Catalyzing Discovery in Mechanistic Biomedicine

The Max Perutz Labs Catalyzing discovery in mechanistic biomedicine

A joint venture of Part of Mission Statement The Max Perutz Labs are dedicated to a mechanistic understanding of impor tant biological processes. We have the potential to AATACTAGATATGAAAGATTCCCCCTTTATTTACACGGCTCTAGCAGCAGCGTCGTCAAGAAGAAAAGCCAGTACACGTACCAGAAAATAGAAGTAACAGCGTCCCCCATCGAATGGCTATTATGCAAAGGGTTACACAATAATTACCACCACCGTGAGACACCACCGCCAGCAGTGCTTATCCATATTCCAGCAGCCATACTTAGTATCGTCTATAACCAACAATAGATCATATCACGCAGCACCAGCAACGGGCTTCCGCCACCACCTTCAGCAGAAATGGTAGTAGTGGGAACAGCAGCACTAACGCCAACAACCGATGAGCGTTGGCAGCACCAGCAGTCCAGATACCGGAACATGCAGGCAGATCATCCGCCTCGCAAGAAGATAATGACGAAAAAAGAGTCACAATAGTCAAGATACGAACGGCAGGACCACGAGCATGGTACAAATTCGTACCACCTACCGCAACGTGGCATTACCAAGCACAACCATCCCCCAGGTACAACAAGATACAAGGCCGTACTATTCAGCTAATAGCAGGGACAAACCGGAGCATACTATCGAAACGGATACACGACTATGAGCAGCCGCCCCAAGAGGGAGACTTGACGGTAATGCGTCTTATGGCGCGAGATACAACAGTGTAGAGGTGGAGCAGGCGGATCGTATTACAGAGGGAGCAAAGGGGGGGTTATCACCATGCGAGACGAATACTCATCCACTCCTCCATGAGCGGATACACGGGAAATAATTATAGCAGA catalyze groundbreaking discoveries in mechanistic

- biomedicine. -

We combine world-class research facilities with modern teaching methods to educate, inspire, and empower the next generation of 21st century scientists.

The Max Perutz Labs are a joint venture between the University of Vienna and the Medical University of Vienna that builds on the unique opportunities that arise from being embedded in the Vienna BioCenter Campus while having one of the largest hospitals in Europe, the Vienna General Hospital, on our doorstep. In visualizing haemoglobin, Max Perutz paved the way towards the era of precision medicine. To realize its full potential, precision medicine necessitates a molecular mechanistic approach. Shaping the Future of the Max Perutz Labs 2005 Highlights Founding Part of the Vienna BioCenter 52/48 The Max Perutz Labs were founded The Max Perutz Labs are part of the 2017—2019 in 2005 as a joint venture of the Vienna BioCenter, one of Europe’s Female and Male Staff University of Vienna and the Medical hotspots for life sciences. University of Vienna.

