkii, a thermoalkaliphilic bacterium that grows anaerobically at high pH (pH 9.5) and temperature (37oC) (Prowe and Antranikian, 2001). The carbon source was starch or xylan. The second one was an enrichment medium (designated as CL medium hereafter) for Caldicellulosiruptor lactoaceticus, an extremely thermophilic, cellulolytic, anaerobic bacterium from an alkaline hot spring in Hverageroi, Iceland (Mladenovska et al., 1995). The carbon source was microcrystalline cellulose. The third one was an enrichment medium (designated as TE medium hereafter) for Thermoanaerobacter ethanolicus, a thermophilic metal-reducing bacterium from deep subsurface of the Piceance Basin, Colorado (Roh et al., 2002). The carbon source was acetate or pyruvate, and the electron acceptor was Fe(III) in oxyhydroxide. All incubations were carried out in the dark without shaking. Growth was monitored by acridine orange direct count (AODC) and by visual inspection of color change and precipitation. When growth was evident, transfer of enrichment tubes was carried out. In the Fe(III) reducing medium (M1, FWA-Fe(III) or TE), production of biogenic Fe(II) was measured by Ferrozine assay (Stookey, 1970). Isolation was performed inside a glove box by pouring anaerobic agar onto plates. For
13 isolation of thermophilic bacteria, a high melting-point agar, GELRITE gellan gum (Sigma), was used and the roll-tube method was employed (Kashefi et al., 2002). DNA isolation, amplification, cloning and sequence analyses. Genomic DNA was extracted from either isolates or the samples of the preserved rocks, the drilling fluids, and the surface soil sample. DNA extraction from isolates was accomplished with an UltraClean Soil DNA Isolation Kit (Mo Bio Laboratory Inc., Solana Beach, CA). DNA extraction from the rocks, the drilling fluids, and the surface soil was carried out with a combination of physical bead beating, chemical extraction, and biological lysis. All stock and working solutions and water used for reagent preparation were filtered through a 0.2- μL filter and then autoclaved. All glassware and utensils used for nucleic acid extraction were baked at 500oC over night. Plastic wares were autoclaved. The rock powder was suspended in 82-mL extraction buffer (200 mM NaCl, 200 mM Tris, 2 mM Na citrate, 10 mM CaCl2, 50 mM EDTA, titrated to pH 8.0 with HCl), incubated for 30 min at 37oC in the solution of 1mL lysozyme (100 mg/mL), 1mL polyadenylic acid (10 mg/mL), and 3 mL 10% pyrophosphate. The extraction solution was precipitated by adding 0.1 volume of 3 M sodium acetate (pH 5.2) and 2 volumes of 100% ethanol, washed with 75% ethanol, and resuspended in sterile distilled water. The resuspended solution was purified with phenol: chloroform: isoamyl-alcohol (24:24:1) and precipitated by ethanol again. Crude nuclide acid extracted was purified with a QIAGEN® RNA/DNA Midi Kit (Qiagen Inc., Chatsworth, CA). Purified DNA was used as template for the amplification of 16S rRNA gene by means of polymerase chain reaction (PCR) according to the procedure of Failsafe Kit (Epicenter Communications Inc., Sausalito, CA). Because the rock cores contained a very small amount of DNA, it was not always reliable to determine DNA concentration by spectrophotometry. Our best estimate of DNA template was on the order of 0.5-1 ng/μL and in a typical reaction, 1 μL template was added to the reaction. The PCR reaction conditions for bacteria were 10 mM Tris pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 μM each dNTP, 0.2 μM each primer, and 1.25 unit FailSafe PCR Enzyme Mix in 50 µL reaction volume. Bacterial primer sequences were Bac27F: 5΄- AGAGTTTGATCMTGGCTCAG, and Univ1492R: 5΄-CGGTTACCTTGTTACGACTT.
14 The following standard conditions were used for amplification of the bacterial 16S rRNA o o o gene: 30 cycles (denature at 95 C for 30s, annealing at 60 C for 30s, extension at 72 C for 2 min). Several tubes were combined to obtain enough PCR products. Archaeal primer sequences were Arch21F: 5΄-TTCCGGTTGATCCYGCCGGA, and 958R: 5΄- YCCGGCGTTGAMTCCAATT. The following standard conditions were used for o amplification of the archaeal 16S rRNA gene: 45 cycles (denature at 95 C for 30s, o o annealing at 55 C for 30s, extension at 72 C for 2 min). Amplified 16S rRNA gene fragments were ligated into pGEM®-T vector (Promega Inc., Madison, WI) and the resulting ligation products were used to transform into E. Coli DH5α competent cells. 16S rRNA gene environmental libraries were constructed, and 40 randomly chosen colonies per sample were analyzed for insert 16S rRNA gene sequences. Plasmid DNA containing inserts of 16S rRNA gene was prepared using Qiagen kit. Sequencing reactions were carried out with primers Bac27F and Arch21F with a DYEnamic ET terminator cycle sequencing ready reaction kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ). The 16S rRNA gene was sequenced with an ABI 3100 sequencer. Partial sequences were typically ~600-700 bp long. Representative bacterial clones and all isolates were sequenced with multiple primers (Bac27F, 925R and Univ1492R) to obtain nearly full-length (~1400 bp) sequences of the bacterial 16S rRNA gene. The sequence for 925R was 5’-CCGTCAATTTTRAGTTT. There was overlap of approximately 200 bases between each pair of primers (i.e., between 27F and 925R). The complementary checking showed that PCR error frequency was low (<0.05 error per 100 nucleotides). PCR error was also checked by amplification, cloning and sequencing of the 16S rRNA gene of Sulfolobus acidocaldarius in the same manner as for the samples. Thirty clones of S. acidocaldarius were sequenced. Base-wise comparison between the sequence from the GenBank and our data indicated that the error frequency of partial sequencing analysis was approximately 0.05 error per 100 bases. T-RFLP analyses. T-RFLP analyses of 16S rRNA gene were performed in order to rapidly identify dominant sequences in the samples and to compare the rocks with the drilling fluid samples. Bacterial 16S rRNA gene was amplified from DNA extracts by PCR using FailSafe PCR Enzyme Mix and labeled primers Bac27F-HEX and Univ1492R-TET for bacteria, and Arch21F-HEX and 958R-TET for archaea. T-RFLP
15 PCR reactions and cycling conditions for the bacterial communities were identical to those described above. The primers were 5΄ labeled with phosphoramidite dyes 5- hexachlorofluoresceine and 5-tetrachlorofluorescein, respectively (Operon, Inc., Alameda, CA). PCR replicates were pooled and subjected to agarose gel electrophoresis. The products were cut from each gel lane and purified using GeneClean Turbo Kit as directed by the supplier. 10 μL of purified 16S rRNA gene sequence was digested in a 20-µL reaction volume with 3 U of HhaI and HaeIII (New England Biolabs, Beverly, MA) each for 6 h. After 6 h, restriction enzymes were heat-inactivated and precipitated by adding 0.2-µL of 3 M sodium acetate (pH 5.2) and 80 µL of 100% ethanol. The pellet was rinsed with 400 µL 70% ethanol, dried, and then re-suspended in 5-µL ultra pure water. The size of fluorescent-labeled fragments was determined by comparison with internal TAMRA 2500 size standards (Applied Biosystems Inc., Foster City, CA). For T-RFLP analyses, 5- µL restriction digest was denatured in the presence of 5 µL of freshly deionized o formamide contained with 0.2 µL TAMRA 2500 marker at 94 C for 3 min. Injection was performed electrokinetically at 15 kV for 5 s and runs at 15kV were completed within 45 min in GeneScan mode with an ABI 310 DNA sequencer. Terminal restriction fragment sizes between 0 and 600 bp with peak heights of ≥100 fluorescence units were determined using GeneScan analytical software v 2.02 (Applied Biosystems Inc.). Phylogenetic analyses. Clone sequences were manually checked with the Sequencer program, and secondary structure diagrams and the Chimera Check program were utilized to identify potential chimeras formed during PCR. The sequences obtained were compared to the small subunit 16S rRNA gene database within the Ribosomal Database Project (RDP-II) and GenBank for finding the two nearest phylogenetic neighbors and a representative collection of divergent phylogenetic groups, and were aligned to 16S rRNA gene sequence data from the RDP and GenBank using the ClustalW multiple sequence alignment program. The sequences were then manually aligned using the Macclad software. Phylogenetic analyses were performed by application of distance matrix, neighbor joining, maximum parsimony, and maximum-likelihood algorithms with PAUP version 4.0. Nucleotide sequence accession numbers. The sequences determined in this study have been deposited in the GenBank database under accession numbers
16 AY820245-AY820252 for the isolate sequences, AY820624-AY820727 for the bacterial clone sequences, and AY820186-AY820244 for the archaeal clone sequences.
RESULTS Quality control. Multiple methods revealed that contamination was negligible. The drilling fluids and the rock cores exhibited drastically different Cl concentration - 2- (166-502 vs. 6-18 ppb) and NO 3/SO 4 ratio (< 0.5 vs. 15-200) (Table 1) as analyzed for the drilling fluid supernatant and the rock leachate, suggesting that the rock cores were not contaminated with the drilling fluid. No 16S rRNA gene of the positive controls (Escherichia coli and Shewanella putrefaciens CN32) was obtained or amplified by PCR, illustrating that the rock cores were sufficiently low in permeability to have minimal microbial penetration. The TC and TOC concentrations in the rock and drilling mud samples were distinctly different, and their respective 13C values were different (Table 1). The TC content for the rocks was 48-64 times lower than the corresponding values for the drilling fluids from the same depths. The 13C value of TC for the rocks was much less negative than those for the drilling fluids (by –4 to –10‰). The TOC content in the rocks was 200-400 times lower than that for the drilling fluids. The 13C value of TOC for the rocks was less negative than that for the drilling fluids and the difference was statistically significant. These results again suggest minimal or undetectable level of contamination of the rocks by the drilling fluids. PLFA analyses of one eclogite sample (CCSD_RK1179 from 1179 m) showed the lack of polyunsaturated fatty acids characteristic of eukaryotic organisms. Since the two drilling fluid samples contained a significant proportion of polyunsaturated fatty acids (16 to 28% to the total PLFA), the absence of such biomarkers in the rock provided further support for the lack of contamination from the drilling fluids. Contamination possibly introduced in the laboratory procedures was tested using 70% ethanol sterilized rock cores, and no DNA was detected or amplified. There was no overlap in microbial community between the soil and the rocks (see below). The bacterial clone sequences from the rock and the drilling fluid samples were not present in the surface soil sample. Because the circulating drilling fluid “saw” freshly cut rock surfaces and was in contact with subsurface geological fluids from structurally weak shear zones/faults, it was
17 expected that the drilling fluid gradually incorporated microbial communities from the rocks as well as from geological fluids. These results collectively demonstrated that contamination, if any, introduced into the rocks either during sample collection at the drilling site or during the subsequent laboratory analyses, could not compromise the in- situ microbial abundances in the rocks. Petrophysical and geochemical analyses. The pH of the drilling fluid samples ranged from 9-10.5. The fluorine and sulfate concentrations were similar between the rocks and the drilling fluids. The chloride concentration in the drilling fluids was 16-31 times higher than in the rocks, but the nitrate concentration in the rocks was much higher than in the drilling fluids (> 366-1376 times) (Table 1). The high nitrate concentration was likely from saline fluid inclusions in the rocks (Shen et al., 2003). This inference was supported by the fact that the eclogite samples, which contained garnet and pyroxene, two dominant host minerals for fluid inclusions, had higher concentration of nitrate than amphibolite (CCSD_RK2026). Eclogite CCSD_RK1930 was enriched in white mica and did not have abundant garnet and pyroxene, possibly accounting for its low nitrate concentration. Similar observations were made by Onstott et al. (Onstott et al., 2003), and the authors ascribed the high concentration of nitrate to fluid inclusions in the crushed quartzite and the Carbon Leader samples. The total organic carbon (TOC) ranged from 0.003 to 0.03% for the rocks with corresponding 13C values of –24.9 to –26.2 per mil, and 1-5% for the drilling fluids with corresponding 13C values of –26.6 to –28.6 per mil. The rock samples ranged in porosity from 1-3.5% with permeability of ~0.5 mDarcy. The rocks were eclogite and amphibolite (Table 2) with high-pressure minerals such as coesite (in CCSD_RK730) and kyanite (in CCSD_RK1080) present as determined by X-ray diffraction (XRD) and electron microprobe analyses. Whole rock chemical analyses revealed that the rock samples contained a significant amount of Fe2O3 and FeO. Electron microprobe analyses showed that most of Fe2O3 and FeO were contained in garnet, pyroxene and ilmenite. Garnet contained almadine-grossular-pyrope components, and pyroxene belonged to omphacite. Both garnet and pyroxene contained some amounts of P2O5 (Table 2). Apatite was present because P2O5 concentration in garnet and pyroxene was lower than that in the whole rock, and there were no other P2O5- bearing minerals. H2O existed as fluid inclusions (Shen et al., 2003) or structural
18 hydroxyl group in alteration minerals. CO2 probably existed as carbonate, organic carbon, and as CO2 gas in fluid inclusions (Shen et al., 2003). SEM image showed that fractures were primarily constrained within garnet and pyroxene (Fig. 2), two main minerals containing various fluid/gas fluid inclusions. Abundant fluid/gas inclusions were present inside minerals of the UHP rocks (Fig. 3). There were four types (Shen et al., 2003). Type I was characterized by aqueous inclusions with high-salinity CaCl2-NaCl-H2O fluid (75% H2O, 17% NaCl, 8% CaCl2 by weight) and they occurred in garnet and pyroxene of eclogite. These inclusions typically ranged in size from 12 to 40 μm and were inferred to be metamorphic in origin. Type II contained mixed H2O-CO2 (+N2) – NaCl – solids (45-70% H2O, 5-30% CO2, and 1-25% NaCl by mol percent) and they occurred in quartz and kyanite of eclogite having similar size as type I. Some inclusions contained a small amount of N2. Shen et al. (Shen et al., 2003) inferred that type II inclusions were introduced into the UHP rocks during the exhumation and later retrogression. Type III inclusions contained aqueous solutions with low to medium salinity in garnet, pyroxene and apatite of eclogite. Type IV inclusions contained carbonates with medium-low salinity. Types III and IV inclusions (upper left in Fig. 3) were distributed along intragranular fractures of garnet and formed when the UHP rocks were uplifted to the crust at low temperature and pressure condition. Biomass determination by direct count and PLFA. Total counts of microbial cells in the rocks were determined by AODC. The data indicated that the number of cells ranged from 5.2 x 103 to 2.4 x 104 cells per gram of dry rock powder. This level of biomass was comparable to that reported for quartzite from South Africa deep mines (Onstott et al., 2003). PLFA represents viable microbial populations (White et al., 1979). The PLFA concentration in the eclogite sample (CCSD_RK1179) was 4.9 pmol/g, which was equivalent to 9.8 x 104 cells/gram (personal communication with Microbial Insights, Inc). The prokaryotic profiles were br15:0d (12%), 16:0 (22%), br16:0a (13%), br16:1a (22%), 18:1ω9c (9%), 18:0 (8%), and 2Me18:0 (18%). The branched saturated acids are characteristic of heterotrophic bacteria such as sulfate- and metal-reducing bacteria and may indicate their presence in the sample. The biomass for the two drilling fluid samples was 3.5 and 7.5 x 108 cells/g for CCSD_DF730 and CCSD_DF1080, respectively. The community structure analyses of the two drilling fluids indicated that Protoebacteria and
19 normal saturated PLFA were the prominent constituents of the two drilling fluid samples. Firmicutes or Clostridia-like fermenting bacteria (terminally branched PLFA) were also present in the two drilling fluids (20% and 10% of the total PLFA for CCSD_DF730 and CCSD_DF1080, respectively). Biomarker for sulfate reducing bacteria was present in the drilling fluids and ranged from 9% (CCSD_DF730) to 17% (CCSD_DF1080) of the total PLFA. Anaerobic metal reducer constituted a minor component (5% and 4% for CCSD_DF730 and CCSD_DF1080, respectively). Enrichment cultures. In the rock enrichments at incubation temperature of 37oC in M1 medium, there were visible cell growths and formation of a black precipitate, suggesting activity of thermophilic Fe(III) reduction. Magnetic testing verified that the precipitate was magnetic, most likely magnetite. There was no evident Fe(III) reduction in either M1 medium at other incubation temperatures or FWA-Fe(III) medium. In the enrichments for the drilling fluid sample CCSD_DF2030 (2030 m) with the TE medium, reduction of Fe(III) in oxyhydroxide was observed and Fe(II) production occurred as measured with Ferrozine assay. Several isolates were obtained from the drilling fluid sample. Two isolates obtained from the AG medium at 37oC (CCSD_DF2030_AG37_isolate1 and CCSD_DF2030_AG37_isolate2) were closely related to (96-98% similarity) Clostridium bifermentans (Fig. 4), an organism capable of using aromatic compounds as electron acceptors for fermentation (Chamkha et al., 2001). One isolate from the TE medium with incubation temperature of 37oC (CCSD_DF2030_TE37_isolate1) and one from the AG medium with incubation temperature of 68oC (CCSD_DF2030_AG68_isolate1) were 96-98% similar to Clostridium felsineum. Two other isolates from the AG medium at 68oC (CCSD_DF2030_AG68_isolate2 and CCSD_DF2030_AG68_isolate3) were only moderately related to (94% similarity) to Clostridium felsineum. One isolate obtained from the CL medium at 68oC (CCSD_DF2030_CL68_isolate1) was not related to any cultured bacteria or environmental clones at the genus level (i.e., 93-95% similarity). One isolate from the TE medium at 37oC (CCSD_DF2030_TE37_isolate2) was only moderately related to (91% similarity) to Chrysiogenes arsenatis, an arsenate reducer to arsenite.
20 T-RFLP analyses. T-RFLP analyses (Fig. 5) showed that although some T-RFs (ribotypes) were common to both the rocks and their corresponding drill fluid samples (for example, T-RF at 232 bp between CCSD_RK529 and its corresponding drilling fluid), in general there was significant distinction between the rocks and the drilling fluids. More importantly, the T-RFLP pattern for the surface soil was distinct from those for all the rocks and the drilling fluids. There were approximately 5-6 major T-RFs (ribotypes) in each rock. Bacterial diversity. (i) CCSD_RK529 (529m). The DNA sequences from this sample clustered into 4 major lineages: the α-, β-, and γ-subdivisions of Proteobacteria, and Cytophaga-Flexibacter-Bacteroides (Fig. 6 and Table 3). One group of clones was closely related to a cultured organism Pantoea agglomerans, an anaerobic Fe(III), Mn(IV), and Cr(VI) reducing bacterium (Francis et al., 2000). Another group was related to a selenate-reducing bacterium TSA. One sequence (B19) was closely, and another remotely (B13), related to Sphingomonas echinoids. The genus of Sphingomonas has been isolated from subsurface sediments, and species in this genus are generally mesophilic, heterotrophic, and Gram-negative (Balkwill et al., 2003). A sequence related to Azoarcus sp. was present. The species of Azoarcus have been shown to anaerobically reduce nitrate and degrade aromatic compounds (Mechichi et al., 2002). Three sequences were related to a bacterial clone from deep-sea hydrothermal systems (uncultured bacterium IndB4-4) (GenBank description). One group of clones of the drilling fluid CCSD_DF529 (4 clones) was closely related to (97% similarity) Janthinobacterium lividum within the β-Proteobacteria (Fig. 6 and Table 3), a facultative nitrate reducing bacterium typically present in soil and water. This organism has been isolated from estuary sediments and Lake Fryxell, McMurdo Dry Valleys, Antarctic (Brambilla et al., 2001) in both aerobic and anaerobic enrichments. One sequence (B2) was related to a clone from Gulf of Mexico gas hydrates (Lanoil et al., 2001). Surface soil clone types were very diverse (Fig. 6). Seventeen nonchimic sequences belonged to the α-, δ, and, γ-subdivisions of Proteobacteria, Actinobacteria, and Cyanobacteria.. Phylogenetic analyses demonstrated that there was no overlap between the surface soil and either the drilling fluid CCSD_DF529 or the rock CCSD_RK529 clone library (Fig. 6).
21 (ii). CCSD_RK730 (730 m). Phylogenetic analyses showed that the 16S rRNA gene sequences from this sample clustered into three major lineages of bacteria: α-, β-, γ-, and, δ-subdivisions of Proteobacteria with some unidentified sequences (Fig. 6 and Table 3). In addition to the clone type closely related to Pantoea agglomerans, the second most abundant group of clones was closely related to Aquaspirillum delicatum. Most species in this genus have been isolated from fresh water. Some species can fix nitrogen.
A. autotrophicum is a H2 oxidizing, facultatively autotrophic bacterium. Some strains are aerobic and tolerate a low salinity (<3% NaCl). Another group of clones was almost identical to Ralstonia sp., a denitrifying facultative microbe resistant to heavy metals and capable of degrading hydrocarbons at 30oC (Leahy et al., 2003). Other clone sequences showed similarity to Pseudomonas sp. (99%), Stenotrophomonas maltophilia or uncultured bacterium SE-77 (98%), Acinetobacter lwoffii (95%), Thialkalivibrio nitratreducens (90%). T. nitratreducens is an anaerobic obligately chemolithoautotrophic sulfur oxidizing bacterium from Soda lakes. They use sulfide as the electron donor and nitrate or nitrous oxide as electron acceptors under alkaline conditions (Sorokin et al., 2003). One sequence was remotely related to Anaeromyxobacter dehalogenans, an anaerobic nitrate reducer to ammonium (Sanford et al., 2002). The 16S rRNA gene sequences from the drilling fluid CCSD_DF730 fell into the α, β-, γ-Proteobacteria, low G-C Gram positive, the Bacteroidetes, and Gram-positive bacteria (Fig. 6 and Table 3). Five sequences clustered within the α-Proteobacteria group with similarities to Paracoccus zeaxanthinifaciens and Methylobacterium organophilum. The species of Paracoccus occur in many terrestrial environments and have a wide range of metabolic modes (autotrophy, methylotrophy, or mixotrophy). Many species are capable of denitrifying under anoxic conditions with nitrate as the respiratory oxidant and organic compounds as carbon and energy sources (Kelly et al., 2000). M. organophilum was isolated from the metalimnion of Lake Mendota, USA, and is an aerobic, Gram- negative, rod-shaped bacterium that is able to grow on compounds more reduced than carbon dioxide as sole carbon and energy source (Green, 2001). Two clone sequences in the β-Proteobacteria were closely related to new arsenite-oxidizing bacteria isolated from Australian gold mining environments. The sequences in the γ-Proteobacteria were closely related to Xanthomonas sp., Halomonas sp., and Alcanivorax sp. (Fig. 6 and
22 Table 3). Xanthomonas sp. ML-122 is a novel alkalo-halophile isolated from Mono Lake sediment, California. All of the members of Halomonas are Gram-negative rods that exhibit extreme tolerance to NaCl. Halomonas reduces nitrate to nitrite, and most of the species can grow under anaerobic conditions in the presence of nitrate (Vreeland, 1999). The species of Alcanivorax are capable of anaerobic growth with nitrate. Members of this genus are moderately halophilic, and the optimal NaCl for growth is 3–10%. The optimum temperature is 20–30°C (Gonzalez and Whitman, 2002). The two sequences in the Bacteroidetes were remotely related to two environmental clones from alkaline, hypersaline, and currently meromictic Mono Lake, CA (Humayoun et al., 2003). The clone sequences in the division of Gram-positive bacteria showed low similarity to any known sequences in the Genbank. (iii) CCSD_RK1080 (1080 m). The 16S rRNA gene sequences in this sample fell into two lineages of bacteria: the β-and γ-Proteobacteria (Fig. 6 and Table 3). In the β-Proteobacteria, one group of clone sequences was closely related to an Antarctic bacterium R-7687 and Janthinobacterium lividum. The Antarctic bacterium R-7687 is from microbial mats of Antarctic lakes (Van Trappen et al., 2002). Sequences similar to Delftia acidovorans and uncultured bacterium AT425_Eub48 from the Gulf of Mexico gas hydrate and the Nankai Trough were also present. D. acidovorans is aerobic and can reduce nitrate to nitrite. Four sequences in the γ-Proteobacteria were related to species of Pseudomonas. Twenty three clone sequences from the drilling fluid sample CCSD_DF1080 fell into 5 major lineages of bacteria: the α-, γ-Proteobacteria, Planctomycetes, Bacteroidetes, and Gram-positive bacteria (Fig. 8). In addition to Paracoccus and Alcanivorax, there was emergence of new clone types. The most abundant clone type was not closely related to any known cultured bacteria or environmental clones. It was remotely related to Bacteroidetes bacterium MWH-CFBk5, which may have come from makeup water. Two sequences (B5 and B19) were moderately related to anaerobic bacterium clone BIOEST-12 from microbial film for the anaerobic treatment of sulfurous effluents. Two sequences (B13 and B20) were related to the strain Aequorivita lipolytica, a sublithic bacterium associated with Antarctic quartz stones (Bowman and Nichols, 2002). Two sequences (B15 and B23) in the α-Proteobacteria were closely related to a
23 clone from hypersaline and alkaline Mono Lake, California and halobenzoate-degrading denitrifying bacteria, respectively. One sequence (B16) was related to Mesorhizobium sp. 4FB11, an anaerobic nitrate reducer. In the γ-Proteobacteria subdivision, one sequence (B22) showed low identity (88%) to a sulfur-oxidizing bacterium from a shallow water hydrothermal vent. One sequence (B17) was remotely related to a methanotroph (Methylosphaera hansonii). The sequence in the Gram-positive lineage (B7) showed 96% similarity to an arsenate respiring bacterium Bacillus sp. JMM-4. Phylogenetic classification of two sequences (B9 and B24) could not be identified, and they were moderately related to an unidentified bacterium in deep-sea sediment from the Western pacific warm pool (GenBank description). (iv). CCSD_RK_1930 (1930 m). Diversity was much lower in this sample. All clone sequences belonged to the β- and γ-Proteobacteria (Fig. 6 and Table 3). One group of clones was closely related to a sequence (unidentified gamma proteobacterium strain BD6-5 or BD4-3) from deep-sea sediments (Li et al., 1999) or Pseudomonas sp. NZ062. Another group of clones was closely related to an iron reducing bacterium JLN-2. Another group of clones was closely related to J. lividum or an Antarctic bacterium R7687. One sequence was related to Ralstonia sp.. One sequence was closely related to gamma proteobacterium A40-1, an aciduric proteobacterium isolated from pH 2.9 soil (Curtis et al., 2002). Eight out of twenty one clone sequences were closely related to Pseudomonas, which included Pseudomonas sp. QSSC1-9, Pseudomonas grimontii, Pseudomonas fluorescens strain ATCC 13525, Pseudomonas corrugata, and Pseudomonas sp. KF/GS-Gitt2-41.
(v) CCSD_RK2026 (2026 m). Twenty-two 16S rRNA gene sequences from this sample phylogentically clustered into the β- and γ-Proteobacteria, Gram-positive bacteria and Actinobacteria (Fig. 6 and Table 3). In addition to those present in CCSD_RK1930, there appeared emergence of new clone types. A major group (6 sequences) was closely related to Pseudomonas pseudoalcaligenes. P. pseudoalcaligenes is metal resistant and reduces nitrate to N2. Another major new type (5 sequences) was moderately related to Methylocaldum tepidum, a thermophilic methanotrophic bacterium (Bodrossy et al., 1997). Other sequences were related to Pseudomonas antarctica or iron- reducing bacterium JLN-2, Acinetobacter, Arthrobacter, and a clone from a Soda lake. P.
24 antarctica is an iron-reducing bacterium isolated from Antarctic lakes. Some Arthrobacter species are capable of dinitrogen fixation. One clone sequence (B9) was closely related to the sequence of an unidentified Hailaer soda lake bacterium Z8 (GenBank description). Nineteen sequences from the drilling fluid CCSD_DF2030 fell into five major lineages of bacteria: the ε, δ, γ-Proteobacteria, Candidate, and Gram-positive bacteria. Two groups were dominant, both in the γ-Proteobacteria: type B3 which was closely related to Pseudomonas nitroreducens, and type B6 which was closely related to an uncultured bacterial clone MB-A2-102 from the methane hydrate-bearing deep marine sediments in the forearc basin of the Nankai Trough near Japan (Reed et al., 2002). Other clone sequences were closely related to P. pseudoalcaligenes, Desulfobotulus sapovorans, and uncultured bacterium Eub No. 6. Other clone sequences were related to Campylobacter sp.. NO3A, a nitrate-reducing, sulfide-oxidizing bacterium, Acetanaerobacter thermotolerans, a strictly anaerobic, moderately thermophilic acetogen and sulfur reducer, and Alkalibacterium olivoapovliticus, a motile, psychrotolerant, halotolerant, facultatively anaerobic bacterium with a pH optimum of 9-10. Archaeal diversity. The archaeal diversity was much lower, and all archaeal sequences formed four groups within the Crenarchaeote (Fig. 7). All sequences from sample CCSD_DF529 (26 sequences) and two sequences from CCSD_DF2030 formed the first group and were 93-98% similar to Sulfolobus solfataricus, an thermophilic archaeon Except for all 21 sequences from CCSD_RK1080 and 6 sequences from CCSD_RK529, all other sequences from the studied rocks formed the second group with the sequences from the deepest drilling fluid sample CCSD_DF2030. This group was similar to soil crenarchaeota group (GenBank description). The third group was closely related to an uncultured archaeon clone Nap013 obtained from a hot spring (GenBank description). The fourth group consisted of all 33 sequences from the drilling fluid sample CCSD_DF730 and CCSD_DF1080, and 9 and 4 sequences from CCSD_RK1080 and CCSD_RK529, respectively. This group was closely related (94-98% similarity) to uncultured marine crenarchaeota group I (Massana et al., 2000).
25
DISCUSSION Biomass and microbial activity. The amount of biomass in the UHP rocks was comparable to that observed in similar rock types from other subsurface extreme environments (Onstott et al., 2003) but much lower than those from sediments of various environments (Onstott et al., 1999; Parks et al., 2000). This was expected because the UHP rocks had low porosity, total organic carbon content and other nutrients. Despite these extreme conditions, our culture-based results indicated the presence of active microorganisms (Fe(III) reducer) in the rocks. Acquisition of new isolates from the drilling fluids suggests the presence of novel bacteria from the subsurface, and their growth habitats (anaerobic, thermophilic and alkaliphilic fermenters and Fe(III) reducers) were consistent with the geochemical characteristics of the fluids from depth. Microbial diversity. The microbial life in the deep subsurface has been postulated for a long time, but surface contamination is a critical issue, especially in low- biomass environmental samples (White et al., 1998). Strict quality control used in this study showed that contamination was minimal. Significant changes in bacterial diversity and community structure were associated with environmental gradients in the deep subsurface. Phylogenetic analyses of 16S rRNA gene sequences from the rock samples collected at different depths revealed a significant degree of bacterial diversity, but the archaeal diversity was low. The frequency of 16S rRNA gene clones should be regarded as qualitative information on community composition. Nonetheless, 16S rRNA gene sequence libraries provided valuable descriptions of microbial diversity that allowed comparisons between communities in different environments. The rocks from all five depths were dominated by bacterial sequences belonging to the lineage Proteobacteria, suggesting that it is one of the most predominant microbial components in terrestrial subsurface. The community structure within Proteobacteria changed with depth, however. Clone sequences belonging to the α-Proteobacteria subdivision were present in the shallowest rock (CCSD_RK529), the surface soil, and most of the drilling fluids, but absent in the deep rocks (i.e, CCSD_RK730 and deeper) and in the deepest drilling fluid sample. Clone sequences belonging to the β- Proteobacteria subdivision were predominant in CCSD_RK730, and became less
26 abundant with increasing depth. At the species level, there was a major shift in the community structure with increasing depth. Clone sequences related to aerobic bacteria (i.e., Sphingomonas echinoids) were present only in the shallow rock (CCSD_RK529) and absent in the deeper ones. Sequences closely related to the metal reducing bacterium Pantoea agglomerans were dominant in the shallow rock samples (CCSD_RK529 and CCSD_RK730), but absent in the deeper ones. Clone sequences belonging to the genus Pseudomonas became increasingly abundant with depth. Sequences related to a thermophilic methanotroph Methylocaldum tepidum were predominant in the deepest rock sample, and was correlated with the high concentration of methane at this depth (0.04% by weight) as measured by real-time gas chromatography for gases extracted from the circulating drilling fluid. The bacterial community in the drilling fluid samples was more diverse than that of the rock sample from the same depth, including anaerobic, alkaliphilic, chemoorganotrophic or chemolithoautotrophic, halotolerant or halophilic nitrate, Fe(III) and sulfate reducers, acetogens, and methanotrophs. This was expected because the drilling fluids contained surface make-up water, clay/mud, and freshly cut rock fragments. In addition, the drilling fluid samples may have incorporated geological fluids/gases/formation water from structurally weak shear zones/faults from various depth of the drill hole. Correlation between geochemistry and microbiology. The geochemical conditions and energy sources available would tend not only to dictate microbial community composition and species richness but also to constrain the physiological characteristics of the community members. One distinct feature of the clone sequences for the UHP rocks was that most of them were closely related to nitrate-reducing bacteria. This was consistent with the geochemical condition that the rocks had unusually high nitrate concentrations. However, nitrate reducers may not be active and high concentrations of nitrate remained. Multiple sequences closely related to iron-reducing bacteria were present in the rocks. For the same rock type with the same mineralogy (eclogite CCSD_RK529, CCSD_RK730, CCSD_RK1080, CCSD_RK1930), the percent of clones related to iron-reducing bacteria (5/16, 8/28, 0, 2/21 for CCSD_RK529, CCSD_RK730, CCSD_RK1080, CCSD_RK1930, respectively, Table 3) was
27 approximately inversely correlated with the Fe2O3/FeO ratio of the whole rocks (Table 2), suggesting that iron-reducers may have possibly reduced Fe(III) to Fe(II) in minerals. The presence of Fe(III) reducing activity in the rock enrichments supported this conclusion. In addition, many clone sequences were related to either alkaliphilic bacteria (such as Alkalibacterium olivoapovliticus) or those clones previously found in alkaline and saline environments (i.e., Mono lake, CA and deep-sea). Many were resistant to heavy metals, suggesting existence of saline, alkaline, and possibly metal-rich geochemical environments. In summary, most clone sequences from the UHP rocks were related to microorganisms that have been isolated from deep subsurface environments (such as Pseudomonas) or Antarctic lakes. These organisms are generally facultative, heterotrophic, halotolerant or halophilic, and carry out a variety of functions (nitrate, Fe and sulfate reduction, and methanotrophy). These unique microbiological characteristics suggest that the microbes in the UHP rocks existed in those geochemical niches where there were high concentrations of nitrate and ferric iron, high pH, and possibly saline and cold environment. We speculate that these microbes existed in various fluid/gas inclusions in minerals such as garnet and pyroxene, where there were nutrients, water, and carbon sources. Because of slow heat conductivity in the rocks and isolated fluid/gas inclusions, fluid/gas inclusions may be out of equilibrium with the in-situ subsurface conditions (such as temperature and pressure) and microbes were expected not to respond to any changes in environmental gradients. The origins of the fluid/gas inclusions remain to be studied. However, microbial habitats (cold, saline, high nitrate concentration) suggest that at least some fluid/gas inclusions may have been derived from ancient seawater. Microbes might have been trapped inside the fluid/gas inclusions for as long as the age of the inclusions. If so, microbes might have possibly survived the subduction/exhumation process. Zheng et al. (Zheng et al., 2003) proposed an ice cream-frying model, where rapid subduction/exhumation could have preserve localized pockets of fluids that were never heated above maximal survival temperature for microorganisms when they were subducted. If so, the microbes found in this study could have been of the same age or older than the age of the fluid inclusions. A recent study (Sharma et al., 2002) shows that if microbes (Shewanella oneidensis strain MR-1 and Escherichia coli strain MG1655)
28 reside in fluid inclusions, they can maintain physiological and metabolic activity at pressures of 1200 to 1600 MPa. They continue to be viable upon release of pressure to ambient pressure (0.1 MPa). Thus, it is conceivable that the detected microbes found in this study could have possibly survived the subduction-related UHP (2.8 GPa) metamorphism. However, more research is necessary to further test this hypothesis. The fluid inclusions in garnet and pyroxene of type III and IV, however, were also likely candidates for microbes as garnet and pyroxene contained high concentrations of P, an essential nutrient for microbial metabolism. In addition, types III and IV fluid inclusions formed at relatively low temperatures during the exhumation process of the UHP rocks. Most of the clones from the rocks were related to mesophilic and psychrophilic microbes and environmental clones, inconsistent with the in situ temperature, where it ranged from 30-60oC. This apparent inconsistency may be reconciled again with the ice cream-frying model, where preservation of cold, localized pockets of fluid inclusions was made possible by the rapid subduction and exhumation (Zheng et al., 2003). The presence of mesophilic and psychrophilic microorganisms in these rocks supports the model and argues that these microbes may have come from ocean floor prior to the subduction process. Oceanic plates were present before the subduction (Zheng et al., 2003) and the oceanic setting was consistent with psychrophilic habitats of microbes detected in this study (cold environments such as deep-sea sediments or Antarctic lakes). The psychrophilic nitrate and Fe(III) reducers present in the drilling fluids may be of the same origin as those in the rocks, but the existence of thermophilic bacteria and archaea (such as Sulfolobus solfataricus) in the drilling fluids suggests different origins, and their possible habitats may be pockets of fluids/gases associated with structurally weak shear zones/faults. Because of possible connectivity to macroscopic flow channels and shear zones, these fluids/gases may be in equilibrium with the modern day geothermal gradient. The presence of Sulfolobus solfataricus in sample CCSD_DF529, a thermophilic archaeon with an optimal growth temperature of 75oC, is approximately consistent with the in-situ temperature at this depth in the borehole. To the best of our knowledge, our study is the first to systematically study microbial community in UHP rocks. Metamorphic rocks are important constituents of the deep subsurface crust, and our study has demonstrated that the biosphere extends into that
29 part of the lithosphere. Metamorphic rocks typically experience high temperature and pressure, so their porosity and permeability are low. Jenneman et al. (Jenneman, 1985) observed that bacterial penetration into sandstone with permeability of <100 mDarcy occurred slowly. The UHP rock samples used in this study had permeability values of around ~0.5 mDarcy. These values were low enough to effectively seal the rocks so that microbial movement was not possible. ACKNOWLEDGMENTS The investigators would like to thank Jingsui Yang, Zeming Zhang, Tianfu Li, Fulei Liu, Shizhong Chen and other field crew members for their hard work in collecting the samples. The CCSD project provided support for the field operations. We are grateful to Chris Wood at The Center for Bioinformatics and Functional Genomics at Miami University for his technical support. We thank David Balkwill for his initial training on phylogenetic analyses during our visit to his laboratory. Matthew Fields helped with some phylogenetic analyses. James Cantu helped with the lipid extraction. Cynthia Cohen helped the laboratory work at Miami University when she took an independent study with our group. We are grateful for an anonymous reviewer and editor Kenneth Nealson to significantly improve the quality of this manuscript. This work was supported by grant EAR-0201609 from the National Science Foundation and a Research Challenge grant from the Ohio Board of Regents to HD. An internal grant from Miami University (Hampton fund) and a grant from National Science Foundation of China (40228004) provided further support. A student grant from the Geological Society of America to GZ provided partial support for materials cost.
30 REFERENCES Balkwill, D.L., Fredrickson, J.K., and Romine, M.F. (2003) Sphingomonas and related genera. In M. Dworkin, Ed. The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community. Springer-Verlag, New York. Bodrossy, L., Holmes, E.M., Holmes, A.J., Kovacs, K.L., and Murrell, J.C. (1997) Analysis of 16S rRNA and methane monooxygenase gene sequences reveals a novel group of thermotolerant and thermophilic methanotrophs, Methylocaldum gen. nov. Archives of Microbiology, 168, 493-503. Bottomley, P.J. (1994) Light microscopic methods for studying soil microorganisms. In R.W. Weaver, Ed. Methods of Soil Analysis, Part 2. Microbiological and bIochemical Properties-SSSA Book Series, no. 5, p. 81-105. Soil Science Society of American Publisher, Madison, WI. Bowman, J.P., and Nichols, D.S. (2002) Aequorivita gen. nov., a member of the family Flavobacteriaceae isolated from terrestrial and marine Antarctic habitats. International Journal of Systematic and Evolutionary Microbiology, 52, 1533- 1541. Brambilla, E., Hippe, H., Hagelstein, A., Tindall, B.J., and Stackbrandt, E. (2001) 16S diversity of cultured and uncultured prokaryotes of a mat sample from Lake Fryxell, McMurdo Dry Valleys, Antarctica. Extremephiles, 5, 23-33. Chamkha, M., Patel, B.K.C., Garcia, J.L., and Labat, M. (2001) Isolation of Clostridium bifermentans from oil mill wastewaters converting cinnamic 3-phenylpropionic acid and emendation of acid to the species. Anaerobe, 7(4), 189-197. Colwell, F.S., T. C. Ontott, M. E. Delwiche, D. Chandler, J. K. Fredrickson, Q.-J. Yao, J. P. McKinley, D. R. Boone, R. Griffiths, T. J. Phelps, D. Ringelberg, D. C. White, L. LaFreniere, D. Balkwill, R. M. Lehman, J. Konisky, and P. E. Long. (1997) Microorganisms from deep, high temperature sandstones: constraints on microbial colonization. FEMS Microbial Reviews, 20, 425-435. Curtis, P., Nakatsu, C.H., and Konopka, A. (2002) Aciduric Proteobacteria isolated from pH 2.9 soil. Archives of Microbiology, 178(1), 65-70.
