Catalyzing Discovery in Mechanistic Biomedicine

Total Page:16

File Type:pdf, Size:1020Kb

Load more

The Max Perutz Labs Catalyzing discovery in mechanistic biomedicine A joint venture of Part of Mission Statement The Max Perutz Labs are dedicated to a mechanistic understanding of impor- tant biological processes. We have the potential to AATACTAGATATGAAAGATTCCCCCTTTATTTACACGGCTCTAGCAGCAGCGTCGTCAAGAAGAAAAGCCAGTACACGTACCAGAAAATAGAAGTAACAGCGTCCCCCATCGAATGGCTATTATGCAAAGGGTTACACAATAATTACCACCACCGTGAGACACCACCGCCAGCAGTGCTTATCCATATTCCAGCAGCCATACTTAGTATCGTCTATAACCAACAATAGATCATATCACGCAGCACCAGCAACGGGCTTCCGCCACCACCTTCAGCAGAAATGGTAGTAGTGGGAACAGCAGCACTAACGCCAACAACCGATGAGCGTTGGCAGCACCAGCAGTCCAGATACCGGAACATGCAGGCAGATCATCCGCCTCGCAAGAAGATAATGACGAAAAAAGAGTCACAATAGTCAAGATACGAACGGCAGGACCACGAGCATGGTACAAATTCGTACCACCTACCGCAACGTGGCATTACCAAGCACAACCATCCCCCAGGTACAACAAGATACAAGGCCGTACTATTCAGCTAATAGCAGGGACAAACCGGAGCATACTATCGAAACGGATACACGACTATGAGCAGCCGCCCCAAGAGGGAGACTTGACGGTAATGCGTCTTATGGCGCGAGATACAACAGTGTAGAGGTGGAGCAGGCGGATCGTATTACAGAGGGAGCAAAGGGGGGGTTATCACCATGCGAGACGAATACTCATCCACTCCTCCATGAGCGGATACACGGGAAATAATTATAGCAGA catalyze groundbreaking discoveries in mechanistic - biomedicine. - We combine world-class research facilities with modern teaching methods to educate, inspire, and empower the next generation of 21st century scientists. The Max Perutz Labs are a joint ven- ture between the University of Vienna and the Medical University of Vienna that builds on the unique opportunities that arise from being embedded in the Vienna BioCenter Campus while having one of the largest hospitals in Europe, the Vienna General Hospital, on our door step. In visualizing haemoglobin, Max Perutz paved the way towards the era of precision medicine. To realize its full potential, precision medicine necessitates a molecular mechanistic approach. Shaping the Future of the Max Perutz Labs 2005 Highlights Founding Part of the Vienna BioCenter 52/48 The Max Perutz Labs were founded The Max Perutz Labs are part of the 2017—2019 in 2005 as a joint venture of the Vienna BioCenter, one of Europe’s Female and Male Staff University of Vienna and the Medical hotspots for life sciences. University of Vienna. Facts & Figures The last two years have seen a period of significant change that will shape the future of the Max Max Perutz Labs Perutz Labs. With the Seeding Success in Science Symposium in 2017 we said farewell 366 to scientific director Graham Warren. at a Glance Arndt von Haeseler was elected as Research Grants, Graham’s successor and continues to With the implementation of a new ERC Grants Prizes and Awards lead the Max Perutz Labs today. He is name—Max Perutz Labs Vienna—we 1 ERC Starting Grant supported by a team of co-directors: aim to strengthen the identity of the Including 12 ERC Grants 3 ERC Consolidator Grants Alwin Köhler, Peter Schlögelhofer institute and reinforce our connection and 8 START Awards 1 ERC Proof of Concept Grant and Kristin Tessmar-Raible, as well with an outstanding scientist, leader as Fabien Martins as administrative and educator. The first Max Perutz Academic Achievements Data as of May Australia 2019 Mexico director. Day in May 2019 brought together our Full Professorship: Austria New Zealand stakeholders, scientists and students Andreas Bachmair, Verena Belarus Pakistan The Catalyzing Change project was to celebrate the 105th birthday and Jantsch, Alwin Köhler, Sascha Australia Belgium Australia Australia Mexico Mexico Poland Mexico kicked off in 2018 and has initiated an legacy of Max Perutz. Austria Austria Austria New Zealand New Zealand New Zealand Martens, Isabella Moll, Kristin Brazil Australia Portugal Mexico internal change process. It has brought Belarus Belarus Belarus Pakistan Pakistan Pakistan Tessmar-Raible, Bojan Zagrovic Belgium Bulgaria Belgium Austria Belgium Poland Poland RussiaNewPoland Zealand together all group leaders of the Max Researchers at the Max Perutz Labs Brazil Brazil Belarus Brazil Portugal PortugalPakistanPortugal Bulgaria Bulgaria Russia Russia Perutz Labs in a series of workshops continue to deliver internationally Associate Professorship: Canada Bulgaria Belgium Russia Serbia Poland Canada Canada Serbia Serbia Canada Brazil Serbia Portugal to redefine the mission of the institute, recognized research in fundamental Boris Görke, Thomas Leonard, China China Slovakia Slovakia China China Bulgaria Slovakia Slovakia Russia Croatia Croatia Slovenia Slovenia finding common ground in the pursuit biological processes. Our group lea- Gijs Versteeg Croatia Canada Slovenia Serbia Czech Croatia Republic Czech Republic Somalia Slovenia Somalia China Slovakia of mechanistic