Facts & Figures The last two years have seen a period of significant change that will shape the future of the Max Max Perutz Labs Perutz Labs. With the Seeding Success in Science Symposium in 2017 we said farewell 366 to scientific director Graham Warren. at a Glance Arndt von Haeseler was elected as Research Grants, Graham’s successor and continues to With the implementation of a new ERC Grants Prizes and Awards lead the Max Perutz Labs today. He is name—Max Perutz Labs Vienna—we 1 ERC Starting Grant supported by a team of co-directors: aim to strengthen the identity of the Including 12 ERC Grants 3 ERC Consolidator Grants Alwin Köhler, Peter Schlögelhofer institute and reinforce our connection and 8 START Awards 1 ERC Proof of Concept Grant and Kristin Tessmar-Raible, as well with an outstanding scientist, leader as Fabien Martins as administrative and educator. The first Max Perutz Academic Achievements Data as of May Australia 2019 Mexico director. Day in May 2019 brought together our Full Professorship: Austria New Zealand stakeholders, scientists and students Andreas Bachmair, Verena Belarus Pakistan The Catalyzing Change project was to celebrate the 105th birthday and Jantsch, Alwin Köhler, Sascha Australia Belgium Australia Australia Mexico Mexico Poland Mexico kicked off in 2018 and has initiated an legacy of Max Perutz. Austria Austria Austria New Zealand New Zealand New Zealand Martens, Isabella Moll, Kristin Brazil Australia Portugal Mexico internal change process. It has brought Belarus Belarus Belarus Pakistan Pakistan Pakistan Tessmar-Raible, Bojan Zagrovic Belgium Bulgaria Belgium Austria Belgium Poland Poland RussiaNewPoland Zealand together all group leaders of the Max Researchers at the Max Perutz Labs Brazil Brazil Belarus Brazil Portugal PortugalPakistanPortugal Bulgaria Bulgaria Russia Russia Perutz Labs in a series of workshops continue to deliver internationally Associate Professorship: Canada Bulgaria Belgium Russia Serbia Poland Canada Canada Serbia Serbia Canada Brazil Serbia Portugal to redefine the mission of the institute, recognized research in fundamental Boris Görke, Thomas Leonard, China China Slovakia Slovakia China China Bulgaria Slovakia Slovakia Russia Croatia Croatia Slovenia Slovenia finding common ground in the pursuit biological processes. Our group lea Gijs Versteeg Croatia Canada Slovenia Serbia Czech Croatia Republic Czech Republic Somalia Slovenia Somalia China Slovakia of mechanistic biomedicine. The new ders successfully secured multiple Estonia Czech Republic Estonia40+ Spain Somalia Spain Croatia Slovenia France Czech Republic Estonia France Switzerland Spain Somalia Switzerland Student Awards and Grants Czech Republic Somalia ‘Think Tank’, a meeting space desig high-profile grants, among them five Germany France GermanyNationalities Thailand Switzerland Thailand Estonia Estonia Spain Spain Greece Germany Greece The Netherlands Thailand The Netherlands ned to encourage exchange and com- highly competitive ERC grants. France Switzerland Uni:docs Fellowship: Hungary France Greece Hungary Tunesia The NetherlandsSwitzerland Tunesia munication was opened in November India Hungary Germany India Turkey TunesiaThailandTurkey Martina Borroni, Madhwesh Greece The Netherlands 2018. A new logo and visual appear- 2017—2019 also