31 Francis, C.A., Obraztsova, A.Y., and Tebo, B.M. (2000) Dissimilatory metal reduction by the facultative anaerobe Pantoea agglomerans SP1. Applied and Environmental Microbiology, 66(2), 543-548. Garrity, G.M.e. (2001) Bergey's manual of systematic bacteriology. Springer-Verlag, New York, N.Y. Gonzalez, J.M., and Whitman, W.B. (2002) Oceanospirillum and Related Genera. In M. Dworkin, Ed. The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community. Springer-Verlag, New York. Green, P.N. (2001) Methylobacterium. In M. Dworkin, Ed. The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community. Springer- Verlag, New York. Guckert, J.B., Antworth, C.P., Nichols, P.D., and White, D.C. (1985) Phospholipid ester- linked fatty acid profiles as reproducible assays for changes in prokaryotic community structure of estuarine sediments. FEMS Microbiology Ecology, 31, 147-158. Humayoun, S.B., Bano, N., and Hollibaugh, J.T. (2003) Depth distribution of microbial diversity in Mono Lake, A meromictic soda lake in California. Applied and Environmental Microbiology, 69(2), 1030-1042. Jenneman, G.E., M. J. McInnerney, and R. M. Knapp. (1985) Microbial penetration through nutrient-saturated Berea sandstone. Applied and Environemental Microbiology, 50(2), 383-391. Kashefi, K., Holmes, D.E., Reysenbach, A.L., and Lovley, D.R. (2002) Use of Fe(III) as an electron acceptor to recover previously uncultured hyperthermophiles: Isolation and characterization of Geothermobacterium ferrireducens gen. nov., sp nov. Applied and Environmental Microbiology, 68(4), 1735-1742. Kelly, D.P., Rainey, F.A., and Wood, A.P. (2000) The Genus Paracoccus. In M. Dworkin, Ed. The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community. Springer-Verlag, New York. Kostka, J.E., and Nealson, K.H. (1998) Isolation, cultivation, and characterization of iron- and manganese-reducing bacteria. In R.S. Burlage, Ed. Techniques in Microbial Ecology, p. 58-78. Oxford University Press, Oxford.
32 Krumholz, L.R., McKinley, J.P., Ulrich, F.A., and Suflita, J.M. (1997) Confined subsurface microbial communities in Cretaceous rock. Nature, 386(6620), 64-66. Lanoil, B.D., Sassen, R., La Duc, M.T., Sweet, S.T., and Nealson, K.H. (2001) Bacteria and Archaea physically associated with Gulf of Mexico gas hydrates. Applied and Environmental Microbiology, 67(11), 5143-5153. Leahy, J.G., Tracy, K.D., and Eley, M.H. (2003) Degradation of mixtures of aromatic and chloroaliphatic hydrocarbons by aromatic hydrocarbon-degrading bacteria. Fems Microbiology Ecology, 43(2), 271-276. Li, L.N., Kato, C., and Horikoshi, K. (1999) Bacterial diversity in deep-sea sediments from different depths. Biodiversity and Conservation, 8(5), 659-677. Lovley, D.R., and Philips, E.J.P. (1988) Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Applied and Environmental Microbiology, 54, 1472-1480. Massana, R., DeLong, E.F., and Pedros-Alio, C. (2000) A few cosmopolitan phylotypes dominate planktonic archaeal assemblages in widely different oceanic provinces. Applied and Environmental Microbiology, 66(5), 1777-1787. Mechichi, T., Stackebrandt, E., Gad'on, N., and Fuchs, G. (2002) Phylogenetic and metabolic diversity of bacteria degrading aromatic compounds under denitrifying conditions, and description of Thauera phenylacetica sp nov., Thauera aminoaromatica sp nov., and Azoarcus buckelii sp nov. Archives of Microbiology, 178(1), 26-35. Mladenovska, Z., Mathrani, I.M., and Ahring, B.K. (1995) Isolation and Characterization of Caldicellulosiruptor Lactoaceticus Sp-Nov, an Extremely Thermophilic, Cellulolytic, Anaerobic Bacterium. Archives of Microbiology, 163(3), 223-230. Onstott, T.C., Moser, D.P., Pfiffner, S.M., Fredrickson, J.K., Brockman, F.J., Phelps, T.J., White, D.C., Peacock, A., Balkwill, D., Hoover, R., Krumholz, L.R., Borscik, M., Kieft, T.L., and Wilson, R. (2003) Indigenous and contaminant microbes in ultradeep mines. Environmental Microbiology, 5(11), 1168-1191. Onstott, T.C., Phelps, T.J., Kieft, T., Colwell, F.S., Balkwill, D.L., Fredrickson, J.K., and Brockman, F.J. (1999) A global perspective on the microbial abundance and
33 activity in the deep subsurface. In J. Seckbach, Ed. Enigmatic microorganisms and life in extreme environments. Kluwer Academic Publishers. Parks, R.J., Cragg, B.A., and Wellsbury, P. (2000) Recent studied on bacterial population and processes in subseafloor sediments: a review. Hydrogeology Journal, 8, 11-28. Pedersen, K. (1997) Microbial life in deep granitic rock. Fems Microbiology Reviews, 20(3-4), 399-414. Prowe, S.G., and Antranikian, G. (2001) Anaerobranca gottschalkii sp. nov., a novel thermoalkaliphilic bacterium that grows anaerobically at high pH and temperature. International Journal of Systematic and Evolutionary Microbiology, 51(Pt 2), 457. Reed, D.W., Fujita, Y., Delwiche, M.E., Blackwelder, D.B., Sheridan, P.P., Uchida, T., and Colwell, F.S. (2002) Microbial communities from methane hydrate-bearing deep marine sediments in a forearc basin. Applied and Environmental Microbiology, 68(8), 3759-3770. Ringelberg, D.B., Townsend, G.T., DeWeerd, K.A., Sulita, J.M., and White, D.C. (1994) Detection of the anaerobic dechlorinating microorganism Desulfomonile tiedjei in environmental matrices by its signature lipopolysaccharide branch-long-chain hydroxy fatty acids. FEMS Microbiology Ecology, 14, 9-18. Roh, Y., Liu, S.V., Li, G.S., Huang, H.S., Phelps, T.J., and Zhou, J.Z. (2002) Isolation and characterization of metal-reducing Thermoanaerobacter strains from deep subsurface environments of the Piceance Basin, Colorado. Applied and Environmental Microbiology, 68(12), 6013-6020. Sanford, R.A., Cole, J.R., and Tiedje, J.M. (2002) Characterization and description of Anaeromyxobacter dehalogenans gen. nov., sp. nov., an aryl-halorespiring facultative anaerobic myxobacterium. Applied and Environmental Microbiology, 68(2), 893-900. Sharma, A., Scott, J.H., Cody, G.D., Fogel, M.L., Hazen, R.M., Hemley, R.J., and Huntress, W.T. (2002) Microbial activity at gigapascal pressures. Science, 295(5559), 1514-1516. Shen, K., Zhang, Z., van den Kerkhof, A.M., Xiao, Y., Xu, Z., and Hoefs, J. (2003) Study of high-density, high salinity inlcusions in ultra-high pressure eclogites from Southern Sulu region, China. Chinese Science Bulletin, 48(10), 1076-1081.
34 Sorokin, D.Y., Antipov, A.N., and Kuenen, J.G. (2003) Complete denitrification in coculture of obligately chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria from a hypersaline soda lake. Archives of Microbiology, 180(2), 127-133. Stookey, L.L. (1970) Ferrozine-a new spectrophotometric reagent for iron. Analytical Chemistry, 42, 779-781. Van Trappen, S., Mergaert, J., Van Eygen, S., Dawyndt, P., Cnockaert, M.C., and Swings, J. (2002) Diversity of 746 heterotrophic bacteria isolated from microbial mats from ten Antarctic lakes. Systematic and Applied Microbiology, 25(4), 603-610. Vreeland, R.H. (1999) The Family Halomonadaceae. In M. Dworkin, Ed. The Prokaryotes: An Evolving Electronic Resource for the Microbiological Community. Springer-Verlag, New York. White, D.C., Davis, W.M., Nickels, J.S., King, J.D., and Bobbie, R.J. (1979) Determination of the sedimentary microbial biomass by extractable lipid phosphate. Oecologia, 40, 51-62. White, D.C., Phelps, T.J., and Onstott, T.C. (1998) What's up down there? Current Opinion in Microbiology, 1(3), 286-290. Zheng, Y.F., Fu, B., Gong, B., and Li, L. (2003) Stable isotope geochemistry of ultrahigh pressure metamorphic rocks from the Dabie-Sulu orogen in China: implications for geodynamics and fluid regime. Earth-Science Reviews, 1276, 1-57.
35 Table 1. Anions, TOC and 13C isotope compositions for the rocks and drilling fluids 13 Sample Rock type F Cl NO3 SO4 TOC TOC δ C (depth, m) (μg/g) (μg/g) (μg/g) (μg/g) (%) (‰) CCSD_RK529 (529) Eclogite 11 18 6118 126 0.003 -25.6 CCSD_RK730 (730) 12 17 15858 1158 CCSD_RK1080 (1080) 8 13 9173 73 0.003 -24.9 CCSD_RK1179 Eclogite (1179) 8 6 4237 122 0.025 -25.7 CCSD_RK1930 (1930) 6 13 3264 140 -26.2 CCSD_RK2026 (2026) 5 10 9629 45 0.02 -25.4 CCSD_DF730 Eclogite (730) 6 502 0 258 CCSD_DF1080 Gneiss (1080) 6 400 25 161 1.07 -26.6 CCSD_DF1930 Eclogite (1930) 4 187 0 113 CCSD_DF2030 Amphibolite (2030) 4 166 7 226 4.68 -28.6
CCSD_DF730, CCSD_DF1080, CCSD_DF1930, and CCSD_DF2030 are the drilling fluid samples from the corresponding depths of rock core CCSD_RK730, CCSD_RK1080, CCSD_RK1930, and CCSD_RK2026, respectively.
36 Table 2. Chemical composition of the rock samples from CCSD Sample Rock type Rock or Fe2O3 FeO P2O5 H2O CO2 (depth, m) mineral comp. (%) (%) (%) (%) (%) CCSD_RK529 Eclogite Whole rock 4.8 15.8 0.24 0.42 <0.01 (529) Garnet 0.7±0.2 23.4±0.2 0.10±0.004 Pyroxene 14.3±2.6 6.3±2.6 0.08±0.01 CCSD_RK730 Eclogite Whole rock 2.3 9.3 0.04 0.48 0.18 (730) Garnet 0.6±0.3 20.8±0.2 0.09±0.002 Pyroxene 4.9±4.2 3.5±2.7 0.10±0.03 CCSD_RK1080 Eclogite Whole rock 4.5 4.3 0.42 0.63 0.15 (1080) CCSD_RK1179 Gneiss Whole rock 1.2 0.6 0.02 0.24 0.52 (1179) CCSD_RK1930 Eclogite Whole rock 3.5 7.4 0.15 1.26 0.18 (1930) CCSD_RK2026 Amphibolite Whole rock 3.8 6.5 0.34 1.40 0.09 (2026)
CCSD_RK529 is an eclogite containing pyrite, rutile, garnet, pyroxene and ilmenite; CCSD_RK730 is an eclogite containing cosite, rutile, garnet and pyroxene; CCSD_RK1080 is a slightly retrograde eclogite containing kyanite, rutile, epidote, and garnet; CCSD_RK1930 is an eclogite containing Si- rich white mica; CCSD_RK2026 is an amphibolite containing amphibole. The composition for the whole rock was determined by wet chemistry method; the composition for individual minerals was determined by electron microprobe analyses. The reported compositions for the individual minerals were averages of 6-8 spot analyses. The total was 98.91 to 100.09 for the whole rock analyses, and 95-101 for the individual minerals in CCSD_RK529, but 99-101 for the minerals in CCSD_RK730.
37 Table 3. Phylogenetic bacterial rDNA clone-type analysis Sample Phylogenetic Clone Related organism or clone Similarity # of group type (%) rel’ed (Depth, m) clones CCSD_RK529 α-Proteobacteria B19 Sphingomonas echinoides 93-100 2/16 (529) β-Proteobacteria B38 Azoarcus 92 1/16
γ-Proteobacteria B1 Pantoea agglomerans 97-99 5/16
B8 Selenate-reducing bacterium TSA 97 3/16 B25 Uncultured gamma proteobacterium 96-99 2/16 clone ccslm2118 Bacteroidetes B11 Uncultured bacterium IndB4-4 88 3/16
CCSD_RK730 α-Proteobacteria B13 Pseudomonas sp. 99 1/28 (730) β-Proteobacteria B3 Aquaspirillum delicatum 96-97 5/28 B10 Uncultured Azoarcus 92-93 2/28
or β-Proteobacterium OS-ac-16 U46748 B18 Ralstonia sp. 13I 99 3/28 γ-Proteobacteria B7 Uncultured bacterium SE-77 or 92-96 2/28 Stenotrophomonas maltophilia B5 Pantoea agglomerans 97-100 8/28
B25 Thialkalivibrio nitratreducens 88 2/28
B34 Acinetobacter lwoffii 95 1/28
B30 Uncultured gamma proteobacterium 88 1/28 clone ML812M-4 δ-Proteobacteria B2 Anaeromyxobacter dehalogenans 78-79 2/28
CCSD_RK1080 β-Proteobacteria B7 Ralstonia 97 1/15 (1080) B19 Antarctic bacterium or 88-99 5/15 Janthinobacterium lividum B5 Uncultured bacterium AT425_Eub48 92-97 3/15
γ-Proteobacteria B2 Pseudomonas fluorescens 98 2/15 B13 Pseudomonas sp. GOBB3-207 88-89 2/15
CCSD_RK1930 β-Proteobacteria B12 J. lividum or 98-99 3/21 Antarctic bacterium (1930) B10 Ralstonia sp. 98 1/21 B5 Iron-reducing bacterium JLN-2 98-99 2/21 γ-Proteobacteria B6 Unidentified gamma proteobacterium 97-99 4/21 strain BD6-5 or BD4-3 B3 Pseudomonas grimontii 94-98 7/21 B26 γ-Proteobacterium A40-1 95 1/21 B29 Pseudomonas corrugata 98 1/21
B24 Uncultured bacterium KF/GS-JG36-13 97 1/21
CCSD_RK2026 β-Proteobacteria B1 J. lividum 99-100 4/22 (2026) B12 Arsenite-oxidizing bacterium BEN-4 99 1/22 B4 Pseudomonas antarctica 99 2/22
38 γ-Proteobacteria B8 Methylocaldum tepidum 88-90 5/22 B20 Pseudomonas pseudoalcaligenes 97-99 6/22 B3 Acinetobacter sp. 98 1/22 Actinobacteria B28 Arthrobacter sp. 91 1/22
Gram-positive B9 Unidentified Hailaer soda lake 99 1/22 bacterium
CCSD_DF529 α-Proteobacteria B9 Sphingomonas echinoides 98 1/9 (529) β-Proteobacteria B2 Uncultured bacterium AT425_Eub48 87-94 1/9
B3 J. lividum 95-97 4/9
CCSD_DF730 α-Proteobacteria B1 Paracoccus zeaxanthinifaciens 96 2/20 (730) B16 Uncultured alpha Proteobacterium 92 1/20 clone SM2A11
B-4 Methylobacterium organophilum 94 2/20 β-Proteobacteria B7 Arsenite-oxidizing bacterium NT-6 97 2/20
γ-Proteobacteria B3 Uncultured γ-proteobacterium 93 1/20
B19 Halomonas sp. IB-559 99 1/20 B5 Xanthomonas sp. ML-122 96 1/20
B24 Alcanivorax sp. PR-1 92 1/20 Bacteroidetes B9 Uncultured Bacteroidetes bacterium 88-91 2/20 clone ML635J-56
Gram-positives B18 Uncultured bacterium SHA-33 97 1/20
B22 Uncultured Clostridium sp. clone 94 1/20 PSB-M-2 B10 Mollicutes bacterium pACH93 91 1/20
CCSD_DF1080 Planctomycetes B6 Uncultured planctomycete 97 1/23 (1080) CY0ARA031A01
Bacteroidetes B1 Bacteroidetes bacterium MWH- 85-90 6/23 CFBk5
B13 Aequorivita lipolytica Y10-2T 89-90 2/23 B4 Uncultured soil bacterium clone 96 1/23 B5 Uncultured bacterium clone BIOEST- 90 2/23 12 B11 Sporocytophaga myxococcoides 90 1/23
Gram positive B7 Bacillus sp. JMM-4 96 1/23
α-Proteobacteria B23 Paracoccus zeaxanthinifaciens 94 1/23
39 B15 Uncultured alpha proteobacterium 98 1/23 clone ML316M-13
B16 Mesorhizobium sp. 4FB11 93 1/23
γ-Proteobacteria B8 Alcanivorax sp. K2-1 90 1/23 B22 Sulfur-oxidizing bacterium OAII2 88 1/23
B17 Methylosphaera hansonii U67929 85 1/23
B14 Uncultured proteobacterium clone 85 1/23
Unidentified B9 Unidentified bacterium clone K2-S7 86-87 2/23
CCSD_DF2030 Candidate B11 Uncultured bacterium SBR1039 88 1/19 (2030) γ-Proteobacteria B3 Pseudomonas nitroreducens 97-99 4/19 B16 Pseudomonas pseudoalcaligenes 100 2/19 B12 Pseudomonas stutzeri strain 28a50 95 1/19
B6 Uncultured bacterium clone MB-A2- 95-96 4/19 102 δ-Proteobacteria B2 Desulfobotulus sapovorans M34402 97 2/19
B1 Uncultured bacterium Eub No. 6 98 1/19 Gram positive B19 Acetanerobacter thermotolerans 89 1/19
B13 Alkalibacterium olivoapovliticus 97 1/19 ε-Proteobacteria B20 Campylobacter sp. NO3A 98 1/19
*FCB group = Flexibacter-cytophaga –bacteroides.
40
FIGURE CAPTIONS
Figure 1. A map showing general geology in the Dabie-Sulu orogen of central-eastern China. NCB and SCB in the inset denote the North China Block (a part of the Sino-Korean plate) and South China Block. The drilling site is the circle labeled Donghai. After Zheng et al. (2003). Figure 2. A back-scattered electron image showing fractures in garnet and pyroxene. The numbers are spots used for obtaining quantitative chemical composition by electron microprobe analyses. Figure. 3: An optical micrograph showing various mineral/fluid inclusions in the UHP rocks. The upper left and lower right pictures show inclusions in garnet and pyroxene. The upper middle and upper right picture show inclusions in quartz (colorless-gray) and kyanite (blue). The lower left picture shows inclusions in kyanite. All these host minerals are from eclogite. Figure 4. Neighbor-joining tree of nearly full-length sequences (~1400 bp) of isolates and representative examples of bacterial clone sequences. The designation for the isolates are as follows, with CCSD_DF2030_AG37_isolate1 as an example: CCSD, Chinese continental scientific drilling; DF2030, drilling fluid from 2030 meter depth; AG37, the AG medium with incubation temperature of 37oC; isolate1, isolate number. Thus, this isolate was obtained from the CCSD project, drilling fluid from 2030 meter depth, using the AG medium at 37oC. Figure 5. Typical electropherograms of bacterial T-RFLPs generated from rDNA with a labeled forward primer and enzyme HhaI digests for the rock, drilling fluid and surface soil samples. There is another set of electropherograms of bacterial T- RFLPs generated from rDNA with a labeled reverse primer but they are not shown in this paper. The numbers above or next to the peaks indicate major ribotypes common to all the samples, and the unlabeled peaks indicate novel ribotypes unique to that sample. For example, none of the peaks for the surface soil sample is labeled, indicating that all the peaks (ribotypes) are unique to the soil sample.
41 Figure 6. Phylogenetic relationships of representative phylotypes of bacterial 16S rRNA gene sequences as determined by the neighbor-joining method. Scale bar = 0.01 nucleotide substitution per site. Sequences for the rock samples are indicated by capital boldface type, sequences for the drilling fluid samples by underline styles, and sequences from the surface soil sample prefixed by CCSD_SOIL. The remaining sequences were references obtained from the RDP or GenBank. Phyla were determined by using classification in Bergey’s Manual of Systematic Bacteriology (10). Aquifex pyrophilus is used as an outer group. Genbank accession numbers are in parentheses. Complete phylogenetic bacterial 16S rRNA gene clone-type analysis was presented in Table 3. Figure 7. Phylogenetic relationships of representative phylotypes of archaeal 16S rRNA gene sequences as determined by the neighbor-joining method. Scale bar = 0.01 nucleotide substitution per site.
42
Zhang et al. Figure 1
43
Zhang et al. Figure 2
44
Zhang et al. Figure 3
45 Thialkalivibrio thiocyanodenitrificans (AY360060)
Thioalcalovibrio denitrificans (AF126545) CCSD_DF730_B8 (AY820712) CCSD_DF2030_B10 (AY820717) γ-proteobacteria Pseudomonas alcalophila (AB030583) Pseudomonas pseudoalcaligenes (AB021379)
CCSD_RK1930_B20 (AY820721) CCSD_DF529_B7(AY820727) Pseudomonas sp. NZ062 (AY014814)
CCSD_DF2030_B15 (AY820719)
CCSD_RK1080_B3 (AY820723)
Uncultured Comamonadaceae bacterium (AY191346)
CCSD_RK1080_B12 (AY820724) β-proteobacteria CCSD_RK1080_B15 (AY820725) CCSD_DF730_B11(AY820713) Uncultured bacterium B35 (AF407720) CCSD_DF730_B17(AY820715) Methylobacterium organophilum (D32226) CCSD_RK2026_B26 (AY820726) α-proteobacteria Bradyrhizobium sp. aeky3 (AF514701) CCSD_RK529_B13 (AY820720) Sphingomonas echinoides (AJ012461) CCSD_RK730_B19 (AY820722) δ-proteobacteria Anaeromyxobacter dehalogenans 2CP-5 (AF382397) CCSD_DF2030_AG37_isolate3 (AY820246) Clostridium bifermentans (AF320283) CCSD_DF2030_AG37_isolate1 (AY820245) CCSD_DF2030_TE37_isolate2 (AY820249) Firmicutes Clostridium felsineum (X77851) CCSD_DF2030_AG68_isolate2(AY820251) CCSD_DF2030_AG68_isolate1(AY820250)
CCSD_DF2030_AG68_isolate3(AY820253)
CCSD_DF2030_CL68_isolate2 (AY820247)
CCSD_DF2030_B9(AY820716) Uncultured bacterium Eub No. 6 (AF395426) Chrysiogenetes CCSD_DF2030_TE37_isolate1 AY820248 Chrysiogenes arsenatis (X81319) CCSD_DF2030_B14 (AY820718) Verrucomicrobia Verrucom icrob iae b acterium pACH90 (AY297806) Uncultured bacterium AT425_EubC11 (AY053483) Unclassified bacteria CCSD_RK730_B14 (AY820714) Aquifex pyrophilus (M83548) 0.05 substitutions/site Figure 4 Zhang et al. Figure 4
46
4.0x104 6.0x104 (94) CCSD_DF529 Soil 3.0x104 CCSD_ 4.5x104 (80) (560) 1(371) (200) (374) 4 2.0x10 3.0x104 (93) 1.0x104 (59) (197) 1.5x104 (60) 0 0 4 4.0x10 6.0x104 CCSD_RK529 4 (250) CCSD_RK1930 3.0x10 4.5x104 2(376) 4 2.0x10 4 3(562) 1(371)2 2(376)3 3.0x10 1(371) 1.0x104 (46) (201) 1.5x104 (91) 0 0
1.0x104 4.0x105 (96) CCSD_DF730 6(202) CCSD_DF2030 7.5x103 3.0x105 (56) 3(562) 5.0x103 4(572) 2.0x105 (181) 5(64) 3 5 2.5x10 1.0x10 (150) 0 0 2.0x104 4.0x104 CCSD_RK730 CCSD_RK2026 1.5x104 3.0x104 6(202) 1(371) (378) 4(572) 1.0x104 2.0x104 5(64) 4 4 Arbitrary fluorescene strength 0.5x10 (204) 1.0x10 (48) 0 0 0 100 200 300 400 500 600 4.0x105 Size (bp) 6(202) CCSD_DF1080 3(562) 3.0x105 Terminal restriction fragment length 2.0x105 1.0x105 (59) (171) (207) 0 2.5x105 6(202) 5 CCSD_RK1080 2.0x10 4(572) 1.5x105 2(376) 1.0x105 1(371) (566) 0.5x105 DS14 0 0 100 200 300 400 500 600 Size (bp) Terminal restriction fragment length
Zhang et al. Figure 5
47 CCS D_S OIL_B 3 (A Y 820662) Unclassified bacteria Uncultured soil bac terium clone 96 -2 (A F42330 2) CCS D_S OIL_B 14(A Y 820664) Uncultured soil bac terium Tc1 19-D02 (A Y 242628) CCS D_S OIL_B 19 (AY 820667) Uncultured Rub robacte ridae b acteriu m GR35 (AY 150896) CCS D_RK2026_B28 (AY820660) Actinobacteria Arthrobactersp. s train 5 37 (X 933 56) CCS D_RK2026_B9 (AY 820657) Unidentified Hailaer so da lake b acteriu m Z8 (A F27 5715) CCS D_DF1080_B 7 (A Y820692) Bacillus sp. JMM-4 (A Y 032601) CCS D_DF2030_B 13 (AY 820708 ) A lkalibacterium olivoapovliticus WW 2-S N4c (A F143 512) CCS D_DF730_B 10(A Y 820682) Gram-positiv e Mollicutes bacte rium pA CH93 (A Y 2978 08) CCS D_DF730_B 18 (A Y 820684) Uncultured bac terium SHA -33 (A J24910 4) CCS D_DF730_B 22 (A Y 820686) Uncultured Clostridium sp.PSB-M-2 (AY128089 ) CCS D_DF2030_B 1 (AY 820702) CCS D_DF2030_B 19 (A Y 820710 ) Uncultured bac terium E ub No. 6 (A F395 426) A cetanaerobac ter t herm otolera ns (AF3 58114 ) CCS D_RK529_B11(AY 820626) CCS D_DF1080_B 5 (A Y 820690) Uncultured bac terium B IOE S T-12 (A J548901 ) Uncultured bac terium IndB 4- 4 (AB 100009 ) CCS D_DF730_B 9 (A Y820681) Bacteroidetes Uncultured B acte roidetes bacteriu m M L635J- 56 (A F 507862 ) CCS D_DF1080_B 13 (A Y 820695 ) A equorivita lipolytica Y 10-2 T (A Y 027805) CCS D_DF1080_B 1 (A Y 820688) B acteroidetes b acteriu m MWH-CFB k5 (A J565431 ) CCS D_DF2030_B 20 (A Y 820711 ) Campylobacter sp. NO3A (A Y 1353 96) CCS D_RK529_B1(AY 820624) P antoea agglo merans (A F19 9029) CCS D_RK730_B5(AY 820632) CCS D_RK529_B8 (AY 820625) S elenate-red ucing bact erium TSA (A B018593) Uncultured ga mma prote obacte rium ccslm 2118 (A Y 133084) CCS D_RK529_B25(AY 820628) CCS D_DF2030_B6 (A Y 820705) Uncultured bac terium clone MB-A 2 -102 (A Y 093457) CCS D_RK1930_B24 (AY 820650) Uncultured P seudo monas s p. K F/GS- Gitt2-4 1 (A J2956 44) CCS D_RK1930_B3 (AY820645) CCS D_RK1930_B29 (AY 820652) CCS D_RK1930_B6 (AY820647) CCS D_RK1080_B2 (AY820640) P seudomonas sp . GOB B 3-207 (A F32 1048) P seudomonas flu orescens bv. G (A F228 366) Iron-r educing b acteriu m JLN-2 (AF157 486) P seudomonas a ntarctica (A J53760 1) P seudomonas g rimontii (A F2680 29) CCS D_RK1930_B5 (AY 820646) Unidentified gam ma p roteob acteriu m strain B D6-5(A B 015575 ) P seudomonas co rrug ata (A F34850 8) CCS D_RK2026_B4(AY 820655) CCS D_RK1080_B13 (AY 820643) CCS D_RK2026_B20 (AY 820659) CCS D_DF2030_B 3 (A Y820704) P seudomonas ps eudoalcaligen es (A B 109888 ) P seudomonas nit rore ducens 0802 (A F4940 91) P seudomonas st utzeri 28a50 (A J312162 ) γ-proteobacteria P seudomonas ps eudoalcaligen es (A B 021379 ) CCS D_DF2030_B 16 (A Y 820709 ) CCS D_DF2030_B 12 (A Y 820707 ) CCS D_DF730_B 19 (A Y 820685) Halomonas sp. IB -559 (AJ309560 ) CCS D_RK730_B34 (AY 820639) A cinetobacter lwoffii A 382 (A F18 8302) A cinetobacter sp . BC187 (A F 189695 ) CCS D_RK2026_B3 (AY 820654) CCS D_RK730_B25 (AY 820637) CCS D_DF730_B 3 (A Y 820677) Uncultured ga mma prote obacte rium B -A C40 (A Y 6222 51) CCS D_DF730_B 24 (A Y 820687) A lcanivorax sp. P R-1 (A B 0531 32) Alcanivorax sp. K2-1 (A B 055204) CCS D_DF1080_B 8 (A Y820693) CCS D_DF1080_B 17 (A Y 820698 ) Methylosphae ra ha nsonii (U679 29) Methylocaldum tepidu m (U892 97) CCS D_RK2026_B8 (AY 820656) Sulfur-oxidizing bact erium OA II2 (A F 170423 ) CCS D_RK730_B30 (AY 820638) CCS D_DF1080_B 22 (AY 820699 ) Uncultured ga mma prote obacte rium ML812 M-4(A F45354 9) Thialkalivibrio nitra treduc ens (AY 07901 0) CCS D_RK529_B38 (AY 820629) CCS D_RK730_B10 (AY 820634) Uncultured Azoarc us sp (A J43 1352) B eta proteo bacteriu m OS -ac -16 (U4 6748) CCS D_RK730_B3(AY 820631) Aquaspirillum delicatum (A F07 8756) CCS D_DF730_B 7 (A Y 820680) Arsenite-oxidizing bac terium NT-6 (A Y 027499 ) CCS D_RK730_B18 (AY 820636) Ralstonia sp. 13I (A Y 191853 ) CCS D_RK1930_B10 (AY 820648) Ralstonia sp. A U2944 (A F4887 79) CCS D_RK1080_B7 (AY 820642) β-proteobacteria CCS D_RK2026_B12 (AY 820658) Arsenite-oxidizing bac terium B E N-4 (A Y 027504) CCS D_RK1080_B5 (AY820641) Uncultured bac terium A T425_E ub 48 (A Y 05347 7) CCS D_DF529_B 2 (A Y 820673) CCS D_DF529_B 3 (A Y 820674) Antarctic bacte rium R-7 687 (A J44 0985) Janthinobacte rium lividum (A Y247410 ) CCS D_RK1080_B19 (AY 820644) CCS D_RK1930_B12 (AY 820649) CCS D_RK2026_B1(AY820653) CCS D_RK730_B7(AY 820633 ) Uncultured bac terium S E -77 (A F2 96231 ) CCS D_RK1930_B26 (AY 820651) Gamma p roteo bacteriu m A 40-1 (A Y 049941) CCS D_DF730_B 5 (A Y 820679) γ-proteobacteria X anthomonas s p. ML -122 (A F139 997) CCS D_DF529_B 9 (A Y820675) P seudomonas sp . RM2- 2001(A F33166 4) S phingomonas ec hinoides (A J01 2461) CCS D_RK730_B13 (AY 820635) CCS D_RK529_B19 (AY 820627) CCS D_S OIL_B 21 (A Y 820668) Uncultured soil bac terium 1152 -2 (AF 423211 ) Uncultured alph a pro teobact erium S M2A 11 (A Y 29340 4) CCS D_DF730_B 16 (A Y 820683) CCSD_DF730_B 4 (A Y 820678) Methylobacte rium o rgano philum (D3 2226) α-proteobacteria CCS D_DF730_B1 (A Y 820676) CCS D_DF1080_B23 (A Y 820700 ) P aracoccus zeaxan thinifaciens R- 1506 (A F4611 59) CCS D_DF1080_B 15 (A Y 820696 ) Uncultured alph a pro teobact erium ML31 6M-1 3 (A F4 54287 ) CCS D_DF1080_B 16 (A Y 820697 ) Mesorhizobiu m sp. 4 FB 11 (A F22987 7) CCS D_S OIL_B 4 (A Y 820663) CCS D_S OIL_B 29 (AY 820670) CCS D_S OIL_B 33 (A Y 820672) Cyanobacteria P hormidium au tumnale (A F21 8371) Microcystis aer uginosa (AB 023256) CCS D_S OIL_B 8 (A Y 820665) CCS D_S OIL_B 25 (A Y 820669) Metal-cont aminate d soil K 20-95 (AF14 5879) CCS D_S OIL_B 32 (A Y 820671) Acidobacteria Bacterial species RB 41( Z9572 2) CCS D_DF2030_B 2 (A Y 820703) Desulfobotulus sap ovorans (M3 4402) CCSD_RK730_B2 (AY 820630) δ-proteobacteria CCS D_S OIL_B 18 (A Y820666) Uncultured delt a pro teobact erium (A J318168 ) A naeromyxobac ter d ehalogen ans 2CP -5 (A F3823 97) CCS D_S OIL_B 2 (A Y820661) Uncultured bac terium clone NMS 8.1 55W L (A F 432672 ) CCS D_DF1080_B 4 (A Y 820689 ) Uncultured soil bac terium clone G7 -1465 -5 (A F52583 6) CCS D_DF2030_B 11 (A Y 820706 ) Unclassified bacteria Uncultured bac terium S BR1039 (X84482 ) CCS D_DF1080_B 6 (A Y 820691) Uncultured planc tomycet e CY 0A RA 031A01 (B X 294822) CCS D_DF1080_B 9 (A Y 820694) Planctomycetes CCS D_DF1080_B 24 (A Y 820701 ) Uncultured bac terium A 64 (A Y 373416 ) Unclassified bacteria A quifex pyrophilus (M835 48) Figure 6 0.01 substitu tions/site
Zhang et al. Figure 6
48
CCSD DF529 A13 CCSD DF529 A14 CCSD DF529 A10 CCSD DF529 A9 CCSD DF529 A17 Thermophilic Sulfolobus (X03235 Ch CCSD DF2030 A13 Desulfurococcus (M36474) CCSD DF2030 A19 CCSD_RK1930_A18 CCSD_RK1930_A22() CCSD_RK529_A14() ()CCSD_RK2026_A22 CCSD_RK2026_A18() ()CCSD_RK529_A11 CCSD_RK529_A12() ()CCSD_RK1930_A5 CCSD_RK730_A8() CCSD_RK730_A15() CCSD_RK730_A10() CCSD_RK2026_A21() ()Uncultured Front Range crenarchaeot FRA1 Soil CrenarchaeotaGroup Unculture crenarchaeot TRC23-31 CCSD DF2030 A10 CCSD DF2030 A9 CCSD DF2030 A18 CCSD_RK730_A1 ()CCSD_RK1930_A25 ()CCSD_RK1930_A26 Crenarchaeote CCSD_RK2026_A12() ()CCSD DF2030 A16 CCSD_RK1930_A15 ()CCSD DF2030 A12 CCSD_RK2026_A17 CCSD_RK529_A19() ()CCSD_RK2026_A23 ()CCSD DF2030 A22 CCSD SOIL A10 CCSD_RK529_A24 ()Unculture archaeonclone Nap013 Hot spring Crenarchaeota CCSD_RK529_A16 CCSD() SOIL A1 CCSD DF730 A7 CCSD DF1080 A13 CCSD DF1080 A7 CCSD DF1080 A22 CCSD DF1080 A8 CCSD DF1080 A23 CCSD DF1080 A18 CCSD DF730 A4 CCSD DF1080 A11(AY8202 CCSD DF1080 A15 CCSD_RK1080_A17 ()CCSD_RK529_A20 ()CCSD RK1930 A9 CCSD DF730 A16 Marine CrenarchaeotaGroup I CCSD_RK1080_A1 ()CCSD DF730 A25 CCSD DF730 A15 CCSD RK2026 A20 Unidentifie archaeonLMA229 CCSD DF1080 A1 CCSD DF1080 A4 Unidentifie archaeonpMC1A11(AB01972 Unculture crenarchaeotAM-20A 102 Unculture archaeon19b-5 Cenarchaeum (U51469) CCSD DF1080 A24 Unculture archaeonSAGM -C(AB050207 Unculture archaeonSAGM -10 Unculture crenarchaeote621-35 Aquifex (M83548)
0.01 btitti /it Figure 7
Zhang et al. Figure 7
49 Unique Microbial Community in Drilling Fluids from Chinese Continental
Scientific Drilling
Running title: Microbial Community in Fluids From Deep Drilling
Gengxin Zhang1, Hailiang Dong1*, Hongchen Jiang1, Zhiqin Xu2, and Dennis D. Eberl3
1: Department of Geology Miami University Oxford, OH 45056
2: Key Laboratory for Continental Dynamics Chinese Academy of Geological Sciences Institute of Geology, Beijing, China
3:US Geological Survey Boulder, CO 80303
*Corresponding author: Hailiang Dong Department of Geology Miami University Oxford, OH 45056 Tel: 513-529-2517 Fax: 513-529-1542 Email: [email protected]
Published in Geomicrobiology Journal (2006),v 23, p 499-514
December 11, 2005
50 ABSTRACT
Circulating drilling fluid is often regarded as a contamination source in investigations of subsurface microbiology. However, it also provides an opportunity to sample geological fluids at depth and to study contained microbial communities. During our study of deep subsurface microbiology of the Chinese Continental Scientific Deep drilling project, we collected 6 drilling fluid samples from a borehole from 2290 to 3350 m below the land surface. Microbial communities in these samples were characterized with cultivation-dependent and -independent techniques. Characterization of 16S rRNA genes indicated that the bacterial clone sequences related to Firmicutes became progressively dominant with increasing depth. Most sequences were related to anaerobic, thermophilic, halophilic or alkaliphilic bacteria. These habitats were consistent with the measured geochemical characteristics of the drilling fluids that have incorporated geological fluids and partly reflected the in-situ conditions. Several clone types were closely related to Thermoanaerobacter ethanolicus, Caldicellulosiruptor lactoaceticus, and Anaerobranca gottschalkii, an anaerobic metal-reducer, an extreme thermophile, and an anaerobic chemoorganotroph, respectively, with an optimal growth temperature of 50- 68°C. Seven anaerobic, thermophilic Fe(III)-reducing bacterial isolates were obtained and they were capable of reducing iron oxide and clay mineral to produce siderite, vivianite, and illite. The archaeal diversity was low. Most archaeal sequences were not related to any known cultivated species, but rather to environmental clone sequences recovered from subsurface environments. We infer that the detected microbes were derived from geological fluids at depth and their growth habitats reflected the deep subsurface conditions. These findings have important implications for microbial survival and their ecological functions in the deep subsurface.
Keywords: archaea, alkaliphilic, bacteria, CCSD, deep subsurface, drilling fluids, Fe(III) reducer, Firmicutes, thermophilic.
51 INTRODUCTION Drilling is an important method to obtain subsurface samples for microbiological investigations. Deep drilling often requires the use of circulating fluids to facilitate the drilling process, especially when the target is crystalline rock. In this practice, contamination is a major concern because contaminant microorganisms can be introduced during the drilling processes (Ong et al. 1999; Smith et al. 2000; Moser et al. 2003; Onstott et al. 2003; Takai et al. 2003). The make-up water (surface water used to replace lost drilling fluids), soil, and air are expected to contain microorganisms that originate from the surface and are carried down by drilling operations. Without a loss of hydrostatic pressure, drilling fluid is circulated throughout drill hole, picking up and ultimately carrying cuttings and rock fragments to the surface. Despite the fact that drilling fluids are generally acknowledged as potential sources of contamination in deep drilling programs, these operations can represent a window enabling sampling of deep geological fluids that may be present in faults and fractures. Geological fluids may contain high concentrations of nutrients for the sustenance of subsurface microorganisms. Several strains of Thermoanaerobacter ethanolicus, showing unique physiological traits (Liu et al. 1997; Roh et al. 2002), have been previously isolated from drilling fluids. Thus, drilling fluid may contain indigenous microorganisms from deep subsurface (Zhang et al. 2005). It is important to recognize that drilling fluids often contain substrates that would not have previously been present in deep geological fluids. Thus, microorganisms detected in the drilling fluids may be indigenous, but also represent perturbed subsurface communities. The overall objective of this research was to study subsurface microbiology by using drilling fluids as a carrier for the indirect sampling of geological fluids. A unique opportunity became available to us from the Chinese Continental Scientific Drilling (CCSD) Project (http://www.icdp-online.de/sites/donghai/news/news.html). Employing the most recent drilling technologies, the CCSD project, sponsored by the International Continental Drilling Program (ICDP) and the Chinese government, has drilled a 5200 m deep borehole in the eastern part of the Dabie-Sulu ultra high-pressure (UHP) metamorphic orogenic belt at the convergent plate boundary between the Sino-Korean and Yangtze Plates. The CCSD project enables the study of the deep subsurface
52 microbiology by offering 1) 5,200 meter long, continuous drill core crossing a wide range of environmental gradients; and 2) a multidisciplinary international research team that ensures the measurement of geological, geochemical, and hydrological parameters, providing an interpretative context for microbial studies. The specific goals of this paper were to systematically investigate microbial diversity and abundance in the circulating drilling fluids from 2290 to 3350 meter below the land surface (mbls) by culture- dependent and -independent approaches with the aim of detecting indigenous subsurface microorganisms. Our results indicate that the microbial community structure in drilling fluids shifted with increasing borehole depth. The phylogenetic positions of clones and isolates identified infer physiologies consistent with the deep subsurface geochemical regimes we explored.
MATERIAL AND METHODS Criteria for the Detection of Indigenous Microbes Present in Drilling Fluids The constituents of the drilling fluids, surface soil, and air must have contained surface derived microbes. Whereas some of the introduced microorganisms may have been inactivated with the circulation of drilling fluid into hot environments deep within the borehole, for the purpose of this study, it was assumed that it would be impossible to avoid surface-derived microbial contamination. Thus, drilling fluid samples likely contained a mixture of microorganisms from surface sources and those indigenous to the rock formations. To address this challenge, a combination of molecular phylogenetic analyses and physiological functional testing of isolates was undertaken in an attempt to differentiate between indigenous vs. contaminating microorganisms. Whereas caution is always warranted when inferring physiology from phylogeny, in some cases, close phylogenetic associations between detected clones and previously cultivated organisms justified predictions concerning the nature of the source organisms (surface-derived vs. indigenous). If the predicted or observed traits and metabolic functions (e.g., anaerobicity, thermophilicity, or electron acceptor utilization patterns) corresponded with in-situ geochemical conditions, then it was deemed likely that a given clone or isolate was derived from the subsurface environment.