biomedicine. The new ders successfully secured multiple Estonia Czech Republic Estonia40+ Spain Somalia Spain Croatia Slovenia France Czech Republic Estonia France Switzerland Spain Somalia Switzerland Student Awards and Grants Czech Republic Somalia ‘Think Tank’, a meeting space de sig- high-profile grants, among them five Germany France GermanyNationalities Thailand Switzerland Thailand Estonia Estonia Spain Spain Greece Germany Greece The Netherlands Thailand The Netherlands ned to encourage exchange and com- highly competitive ERC grants. France Switzerland Uni:docs Fellowship: Hungary France Greece Hungary Tunesia The NetherlandsSwitzerland Tunesia munication was opened in November India Hungary Germany India Turkey TunesiaThailandTurkey Martina Borroni, Madhwesh Greece The Netherlands 2018. A new logo and visual appear- 2017—2019 also saw five Max Perutz IndonesiaGermany India Indonesia U.S.A. Turkey Thailand U.S.A. Coimbatore Ravichandran, Italy Indonesia Hungary Italy Ukraine U.S.A.TunesiaUkraine ance of the institute were introduced Labs group leaders promoted to full Japan Greece Italy India Japan United Kingdom Ukraine TheTurkeyUnited Netherlands Kingdom Merrit Romeike, Adriana Savova, Latvia Venezuela Latvia Japan Indonesia Venezuela United KingdomU.S.A. in May 2019 as a symbolic milestone, professor and three promoted to Lithuania Hungary Lithuania Tunesia Maria Velkova, Theresa Zekoll Latvia Italy Venezuela Ukraine kicking off a new era. associate professors, demonstrating India Lithuania Japan Turkey United Kingdom Latvia Venezuela the success of the tenure track system. DocAward: Indonesia Lithuania U.S.A. Research Groups and their relation to Research Areas Research Groups and their relation to Research Areas Finally, in July 2019 we celebrated Iva Lučić Italy Ukraine the 95th birthday of Professor Hans Research Groups and their relation to Research Areas 55 Group Leaders 55 Group Leaders VBC PhD Award: Japan and Lecturers andUnited Lecturers Kingdom Tuppy, who was honoured for his ResearchResearch Groups Groups and and their their relation relation to Research to ResearchAreas 114 Administrative Areas staff 114 Administrative55 staff Group Leaders Dorotea Fracchiolla, and science support and science support outstanding scientific achievements. Latvia 97 Post Docs and Lecturers Venezuela97 Post Docs Laura D. Gallego, Iva Lučić 114 Administrative staff 55 Group Leaders and Lecturers Lithuania and science support 97 Post Docs 114 Administrative staff At the Max Perutz Labs Vienna we ÖAW Doc Fellowship: and science support 97 Post Docs draw inspiration from the legacy of Tanja Kaufmann, Max Perutz, are home to the talented Anete Romanauska, scientists of today, and educate an Raffaela Torggler, Georg Vucak, Research Groups and their relation to Research Areas 7 50 452 aspiring young generation of scientists. Milica Vunjak Research Areas Research Groups Scientists & Over the next few years our institute 47 Undergraduates 47 Undergraduates L’Oreal Fellowship: 55 GroupStaff Leaders will continue to focus on our mission 126 PhD Students 126 PhD Students Laura D. Gallego and Lecturers to push forward the frontiers of mecha- Cell Biology & Signalling Computational Modelling Immunity & Infection Cell BiologyStructure & Signalling & Function Computational Modelling Immunity & Infection Structure & Function 47 Undergraduates of Biological Systems of Biological Systems of Macromolecular Chromatin, RNA & Mechanisms of HumanChromatin, of Macromolecular RNA & Mechanisms of Human 114 Administrative staff 126 PhD Students nistic biomedicine as we see more Assemblies Assemblies 47 Undergraduates Chromosome Biology Developmental Dynamics Disease Chromosome Biology Developmental Dynamics Disease and science support of the Catalyzing Change process Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function 12697 PhD Post Students Docs of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular coming to life. Cell Biology & Signalling Chromosome Biology DevelopmentalComputational Dynamics ModellingDisease Immunity & Infection AssembliesStructure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies 47 Undergraduates 126 PhD Students Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies Research Areas Research at the Max Perutz Labs Is Curiosity-Driven and Spans the Fields of Molecular and Cell Biology. Cell Biology & Signalling Chromatin, RNA & Computational Modelling Cells communicate at every level and Chromosome Biology of Biological Systems molecular misunderstandings must Unravelling nature’s genetic and Making
Recommended publications
  • Master's Position in Plant Molecular Biology