saw five Max Perutz IndonesiaGermany India Indonesia U.S.A. Turkey Thailand U.S.A. Coimbatore Ravichandran, Italy Indonesia Hungary Italy Ukraine U.S.A.TunesiaUkraine ance of the institute were introduced Labs group leaders promoted to full Japan Greece Italy India Japan United Kingdom Ukraine TheTurkeyUnited Netherlands Kingdom Merrit Romeike, Adriana Savova, Latvia Venezuela Latvia Japan Indonesia Venezuela United KingdomU.S.A. in May 2019 as a symbolic milestone, professor and three promoted to Lithuania Hungary Lithuania Tunesia Maria Velkova, Theresa Zekoll Latvia Italy Venezuela Ukraine kicking off a new era. associate professors, demonstrating India Lithuania Japan Turkey United Kingdom Latvia Venezuela the success of the tenure track system. DocAward: Indonesia Lithuania U.S.A. Research Groups and their relation to Research Areas Research Groups and their relation to Research Areas Finally, in July 2019 we celebrated Iva Lučić Italy Ukraine the 95th birthday of Professor Hans Research Groups and their relation to Research Areas 55 Group Leaders 55 Group Leaders VBC PhD Award: Japan and Lecturers andUnited Lecturers Kingdom Tuppy, who was honoured for his ResearchResearch Groups Groups and and their their relation relation to Research to ResearchAreas 114 Administrative Areas staff 114 Administrative55 staff Group Leaders Dorotea Fracchiolla, and science support and science support outstanding scientific achievements. Latvia 97 Post Docs and Lecturers Venezuela97 Post Docs Laura D. Gallego, Iva Lučić 114 Administrative staff 55 Group Leaders and Lecturers Lithuania and science support 97 Post Docs 114 Administrative staff At the Max Perutz Labs Vienna we ÖAW Doc Fellowship: and science support 97 Post Docs draw inspiration from the legacy of Tanja Kaufmann, Max Perutz, are home to the talented Anete Romanauska, scientists of today, and educate an Raffaela Torggler, Georg Vucak, Research Groups and their relation to Research Areas 7 50 452 aspiring young generation of scientists. Milica Vunjak Research Areas Research Groups Scientists & Over the next few years our institute 47 Undergraduates 47 Undergraduates L’Oreal Fellowship: 55 GroupStaff Leaders will continue to focus on our mission 126 PhD Students 126 PhD Students Laura D. Gallego and Lecturers to push forward the frontiers of mecha- Cell Biology & Signalling Computational Modelling Immunity & Infection Cell BiologyStructure & Signalling & Function Computational Modelling Immunity & Infection Structure & Function 47 Undergraduates of Biological Systems of Biological Systems of Macromolecular Chromatin, RNA & Mechanisms of HumanChromatin, of Macromolecular RNA & Mechanisms of Human 114 Administrative staff 126 PhD Students nistic biomedicine as we see more Assemblies Assemblies 47 Undergraduates Chromosome Biology Developmental Dynamics Disease Chromosome Biology Developmental Dynamics Disease and science support of the Catalyzing Change process Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function 12697 PhD Post Students Docs of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular coming to life. Cell Biology & Signalling Chromosome Biology DevelopmentalComputational Dynamics ModellingDisease Immunity & Infection AssembliesStructure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies

47 Undergraduates 126 PhD Students

Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies Research Areas Research at the Max Perutz Labs Is Curiosity-Driven and Spans the Fields of Molecular and Cell Biology.

Cell Biology & Signalling Chromatin, RNA & Computational Modelling Cells communicate at every level and Chromosome Biology of Biological Systems molecular misunderstandings must Unravelling nature’s genetic and Making sense of big data to drive be avoided. epi-genetic codes. hypothesis-based research.

Developmental Immunity & Mechanisms of Dynamics Infection Human Disease Elucidating the faithful execution of Maintaining an intact armour is Cures for human disease start with developmental programmes. essential for human health. basic research.

Structure & Function of Macromolecular Assemblies Visualising the biochemistry of macromolecules in health and disease. Research Groups Verena Thomas Leonard Peter Schlögelhofer Jantsch-Plunger Structural Biology of Molecular mechanisms of Meiosis in Caenorhabditis Lipid-Activated Signal meiotic recombination elegans Transduction From Mechanism Tim Skern Thomas Juffmann Josef Loidl Virus-host interactions Quantum Microscopy and Meiotic Chromosome Biophysics Pairing and Dea Slade to Medicine Recombination DNA Damage Response Elif Karagöz and Transcription Protein Quality Control Sascha Martens Regulation in the Endoplasmic Molecular Mechanisms of Reticulum Autophagy Kelly Swarts Tree-ring genomics Franz Klein Javier Martinez Yeast chromosomes in RNA processing machin- Kristin Teßmar-Raible meiosis eries in mammalian cells Biological Timers set by Max Perutz Labs research groups tackle sun and moon Robert Konrat Isabella Moll diverse biological questions, promoting Computational Biology Ribosome Heterogeneity Gijs Versteeg and Biomolecular NMR in Bacteria Cellular control cross-fertilization of research fields and Spectroscopy mechanisms of protein Johannes Nimpf degradation broad perspectives. Alwin Köhler ApoER2 and VLDL Nuclear Envelope Receptor Arndt von Haeseler Biology – Gates, Center for Integrative Chromatin & Lipids Egon Ogris Bioinformatics Vienna Protein Phosphatase (CIBIV) Pavel Kovarik 2A Biogenesis and Signaling and gene ex- Monoclonal Antibodies Georg Weitzer pression in inflammation Molecular aspects of Shotaro Otsuka cardiomyogenesis Heinrich Kowalski Intra-cellular Manuela Baccarini Alexander Boris Görke Molecular and structural Communication between Gerhard Wiche Deciphering the MAPK Dammermann Signal transduction and biology of picornaviruses the ER and the Nucleus The cytolinker protein pathway in vivo Centriole Assembly and post-transcriptional reg- plectin and its role in Function ulation in bacteria Karl Kuchler Florian Raible disease Andreas Bachmair Host-Pathogen Inter- Stem Cells, Regeneration Protein modification in Thomas Decker Andreas Hartig actions & Mechanisms of and Developmental Angela Witte plants Interferons: Signals and Origin and biogenesis of Drug Resistance & Fungal Plasticity Virus φCh1 as a model Immunobiology peroxisomes Pathogenesis system Andrea Barta Johann Rotheneder Post-transcriptional Kristina Djinovic- Marcela Hermann Martin Leeb Cell cycle regulation and Bojan Zagrovic regulation of gene Carugo LDL-R gene family, apo- Molecular Control of Cell DNA damage response Laboratory of Molecular expression in plants Structure and assembly lipoproteins and lipid Identity Biophysics of sarcomeric Z-disc transfer Dieter Blaas Early Interactions of Gang Dong Joachim Hermisson Picornaviruses with Host Structural biology of Mathematics and Cells ciliogenesis and Biosciences Group membrane trafficking (MaBS) Hans Tuppy Udo Bläsi Honorary Molecular Microbiology Sebastian Falk Reinhold Hofbauer Faculty Member Biogenesis & Action of L-carnitine as a nutrige- Hans Tuppy, Professor Emeritus at Christa Buecker small RNAs nomical metabolite and the Institute of Biochemistry at the Transcriptional the use of cytostatic and University of Vienna, was instrumental Regulation during Early Roland Foisner toxic genes to treat solid in establishing research in Biochemistry Embryonic Development Lamins in nuclear organi- tumors and Molecular Biology in Austria. zation and human disease He has served as the President of the Christopher Campbell Natale-Erwin Ivessa Austrian Science Fund, Rector of the Mechanisms that ensure Peter Fuchs Protein and Lipid University of Vienna, President of the chromosome segregation Intermediate filaments in Homeostasis in Cells and Austrian Academy of Sciences and fidelity in mitosis epithelial stress response Organisms Minister for Science and Research. Research Highlights 2017 — 2019 Catalyzing Discovery in

New Group Leaders Sebastian Falk Thomas Juffmann Mechanistic Biomedicine Biogenesis & Action of small RNAs Quantum Microscopy and Biophysics Welcome Sebastian Falk is interested in the How can the sensitivity of microscopes mechanisms of gene silencing and be improved, so that the information the regulation of gene expression by extracted from each probe particle to the small RNAs. A biochemist and struc- is maximized? tural biologist by training, he received his PhD from Heidelberg University, Physicist Thomas Juffmann works at Max Perutz where he worked on the targeting the interface of quantum physics and of membrane proteins. During his biology to answer this question. He did Our scientists strive to answer fundamental questions Postdoc at the Max Planck Institute his PhD on molecular quantum optics Labs of Biochemistry in Munich he stud- at the University of Vienna and then in biology with the potential to catalyze discovery in ied eukaryotic RNA degradation. He moved to Stanford as a postdoc. He joined the Max Perutz Labs as a junior then joined the ENS Paris as an HFSP mechanistic biomedicine. Research at the Max Perutz group leader in March 2019. fellow. In 2018, he came back to Vienna to start his shared, interdisciplinary Labs spans the fields of molecular and cell biology. group at the Faculty of Physics and the Max Perutz Labs. Recent research highlights cover basic research questions, but also more applied fields of biology.