53 Site Description The CCSD drilling site is located in Donghai County, Lianyungang City, Jiangsu Province, in the eastern part of the Dabie-Sulu ultra-high pressure metamorphic (UHPM) belt (Figure 1). The Dabie-Sulu UHPM belt was formed by collision between Sino- Korean Plate and Yangtze Plate about 240 Ma years ago. The occurrence of diamond and coesite in the rocks reveals temperature-pressure conditions of 700 to 850°C and 2.8 GPa for the UHP metamorphism (Zheng et al. 2003). The temperature gradient at the site is 19 - 26oC/km (Wang et al., 2001). The UHP rocks were subducted to at least 100-km depth and experienced the UHP metamorphism before being rapidly exhumed to the surface about 220 Ma ago. By drilling to a depth of 5 km, it is possible to study rocks that were formerly at a depth of 100 km. The products of plate tectonics in this region, i.e., UHP rocks and minerals, along with abundant fluids, radioactivity (U and Th), and gases (H2,
CO2, CO, and CH4), have provided a potentially unique assemblage of resources for the development of subsurface microbial communities. The UHP rocks are typically separated by a series of structurally weak shear zones and faults. These shear zones and faults are potential storage space for large pockets of fluids/gases and may serve as a potential microbial habitat.
Sample Collection and Preservation Samples of drilling fluids were collected every 50 meters using sterile glass bottles, purged in an anaerobic glove box, and immediately preserved at the drilling site. Exceptions in sampling frequency were made when geochemical anomalies were encountered, such as structure shear zones and certain depth intervals with anomalously high amounts of fluid/gas. In such cases, sampling was more frequent. Six drilling fluid samples covering the depth range from 2290 to 3350 mbls were collected. Each of the samples was split into two equal aliquots: one frozen at –80oC for molecular microbiology and the other held at 4oC for cultivation. The samples were shipped from the drilling site to the US at –80 and 4oC temperatures. The samples were CCSD_DF2290, CCSD_DF2450, CCSD_DF2700, CCSD_DF2950, CCSD_DF3200, and CCSD_DF3350: with CCSD referring to Chinese Continental Scientific Drilling; DF, to drilling fluid; and the number (e.g., 2290), referring to the depth in meters to which the
54 drilling fluid had circulated. All the samples were analyzed for geochemistry and microbiology. Given the measured geothermal gradient (19-26oC/km), the in-situ temperature at these depths was 43-59, 46-63, 51-70, 56-76, 60-83, 63-87oC, respectively. The range in temperatures reflects the uncertainty in the geothermal gradient estimate (Wang et al. 2001).
Drill-site Geological Fluid Analyses Because circulating drilling fluid was used for drilling, any gas or fluid from geological shear zones/faults would have been mixed into the drilling fluid from the surface. Constituent concentrations of geological gas and fluid were therefore determined by subtraction of the background noise from measured signal. Any levels significantly above the background were considered to reflect the contributions of fluids/gases from geological environment. In this study, concentrations of CO2, CH4, H2, and He were determined by real-time gas chromatography (GC) at the drilling site.
Laboratory Geochemical Analyses The supernatant from settled drilling fluid samples was analyzed for major anion concentrations by high performance liquid chromatography (HPLC) and for major cation concentrations by ICP-MS (Table 1). The pH of the drilling fluids was measured with a YSI (YSI, Inc., Yellow Springs, OH) pH probe and salinity by a YSI salinity probe.
Direct Microscopic Counts One portion of the unfrozen aliquot (stored at 4oC) was used for direct count to estimate the total number of microbial cells. Microbial cells were first detached from drilling mud by strong agitation in 0.7% NaCl solution for 10 min (Bottomley 1994) followed by acridine orange direct counting (AODC) (Ghiorse and Balkwill 1983).
Enrichment and Isolation Based on the similarity of cloned sequences to their most closely related cultured bacteria, various media were prepared to determine whether microorganisms from the drilling fluid samples could be cultured. Enrichments were set up for several drilling
55 fluids (from 2290 to 3350 meters) in minimal medium M1 (Kostka and Nealson 1998) and the FWA-Fe(III) medium (Lovley and Philips 1988) under strictly anaerobic conditions with a gassing station and Coy anaerobic chamber (Coy Laboratory Products, Grass Lake MI) at incubation temperature of 37oC, 68oC, 80oC and 100oC. Acetate or lactate was used as electron donor. In the M1 medium, Fe(III) in nontronite (iron-rich smectite) served as electron acceptor. In the FWA-Fe(III) medium, Fe(III) in two-line ferrihydrite served as electron acceptor. Enrichments were also prepared by using 3 media previously designed for anaerobic, thermophilic, and alkaliphilic bacteria from various subsurface environments, and incubation temperatures of 37oC and 68oC were used. The first one was an enrichment medium (designated as AG medium hereafter) for Anaerobranca gottschalkii, a thermoalkaliphilic bacterium that grows anaerobically at high pH (9.5) and temperature (55oC) (Prowe and Antranikian 2001). The carbon source was starch or xylan with no addition of electron acceptor. The second one was an enrichment medium (designated as CL medium hereafter) for Caldicellulosiruptor lactoaceticus, an extremely thermophilic, cellulolytic, anaerobic bacterium from an alkaline hot spring in Iceland (Mladenovska et al. 1995). The carbon source was yeast extract. The third one was an enrichment medium (designated as TE medium hereafter) for Thermoanaerobacter ethanolicus, a thermophilic metal-reducing bacterium from deep subsurface of the Piceance Basin, Colorado (Roh et al. 2002). The carbon source was acetate or pyruvate, and the electron acceptor was Fe (III) in two-line ferrihydrite. All incubations were carried out in the dark without shaking. Growth was monitored by AODC and by visual inspection of color change and precipitation. When growth was evident, transfer to fresh enrichment tubes was carried out. In the Fe(III)-reducing medium (M1, FWA-Fe(III) or TE), production of biogenic Fe(II) was measured by the ferrozine assay (Stookey 1970). The isolates were obtained from enrichment cultures with a modification of the roll-tube method (Kashefi et al. 2002). In this method, the solid medium was made in a three-step process. First, to prepare a solidifying agent, 1.5 g GELRITE gellan gum
(Sigma) was added to 50 mL anaerobic water in 128 mL serum bottles under N2 atmosphere, the other part of the medium with the constituents at twice the concentration of FWA-Fe(III), or M1 medium, and 10 mM lactate and acetate, was dispensed into
56 Balch tubes in 3.5 mL aliquots under N2/CO2 or H2/CO2 (80:20%, v/v), and the bottles or tubes were then sealed with thick butyl-rubber stoppers. Second, the solidifying agent and double-strength medium were autoclaved and then placed into a water bath (60°C) to amend with FeCl2 (1 to 2.6 mM). Third, an aliquot (3.5 mL) of the solidifying agent was added anaerobically to the tubes of the double-concentration medium, followed immediately by an inoculum (0.7 ml) from the enrichment cultures. The contents were mixed gently and thoroughly at 60°C. Next, a second aliquot of 0.7 mL inoculum was quickly removed from inoculated tubes and diluted into another pure mixture of solidifying agent and double-strength medium. The inoculated pressure tubes were then rolled in a cold water-bath by hands. When complete, the roll tubes were incubated vertically at 60 or 68°C.
Clay Reduction Experiments Using Fe-Reducing Isolates To assess the capabilities of the isolates from the M1 and FWA-Fe(III) media for Fe reduction and mineral transformations, bioreduction experiments were performed.
The pure cultures from the M1 and FWA-Fe(III) media were incubated under a N2-CO2 (80:20) headspace with 20 mM lactate as electron donor, and nontronite (5mg/mL) and 50 mM ferrihydrite as electron acceptor in the M1 and FWA-Fe(III) media, respectively. The production of Fe(II) and mineral transformations associated with the bioreduction were measured by the ferrozine assay and powder X-ray diffraction (XRD), respectively. Nontronite (NAu-2) was purchased from the Source Clays Repository of the Clay Minerals Society. Bulk clay, with a total Fe content of 23.4% and Fe(II) content of 0.12% (Jaisi et al. 2005), was size-fractionated and the 0.5-2 μm fraction used in the experiment. A previous study has shown that ~91% of the total Fe(III) in the clay was in the octahedral site, and 9% in the tetrahedral site (Gates et al. 2002). Ferrihydrite was made by neutralizing a solution of 0.4 M FeCl3 with 10 M NaOH as described previously (Lovley and Phillips 1986). At selected time points during the bioreduction, the culture tubes were removed from the incubator and 0.2 mL of cell-mineral suspension was sampled with a sterile syringe and added to a centrifuge tube containing 0.2mL of 1 N Ultrex HCl. The cell- mineral suspension was allowed to stand for 24 hours. This extraction was termed the
57 “0.5 N HCl extraction” and (with the exception of highly crystalline magnetite) has been shown to be effective for extracting microbially produced Fe(II) including the adsorbed form and Fe(II) in biogenic solids (Fredrickson et al. 1998; Zachara et al. 1998). The Fe(II) in a given solution was determined by the ferrozine assay (Stookey 1970). Both unreduced and bioreduced samples were examined by XRD to identify mineralogical changes in the culture tubes. For the ferrihydrite samples and their bioreduced products, XRD patterns were obtained with a Scintag X1 powder diffractometer system using CuKα radiation with a variable divergent slit and a solid- state detector. The routine power was 1400 W (40 kV, 35 mA) and low-background quartz XRD slides (Gem Dugout, Inc., Pittsburgh, Pennsylvania) were used. For analysis, powder samples were tightly packed into the slide wells, and mineral identification was made using the search-match software. The nontronite samples and their bioreduced products (approximately 50 mg each) were run at U.S. Geological Survey in Boulder, CO. Samples were dispersed in 2 mL distilled water using an ultrasonic probe, and then pipeted and dried onto glass slides for XRD analysis. Samples were X-rayed with a Siemens D500 X-ray diffraction system using Cu radiation, a monochromator, and were scanned in 0.02-degree two-theta steps from 2 to 40 degrees, with a count time of 2 seconds per step.
Phospholipid Fatty Acid (PLFA) Analyses PLFA analyses were performed for three drilling fluid samples (CCSD_DF2290, CCSD_DF2950, and CCSD_DF3350) by Microbial Insights, Inc. in Rockford, TN. After the total lipid extraction (White et al. 1979) polar lipids were separated by column chromatography (Guckert et al. 1986). The polar lipid fatty acids were derivatized to fatty acid methyl esters, which were quantified using gas chromatography (Ringelberg et al. 1994). Fatty acid structures were verified by chromatography/mass spectrometry and equivalent chain length analysis.
DNA Isolation, Amplification, Cloning and Sequencing Total DNA was extracted from either the drilling fluids or the isolates using the UltraClean Soil DNA Isolation Kit (Mo Bio Laboratory Inc., Solana Beach, CA).
58 Purified DNA was used as template for the amplification of 16S rRNA gene by means of the polymerase chain reaction (PCR) using the manufacturer’s recommendations for the Failsafe Kit (Epicentre Biotechnologies, Madison, WI). PCR reaction mixtures contained
10 mM Tris pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 μM each dNTP, 0.2 μM each primer, and 1.25 unit FailSafe PCR Enzyme Mix in 50 µL reaction volume. Bacterial primer sequences were Bac27F: 5΄-AGAGTTTGATCMTGGCTCAG, and Univ1492R: 5΄-CGGTTACCTTGTTACGACTT (Lane 1985). The following standard conditions were used for amplification of the bacterial 16S rRNA gene: 30 cycles (denaturing at 95 o o o C for 30s, annealing at 60 C for 30s, extension at 72 C for 2 min). Several tubes were combined to obtain enough PCR products. Archaeal primer sequences were Arch21F: 5΄- TTCCGGTTGATCCYGCCGGA and 958R: 5΄-YCCGGCGTTGAMTCCAATT (DeLong 1992). The following standard conditions were used for amplification of the o o archaeal 16S rRNA gene: 30 cycles (denaturing at 95 C for 30s, annealing at 55 C for o 30s, extension at 72 C for 2 min). PCR products were ligated into pGEM®-T vector (Promega Inc., Madison, WI) and the resulting ligation mixtures were transformed into E. Coli DH5α competent cells. Environmental clone libraries were constructed, and plasmid DNA from 40 insert-containing colonies per sample was purified using Qiagen kit (Qiagen Inc., Chatsworth, CA). 16S rRNA genes were sequenced from Bac27F and Arch21F primers with a DYEnamic ET terminator cycle sequencing ready reaction kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ) and an ABI 3100 sequencer. Based on phylogenetic trees constructed from partial sequences, representative bacterial clone types and all isolates were sequenced with multiple primers (Bac27F, 925R and Univ1492R) to obtain nearly full-length (~1400 bp) sequences of the bacterial 16S rRNA gene. The sequence for 925R was 5’-CCGTCAATTTTRAGTTT. There was overlap of approximately 200 bases between each pair of primers (i.e., between 27F and 925R). The complementary checking and sequencing of a known archaeon Sulfolobus acidocaldarius indicated that the error frequency of partial sequencing analysis was approximately 0.05 errors per 100 bases (Zhang et al. 2005).
Phylogenetic Analyses
59 Clone sequences were manually verified with the Sequencer program and secondary structure diagrams. The RDP Chimera Check program (http://rdp8.cme.msu.edu/html/index.html) was utilized to identify potential chimeras formed during PCR. The sequences obtained were compared to the small subunit 16S rRNA gene database within the Ribosomal Database Project (RDP-II) and GenBank for the identification of the two nearest phylogenetic neighbors and a representative collection of divergent phylogenetic groups, and were aligned to 16S rRNA gene sequence data from the RDP and GenBank using the ClustalW multiple sequence alignment program. The sequences were then manually aligned using the Macclade software. Phylogenetic analyses were performed with molecular evolutionary genetics analysis software (MEGA) (http://www.megasoftware.net). Trees generated with neighbor-joining and minimum evolution methods were not significantly different. Phylogenetic inference and evolutionary distance calculations were made with the distance Jukes-Cantor model (gamma parameter equal to 2.0). Bootstrap analysis (500 replicates) was used to obtain confidence estimates for the phylogenetic trees.
Nucleotide Sequence Accession Numbers. The sequences determined in this study have been deposited in the GenBank database under accession numbers DQ128177-DQ128183 for the isolate sequences, DQ128184-DQ128258 for the bacterial clone sequences, and DQ128259-DQ128311 for the archaeal clone sequences.
RESULTS Geochemical Characteristics of the Drilling Fluids Sulfate, chloride, and nitrate concentrations were similar among the drilling fluid samples, but the fluorine concentration abruptly increased by a factor of 22 from DF2950 to DF3200 (Table 1). The change of the fluorine concentration could have been caused by incorporation of geological fluid (Ivanova et al. 1995; Balashov et al. 2000). All of the drilling fluid samples were alkaline and of middle-low salinity (2.0-3.3%). In-situ temperatures were calculated for each sample based upon the previously measured geothermal gradient (Wang et al. 2001).
60
Biomass Determination by Direct Count and PLFA Total counts of microbial cells in the drilling fluid by AODC indicated a range of 2.3 to 5.0 x 108 cells per mL. PLFA represents viable bacterial populations (White et al. 1979). Based on the conversion factor of 2.5 x 104 cells per picomole of PLFA (Balkwill et al. 1988), the biomass for the three drilling fluid samples was 1.3, 1.7, and 2.1 x 108 cells/mL for CCSD_DF2290, CCSD_DF2950 and CCSD_DF3350, respectively. These estimates were lower than the AODC-determined biomass, indicating the presence of archaeal biomass. The community structure analyses of the three drilling fluids indicated that monoenoic (indicative of Protoebacteria) and normal saturated PLFA were the prominent constituents of the three drilling fluid samples (Figure 2). Firmicutes or Clostridia-like fermenting bacteria (terminally-branched PLFA) were also present in the three drilling fluids at around 10%. A biomarker for sulfate-reducing bacteria (mid- branched saturated PLFA) was present at less than 0.5% in the three drilling fluids. Biomarkers that indicate the presence of anaerobic metal reducer (branched monoenoic PLFA) increased with depth (0.3%, 3.2% and 22.1% for CCSD_DF2290, CCSD_DF2950 and CCSD_DF3350, respectively).
Isolate Acquisition and Microbial Reduction of Fe(III) in Nontronite and Ferrihydrite Seven isolates were obtained from the drilling fluid samples. One isolate obtained from CCSD_DF2290 on FWA-Fe(III) medium at 60oC (CCSD_DF2290_FWA_60_isolate1) was moderately related (95% similarity) to Soehngenia saccharolytica (Figure 3), an anaerobic, benzaldehyde-converting bacterium (Parshina et al. 2003). This isolate was able to use Fe(III) in ferrihydrite as an electron acceptor and acetate or lactate as an electron donor at 60oC (Figure 4a). XRD analysis detected the presence of siderite, vivianite, and goethite as a result of microbial reduction of Fe(III) in ferrihydrite (Figure 4b). In the enrichment cultures for CCSD_DF2450, there was visible cell growth and change of nontronite color in the M1 medium at incubation temperatures of 37, 68, 80, and 100oC, suggesting activity of thermophilic Fe(III) reducers. Six isolates were obtained from the M1 medium at 68oC (CCSD_DF2450_M1_68_isolate1, 2, 3 etc.) and they were 98-99% similar to
61 Thermoanaerobacter ethanolicus (Figure 3). The six isolates were able to use lactate as electron donor and Fe(III) in nontronite as electron acceptor. When one isolate was inoculated with nontronite, there was evident Fe (III) reduction in the M1 medium at 68oC (Figure 5a) with the extent of bioreduction reaching 19.5% within 30 days. Cell growth was observed visually. Nontronite remained in the control tubes after 30 days of incubation (Figure 5b). However, microbial reduction of Fe(III) in nontronite resulted in formation of 40% illite layers (Figure 5c).
Bacterial 16S rRNA Clone Libraries Approximately 134 bacterial 16S rRNA gene clones were sequenced and identified in the clone libraries of the drilling fluid samples. Rarefaction curves were constructed to assess clone library coverage. Our results indicate that the archaeal diversity was low, and fully analyzed in our libraries. The bacterial diversity was higher, and the rarefaction curves for the bacterial clone libraries were not fully saturated. However, in a given library, multiple sequences were highly similar to one another (>98- 99% similarity), implying that the dominant organisms were not missed. Sixteen representative bacterial clones were sequenced for nearly full-length 16S rRNA gene (Figure 3). Below are detailed descriptions of the individual clone libraries.
CCSD_DF2290 (2290m) The clone sequences from this sample clustered into 4 major lineages: Betaproteobacteria Gammaproteobacteria, Actinobacteria, and Firmicutes (Figure 6). One group of clones was related to (89-98% similarity) a cultured organism Tepidiphilus margaritifer, an aerobic moderately thermophilic bacterium (Manaia et al. 2003). Another group was closely-related to (97-99% similarity) an anaerobic, mesophilic, fermentative, and benzaldehyde-converting bacterium Soehngenia saccharolytica (Parshina et al. 2003). One sequence (CCSD_DF2290_B4) was closely-related to (>99% similarity) a bacterial clone from ultra-deep gold mines of South Africa (AF486687) (Baker et al. 2003). Another sequence (CCSD_DF2290_B6) was related to (97% similarity) Anaerobranca californiensis, an obligately anaerobic, alkalithermophilic, chemo-organotrophic bacterium (Gorlenko et al. 2004). The species of A. californiensis
62 have been shown to anaerobically reduce Fe(III) and Se(IV) in the presence of organic matter and to grow optimally at pH 9.0–9.5 and temperature of 58°C. These conditions were similar to the measured pH of 9.2 and the in-situ temperature of 43-59°C for this sample. One sequence was related to a bacterial clone from Mammoth hot springs in Yellowstone National Park, USA (uncultured bacterium SM2E10) (AF445726).
CCSD_DF2450 (2450 m) The 16S rRNA gene sequences from this sample clustered into a single bacterial lineage: Firmicutes (Figure 6). The most abundant group of clone sequences (7 sequences) clustered together with various similarities to Bacillus macyae sp. JMM-4. JMM-4 was isolated from a gold mine (Santini et al. 2004) and is a strictly anaerobic arsenate-respiring bacterium capable of respiration with arsenate and nitrate as terminal electron acceptors using a variety of electron donors. In addition to the clone type closely related to Bacillus macyae, the second most abundant group of clones was 97% similar to Halobacillus salinus. H. salinus, which grows optimally in the presence of 2–10% (w/v) NaCl, was isolated from a salt lake (Yoon et al. 2003). One sequence (CCSD_DF2450_B12) was closely related to (99% similarity) Paraliobacillus ryukyuensis, an extremely halotolerant facultative anaerobe (Ishikawa et al. 2002). Three sequences were related to (96% similarity) a strictly anaerobic chemoorganotrophic bacterium (Alkaliphilus transvaalensis) isolated from a mine water containment dam at 3200 mbls in a South African gold mine (Takai et al. 2001). A. transvaalensis grows optimally at 40°C and pH 10. One sequence was closely related to (>99% similarity) Caldicellulosiruptor lactoaceticus, and three others were closely related to (>99% similarity) Thermoanaerobacter ethanolicus (Figure 6). C. lactoaceticus is a thermophilic, anaerobic bacterium that ferments cellulose and produces lactate, acetate and H2 as the major fermentation products with an optimum growth temperature of 68°C (Mladenovska et al. 1995). T. ethanolicus is a thermophilic, non-spore-forming anaerobic bacterium isolated from many terrestrial hot springs and deep subsurface (Wiegel and Ljungdahl 1981; Lacis and Lawford 1985; Roh et al. 2002). Some strains of this species are capable of using acetate, lactate, and H2 as electron donors and Fe(III), Co(III),
63 Mn(IV) and U(VI) as electron acceptors (Roh et al. 2002). Growth occurs between 37 and 78°C and over a pH range of 4.4 to 9.8 (Wiegel and Ljungdahl 1981).
CCSD_DF2700 (2700 m) Twenty-three clone sequences from CCSD_DF2700 clustered into 3 major lineages of bacteria: Gammaproteobacteria, Actinobacteria, and Firmicutes (Figure 6). In Gammaproteobacteria, one sequence (CCSD_DF2700_B8) showed 99% similarity to a known deep subsurface isolate Pseudomonas sp. SMCC isolate B0628 (Vepritskiy et al. 2002). In the Firmicutes, in addition to A. transvaalensis, and B. macyae present in CCSD_DF2450, several novel clone types appeared in this sample. Three sequences were closely related to (97-98% similarity) Virgibacillus halodenitrificans, a moderately halophilic, anaerobic, nitrate-reducing bacterium (Denariaz et al. 1989; Yoon et al. 2004). Two sequences were related to (97% similarity) Anaerobranca gottschalkii, a thermoalkaliphilic, obligately anaerobic bacterium that grows at high pH (9.5) and temperature (55oC) (Prowe and Antranikian 2001). One clone sequence (CCSD_DF2700_B20) was moderately related to (95% similarity) an obligately anaerobic, alkaliphilic bacterium Alkalibacter saccharofermentan with the optimum pH of 9.0 (Garnova et al. 2004).
CCSD_DF_2950 (2950 m) The 16S rRNA gene sequences in this sample clustered into four lineages of bacteria: Epsilonproteobacteria, Gammaproteobacteria, Actinobacteria and Firmicutes (Figure 6). In the Firmicutes, one group of clone sequences was related to (~95% similarity) A. transvaalensis from South Africa ultra-deep gold mines. Sequences similar to A. gottschalkii, B. macyae and uncultured bacterium Clostridium sp. clone PSB-M-2 were also present. One sequence was closely related to (98% similarity) Soehngenia saccharolytica. One sequence in Gammaproteobacteria was closely related to (>99% similarity) an uncultured bacterium clone MB-A2-102 from methane hydrate-bearing deep marine sediments in a Forearc Basin (Reed et al. 2002). Three sequences showed moderate similarity (96%) to a facultative anaerobic bacterium Corynebacterium casei (Brennan et al. 2001).
64
CCSD_DF3200 (3200 m) Twenty-one 16S rRNA gene sequences from this sample phylogentically clustered into Betaproteobacteria, Gammaproteobacteria, and Firmicutes (Figure 6). In addition to those present in the previous drilling fluids, there emerged several new clone types. There were three major groups: one group (6 sequences) was closely related to (98% similarity) Halomonas nitritophilus; another group (5 sequences) closely (98% similarity) to Paraliobacillus ryukyuensis; and the other (4 sequences) to an unidentified Hailar soda lake bacterium F27 (AF275703). All three closely-related reference sequences have been isolated in saline alkali environment. P. ryukyuensis is an extremely halotolerant, alkaliphilic, and facultatively anaerobic rod bacterium (Ishikawa et al. 2002).
CCSD_DF3350 (3350 m) The 16S rRNA gene sequences of this sample clustered into only one lineage of bacteria: the Firmicutes (Figure 6). Thirteen of twenty-four sequences were related to Anaerobranca gottschalkii, with similarities ranging from 80 to 96%. In addition to halophilic or alkaliphilic P. ryukyuensi, A. transvaalensis, and A. saccharofermentan, there was emergence of new clone types. One sequence was closely related (98% similarity) to an anaerobic, obligate alkaliphile, Bacillus vedderi (Agnew et al. 1995). One sequence was moderately (96%) related to an uncultured bacterium SHA-61 from an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from the sediment of River Saale, Germany (Schloetelburg et al. 2002).
Archaeal Diversity The archaeal diversity was much lower, and the majority (133 clones) of the archaeal sequences clustered into two groups within the Euryarchaeota and three groups within the Crenarchaeota (Figure 7). Sequences from different libraries (CCSD_DF2290 through CCSD_DF3350) clustered together. The majority of the archaeal 16S rRNA gene sequences clustered into the Marine Benthic Group-D (as defined by Vetriani et al. 1999) of the Euryarchaeota and were closely related to (95-98% similarity) uncultured
65 euryarchaeon clones recovered from methanogenic communities in marine sediments (Hinrichs et al. 1999; Inagaki et al. 2003) and methane-consuming marine sediments (AF134389). One sequence (CCSD_DF2700_A24) was closely related to (98.5%) Methanobacterium thermoautotrophicum, a thermophilic methanogen (Mori et al. 2000). In the Crenarchaeota, thirteen sequences formed one cluster belonging to the Deep-Sea Archaeal Group (DSAG) (Inagaki et al. 2003). These sequences were related to anaerobic methanotrophic communities in deep-sea sediments from Japan Trench and Nankai Trough (Newberry et al. 2004), and sediments in sulfide and methane-rich cold seep environment (AY769057). Nine sequences formed another cluster with the Marine Group I crenarchaeota (Takai and Horikoshi 1999) and were related to deep-sea hydrothermal vent and mud volcanoes clones (AY592231). The third group (eight sequences) was closely-grouped with the soil crenarchaeota group (AY016470).
DISCUSSION Contamination Issue Most of our bacterial isolates and clone sequence identities indicated anaerobic, thermophilic, alkaliphilic and halophilic nature. These features were distinct from the expected aerobic, mesophilic and neutrophilic nature of surface-derived microbes, suggesting that the detected microorganisms were likely to have originated from the deep subsurface. The initial drilling fluids must have contained various surface microorganisms derived from make-up constituents of the drilling fluids, but the deep extreme subsurface environments (hot, anoxic, high pH and saline) through which the drilling fluids circulated would have tended to favor indigenous, subsurface-adapted microorganisms. However, some surface-derived microbes may have survived this process, and so it is likely that our clone libraries contained a mixture of contaminant and indigenous microorganisms. Overall, the unique phylogenetic character and community composition indicated by the libraries from the deep samples suggests that at least some of the clones were from the deep subsurface.
Isolate Characteristics
66 CCSD_DF2290_FW60_isolate1 was moderately related to (95% similarity) Soehngenia saccharolytica, and was detected in the CCSD_DF2290 bacterial clone library as a main group. S. saccharolytica is an anaerobic, benzaldehyde-converting bacterium which grows between 15 and 40°C and cannot use Fe(III) as an electron acceptor (Parshina et al. 2003). The CCSD_DF2290_FW60_isolate1 was an obligately anaerobic and thermophilic bacterium. It was able to use short-chain fatty acids as electron donors and two-line ferrihydrite as an electron acceptor to form siderite and vivianite. These physiological characteristics of the new isolate were different from those of S. saccharolytica. The 16S rRNA gene of the new isolate was different from that of S. saccharolytica at the genus level (>5% difference). Therefore, the new isolate may belong to a new genus (Figure 3). Six isolates of thermophilic Fe(III)-reducing bacteria from sample CCSD_DF2450 (e.g., CCSD_DF2450_M1_68_isolate1 etc.) were phylogeneticly related to (98-99% similarity) Thermoanaerobacter ethanolicus. Certain physiological characteristics of the CCSD_DF2450_M1_68 isolates were similar to those of several strains of a non-spore-forming anaerobic bacterium T. ethanolicus, for their ability to reduce Fe(III) in solid minerals and mineral transformations (Roh et al. 2002). Our isolates were capable of reducing Fe(III) in the nontronite structure with consequent formation of illite layers (Fig. 5c). However, further characterizations will be necessary to determine if the newly formed illite layers were collapsed, high-charge smectite, or neoformed illite with different composition and structure. This distinction can be made using imaging techniques such as high-resolution transmission electron microscopy (Kim et al. 2004). In the control, neither Fe(III) reduction nor mineral transformation occurred. Based on the discussions above, we conclude that the new isolates were different strains of T. ethanolicus. Our new isolates and those obtained previously by Roh et al. (2002) may not be same, however. The CCSD_DF2450_M1_68 isolates were able to use short fatty acids (such as lactate and acetate) as electron donors and Fe(III) in the nontronite structure as electron acceptor. Roh et al. (2002) did not test whether their isolates were able to reduce Fe(III) in clay minerals. Further characterization is currently underway and important differences may be revealed in the future.
67
Change of Microbial Diversity with depth Phylogenetic analyses of 16S rRNA gene sequences from the drilling fluid samples collected at different depths revealed significant changes in bacterial diversity with depth (Figure 8). The frequency of 16S rRNA gene clones should be regarded as qualitative information on the community composition. Nonetheless, 16S rRNA gene sequence libraries provided valuable information about microbial diversity that allowed qualitative comparisons between communities from different environments. The drilling fluids from all six depths were dominated by bacterial sequences belonging to the lineage of the Firmicutes. In contrast, the drilling fluids from the shallow depth (500 to 2030 m) were dominated by bacterial sequences belonging to the Proteobacteria (Zhang et al. 2005), suggesting, as has been previously reported (Baker et al. 2003; Moser et al. 2003), that the Firmicutes often predominate in the terrestrial deep subsurface. The archaeal 16S rRNA gene sequences in the shallow drilling fluids all clustered into the Crenarchaeota (Zhang et al. 2005), but those from the deeper drilling fluids (CCSD_DF2290 to CCSD_DF3350) were distributed between the Crenarchaeota and the Euryarchaeota with the majority of the clone sequences (82%) belonging to the Euryarchaeota. These data showed that the archaeal diversity increased with depth, an indication that the detected archaeal community was not contamination from the surface. The archaeal sequences were mainly related to uncultured archaea from methane-rich environments, suggesting that methanogenic and/or methanotrophic communities may be one of main archaeal components in these fluids. The presence of clone sequences related to methanogenic/methanotrophic archaea was consistent with detection of methane gas (up to 1.4% by weight) in the drilling fluids by real-time gas chromatography (data not shown).
Correlation Between Geology and Microbiology The affiliation of clone types with known Fe(III) reducing-bacteria (such as A. californiensis, T. ethanolicus) and acquisition of Fe(III) reducing isolates suggest the presence of Fe(III) reducing activity in the samples. Typical growth conditions for A.
68 californiensis and T. ethanolicus are anaerobic with high pH (pH optimum > 8.5) and high temperature (45-67°C and 37-78°C for the two bacteria, respectively). These conditions were consistent with the measured alkaline pH and the calculated in-situ temperature (43-87°C) of the corresponding drilling fluid samples. The presence of Fe(III)-bearing minerals (such as chlorite) in metamorphic rocks and organic matter (i.e.
CH4, C2H6, C3H8, and C4H10) in the geological fluids (Luo et al. 2004) may have served as electron acceptors and donors to support these Fe(III) reducing bacteria. Indeed, iron- reducing bacteria were successfully enriched when a metamorphic mineral chlorite was used as an electron acceptor in M1 medium (data not shown). Many clone sequences were affiliated with fermentative C. lactoaceticus and A. gottschalkii. C. lactoaceticus is an anaerobic, thermophilic (optimum temperature 68°C), and non-spore-forming bacterium (Mladenovska et al. 1995). A. gottschalkii is a thermoalkaliphilic and obligately anaerobic bacterium (Prowe and Antranikian 2001). These growth conditions were also consistent with the in-situ environmental conditions.
Luo et al (2004) reported the presence of hydrocarbons, such as CH4, C2H6, C3H8, and,
C4H10, and they may serve as sources for fermentative activity of these bacteria. A few clone sequences were related to either halotolerant or halophilic bacteria (such as P. ryukyuensi) that were previously found in saline environments (Ishikawa et al. 2002). However, the measured salinity in the drilling fluids was low, which is inconsistent with the halotolerant or halophilic nature of the above bacteria. This apparent inconsistency may be caused by dilution of saline geological fluids by the circulating drilling fluids. It was not possible to directly measure salinity of any geological fluids that may have harbored the detected microbial community. In the archaeal community, the presence of a clone sequence in one drilling fluid sample that was related to the thermophilic methanogen M. thermoautotrophicum with the optimum growth temperature of 60°C (Mori et al. 2000) was consistent with the in- situ temperature of the corresponding drilling fluid sample (51-70oC). The majority of the archaeal clone sequences were related to uncultured sequences recovered from methanogenic communities in marine sediments, and their growth habitats could not be predicted.
69 Our combined results from a previous study (Zhang et al. 2005) and the present one suggest that there was a large shift of the microbial community structure in the drilling fluids from 2030 m and 2290 m depth. This shift appears to correspond to the occurrence of ductile shear belts and cataclastic zones from 2109 to 2284m depth (http://www.icdp-online.de/sites/donghai/news/news.html). Fractures, faults, and ductile shear zones may have controlled migration of geological fluids/gases and subsequently, the transport of subsurface microbes. These geological structures may contain large amounts of geological fluids with sufficient space and nutrients for microbes to live.
CONCLUSIONS Drilling fluid is often regarded as a contamination source during investigations of deep subsurface microbiology, but it is also a vector for the sampling of geological fluids and possibly microbial life from such environments. Our geochemical and microbiological investigations of the drilling fluids that circulated within a deep borehole (down to 3350 m) suggest the presence of unique, depth-associated microbes, including anaerobic, thermophilic, alkaliphilic, halotolerant or halophilic Fe(III) reducers, fermenters, and possibly methanogens/methanotrophs. These growth habitats were distinct from those of surface-derived microbes, which often exhibit an aerobic, mesophilic, and neutrophilic habit. The unique growth habitats intersected here were consistent with the geochemical characteristics of the drilling fluids, which may have incorporated geological fluids/gases from the deep subsurface and partly reflect the in- situ conditions, such as reducing, hot, alkaline, and saline environments. These results have important implications for enhancing our understanding of deep biosphere in terrestrial continental crust.
ACKNOWLEDGMENT The investigators would like to thank Jingsui Yang, Zeming Zhang, Tianfu Li, Fulei Liu, Shizhong Chen and other field crew members for their hard work in collecting the samples. The CCSD project provided partial support for the field operations (973 project: 2003CB 716508). We are grateful to Chris Wood at the Center for Bioinformatics and Functional Genomics at Miami University for his technical support.
70 We thank John Morton for his help in cation and anion analyses. This work was supported by grants EAR-0201609 and EAR-0345307 from the National Science Foundation and a Research Challenge grant from the Ohio Board of Regents to HD. An internal grant from Miami University (Hampton fund) and grants from National Science Foundation of China (40228004, 40472064) provided further support. A student grant from the Geological Society of America to GZ provided partial support for materials and supplies. We are grateful to two anonymous reviewers and editor Dr. Duane Moser for their constructive comments.
REFERENCES Agnew MD, Koval SF, Jarrell, KF. 1995. Isolation and Characterization of Novel Alkaliphiles from Bauxite-Processing Waste and Description of Bacillus-Vedderi Sp-Nov, a New Obligate Alkaliphile. Syst. Appl. Microbiol 18:221-230. Baker BJ, Moser DP, MacGregor BJ, Fishbain S, Wagner M, Fry NK, Jackson B, Speolstra N, Loos S, Takai K, Lollar BS, Fredrickson J, Balkwill D, Onstott TC, Wimpee CF, Stahl DA. 2003. Related assemblages of sulphate-reducing bacteria associated with ultradeep gold mines of South Africa and deep basalt aquifers of Washington State. Environ. Microbiol 5:267-277. Balashov VN, Zaraisky GP, Seltmann R. 2000. Fluid-magma interaction and oscillatory phenomena during crystallization of granitic melt by accumulation and escape of water and fluorine. Petrology 8:505-524. Balkwill DL, Leach FR, Wilson JT, McNabb JF, White DC. 1988. Equivalence of Microbial Biomass Measures Based on Membrane Lipid and Cell-Wall Components, Adenosine-Triphosphate, and Direct Counts in Subsurface Aquifer Sediments. Microb. Ecol.16:73-84. Bottomley PJ. 1994. Light microscopic methods for studying soil microorganisms. In R.W. Weaver, Ed. Methods of Soil Analysis, Part 2. Microbiological and biochemical Properties-SSSA Book Series, no. 5, p. 81-105. Soil Science Society of American Publisher, Madison, WI.
71 Brennan NM, Brown R, Goodfellow M, Ward AC, Beresford TP, Simpson PJ, Fox PF, Cogan TM. 2001. Corynebacterium mooreparkense sp nov and Corynebacterium casei sp nov., isolated from the surface of a smear-ripened cheese. Int. J. Syst. Evol. Microbiol 51:843-852. Christidis GE, Eberl DD. 2003. Determination of layer-charge characteristics of smectites. Clays Clay Miner 51:644-655. DeLong EF. 1992 Archaea in coastal marine environments. Proc. Nat. Acad. Sci. 89: 5685-5689. Denariaz G, Payne WJ, Legall, J. 1989. A Halophilic Denitrifier, Bacillus- Halodenitrificans Sp-Nov. Int. J. Syst. Bacteriol 39:145-151. Garnova ES, Zhilina TN, Tourova TP, Kostrikina NA, Zavarzin GA. 2004. Anaerobic, alkaliphilic, saccharolytic bacterium Alkalibacter saccharofermentans gen. nov., sp nov from a soda lake in the Transbaikal region of Russia. Extremophiles 8:309- 316. Garrity GM. 2001. Bergey's manual of systematic bacteriology. Springer-Verlag, New York, N.Y. Gates WP, Jaunet AM, Tessier D, Cole MA, Wilkinson HT, Stucki JW 1998. Swelling and texture of iron-bearing smectites reduced by bacteria. Clays Clay Miner 46:487-497. Ghiorse, WC, Balkwill DL. 1983. Enumeration and morphological characterization of bacteria indigenous to subsurface sediments. Dev. Ind. Microbiol. 24:213-224. Gorlenko V, Tsapin A, Namsaraev Z, Teal T, Tourova T, Engler D, Mielke R, Nealson, K. 2004. Anaerobranca californiensis sp nov., an anaerobic, alkalithermophilic, fermentative bacterium isolated from a hot spring on Mono Lake. Int. J. Syst. Evol. Microbiol 54:739-743. Guckert JB, Hood MA, White, DC. 1986. Phospholipid ester-linked fatty acid profile changes during nutrient deprivation of Vibrio cholerae: increases in the trans/cis ratio and proportions of cyclopropyl fatty acids. Appl. Environ. Microbiol 52:794- 801. Hinrichs KU, Hayes JM, Sylva SP, Brewer PG, DeLong, EF. 1999. Methane-consuming archaebacteria in marine sediments. Nature 398:802-805.
72 Inagaki F, Suzuki M, Takai K, Oida H, Sakamoto T, Aoki K, Nealson KH, Horikoshi K. 2003. Microbial Communities Associated with Geological Horizons in Coastal Subseafloor Sediments from the Sea of Okhotsk. Appl. Environ. Microbiol 69: 7224-7235. Ishikawa M, Ishizaki S, Yamamoto Y, Yamasato K. 2002. Paraliobacillus ryukyuensis gen. nov., sp nov., a new Gram- positive, slightly halophilic, extremely halotolerant, facultative anaerobe isolated from a decomposing marine alga. J. Gen. Appl. Microbiol 48:269-279. Ivanova GF, Kolesov GM, Cherkasova EV. 1995. Ree in Granites, Topazes, and Fluorites of Tungsten-Ore Mongolian Regions. Geokhimiya 8:1157-1177. Jaisi DP, Kukkadapu RK, Eberl DD, Dong H. 2005. Control of Fe(III) site occupancy on the rate and extent of microbial reduction of Fe(III) in nontronite. Geochim. Cosmochim. Acta In press. Kashefi K, Tor JM, Holmes DE, Van Praagh CVG, Reysenbach AL, Lovley DR. 2002. Geoglobus ahangari gen. nov., sp nov., a novel hyperthermophilic archaeon capable of oxidizing organic acids and growing autotrophically on hydrogen with Fe(III) serving as the sole electron acceptor. Int. J. Syst. Bacteriol 52:719-728. Kim J, Dong H, Seabaugh J, Newell S, Eberl D. 2004. Role of microbes in the smectite- illite reaction. Science 303:830-832. Kostka JE, Nealson KH. 1998. Isolation, cultivation, and characterization of iron- and manganese-reducing bacteria. In R.S. Burlage, Ed. Techniques in Microbial Ecology, p. 58-78. Oxford University Press, Oxford. Lacis LS, Lawford, HG. 1985. Thermoanaerobacter-Ethanolicus in a Comparison of the Growth Efficiencies of Thermophilic and Mesophilic Anaerobes. J. Bacteriol. 163:1275-1278. Lane DJ. 1985 16S/23S rRNA sequencing. In E. Stackebrandt, and M. Goodfellow, Eds. Nucleic Acid Techniques in Bacterial Systematics. New York: Wiley. Liu SV, Zhou JZ, Zhang CL, Cole DR, Gajdarziska-Josifovska M, Phelps TJ. 1997). Thermophilic Fe(III)-reducing bacteria from the deep subsurface: The evolutionary implications. Science 277:1106-1109.