    Master's Position in Plant Molecular Biology

    Bachmair Lab Master’s position in plant molecular biology About the Bachmair lab Focus of the Bachmair lab lies on the biochemical and cell biological analysis of protein turnover driven by amino-terminal degradation signals. The biological context is how plants respond to environmental stimuli such as heat, flooding, or salt stress. Additional information can be found on the group page of the Bachmair lab. About the research project The applicant shall analyze protein turnover that depends on amino-terminal degradation signals. Firstly, expression of plant ubiquitin ligases via a synthetic biology approach in the budding yeast S. cerevisiae serves to elucidate turnover mechanisms. Secondly, expression vectors for so-called tandem fluorescent timer reporters shall be made and tested in plants. These vectors serve to investigate tissue- specificity and subcellular localization of turnover pathways. Candidates Successful candidates should have finished studies in Molecular Biology, Biochemistry or related (B. Sc.), and have 45 ECTS accomplished in the Master module. Interest in plant signal transduction and cellular homeostasis is advantageous. Duration: Ca. 12 months, starting Sep 2021 or later Payment: According to FWF payment scheme Contact: Univ.-Prof. Dr. Andreas Bachmair [email protected] Max Perutz Labs, Dept. of Biochemistry and Cell Biology, Univ. Wien Rm. 5110, Dr.-Bohr-Gasse 9, A-1030 Wien About the Max Perutz Labs The Max Perutz Labs are a research institute established by the University of Vienna and the Medical University of Vienna to provide an environment for excellent, internationally recognized research and education in the field of Molecular Biology. Dedicated to a mechanistic understanding of fundamental biomedical processes, scientists at the Max Perutz Labs aim to link breakthroughs in basic research to advances in human health.
  • Gesellschaft Und Psychiatrie in Österreich 1945 Bis Ca