Elif Karagöz Shotaro Otsuka Kelly Swarts Protein Quality Control in the Intra-cellular Communication between Tree-ring genomics Endoplasmic Reticulum the ER and the Nucleus Using quantitative, computational and Most proteins need to fold into dis- Shotaro Otsuka joined the Max Perutz population genetic approaches, Kelly tinct structures to fulfill their function. Labs in April 2019 to investigate inter- Swarts’ group seeks to understand the How cells deal with protein folding organelle communication, and is espe- biological basis of climate adaptation in defects is a fundamental biological cially interested in the connection be- conifers. question. tween the endoplasmic reticulum and the nucleus. As a postdoc at the EMBL, She studied at the University of Michigan Max Perutz’s major contribution to Elif Karagöz investigates how cells he has developed a novel ‘dynamic’ and holds a M.A. in archaeology and protein crystallography was to solve sense and adapt to the conditions nano-scale imaging approach. archaeobotany from Northern Arizona the s o-called ‘phase problem’ by intro that challenge their protein folding University. During her PhD studies at ducing heavy atoms into proteins. The capacity. She studied in Turkey Before that he investigated nucleocyto- Cornell University she focused on quan- changes in the intensities of the re- before doing her Master’s degree at plasmic transport by single-molecule titative genetics in maize and compu- flections allowed the positions of the the Max Planck Research School in measurements using atomic force tational biology. After a short postdoc heavy atoms to be worked out using Göttingen. After completing her PhD microscopy during his PhD research at in Germany she moved to the Vienna the Patterson synthesis. Today, the at Utrecht University, she did a post- Kyoto University. BioCenter as a joint GMI/Max Perutz Patterson map is still widely used for doc at the University of California Labs group leader. the interpretation of the heavy atom San Francisco. She joined the Max sub-structure and initial experimental Perutz Labs in January 2019. phasing. Activate Innate Immunity How Quickly Cells of thetranscriptionfactorISGF3 alternative andtheregularversion a molecularswitchbetween an Decker’s grouphas discovered that antiviral geneexpression. Thomas cade thatactivates antimicrobial or This requiresacellularsignal cas- reaction in a matterofminutes. from normaloperationtoimmune Upon infectioncellsquicklyswitch immune response. enables therapidonsetofinnate underlies interferon-inducedgenetranscription.NatureCommunications,2019Jul2;10(1):2921. Gossenreiter, MathiasMüller, MariaNovatchkova &ThomasDecker: AmolecularswitchfromSTAT2-IRF9 toISGF3 Ekaterini Platanitis,DuyguDemiroz,AnjaSchneller, KatrinFischer, Thomas ChristopheCapelle,MarkusHartl, Research Highlight

© Alexander Dammermann A Critical A Critical Player at levels ofeffectorproteinsinsuchaquick manner. ‘light’ andcompleteversions explains howtheinnateimmunesystemproduceshigh innate immunity. Theproximity oftheproteinstoDNA andtherapidexchange of version ofISGF3assemblesinthenucleus,thusrevving upthe genetic machineof ilar toanenginerunninginlowgear. Whenactivated by interferons,thecomplete This ‘light’version ofISGF3maintains alowexpression ofantimicrobialgenes,sim- by interferons. ing thiscomplex independentlyofthesignalscaused areconstantlybound toDNA, bial geneexpression. Theresearchers foundoutthattwoofthe threeproteinsform- the celltoproduceproteincomplex ISGF3, responsibleforactivating antimicro- Interferons dockoncellsurfacereceptorstoinitiateasignaling processthatcauses centrosome function inmitosis. how centrioles contributeto Dammermann hasbeenexamining A teamledbyAlexander somes alignandaresegregated. mitotic spindleonwhichchromo - somes directtheassembly ofthe centro- cells, centriole-organised feature ofalllifeonearth.Inanimal two daughtercells,afundamental on chromosomesisdistributedto the geneticinformationencoded Mitosis istheprocessbywhich Research Highlight the Centre the Centre of Mitosis