73 Lovley DR, Philips EJP. 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl. Environ. Microbiol 54:1472-1480. Lovley DR, Phillips EJP. 1986. Organic-Matter Mineralization with Reduction of Ferric Iron in Anaerobic Sediments. Appl. Environ. Microbiol 51:683-689. Luo L, Sun Q, Zhan, X. 2004. 0-2000 m fluid profiles and sources in Chinese Continental Scientific Drilling Project. Acta Petrol. Sinica 20:185-191. Manaia CM, Nogales B, Nunes OC. 2003. Tepidiphilus margaritifer gen. nov., sp nov., isolated from a thermophilic aerobic digester. Int. J. Syst. Evol. Microbiol 53:1405-1410. Mladenovska Z, Mathrani IM, Ahring BK. 1995. Isolation and Characterization of Caldicellulosiruptor Lactoaceticus Sp-Nov, an Extremely Thermophilic, Cellulolytic, Anaerobic Bacterium. Arch. Microbiol. 163:223-230. Mori K, Hatsu M, Kimura R, Takamizawa K. 2000. Effect of heavy metals on the growth of a methanogen in pure culture and coculture with a sulfate-reducing bacterium. J. Biosci. Bioeng. 90:260-265. Moser DP, Onstott TC, Fredrickson JK, Brockman FJ, Balkwill DL, Drake GR, Pfiffner SM, White DC, Takai K, Pratt LM, Fong J, Sherwood-Lollar BS, Slater G, Phelps TJ, Spoelstra N, Deflaun M, Southam G, Welty AT, Baker BJ, Hoek, J. 2003. Temporal shifts in the geochemistry and microbial community structure of an ultradeep mine borehole following isolation. Geomicrobiol. J 20:517-548. Newberry CJ, Webster G, Cragg BA, Parkes RJ, Weightman AJ, Fry JC. 2004. Diversity of prokaryotes and methanogenesis in deep subsurface sediments from the Nankai Trough, Ocean Drilling Program Leg 190. Environ. Microbiol 6:274-287. Ong YL, Razatos A, Georgiou G, Sharma MM. 1999. Adhesion forces between E. Coli bacteria and biomaterial surfaces. Langmuir 15:2719-2725. Onstott TC, Moser DP, Pfiffner SM, Fredrickson JK, Brockman FJ, Phelps TJ, White DC, Peacock A, Balkwill D, Hoover R, Krumholz LR, Borscik M, Kieft TL, Wilson R. 2003. Indigenous and contaminant microbes in ultradeep mines. Environ. Microbiol 5:1168-1191.
74 Parshina SN, Kleerebezem R, Sanz JLS, Lettinga G, Nozhevnikova AN, Kostrikina NA, Lysenko AM, Stams AJM. 2003. Soehngenia saccharolytica gen. nov., sp nov and Clostridium amygdalinum sp nov., two novel anaerobic, benzaldehyde- converting bacteria. Int. J. Syst. Evol. Microbiol 53:1791-1799. Prowe SG, Antranikian G. 2001. Anaerobranca gottschalkii sp nov., a novel thermoalkaliphilic bacterium that grows anaerobically at high pH and temperature. Int. J. Syst. Evol. Microbiol 51:457-465. Reed DW, Fujita Y, Delwiche ME, Blackwelder DB, Sheridan PP, Uchida T, Colwell FS. 2002. Microbial communities from methane hydrate-bearing deep marine sediments in a forearc basin. Appl. Environ. Microbiol 68:3759-3770. Ringelberg DB, Townsend GT, DeWeerd KA, Sulita JM, White, DC. 1994. Detection of the anaerobic dechlorinating microorganism Desulfomonile tiedjei in environmental matrices by its signature lipopolysaccharide branch-long-chain hydroxy fatty acids. FEMS Microbiol. Ecol 14:9-18. Roh Y, Liu SV, Li GS, Huang HS, Phelps TJ, Zhou, JZ. 2002. Isolation and characterization of metal-reducing Thermoanaerobacter strains from deep subsurface environments of the Piceance Basin, Colorado. Appl. Environ. Microbiol 68:6013-6020. Santini JM, Streimann ICA, Vanden Hoven, RN. 2004. Bacillus macyae sp. nov., an arsenate-respiring bacterium isolated from an Australian gold mine. Int. J. Syst. Evol. Microbiol 54:2241-2244. Schloetelburg C, von Wintzingerode C, Hauck R, von Wintzingerode F, Hegemann W, Goebel, UB. 2002. Microbial structure of an anaerobic bioreactor population that continuously dechlorinates 1,2-dichloropropane. FEMS Microbiol. Ecol 39:229- 237. Schwertmann U, Cornell RM. 2000. Iron oxides in the laboratory; preparation and characterization. 206 pp. Smith DC, Spivack AJ, Fisk MR, Haveman SA, Staudigel, H. 2000. Tracer-based estimates of drilling-induced microbial contamination of deep sea crust. Geomicrobiol. J 17:207-219.
75 Stookey LL. 1970. Ferrozine-a new spectrophotometric reagent for iron. Anal. Chem 42:779-781. Takai K, Horikoshi K. 1999. Genetic diversity of archaea in deep-sea hydrothermal vent environments. Genetics 152: 1285-1297. Takai K, Mormile MR, McKinley JP, Brockman FJ, Holben WE, Kovacik WP, Fredrickson JK. 2003. Shifts in archaeal communities associated with lithological and geochemical variations in subsurface Cretaceous rock. Environ. Microbiol 5:309-320. Takai K, Moser DP, Onstott TC, Spoelstra N, Pfiffner SM, Dohnalkova A, Fredrickson, JK. 2001. Alkaliphilus transvaalensis gen. nov., sp nov., an extremely alkaliphilic bacterium isolated from a deep South African gold mine. Int. J. Syst. Evol. Microbiol 51:1245-1256. Vepritskiy AA, Vitol IA, Nierzwicki-Bauer SA. 2002. Novel group I intron in the tRNA(Leu)(UAA) gene of a gamma-proteobacterium isolated from a deep subsurface environment. J. Bacteriol 184:1481-1487. Vetriani C, Jannasch HW, MacGregor BJ, Stahl DA, Reysenbach AL. (1999) Population structure and phylogenetic characterization of marine benthic archaea in deep-sea sediments. Appl. Environ. Microbiol 65:4375-4384. Wang JY, Hu SB, Yang WC, Chen BH, Chen ZY, Li, TJ. 2001. Geothermal measurements in the pilot-boreholes of the China Continental Scientific Drilling. Chinese Sci. Bull 46:1745-1748. White DC, Davis WM, Nickels JS, King JD, Bobbie, RJ. 1979. Determination of the sedimentary microbial biomass by extractable lipid phosphate. Oecologia 40:51- 62. Wiegel J, Ljungdahl LG. 1981. Thermoanaerobacter-Ethanolicus Gen-Nov, Spec-Nov, a New, Extreme Thermophilic, Anaerobic Bacterium. Arch. Microbiol 128:343-348. Yoon JH, Kook HKG, Park YH. 2003. Halobacillus salinus sp nov., isolated from a salt lake on the coast of the East Sea in Korea. Int. J. Syst. Evol. Microbiol 53:687- 693.
76 Yoon JH, Oh TK, Park YH. 2004. Transfer of Bacillus halodenitrificans Denariaz et al. 1989 to the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov. Int. J. Syst. Evol. Microbiol 54:2163-2167. Zhang G, Dong H, Xu Z, Zhao D, Zhang C. 2005. Bacterial Diversity in Ultra-high Pressure Metamorphic Rocks From the Dabie-Sulu Orogen in China. Appl. Environ. Microbiol. 71:3213-3227. Zheng YF, Fu B, Gong B, Li L. 2003. Stable isotope geochemistry of ultrahigh pressure metamorphic rocks from the Dabie-Sulu orogen in China: implications for geodynamics and fluid regime. Ear.-Sci. Rev 1276:1-57.
77 Table 1. Anion and cation composition, pH, salinity and in-situ temperature for the drilling fluid samples
In-situ
Salinity temp.
Sample (depth, m) F Cl NO3 SO4 Li Na K Mg Ca NH4 pH (%) (°C)
CCSD_DF2290 (2290) 4.41 201.51 9.63 95.21 0.73 1216 29.13 14.52 81.83 26.97 9.2 2.45 43-59
CCSD_DF2450 (2450) 5.07 351.62 9.89 118.01 0.28 1678 42.43 4.83 23.50 6.99 9.4 2.50 46-63
CCSD_DF2700 (2700) 5.95 582.77 7.33 213.31 0.14 2877 46.24 4.58 29.83 10.05 9.3 3.30 51-70
CCSD_DF2950 (2950) 8.00 679.22 7.84 74.21 0.20 2994 59.51 2.55 20.50 4.70 9.5 2.42 56-76
78 CCSD_DF3200 (3200) 177.36 469.63 9.21 143.93 0.08 2880 29.62 1.35 24.56 9.90 9.2 2.69 60-83
CCSD_DF3350 (3350) 76.44 367.52 11.63 94.76 0.09 2720 38.64 1.17 27.60 9.37 9.4 2.05 63-87
The unit for all the anion and cation concentrations is μg/g. pH and salinity were measured from each of the drilling fluid samples using YSI probes. The in-situ temperature was calculated based on the measured geothermal gradient (Wang et al., 2001). FIGURE CAPTIONS
Figure 1. A map showing the general geology and the drill site in the Dabie-Sulu region of Central-Eastern China. NCB and SCB in the inset denote the North China Block (a part of the Sino-Korean plate) and South China Block. The drilling site is the circle labeled Donghai. After Zheng et al. (2003).
Figure 2. PLFA profiles for the drilling fluid samples. PLFA groupings were normal saturates (Nsat), mid-branched saturates (MBSat), terminally branched saturates (TBSat), branched monounsaturates (Bmono), monounsaturates (Mono), and polyunsaturates (Poly).
Figure 3. Neighbor-joining tree of nearly full-length sequences (~1400 bp) of isolates and representative examples of bacterial clone sequences. Scale bar = 0.05 nucleotide substitution per site. The designation for the isolates are as follows, with CCSD_DF2290_M1_68_isolate1 as an example: CCSD, Chinese continental scientific drilling; DF2290, drilling fluid sample from 2290 meter depth; M1_68, M1 medium with incubation temperature of 68oC; isolate1, isolate number. Thus, this isolate was obtained from the CCSD project, drilling fluid sample from depth 2290 m, using M1 medium at 68oC.
Figure 4. (a) Production of biogenic Fe(II) with time as measured by the 0.5 N HCl- extractable Fe(II) in the ferrihydrite control (no cells added) and in the experimental treatment (ferrihydrite and CCSD_DF2290_FWA_60_ isolate1 in the FWA-Fe(III) medium at 60oC). The initial amount of Fe(II) (~2 mM) at time 0 was attributed to reduction of Fe(III) in ferrihydrite by a reducing agent
(cysteine) which was added to remove a trace amount of O2 in the medium. (b) XRD patterns of the control and bioreduced ferrihydrite. The control shows typical two broad peaks corresponding to two-line ferrihydrite. The presence of goethite in the bioreduced sample suggests that two-line ferrihydrite may be abiotically transformed to goethite through a dehydration process during
79 incubation (Schwertmann and Cornell 2000). This likely occurred due to the high experimental temperature (>45°C) used in the incubations (Roh et al. 2002).
Figure 5. (a) Production of biogenic Fe(II) with time as measured by the 0.5 N HCl- extractable Fe(II) in the nontronite control (nontronite only, no cells added) and in the experimental treatment (nontronite and CCSD_DF2450_M1_68_ isolate6 cells in the M1 medium at 68oC). (b) Measured and calculated XRD patterns of glycolated oriented nontronite control. The calculated XRD pattern was obtained with NEWMOD and the LayerCharge (Christidis and Eberl 2003) programs assuming 100% nontronite. The good match illustrates that the control material consisted of pure nontronite only. (c) Measured and calculated XRD patterns of glycolated oriented bioreduced nontronite. The calculated pattern was obtained using the same programs and assuming 60% nontronite and 40% illite. The good match illustrates that there was 40% illite layers and 60% nontronite layers in the bioreduced nontronite sample.
Figure 6. Phylogenetic relationships of representative phylotypes of bacterial 16S rRNA gene sequences as determined by the neighbor-joining method. Scale bar = 0.05 nucleotide substitution per site. Phyla were determined by using classification in the Bergey’s Manual of Systematic Bacteriology (Garrity 2001). Aquifex pyrophilus was used as an outer group. For a group of sequences with high similarity to each other, only one representative sequence is shown.
Figure 7. Phylogenetic relationships of representative phylotypes of archaeal 16S rRNA gene sequences as determined by the neighbor-joining method. Scale bar = 0.1 nucleotide substitution per site. Again, for a group of sequences with high similarity to each other, only one representative sequence is shown.
Figure 8. Stacked bar graph showing the contribution of each family of bacteria in the clone libraries for the drilling fluid samples.
80
Zhang et al. Figure 1
81
100%
TBSat 80% Poly
60% Nsat
40% MBSat
Mole % PLFA Bmono 20% Mono
0% CCSD_DF2290 CCSD_DF2950 CCSD_DF3350
Zhang et al. Figure 2
82
91 Corynebacterium casei AF267152 100 Corynebacterium argentoratense AF537589 99 CCSD_DF2950_B22 DQ128255 Actinobacteria CCSD_DF2950_B18 DQ128254 CCSD_DF2450_M1_68_isolate1 DQ128178 81 CCSD_DF2450_ M1_68_isolate2 DQ128183 Thermoanaerobacter ethanolicus L09164 CCSD_DF2450_B1 DQ128246 62 CCSD_DF2450_ M1_68_isolate3 DQ128182 CCSD_DF2450_ M1_68_isolate4 DQ128181 58 51 CCSD_DF2450_ M1_68_isolate5 DQ128179 100 Thermoanaerobacter ethanolicus AF542517 82 100 Thermoanaerobacter ethanolicus AF542519 CCSD_DF2450_ M1_68_isolate6 DQ128177 63 Thermoanaerobacter ethanolicus AF542520 Caldicellulosiruptor lactoaceticus X82842 100 CCSD_DF2450_B4 DQ128247 50 100 CCSD_DF2700_B24 DQ128251 Anaerobranca gottschalkii AF203703 100 CCSD_DF2290_B22 DQ128245 Firmicute 71 100 CCSD_DF2290_ FWA_60_isolate1 DQ128180 Soehngenia saccharolytica AY353956 99 CCSD_DF2290_B16 DQ128244 97 Fusibacter sp. SA1 AF491333 54 63 Clostridium felsineum X77851 81 CCSD_DF2950_B4 DQ128252 100 Alkaliphilus transvaalensis AB037677 CCSD_DF2700_B18 DQ128250 Clostridium sp. 9B4 AY554416 66 100 CCSD_DF2700_B13 DQ128249 Amphibacillus sp. YIM-kkny 6 AY121432 99 Bacillus pseudofirmus AF406790 unidentif ied Hailaer soda lake bacterium F1 AF275700 85 100 CCSD_DF2950_B6 DQ128253 74 Alkalibacterium olivapovliticus AF143512 100 Delftia acidovorans AB020186 96 Curvibacter lanceolatus AB021390 99 Janthinobacterium sp. HHS7 AJ846272 Betaproteobacteria 77 CCSD_DF2290_B14 DQ128243 100 Beta proteobacterium HMD444 AB015328 CCSD_DF3200_B9 DQ128257 100 Stenotrophomonas maltophilia AY040357 100 Thialkalivibrio thiocyanodenitrificans AY360060 100 CCSD_DF3200_B17v DQ128258 66 Halomonas nitritophilus AJ309564 100 Pseudomonas sp. TUT1023 AB098591 86 100 Pseudomonas sp. NZ060 AY014813 Grammaroteobacteria Pseudomonas cf. pseudoalcaligenes AF181570 CCSD_DF2700_B7 DQ128248 gamma proteobacterium HTB082 AB010842 100 CCSD_DF2950_B23 DQ128256 97 uncultured bacterium AY093457 Aquifex pyrophilus M83548 0.05
Zhang et al. Figure 3
83 a 6 Control 5 Reduction
4
3
Fe(II)mM 2
1
0
0 5 10 15 20 25 days
b G S: Siderite V:Vivianite V V G:Goethite S V G
S G S G S G Intensity (arbitrary units) Reduction
Control
30 40 50 60 70 2-Theta (degree)
Zhang et al. Figure 4a-b
84 a 3 control
Reduction
2
Fe II (mM) 1
0 0 5 10 15 20 25 30 days b
Intensity (arbitrary Units)
Control Calculated 2.5 7.5 12.5 17.5 22.5 27.5 32.5
2-Theta (degree)
Zhang et al. Figure 5a - b
85
Intensity (arbitrary units)
Reduction Caculated
2.5 7.5 12.5 17.5 22.5 27.5 32.5
2-Theta (degree)
Zhang et al. Figure 5c
86 100 Caldicellulosiruptor lactoaceticus (X82842) CCSD DF2450 B4 (DQ128247) CCSD DF3350 B10 (DQ128237) CCSD DF2450 B12 (DQ128199) CCSD DF2950 B24 (DQ128224) CCSD DF2450 B2 (DQ128194) 55 CCSD DF2700 B13 (DQ128249) Paraliobacillus ryukyuensis (AB087828) CCSD DF2700 B21 (DQ128213) 66 Halobacillus salinus (AF500003) CCSD DF3200 B16 (DQ128231) Amphibacillus sp. YIM-kkny10 (AY121435) Amphibacillus fermentum (AF418603) CCSD DF3350 B5 (DQ128235) 100 Bacillus vedderi (Z48306) Bacillus macyae JMM-4(AY032601) Virgibacillus halodenitrificans (AB021186) CCSD DF2950 B10 (DQ128219) CCSD DF2700 B3 (DQ128202) 83 Zabuye lake sediment clone ZB-Z54 (AY162956) 53 CCSD DF2450 B11 (DQ128198) CCSD DF2700 B4 (DQ128203) Bacillus arseniciselenatis (AJ865469) 97 CCSD DF3350 B13 (DQ128238) 74 Enterococcus casseliflavus (AF039903) 63 Alkalibacterium sp. A-13 (AY347313) CCSD DF3200 B6 (DQ128226) 98 Unidentified Hailaer soda lake bacterium F27 (AF275703) 52 88 Unidentified Hailaer soda lake bacterium F1 (AF275700) CCSD DF2290 B4 (DQ128186) 100 Uncultured bacterium (AF486687) CCSD DF2450 B15 (DQ128200) Firmicutes 100 Thermoanaerobacter ethanolicus (AF542520) 70 CCSD DF3350 B4 (DQ128234) CCSD DF3200 B10 (DQ128229) 81 CCSD DF2950 B9 (DQ128218) CCSD DF2700 B10 (DQ128206) 99 CCSD DF2290 B6 (DQ128188) 60 Anaerobranca gottschalkii (AF203703) Anaerobranca californiensis (AY064218) 100 CCSD DF2950 B3 (DQ128216) Mono lake clone ML635J-4 (AF507887) 99 CCSD DF2700 B20 (DQ128212) 84 CCSD DF3350 B19 (DQ128241) Alkalibacter saccharofermentans (AY312403) 100 CCSD DF3200 B7 (DQ128227) Mono lake clone ML623J-27 (AF507878) 75 Uncultured Bacillus sp. (AF454299) 74 CCSD DF2290 B16 (DQ128244) 68 Fusibacter sp. SA1 (AF491333) Uncultured bacterium (AY327214) Alkaliphilus transvaalensis (AB037677) 50 CCSD DF2290 B18 (DQ128191) 99 CCSD DF2950 B2 (DQ128215) Soehngenia saccharolytica (AY353956) CCSD DF3350 B7 (DQ128236) 75 CCSD DF2950 B1 (DQ128214) CCSD DF2450 B5 (DQ128196) 61 CCSD DF2700 B17 (DQ128210) Uncultured Clostridium sp. (AY128089) 100 Clostridium sp. 13A1 (AY554421) CCSD DF2950 B20 (DQ128223) 69 CCSD DF2700 B16 (DQ128209) CCSD DF3350 B18 (DQ128240) 100 CCSD DF3200 B8 (DQ128228) Janthinobacterium lividum (AY247410) 92 CCSD DF2290 B5 (DQ128187) Betaproteobacteria 94 CCSD DF2290 B19 (DQ128192) Tepidiphilus margaritifer (AJ504663) 85 CCSD DF2290 B13 (DQ128190) 99 Thauera aromatica (AJ315681) 100 CCSD DF3200 B9 (DQ128257) 55 Stenotrophomonas maltophilia (AY040357) 62 Mammoth Hot spring deposit clone SM2E10 (AF445726) CCSD DF2290 B2 (DQ128184) 100 CCSD DF2700 B8 (DQ128205) Gammaproteobacteria 80 Pseudomonas sp. SMCC B0628 (AF501878) 99 CCSD DF3200 B4 (DQ128225) 93 Halomonas nitritophilus (AJ309564) 81 CCSD DF3200 B19 (DQ128232) Methane hydrate-bearing deep marine sediment clone MB-A2-102 (AY093457) 65 63 CCSD DF2950 B19 (DQ128222) Uncultured bacterium (AF371859) 98 CCSD DF3350 B20 (DQ128242) Uncultured bacteria Uncultured bacterium SHA-61 (AJ249095) CCSD DF2950 B8 (DQ128217) Epsilonproteobacteria 100 Campylobacter sp. NO3A (AY135396) 93 CCSD DF2290 B3 (DQ128185) Mycobacterium scrofulaceum (AY226508) 100 Mycobacterium scrofulaceum (AF480604) Actinobacteria 70 Mycobacterium sp. 01-632 (AY312273) 96 CCSD DF2700 B15 (DQ128208) 96 CCSD DF2950 B13 (DQ128220) 52 Corynebacterium casei (AF267153) 99 Corynebacterium sp. (X86606) Aquifex pyrophilus (M83548) 0.05 Zhang et al. Figure 6
87
CCSD_DF2700_A14 DQ 128276 CCSD_DF2700_A9 DQ128274 CCSD_DF2950_A5 DQ128283 CCSD_DF2450_A14 DQ 128270 CCSD_DF2290_A22 DQ 128263 50 CCSD_DF3200_A12 DQ 128297 Soil Crenarchaeota Group unc ultured Front Range soil crenarchaeot e FRA1 AY 016470 unc ultured arc haeon clone pST-3 AB 182704 100 CCSD_DF3350_A24 DQ 128311 CCSD_DF3200_A19 DQ 128299 96 freshwat er reser voir clone HTA-G6 AF 418938 75 CCSD_DF2290_A2 DQ128260 unidentified archaeon LMA229 U87519 unidentified archaeonclone pMC1A11 AB019724 99 unc ultured crenarchaeote AM-20A_102 AF223127 Marine Group I 63 deep-sea mud volcanoeclone Amsterdam-1A-02 AY592231 51 CCSD_DF3350_A21 DQ 128310 75 CCSD_DF3200_A6 DQ128295 100 CCSD_DF2450_A7 DQ128268 deep-sea sediment clone 621-35 AY 345168 Crenarchaeota Okhotskseafloor clone OHKA1.44 AB094531 72 unc ultured arc haeon MN16 BT2-67 AF357890 100 deep-sea sediment clone CRA 8-27c m AF119128 Nankai Trough deep s ubs urface sediment cl one NANK-A 3 A Y436513 Nankai Trough deep s ubs urfac e sediment clone NANK-A 102 AY436514 Sulfide and methane-rich cold seep environment clone FE 2ArchBot 11 AY 769057 CCSD_DF3350_A10 DQ 128306 75 CCSD_DF3200_A42 DQ 1282 93 Deep-Sea CCSD_DF2950_A20 DQ 1282 91 Archaeal 98 CCSD_DF2950_A10 DQ 1282 86 CCSD_DF2950_A16 DQ 128290 Group
55 CCSD_DF2700_A8 DQ128273 (DSA G) 56 CCSD_DF2450_A4 DQ128265 Okhotskseafloor clone clone OHKA1.8 AB094518 100 CCSD_DF2700_A24 DQ 128278 Methanobacterium Methanother mobac ter t her mautotrophic us AB020530
94 Kinneret l ake s edi ment cl one LKS7 AJ310856 51 CCSD_DF2950_A3 DQ128281 87 CCSD_DF3350_A19 DQ 128309 54 Okhotskseafloor clone OHKA1.44 AB094529 99 Methane-consuming marine sediment clone TA 1e 6 AF 134389 Lake Dagowsediment clone PSS3 AY133886 89 Geot her mal aquifer clone GAB-A 04 AB 183851 64 unc ultured arc haeon AJ 310857 56 unc ultured eur yarchaeote AY 133891 CCSD_DF2950_A6 DQ128284 81 unc ultured arc haeon clone ARC-F1SU-34 AY457656 CCSD_DF2700_A1 DQ128271 CCSD_DF3200_A1 DQ128292 CCSD_DF2450_A6 DQ128267 Marine Benthic Group-D Euryarchaeota CCSD_DF2700_A4 DQ128272 CCSD_DF2450_A2 DQ128264 CCSD_DF2950_A9 DQ128285 CCSD_DF3200_A18 DQ 128298 61 CCSD_DF3350_A7 DQ128303 CCSD_DF3200_A5 DQ128294 CCSD_DF3200_A24 DQ 128300 CCSD_DF3350_A18 DQ 128308 CCSD_DF2950_A1 DQ128279 CCSD_DF2700_A15 DQ 128277 aquaf arm s edi ment clone BCMS-10 AJ579730 CCSD_DF2950_A14 DQ 128288 CCSD_DF2950_A4 DQ128282 Aquif ex pyrophilus M835 48 0.1
Zhang et al. Figure 7
88
100%
80%
60%
40%
20%
0% CCSD_DF2290 CCSD_DF2450 CCSD_DF2700 CCSD_DF2950 CCSD_DF3200 CCSD_DF3350
Betaproteobacteria Gammaproteobacteria Epsilonproteobacter Actinobacteria Firmicute Unclassified bacteriu
Zhang et al. Figure 8
89
Evidence for Microbially-Mediated Iron Redox Cycling in the Deep Subsurface
Gengxin Zhang1, Hailiang Dong1*, Hongchen Jiang1, Romy Chakraborty2, Brian P. Hedlund3, Ravi K. Kukkadapu4, Jinwook Kim5, Terry Hazen2, and Zhiqin Xu6
1: Department of Geology Miami University Oxford, OH 45056
2: Microbial Ecology, Earth Sciences Division Lawrence Berkeley National Laboratory, Berkeley, CA 94720
3:University of Nevada, Las Vegas, Department of Biological Sciences, Las Vegas, NV
4: Pacific Northwest National Laboratory, MSIN K8-96, Richland, WA 99352, USA.
5: Naval Research Laboratory, Seafloor Sciences Branch, Stennis Space Center, MS 39529, U.S.A.
6: Chinese Academy of Geological Sciences, Institute of Geology, Beijing, China
*Corresponding author: Hailiang Dong Department of Geology Miami University Oxford, OH 45056 Tel: 513-529-2517 Fax: 513-529-1542 Email: [email protected]
To be submitted to Geomicrobiology Journal
November 17, 2006
90 ABSTRACT
Iron reducing and oxidizing microorganisms gain energy through reduction or oxidation of iron, and by doing so they play an important role in geochemical cycling of iron in a wide range of environments. This study was undertaken to investigate the iron redox cycle in the deep subsurface by taking an advantage of the Chinese Continental Scientific Deep Drilling project. A fluid sample from 2450 m was collected and Fe(III)- reducing microorganisms were enriched using specific media (pH 6.2). Nontronite, an Fe(III)-containing clay mineral, was used in the initial enrichment with lactate and acetate as electron donors under strictly anaerobic condition at a temperature of 65oC. Instead of a monotonic increase in Fe(II) concentration with time as would have been expected if Fe(III) bioreduction was the sole process, Fe(II) concentration initially increased, reached a peak, but then decreased to a minimum level. Continued incubation revealed an iron cycling with a cycling period of five to ten days. These initial results suggested that there were Fe(III) reducers and Fe(II) oxidizers in the enrichment culture. Subsequently, multiple transfers were made with an attempt to isolate Fe(III) reducer and Fe(II) oxidizer. However, iron cycling persisted after multiple transfers. Additional experiments were conducted to ensure that iron reduction and oxidation was indeed biological. Biological Fe(II) oxidation was further confirmed in a series of roll tubes (with a pH gradient) where FeS and siderite were used as the sole electron donor. The oxidation of FeS occurred only at pH 10. Goethite, lepidocrocite, and ferrihydrite formed as a result of microbial oxidation of FeS. Molecular results (16rRNA gene analysis and restriction enzyme digestion) collectively demonstrated that only a single organism (a strain of Thermoanaerobacter ethanolicus) was present and was probably responsible for both Fe(III) reduction and Fe(II) oxidation. To the best of our knowledge, this is the first report on iron redox cycle in the deep subsurface. These results have important implications for iron cycling in the deep subsurface.
91 INTRODUCTION
Iron is the fourth most abundant element and the most dominant redox active metal in the Earth crust (Edwards et al., 2004). Depending on the environmental conditions, iron can form stable minerals in both divalent and trivalent state. In the Earth crust, the average FeO is 4.3% by weight and Fe2O3 is 2.43%. Iron cycling depends on redox reactions that are driven by both abiotic and biotic factors, which often result in precipitation and dissolution of Fe-bearing minerals. Microbial activity can mediate the iron cycle through carbon fixation and iron respiration (Fortin and Langley, 2005; Lovley, 2000).
Microorganisms can gain energy by reducing Fe(III) with organic acids or H2 as electron donor (Lovley, 1993; Nealson and Saffarini, 1994) or oxidizing Fe(II) with O2
(Neubauer et al., 2002), nitrate(Benz et al., 1998) or CO2 (Kappler and Newman, 2004) as electron acceptor. Numerous Fe(III)-reducing microorganisms have been isolated and characterized (Lovley, 1993; Nealson and Saffarini, 1994). Whereas it is now well established that diverse microorganisms are capable of reducing both aqueous and solid Fe(III) in near-surface, subsurface and deep subsurface environments (Liu et al., 1997; Lovley and Chapelle, 1995; Lovley et al., 1996; Roh et al., 2002; Zhang et al., 2005), the microbial role in Fe(II) oxidation remains poorly understood. Although aerobic oxidation of Fe(II) minerals by acidophiles and neutrophiles has been recognized for many years
(Ghiorse, 1984; Harrison, 1984; Straub et al., 2001), nitrate- and CO2-dependent anaerobic Fe(II) oxidation was discovered only recently. (Benz et al., 1998; Ehrenreich and Widdel, 1994; Kappler and Newman, 2004; Straub et al., 1996; Straub and Buchholz- Cleven, 1998; Widdel et al., 1993). In those studies, phototropic and nitrate-reducing bacteria have been demonstrated to be able to utilize Fe(II) as an electron donor. The role of anaerobic Fe(II)-oxidizing bacteria has recently been the subject of intense investigations (Fortin and Langley, 2005; Roden et al., 2004; Straub et al., 2001; Straub et al., 2004; Weber et al., 2006). A single bacterial species Desulfitobacterium frappieri has been found to be capable of both reducing Fe(III) with H2 as electron donor and oxidizing Fe(II) with nitrate as electron acceptor under different conditions (Shelobolina et al., 2003). Clearly, such microbially mediated iron cycling is very important to a
92 number of subsurface processes. For example, by regenerating Fe(III), anaerobic microbial Fe(II) oxidation may enhance the mineralization of organic material in sediments by Fe(III)-reducing bacteria (Shelobolina et al., 2003). However, the mechanisms of iron cycling are poorly understood. The purpose of this study was to investigate microbially mediated iron cycling in the deep subsurface. This project took an advantage of the recently completed Chinese Continental Scientific Drilling (CCSD) Project (Zhang et al., 2006a; Zhang et al., 2005). We integrated mineralogy, geochemistry and microbiology in this study to characterize iron redox cycling. Our results identified a single organism that might be capable of both Fe(III) reduction and Fe(II) oxidation under different conditions. These results have important implications for iron redox chemistry and microbial ecology in the deep subsurface.
MATERIAL AND METHODS
Site Description The CCSD drilling site is located in Donghai County, Lianyungang City, Jiangsu Province, in the eastern part of the Dabie-Sulu ultra-high pressure metamorphic (UHPM) belt. The Dabie-Sulu UHPM belt was formed by collision between Sino-Korean Plate and Yangtze Plate about 240 Ma years ago. Occurrence of diamond and coesite in the rocks reveals temperature-pressure conditions of 700 to 850°C and 2.8 GPa for the UHP metamorphism (Zheng et al., 2003). The temperature gradient at the site is 19 - 26oC/km (Wang et al., 2001). The UHPM rocks were subducted to at least 100-km depth and experienced the UHP metamorphism before being rapidly exhumed to the surface about 220 Ma ago. By drilling to a depth of 5 km, it is possible to study rocks that used to be at a depth of 100 km. The products of plate tectonics of this region, i.e., UHPM rocks and minerals, along with abundant fluids, radioactivity (U and Th), and gases (H2, CO2, CO and CH4), have provided a unique environment for subsurface microbes. The UHPM rocks are typically separated by a series of structurally weak shear zones and faults. These shear zones and faults are potential storage space for large pockets of fluids/gases and they may serve as a potential microbial habitat.
93
Sample Collection and Preservation Drilling fluid is often regarded as a contamination source during investigations of deep subsurface microbiology, but it is also a means for sampling geological fluids and possibly microbial communities from deep subsurface environments. Our previous studies of the drilling fluids that circulated within a deep borehole (down to 3350 m) suggest the presence of unique microbes from the deep subsurface (Zhang et al., 2006a). For this reason, samples of drilling fluids were collected every 50 meters using sterile tools, purged in an anaerobic glove box, and immediately preserved in a -80oC freezer at the drilling site. Exceptions in sampling frequency were made when geochemical anomalies were encountered, such as structure shear zones and certain depth intervals with anomalously high amounts of fluid/gas. In such cases, sampling was more frequent. One of unfrozen drilling fluids, from the depth of 2450 meters below the ground surface, was shipped to the US in blue ice. This sample was analyzed for geochemistry and microbiology.
Drill-site Geological Fluid Analyses Because circulating drilling fluid was used for drilling, any gases or fluids from geological structures such as shear zones/faults that may contain unique microbes were mixed with the drilling fluid. The concentrations of geological fluids and gases were therefore determined by a deconvolution method (subtraction of the background from the overall measured signals). Gas concentrations (CO2, CH4, H2, and He) in the circulating drilling fluids were determined by real-time gas chromatography (GC) at the site. Peaks significantly above the background level were considered to reflect fluids/gases from geological environment.
Drilling Fluid Geochemical Analyses The supernatant of the drilling fluid sample (2450 m), separated by high-speed - 2- centrifugation, was analyzed for F, Cl, NO 3, and SO 4 concentrations by high performance liquid chromatography (HPLC). The pH of the sample was also measured with an YSI pH probe and salinity by an YSI salinity probe.
94
Direct Microscopic Counts One aliquot of the sample was used for direct count to estimate the total number of microbial cells. Microbial cells were first detached from solids by strong agitation in 0.7% NaCl solution for 10 min (Bottomley, 1994) followed by acridine orange staining and counting with an epifluorescence microscope.
Fe(III) Reduction During Enrichment and Serial Transfers Mineral preparation. Nontronite (NAu-2) was purchased from the Source Clays Repository of the Clay Minerals Society. Bulk clay was size fractionated and the size fraction of 0.5-2 μm was used in the experiment. The total Fe content was 23.4%, and 0.52% of that was Fe(II). Synthetic ferridyrite (HFO) and ferric citrate were used, along with NAu-2, to test Fe(III) reduction. Synthetic FeS and siderite (FeCO3) were used to enrich iron-oxidizing microbes. Synthetic ferrihydrite was synthesized by following a previous published method (Lovley and Philips, 1988). FeS and siderite were synthesized according to published methods (Ehrenreich and Widdel, 1994; Emerson and Moyer, 1997; Hallbeck et al., 1993). Enrichment. Based on the similarity of cloned sequences (see below) to known cultures, two media were prepared to initially target iron-reducing bacteria, i.e., M1 and AG media. Enrichments were set up in a minimal medium M1 (Myers and Nealson, 1988) under strictly anaerobic conditions at an incubation temperature of 65oC. The M1 medium had the following basal salts (Table 1) and trace elements: disodium EDTA, 67.2
µM; H3BO3, 56.6 µM; NaCl, 10.0 µM; FeSO4, 5.4 µM; CoSO4, 5.0 µM; Ni(NH4)2(SO4)2,
5.0 µM; Na2MoO4, 3.9 µM; Na2SeO4, 1.5 µM; MnSO4, 1.3 µM; ZnSO4, 1.0 µM; CuSO4, 0.2 µM; vitamin-free Casamino Acids, 0.1 g/L; L-arginine, 20 µg/mL; L-glutamate, 20 µg/mL; and L-serine 20 µg/mL; and yeast extract, 0.1 g/L (Myers and Nealson, 1988). The M1 medium had a final pH value of 6.2. In the M1 medium, Fe(III) (20 mM) in clay mineral nontronite was provided as electron acceptor, and acetate and lactate as electron donors (Table 1). Cell growth was monitored by acridine orange direct count (AODC). Production of Fe(II) was measured by Ferrozine assay (Stookey, 1970).
95 Serial Transfers. When growth in the enrichment culture was evident and iron reduction (and oxidation) ceased, three serial transfers into either M1 or AG medium (see below) were carried out. Each successive transfer was carried out after apparent mineral- microbe interaction had stopped [i.e., no change in Fe(II) concentration]. AG is an enrichment medium for Anaerobranca gottschalkii, a thermoalkaliphilic bacterium that grows anaerobically at high pH (pH 9.5) and high temperature (55oC) (Prowe and Antranikian, 2001). The AG medium contained: base compounds (Table 1), yeast extract, 0.1 g/L; resazurin, 0.001 g/L; trace element solution 141 (DSMZ), 10 mL; vitamin solution 141 (DSMZ), 10 mL. The transfer tubes were inoculated with cell culture (0.5 mL) from either the original enrichment tube or from a previous transfer tube (Table 3). In all transfers, Fe(III) in NAu-2 was used as a sole source of electron acceptor and 5 mM each of lactate and acetate as electron donors in the presence of AQDS as an electron shuttle (Table 3). In the third transfer, additional experiments were set up in the AG medium with ferric citrate or ferrihydite (HFO), instead of Fe(III) in NAu-2, as an electron acceptor. The production of Fe(II) concentration with time was measured by Ferrozine assay (Stookey, 1970). At selected time points during the experiments, the culture tubes were removed from the incubator and 0.2 mL of cell-mineral suspension was sampled with a sterile syringe and was added to a centrifuge tube that was preadded with 0.2mL of 1 N Ultrex HCl. The cell-mineral suspension was allowed to stand for 24 hours. This extraction was termed the 0.5 N HCl extraction and has been shown to be effective extracting microbially produced Fe(II) including adsorbed form and Fe(II) in biogenic solids except for highly crystalline magnetite (Fredrickson et al., 1998; Zachara et al., 1998). Aqueous Fe(II) concentration was measured by Ferrozine assay after passing 0.3 ml of cell-mineral suspension through a 0.22 μm filter. The change of lactate, acetate, 2- - - 3- SO4 , NO3 , NO2 , and PO4 concentrations were detected by HPLC in the serial transfer. Any change of Eh and pH values during the course of the second transfer experiment was monitored. The Eh and pH measurements were made at selected time points inside a glove box (Coy Laboratory Products, Grass Lake, MI). The Eh measurement was made using platinum microelectrodes (Microelectrodes, Inc., Londonderry, NH). Initial measurements indicated that the Eh value changed
96 dramatically when the anaerobic culture tubes were opened inside a glove box, apparently because the gas composition of headspace in the tubes was different from that in the glove box. Thus, subsequent Eh measurements were made without opening the anaerobic culture tubes. Instead, Eh microelectrodes were inserted into a 1cc syringe with a connected needle. The needle penetrated through the thick rubber stopper of the culture tubes and was able to bring a small amount of liquid sample in contact with the Eh microelectrodes for Eh measurement. Because Fe(II) oxidation occurred unexpectedly in experiments designed to examine Fe(III) reduction, it was necessary to verify if iron oxidation was biological. For this reason, certain antibiotics, i.e., chloramphenicol (200 μg/ml) and carbonyl cyanide m-chlorophenyl-hydrazone or CCCP (41 μg/ml) (van de Graaf et al., 1995), were added, at the time of maximal Fe(II) concentration, to selected culture tubes to stop biological activity. Alternatively, selected culture tubes were autoclaved. Any cessation of Fe(II) oxidation, following addition of these antibodies or autoclaving, was taken as an indication of biological Fe(II) oxidation.
Fe(II) Oxidation Experiments and Isolation of Fe(II) Oxidizing Bacteria Our results from the Fe(III) reduction experiments (described above) indicated that the enrichment cultures may have contained some Fe(II)-oxidizing microorganisms, and the relative dominance of Fe(II) oxidizers (relative to the Fe(III) reducers) was pH- dependent (see below). Thus, separate experiments were carried out to attempt to isolate Fe(II)-oxidizing bacteria using a synthetic FeS solid used by a previous study (Ehrenreich and Widdel, 1994; Emerson and Moyer, 1997) with a modified roll-tube method. A series of roll tubes were set up with FeS as the sole electron donor with pH ranging from 3 to 11 (pH gradient). For isolation, the AG medium was made with a solidifying agent GELRITE gellan gum (Sigma) mixed with FeS and 0.7 mL inoculum. When complete, the roll tubes were incubated vertically at 65°C. After isolation, individual clones were picked and inoculated into liquid AG medium with FeS or siderite (FeCO3) as the sole electron donor (Table 3). The extent of
FeS or FeCO3 oxidation was determined by measuring Fe(II) disappearance with Ferrozine assay. To characterize the Fe(III) precipitates produced as a result of Fe(II)
97 oxidation, biooxidized FeS products were studied by XRD, SEM and transmission electron microscopy (TEM). Details of the TEM sample preparation, instrumentation and data collection have been described elsewhere (Kim et al., 2003).