    Gesellschaft Und Psychiatrie in Österreich 1945 Bis Ca

    1 VIRUS 2 3 VIRUS Beiträge zur Sozialgeschichte der Medizin 14 Schwerpunkt: Gesellschaft und Psychiatrie in Österreich 1945 bis ca. 1970 Herausgegeben von Eberhard Gabriel, Elisabeth Dietrich-Daum, Elisabeth Lobenwein und Carlos Watzka für den Verein für Sozialgeschichte der Medizin Leipziger Universitätsverlag 2016 4 Virus – Beiträge zur Sozialgeschichte der Medizin Die vom Verein für Sozialgeschichte der Medizin herausgegebene Zeitschrift versteht sich als Forum für wissenschaftliche Publikationen mit empirischem Gehalt auf dem Gebiet der Sozial- und Kulturgeschichte der Medizin, der Geschichte von Gesundheit und Krankheit sowie an- gren­­zender Gebiete, vornehmlich solcher mit räumlichem Bezug zur Republik Österreich, ihren Nachbarregionen sowie den Ländern der ehemaligen Habsburgermonarchie. Zudem informiert sie über die Vereinstätigkeit. Die Zeitschrift wurde 1999 begründet und erscheint jährlich. Der Virus ist eine peer-reviewte Zeitschrift und steht Wissenschaftlerinnen und Wissenschaftlern aus allen Disziplinen offen. Einreichungen für Beiträge im engeren Sinn müssen bis 31. Okto- ber, solche für alle anderen Rubriken (Projektvorstellungen, Veranstaltungs- und Aus stel lungs- be richte, Rezensionen) bis 31. Dezember eines Jahres als elektronische Dateien in der Redak- tion einlangen, um für die Begutachtung und gegebenenfalls Publikation im darauf ­­fol genden Jahr berücksichtigt werden zu können. Nähere Informationen zur Abfassung von Bei trägen sowie aktuelle Informationen über die Vereinsaktivitäten finden Sie auf der Homepage des Ver eins (www.sozialgeschichte-medizin.org). Gerne können Sie Ihre Anfragen per Mail an uns richten: [email protected] Bibliografische Information der Deutschen Nationalbibliothek Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen Nationalbi - bli o grafie; detaillierte bibliografische Daten sind im Internet über http://dnb.d-nb.de abrufbar. Das Werk einschließlich aller seiner Teile ist urheberrechtlich geschützt.
  • Assistant Professor in Molecular Biology According to § 99 (5) University Law 2002 (UG) Is Announced

    Assistant Professor in Molecular Biology According to § 99 (5) University Law 2002 (UG) Is Announced

    At the Medical University of Vienna a position as Assistant Professor in Molecular Biology according to § 99 (5) University Law 2002 (UG) is announced. The Medical University of Vienna is one of Europe’s premiere institutions for biomedical and clinical research. We are looking for a highly qualified scientist in the field of Molecular Biology with enthusiasm for inter- and multi-disciplinary research, and commitment to teaching. The Max Perutz Labs (https://maxperutzlabs.ac.at), a joint venture of the University of Vienna and the Medical University of Vienna, are seeking a tenure track junior group leader with outstanding potential to establish an independent and internationally competitive research group. The mission of the Max Perutz Labs is to catalyze discovery in mechanistic biomedicine with an emphasis on analyzing and reconstituting biological processes from atomic to tissue and organismal scales. The successful candidate will bring ambition and creativity to tackle fundamental biological questions that have the potential to impact human health. Your profile: • Completed scientific or medical education with PhD or equivalent degree. • International recognition in the respective research area. • Successful and continuous acquisition of peer-reviewed third-party funding. • Educational and didactic qualifications including supervision of Masters and PhD students. • Diversity and gender competence. • International working experience We offer: The successful candidate will be offered an Assistant Professor position for a maximum duration of six years. Should the candidate meet the conditions stipulated in the qualification agreement, she/he will be promoted to tenured Associate Professor. Conditions and criteria are defined in the official career track guidelines of the university (Career scheme for the scientific University staff according to §99 Abs.
  • Master Position in Plant Molecular Biology