rebars doforreinforcedconcrete. to thepericentriolarmaterial justas tensilestrength proteins thatimpart provide anchorsitesforfilamentous authors proposethatcentriolesmay larger isnotimmediatelyclear. The chanical stabilitytoastructure>30x material. Howcentriolesconferme- trioles comparedtothepericentriolar markable given thesmallsizeofcen- re- centrosomes. Thisisparticularly sential forthestructuralintegrityof Centrioles werealsofoundtobees- spindle assembly. a criticalroleforcentriolesinmitotic rial wasstronglyimpaired,revealing However, ofthismate- growth further ing so-calledpericentriolarmaterial. immediate collapseofthesurround- centriole ablationdidnotleadtoan the entirestructure.They foundthat without simultaneouslyeliminating from withinthemitoticcentrosome was abletoremove thecentrioles Using lasermicrosurgery, theteam 5;50(3):355-366.e6 Maintenance. Developmental Cell,2019Aug and for CentriolesinMitotic CentrosomeGrowth Alexander Dammermann:Differential Requirements Gabriela Cabral,Triin Laos, JulienDumont,

© Thomas Decker Vascular Ageing The Biomechanics of The Biomechanicsof A Molecular“Claw” Isa Long Sought Missing Link Long SoughtMissingLink system. processes inthecardiovascular understanding ofnormalaging so, theyalsoimprovedoing our In syndrome. Gilford progeria mature agingdiseaseHutchinson- vascular symptoms inthepre cular mechanismbehindcardio- group have unravelled themole Scientists fromRolandFoisner’s Research Highlight Molecular Cell,2019Apr18;74(2):330-346.e11. FIP200 ClawDomainBindingtop62PromotesAutophagosomeFormation atUbiquitinCondensates. Fracchiolla, DanielBernklau,JuliaRomanov, JamesH.Hurley, MarkusHartl, Oliver Daumke, SaschaMartens: Sztacho, Danieli,XiaoshanShi,GabrieleZaffagnini,AnnamariaGamper, Alberto Schuschnig,Dorotea Martina Eleonora Turco, Tobias ChristineAbert, MarieWitt, Bock-Bierbaum, Ming-Yuan Su,RiccardoTrapannone, Martin pression causescardiovascular pathology throughanimpairedmechanoresponse.JCI,2019Feb 1;129(2):531-545. Irmgard Fischer, Petra Fichtinger, BrunoK.Podesser, MariaEriksson,andRolandFoisner: Endothelialprogerinex Selma Osmanagic-Myers, AttilaKiss,ChristinaManakanatas,OuafaHamza,Franziska Sedlmayer, PetraSzabo, L. Research Highlight in Selective Autophagy

© Dorotea Fracchiolla, Eleonora Turco fibrosis. connective tissue, acondition called affected cellsthenproduceexcessive dation byselective autophagy. to thematerialdestinedfordegra- player inautophagy, isrecruited a key how theproteinFIP200, Sascha Martenshave identified different actors.Scientistsledby fect communicationbetween the healthy. The processrequiresper- ensures thattheorganismstays tentially dangerousmaterial.This In autophagy, cells getridofpo- forces exerted by bloodflow. The Progeria iscausedby mutationsin their abilitytorespondmechanical cell. Inendothelialcellsthis reduces structures thatprovide stabilitytothe ens thelaminaandcytoskeleton, out thataccumulatingprogerinstiff- called progerin.Thescientistsfound duction ofamutantlaminprotein, the LMNAgenethatleadtopro-