X-Ray Diffraction and Electron Microscopy Solid samples from both abiotic control and reacted NAu-2 from the second and the third transfer were studied by X-ray diffraction (XRD) at U.S. Geological Survey in Boulder, CO, to identify mineralogical changes as a result of NAu-2 interaction with microbial cells. Solid samples were dispersed in 2 mL distilled water using an ultrasonic probe, and then pipetted and dried onto glass slides for XRD analysis. Samples were X- rayed with a Siemens D500 X-ray diffraction system using Cu radiation, a monochromator, and were scanned in 0.02 degree two-theta steps with a count time of 2 seconds per step. In order to identify the possible presence of smectite-illite mixed layers as a result of reduction of Fe(III) in NAu-2, reacted NAu-2 was treated with ethylene glycol. The positions of the peak maxima were compared with those calculated by the NEWMOD program. For the third transfer with ferric citrate or ferrihydite as an electron acceptor, the production of Fe(II) concentration with time was measured by Ferrozine assay, and the solid residue was studied by XRD, scanning electron microscopy (SEM), and Mössbauer spectroscopy. XRD patterns were obtained with a Scintag X1 powder diffractometer system using CuKα radiation with a variable divergent slit and a solid-state detector. The routine power was 1400 W (40 kV, 35 mA). Low-background quartz XRD slides (Gem Dugout, Inc., Pittsburgh, Pennsylvania) were used. Mineral identification was made using the search-match software and manual search. For SEM observations, samples were prepared following a previously published procedure (Dong et al., 2003). Briefly, cell- mineral suspensions were fixed in 2.5% glutaraldehyde, placed on the surface of glass cover slip to allow mineral particles to settle down for 15 min. The sample-coated cover slips were sequentially dehydrated and followed by critical point drying. All these steps were done in a glove box to minimize the exposure of the samples to O2. Before SEM observations, samples were taken out from the glove box and coated with Au. The Zeiss Supra35 VP-FEG SEM was operated at an accelerating voltage of 10 to 15 kV. A short
98 working distance (6 -10 mm) and low beam current (30 -40 mA) were used to achieve the best image resolution. A longer working distance (8.0 mm) and higher beam current (50 - 70 mA) were used for qualitative energy dispersive spectroscopy (EDS) analysis.
Mössbauer Spectroscopy 57Fe transmission Mössbauer spectroscopy was employed to characterize the Fe mineralogy of the reacted material in AG medium with ferric citrate as electron acceptor (Treatment number 5 in Table 3). Both room temperature, 20 K and 12K spectra were obtained. The sample was analyzed under anaerobic conditions in an environmental chamber. Details of the instrumentation, data collection, calibration, and folding of the data have been described elsewhere (Kukkadapu et al., 2004; Kukkadapu et al., 2001).
DNA Isolation, Amplification, Cloning and Sequencing To identify possible presence of iron reducers and oxidizers, DNA was extracted from the drilling fluid sample, the first transfer culture in the M1 medium (at the end of iron cycling), and finial Fe(II)-oxidizing isolates (from the FeS oxidation experiments) in the AG medium. DNA extraction was accomplished with an UltraClean Soil DNA Isolation Kit (Mo Bio Laboratory Inc., Solana Beach, CA). Purified DNA was used as template for the amplification of 16S rRNA gene by means of Polymerase Chain Reaction (PCR) according to the procedure of Failsafe Kit (Epicenter Biotechnologies, Madison, WI). The PCR reaction conditions for bacteria were 10 mM Tris pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 200 μM each dNTP, 0.2 μM each primer, and 1.25 unit FailSafe PCR Enzyme Mix in 50 µL reaction volume. Bacterial primer sequences were Bac27F: 5΄-AGAGTTTGATCMTGGCTCAG, and Univ1492R: 5΄- CGGTTACCTTGTTACGACTT (Lane, 1985). The following standard conditions were o used for amplification of the bacterial 16S rRNA gene: 30 cycles (denature at 95 C for o o 30s, annealing at 58 C for 30s, extension at 72 C for 2 min). Several tubes were combined to obtain enough PCR products. Archaeal primer sequences were Arch21F: 5΄- TTCCGGTTGATCCYGCCGGA and 958R: 5΄-YCCGGCGTTGAMTCCAATT (DeLong, 1992). The following standard conditions were used for amplification of the o o archaeal 16S rRNA gene: 30 cycles (denature at 95 C for 30s, annealing at 55 C for 30s,
99 o extension at 72 C for 2 min). Amplified 16S rRNA gene fragments were ligated into pGEM®-T vector (Promega Inc., Madison, WI) and the resulting ligation products were used to transform into E. Coli DH5α competent cells. 16S rRNA gene environmental libraries were constructed, and about 40 randomly chosen colonies per sample were analyzed for insert 16S rRNA gene sequences. Plasmid DNA containing inserts of 16S rRNA gene was prepared using Qiagen kit (Qiagen Inc., Chatsworth, CA). Sequencing reactions were carried out with primer Bac27F with a DYEnamic ET terminator cycle sequencing ready reaction kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ). The 16S rRNA gene was sequenced with an ABI 3100 sequencer. Partial sequences were typically ~600-700 bp long. The complementary checking and sequencing of a known archaeon Sulfolobus acidocaldarius indicated that the error frequency of partial sequencing analysis was approximately 0.05 errors per 100 bases (Zhang et al., 2005).
Phylogenetic Analyses Clone sequences were manually checked with the Sequencer program, and secondary structure diagrams and the Chimera Check program were utilized to identify potential chimeras formed during PCR. The sequences obtained were compared to the small subunit 16S rRNA gene database within the Ribosomal Database Project (RDP-II) and GenBank for finding the two nearest phylogenetic neighbors and a representative collection of divergent phylogenetic groups. The sequences were aligned to 16S rRNA gene sequence from the RDP and GenBank database using the ClustalW multiple sequence alignment program. The sequences were then manually aligned using the Macclade software. Phylogenetic analyses were performed with molecular evolutionary genetics analysis software (MEGA) (http://www.megasoftware.net/). Trees generated with neighbor-joining and minimum evolution methods were not significantly different. Phylogenetic inference and evolutionary distance calculations were made with the distance Jukes-Cantor model (gamma parameter equal to 2.0). Bootstrap analysis (500 replicates) was used to obtain confidence estimates for the phylogenetic trees.
Nucleotide Sequence Accession Numbers
100 The sequences determined in this study have been deposited in the GenBank database under accession numbers XXXX for the bacterial clone sequences.
RESULTS Characteristics of the Drilling Fluid Sample The drilling fluid sample (2450 m) was alkaline (pH 9.4) with a salinity of 2.5% and various levels of cations and anions (Table 2). The in-situ temperature was calculated to be 66-83 °C based on the measured geothermal gradient (Wang et al., 2001). The total iron concentration in the drilling fluid sample was 22.7 mM and the ratio of Fe(II)/Fe(III) was 35.5%. The AODC data showed that the total number of cells was 4.3 x 108 cells/mL.
Iron Redox Cycling in the Enrichment and Transfer Culture In two replicate incubation tubes of the first transfer originally designed to examine reduction of Fe(III) in NAu-2 in M1 medium (pH 6.2) (corresponding to treatment # 2 in Table 3), Fe(II) concentration initially increased, reached a peak of 3.75- 4.2 mM [18-20% of total Fe(III)], but then decreased to a minimum level 1.5-2.3 mM [7- 11% of total Fe(III)] (Figure 1). Abiotic control did not show reduction of Fe(III). Upon cessation of Fe cycling in the first transfer, a small aliquot of cell suspension (from M1A1) was transferred into new tubes with fresh M1 and AG medium. Upon this second transfer into the AG medium (pH 9.2) (corresponding to treatment # 3 in Table 3), obvious iron cycling was observed. The Fe(II) concentration increased from an initial value of ~1 mM to a maximum level of 7.2-7.5mM, and then rapidly decreased to a minimum level of 3.1-5.4 mM (Figure 2a). The extent of Fe(III) bioreduction in NAu-2 reached 34.6~36% and then dropped to 14.9~25.9%. Continuing incubation revealed iron cycling with a cycling period of ~5 days. Fe(III) reduction corresponded to lactate oxidation to form acetate (Figure 2b), suggesting that lactate was the electron donor during the Fe(III) reduction cycle. Fe(II) oxidation corresponded to acetate reduction, suggesting that acetate was the possible electron acceptor. Lactate and acetate concentrations did not show any obvious change in abiotic controls (Figure 2b). This result was consistent with a previous observation in that Fe(II) oxidation was oxidized
101 only in the presence of acetate (Kappler and Straub, 2005). Sulfate and phosphate concentration did not show any obvious correlation with Fe(III) reduction and Fe(II) oxidation. Accompanying the iron redox cycling in the second transfer (AG medium), the pH and Eh values also changed in the system. The final pH value dropped by 0.6-0.7 unit in biotic treatment (Figure 2c), but it only dropped by 0.2-0.3 unit in the abiotic controls.
Microbial utilization of lactate in the AG medium (pH 9.2) under N2 atmosphere resulted in significantly lower Eh values (- 414 to - 448mV) (Figure 2d). The Eh values also decreased in the abiotic controls, possibly as a result of abiotic degradation of organic nutrients in the medium such as yeast extract and production of CO2. Overall, the pH and Eh values decreased much more in biotic cultures than in abiotic controls (Figure 2c, d). Upon cessation of Fe cycling in the second transfer tubes, a small aliquot of culture (from AG2A2) was transferred into new tubes with fresh M1 and AG medium (the third transfer, corresponding to treatment # 4 in Table 3). Iron redox cycling was only observed in the AG medium (Figure. 3a) but not in the M1 medium (Figure. 3c). The iron cycling period became irregular by the third transfer. The main difference between the M1 and AG medium was the initial pH value (6.2 vs. 9.2). These data suggest that by the third transfer, both iron reduction and oxidization were active at pH 9.2, while iron oxidization became inactive or was eliminated at pH 6.25. About 10 percent of total biogenic Fe(II) was released into aqueous solution in the M1 medium, but only 1~2 percent in the AG medium, so biogenic Fe(II) was either associated with solids or sorbed on solid (such as residual NAu-2) surfaces. In order to rule out the possibility of abiotic oxidation of Fe(II) (Figure 1-3), separate control assays were performed under the same conditions as were the culture experiments, except that biological activity was either absent or stopped. Since Fe(II) can be easily oxidized by molecular oxygen or other oxidants, controls without inoculum were run to check for chemical oxidation of Fe(II) (using FeCl2). Fe(II) oxidation in absence of inoculum was not detectable (data not shown). When Fe(II) concentration reached the maximum level (Figure 3a), protein inhibitors, carbonyl cyanide m- chlorophenyl-hydrazone (CCCP, 41 mg/l) and chloramphenicol (antibiotic,200 μg/ml) were added to a few tubes to poison microbial activity (Roh et al., 2002; van de Graaf et
102 al., 1995). Certain tubes were also autoclaved. Fe(II) concentration did not decrease after microbial Fe(II) oxidizing activity was stopped (Figure 3b). These control experiments proved that chemical oxidation was not responsible for the observed Fe(II) oxidation.
Ferric Citrate Redox Experiments Upon cessation of Fe cycling in the second transfer, a small aliquot of culture (from AG2A2) was transferred into new tubes with fresh AG medium but with ferric citrate or HFO as electron acceptors (corresponding to treatment # 5 in Table 3). Ferric citrate was steadily reduced to Fe(II) and Fe(II) concentration reached up to 19 mM [90% of Fe(III). After 10 days, Fe(II) concentration slowly decreased to 15 mM (66%) (Figure3d). In the experiment with HFO, Fe(II) concentration increased and remained stable at 8mM which was about 40% reduction extent (Figure 3e).
FeS Oxidation Experiments In order to isolate potential Fe(II) oxidizers, FeS was used as an electron donor and a series of roll tubes were set up (treatment # 6 in Table 3). After 4-5 days, clones of 0.55-mm in diameter formed on the inside wall of the roll tubes (pH 10). Around clones, black-colored FeS solid was oxidized to form colorless-brown circles of 2 mm in diameter (Figure 4a). Individual clones were handpicked and inoculated into liquid AG medium with 3mM Fe(II) in solid FeS or FeCO3 as the sole electron acceptor. Multiple tubes were set up with a pH-gradient ranging from 6 to 11 and the incubation was carried out in a glove box at temperature of 65°C (treatment # 7 in Table 3). In five days, FeS was oxidized with an obvious color change from black to brown (Figure 4b). Ferrozine measurement indicated a decrease in Fe(II) concentration from 2.4 to 0.8 mM and then a slight increase to 1.0 mM, confirming FeS oxidation (Figure 4c).The slight increase after 4 days might be due to bacterial Fe(III) reduction when the Fe(II) concentration was high. The synthetic siderite was similarly oxidized. Ferrozine measurement showed an initial decrease of Fe(II) concentration and then an increase at pH 10 (Figure 4c).
X-ray Diffraction Analysis of Iron-redox Products
103 The solid products from the second and third transfer tubes were examined for any mineralogical changes as a result of bioreduction and biooxidation. In the second transfer tubes [Fe(III) in NAu-2 as an electron acceptor], based on the position of 001/002 peak at 9.72 degree, about 60% expandable nontronite layers remained after Fe(III) bioreduction and Fe(II) biooxidation, and 40% illite layer formed. In the third transfer with ferric citrate or ferrihydrite as an electron acceptor, XRD revealed that vivianite was the dominant Fe(II) mineral. XRD detected the presence of an amorphous Fe(III) phase, ferrihydrite (HFO), as a result of microbial oxidation of Fe(II) in FeS (Figure 5) (treatment # 7 in Table 3).
Electron Microscopy Mineralogical changes as a result of biological reduction-oxidation were studied with scanning and transmission electron microscopy. Bioreduced and -oxidized nontronite showed smectite-illite transformation as consistent with the XRD results (data not shown). Scanning electron microscopy (SEM) was employed to study mineral transformations when ferric citrate was used as an electron acceptor in the third transfer (Treatment # 5, Table 3). Vivianite was observed as a reduction product of ferric citrate (Figure 6a). The EDS spectrum revealed the presence of P, O and Fe. During the oxidation phase, vivianite crystal dissolved, forming dissolution pits in association with some encrusted cells (Figure 6b). As a result of vivianite oxidation, amorphous-looking precipitates formed, which consisted of only iron and oxygen (spot B on Figure 6b). With further development of dissolution, etched pits connected to form long cracks or channels (Figure 6b) and cells were associated with these channels (Figure 6c). Some cells formed biofilm in a close association with amorphous precipitates (Figure 6d). The FeS oxidation products were also studied with SEM and TEM. Scanning electron micrographs of biooxidized FeS showed aggregates of several μm in size in association with biofilms (Figure 7). The synthesized FeS appeared as layer aggregates (Figure 7a), which were distinct from microbially oxidized minerals (Figure 7b). These oxidized aggregates were composed of small aggregates of hundreds of nm in size with various shapes such as needles or irregular shapes associated with biofilm. Generally, the
104 precipitates appeared to be fine-grained (Figure 7b) and the corresponding EDS spectrum (inset A) revealed that precipitates consisted of iron and oxygen without S (Point A on Figure 7c). Interestingly, biologically formed pyrite possessed a framboidal texture (a spherical or sub-spherical structure composed of numerous microcrystals which are often equaldimensional) (Figure 7 d) and EDS analysis revealed Fe and S. The framboidal texture was not present in abiotic FeS control, suggesting a biogenic origin of the pyrite. Pyrite has previously been observed as a product of FeS oxidation (Butler and Rickard, 2000). Transmission electron microscopy images clearly showed crystalline and poorly crystalline iron oxides in biooxidized FeS sample (Figure 8). High magnification (up to 400 K times) TEM was employed to capture the structure of the iron minerals. Aggregates of the Fe-precipitates with 3.2 Å spacing were dominant (Figure. 8a). The upper inset showed 0.3 nm lattice fringes, and selected area electron diffraction (SAED) of the Fe-precipitates displayed the ring patterns with 2.1-, 2.5-, and 3.2- Å spacings (Figure. 8a). These layer spacings were consistent with ferrhydrite (Janney et al., 2000). Needle-like aggregates of the Fe-precipitates with 10- Å spacings were dominant crystalline minerals (Figure. 8b). The insert selected area electron diffraction (SAED) of the Fe-precipitates showed the ring patterns with 3.2-, 4.6-, and 10- Å spacings, which is consistent with goethite (Figure. 8b). Crystalline lepidocrocite also was observed as a product of FeS oxidation.
Mössbauer Spectroscopy Variable-temperature Mössbauer spectroscopy was used to characterize the Fe mineralogy of the bioreduced-biooxidized ferric citrate (treatment # 5 in Table 3). The room temperature (RT) Mössbauer spectrum showed two doublets representing Fe(II) associated with vivianite A site (56%) and vivianite B site (35%), and one doublet representing Fe(III) (9%) (Figure 9a). Fe(III) exhibited a doublet (central doublet) at room temperature. 20-K and 12-K Mössbauer spectroscopy were employed to further study Fe(II) and Fe(III) phases (Figure 9b). The 12-K spectrum, however, was virtually identical to that of the 20-K spectrum. The central doublet did not split and did not exhibit a well-defined sextet feature at 22K, which revealed (9%) Fe(III) was from the
105 oxidized vivianite phase (McCammon and Burns, 1980), which was oxidized by microbes. These data confirm the SEM observations in that vivianite, formed from reduction of ferric citrate, was subsequently oxidized.
Bacterial Clone Libraries Approximately 118 bacterial clones were sequenced and identified in the clone libraries for the original drilling fluid sample, the first transfer, and the isolates from the FeS oxidation experiments. Our results showed that archaea were not present in the first transfer and isolates. The bacterial diversity was the highest in the original drilling fluid sample, and the rarefaction curve for the bacterial clone library was not fully saturated. The bacterial diversity for the transfer cultures was lower, and the rarefaction curves were fully saturated in these samples. However, even in the clone library for the drilling fluid sample, multiple sequences were highly similar to one another (>98-99% similarity), implying that the dominant organisms might not be missed. Below is a detailed description of the clone libraries. The 16S rRNA gene sequences from the drilling fluid sample (2450 m) clustered into three lineage of bacteria: Firmicute, Gammaproteobacteria and Deltaproteobacteria (Figure 10). In the linage of Firmicutes, The most abundant group of clone sequences (7 sequences) clustered with (95-99% similarity) an anaerobic, mesophilic, fermentative, and benzaldehyde-converting bacterium Soehngenia saccharolytica (Parshina et al. 2003). The second most abundant group of clones was closely or moderately (92 -99%) related to Alkalibacterium. Among various species of Alkalibacterium, A. psychrotolerans grows optimally in the presence of 2-10% (w/v) NaCl at pH 9.5-10.5 (Yumoto et al., 2004). A. olivoapovliticus is a psychrotolerant, halotolerant, and facultatively anaerobic bacterium with a pH optimum of 9.8-10.2 (Ntougias and Russell, 2001). Four sequences were closely related to Acetobacterium psammolithicum. It is an acetogen isolated from a subsurface sandstone (Krumholz et al., 1999) and can produce acetate by addition of autoclaved shales (Krumholz et al., 2002). Five sequences were related to an unidentified bacterium clone RB13C12 (AF407415) and uncultured bacterium clone CCSD_DF3350_B20 (DQ128242) from a CCSD drilling fluid sample from 3350 m depth (Zhang et al., 2006a). One sequence was closely related to Thermoanaerobacter
106 ethanolicus (Figure 7). T. ethanolicus is a thermophilic, non-spore-forming anaerobic bacterium isolated from many terrestrial hot springs and deep subsurface (Wiegel and Ljungdahl 1981; Lacis and Lawford 1985; Roh et al. 2002). Some strains of this species are capable of using acetate, lactate, and H2 as electron donors and Fe(III), Co(III), Mn(IV) and U(VI) as electron acceptors (Roh et al. 2002). Growth occurs between 37 and 78°C and at pH 4.4 to 9.8 (Wiegel and Ljungdahl 1981). These conditions were similar to the measured pH of 9.4 and the in-situ temperature of 63-83°C at the depth from which our drilling fluid sample was collected. In the linage of Gammaproteobacteria, two clones were remotely or moderately related to Halomonas desiderata, an alkaliphilic, halotolerant and denitrifying bacterium (Berendes et al., 1996). In the lineage of Deltaproteobacteria, one sequence was closely related to Desulfomicrobium norvegicum, a sulfate reducing bacterium that is able to reduce Co(III) and U(VI)(Genthner et al., 1997; Michel et al., 2001). Another sequence was moderately related (96% similarity) to an uncultured delta proteobacterium clone WN-USB-14 (DQ432197) from the alkaline, hypersaline lakes of the Wadi An Natrun, Egypt (GenBank description). DNA was also extracted from the first transfer and isolated colonies from the FeS oxidation experiments. Thirty-four out of 36 clone sequences from the first transfer (Corresponding to Figure1a, Treatment #2 in table 3) were closely related (>98-99%) to Thermoanaerobacter ethanolicus, suggesting the enrichment and the subsequent transfer enriched this thermophilic metal-reducing organism. Two clones were remotely or moderately related to Halomonas desiderata. All forty-eight sequences from the FeS oxidation experiment were closely related to (>98-99%) Thermoanaerobacter ethanolicus..
DISCUSSION
Chemical vs. Biological Fe(II) Oxidation Strictly anaerobic culture techniques were used in the enrichment and isolation procedures. If oxygen penetrated or leaked into culture of T. ethanolicus, this obligately anaerobic bacterium would not perform Fe(III) reduction. Resazurin, a sensitive O2
107 indicator, should be turned into pink if oxygen leaked into the tubes, but we did not observe any pink color. Thus, the possibility was ruled out that the oxidation part of the iron cycle was due to chemical oxidation by oxygen or other oxidants. The control experiments further proved that oxygen penetration through the butyl rubber stoppers of the culture tubes was not responsible for the observed Fe(II) oxidation in inoculated tubes. We did not know any other possible inorganic oxidants in culture solution that could oxidize Fe(II). The AG medium does not contain any nitrate. Other oxidant such as nitrite was deemed not responsible for Fe(II) oxidation either, because nitrite was never detected by HPLC, although chemical oxidation of Fe(II) with nitrite could possibly play a significant role only at nitrite concentrations of several millimolar (Benz et al., 1998). 2- 3- 2- - SO4 , PO4 , CO3 and HCO3 could not oxidize Fe(II), because controls (with FeCl2) did not show any Fe(II) oxidation by these oxidants. The periodical fluctuation of Fe(II) concentration could not be explained by chemical oxidants other than by biological factors. Furthermore, brown-colored materials surrounding the FeS oxidizing colonies were unevenly distributed on the inside wall of the roll-tubes, indicating biological oxidation of FeS, because abiotic oxidation should not form circular colonies. Based on these data, we concluded that anaerobic Fe(II) oxidation must be a biologically catalyzed reaction.
Change of Microbial Diversity During the Isolation Process Phylogenetic analyses of 16S rRNA gene sequences from the drilling fluid enrichment, the first transfer, and isolates (from the FeS oxidation experiments) revealed significant changes in the bacterial diversity as a result of enrichment and transfers (Figure 10). The frequency of 16S rRNA gene clones should be regarded as qualitative information on the community composition. Nonetheless, 16S rRNA gene sequence libraries provided valuable information about microbial diversity that allowed qualitative comparisons between communities as the enrichment and isolation process continued. The drilling fluid was dominated by bacterial sequences belonging to the lineage of Firmicute and only several sequences were clustered into Proteobacteria. In addition, many clone sequences were related to either alkaliphilic bacteria (such as Alkalibacterium olivoapovliticus), fermentative or those clones previously found in alkaline and saline
108 environments. After the enrichment processes, the bacterial diversity decreased dramatically. The enrichment and cultivation is a selective process because it places a stress on the original microbial community. As a result, many species present in the original environment are eliminated in the isolation process (Dunbar et al., 1999). The enriched bacteria were not dominated by alkaliphic bacteria any more, but instead by strains of Thermoanaerobacter ethanolicus, although the pH in the original drilling fluid sample was alkaline. The majority of sequences (34 out of 36 sequences) were closely related to T. ethanolicus after the first transfer. After further isolation from the FeS oxidation experiment, T. ethanolicus, a known thermophilic Fe(III) reducer was the only one identified. A wide diversity of acidophilic bacteria (Thiobacillus ferrooxidans, Acidimicrobium ferrooxidans and Ferrimicrobium acidophilus), hyperthermophilic archeon Ferroglobus placidus, Geobacter. metallireducens, and Desulfitobacterium frappieri have been reported to have the ability to conserve energy to support growth from both Fe(III) reduction and anaerobic Fe(II) oxidation (Blake and Johnson, 2000; Hafenbradl et al., 1996; Shelobolina et al., 2003).G. metallireducens reduces Fe(III) when nitrate was consumed(Finneran et al., 2002). Although more tests are necessary to confirm, based on our current data, we propose that our Thermoanaerobacter ethanolicus strain may be capable of both of iron reduction and oxidation. A major frustration in the cultivation and bioreduction-biooxidation process was repeatability. As a result of enrichment and subsequent transfers, the bacterial diversity progressively decreased, and in the meantime, the iron redox cycles became progressively irregular, even replicates of the same experiment (under identical conditions) exhibited different behavior. For example, in the second transfer, duplicates displayed quite similar behavior in iron redox cycling, but by the third transfer, replicates were dramatically different (Figure 3a). Another example was FeS oxidation using the roll-tube method.
Fe(II) oxidation was only repeatable twice at pH 10 by using FeS and FeCO3, although much effort was made to repeat iron oxidation at a later time. Similar repeatability issue was reported for nitrate-dependent, Fe(II) oxidizing bacteria (Kappler and Straub, 2005). The authors noticed that continuous cultivation with Fe(II) as sole electron donor turned out to be impossible. After a few transfers, Fe(II) was
109 oxidized only in the presence (of low concentrations, e.g., 0.5 M acetate) of an organic substrate. Most Fe(II)-oxidizing nitrate reducers need an organic co-substrate for growth (Kappler and Straub, 2005). In our case, however, the experiments were not repeatable even in the presence of acetate or other organic substrate.
Search for Possible Electron Acceptors to Couple With Fe(II) Oxidation Based on our current knowledge, only two pathways are known for anaerobic oxidation of Fe(II). Oxygen-independent biological oxidation of Fe(II) was first recognized in cultures of anoxygenic phototrophic bacteria (Widdel et al., 1993), showing that Fe(II) can be oxidized within anoxic environments (Straub et al., 2001). Fe(II)- oxidizing photoautotrophic bacteria use light for CO2 fixation by oxidation Fe(II) to 2+ + Fe(III). The reaction is 4Fe + CO2 + 11H2O (light)→ 4Fe(OH)3 + (CH2O) + 8H (Ehrenreich and Widdel, 1994). The second pathway involves nitrate-dependent 2+ - + 2+ oxidation of Fe(II) as 10 Fe + 2 NO3 + 24 H2O → 10 Fe(OH)3 + N2 + 12 H or 2Fe + - 3+ - NO3 → 2Fe + NO2 (Shelobolina et al., 2003; Straub et al., 1996; Straub and Buchholz- Cleven, 1998). Since all of our experiments were performed in the dark without nitrate, iron oxidation in our enriched and isolate cultures should not have depended on photosynthesis and nitrate. Although anaerobic biological phosphine production from reduction of phosphate has been proposed to couple with Fe(II) oxidation and researched for more than one hundred years (Roels and Verstraete, 2001), yet it is still a controversy. The reduction of phosphate to phosphine has to proceed through steps of extremely low redox potential 2- 2- 2- - - (HPO4 /HPO3 ,- 690 mV; HPO3 / H2PO2 , -913 mV; H2PO2 /P, -922 mV; P/PH3, -525 mV, at pH 7.0)(Schink and Friedrich, 2000), so this reduction was unlikely to couple with Fe(II) oxidation under our experimental conditions, as the measured Eh values were only about - 414 to - 448mV in the transfer culture tubes (Figure 2d). 2- 2- Thermodynamically, bacteria could reduce SO4 to SO3 by oxidizing Fe(II) to 2- 2- Fe(III) from the calculated SO3 /SO4 concentration ratios at equilibrium as a function of pH and Fe(II) concentration (personal communication, Chongxuan Liu). Sulfate concentration, however, did not show any obvious difference between inoculated cultures and abiotic controls.
110 Based on our observed data that acetate reduction was coupled with Fe(II) oxidation (Figure. 2a, 2b), and publications in the literature (Kapper and Straub, 2005), we propose that some strains of T. ethanolicus may be able to reduce Fe(III) by using organic acids as electron donor and to oxidize Fe(II) by using acetate as an electron acceptor. However, this preliminary conclusion needs further confirmation in the future. Acetate/lactate and Fe(II)/Fe(III) redox potentials can be calculated as a function of pH and solution chemistry to judge if acetate is a favorable electron acceptor.
Ecology Implication: Electron Flow in the Deep Subsurface Microorganisms inhabit much of the Earth's hydrosphere and some part of the lithosphere, thriving in environments ranging from surface water to groundwater several kilometers below the surface to submarine hot springs (Boone et al., 1995; Chapelle et al., 2002; Liu et al., 1997; Lovley and Chapelle, 1995; Moser et al., 2003; Pedersen, 1997; Stevens, 1997). Dissimilatory iron reducing bacteria are recognized as the dominant mechanism for Fe(III) oxide reduction in non-sulfidogenic anaerobic soils and sediments by direct microbial reduction coupled to oxidation of organic carbon and H2 (Lovley, 2000). Dissimilatory Fe(III) reduction was thought to be an early form of microbial respiration (Liu et al., 1997). Iron reducing process contributes to both natural and contaminant organic carbon oxidation in sedimentary environments, and exerts a broad range of impacts on the behavior of trace and contaminant metals and radionuclides (Fredrickson et al., 2000; Lovley and Philips, 1988; Lovley and Phillips, 1992; Zachara et al., 2000). The distinguishing feature of the Fe(II)/Fe(III) redox couple is that Fe(III) is prone to hydrolysis and precipitation (Schwertmann and Cornell, 2000), whereas Fe(II) is soluble. Metals that undergo hydrolysis in solution also tend to sorb strongly and specifically to surfaces of reactive solids, including bacterial cells (Ferris, 2005). The high metal uptake affinity of these poorly ordered iron oxides may be important in the global cycling of trace elements throughout the world’s oceans (Kennedy et al., 2003). Because iron oxides play an important role in heavy metal and nutrition sorption (Kreller et al., 2003; Martinez and Ferris, 2005). For instances, the potential for immobilization of Co(II) and U(VI) in crystalline Fe(III) oxides form during nitrate-dependent Fe(II) oxidation(Lack et al., 2002).
111 The ability of a single microorganism capable of iron reduction and oxidation links iron in different reservoirs (i.e., aqueous and solid forms) and in different habitats (aerobic and anaerobic). Iron redox cycling is equivalent to cycling of iron solubility because Fe(II) is soluble and Fe(III) is insoluble. Fe(II) reduction causes mineral transformation of iron oxides (Dong et al., 2000) and phyllosilicates (Kim et al., 2004; Zhang et al., 2006b; Zhang et al., 2006c). For example, the smectite-illite transformation, an important mineral reaction in the subsurface, is promoted by iron-reducing bacteria (Kim et al., 2004). This iron redox cycling is expected to significantly contribute to the overall electron flow at the oxic-anoxic interface. Fe(III)-reducing and Fe(II)-oxidizing bacteria can gain energy through reduction or oxidation of iron, and by doing so they may play an important role in geochemical cycling of iron in the subsurface. In the deep subsurface, the availability of electron acceptors usually constrains biomass and microbial community structure (Pedersen, 2000). The ability of a single organism to recycle electrons between Fe(II) and Fe(III) has a tremendous impact not only on the redox potential of the environment, but also on the energetics of the microorganisms. For example, Desulfitobacterium frappieri not only reduces Fe(III), but also anaerobically oxidizes Fe(II) when nitrate becomes available. This ability provides a competitive advantage for the organism (Shelobolina et al., 2003). Thus, some strains of Thermoanaerobacter ethanolicus may be able to take this type of advantage, thus accounting for its wide distribution in natural environments (Roh et al., 2002; Wiegel and Ljungdahl, 1981; Zhang et al., 2006a). Microorganisms need constant supply of energy to survive, grow, and reproduce. Hydrogen gas is continuously generated in the interior of our planet and probably constitutes sustainable sources of energy for deep terrestrial biosphere ecosystems (Chapelle et al., 2002; Pedersen, 1997; Pedersen, 2000; Stevens, 1997; Stevens and McKinley, 2000). The lack of energy substrates often forces an organism to switch to a different type of metabolism, or may even cause a shift in the composition of a microbial community (Brune et al., 2000), but the recycling of electrons between Fe(II) and Fe(III) provides a renewable energy source for the microorganisms so that it may not be necessary for them to switch metabolic pathways even under stressed conditions.
112 CONCLUSIONS To the best of our knowledge, this is the first report on iron redox cycle in the deep subsurface. Molecular results collectively demonstrated that only a single organism (T. ethanolicus) was present and was probably responsible for both Fe(III) reduction and Fe(II) oxidation. These results have important implications for iron cycling in the deep subsurface for enhancing our understanding of deep biosphere in terrestrial continental crust.
ACKNOWLEDGMENT The investigators would like to thank Jingsui Yang, Zeming Zhang, Tianfu Li, Fulei Liu, Shizhong Chen and other field crew members for their hard work in collecting the samples. The CCSD project provided partial support for the field operations (973 project: 2003CB 716508). We are grateful to Chris Wood at The Center for Bioinformatics and Functional Genomics at Miami University for his technical support. We thank John Morton for his help in cation and anion analyses. This work was supported by grants EAR-0201609 and EAR-0345307 from the National Science Foundation and a Research Challenge grant from the Ohio Board of Regents to HD. An internal grant from Miami University (Hampton fund) and grants from National Science Foundation of China (40228004, 40472064) provided further support. A student grant from the Geological Society of America to GZ provided partial support for materials and supplies.
REFERENCES
Benz, M., Brune, A., and Schink, B. (1998) Anaerobic and aerobic oxidation of ferrous iron at neutral pH by chemoheterotrophic nitrate-reducing bacteria. Archives of Microbiology, 169(2), 159-165. Berendes, F., Gottschalk, G., HeineDobbernack, E., Moore, E.R.B., and Tindall, B.J. (1996) Halomonas desiderata sp nov, a new alkaliphilic, halotolerant and
113 denitrifying bacterium isolated from a municipal sewage works. Systematic and Applied Microbiology, 19(2), 158-167. Blake, I.R., and Johnson, D.B. (2000) Phylogenetic and biochemical diversity among acidophylic bacteria that respire iron. In D.R. Lovley, Ed. Environmental microbe-mineral interactions, p. 53-78. ASM Press, Washington, DC. Boone, D.R., Liu, Y.T., Zhao, Z.J., Balkwill, D.L., Drake, G.R., Stevens, T.O., and Aldrich, H.C. (1995) Bacillus-Infernus Sp-Nov, an Fe(Iii)-Reducing and Mn(Iv)- Reducing Anaerobe from the Deep Terrestrial Subsurface. International Journal of Systematic Bacteriology, 45(3), 441-448. Bottomley, P.J. (1994) Light microscopic methods for studying soil microorganisms. In R.W. Weaver, Ed. Methods of Soil Analysis, Part 2. Microbiological and bIochemical Properties-SSSA Book Series, no. 5, p. 81-105. Soil Science Society of American Publisher, Madison, WI. Brune, A., Frenzel, P., and Cypionka, H. (2000) Life at the oxic-anoxic interface: microbial activities and adaptations. Fems Microbiology Reviews, 24(5), 691-710. Butler, I.B., and Rickard, D. (2000) Framboidal pyrite formation via the oxidation of iron (II) monosulfide by hydrogen sulphide. Geochimica Et Cosmochimica Acta, 64(15), 2665-2672. Chapelle, F.H., O'Neill, K., Bradley, P.M., Methe, B.A., Ciufo, S.A., Knobel, L.L., and Lovley, D.R. (2002) A hydrogen-based subsurface microbial community dominated by methanogens. Nature, 415(6869), 312-315. DeLong, E.F. (1992) Archaea in coastal marine environments. Proceedings of National Academy of Science, 89, 5685-5689. Dong, H., Fredrickson, J.K., Kennedy, D.W., Zachara, J.M., Kukkadapu, R.K., and Onstott, T.C. (2000) Mineral transformation associated with the microbial reduction of magnetite. Chemical Geology, 169, 299-318. Dong, H., Kostka, J.E., and Kim, J.W. (2003) Microscopic evidence for microbial dissolution of smectite. Clays and Clay Minerals, 51(5), 502-512. Dunbar, J., Takala, S., Barns, S.M., Davis, J.A., and Kuske, C.R. (1999) Levels of bacterial community diversity in four arid soils compared by cultivation and 16S rRNA gene cloning. Applied and Environmental Microbiology, 65(4), 1662-1669.
114 Edwards, K.J., Bach, W., McCollom, T.M., and Rogers, D.R. (2004) Neutrophilic iron- oxidizing bacteria in the ocean: Their habitats, diversity, and roles in mineral deposition, rock alteration, and biomass production in the deep-sea. Geomicrobiology Journal, 21(6), 393-404. Ehrenreich, A., and Widdel, F. (1994) Anaerobic Oxidation of Ferrous Iron by Purple Bacteria, a New-Type of Phototrophic Metabolism. Applied and Environmental Microbiology, 60(12), 4517-4526. Emerson, D., and Moyer, C. (1997) Isolation and characterization of novel iron-oxidizing bacteria that grow at circumneutral pH. Appl. Environ. Microbiol., 63(2), 4784- 4792. Ferris, F.G. (2005) Biogeochemical properties of bacteriogenic iron oxides. Geomicrobiology Journal, 22(3-4), 79-85. Finneran, K.T., Housewright, M.E., and Lovley, D.R. (2002) Multiple influences of nitrate on uranium solubility during bioremediation of uranium-contaminated subsurface sediments. Environmental Microbiology, 4(9), 510-516. Fortin, D., and Langley, S. (2005) Formation and occurrence of biogenic iron-rich minerals. Earth-Science Reviews, 72(1-2), 1-19. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Dong, H.L., Onstott, T.C., Hinman, N.W., and Li, S.M. (1998) Biogenic iron mineralization accompanying the dissimilatory reduction of hydrous ferric oxide by a groundwater bacterium. Geochimica Et Cosmochimica Acta, 62(19-20), 3239-3257. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Duff, M.C., Gorby, Y.A., Li, S.M.W., and Krupka, K.M. (2000) Reduction of U(VI) in goethite (alpha-FeOOH) suspensions by a dissimilatory metal-reducing bacterium. Geochimica et Cosmochimica Acta, 64(18), 3085-3098. Genthner, B.R.S., Friedman, S.D., and Devereux, R. (1997) Reclassification of Desulfovibrio desulfuricans Norway 4 as Desulfomicrobium norvegicum comb nov and confirmation of Desulfomicrobium escambiense (corrig, formerly ''escambium'') as a new species in the genus Desulfomicrobium. International Journal of Systematic Bacteriology, 47(3), 889-892.
115 Ghiorse, W.C. (1984) Biology of Iron-Depositing and Manganese-Depositing Bacteria. Annual Review of Microbiology, 38, 515-550. Hafenbradl, D., Keller, M., Dirmeier, R., Rachel, R., Rossnagel, P., Burggraf, S., Huber, H., and Stetter, K.O. (1996) Ferroglobus placidus gen nov, sp nov, a novel hyperthermophilic archaeum that oxidizes Fe2+ at neutral pH under anoxic conditions. Archives of Microbiology, 166(5), 308-314. Hallbeck, L., Stahl, F., and Pedersen, K. (1993) Phylogeny and Phenotypic Characterization of the Stalk-Forming and Iron-Oxidizing Bacterium Gallionella- Ferruginea. Journal of General Microbiology, 139, 1531-1535. Harrison, A.P. (1984) The Acidophilic Thiobacilli and Other Acidophilic Bacteria That Share Their Habitat. Annual Review of Microbiology, 38, 265-292. Janney, D.E., Cowley, J.M., and Buseck, P.R. (2000) Transmission electron microscopy of synthetic 2- and 6- line ferrihydrite. Clays & Clay Minerals, 48(1), 111-119. Kappler, A., and Newman, D.K. (2004) Formation of Fe(III)-minerals by Fe(II)-oxidizing photoautotrophic bacteria. Geochimica Et Cosmochimica Acta, 68(6), 1217-1226. Kappler, A., and Straub, K.L. (2005) Geomicrobiological cycling of iron. Molecular Geomicrobiology, 59, p. 85-108. Kennedy, C.B., Scott, S.D., and Ferris, F.G. (2003) Characterization of bacteriogenic iron oxide deposits from Axial Volcano, Juan de Fuca Ridge, northeast Pacific Ocean. Geomicrobiology Journal, 20(3), 199-214. Kim, J.W., Dong, H., Seabaugh, J., Newell, S.W., and Eberl, D.D. (2004) Role of microbes in the smectite-to-illite reaction. Science, 303(5659), 830-832. Kim, J.W., Newell, S., Furukawa, Y., Lavoie, D., and Daulton, T. (2003) Characterization of microbially Fe(III)-reduced nontronite: environmental cell transmission electron microscopy. Clays & Clay Minerals, 51(4), 382-389. Kreller, D.I., Gibson, G., Novak, W., Van Loon, G.W., and Horton, J.H. (2003) Competitive adsorption of phosphate and carboxylate with natural organic matter on hydrous iron oxides as investigated by chemical force microscopy. Colloids and Surfaces a-Physicochemical and Engineering Aspects, 212(2-3), 249-264. Krumholz, L.R., Harris, S.H., and Suflita, J.M. (2002) Anaerobic microbial growth from components of cretaceous shales. Geomicrobiology Journal, 19(6), 593-602.
116 Krumholz, L.R., Harris, S.H., Tay, S.T., and Suflita, J.M. (1999) Characterization of two subsurface H-2-utilizing bacteria, Desulfomicrobium hypogeium sp nov and Acetobacterium psammolithicum sp nov., and their ecological roles. Applied and Environmental Microbiology, 65(6), 2300-2306. Kukkadapu, R.K., Zachara, J.M., Fredrickson, J.K., and Kennedy, D.W. (2004) Biotransformation of two-line silica-ferrihydrite by a dissimilatory Fe(III)- reducing bacterium: Formation of carbonate green rust in the presence of phosphate. Geochimica Et Cosmochimica Acta, 68(13), 2799-2814. Kukkadapu, R.K., Zachara, J.M., Smith, S.C., Fredrickson, J.K., and Liu, C.X. (2001) Dissimilatory bacterial reduction of Al-substituted goethite in subsurface sediments. Geochimica et Cosmochimica Acta, 65(17), 2913-2924. Lack, J.G., Chaudhuri, S.K., Kelly, S.D., Kemner, K.M., O'Connor, S.M., and Coates, J.D. (2002) Immobilization of radionuclides and heavy metals through anaerobic biooxidation of Fe(II). Appl. Environ. Microbiol., 68, 2704-2710. Liu, S.V., Zhou, J.Z., Zhang, C.L., Cole, D.R., GajdarziskaJosifovska, M., and Phelps, T.J. (1997) Thermophilic Fe(III)-reducing bacteria from the deep subsurface: The evolutionary implications. Science, 277(5329), 1106-1109. Lovley. (1993) Dissimilatory Metal Reduction. Annual Review of Microbiology, 47, 263-290. Lovley, D.R. (2000) Environmental Microbe-Metal Interactions. 408 p. ASM press, Washington, D.C. Lovley, D.R., and Chapelle, F.H. (1995) Deep Subsurface Microbial Processes. Reviews of Geophysics, 33(3), 365-381. Lovley, D.R., Coates, J.D., BluntHarris, E.L., Phillips, E.J.P., and Woodward, J.C. (1996) Humic substances as electron acceptors for microbial respiration. Nature, 382(6590), 445-448. Lovley, D.R., and Philips, E.J.P. (1988) Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Applied and Environmental Microbiology, 54, 1472-1480.