    Master Position in Plant Molecular Biology

    Bachmair lab Master position in plant molecular biology A Master Thesis position is available in the Bachmair group (Max Perutz Labs), starting Dec 2020 or later. Topic A) Analysis of plant ubiquitin ligases via a synthetic biology approach in the budding yeast S. cerevisiae. We are analyzing protein turnover in plants that depends on amino-terminal degradation signals. Expression of the involved enzymes in yeast is part of mechanistic studies on these turnover pathways. B) Construction of expression vectors for novel reporter proteins (tandem fluorescent timer constructs). The vectors shall serve for analysis of half-life and subcellular localization of fused proteins. The constructs shall be tested in the model plant, A. thaliana. Focus of the Bachmair lab lies on the biochemical and cell biological analysis of protein turnover driven by amino-terminal degradation signals. The biological context is how plants respond to environmental stimuli such as heat, flooding or salt stress. Additional information can be found on the Bachmair lab web site (contact address below). Application Requirements: Finished study (B. Sc.) in Molecular Biology, Biochemistry or related, 45 ECTS accomplished in the Master module Duration: ca. 12 months Payment: acc. to FWF rates Contact: [email protected] Univ.-Prof. Dr. Andreas Bachmair Max Perutz Labs, Dept. of Biochemistry and Cell Biology, University of Vienna Rm. 5110, Dr.-Bohr-Gasse 9, A-1030 Wien https://www.maxperutzlabs.ac.at/research/research-groups/bachmair MAX PERUTZ LABS A joint venture of Part of Vienna BioCenter (VBC) • Dr.-Bohr-Gasse 9 • 1030 Vienna Tel: +43 1 4277 24001 • [email protected] www.maxperutzlabs.ac.at Recent publications (Bachmair lab) Millar, A.
  • CONTEMPORARY AUSTRIAN STUDIES Volume 18

    CONTEMPORARY AUSTRIAN STUDIES Volume 18

    The Schüssel Era in Austria Günter Bischof, Fritz Plasser (Eds.) CONTEMPORARY AUSTRIAN STUDIES Volume 18 innsbruck university press Copyright ©2010 by University of New Orleans Press, New Orleans, Louisiana, USA. All rights reserved under International and Pan-American Copyright Conventions. No part of this book may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without prior permission in writing from the publisher. All inquiries should be addressed to UNO Press, University of New Orleans, ED 210, 2000 Lakeshore Drive, New Orleans, LA, 70119, USA. www.unopress.org. Printed in the United States of America. Published and distributed in the United States by Published and distributed in Europe by University of New Orleans Press: Innsbruck University Press: ISBN 978-1-60801-009-7 ISBN 978-3-902719-29-4 Library of Congress Control Number: 2009936824 Contemporary Austrian Studies Sponsored by the University of New Orleans and Universität Innsbruck Editors Günter Bischof, CenterAustria, University of New Orleans Fritz Plasser, Universität Innsbruck Production Editor Copy Editor Assistant Editor Ellen Palli Jennifer Shimek Michael Maier Universität Innsbruck Loyola University, New Orleans UNO/Vienna Executive Editors Franz Mathis, Universität Innsbruck Susan Krantz, University of New Orleans Advisory Board Siegfried Beer Sándor Kurtán Universität Graz Corvinus University Budapest Peter Berger Günther Pallaver Wirtschaftsuniversität
  • Cephalic Sensory Cell Types Provides Insight Into Joint Photo