117 Lovley, D.R., and Phillips, E.J.P. (1992) Bioremediation of uranium contamination with enxymatic uranium reduction. Environmental Science and Technology, 26, 2228- 2234. Martinez, R.E., and Ferris, F.G. (2005) Review of the surface chemical heterogeneity of bacteriogenic iron oxides: Proton and cadmium sorption. American Journal of Science, 305(6-8), 854-871. McCammon, C.A., and Burns, R.G. (1980) The oxidation mechanism of vivianite as studied by Mossbauer spectroscopy. American Mineralogist, 65, 361-366. Michel, C., Brugna, M., Aubert, C., Bernadac, A., and Bruschi, M. (2001) Enzymatic reduction of chromate: comparative studies using sulfate reducing bacteria - Key role of polyheme cytochromes c and hydrogenases. Applied Microbiology and Biotechnology, 55(1), 95-100. Moser, D.P., Onstott, T.C., Fredrickson, J.K., Brockman, F.J., Balkwill, D.L., Drake, G.R., Pfiffner, S.M., White, D.C., Takai, K., Pratt, L.M., Fong, J., Lollar, B.S., Slater, G., Phelps, T.J., Spoelstra, N., Deflaun, M., Southam, G., Welty, A.T., Baker, B.J., and Hoek, J. (2003) Temporal shifts in the geochemistry and microbial community structure of an ultradeep mine borehole following isolation. Geomicrobiology Journal, 20(6), 517-548. Myers, C.R., and Nealson, K.H. (1988) Bacterial manganese reduction and growth with manganese oxide as the sole electron acceptor. Science, 240, 1319-1321. Nealson, K.H., and Saffarini, D. (1994) Iron and manganese in anaerobic respiration: environmental significance, physiology, and regulation. Annual Review of Microbiology, 48, 311-343. Neubauer, S.C., Emerson, D., and Megonigal, J.P. (2002) Life at the energetic edge: Kinetics of circumneutral iron oxidation by lithotrophic iron-oxidizing bacteria isolated from the wetland-plant rhizosphere. Applied and Environmental Microbiology, 68(8), 3988-3995. Ntougias, S., and Russell, N.J. (2001) Alkalibacterium olivoapovliticus gen. nov., sp nov., a new obligately alkaliphilic bacterium isolated from edible-olive wash-waters. International Journal of Systematic and Evolutionary Microbiology, 51, 1161- 1170.
118 Pedersen, K. (1997) Microbial life in deep granitic rock. Fems Microbiology Reviews, 20(3-4), 399-414. -. (2000) Exploration of deep intraterrestrial microbial life: current perspectives. Fems Microbiology Letters, 185(1), 9-16. Prowe, S.G., and Antranikian, G. (2001) Anaerobranca gottschalkii sp. nov., a novel thermoalkaliphilic bacterium that grows anaerobically at high pH and temperature. International Journal of Systematic and Evolutionary Microbiology, 51(Pt 2), 457. Roden, E.E., Sobolev, D., Glazer, B., and Luther, G.W. (2004) Potential for microscale bacterial Fe redox cycling at the aerobic-anaerobic interface. Geomicrobiology Journal, 21(6), 379-391. Roels, J., and Verstraete, W. (2001) Biological formation of volatile phosphorus compounds. Bioresource Technology, 79(3), 243-250. Roh, Y., Liu, S.V., Li, G.S., Huang, H.S., Phelps, T.J., and Zhou, J.Z. (2002) Isolation and characterization of metal-reducing Thermoanaerobacter strains from deep subsurface environments of the Piceance Basin, Colorado. Applied and Environmental Microbiology, 68(12), 6013-6020. Schink, B., and Friedrich, M. (2000) Bacterial metabolism - Phosphite oxidation by sulphate reduction. Nature, 406(6791), 37-37. Schwertmann, U., and Cornell, R.M. (2000) Iron oxides in the laboratory; preparation and characterization. 206 p. p. VCH-Wiley, Weinheim, Federal Republic of Germany (DEU). Shelobolina, E.S., Vanpraagh, C.G., and Lovley, D.R. (2003) Use of ferric and ferrous iron containing minerals for respiration by Desulfitobacterium frappieri. Geomicrobiology Journal, 20(2), 143-156. Stevens, T. (1997) Lithoautotrophy in the subsurface. Fems Microbiology Reviews, 20(3- 4), 327-337. Stevens, T.O., and McKinley, J.P. (2000) Abiotic controls on H2 production from basalt- water reactions and implications for aquifer biogeochemistry. Environmental Science and Technology, 34, 826-831. Stookey, L.L. (1970) Ferrozine-a new spectrophotometric reagent for iron. Analytical Chemistry, 42, 779-781.
119 Straub, K.L., Benz, M., and Schink, B. (2001) Iron metabolism in anoxic environments at near neutral pH. Fems Microbiology Ecology, 34(3), 181-186. Straub, K.L., Benz, M., Schink, B., and Widdel, F. (1996) Anaerobic, nitrate-dependent microbial oxidation of ferrous iron. Applied and Environmental Microbiology, 62(4), 1458-1460. Straub, K.L., and Buchholz-Cleven, B.E.E. (1998) Enumeration and detection of anaerobic ferrous iron-oxidizing, nitrate-reducing bacteria from diverse European sediments. Applied and Environmental Microbiology, 64(12), 4846-4856. Straub, K.L., Schonhuber, W.A., Buchholz-Cleven, B.E.E., and Schink, B. (2004) Diversity of ferrous iron-oxidizing, nitrate-reducing bacteria and their involvement in oxygen-independent iron cycling. Geomicrobiology Journal, 21(6), 371-378. van de Graaf, A.A., Mulder, A., de Bruijn, P., Jetten, M.S., Robertson, L.A., and Kuenen, J.G. (1995) Anaerobic oxidation of ammonium is a biologically mediated process. Appl. Environ. Microbiol., 61(4), 1246-1251. Wang, J.Y., Hu, S.B., Yang, W.C., Chen, B.H., Chen, Z.Y., and Li, T.J. (2001) Geothermal measurements in the pilot-boreholes of the China Continental Scientific Drilling. Chinese Science Bulletin, 46(20), 1745-1748. Weber, K.A., Urrutia, M.M., Churchill, P.F., Kukkadapu, R.K., and Roden, E.E. (2006) Anaerobic redox cycling of iron by freshwater sediment microorganisms. Environmental Microbiology, 8(1), 100-113. Widdel, F., Schnell, S., Heising, S., Ehrenreich, A., Assmus, B., and Schink, B. (1993) Ferrous Iron Oxidation by Anoxygenic Phototrophic Bacteria. Nature, 362(6423), 834-836. Wiegel, J., and Ljungdahl, L.G. (1981) Thermoanaerobacter-Ethanolicus Gen-Nov, Spec- Nov, a New, Extreme Thermophilic, Anaerobic Bacterium. Archives of Microbiology, 128(4), 343-348. Yumoto, I., Hirota, K., Nodasaka, Y., Yokota, Y., Hoshino, T., and Nakajima, K. (2004) Alkalibacterium psychrotolerans sp. nov., a psychrotolerant obligate alkaliphile that reduces an indigo dye. International Journal of Systematic and Evolutionary Microbiology, 54, 2379-2383.
120 Zachara, J.M., Fredrickson, J.K., Li, S.-W., Kennedy, D.W., Smith, S.C., and Gassman, P.L. (1998) Bacterial reduction of crystalline Fe3+ oxides in single phase suspensions and subsurface materials. American Mineralogist, 83, 1426-1443. Zachara, J.M., Smith, S.C., and Fredrickson, J.K. (2000) The effect of biogenic Fe(II) on the stability and sorption of Co(II)EDTA(2-) to goethite and subsurface sediment. Geochimica et Cosmochimica Acta, 64(8), 1345-1362. Zhang, G., Dong, H., Jang, H., Eberl, D.D., and Xu, Z. (2006a) Unique Microbial Community Structure in Drilling Fluids from Chinese Continental Scientific Deep Drilling. Geomicrobiology Journal, 23, 499-514. Zhang, G., Dong, H., Kim, J., and Eberl, D.D. (2006b) Microbial Reduction of Structural Fe(III) in Nontronite by a Thermophilic Bacterium and its Roles in Promoting the Smectite-illite Reaction. American Mineralogist, In submission. Zhang, G., Dong, H., Xu, Z., Zhao, D., and Zhang, C. (2005) Microbial Diversity in Ultra-High-Pressure Rocks and Fluids from the Chinese Continental Scientific Drilling Project in China. Applied and Environmental Microbiology, 71(6), 3213- 3227. Zhang, G., Kim, J., Dong, H., and Andre, J.S. (2006c) Microbial effects in promoting the smectite to illite reaction: Role of organic matter intercalated in the interlayer. American Mineralogist, Submitted. Zheng, Y.F., Fu, B., Gong, B., and Li, L. (2003) Stable isotope geochemistry of ultrahigh pressure metamorphic rocks from the Dabie-Sulu orogen in China: implications for geodynamics and fluid regime. Earth-Science Reviews, 1276, 1-57.
121 Table 1 Composition of M1 and AG medium Compounds M1 Medium AG Medium (NH4)2SO4 9.0 mM 11.4 mM K2HPO4 5.7 mM 2.7 mM KH2PO4 3.3 mM ~ MgSO4 1.0 mM 0.4 mM CaCl2 0.5 mM 0.3 mM NaCl ~ 51.3 mM NaHCO3 2.0 mM 11.2 mM Na2CO3 ~ 26.2 mM yeast extract 0.1 g/l 0.1 g/l Lactate 5 mM 5 mM acetate 5 mM 5 mM pH 6.2 9.2
122 Table 2. Anion and cation composition, pH, salinity and in-situ temperature for the drilling fluid sample - Sample (depth, m) F Cl NO3 SO4 Li Na K Mg Ca NH 4 pH Salinity In-situ temp. (%) ( °C) 2450 5.07 351.62 9.89 118.010.28 1678 42.43 4.83 23.50 6.99 9.4 2.50 66-83 The unit for all the anion and cation concentrations is μg/g. pH and salinity were measured from each of the drilling fluid samples using YSI probes. The in-situ temperature was calculated based on the measured geothermal gradient (Wang et al., 2001).
123
Table 3. Experimental conditions and employed analysis methods Treatment# Experiments Medium pH Fe form Organic Analysis 1 Enrichment from M1 6.2 Fe(III) in clay 5mM of the original structure Lactate and drilling fluid acetate 2 First transfer M1 6.2 Fe(III) in clay 5mM of Fe(II), microbial community by clone library structure Lactate and acetate 3 Second transfer M1 6.2 Fe(III) in clay 5mM of Fe(II), anions, cations, pH, Eh, SEM, XRD, structure Lactate and microbial community by clone library and 16S AG 9.2 acetate rDNA chips 4 Third transfer M1 6.2 Fe(III) in clay 5mM of Fe(II) structure Lactate and AG 9.2 acetate
124 5 Third transfer AG 9.2 Fe(III) in Ferric 5mM of Fe(II), SEM, XRD, Mössbauer citrate and HFO Lactate and acetate 6 Isolation by a roll AG 4~11 Fe(II) in FeS 5 mM acetate tube method from the third transfer 7 Fe(II) oxidation in AG 10 Fe(II) in FeS and 5 mM acetate Fe(II), SEM, XRD, EC-TEM liquid culture FeCO3
FIGURE CAPTIONS
Figure 1. Change in 0.5 N HCl-extractable Fe(II) with time in the first transfer (from the enrichment culture) in the M1 medium. M: M1 medium (pH 6.2); 1: the first transfer; A1 and A2: inoculated replicate samples; C: abiotic control. Fe(III) (20.8mM) in nontronite was used as the sole electron acceptor and acetate and lactate (5 mM each) as electron donors. Figure 2. (a) Change in 0.5 M HCl-extractable Fe(II) with time in the second transfer in AG medium (pH 9.2); (b) Change of lactate and acetate concentration with time; (c ) Change of pH with time; and (d) Change of Eh with time. AG: AG medium; 2: the second transfer; A: inoculated sample; C: abiotic control. The electron acceptor and donors were the same as in Figure 1. Figure 3. (a) Change in 0.5 M HCl-extractable Fe(II) with time in the third transfer in AG medium. (b) Change in 0.5 M HCl-extractable Fe(II) with time in the third transfer in AG medium in different controls. When Fe(II) concentration reached up to 5mM, several inoculated samples were treated with CCCP, an antibiotic, or autoclaving to stop biological activity. Cessation of Fe(II) oxidation as a result of these treatment suggest biological activity, not chemical activity, was responsible for the observed Fe(II) oxidation. AG: AG medium;3: the third transfer; A: inoculated sample; C: abiotic control. Arrows indicated the time at which either CCCP was added to the inoculated tubes or these tubes were autoclaved to stop biological activity. The electron acceptor and donors were the same as those for the first and second transfers. (c) Change in 0.5 M HCl-extractable Fe(II) with time in the third transfer in M1 medium. M: M1 medium; 3: the third transfer; A: inoculated samples; C: abiotic control. In contrast to the AG medium, no iron cycling was observed in the M1 medium. The electron acceptor and donors were the same as those for the first and second transfers. (d) Change in 0.5 M HCl-extractable Fe(II) with time in the third transfer in AG medium. Fc: ferric citrate. A: inoculated samples; C: abiotic control. In this treatment, ferric citrate was used as the sole electron acceptor. The donors were the same as above. (e) Change in 0.5 M HCl-extractable Fe(II) with time in the third transfer in AG medium.. Fw: ferrihydrite was used; A: inoculated samples; C: abiotic control. In this treatment, ferrihydrite was sued an the sole electron acceptor.
125 Figure 4. (a) A photograph of roll tubes showing oxidized FeS (apparently by Fe(II) oxidizing bacteria) and an FeS control. (b) A photograph of the culture tubes showing biooxidized FeS and abiotic controls. Oxidation of FeS changed color from black to brown. (c) Decrease of Fe(II) with time as measured by the 0.5 N HCl-extractable Fe(II) in the microbially oxidized FeS and abiotic control (no cells added). Slight increase of Fe(II) after 4 days may indicate Fe(III) reduction. Figure 5. XRD patterns of bio-oxidized FeS, abiotic control, and reference ferrihydrite (XRD database). The reference shows typical two broad peaks corresponding to two-line ferrihydrite. Figure 6. Secondary electron image showing that ferric citrate was reduced to form vivianite and then partially oxidized in the third transfer in AG medium (treatment # 5, Table 3). The images were taken from solids at the end of the reduction-oxidation experiments. (a) Overview of vivianite and amorphous- looking precipitate; (b) Crystalline vivianite with dissolution futures (pits and channels). Amorphous precipitate and encrusted cells are also present. The inserts are SEM-EDS showing the composition of vivianite and oxidized vivianite; (c) Vivianite with dissolution pits and associated cells;(d) Oxidized products of vivianite in association with cells and biofilm. Figure 7. (a) Secondary electron image showing ferrihydrite as a oxidation product of FeS. The inset (a) is abiotic control FeS; (b) Amorphous-looking ferrihydrite; (c) Crystalline iron oxides (Goethite); (d) Framboidal pyrite. The insets are SEM-EDS spectra of iron oxides in (c) and pyrite in (d). Figure 8. TEM micrographs of a) microbially oxidized FeS showing Fe-precipitates with 0.3 nm lattice fringe in upper inset and the SAED pattern showing 2.1-, 2.5-, and 3.2-Å spacings typical of ferrihydrite; b) biooxidized FeS with a needle shape and 1 nm lattice fringe. The inset SAED shows typical goethite with 3.2-, 4.6-, and 10-Å spacings. Figure 9. Mössbauer spectra of the bioreduced ferric citrate at: (a) room temperature (RT) showing the relative percentage of Fe(II) and Fe(III) associated with vivianite; (b) 20K Mössbauer spectra showing the Fe(III) is from oxidized vivianite. Figure 10. Phylogenetic relationships of representative phylotypes of bacterial 16S rRNA gene sequences as determined by the neighbor-joining method. Scale
126 bar = 0.02 nucleotide substitution per site. Phyla were determined by using classification in the Bergey's Manual of Systematic Bacteriology (Garrity 2001). Aquifex pyrophilus was used as an outer group. For a group of sequences with high similarity to each other, only one representative sequence is shown. CCSD_DF2450_B: is from the drilling fluid sample; CCSD_DF2450_Transfer_B: is from first transfer culture and CCSD_DF2450_isolate: is from final isolated bacteria from the FeS oxidation experiments (Ag medium)
127
5 The first transfer in M1 medium with nontronite M1A1
M1C 4 M1A2
3
2
1
0.5N HCl extractable Fe(II) (mM) Fe(II) HCl extractable 0.5N 0 0102030Days
Zhang et al. Figure 1
128 a 10 The second transfer in AG medium with nontronite
8
6 AG2C1
AG2C2 4 AG2A1 Ag2A2 2
0.5N HCl extractable Fe(II) (mM) Fe(II) HCl extractable 0.5N 0
Days 0 5 10 15 20 25 30 b
AG2A1(acetate) 20 AG2A2(acetate) AG2A1(lacetate)
AG2A2(lacetate) 10 AG2C (lactate) AG2C (acetate)
lactate or acetate mM acetate or lactate
0 0 5Days 10 15
Zhang et al. Figure 2a - b
129
c 9.50 The second transfer in AG medium with nontronite Ag2C pH
Ag2A 9.00
8.50
8.00 Days 0 5 10 15 20
The second transfer in AG medium with nontronite 0 d Eh -50 -100 -150 -200 -250 Ag2C mV -300 Ag2A -350 -400 -450 -500
Days 0 5 10 15 20
Zhang et al. Figure 2c - d
130
a 10 The third transfer in AG medium with nontronite
8 Ag3C1
Ag3C2 6 Ag3A1 Ag3A2 4 Ag3A3 Ag3A4 2
0.5N HCl extractable Fe(II) (mM) Fe(II) HCl extractable 0.5N 0
Days 0 5 10 15 20 25 30 35 10 b The third transfer in AG medium with nontronite
autoclave killed 8 add CCCP and antobody CCCP
6 Antibody Autoclave 4 Ag3C1
Ag3C2 2
0.5N HCl extractable Fe(II) (mM) Fe(II) HCl extractable 0.5N 0 0 5 10 15Days 20 25 30 35
Zhang et al. Figure 3a - b
131 8 c Third transfer in M1 medium with nontronite
6
M3C1 M3C2 4 M3A1 M3A2
M3A3 2 M3A4
(mM) Fe(II) HCl0.5N extractable
0 0102030Days
d The third transfer in AG medium with ferric citrate 1.0
0.8
0.6 FcC1 FcC2 0.4 FcA1
FcA2 0.2 FcA3
(%) extent Fe reduction 0.0 0102030Days e 0.5 The third transfer in AG medium with HFO
0.4
0.3 FWC1
FWA1 0.2 FWA2 0.1 FWA3
(%) extent Fe reduction 0.0 0 102030Days
Zhang et al. Figure 3c - e
132
c 3 Oxidation of FeS or FeCO3 at pH 10 in AG medium
2
Fe(II) (mM) FeS oxidation 1 FeS abiotic control
0.5N HCl extractable 0.5N FeCO3 abiotic control FeCO3 oxidation
0
Days 0246
Zhang et al. Figure 4a- c
133
Oxidation of FeS at pH 10 in AG medium 200
Ferrihydrite
Intensity Oxidized FeS 100
abiotic control FeS
0
2-theta 5254565
Zhang et al. Figure 5
134
Zhang et al. Figure 6
135
Zhang et al. Figure 7
136
Zhang et al. Figure 8a
137
Zhang et al. Figure 8b
138
a 3.30e+6
3.25e+6
3.20e+6
3.15e+6 Experimental Simulated Fe(II)-b-56% Fe(II)-a-35% Fe(III)-9% 3.10e+6 Difference a) RT Spectrum
-6 -4 -2 0 2 4 6
1.34e+6 b 1.32e+6
1.30e+6 Intensity (arb. units) Intensity 1.28e+6
1.26e+6
1.24e+6
1.22e+6
1.20e+6
1.18e+6 b) 20-K Spectrum 1.16e+6 -15 -10 -5 0 5 10 15
Velocity (mm/s)
Zhang et al. Figure 9a - b
139 75 Soehngenia saccharolytica AY353956 69 CCSD_DF2450_B30 CCSD_DF2450_B20 99 CCSD_DF2450_B22 99 CCSD_DF2450_B5 CCSD_DF2450_B2 Firmicutes CCSD_DF2450_B47 99 CCSD_DF2450_B6 50 CCSD_DF2450_B40 71 Acetobacterium psammolithicum AF132739 Uncultured bacterium clone HDBW-WB46 AB237709 99 CCSD_DF2450_B28 91 CCSD_DF2450_B 10 (2) 70 CCSD_DF2450_Transfer_B7 Halomonas desiderata X92417 99 CCSD_DF2450_B38 Gammaproteobacteria Halomonas nitritophilus AJ309564 99 CCSD_DF2450_Transfer_B13 97 86 CCSD_DF2450_B17 CCSD_DF2450_B7 99 Clostridium sp. 13A1 AY554421 75 99 CCSD_DF2450_B27 T.aceticus Z49863 99 Uncultured bacterium clone RB13C12 AF407415 99 Uncultured bacterium clone CCSD_DF3350_B20 DQ128242 99 CCSD_DF2450_B11(5) CCSD_DF2450_Transfer_B19 99 CCSD_DF2450_B24 99 Planococcus psychrotoleratus AF324659 Bacillus sp. LY AY787805 90 CCSD_DF2450_B3 86 99 CCSD_DF2450_B34 Firmicutes 61 CCSD_DF2450_B 14 (3) Al k alib ac teri um ib uri ens e AB188093 99 Alkalibacterium psychrotolerans AB125938 69 Alkalibacterium sp. A-13 AY347313 61 95 CCSD_DF2450_B33 80 CCSD_DF2450_B8 CCSD_DF2450_B43 81 96 Alkalibacterium olivoapovliticus AF143512 Unidentified Hailaer soda lake bacterium F27 AF275703 83 CCSD_DF2450_B1,14,15,36,37 CCSD_DF2450_isolate3 CCSD_DF2450_isolate8 99 CCSD_DF2450_Transfer_B14 (34) CCSD_DF2450_B52
98 Thermoanaerobacter ethanolicus strain X514 AF542517 CCSD_DF2450_isolate2 98 87 Thermoanaerobacter ethanolicus isolate DQ128181 CCSD_DF2450_isolate1 52 Thermoanaerobacter ethanolicus (ATCC 33223) L09164 99 CCSD_DF2450_B32 Uncultured delta proteobacterium clone WN-USB-14 DQ432197 98 CCSD_DF2450_B39 Deltaproteobacteria 99 Desulfomicrobium norvegicum AJ277897 Aquifex pyrophilus M83548
0.02
Zhang et al. Figure 10
140 Microbial reduction of structural Fe(III) in nontronite by a thermophilic bacterium and its role in promoting the smectite to illite reaction
Running title: The smectite to illite reaction by a thermophilic bacterium
Gengxin Zhang1, Hailiang Dong1*, Jinwook Kim2, and D. D. Eberl3
1: Department of Geology, Miami University, Oxford, OH 45056
2: Naval Research Laboratory, Seafloor Sciences Branch, Stennis Space Center, MS 39529
3:US Geological Survey, Boulder, CO 80303
*Corresponding author: Hailiang Dong Department of Geology Miami University Oxford, OH 45056 Phone: 513-529-2517 Fax: 513-529-1542
Submitted to American Mineralogist
November 5, 2006
141 ABSTRACT
The illitization process of Fe-rich smectite (nontronite NAu-2) promoted by microbial reduction of structural Fe(III) was investigated by using a thermophilic metal-reducing bacterium, Thermoanaerobacter ethanolicus, isolated from the deep subsurface. T. ethanolicus was incubated with lactate as the sole electron donor and structural Fe(III) in nontronite as the sole electron acceptor, and anthraquinone-2, 6- disulfonate (AQDS) as an electron shuttle in a growth medium (pH 6.2 and 9.2, 65°C) with or without an external supply of Al and K sources. With an external supply of Al and K, the extent of reduction of Fe(III) in NAu-2 was 43.7% and 40.4% at pH 6.2 and 9.2, respectively. X-ray diffraction, and scanning and transmission electron microscopy revealed formation of discrete illite only at pH 9.2 with external Al and K sources, while mixed layers of illite/smectite or highly charged smectite were detected under other conditions. The morphology of biogenic illite evolved from lath and flake to pseudo-hexagonal shape. These data suggest that an external supply of Al and K under alkaline conditions enhances the smectite-illite reaction during microbial Fe(III) reduction of smectite. Biogenic SiO2 was observed as a result of bioreduction under all conditions. This study demonstrated that the microbially promoted smectite-illite reaction proceeded via dissolution of smectite and precipitation of illite. This study, therefore, highlights the significant role of thermophilic, iron reducing bacteria in promoting the smectite to illite reaction under conditions common in sedimentary basins. Key Words— Dissolution, Illite, Microbial Fe(III) Reduction, Nontronite, Precipitation, Sedimentary basin, Smectite, Thermoanaerobacter ethanolicus.
142 INTRODUCTION
Smectite-illite interstratified clay minerals are dioctahedral layer phyllosilicates, which are ubiquitous in soils, sediments, and pelitic rocks. Whereas smectite is common in soils and shallow sediments, illite is a more stable phase under diagenetic conditions. When water-bearing and expandable smectite is buried and subject to increasing temperature and pressure, it tends to transform to illite (Dong and Peacor, 1996; Dong et al., 1997). The resultant illite is fundamentally different from smectite in both structure and composition. The smectite to illite (S-I) reaction is considered to be one of the most important mineral reactions during sediment diagenesis of mudstones and shales (Peacor, 1992), as the degree of the smectite to illite reaction, termed “smectite illitization”, is linked to the maturation, migration and trapping of hydrocarbons (Burst, 1969; Pevear, 1999; Weaver, 1960), the development of pore pressures (Freed and Peacor, 1989), growth faults (Bruce, 1984), rock cementation and porosity reduction (Bjorkum and Nadeau, 1998; Boles and Franks, 1979), and pore water chemistry (Brown et al., 2001). The smectite to illite reaction proceeds through mixed-layer illite-smectite (I-S) intermediates in which the percentage of illite layers increases with increasing temperature (Hower et al., 1976), time (Pytte and Reynolds, 1989), K concentration (Huang et al., 1993), water/rock ratio (Whitney, 1990), and pH (Drief et al., 2002; Eberl et al., 1993). Recent studies have shown a significant effect of microbes in promoting the smectite to illite reaction (Kim et al., 2004). The microbially promoted smectite-illite reaction can take place at room temperature and one atmosphere within two weeks (Kim et al., 2004). This reaction typically requires conditions of 300- 350oC, 100 MPa, and 4-5 months in the absence of microbial activity. Our most recent study (Zhang et al., 2006b) has demonstrated a strong catalytic effect of organic matter intercalated in the interlayer of the smectite structure. The S-I reaction can be promoted by reducing structural Fe(III) in smectite, either biologically (Kim et al., 2004; Zhang et al., 2006b) or chemically (Eslinger et al., 1979; Russell et al., 1979). During the process, smectite may be partially dissolved, and illite precipitated. The extent of microbial dissolution of smectite may depend on several factors, such as the amount of Fe(III) in the structure, the extent of Fe(III) reduction, the type of bacteria, and solution chemistry. Iron-rich smectite is fairly common in nature, and its content may vary from 0.4 mmol Fe3+/g for
143 Wyoming Na-Montmorillonite (Swy-1) (Source Clays Repository) to 4.2 mmol/g for nontronite (Keeling et al., 2000). It is also well established that microbes can reduce Fe(III) in the smectite structure (Dong et al., 2003; Gates et al., 1998; Gates et al., 1993; Kim et al., 2003; Kostka et al., 1999a; Kostka et al., 1996; Kostka et al., 1999b; Stucki et al., 1987; Jaisi et al., 2005; Jaisi et al., 2006a, 2006b), with a varying extent of Fe(III) reduction depending on experimental conditions. Our previous studies have focused on the microbially promoted S-I reaction at room temperature and in presence of organic matter (Kim et al., 2004; Zhang et al., 2006b). However, it has not been studied the effect of microbial Fe(III) reduction on the S-I reaction at elevated temperatures that may be common in sedimentary basins. The objectives of this study were therefore: 1) to understand if bacteria can promote the S-I reaction under diagenetically relevant conditions by using a thermophilic bacterium; 2) to understand if the reaction rate is affected by environmental conditions, such as pH and availability of K and Al. We found that the S-I reaction was favored at an alkaline pH with an external supply of Al and K source. The present study, therefore, enhances our fundamental understanding of the S-I reaction and has significant implications for sediment diagenesis.
MATERIALS AND METHODS Bacterium and clay mineral CCSD_DF2450_M1_68_isolate1 was isolated from a circulating drilling fluid taken at 2450 m depth in the Chinese Continental Scientific Deep Drilling project (Zhang et al., 2006a). 16S rRNA gene analysis identified that it is 98-99% similar to Thermoanaerobacter ethanolicus (Zhang et al., 2006a). T. ethanolicus is an obligately anaerobic, thermophilic, metal-reducing bacterium isolated from the deep subsurface of the Piceance Basin, Colorado (Liu et al., 1997; Roh et al., 2002). CCSD_DF2450_M168_isolate1 was enriched and isolated in M1 medium (Kostka and Nealson, 1998) under strictly anaerobic conditions at an incubation temperature o of 68 C. The isolate was able to use lactate, acetate, and H2 as electron donors and Fe(III) in chlorite and nontronite as an electron acceptor (Zhang et al., 2006a). Nontronite is a dioctahedral smectite-group mineral and represents the ferric end member of the nontronite-beidellite series. The nontronite sample (NAu-2) used in this study was purchased from the Source Clays Repository of the Clay Minerals Society. NAu-2 was originally uncovered from veins in deeply weathered granulite
144 facies containing schist, gneiss and amphibolite from Uley Graphite Mine near Port Lincoln in South Australia (Keeling et al., 2000). Bulk clay was size fractionated and a size fraction of 0.5-2 μm was used in this study. The total Fe content in NAu-2 is 23.4% and 0.52% of that is Fe(II) (Jaisi et al., 2005). NAu-2 consists of pure nontronite with no other Fe-bearing minerals. It contains both octahedral (91%) and tetrahedral Fe(III) (~9%) (Gates et al., 2002; Keeling et al., 2000).
Bacterial reduction experiments For nontronite reduction experiments, a modified basal medium was prepared with the Hungate technique (Hungate, 1969). The composition of the medium (Prowe and
Antranikian, 2001) contained (per liter of deionized water) Na2HPO4, 0.5 g;
(NH4)2SO4, 1.5 g; MgSO4.7H2O, 0.1g; CaCl2.2H2O, 0.05 g; vitamin solution 141 (DSMZ), 10 mL; trace element solution 141 (DSMZ), 10 mL; yeast extract, 0.2 g; and resazurin, 0.0001 g. The basal medium was adjusted to pH of 6.2 and 9.2 to test the effect of pH on the S-I reaction. T. ethanolicus can grow in a wide pH range (4.4 ~ 9.8) (Wiegel and Ljungdahl, 1981), and growth curves are similar at both pH 6.2 and 9.2.
The medium pH of 6.2 was achieved with addition of 1.68 g of NaHCO3 (per L of the modified basal medium) under a N2-CO2 (80:20) gas atmosphere. The medium pH of
9.2 was achieved with addition of 2.2 g of NaHCO3 and 2.2 g of Na2CO3 under a N2 (100%) gas atmosphere. In selected experiments, external K and Al sources were added to the basal medium to promote the S-I reaction. An external K source was added in the form of KHCO3 (to replace NaHCO3) and K2CO3 (to replace Na2CO3) with an additional amount of KCl to achieve a final K concentration of 50 mM. An external Al source (1 g per liter of medium) was added in the form of amorphous
Al(OH)3.nH2O, which was synthesized according to the method described previously (Sato and Sato, 1996). The components in reduction experiments were composed of Fe(III) in nontronite (5mg/mL, final concentration) as the sole electron acceptor, lactate (20 mM, final concentration) as the sole electron donor, and CCSD_DF_M168_isolate1 cells as a mediator in a modified basal medium (at pH 6.2 and 9.2) with anthraquinone-2,6-disulfonate (AQDS) (Sigma, St. Louis, MO) as an electron shuttle (Table 1). The modified basal medium (without vitamin, lactate, and AQDS) was dispensed into anaerobic culture tubes (Bellco Biotechnology, Inc.,
Vineland, NJ), purged with N2 or N2-CO2 mix gases, and autoclaved. After autoclave, a minimum amount of reducing agent (cysteine) was added to achieve a fully
145 anaerobic condition. CCSD_DF2450_M1_68_isolate1 cells (final concentration ~ 1 x 106 cells/mL) were inoculated into autoclaved, anaerobic culture tubes (duplicates for each type of treatment). Controls were identical to the treatment tubes except that anaerobic medium replaced cells. The incubation temperature was 68°C without shaking.
Analysis of bacterial Fe(III) reduction The extent of microbial reduction of nontronite was monitored by measuring Fe(II) production with ferrozine assay (Stookey, 1970). At selected time points, 0.5 mL of cell-mineral suspension, sampled with a sterile syringe, was added to plastic tubes containing 0.5 mL of 1 N Ultrex HCl. The cell-mineral mixture was suspended in HCl for 24 h before Fe(II) analyses which was designated as the 0.5 N HCl extractable Fe(II). Other studies have shown 0.5 N HCl to be effective for extracting microbially produced Fe(II) including both the adsorbed form and Fe(II) in biogenic solids (except for magnetite) (Fredrickson et al., 1998; Zachara et al., 1998). However, this treatment may underestimate the degree of reduction in nontronite (Jaisi et al., 2006b). For this reason, the extent of reduction was also measured by using 1,10- phenanthroline at the conclusion of the experiments (Stucki, 1981). The concentration of aqueous Fe(II) was determined by filtering 0.5 mL of cell-mineral suspension through a 0.2-μm polycarbonate filter into 0.5 mL of 1 N Ultrex HCl followed by ferrozine assay. Concentrations of other cations in the filtrate were measured with inductively coupled plasma mass spectrometry (ICP-MS). We measured Eh and pH within treatment tubes at selected time points. The culture tubes were opened inside a glove box (Coy Laboratory Products, Grass Lake, MI) and the pH was measured with a probe. Initial measurements indicated that the Eh value changed dramatically when the anaerobic culture tubes were opened inside a glove box, apparently because the gas composition of headspace in the tubes was different from that in the glove box. Thus, subsequent Eh measurements were made without opening the anaerobic culture tubes. Instead, Eh microelectrodes were inserted into a 1cc syringe with a connected needle. The needle penetrated through the thick rubber stopper of the culture tubes and was able to bring a small amount of liquid sample in contact with the Eh microelectrodes for Eh measurement.
146 X-ray Diffraction (XRD) Both unreduced and bioreduced NAu-2 samples were studied by XRD to identify mineralogical changes as a result of bioreduction. The samples were dispersed in 2 mL distilled water using an ultrasonic probe. An oriented nontronite layer was prepared by repeated pipetting of clay slurry onto a glass slide followed by air-drying. Samples were X-rayed with a Siemens D500 X-ray diffraction system using Cu radiation, a monochromator, and were scanned in 0.02 two-theta steps from 2 to 40 degrees, with a count time of 2 seconds per step. The proportion of illite and nontronite layers in mixed layered illite/nontronite were determined by using the NEWMOD and the LayerCharge (Christidis and Eberl, 2003) programs.
Scanning and transmission electron microscopy (SEM and TEM) Mineralogical changes were further studied with SEM and TEM. SEM samples were prepared following a previously published procedure (Dong et al., 2003). Briefly, cell-mineral suspensions were fixed in 2.5% glutaraldehyde in a bicarbonate solution and one droplet of fixed suspension was placed on the surface of a glass cover slip that was pre-cleaned with 1 mg/mL polylysine solution prior to use. Nontronite particles were allowed to settle onto the cover slip for 15 min. The sample- coated cover slips were sequentially dehydrated using varying proportions of ethanol and distilled water followed by critical point drying. The cover slips were mounted onto SEM stubs and Au coated for observation using a Zeiss low vacuum SEM. The SEM was operated at an accelerating voltage of 10 to 15 kV. A short working distance (6–10 mm) and low beam current (30–40 mA) were used to achieve the best image resolution. A longer working distance (8.0 mm) and higher beam current (50 – 70 mA) were used for qualitative energy dispersive spectroscopy (EDS) analysis. XRD data and SEM observations revealed that bioreduced NAu-2 at pH 9.2 with external K and Al sources contained illite. Thus, this sample was selected for high resolution TEM observation, along with an abiotic control. The sample was imbedded within L.R. White resin (Kim et al., 1995) and sliced using a microtome for TEM observations (Kim et al., 2004; Kim et al., 2003). The advantage of using L.R. White resin in this study is that smectite layer collapse due to dehydration during conventional TEM observation is avoided and 12-13 Å smectite layers are easily differentiated from 10-Å illite layers (Kim et al., 1995). A JEOL 3010 TEM operating at 300 keV with a LaB6 filament was used for TEM analysis. A total of 124 packets of
147 bioreduced smectite were measured on TEM lattice fringe images and statistical analysis of layer spacing distribution was performed.
RESULTS Reduction of Fe(III) in nontronite by T. ethanolicus As a result of bioreduction, the pH value decreased in both pH 6.2 and 9.2 experiments by 0.2-0.3 and 0.6-0.7 unit, respectively. This decrease was likely due to release of CO2 by bacterial respiration of lactate. Microbial oxidization of lactate and Fe(III) reduction also resulted in a significant decrease in Eh for both experiments.
The pH 9.2 experiments under N2 atmosphere resulted in a significantly lower Eh value (– 414 to – 448mV) than the pH 6.2 experiments under N2-CO2 (– 251 to – 325 mV) atmosphere. The Eh value also decreased in abiotic controls, which might have resulted from abiotic degradation of organic nutrients such as yeast extract. However, these decreases were not significant relative to those in biotic experiments (Table 2). At pH 6.2, the extent of Fe(III) bioreduction as measured with 0.5 N HCl extraction reached 42.4% and 27.1% with and without an external supply of K and Al source, respectively (Figure 1). At pH 9.2 the extent of reduction was 34.1% and 30.9% with and without K and Al, respectively. The abiotic (non-inoculated) controls did not show any significant reduction. The extent of reduction of Fe(III) at the end of experiments was also measured with 1,10-phenanthroline. With an external supply of K and Al, it was 43.7% and 40.4% at pH 6.2 and 9.2, respectively. In the absence of an external supply of K and Al source, the extent was only 32.8% and 31.7% at the same two pH values. In comparison with the extent of reduction measured by 0.5 N HCl extraction, this method extracted more Fe(II). Aqueous concentrations of Fe, Si, Al, and Mg were measured for the samples with an external K and Al supply. Aqueous concentration of Fe(II) comprised an insignificant fraction of total biogenic Fe(II). This fraction was pH dependent. At pH 6.2, aqueous concentration of Fe(II) reached up 9.5% of total Fe(II) by 11 days, and then decreased to 4.1% by 13 days (Fig. 1c). At pH 9.2, aqueous concentration of Fe(II) was only 1.8~2.9% of total Fe(II) (Fig. 1d). Aqueous concentration of Si and Al did not show any obvious difference between abiotic control and biotic samples at pH 6.2 and 9.2, apparently because of formation of Si and Al precipitates in biotic incubations (see below).
148 X-ray diffraction pH 6.2 experiments. Without an external supply of Al and K source, XRD pattern for bioreduced NAu-2 showed some mixed layer of smectite-illite (data not shown). With external Al and K sources, XRD pattern for bioreduced NAu-2 did not show any obvious change with time (from 60 to 120 days), other than a shift of the (001) peak from 12.79 Å (2θ = 6.9 degree) at 60 day to 12.51 Å (2θ = 7.05 degree) at 120 day (Figure 2a). These results suggest that bioreduction had stopped by 60 day (probably much earlier, i.e., by 20 days, Fig. 1). Ethylene glycolation revealed a new 8.78~9.08 Å peak and shifted the nontronite (001) peak to a larger d-spacing. For example, for the 120-day sample, the (001) peak at 12.51 Å for the air-dried sample was split into 9.08 Å and 16.10 Å after glycolation. Based on the position of the (001)/(002) peak at ~9.72 degree [a compounded peak from the (001) of illite and (002) of smectite], about 50 to 60% expandable nontronite layers remained in bioreduced NAu-2 by 120 days. Nearly 100% nontronite layers remained in abiotic control NAu-2 by 120 days (Figure 2a). pH 9.2 experiments. Without an external supply of Al and K source, XRD patterns for bioreduced NAu-2 were similar to those at pH 6.2 with external Al and K source (e.g., Figure 2a). With external Al and K sources, bioreduction of Fe(III) in NAu-2 resulted in appearance of a new peak at 9.94-9.96 Å (2θ = 8.86 degree) (Figure 2b), likely the illite (001) peak. In order to distinguish among nontronite, illite and mixed-layer phases, bioreduced NAu-2 was subject to ethylene glycolation, Li+ saturation, and PVP treatment (Eberl et al., 1998). Ethylene glycolation did not change the position of the illite (001) peak (9.94-9.96 Å), but increased the spacing of the nontronite (001) peak. For the 60-day sample, the nontronite (001) peak shifted from 12.94 Å to 14.78 Å. For the 90-day sample, the 12.90 Å peak shifted to 15.51 Å. After treatments with Li+ saturation and PVP, the 9.96 Å illite peak was intensified, confirming that it was the (001) peak for discrete illite (Figure 2b insert). In abiotic control, 100% nontronite layers remained by 90 days.
SEM observations SEM observations revealed that the abiotic control did not undergo any mineralogical changes (Fig. 3a), but extensive dissolution texture was obvious in the bioreduced samples by the end of the experiment (Fig. 3b). Bioreduction of NAu-2
149 may have proceeded via close associations between bacterial cells, biofilm and NAu-2 as expected for enzymatic mediation of electron transfer to Fe(III) in nontronite (Figure 3c). In the absence of external K and Al sources, dissolution of NAu-2 in both pH 6.2 and 9.2 experiments resulted in formation of biogenic silica and euhedral flaky crystals of smectite (Figure 3d). The relatively well-defined crystal morphology of the flakes suggests that these crystals were different from the initial nontronite, and they were likely precipitated from solution as a result of reductive dissolution of nontronite. Precipitation of biogenic smectite, from reductive dissolution of nontronite, has been observed before (Dong et al., 2003). The qualitative SEM-EDS analyses revealed that those flakes had a lower iron content than the initial nontronite. Nanosized biogenic silica particles were associated with biofilms, and with time, these nanoparticles aggregated and transformed to well-crystalline quartz (Figure 3d, 3e). With an external K and Al supply at pH 6.2, bioreduced NAu-2 displayed similar features as without external K and Al supplies. Discrete illite formation was only observed in bioreduced NAu-2 at pH 9.2 with an external supply of Al and K source. SEM observations revealed a progressive change in illite morphology. Lath-shaped aggregates were observed in the 23 and 60- day samples (Figure 4a, and 4b). By 90 days, distinct euhedral plates formed (Figure 4c). SEM-EDS analyses identified all these crystals as illite (higher Al and K, and lower Fe than nontronite). The crystals not only changed the morphology from lath to plates, but also slightly increased in size (Figure 4a, 4b and 4c). The 90-day sample contained a significant number of euhedral plates and elongated laths (Figure 4d). In the abiotic controls, no mineral transformations were observed. The unaltered nontronite remained at the end of the incubations.
TEM observations Discrete illite packets (14-20 layers) with 1.0 nm spacings were the dominant phase in the bioreduced NAu-2 sample (pH 9.2 containing external K and Al sources) (Figure 5a), compared with the variable layer spacings (1.2 – 1.3 nm) (Figure 5b) in the nonreduced abiotic control (Figure 5b). Newly formed illite layers associated with microbial Fe(III) reduction were differentiated from the smectite layers based on layer spacing (10 Å vs. 12-13 Å). The inset selected area electron diffraction (SAED) pattern also showed discrete Brag reflections, d(001) = 1.0 nm (Fig. 5a), as opposed to diffuse reflections characteristic of unreduced nontronite. A statistical measurement of
150 132 packets in bioreduced NAu-2 showed that about 42% of the measured layers had layer spacings of 0.9 – 1.1 nm, most likely illite layers (Figure 6).
DISCUSSION Microbially mediated S-I reaction at diagenetically relevant temperature To the best of our knowledge, this is the first study to investigate microbial Fe(III) reduction in nontronite using a thermophilic iron-reducing bacterium. In general, the extent of reduction by thermophilic bacteria is higher than that achieved by mesophilic bacteria. For example, mesophilic iron-reducing or sulfate-reducing bacteria can reduce 20.5~32% of Fe(III) in NAu-2 (Li et al., 2004; O'Reilly et al., 2005; Jaisi et al., 2005; Jaisi et al., 2006a, 2006b; Zhang et al., 2006b). In comparison, the extent of reduction by a thermophilic iron-reducing bacterium in this study can reach as high as 27-44%, depending on solution chemistry. Apparently, temperature enhances the extent and rate of bioreduction. Our data on abiotic controls did not show any evidence for smectite dissolution, suggesting that our experimental temperature was not high enough to dissolve smectite. Therefore, this enhanced bioreduction was likely a result of enhanced rate of electron transfer at elevated temperature. This enhanced rate may also be related to differences in microbial metabolic activities between mesophilic and thermophilic bacteria. This study demonstrates that thermophilic bacterium can promote the S-I reaction. Optimum conditions (pure isolate, rich carbon sources, and pure nontronite) were used in our study to accelerate the rate of the S-I reaction. We recognize that these conditions may not predominate or exist in natural environments. However, the lack of these optimal conditions in nature may be compensated by long geological time scales beyond those of our study. It is certainly possible that one or more of these conditions may occur in certain geological environments. For instance, several thermophilic, dissimilatory iron-reducing bacteria have been isolated from sedimentary basins, such as T. ethanolicus from the Piceance Basin, Colorado (Liu et al., 1997); Roh, 2003; Roh et al., 2002), Bacillus infernus from the Taylorsville Basin (Boone et al., 1995), Deferribacter thermophilus, Tepidimicrobium ferriphilum, Thermoterrabacterium ferrireducens, Thermoanaerobacter siderophilus from oil reservoirs or hot springs (Greene et al., 1997; Slobodkin et al., 2006; Slobodkin et al., 1999). Thus, iron-reducing bacteria may be widely distributed in clay-rich subsurface sedimentary basins. Previous studies have shown that sulfate reducing and fermenting
151 bacteria also reduce Fe(III) in the nontronite structure (Li et al., 2004) and in iron oxides (Bond and Lovley, 2002; Boone et al., 1995). This further expands the diversity of bacteria capable of reducing Fe(III) in the subsurface. In clay-rich rocks, iron-bearing smectite can be abundant, such as in Gulf Coast mudstones (Freed and Peacor, 1992) and in shales from Nankai Trough (Masuda et al., 2001). In addition to bacteria and iron-rich smectite, organic acids with concentrations higher than 20 mM have been reported to be present in continental shelf formation waters derived from source rocks (Barth, 1991; Barth et al., 1990). Acetate is usually abundant, but benzoate, butyrate, formate, and propionate are also commonly detected (Magot, 2000). Thus, in such natural systems, there exist electron donor, acceptor and bacteria, and these are major components necessary for promoting the smectite-illite reaction. The rate of microbially-mediated S-I reactions depends on several factors including temperature, pH and activity/concentration of K and Al.
Factors controlling the microbially mediated S-I reaction This study demonstrates that iron-reducing bacteria, when growing on short- chain fatty acids as an energy source and under varied geochemical conditions, have the ability to promote the S-I reaction. The major factors controlling the S-I reaction are the composition and concentration of cations in aqueous solution, reaction temperature, pH, and time. Other factors such as type of bacteria, energy source for microbial metabolism, and Eh would have important effects, but these were not examined in this study. During microbial Fe(III) reduction of nontronite, the S-I reaction rate was enhanced when excess K and Al was present. This finding is consistent with previous studies for the chemically mediated S-I reaction (Drief et al., 2002; Huang et al., 1993; Whitney and Northrop, 1988). The microbially mediated S-I reaction can 3+ + 2+ + qualitatively be written as Na-smectite +Al +K →K-illite +SiO2 +Fe + Na . This reaction is based on the fact that smectite usually has a much lower amount of K and Al, but a higher amount of iron than illite (Peacor, 1992). Thus, the S-I reaction requires external K and Al sources (Eberl et al., 1986, 1993; Drief et al., 2002). The possible source in natural environments may be from feldspar and/or mica dissolution (Wilkinson and Haszeldine, 1996). Smectites with K as the dominant interlayer cation have been reported to occur in many rocks (Drief and Nieto, 2000; Freed and Peacor,
152 1992). In such cases, an external supply of K may not be necessary for the development of illite, because intrinsic supply is available. In nontronite NAu-2, structural Al is present in small amounts. Even if all of this aluminum were available to build illite layers, the number of such layers would be so few that it would be difficult to observe. At pH 9.2, there was no discrete illite formation without external K and Al sources, and some components from dissolved nontronite formed quartz or recombined to form biogenic smectite (Fig. 3). When external Al and K sources were added to the system, discrete illite formed. The microbially mediated S-I reaction was enhanced with an alkaline pH. Discrete illite formed in experiments conducted at pH 9.2 but not in those conducted at pH 6.2, despite the fact that the extent of Fe(III) bioreduction was similar between pH 6.2 and 9.2. Previous studies have shown the important effects of pH on the S-I reaction. In general, increasing pH can enhance smectite dissolution (Bauer and Velde, 1999; Claret et al., 2002) and illite formation (Eberl et al., 1986; 1993; Drief et al., 2002). Our study showed a similar pH effect when microbes (T. ethanolicus) were involved in promoting the S-I reaction.
Mechanism of the microbially mediated S-I reaction This study demonstrates that the microbially mediated S-I reaction was accomplished via dissolution of smectite and precipitation of illite. When K and Al were deficient in the system, the conditions for illite precipitation were not satisfied, and thus the components from dissolved smectite recombined to form euhedral smectite and biogenic silica. When there were external supplies of K and Al at an alkaline pH, the components of dissolved smectite combined with K and Al to precipitate illite. The detection of bioproduced amorphous and crystalline silica provided a strong evidence for dissolution of smectite, which was a prerequisite for subsequent illite precipitation. The dissolution-precipitation mechanism was further supported by an evolution of illite morphology from flake and lath-shaped to pseudo- hexagonal crystals (Eberl and Srodon, 1988; Inoue et al., 1988; Meunier et al., 2000). This evolution was accompanied by an increase in crystal size (Figure 4a ~ c). Such an increase in crystal size and change in crystal morphology was also detected in natural samples (Inoue and Kitagawa, 1994; Inoue et al., 2004; Lanson and Champion, 1991) and was interpreted as resulting from dissolution-precipitation process (Inoue et al., 2004).
153
ACKNOWLEDGMENTS This research was also supported by a grant from National Science Foundation (EAR-0345307). Some part of this research was supported by a student grant from the Clay Minerals Society (Student Research Grant, 2004) to GZ.
REFERENCES CITED Barth, T. (1991) Organic-Acids and Inorganic-Ions in Waters from Petroleum Reservoirs, Norwegian Continental-Shelf - a Multivariate Statistical-Analysis and Comparison with American Reservoir Formation Waters. Applied Geochemistry, 6, 1-15. Barth, T., Borgund, A.E., and Riis, M. (1990) Organic-Acids in Reservoir Waters - Relationship with Inorganic-Ion Composition and Interactions with Oil and Rock. Organic Geochemistry, 16, 489-496. Bauer, A., and Velde, B. (1999) Smectite transformation in high molar KOH solutions. Clay Minerals, 34, 259-273. Bjorkum, P.A., and Nadeau, P.H. (1998) Temperature controlled porosity/permeability reduction, fluid migration, and petroleum exploration in sedimentary basins. APPEA Journal, 38, 453-464. Boles, J.R., and Franks, S.G. (1979) Clay diagenesis in Wilcox sandstones of southwest Texas - implications of smectite diagenesis on sandstone cementation. Journal of Sedimentary Petrology, 49, 55-70. Bond, D.R., and Lovley, D.R. (2002) Reduction of Fe(III) oxide by methanogens in the presence and absence of extracellular quinones. Environmental Microbiology, 4, 115-124. Boone, D.R., Liu, Y.T., Zhao, Z.J., Balkwill, D.L., Drake, G.R., Stevens, T.O., and Aldrich, H.C. (1995) Bacillus-Infernus Sp-Nov, an Fe(Iii)-Reducing and
154 Mn(Iv)-Reducing Anaerobe from the Deep Terrestrial Subsurface. International Journal of Systematic Bacteriology, 45, 441-448. Brown, K.M., Saffer, D.M., and Bekins, B.A. (2001) Smectite diagenesis, pore-water freshening, and fluid flow at the toe of the Nankai wedge. Earth and Planetary Science Letters, 194, 97-109. Bruce, C.H. (1984) Smectite dehydration: its relation to structural development and hydrocarbon accumulation in northern Gulf of Mexico basin. American Association of Petroleum Geologist Bulletin, 68, 673-683. Burst, J.F. (1969) Diagenesis of Gulf Coast clayey sediments and its possible relation to petroleum migration. American Association of Petroleum Geologist Bulletin, 53, 73-93. Christidis, G.E., and Eberl, D.D. (2003) Determination of layer-charge characteristics of smectites. Clays and Clay Minerals, 51, 644-655. Claret, F., Bauer, A., Schafer, T., Griffault, L., and Lason, B. (2002) Experimental investigation of the interaction of clays with high-pH solutions: a case study from the callovo-oxfordian formation, meuse-haute marne underground laboratory (France). Clays and Clay Minerals, 50, 633-646. Dong, H., Kostka, J.E., and Kim, J.W. (2003) Microscopic evidence for microbial dissolution of smectite. Clays and Clay Minerals, 51, 502-512. Dong, H., and Peacor, D.R. (1996) TEM observations of coherent stacking relations in smectite, I/S and illite of shales: evidence for MaEwan crystallites and
dominance of 2M1 polytypism. Clays and Clay Minerals, 44, 257-275. Dong, H., Peacor, D.R., and Freed, R.L. (1997) Phase relations among smectite, R1 I/S and illite. American Mineralogist, 82, 379-391. Drief, A., Martinez-Ruiz, F., Nieto, F., and Sanchez, N.V. (2002) Transmission electron microscopy evidence for experimental illization of smectite in K- enriched seawater solution at 50 °C and basic pH. Clays and Clay minerals, 50, 746-756. Drief, A., and Nieto, F. (2000) Chemical composition of smectites formed in clastic sediments. Implications for the smectite-illite transformation. Clay Minerals, 35, 665-678. Eberl, D.D., Nüesch, R., Sucha, V., and Tsipursky, S. (1998) Measurement of fundamental illite particle thickness by X-ray diffraction using PVP-10 intercalation. Clays and Clay Minerals, 46, 89-97.
155 Eberl, D.D., and Srodon, J. (1988) Oswald ripening and interparticle-diffraction effects for illite crystals. American Mineralogist, 73, 1335-1345. Eberl, D.D., Srondon, J., and Northrop, H.R. (1986) Potassium fixation in smectite by wetting and drying. In J.A. Davis and Hayes, K.F., Eds., Geochemical Processes at Mineral Surfaces, p. 296-326. Eberl, D.D., Velde, B., and McCormick, T. (1993) Synthesis of Illite-Smectite from Smectite at Earth Surface Temperatures and High Ph. Clay Minerals, 28, 49- 60. Eslinger, E., Highsmith, P., Albers, D., and DeMayo, B. (1979) Role of iron reduction in the conversion of smectite to illite in bentonites in the Disturbed Belt, Montana. Clays and Clay Minerals, 27, 327-338. Fredrickson, J.K., Zachara, J.M., Kennedy, D.W., Dong, H.L., Onstott, T.C., Hinman, N.W., and Li, S.M. (1998) Biogenic iron mineralization accompanying the dissimilatory reduction of hydrous ferric oxide by a groundwater bacterium. Geochimica et Cosmochimica Acta, 62, 3239-3257. Freed, R.L., and Peacor, D.R. (1989) Geopressured shale and sealing effect of smectite to illite transition. American Association of Petroleum Geologist Bulletin, 73, 1223-1232. -. (1992) Diagenesis and the formation of authigenic illite-rich I/S crystals in Gulf Coast shales: TEM study of clay separates. Journal of Sedimentary Petrology, 62, 220-234. Gates, W.P., Jaunet, A.M., Tessier, D., Cole, M.A., Wilkinson, H.T., and Stucki, J.W. (1998) Swelling and texture of iron-bearing smectites reduced by bacteria. Clays and Clay Minerals, 46, 487-497. Gates, W.P., Slade, P.G., Manceau, A., and Lanson, B. (2002) Site occupancies by iron in nontronites. Clays and Clay Minerals, 50, 223-239. Gates, W.P., Wilkinson, H.T., and Stucki, J.W. (1993) Swelling Properties of Microbially Reduced Ferruginous Smectite. Clays and Clay Minerals, 41, 360- 364. Greene, A.C., Patel, B.K., and Sheehy, A.J. (1997) Deferribacter thermophilus gen. nov., sp. nov., a novel thermophilic manganese- and iron-reducing bacterium isolated from a petroleum reservoir. International Journal of Systematic Bacteriology, 47, 505-509.
156 Hower, J., Eslinger, E.V., Hower, M.H., and Perry, E.A. (1976) Mechanism of burial metamorphism of argillaceous sediments. 1. Mineralogical and chemical evidence. Geological Society of America Bulletin, 87, 725-737. Huang, W.-L., Longo, J.M., and Pevear, D.R. (1993) An experimentally derived kinetic model for smectite-to-illite conversion and its use as a geothermometer. Clays and Clay Minerals, 41, 162-177. Hungate, R.E. (1969) A roll tube method for cultivation of strict anaerobes. Methods in Microbiology, 3B, 117-132. Inoue, A., and Kitagawa, R. (1994) Morphological-Characteristics of Illitic Clay- Minerals from a Hydrothermal System. American Mineralogist, 79, 700-711. Inoue, A., Meunier, A., and Beaufort, D. (2004) Illite-smectite mixed-layer minerals in felsic volcaniclastic rocks from drill cores, Kakkonda, Japan. Clays and Clay Minerals, 52, 66-84. Inoue, A., Velde, B., Meunier, A., and Touchard, G. (1988) Mechanism of illite formation during smectite-to illite conversion in a hydrothermal system. American Mineralogist, 73, 1325-1334. Jaisi, D.P., Kukkadapu, R.K., Eberl, D.D., and Dong, H. (2005) Control of Fe(III) site occupancy on the extent and rate of microbial Fe(III) reduction in nontronite. Geochimica et Cosmochimica Acta, 69, 5429-5440. Jaisi, D.P., Dong, H., Kim, J.W., He, Z., and Morton, J.P. (2006a) Particle aggregation kinetics during microbial reduction of Fe(III) in nontronite. Clays and Clay Minerals, in press. Jaisi, D.P., Dong, H. and Liu, C. (2006b) Influence of biogenic Fe(II) on the extent of microbial reduction of Fe(III) in clay mineral nontronite, illite and chlorite. Geochimica et Cosmochimica Acta, in revision. Keeling, J.L., Raven, M.D., and Gates, W.P. (2000) Geology and characterization of two hydrothermal nontronites from weathered metamorphic rocks at the Uley Graphite Mine, South Australia. Clays and Clay Minerals, 48, 537-548. Kim, J.W., Dong, H., Seabaugh, J., Newell, S.W., and Eberl, D.D. (2004) Role of microbes in the smectite-to-illite reaction. Science, 303(5659), 830-832. Kim, J.W., Newell, S., Furukawa, Y., Lavoie, D., and Daulton, T. (2003) Characterization of microbially Fe(III)-reduced nontronite: environmental cell transmission electron microscopy. Clays and Clay Minerals, 51, 382-389.
157 Kim, J.W., Peacor, D.R., Tessier, D., and Elsass, F. (1995) A technique for maintaining texture and permanent expansion of smectite interlayers for TEM observations. Clays and Clay Minerals, 43, 51-57. Kostka, J.E., Haefele, E., Viehweger, R., and Stucki, J.W. (1999a) Respiration and dissolution of iron(III)-containing clay minerals by bacteria. Environmental Science and Technology, 33, 3127-3133. Kostka, J.E., and Nealson, K.H. (1998) Isolation, cultivation, and characterization of iron- and manganese-reducing bacteria. In R.S. Burlage, Ed. Techniques in Microbial Ecology, p. 58-78. Oxford University Press, Oxford. Kostka, J.E., Stucki, J.W., Nealson, K.H., and Wu, J. (1996) Reduction of structural Fe(III) in smectite by a pure culture of Shewanella putrefaciens strain MR-1. Clays and Clay Minerals, 44, 522-529. Kostka, J.E., Wu, J., Nealson, K.H., and Stucki, J.W. (1999b) The impact of structural Fe(III) reduction by bacteria on the surface chemistry of smectite clay minerals. Geochimica et Cosmochimica Acta, 63, 3705-3713. Lanson, B., and Champion, D. (1991) The I/S-to-Illite Reaction in the Late Stage Diagenesis. American Journal of Science, 291, 473-506. Li, Y.L., Vali, H., Sears, S.K., Yang, J., Deng, B.L., and Zhang, C.L. (2004) Iron reduction and alteration of nontronite NAu-2 by a sulfate-reducing bacterium. Geochimica et Cosmochimica Acta, 68, 3251-3260. Liu, S.V., Zhou, J.Z., Zhang, C.L., Cole, D.R., GajdarziskaJosifovska, M., and Phelps, T.J. (1997) Thermophilic Fe(III)-reducing bacteria from the deep subsurface: The evolutionary implications. Science, 277(5329), 1106-1109. Magot. (2000) Microbiology of petroleum reservoirs. Antonie van Leeuwenhoek, 77, 103. Meunier, A., Lanson, B., and Beaufort, D. (2000) Vermiculitization of smectite interfaces and illite layer growth as a possible dual model for illite-smectite illitization in diagenetic environments: a synthesis. Clay Minerals, 35, 573-586. O'Reilly, S.E., Watkins, J., and Furukawa, Y. (2005) Secondary mineral formation associated with respiration of nontronite, NAu-1 by iron reducing bacteria. Geochemical Transactions, 6, 67-76. Peacor, D.R. (1992) Diagenesis and low-grade metamorphism of shales and slates. In P.R. Buseck, Ed. Reviews in Mineralogy: Minerals and reactions at the atomic
158 scale: transmission electron microscopy, 27, p. 335-380. BookCrafters, Inc., Chelsea. Pevear, D.R. (1999) Illite and hydrocarbon exploration. Proceedings of National Academy of Science, 96, 3440-3446. Prowe, S.G., and Antranikian, G. (2001) Anaerobranca gottschalkii sp. nov., a novel thermoalkaliphilic bacterium that grows anaerobically at high pH and temperature. International Journal of Systematic and Evolutionary Microbiology, 51, 457-465. Pytte, A.M., and Reynolds, R.C., Jr. (1989) The thermal transformation of smectite to illite. In N.D. Naeser, and T.H. McCulloh, Eds. Thermal history of sedimentary basins: Methods and case histories, p. 133-140. Springer-Verlag, New York. Roh. (2003) Biogeochemical and environmental factors in fe biomineralization: magnetite and siderite formation. Clays and Clay Minerals, 51, 83-95. Roh, Y., Liu, S.V., Li, G.S., Huang, H.S., Phelps, T.J., and Zhou, J.Z. (2002) Isolation and characterization of metal-reducing Thermoanaerobacter strains from deep subsurface environments of the Piceance Basin, Colorado. Applied and Environmental Microbiology, 68, 6013-6020. Russell, J.D., Goodman, B.A., and Fraser, A.R. (1979) Infrared and Mossbauer studies of reduced nontronite. Clays & Clay Minerals, 27, 63-71. Sato, T., and Sato, K. (1996) Preparation of gelatinous aluminium hydroxide from aqueous solution of aluminium salts containing sulphate group with alkali. Journal of Ceramic Society of Japan, 104, 377-382. Slobodkin, A.I., Tourova, T.P., Kostrikina, N.A., Lysenko, A.M., German, K.E., Bonch-Osmolovskaya, E.A., and Birkeland, N.K. (2006) Tepidimicrobium ferriphilum gen. nov., sp. nov., a novel moderately thermophilic, Fe(III)- reducing bacterium of the order Clostridiales. International Journal Systematic and Evolutionary Microbiology, 56, 369-372. Slobodkin, A.I., Tourova, T.P., Kuznetsov, B.B., Kostrikina, N.A., Chernyh, N.A., and Bonch-Osmolovskaya, E.A. (1999) Thermoanaerobacter siderophilus sp. nov., a novel dissimilatory Fe(III)-reducing, anaerobic, thermophilic bacterium. International Journal Systematic Bacteriology, 49, 1471-1478. Stookey, L.L. (1970) Ferrozine-a new spectrophotometric reagent for iron. Analytical Chemistry, 42, 779-781.
159 Stucki, J.W. (1981) The Quantitative Assay of Minerals for Fe2+ and Fe3+ Using 1,10-Phenanthroline .2. a Photochemical Method. Soil Science Society of America Journal, 45, 638-641. Stucki, J.W., Komadel, P., and Wilkinson, H.T. (1987) Microbial reduction of structural iron(III) in smectites. Soil Science Society of America Journal, 51, 1663-1665. Weaver, C.E. (1960) Possible uses of clay minerals in search for oil. American Association of Petroleum Geologists, 44, 1505-1518. Whitney, G. (1990) Role of water in the semctite to illite reaction. Clays and Clay Minerals, 38, 343-350. Whitney, G., and Northrop, H.R. (1988) Experimental investigation of the smectite to illite reaction: dual reaction mechanisms and oxygen-isotope systematics. American Mineralogist, 73, 77-90. Wiegel, J., and Ljungdahl, L.G. (1981) Thermoanaerobacter-Ethanolicus Gen-Nov, Spec-Nov, a New, Extreme Thermophilic, Anaerobic Bacterium. Archives of Microbiology, 128, 343-348. Wilkinson, M., and Haszeldine, R.S. (1996) Aluminium loss during sandstone diagenesis. Journal of the Geological Society, 153, 657-660. Zachara, J.M., Fredrickson, J.K., Li, S.-W., Kennedy, D.W., Smith, S.C., and Gassman, P.L. (1998) Bacterial reduction of crystalline Fe3+ oxides in single phase suspensions and subsurface materials. American Mineralogist, 83, 1426- 1443. Zhang, G., Dong, H., Jang, H., Eberl, D.D., and Xu, Z. (2006a) Unique Microbial Community Structure in Drilling Fluids from Chinese Continental Scientific Deep Drilling. Geomicrobiology Journal, 23, 499-514. Zhang, G., Kim, J., Dong, H., and Andre, J.S. (2006b) Microbial effects in promoting the smectite to illite reaction: Role of organic matter intercalated in the interlayer. American Mineralogist, Submitted.
160
Table 1. Experimental conditions used for nontronite reduction in bacterial cultures and abiotic controls. Amendments
Exp. pH Al(OH)3•nH2O Lactate NAu-2 K 1g/L 20mM 5mg/ml 50m M 1 6.2 √ 2 6.2 √ √ 3 6.2 √ √ √ 4 6.2 √ √ √ √ 5 9.2 √ √ √ 6 9.2 √ √ √ √ 7 9.2 √ 8 9.2 √ √
161 Table 2. Change in pH and Eh as a result of Fe(III) bioreduction
Without K and Al With K and Al
(80%N2-20%CO2) (100% N2) Initial1 Final2 Initial Final Bioreduction 6.2 5.9 – 6.0 9.2 8.6 – 8.5 pH Control 6.2 6.2 9.2 8.7 Eh(mV) Bioreduction – 50 – 251 to – 325 – 49 – 414 to – 448 Control – 50 – 34 to – 97 – 49 – 83 to – 171
1 Initial time = before the inoculation of Thermoanaerobacter ethanolicus. 2 Final time = end of experiments (18 days of incubation)
162 FIGURE CAPTIONS
FIGURE 1. (a) Production of 0.5 N HCl extractable Fe(II) with time in bioreduced NAu-2 and abiotic control (no bacterial cells added) at pH 6.2 with an external supply of Al and K. (b) Production of aqueous Fe(II) with time under the same conditions. (c) A similar plot as (a) but at pH 9.2. (d) A similar plot as (b) but at pH 9.2. All results were from duplicate cultures and the error bars represent two-sigma variation. R: bioreduced sample; C: abiotic control.
FIGURE 2. (a) XRD patterns for oriented bioreduced NAu-2 at pH 6.2 with an external supply of Al and K source. Both air-dried and ethylene glycolated samples were run. Three time points (and one abiotic control) were selected to show time-course changes in the patterns as bioreduction continued. (b). XRD patterns for oriented bioreduced NAu-2 at pH 9.2 with an external supply of Al and K source. Two time points (along with one abiotic control) were selected to show changes as bioreduction continued. 60 days-Air: 60-day sample air-dried; 60 day-Gly: 60-day sample solvated with ethylene glycol vapor at 65oC. The inset pattern was for a 90-day sample (pH 9.2) that was saturated wit Li+ and then intercalated with PVP. This method intensifies the illite (001) peak. See text for description of the differences between patterns.
FIGURE 3. Secondary electron images showing various changes in NAu-2 as a result of bioreduction at pH 6.2 without external K and Al sources. (a) Abiotic control after 120 days of incubation showing no changes. (b) Dissolution features (pits and etches) of bioreduced NAu-2 after 120 days of incubation. (c) Biogenic silica and euhedral smectite in bioreduced NAu-2 after 23 days of incubation. The bottom panel shows SEM-EDS composition of grain A and B on Fig. 3c corresponding to euhedral smectite and silica, respectively. The right insert shows neoformed euhedral flaky smectite in bioreduced NAu-2 after 23 days of incubation. The composition of the euhedral smectite flakes is different from the initial nontronite NAu-2 in that it has higher Al and lower Fe content. (d) Biofilm formation in bioreduced NAu-2 after 23 days of incubation. (e) Secondary electron image showing nano-sized and aggregated biogenic silica in bioreduced NAu-2 after 23 and 120 days of incubation. The
163 left subfigure shows nano-sized silica after 23 days of incubation; the top right subfigure shows nano-sized silica associated with biofilm after 23 days of incubation and the low right subfigure shows aggregated biogenic silica after 120 days of incubation. FIGURE 4. Secondary electron image showing evolution of illite crystal morphology in bioreduced NAu-2 as a function of time from curled sheets at 23 days (a) to lath at 60 days (b) to pseudo-hexagonal plates at 90 days (c) and large lath (d). Residual nontronite remained even at the end of 90 days. The right panel of (d) shows SEM-EDS spectra of Grain A (residual NAu-2) and B (neoformed illite). The experiments were performed at pH 9.2 with external Al and K sources.
FIGURE 5. TEM micrographs for bioreduced and nonreduced NAu-2 from the pH 9.2 experiments with external K and Al sources. (a) bioreduced NAu-2 with newly formed illite precipitates having 10-Å lattice fringes confirmed with SAED pattern. (b) NAu-2 lattice fringes in the abiotic control. 12-Å layer spacings were dominant for this sample.
FIGURE 6. Histogram showing the distribution of layer spacings in bioreduced NAu- 2 (pH 9.2, with K and Al) in comparison with the abiotic control (no cells added). The x-axis should be read as follows with [9, 10) as an example: layer spacing between 9 Å (including 9) and 10 Å (excluding 10).
164 a 10 pH6.2, with external Al and K sources c 10
) pH9.2, with external Al and K sources ) 8 8
6 6
mM 4 4
mM
2 2
0.5 N Fe(II HCl0.5 extractable 0 0 0.5 N Fe(II HCl0.5 extractable 0 5 10Days 15 20 25 0 5 10Days 15 20 NAu-2R NAu-2C NAu-2R NAu-2C d pH9.2, with external Al and K sources 0.8 pH6.2, with external Al and K sources 0.8 b M M 0.6 0.6
165 0.4 0.4
0.2 0.2 Aqueous Fe(II) m Aqueous Fe(II) Aqueous Fe(II) m Aqueous Fe(II)
0.0 0 0 5 10Days 15 20 0 5 10Days 15 20 25 NAu-2R NAu-2C NAu-2R NAu-2C
Zhang et al. Figure 1
12.51 pH 6.2, with external K and Al sources a 16.90
16.10 120days-Air 9.08
16.38 12.89 120days-Gly 8.79 90days-Gly 90days-Air
16.34 12.79
8.78 60days-Gly 60days-Air
13.40 8.49
control-Air control-Gly
2 7 122 Theat 17 22 27 b 15.51 pH 9.2 ,with extenal K and Al sources 9.94 12.90 9.96 9.96 90days-Gly Li-PVP (90days) 14.78 12.94 90days-Air 600
9.96 60days-Gly 16.58 400 12.38 60days-Air 611
8.96 Control-Air
Control-Gly
2 72-Theta 12 17 22 27 Zhang et al. Figure 2
166
Zhang et al. Figure 3a - e
167
Zhang et al. Figure 4a - d
168
Zhang et al. Figure 5a - b
169
70 63 60
50
40 Reduced Nontronite 29 30 25 Non-reduced nontronite 22.6 19.4 total no. of packet = 20 16.1 Frequency (%) 132 12 10 5.6 5.6
000 1.6 0 0 <9 [9,10) [10,11) [11,12) [12,13) [13,14) >14 Spacing (Å)
Zhang et al. Figure 6
170
MICROBIAL EFFECTS IN PROMOTING THE SMECTITE TO ILLITE
REACTION: ROLE OF ORGANIC MATTER INTERCALATED IN THE
INTERLAYER
Running title: Microbial effects on the smectite to illite reaction
Gengxin Zhang1†, Jinwook Kim2†, Hailiang Dong1*, and Andre J Sommer3
1: Department of Geology, Miami University, Oxford, OH 45056, U.S.A.
2: Naval Research Laboratory, Seafloor Sciences Branch, Stennis Space Center, MS 39529, U.S.A.
3: Department of Chemistry and Biochemistry, Miami University, Oxford, OH 45056, U.S.A.
†These authors contributed equally to this work.
*Corresponding author: Hailiang Dong Department of Geology Miami University Oxford, OH 45056 Phone: 513-529-2517 Fax: 513-529-1542
Submitted to American Mineralogist
May 28, 2006
171 ABSTRACT The illitization of organic matter intercalated, iron rich smectite (nontronite, NAu- 2) induced by microbial reduction of structural Fe(III) was investigated by using cysteine and toluene as model organic molecules. Iron reducing bacterium Shewanella oneidensis CN32 was incubated with lactate as the sole electron donor and structural Fe(III) in cysteine- and toluene-intercalated nontronite (referred to as cysteine-nontronite and toluene-nontronite hereafter) as the sole electron acceptor, and anthraquinone-2, 6- disulfonate (AQDS) as an electron shuttle in bicarbonate buffer. The extent of Fe(III) reduction in cysteine-nontronite and toluene-nontronite was 15.7% and 5.4%, respectively, compared to 20.5% in nontronite without organic matter intercalation. In the bioreduced nontronite, X-ray diffraction, scanning and transmission electron microscopy did not detect any discrete illite or biogenic minerals, although illite/smectite mixed layer or high charge smectite phases were observed. In bioreduced cysteine-nontronite, discrete illite and siderite formed. In contrast, bioreduction of toluene-nontronite did not result in any mineralogical changes. The contrasting bioreduction results between cysteine- and toluene-intercalated nontronite may be ascribed to the nature of organic matter-bacteria interactions. Whereas cysteine is an essential amino acid for bacteria and can also serve as an electron shuttle, thus enhancing the extent of Fe(III) bioreduction and illitization, toluene is toxic and inhibits Fe(III)-reducing activity. This study, therefore, highlights the significant role of organic matter in promoting the smectite to illite reaction under conditions more typical of natural environments (i.e., non-growth condition for bacteria). Key Words— Cysteine, Illite, Microbial Fe(III) Reduction, Nontronite, Toluene, Shewanella oneidensis.
172 INTRODUCTION
The smectite to illite reaction proceeds through mixed-layer illite-smectite (I-S) intermediates in which the percentage of illite layers increases with increasing temperature (Hower et al., 1976), time (Pytte and Reynolds, 1989), K concentration (Huang et al., 1993), and water/rock ratio (Whitney, 1990). These empirical relationships have been used to infer paleotemperature and diagenetic grade (Hoffman and Hower, 1979). However, ambiguity exists as to the mechanisms by which smectite layers are converted to illite. In one model (Hower et al., 1976), the smectite-to-illite reaction is believed to occur through a sequence of mixed-layer I-S, including smectite-rich R0, R1, R2, R3 I-S, and illite rich I-S, with a continuously variable ratio in the proportions of smectite and illite layers. The model implies that all I-S with the relative proportions of illite layers from 0 to 100% are likely to occur in nature. This concept led to the implication that the smectite-to-illite transformation can proceed layer-by-layer in the solid state. However, several TEM studies indicated that R1 I-S with 50% illite layers is abundant, whereas other proportions of mixed-layer I-S phases (i.e., R2, R4 etc.) are rarely observed (Ahn and Peacor, 1989; Veblen et al., 1990). Using the L.R.White resin treatment (Kim et al., 1995), Dong et al. (1997) determined that smectite, R1 I-S, and illite are the dominant phases in the I-S series, and that R1 I-S has a unique structure and composition. Recent lattice energy calculations (Stixrude and Peacor, 2002) are consistent with that observation. These data imply that the smectite to illite reaction occurs via dissolution of smectite and precipitation of illite. Different mechanisms for the smectite to illite reaction may be in part due to the different conditions of the geological systems studied, including variables such as water/rock ratio, fluid composition, redox state, and presence or absence of organic matter (Dong, 2005). Solid-state transformations may be operative in closed systems, where the water/rock ratio is low, whereas dissolution-precipitation may be predominant in open systems, where the water/rock ratio is high. Numerous studies have been performed in support of one model, or the other (Bethke and Altaner, 1986; Dong and Peacor, 1996; Dong et al., 1997; Drits et al., 1996; Eberl and Srodon, 1988; Lindgreen and Hansen, 1991; Nadeau et al., 1985), or both (Whitney and Northrop, 1988), but few have taken into account the role of microbes.
173 Bacteria are ubiquitous in soil and sediments, and have been shown to reduce structural Fe(III) in smectite for respiration and growth (Dong et al., 2003; Gates et al., 1998; Gates et al., 1993; Kim et al., 2003; Kostka et al., 1999a; Kostka et al., 1996; Kostka et al., 1999b; Stucki et al., 1987; Kim et al., 2004). Although it is well established that microbes can reduce Fe(III) in the smectite structure, only recently has experimental evidence suggested that microbes may be doing so via a dissolution mechanism (Dong et al., 2003). A recent study (Kim et al., 2004) first demonstrated that microbes can promote the smectite to illite reaction at room temperature within 14 days. These results are of great importance because this reaction was thought to require a much higher temperature over an extended period of time (Huang et al., 1993; Whitney and Northrop, 1988). In abiotic systems, elevated temperatures are typically used in laboratory experiments to accelerate the smectite to illite reaction in order to compensate for a long geological time in nature (e.g., Bauer and Velde, 1999; Whitney and Northrop, 1988). In biotic systems, bacteria may catalyze the reaction, and elevated temperature or prolonged time may not be necessary. This paper is an extension of the study by Kim et al. (2004) to further test the hypothesis that bacteria can promote the S-I reaction in presence of other factors such as organic matter. The natural organic matter (amino acids, natural sugar, lignin phenol, etc.) is widely distributed in sediments (Keil et al., 1998) and a significant amount of organic matter is associated with the smectite interlayer (Kennedy et al., 2002). A few previous studies have shown some effects of organic matter in the smectite to illite reaction. For example, Small et al. (1994) demonstrated that K-oxalate and K-acetate in neutral-alkaline aqueous solution can significantly promote the smectite to illite reaction. Likewise, abundant illite is observed in organic matter rich black shales relative to sandstones, siltstones, and organic matter poor shales (Uysal et al., 2004). However, it is not yet clear how the presence of organic matter in the smectite interlayer affects microbial Fe(III) reduction and the smectite-illite reaction. The objectives of this study was therefore to understand the role of intercalated organic matter in microbial reduction of Fe(III) and the smectite to illite reaction. We found that the rate of the smectite-illite reaction was either accelerated or slowed depending on the type of organic molecules present in the interlayer. Organic matter was
174 not subject to microbial degradation if it was present in the smectite interlayer. The present study, therefore, would enhance our fundamental understanding of the S-I reaction in clay-rich sediments and rocks and have significant implications for sediment diagenesis.
MATERIALS AND METHODS Synthesis of cysteine- and toluene intercalated nontronite Nontronite NAu-2, an iron-rich variety of smectite from Uley graphite mine, South Australia (the Clay Minerals Society Reference Clay) (Keeling et al., 2000), was used in this study. A clay fraction (0.5 – 2.0 μm) was separated by a combination of gravity settling and centrifugation and air-dried. The clay sample was then sterilized by a five-minute exposure to microwave radiation (Keller et al., 1988), and sterility was confirmed from lack of bacterial growth in LB broth following a 48-hour incubation at 30oC in the dark under aerobic condition. The total Fe content in NAu-2 is 23.4%, and 0.6% of it is Fe(II) (Keeling et al., 2000; Jaisi et al., 2005). Smectite clays have a large reactive surface area capable of sorbing a large number of dissolved organic compounds (amino acids, natural sugars, lignin phenols, etc.) in natural environments. These clays also make important contributions to pesticide and organic contaminant retention in soils (Li et al., 2003; Ll et al., 2004; Sheng et al., 2001). Among a large number of organic matters that can possibly be associated with smectite, two particular types were chosen for this study. Cysteine, a type of amino acid, was used as a representative natural organic matter because it is an essential nutrient for many living organisms and can be found in electron-transfer proteins (Doong and Schink, 2002). Toluene, a widely distributed carcinogenic hydrocarbon in soils and sediments, was used because a large number of bacteria can degrade it for growth at hydrocarbon- contaminated sites. Cysteine intercalated nontronite, hereafter called cysteine-nontronite, was synthesized following a previously published procedure (Brigatti et al., 1999). The first step involves synthesis of homoionic clay. Two grams of nontronite Nau-2 were mixed
with 200 mL of 1M CuCl2 solution in a flask, and the suspension was stirred overnight at room temperature. After centrifugation, the supernatant was decanted and replaced by
175 freshly prepared 1N CuCl2 solution. This process was repeated three times. Excess salts were removed from the homoionic clay by dialysis until the aspired solution tested negative with AgNO3. The second step involves cysteine intercalation. Two grams of the homoionic nontronite were suspended in a flask containing 100 mL of 0.05 M cysteine solution. The suspension was stirred at room temperature for 24 h. After centrifugation, cysteine-nontronite was washed 10 times with distilled water. The amount of cysteine intercalated into nontronite was quantified by measuring the difference between the starting and the remaining cysteine concentration in aqueous solution. Toluene intercalated nontronite, hereafter called toluene-nontronite, was synthesized following a published procedure (Sharmasarkar et al., 2000). Hexadecyltrimethylammonium bromide (HDTMA), an organic compound, was purchased from Sigma Company and used to prepare HDTMA-clay suspension. Aqueous solution of HDTMA (20 mg/mL) was added to a clay suspension (10 mg/mL) and agitated with a magnetic stirrer. After mixing for 4 hrs, HDTMA-clay was washed with distilled-deionized water until free of salts. The HDTMA-clay complex of 0.10 g was weighed into a 25-mL centrifuge tube that contained 25 mL of distilled water. A volume of 12 µL toluene/methanol (4.6 µL/7.4µL) solution was added to the 25 mL tube containing the HDTMA-clay complex, yielding a toluene concentration of 160 mg/L. The tube was shaken for up to 18 hrs at room temperature. After centrifugation, toluene- nontronite was washed 5 times with distilled water. The amount of toluene intercalated into nontronite was quantified by measuring the difference between the starting and the remaining toluene concentration in aqueous solution.