    Cephalic Sensory Cell Types Provides Insight Into Joint Photo

    RESEARCH ARTICLE Characterization of cephalic and non- cephalic sensory cell types provides insight into joint photo- and mechanoreceptor evolution Roger Revilla-i-Domingo1,2,3, Vinoth Babu Veedin Rajan1,2, Monika Waldherr1,2, Gu¨ nther Prohaczka1,2, Hugo Musset1,2, Lukas Orel1,2, Elliot Gerrard4, Moritz Smolka1,2,5, Alexander Stockinger1,2,3, Matthias Farlik6,7, Robert J Lucas4, Florian Raible1,2,3*, Kristin Tessmar-Raible1,2* 1Max Perutz Labs, University of Vienna, Vienna BioCenter, Vienna, Austria; 2Research Platform “Rhythms of Life”, University of Vienna, Vienna BioCenter, Vienna, Austria; 3Research Platform "Single-Cell Regulation of Stem Cells", University of Vienna, Vienna BioCenter, Vienna, Austria; 4Division of Neuroscience & Experimental Psychology, University of Manchester, Manchester, United Kingdom; 5Center for Integrative Bioinformatics Vienna, Max Perutz Labs, University of Vienna and Medical University of Vienna, Vienna, Austria; 6CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria; 7Department of Dermatology, Medical University of Vienna, Vienna, Austria Abstract Rhabdomeric opsins (r-opsins) are light sensors in cephalic eye photoreceptors, but also function in additional sensory organs. This has prompted questions on the evolutionary relationship of these cell types, and if ancient r-opsins were non-photosensory. A molecular profiling approach in the marine bristleworm Platynereis dumerilii revealed shared and distinct *For correspondence: features of cephalic and non-cephalic r-opsin1-expressing cells. Non-cephalic cells possess a full set [email protected] (FR); of phototransduction components, but also a mechanosensory signature. Prompted by the latter, [email protected] (KT-R) we investigated Platynereis putative mechanotransducer and found that nompc and pkd2.1 co- Competing interest: See expressed with r-opsin1 in TRE cells by HCR RNA-FISH.
  • Judaica Olomucensia

    Judaica Olomucensia

    Judaica Olomucensia 2016/2017 Special Issue Kurt Schubert, the Founder 1 – 2016/2017 Table of Content Judaica Olomucensia 2016/2017 Special Issue Kurt Schubert, the Founder This special issue is a last and final volume of biannual peer-reviewed journal Judaica Olomucensia. Editor-in-Chief Ingeborg Fiala-Fürst Editor Ivana Cahová, Matej Grochal ISSN 1805-9139 (Periodical) ISBN 978-80-244-5289-0 (Proceedings) Table of Content 5 Introduction Ingeborg Fiala-Fürst 6 The Jewish Community in Olomouc Reborn Josef Jařab 8 Kurt and Ursula Schubert Center for Jewish Studies Ivana Cahová – Ingeborg Fiala-Fürst 27 The Importance of Feeling Continuity Eva Schubert 30 Interreligious Dialogue as The Mainstay of Kurt Schubert’s Research Petrus Bsteh 33 Kurt and Ursula Schubert Elisheva Revel-Neher 38 The Jewish Museum as a Physical, Social and Ideal Space – a Jewish Space? Felicitas Heimann-Jelinek 47 The Kurt and Ursula Schubert Archive at the University of Vienna Sarah Hönigschnabel 52 The Institute for Jewish Studies in Vienna – From its Beginnings to The Presen Gerhard Langer 65 Between Jewish Tradition and Early Christian Art Katrin Kogman-Appel – Bernhard Dolna 4 – 2016/2017 Introduction Ingeborg Fiala-Fürst The anthology we present to the readers fulfills a dual function: the authors of the individual articles both recall Prof. Kurt Schubert (2017 marked the 10th anniversary of his death) and the institutions which were co-founded by Kurt Schubert and his wife, Ursula Schubert. This double function is reflected in the title of the anthology, "Kurt Schubert, the Founder". One of the youngest institutions that Kurt Schubert helped to found, the Center for Jewish Studies at the Faculty of Arts at Palacký University, is allowed the bear the Schuberts' name since 2008.
  • CV Paul Maxime Nurse Date of Birth: 25 January 1949 Nationality: British Marital Status: Married, Two Children EDUCATION 1960

    CV Paul Maxime Nurse Date of Birth: 25 January 1949 Nationality: British Marital Status: Married, Two Children EDUCATION 1960