Bacteria and bioreduction experiments An iron-reducing bacterium Shewanella putrefaciens strain CN32 was routinely cultured aerobically in tryptic soy broth (TSB) (30 g/L) from the stock culture, which was kept at –80oC. After harvesting in TSB until mid to late log phase, CN32 cells were washed with anaerobic bicarbonate buffer and resuspended in the buffer. Nontronite NAu-2, cysteine-nontronite, and toluene-nontronite were made into clay slurries (100 mg/mL) in bicarbonate buffer. These slurries served as stock solutions for subsequent experiments and were sterilized. In a typical experiment with a 15-mL final
176 volume of culture medium, 1.5 mL of each clay slurry (final concentration, 5 mg/mL,) was added to replicate pressure tubes of 23-mL capacity with lactate as the electron donor (20 mM) and Fe(III) in the nontronite structure as the sole electron acceptor in the presence of an electron shuttling compound anthraquinone-2, 6-disulfonate (AQDS).
Tubes were purged with N2/CO2 gas mix (80:20) and sealed with thick butyl rubber stoppers. CN32 cells (1 x 108 and 2 x 108 cells/mL final concentration for cysteine- nontronite and toluene-nontronite reduction experiments, respectively) were added to the treatment tubes with a sterile and anaerobic syringe. The controls consisted of tubes that received the same amount of sterile bicarbonate buffer in place of CN32 cells. All experiments were incubated at 30°C with shaking at 60 rpm.
Numeration of cell numbers Although our experiments were performed under non-growth conditions, nonetheless, cell numbers were numerated at the end of the bioreduction experiments to monitor possible cell death. Cell-clay suspension of 1 mL in volume was removed from the experimental tubes, diluted and plated on agar plates. The number of colony forming units (CFU) was visually counted.
Analyses Due to the possibility of Fe(III) reduction by cysteine during synthesis, Fe(II) production was measured by 0.5 N HCl extraction. In addition, the total Fe(III) and Fe(II) contents in cycteine-nontronite and toluene-nontronite were measured by direct current plasma (DCP) emission spectroscopy and titration (Andrade et al., 2002), respectively. The extent of microbial reduction of Fe(III) in nontronite was monitored by measuring Fe(II) production. At select time points, 0.5 mL of mineral suspension, sampled with a sterile syringe, was added to a plastic tube pre-added with 0.5 mL of 1 N Ultrex HCl. The cell-mineral suspension was allowed to stand in HCl for 24 h before analyzing for Fe(II). This extraction is termed the 0.5 N HCl extracted Fe(II), and has been shown to be effective for extracting microbially produced Fe(II) including adsorbed form and Fe(II) in biogenic solids except for highly crystalline magnetite.
177 Aqueous concentration of cysteine during the cysteine-nontronite synthesis and the bioreduction experiments was determined by the DTNB method {5,5’-dithiobis(2- nitrobenzoic acid)} (Riddles et al., 1983). Clay-cysteine suspension (0.2 mL) was centrifuged at 14,000 g for 5 min to settle particles. The clear supernatant (0.1 mL) was mixed with 1 mM DTNB in 50 mM phosphate buffer (pH 8.0). The cysteine concentration was determined with a spectrophotometer at 412 nm. Toluene concentration in aqueous solution was determined by high performance liquid chromatography (HPLC).
X-ray Diffraction (XRD) Both nonreduced and bioreduced nontronite, cysteine-nontronite, and toluene- nontronite solid samples were studied by XRD to identify mineralogical changes as a result of bioreduction. The samples were dried in an anaerobic glove box (95% N2 and
5% H2) (Coy Laboratory Products, Grass Lake MI). XRD data were collected with a Scintag X1 powder diffract meter system using CuKα radiation with a variable divergent slit and a solid-state detector. Low-background quartz XRD slides (Gem Dugout, Inc., Pittsburgh, Pennsylvania) were used for the calibration.
Fourier Transform Infrared Spectroscopy (FTIR) Fourier transform infrared spectroscopy (FTIR) was used to confirm intercalation of cysteine into the interlayer of the nontronite structure and to detect structural changes as a result of bioreduction. Dried clay powder was pressed to form a pellet. Infrared spectra were collected with a Harrick Split-pea ATR microscope interfaced to a Perkin- Elmer 2000 Fourier transform infrared spectrometer. This accessory employed a silicon internal reflection element (IRE) and the standard deuterium triglycine sulfate (DTGS) detector on the Spectrum 2000 macro bench. Spectra collected using this device represent the average of 32 individual scans possessing a spectral resolution of 4 cm-1. The samples were brought into intimate contact with the IRE using a loading of 0.5 kg.
Scanning and Transmission Electron Microscopy (SEM and TEM)
178 Mineralogical changes were further studied with SEM and TEM. SEM samples were prepared following a previously published procedure (Dong et al., 2003). Briefly, cell-mineral suspensions were fixed in 2.5% glutaraldehyde in bicarbonate solution and one droplet of fixed suspension was placed on the surface of a glass cover slip that was cleaned with 1 mg/mL polylysine solution prior to use. The nontronite particles were allowed to settle onto the cover slip for 15 min. The sample-coated cover slip was sequentially dehydrated using varying proportions of ethanol and distilled water followed by critical point drying. The cover slip was mounted onto a SEM stub and Au coated for observation using a Zeiss Supra 35 FEG-VP SEM. The SEM was operated at an accelerating voltage of 10 to 15 kV. A short working distance (6–10 mm) and low beam current (30–40 mA) were used to achieve the best image resolution. A longer working distance (8 mm) and higher beam current (50 –70 mA) were used for qualitative energy dispersive spectroscopy (EDS) analysis. Both nonreduced control and bioreduced solid samples were imbedded with Nanoplast resin and sliced using a microtome for TEM observations (Kim et al., 2003; 2004). The advantage of using hydrophilic Nanoplast resin in this study is that solvent exchange (methanol/water exchange) is not required, which is necessary in the L.R. White resin impregnation technique (Kim et al., 1995). Because solvent exchange can cause artifacts, such as dissolution of organic matters, this Nanoplast resin is preferred. High magnification (up to 400 k times) was applied for measurements of secondary mineral phases to resolve fine lattice fringes. A JEOL 3010 TEM operating at 300 keV with a LaB6 filament was used for all TEM analyses. Sample preparations for TEM and SEM observations were performed in an anaerobic glove box except during critical point drying, Au coating, polymerization of resin and microtoming.
RESULTS Characterization of cysteine- and toluene-intercalated nontronites The amount of cysteine incorporated into the interlayer of the nontronite structure was 92 mg per gram of NAu-2. Because cysteine is a reductant, even though the synthesis of cysteine-nontronite was carried out in air, there was 28.4% of Fe(III) reduction. This Fe(III) reduction could mostly likely have happened when dissolved
179 oxygen in the aqueous solution was consumed by cysteine, as it is an effective oxygen scavenger (Logan et al., 2005). When oxidized by oxygen, cysteine converts into cystine. Thus, some amount of cysteine may have been lost via this pathway, and the cysteine concentration in cysteine-nontronite (92 mg/g) may be overestimated. As a result of Fe(III) reduction and its subsequent solubilization during the synthesis, the total Fe content in cysteine-nontronite decreased to 15.1%, and 0.01% of which was Fe(II). The sum of this remaining Fe(III) in cysteine-nontronite and that released into aqueous solution was the same as that originally present in NAu-2. The increase in the d(001) spacing from 11.08 Å (at 2θ = 7.96 degree) for nontronite NAu-2 to 18.8 Å (at 2θ = 4.7 degree) for cysteine-nontronite confirms that cysteine was intercalated into the interlayer of the nontronite structure (NAu-2) (Fig. 1a). The IR spectrum for cysteine-nontronite shows changes of main functional groups relative to native NAu-2 (Fig. 2). In particular, the characteristic absorption bands of - -1 -1 - -1 NH3 (3130 - 3030 cm and 1640-1610 cm ), COO (1600-1650 cm ), and CH2 (2926- 2853 cm-1) indicates that the interlayer cysteine formed complex with the interlayer Cu2+ in the nontronite structure (Brigatti et al., 1999). The amount of toluene intercalated into the interlayer of the nontronite structure per gram of NAu-2 was 43 mg. The total Fe content in toluene-nontronite was 20.0%, only slightly lower than 23.4% for NAu-2. The Fe(II) content was 0.74% of the total iron. Rather than any Fe(III) reduction or dissolution of nontronite during synthesis, this decrease in the total Fe content was caused by addition of HDTMA and toluene in the interlayer. The d(001) spacing of toluene-nontronite increased to 14.02 Å after HDTMA and toluene were intercalated into the nontronite structure (Fig. 1b).
Microbial reduction of Fe(III) in nontronite and organic matter intercalated nontronite The extent of Fe(III) bioreduction in nontronite NAu-2 reached 20.5% in 41 days (Fig. 3a), similar to that observed previously in our laboratory (Jaisi et al., 2005). During the same time period, 15.7% of Fe(III) bioreduction was measured for cysteine- nontronite (relative to the amount of Fe(III) remaining in this complex). Over the course of the bioreduction, 8.5% of cysteine was slowly released into aqueous solution while no
180 cysteine was released in the control (Fig. 3b), suggesting partial dissolution of cysteine- nontronite upon Fe(III) reduction. Because the relative partitioning of the released cysteine between clay surfaces and aqueous solution was not known, it was not possible to determine the mass balance of the interlayer cysteine as a result of bioreduction. In contrast to the bioreduction of Fe(III) in cysteine-nontronite, the extent of Fe(III) bioreduction in toluene-nontronite was only 5.4% in 8 days (Fig. 3c), and 4.4% of toluene was released into solution (Fig. 3d). There was little difference in toluene release between the abiotic control and bioreduced toluene-nontronite.
Cell numeration The viable cell number was counted to be 2.2 x 106 cells/mL in the bioreduced cysteine-nontronite sample and only 4.5 x 105 cells/mL in the bioreduced nontronite. These cell numbers represented a significant decrease from the initial cell concentration of 1 x 108 cells/mL, but less so for the bioreduced cysteine-nontronite system. In the toluene-nontronite experiment, the cell number was 5 x 105 and 2.1 x 107 in bioreduced toluene-nontronite and bioreduced NAu-2, respectively, but more so for the toluene- nontronite system.
X-ray Diffraction (XRD) The structural changes of nontronite NAu-2 and cysteine-nontronite upon microbial Fe(III) reduction were detected by XRD (Fig. 1). Bioreduction of Fe(III) in nontronite resulted in disappearance of the peak at 11.08 Å (2θ = 7.96 degree) and appearance of peaks at 12.5 Å (2θ = 7.1 degree), 20.1 Å (2θ = 4.4 degree), and 10.2 Å (2θ = 8.6 degree). The peaks for cysteine-nontronite at 2θ = 4.7 and 9.4 degrees, which corresponded to d(001) = 18.8 Å and d(002) = 9.5 Å, respectively, disappeared upon Fe(III) reduction. Instead, two new peaks at 2θ = 6.8 and 8.9 degrees with d-spacings of 13.3 Å and 10.0 Å, respectively, appeared in the bioreduced cysteine-nontronite. These two new peaks more likely corresponded to high charge nontronite (Gates et al., 1998) and discrete illite (Kim et al., 2004), respectively. In order to confirm that the 10-Å peak was from discrete illite, the bioreduced material was treated with ethylene glycol. The 10- Å illite peak remained at the same position and two new peaks 17.2, and 8.6 Å, the first-
181 and second-order of expanded smectite peak, appeared at the expense of the 13.3 Å peak. The reduced intensity of the peaks was caused by a small amount of material on the glass slide. The d(001) spacing of the bioreduced toluene-nontronite slightly increased from 14 to 14.6 Å, and that of the abiotic toluene-nontronite control remained at 14 Å (Fig. 1b).
Scanning Electron Microscopy (SEM) Irregular flaky particles were observed in the abiotic cysteine-nontronite control with SEM (Fig. 4a). Qualitative SEM energy dispersive spectroscopy (EDS) showed a very low Al/Si ratio, typical of the starting NAu-2 composition. The relatively low Fe content was caused by loss of a large fraction of Fe during synthesis of this material. A high amount of C, S and Cu was probably due to the interlayer cysteine-Cu3+ complex (inset in Fig. 4a). Particles in the bioreduced cysteine-nontronite, however, were more rounded than those in the control (Fig. 4b). In addition, new mineral precipitates (labeled as A, B, C, D, and E) were observed with different chemical compositions (the inset in Fig. 4b). The elemental composition of grain A exhibited a high Al/Si ratio, low Fe, and high K content, typical of illite. Grain C was identified as residual cysteine-intercalated nontronite. Grain D showed a significant amount of increase in the Al content (relative to grain C and E) and a low amount of K content. High C, S, and Cu contents, which were detected in the control (Fig. 4a), disappeared in grain D and E. Grain D and E might be the intermediate phases between cysteine-nontronite and illite, such as high charge nontronite. Grain B was identified as biogenic silica. Bioreduced toluene-nontronite and its control were also characterized with SEM. No obvious changes were observed in either morphology or element composition as a result of Fe(III) bioreduction (Fig. 4c, d).
Transmission Electron Microscopy (TEM) Lattice fringe spacings were measured for a total of 56 and 124 packets for bioreduced- and nonreduced cysteine-nontronite, respectively. Layer spacings of 14 and 15 Å were dominant in the unreduced cysteine-nontronite (Fig. 5, 6a). The difference in d(001) spacing between XRD and TEM measurements was most likely caused by some extent of dehydration under high vacuum in the electron column of TEM. The Fe(III) bioreduction decreased the proportions of larger layer spacings (14 and 15 Å) and
182 increased smaller ones (10 to 12 Å) (Fig. 5). A mixture of Fe-rich precipitates, newly formed illite phases (I), and residual cysteine-nontronite packets (12-13 Å layer spacings) were observed in the bioreduced cysteine-nontronite sample (Fig. 6b). Illite was identified based on the EDS composition (the inset of Fig. 6b) showing a high Al/Si ratio and K content. The high Fe content was most likely due to contamination of illite by the Fe-rich precipitates. The inset selected area electron diffraction (SAED) of the Fe- precipitates (outlined area in Fig. 6b) displayed the ring patterns with 1.9-, 2.8-, and 3.5- Å spacings (Fig. 6c). These layer spacings were consistent with siderite. High magnification (up to 400 K times) TEM was employed to capture the structure of secondary phase minerals (Fig. 7). Aggregates of the Fe-precipitates with 11- Å spacings were dominant (Fig. 7a). The outlined area in Fig. 7a, when magnified, showed randomly oriented nanoparticles with the dominant spacings of 3.6 Å (Fig. 7b). The particle size of the Fe precipitates was small, often less than 30-60 Å. The inset SAED pattern showed three strongest rings, with d-spacings of 3.6-, 2.7-, and 2.9- Å, respectively. These spacings were consistent with siderite. The newly formed illite aggregates (I) with residual cysteine-nontronite (12- Å spacings) were displayed in Fig. 7c. The outlined area of the aggregates in Fig. 7c, when magnified, showed an illite packet consisting of 8-10 layers with 10- Å spacings (Fig. 7d). The inset SAED pattern displayed the discrete Bragg reflections of illite with d(001) = 1.0 nm. In contrast to the extensive mineralogical changes that occurred in the cysteine-nontronite, the d(001) layer spacings of toluene- nontronite did not change and the biogenic minerals were not precipitated as a result of bioreduction (Fig. 8a, b). Total 76 and 97 packets for nonreduced and bioreduced toluene-nontronite were measured on the lattice fringes and the average value of layer spacing for both was 14 Å.
DISCUSSION Influence of interlayer organic matter on Fe(III) bioreduction
The two types of organic matter present in the interlayer of the nontronite structure exhibited a contrasting behavior in influencing Fe(III) bioreduction. The extent
183 of Fe(III) reduction for the cysteine-nontronite system and the nontronite bioreduction system was similar within 41 days, despite the lower amount of Fe(III) in cysteine- nontronite. In contrast, toluene significantly decreased the extent of Fe(III) bioreduction relative to that for bioreduction of pure nontronite. Cysteine, when present in aqueous solution, can serve as an electron shuttle or mediator, thus significantly stimulating the reduction extent of Fe(III) in cultures of Geobacter sulfurreducens (Doong and Schink, 2002). In our experiments, the cysteine released into aqueous solution could have served as an electron shuttle, thus enhancing Fe(III) bioreduction. However, an external electron shuttle, AQDS, was already present in the system. Thus, the presence of an additional electron shuttle may not have had much effect as shown in our data (Fig. 3a). Cysteine is also a known essential amino acid for bacteria and its presence may have promoted cell growth and Fe(III) bioreduction. Indeed, in comparison with the extent of decrease in cell number in the bioreduction experiment with nontronite alone (from 1 x 108 to 4.5 x 105 cells/mL), this decrease was much less for the cysteine-nontronite system (from 1 x 108 to 2.2 x 106 cells/mL). In contrast, toluene is not a nutrient and may even be toxic. Thus, its presence may inhibit bacterial activity (Stiner and Halverson, 2002). So the presence of toluene, even in a solid matrix, may have inactivated CN32 cells and may have been responsible for the decreased extent of Fe(III) bioreduction relative to that with nontronite alone (without toluene). Indeed, our data showed a significant decrease in cell number (from 2 x 108 to 5 x 105 cells/mL) relative to the bioreduction of nontronite alone (from 2 x 108 to 2.1 x 107 cells/mL).
Promotion of the smectite to illite reaction by organic matter
Our data conclusively showed that certain types of organic matter, when intercalated in the interlayer of the smectite structure, facilitated illitization via reductive dissolution of nontronite. Cysteine could have multiple effects on promoting the smectite to illite reaction. It is an essential nutrient for bacterial growth. So its presence, even in the interlayer of the nontronite structure, would have been attractive to CN32 cells. They
184 may have attacked it by dissolving the nontronite structure, thus resulting in an enhanced extent of Fe(III) bioreduction (Fig. 3a) and release of the intercalated cysteine into aqueous solution (Fig. 3b). The released cysteine, as an organic acid, would have a catalytic effect on the smectite illitization, similar to the effects of K-oxalate and K- acetate on this reaction (Small, 1994). This study supplements our previous study in that microbes play an important role in promoting the smectite to illite reaction (Kim et al., 2004). This reaction typically requires conditions of 300 to 350oC, 100 megapascals, and 4-5 months in the absence of microbial activity. But in its presence, it takes place at 1 atmosphere and room temperature. In our early study, a growth medium was used, where the smectite to illite reaction may have been coupled with microbial growth. In our current study, we have demonstrated that even in a non-growth medium, more typical of natural environments, this microbially mediated reaction can take place, as long as there is cysteine present in the interlayer of the nontronite structure. Cysteine is a natural degradation product of organic matter and may be present in soils and sediments. Thus, cysteine, nontronite, and iron-reducing microorganisms may co-exist in natural environments and may be important in promoting the smectite to illite reaction, even when microbial growth conditions are absent. In contrast, the presence of toluene in the interlayer of the nontronite structure significantly inhibited Fe(III) bioreduction of nontronite, even in the presence of an electron shuttle AQDS. As a result, there was no nontronite dissolution and illite formation. These data suggest that toluene may be toxic to CN32 cells, and its presence may have inactivated CN32 reducing activity. Alternatively, the presence of toluene in the interlayer may have partially blocked the electron transfer chain, thus making Fe(III) bioreduction more difficult. Because of the presence of toluene, AQDS could not even enter the interlayer to facilitate the electron transfer. These data appear to suggest that electron transfer in clay minerals takes place from the interlayer region to the Fe(III) centers in either the tetrahedral or octahedral Fe(III) sheets. These data are consistent with our recent study showing that the tetrahedral Fe(III) is preferentially reduced relative to the octahedral Fe(III) (Jaisi et al., 2005).
185 Stability of Cu-cysteine complex in natural environments A previous study (Brigatti et al., 1999) has shown that Cu-cysteine complex within the interlayer of the smectite structure is stable and can be resistant to migration in soils and ground waters. Thus, Cu, as a toxic heavy metal, may be sequestered via this mechanism (Brigatti et al., 1999). The results of this study, however, points out the importance of understanding the effect of microorganisms on metal sequestration into clay minerals. If the smectite contains a certain amount of Fe(III) in the structure, and if iron-reducing bacteria are present, these bacteria can reduce the structural Fe(III) under anoxic conditions, partially dissolve the clay structure, and thus remobilize Cu. Iron- reducing bacteria are abundant in soils and sediments (Lovley, 2000). Recently, even thermophilic iron-reducing bacteria have been found in the subsurface (Boone et al., 1995; Kashefi and Lovley, 2003; Roh et al., 2002), highlighting the importance of understanding biogeochemistry in designing metal sequestration technologies.
CONCLUSIONS The effect of organic matter on the smectite to illite reaction is dependent on the nature of organic matter and its interactions with iron-reducing bacteria. Whereas the presence of cysteine in the interlayer of the nontronite significantly promoted Fe(III) bioreduction in nontronite and resulted in a significant extent of illitization, toluene significantly inhibited Fe(III) bioreduction and there was no illite formation. This contrasting behavior was ascribed to the nature of organic matter-bacteria interactions. Cysteine is a nutrient to bacteria and its presence enhanced cell growth and reduction activity. Toluene is a toxic compound and its presence may have inhibited bacterial iron reduction activity. These results definitively demonstrate that iron-reducing microorganisms can significantly promote the smectite to illite reaction, even in a non- growth condition. We further conclude that it is important to consider the effect of microorganisms on the stability of metal sequestration in the structure of clay minerals, as microorganisms can remobilize metals, depending on the nature of the clay mineral, bacteria, and metals involved in the system.
ACKNOWLEDGMENTS
186 This research was supported by a grant from National Science Foundation (EAR-0345307). Some part of this research was supported by a student grant from the Clay Mineral Society (Student Research Grant, 2004) to GZ. JWK publishes with NRL contribution number NRL/JA/7430-06-3.
REFERENCES CITED
Ahn, J.H., and Peacor, D.R. (1989) Illite/smectite from Gulf Coast: a reappraisal of transmission electron microscope images. Clays & Clay Minerals, 37, 542-546. Andrade, S., Hypolito, R., Ulbrich, H.H.G.J., and Silva, M.L. (2002) Iron(II) oxide determination in rocks and minerals. Chemical Geology, 182, 85-89. Bauer, A., and Velde, B. (1999) Smectite transformation in high molar KOH solutions. Clay Minerals, 34(2), 259-273. Bethke, C.M., and Altaner, S.P. (1986) Layer-by-layer mechanism of smectite illitization and application to a new rate law. Clays & Clay Minerals, 34, 136-145. Boone, D.R., Liu, Y., Zhao, Z., Balkwill, D.L., Drake, G.R., Stevens, T.O., and Aldrich, H.C. (1995) Bacillus infernus sp. nov., an Fe(III)- and Mn(IV)-reducing anaerobe from the deep terrestrial subsurface. International Journal of Systematic Bacteriology, 45(3), 441-448. Brigatti, M.F., Lugli, C., Montorsi, S., and Poppi, L. (1999) Effects of exchange cations and layer-charge location on cysteine retention by smectites. Clays and Clay Minerals, 47(5), 664-671. Dong, H. (2005) Interstratified Illite-Smectite: A Review of Contributions of TEM Data to Crystal Chemical Relation and Reaction Mechanisms. Clay Science, 12(supplement 1), 6-12. Dong, H., Kostka, J.E., and Kim, J.W. (2003) Microscopic evidence for microbial dissolution of smectite. Clays and Clay Minerals, 51(5), 502-512. Dong, H., and Peacor, D.R. (1996) TEM observations of coherent stacking relations in smectite, I/S and illite of shales: evidence for MaEwan crystallites and dominance
of 2M1 polytypism. Clays and Clay Minerals, 44, 257-275.
187 Dong, H., Peacor, D.R., and Freed, R.L. (1997) Phase relations among smectite, R1 I/S and illite. American Mineralogist, 82, 379-391. Doong, R.A., and Schink, B. (2002) Cysteine-Mediated Reductive Dissolution of Poorly Crystalline Iron(III) Oxides by Geobacter sulfurreducens. Environ. Sci. Technol., 36(13), 2939-2945. Drits, V.A., Salyn, A.L., and Sucha, V. (1996) Structural transformations of interstratified illite-smectites from Dolna Ves hydrothermal deposits: dynamics and mechanisms. Clays & Clay Minerals, 44, 181-190. Eberl, D.D., and Srodon, J. (1988) OSwald ripening and interparticle-diffraction effects for illite crystals. American Mineralogist, 73, 1335-1345. Gates, W.P., Jaunet, A.M., Tessier, D., Cole, M.A., Wilkinson, H.T., and Stucki, J.W. (1998) Swelling and texture of iron-bearing smectites reduced by bacteria. Clays & Clay Minerals, 46(5), 487-497. Gates, W.P., Wilkinson, H.T., and Stucki, J.W. (1993) Swelling Properties of Microbially Reduced Ferruginous Smectite. Clays and Clay Minerals, 41(3), 360-364. Hoffman, J., and Hower, J. (1979) Clay mineral assemblages as low grade metamorphic geothermometers: application to the thrust-faulted disturbed belt of Montana, U.S.A. In P.A. Scholle, and P.R. Schluger, Eds. Aspects of diagenesis, 26, p. 55- 80. Society of Economic Paleontologists and Mineralogists Special Publication. Hower, J., Eslinger, E.V., Hower, M.H., and Perry, E.A. (1976) Mechanism of burial metamorphism of argillaceous sediments. 1. Mineralogical and chemical evidence. Geological Society of America Bulletin, 87, 725-737. Huang, W.-L., Longo, J.M., and Pevear, D.R. (1993) An experimentally derived kinetic model for smectite-to-illite conversion and its use as a geothermometer. Clays and Clay Minerals, 41, 162-177. Jaisi, D.P., Kukkadapu, R.K., Eberl, D.D., and Dong, H.L. (2005) Control of Fe(III) site occupancy on the rate and extent of microbial reduction of Fe(III) in nontronite. Geochimica Et Cosmochimica Acta, 69(23), 5429-5440. Kashefi, K., and Lovley, D.R. (2003) Extending the upper temperature limit for life. Science, 301, 934.
188 Keeling, J.L., Raven, M.D., and Gates, W.P. (2000) Geology and characterization of two hydrothermal nontronites from weathered metamorphic rocks at the Uley Graphite Mine, South Australia. Clays and Clay Minerals, 48(5), 537-548. Keil, R.G., Tsamakis, E., Giddings, J.C., and Hedges, J.I. (1998) Biochemical distributions (amino acids, neutral sugars, and lignin phenols) among size-classes of modern marine sediments from the Washington coast. Geochimica Et Cosmochimica Acta, 62(8), 1347-1364. Keller, M.D., Bellows, W.K., and Guillard, R.R.L. (1988) Microwave Treatment for Sterilization of Phytoplankton Culture Media. Journal of Experimental Marine Biology and Ecology, 117(3), 279-283. Kennedy, M.J., Pevear, D.R., and Hill, R.J. (2002) Mineral surface control of organic carbon in black shale. Science, 295(5555), 657-660. Kim, J.W., Dong, H., Seabaugh, J., Newell, S.W., and Eberl, D.D. (2004) Role of microbes in the smectite-to-illite reaction. Science, 303(5659), 830-832. Kim, J.W., Newell, S., Furukawa, Y., Lavoie, D., and Daulton, T. (2003) Characterization of microbially Fe(III)-reduced nontronite: environmental cell transmission electron microscopy. Clays & Clay Minerals, 51(4), 382-389. Kim, J.W., Peacor, D.R., Tessier, D., and Elsass, F. (1995) A technique for maintaining texture and permanent expansion of smectite interlayers for TEM observations. Clays & Clay Minerals, 43, 51-57. Kostka, J.E., Haefele, E., Viehweger, R., and Stucki, J.W. (1999a) Respiration and dissolution of iron(III)-containing clay minerals by bacteria. Environmental Science and Technology, 33, 3127-3133. Kostka, J.E., Stucki, J.W., Nealson, K.H., and Wu, J. (1996) Reduction of structural Fe(III) in smectite by a pure culture of Shewanella putrefaciens strain MR-1. Clays and Clay Minerals, 44(4), 522-529. Kostka, J.E., Wu, J., Nealson, K.H., and Stucki, J.W. (1999b) The impact of structural Fe(III) reduction by bacteria on the surface chemistry of smectite clay minerals. Geochimica et Cosmochimica Acta, 63(22), 3705-3713.
189 Li, H., Sheng, G.Y., Teppen, B.J., Johnston, C.T., and Boyd, S.A. (2003) Sorption and desorption of pesticides by clay minerals and humic acid-clay complexes. Soil Science Society of America Journal, 67(1), 122-131. Lindgreen, H., and Hansen, P.L. (1991) Ordering of illite/smectite in Upper Jurassic claystones from the North Sea. Clay Minerals, 26, 105-125. Ll, H., Teppen, B.J., Laird, D.A., Johnston, C.T., and Boyd, S.A. (2004) Geochemical modulation of pesticide sorption on smectite clay. Environmental Science & Technology, 38(20), 5393-5399. Logan, B.E., Murano, C., Scott, K., Gray, N.D., and Head, I.M. (2005) Electricity generation from cysteine in a microbial fuel cell. Water Research, 39(5), 942-952. Lovley, D.R. (2000) Fe(III) and Mn(IV) reduction. In D.R. Lovley, Ed. Environmental microbe-metal interactions, p. 3-30. ASM Press, Washington, DC. Nadeau, P.H., Wilson, M.J., McHardy, W.J., and Tait, J.M. (1985) The conversion of smectite to illite during diagenesis: evidence from some illitic clays from bentonites and sandstones. Mineralogical Magzine, 49(393-400). Pytte, A.M., and Reynolds, R.C., Jr. (1989) The thermal transformation of smectite to illite. In N.D. Naeser, and T.H. McCulloh, Eds. Thermal history of sedimentary basins: Methods and case histories, p. 133-140. Springer-Verlag, New York. Riddles, P.W., Blakeley, R.L., and Zerner, B. (1983) Reassessment of Ellman Reagent. Methods in Enzymology, 91, 49-60. Roh, Y., Liu, S.V., Li, G.S., Huang, H.S., Phelps, T.J., and Zhou, J.Z. (2002) Isolation and characterization of metal-reducing Thermoanaerobacter strains from deep subsurface environments of the Piceance Basin, Colorado. Applied and Environmental Microbiology, 68(12), 6013-6020. Sharmasarkar, S., Jaynes, W.F., and Vance, G.F. (2000) BTEX sorption by montmorillonite organo-clays: TMPA, ADAM, HDTMA. Water Air and Soil Pollution, 119(1-4), 257-273. Sheng, G.Y., Johnston, C.T., Teppen, B.J., and Boyd, S.A. (2001) Potential contributions of smectite clays and organic matter to pesticide retention in soils. Journal of Agricultural and Food Chemistry, 49(6), 2899-2907.
190 Small, J.S. (1994) Fluid composition, mineralogy and morphological-changes associated with the smectite-to-illite reaction - an experimental investigation of the effect of organic-acid anions. Clay Minerals, 29(4), 539-554. Stiner, L., and Halverson, L.J. (2002) Development and Characterization of a Green Fluorescent Protein-Based Bacterial Biosensor for Bioavailable Toluene and Related Compounds. Appl. Environ. Microbiol., 68(4), 1962-1971. Stixrude, L., and Peacor, D.R. (2002) First-principles study of illite-smectite and implications for clay mineral systems. Nature, 420, 165-168. Stucki, J.W., Komadel, P., and Wilkinson, H.T. (1987) Microbial reduction of structural iron(III) in smectites. Soil Science Society of America Journal, 51(6), 1663-1665. Uysal. (2004) Hydrothermal control on organic matter alteration and illite precipitation, Mt Isa Basin, Australia. Geofluids, 4(2), 131. Veblen, D.R., Guthrie, G.D., Livi, K.J.T., and Reynolds, R.C., Jr. (1990) High-resolution transmission electron microscopy and electron diffraction of mixed-layer illite/smectite: experimental results. Clays & Clay Minerals, 38, 1-13. Whitney, G. (1990) Role of water in the semctite to illite reaction. Clays & Clay Minerals, 38, 343-350. Whitney, G., and Northrop, H.R. (1988) Experimental investigation of the smectite to illite reaction: dual reaction mechanisms and oxygen-isotope systematics. American Mineralogist, 73, 77-90.
191 FIGURE CAPTIONS FIGURE 1. (a) XRD patterns for oriented specimens of NAu-2, bioreduced NAu-2, ethylene glycolated bioreduced NAu-2, abiotic cysteine-NAu-2 control (no cells added), bioreduced cysteine-NAu-2, and ethylene glycolated bioreduced cysteine- NAu-2. (b) XRD patterns for oriented specimens of NAu-2, toluene-NAu-2, and abiotic toluene-NAu-2 control (no cells added), and bioreduced toluene-NAu-2,. G: sample was solvated with ethylene glycol vapor at 65oC.
FIGURE 2. Comparison of FTIR spectra for nontronite, cysteine, and cysteine-NAu-2 -1 complex. Label A refers to the stretching of CH2 (2926-2853 cm ) and stretching of NH3+ groups (3130-3030); label B refers to NH3+ deformation and COO- asymmetric stretching modes.
FIGURE 3. (a) Fe(III) reduction with time as measured by 0.5 M HCl-extractable Fe(II) in bioreduced NAu-2, cystiene-NAu-2, and cystiene-NAu-2 control (no cells added). (b) Release of cysteine into aqueous solution from the cysteine-NAu-2 complex as a result of bioreduction. (c) Fe(III) reduction with time as measured by 0.5 M HCl-extractable Fe(II) in NAu-2 control (no cells), bioreduced NAu-2, toluene-NAu-2, and toluene-NAu-2 control (no cells added). (d) Release of toluene into aqueous solution from toluene-NAu-2 complex as a result of bioreduction and in the control (no cells added). All results were from duplicate treatments.
FIGURE 4. (a) Secondary electron image showing the remaining cysteine-NAu-2 complex in the abiotic control after 41 days of incubation. The inset is a SEM- EDS spectrum of the cysteine-NAu-2 complex showing a typical elemental composition of the complex. The Au peak is from Au coating. (b) Secondary electron image showing bioreduced cysteine-NAu-2 after 41 days of incubation. The right panel shows SEM-EDS spectra of Grain A, B, C, D and E. (c) Secondary electron image showing the remaining toluene-NAu-2 complex in the abiotic control (no added cells) after 8 days of incubation. The inset is a SEM-
192 EDS spectrum of toluene-NAu-2 complex showing a typical elemental composition. (d) Secondary electron image showing bioreduced toluene-NAu-2 after 8 days of incubation. The inset is a SEM-EDS spectrum of bioreduced toluene-NAu-2 showing no change in the composition.
FIGURE 5. A histogram showing the distribution of layer spacings in the cysteine-NAu- 2 complex as a result of bioreduction in comparison with the abiotic control (no cells added). Total 56 and 124 packets for bioreduced and nonreduced cysteine- nontronite were measured.
FIGURE 6. TEM micrographs of a) nonreduced cysteine-nontronite with layer spacings of 14-15 Å; b) bioreduced cysteine-nontronite showing Fe-precipitates and illite (I) particles. The inset EDX shows typical illite composition of high Al/Si ratio and K.; c) high magnification image of the outlined area in (b) showing randomly oriented fringes with 1.9-, 2.8-, and 3.5-Å spacings on the SAED pattern, typical of siderite.
FIGURE 7. TEM micrographs of a) bioreduced cysteine-nontronite with 11 Å layers and Fe-precipitate mixtures; b) high magnification of the outlined area showing 3.6 Å fringes and typical siderite diffraction patterns with strong diffractions of 2.0-, 2.7-, and 3.6-Å spacings; c) illite precipitates having 10 Å lattice fringes confirmed with SAED pattern.
FIGURE 8. TEM micrographs of a) nonreduced and b) bioreduced toluene-nontronite lattice fringes. 14- Å layer spacings were dominant for both samples.
193 a 17.2 10.0 Bioreduced cysteine NAu-2(G)
10.0
18.8 13.3
Bioreduced cysteine NAu-2 9.5
18.6 Abiotic cysteine NAu-2
12.5 20.2 Bioreduced NAu-2(G)
10.2 11.08 Bioreduced NAu-2
NAu-2
2 4 6 8 10 12 14 2-Theta b 14.02
14.67
11.08
14.02 Bioreduced toluene NAu-2
Toluene NAu-2
Abiotic toluene NAu-2 NAu-2 3579111315 2-Theta Zhang et al. Figure 1
194
2094 3566 1627 3561 3025
1337 1193 ) A 1620 1484 1297 614
%
( 670 1382
e c 1405 776 n 1581 872 789
a
t 674
t i B 823
m 845
s
n 842 538
a
r
T
992 491 1008 488
3900 3400 2900 2400 1900 1400 900 400 Wavenumber cm-1
989 1139
1642 ) 2561
%
( 1616
e
c
n 1059
a
t 3016 t 3360
i
m
s 1567
n
a 2859 1431 930 r 1106 T A 634 837 1398 868 1738 B 777 1516 1206 1219
3900 3400 2900 2400 1900 1400 900 400 Wavenumber cm-1 Cysteine +NAu-2 Nontronite Cysteine
Zhang et al. Figure 2
195 25 a ) Bioreduced NAu-2 20
15 Bioreduced cysteine NAu-2 10
5 Abiotic cysteine NAu2 co Fe(III) reduction (% 0 0 10203040Days
10 Bioreduced cysteine NAu-2 b 8 6 4 2 Cysteine NAu-2 control
Released Cysteine % Cysteine Released 0 0 10203040Day s
) 30 c Bioreduced NAu-2 25 20 15 Toluene NAu-2 Control 10 Bioreduced Toluene NAu-2 5 NAu-2 control Fe(III) reduction (% 0 02468Day s
d
% 6 5 Bioreduced Toluene NAu-2 4 3 2 1 Toluene NAu-2 control
Released Toluene Released 0 02468Day s
Zhang et al. Figure 3a - d
196
2000 Si Au 1500 O Fe S 1000 Na
Counts Al C 500 Fe Cu
0 02468Energy (keV)
Zhang et al. Figure 4a
197 Si Grain A
Al O
Au K Fe
Si GrainB
O
Au Na Counts
Si Grain C and E
O
Fe Au Al S Na Fe Cu
O Si Grain D Al
Na Au K Fe
0246810 Energy (keV)
Zhang et al. Figure 4b
198 3000 Si O Si 2000 O 2000
Counts Al
Counts 1000 C 1000 Fe C Fe Al Au Fe Au Fe
0 0 02468Energy (keV) 02468Energy (keV)
Zhang et al. Figure 4c-d
199
Zhang et al. Figure 5
200
Zhang et al. Figure 6a - c
201
Zhang et al. Figure 7a - d
202
Zhang et al. Figure 8a - b
203 CHAPTER 7:
SUMMARY This study is the first comprehensive investigation into microbial communities in ultra-high pressure metamorphic (UHPM) rocks and conclusively demonstrates that microorganisms survive in the deep subsurface and affect mineral and geochemical reactions. Characterization of the relationship between microbial community and the host UHPM rocks/fluids was made possible by integrating studies of culture dependent, culture independent and microbial-mineral interactions. The unique UHPM rocks had low porosity, permeability, abundant fluid/gas inclusions and multiple structural weak zones Despite these extreme conditions, our culture-based results indicated the presence of active microorganisms [Fe(III) reducers and Fe(II) oxidizer] in these rocks and their growth habitats were consistent with the geochemical characteristics of the rocks and the fluids from depth. The growth habitats of microbes from the UHPM rocks are typically facultative, nitrate-reducing and mesophilic. We infer that these microbes reside in fluid/gas inclusions inside the UHPM rocks. Circulating drilling fluid is often regarded as a contamination source in investigations of subsurface microbiology. However, it also provides an opportunity to sample geological fluids at depth and to study contained microbial communities. The growth habitats of microbes from the fluids are anaerobic, thermophilic, alkaliphilic and Fe-reducing or oxidizing, suggesting that these organisms may be derived from a different environment.
My second important contribution is enrichment and identification of an Fe(III)- reducing/Fe(II)-oxidizing enrichment/organism. We have enriched organisms that are capable of iron redox cycling at high temperatures relevant to the subsurface conditions. The ability of organisms to recycle electrons between Fe(II) and Fe(III) has a tremendous impact not only on the redox processes of the environment, but also on the microbial energetics. Recycling of electrons between Fe(II) and Fe(III) provides a renewable energy source for microbial ecology. These results have important implications for iron cycling in the deep subsurface. At present, our current work has identified the dominant
204 organism as Thermoanaerobacter ethanolicus, a thermophilic organism that is previously known to reduce Fe(III) only. However, our work may suggest that it may be capable of Fe(II) oxidation as well. The third major contribution of this research is on mineral-microbe interactions. The geological environments (e.g. rock types, temperature, pH) affect microbial respiration, and microbial respiration alters the geological environments. In To address these questions, isolated iron reducing bacteria from the CCSD project were used to study dissolution, precipitation and transformation of clay minerals and iron oxides. The interactions of microbes with these minerals were studied by inoculating T. ethanolicus (thermophilic) and Shewanella putrefaciens (mesophilic) with these minerals under different temperature, pH and electron donor conditions. Our results show that microbially mediated smectite-illite reaction was accomplished via dissolution of smectite and precipitation of illite. These findings highlight the significant role of iron reducing bacteria in promoting the smectite to illite reaction under conditions present in sedimentary basins.
Overall, our results suggest that indigenous microbes indeed live in the UHPM rocks and may play an important role in mineral dissolution and precipitation.
Despite many achievements of this research, many important questions remain for future research such as: 1) What are the criteria to identify indigenous microbes from the deep subsurface? 2+ 2) What are possible energy sources (H2, CH4 or Fe ?) for microbial community in the deep subsurface? 3) How do microbial species communicate with each other in the deep subsurface under conditions of limited electron donors and acceptors? 4) What are the overall effects of microbe-mineral interactions on the subsurface geochemical processes?
205