    CV Paul Maxime Nurse Date of Birth: 25 January 1949 Nationality: British Marital Status: Married, two children EDUCATION 1960 - 1966 Harrow County Grammar School 1967 - 1970 University of Birmingham - BSc (First Class Honours) in Biological Sciences Awarded the John Humphreys Memorial Prize in Botany 1970 - 1973 University of East Anglia - PhD in Cell Biology/Biochemistry EMPLOYMENT 1967 Twyford Laboratories, London; Research Assistant in Microbiology Department 1973 Institute of Microbiology, University of Bern, Switzerland; Royal Society Research Fellow 1974 - 1980 Department of Zoology, University of Edinburgh; SERC Research Fellow with Professor J M Mitchison 1980 - 1984 School of Biology, University of Sussex; MRC Senior Research Fellow 1984 - 1987 Imperial Cancer Research Fund, London; Head of Cell Cycle Control Laboratory 1987 - 1991 University of Oxford, Iveagh Professor of Microbiology 1991 - 1993 University of Oxford, Napier Research Professor of the Royal Society 1993 - 1996 Imperial Cancer Research Fund, London, Director of Research (Laboratories) 1996 - 2002 Imperial Cancer Research Fund, London, Director-General 2002 - 2003 Cancer Research UK, Director-General (Science) (Feb-Mar 2002), Chief Executive (Mar-Apr 2003) 2003 - 2011 The Rockefeller University, New York, USA, President 2010 - 2015 The Royal Society, London, President 2010 - Francis Crick Institute, Director ACADEMIC DISTINCTIONS Major International Award Lectures and Medals 1990 Royal Society Florey Lecturer (UK) 1991 Cetus Lecturer, University of California,
  • Wa(H)Re Forschung? Science – Change of Paradigms?

    Wa(H)Re Forschung? Science – Change of Paradigms?

    Science – Change of Paradigms? Science – Change of WA(H)RE FORSCHUNG? Wa(h)re Forschung? / Forschung? Wa(h)re SCIENCE – CHANGE OF PARADIGMS? SYMPOSIUM 20.–21. MAI 2010 Anlässlich der Feierlichen Sitzung der Österreichischen Akademie der Wissenschaften ÖAW ÖAW: Forschung und Gesellschaft 2 WA(H)RE FORSCHUNG? SCIENCE – CHANGE OF PARADIGMS? SYMPOSIUM 20.–21. MAI 2010 Anlässlich der Feierlichen Sitzung der Österreichischen Akademie der Wissenschaften ÖAW: Forschung und Gesellschaft 2 1 Impressum Herausgeber: Präsidium der Österreichischen Akademie der Wissenschaften Dr. Ignaz Seipel-Platz 2, 1010 Wien www.oeaw.ac.at Redaktion: Marianne Baumgart, Angelika Eckel, Öffentlichkeitsarbeit der ÖAW Graphische Gestaltung: Angelika Eckel, Öffentlichkeitsarbeit der ÖAW Druck: Friedrich VDV, 4020 Linz Alle Rechte vorbehalten. Copyright © 2011 Die inhaltliche Verantwortung und das Copyright für die jeweiligen Beiträge liegen bei den einzelnen Autorinnen und Autoren. Wa(h)re Forschung? / Science – Change of Paradigms? Wa(h)re Forschung? Science – Change of Paradigms? Symposium 20.–21. MAI 2010 Anlässlich der Feierlichen Sitzung der Österreichischen Akademie der Wissenschaften Präambel Das Symposium „Wa(h)re Forschung? / Science – Change of Paradigms?“ thematisiert Aspekte eines Paradigmenwechsels, der sich heute in allen Bereichen der Wissenschaft vollzieht. Die klassische Vorgangsweise in Wissenschaft und Forschung, als erkenntnis- orientierte Grundlagenforschung bezeichnet, weicht unter ökonomischer und politischer Perspektive einer zunehmenden Anwendungsorientierung
  • Tree 19.Indd

    Tree 19.Indd

    15th Annual Conference The Academia’s Letter from New members to 2003 at Graz future plans the President Academia Europaea page 2 page 8 page 12 page 21 Academia Europaea ~19 88~ TheTNewsletter of Academiaree Europaea • Issue 19 • March 2004 16th Annual Conference University of Helsinki, 2-4 September 2004 “Europe in Change” and give short papers to the assembly. We Session 3: will once again welcome newly elected The 2004 annual conference of the 1 Social and economic change and health members of the Academia. Academia Europaea, will bring together in Europe East and West. Michael eminent researchers from across all This year we will also have two “invited Marmot (London) disciplines. The meeting will encourage in papers” sessions, one on each day of the 1 Society and well-being Richard Layard open discussion of a range of key factors conference. (London) that have conspired together to shape the 1 Child development in Europe Michael Europe of today and may well contribute Main programme speakers Rutter (London) towards the Europe of tomorrow. include: 1 Psychological change through the life “Europe in Change” emphasises a fact of course. Paul Baltes (Berlin) our European heritage – that ‘Europe’ is Session1: Session 4: constantly evolving and in flux. Aspects 1 Glacial and interglacial climate 1 of change will be presented through four From analogue to digital – convergence variability: How do they compare? What multidisciplinary sessions: and divergence.Yrjö Neuvo (Helsinki) are the implications for the future? Jean- 1 Market driven energy supply with 1: The Shaping of Europe Claude Duplessy (Gif-sur-Yvette) growing shares of nuclear energy and 2: Turning points in European Culture 1 Patterns in biodiversity: past, present, and biomass Pekka Pirilä (Helsinki) 3: Is there a common European Society? future.
  • Lead Bioinformatician (Proteomics)

    Lead Bioinformatician (Proteomics)

    Mass Spectrometry Lead Bioinformatician (Proteomics) About us The Mass Spectrometry Facility at the Max Perutz Labs performs state-of-the-art proteomics analyses for more than 30 research groups at the Vienna BioCenter and beyond. Our work supports basic research in the fields of molecular biology, cell biology, and biomedicine with plenty of opportunities to engage in exciting and ground-breaking science. In doing so, we routinely explore the limits of current proteomics technology. Your role Modern proteomics generate vast quantities of data that require careful, and often sophisticated analysis in order to derive robust biological insights. We are therefore recruiting a Lead Bioinformatician to help strengthen our existing data analysis pipelines as well as develop new ones. In addition to supporting our team in conducting advanced data analyses you will also have the opportunity to develop your own research project. Your primary responsibilities will include: Apply existing and develop novel bioinformatics approaches to analyse data from complex proteomics experiments to help our customers answer their biological questions Design, implement, and evaluate new bioinformatics tools to extend the services and capabilities of the facility Document all procedures reliably and communicate results to customers Take responsibility for projects and report to Facility Head (Markus Hartl) Disseminate our work at internal meetings and scientific conference as well as engage with our user community to provide support and understand their needs
  • First Results from the Austrian School-SARS-Cov-2 Study

    First Results from the Austrian School-SARS-Cov-2 Study

    medRxiv preprint doi: https://doi.org/10.1101/2021.01.05.20248952; this version posted January 6, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . Prevalence of RT-PCR-detected SARS-CoV-2 infection at schools: First results from the Austrian School-SARS-CoV-2 Study Peter Willeit, Robert Krause, Bernd Lamprecht, Andrea Berghold, Buck Hanson, Evelyn Stelzl, Heribert Stoiber, Johannes Zuber, Robert Heinen, Alwin Köhler, David Bernhard, Wegene Borena, Christian Doppler, Dorothee von Laer, Hannes Schmidt, Johannes Pröll, Ivo Steinmetz, Michael Wagner Clinical Epidemiology Team, Department of Neurology, Medical University of Innsbruck, Innsbruck, Austria and Department of Public Health and Primary Care, University of Cambridge, Cambridge, UK (P Willeit MD MPhil PhD), Section of Infectious Diseases and Tropical Medicine, Department of Internal Medicine, Medical University of Graz, Graz, Austria and BioTechMed-Graz, Graz, Austria (R Krause MD), Department of Pulmonology, Kepler-University-Hospital, Faculty of Medicine, Johannes Kepler University Linz, Linz, Austria (B Lamprecht MD), Institute for Medical Informatics, Statistics and Documentation, Medical University of Graz, Graz, Austria (A Berghold PhD), Centre for Microbiology and Environmental Systems Science, Department of Microbiology and Ecosystem Science, University of Vienna, Vienna, Austria (B Hanson MSc PhD, Dr. H Schmidt, Mag. Dr. M Wagner), Vienna Covid-19 Detection Initiative, Vienna, Austria (B Hanson MSc PhD, Dr. H Schmidt, Mag. Dr. M Wagner), Diagnostic and Research Institute of Hygiene, Microbiology and Environmental Medicine, Medical University of Graz, Graz, Austria (Mag.