© Selma Osmanagic-Myers cesses innormalaging. under for progeriapatientsandhelps inthe to develop new therapeuticstrategies vascular diseaseinprogeriacanhelp molecular defectsleadingto cardio- those inprogeria.Under ‘normally-aged’ peopleresemble of levels. The cardiovascular pathologies mally agedorganisms,butatlower Progerin is also oftenfoundinnor other. Structuralanalysis FIP200 proteinsdirectlybindtoeach scientists discovered thatthep62and p62, revealing along-soughtlink FIP200 clawthatbindsasmallmo The teamidentifiedapocket inthe like aclaw. also revealed ofitisshaped thatapart therefore opennewavenues can form around it. Howthe can formaroundit. go material,sothatautophagosomes Another protein,p62,collectsthiscar sequestered andfinallydegraded. wherein harmfulcellularsubstances are formation ofautophagosomes, FIP200 factorinthe isanimportant search intohumandiseases. of themechanismautoph degeneration. Abetterunderstanding a numberofdiseasesincludingneuro- ic degradation.Mutationsinp62cause tween cargocollectionandautophag- tophagy machinery wasun tophagy machinery ance ofthecargoiscoupledtoau- standing ofthemolecularpro - standing the of FIP200 clear. The agy could appear- of re-

be-

tif of - A System of Balances in Balances in Research Highlight the Blood Checks and Checks and tween activation anddormancy. guard thisdelicate balance be- intracellular signallingcan safe- Baccarini hasshown Manuela how activation.and state The groupof and forthbetween theirdormant they mustrapidlyswitchback new bloodneedstobeformed, survival. Whenever for essential cells of thebody, andaretherefore give risetobloodandimmune Hematopoietic StemCells(HSCs)

© Anete Romanauska, Alwin Köhler and Sonja Jacob Lipid Storage Metabolism Lipid StorageMetabolism have catastrophicconsequencesfor A smalltilttowardseitherstatecan revert backtotheirdormantstate. completing theirtask,HSCsneedto entiate intoallbloodcelltypes.After toactivelystart self-renewanddiffer- To compensateforblood loss,HSCs 26;174(3):700-715.e18. Generates NuclearLipidDroplets.Cell,2018Jul Membrane IsaMetabolicallyActive Territory that Anete Romanauska,AlwinKöhler: TheInnerNuclear be influencedby nuclearlipidmetabolisminhealthanddisease. inner nuclearmembraneandraisesintriguingquestionsabouthowthegenomemight droplets andtheinnernuclearmembrane.Thisstudyassignsanewfunctionto and identifiedafactorthatisrequiredfortheproperexchange oflipidsbetweenthe authors alsodescribedthegeneticcircuitforsynthesisofnuclearlipiddroplets, cate withtheinnernuclearmembranethroughspecializedbridges.The ofnuclearspaceandcommuni canoccupy ahugeportion These dropletsstorefat, brane, whichleadstotheformationofspecificorganellescallednuclearlipiddroplets. analyses, theresearchersdemonstratedlipidturnover attheinnernuclearmem lipidbiosensorprobesandelectronmicroscopic Using metabolicperturbations, idea bydiscovering active lipidmetabolismattheinnernuclearmembrane. system.membrane KöhlerAlwin have andAneteRomanauska overturned this been regardedasametabolicallyinactivehas backwater ofacell’s endo lipids formembraneproliferationorfatstorage,theinner nuclearmembrane nucleus. Whiletheoutermembranehaslongbeenknown tosynthesize new Our geneticmaterialissafeguardedbytwo membranes surroundingthecell pounds couldberepurposed to homeostasis.Inhibitors HSC tains dinated by afeedback-loop that main - always activated inparallel, arecoor- cellular signallingpathways, almost They showedthattwopivotal intra- that safeguardsthisdelicatebalance. has discoveredgroup themechanism the organism.ManuelaBaccarini’s instance, inageing organisms. asseen, for HSCs, ‘lazy’ mobilize the pathwaysunderstudyare Research Highlight The resultssuggestthatthese com- rently beingusedincancertherapy. in anUnexpected Place cur-

of 892.e6. Exhaustion. CellStemCell,2018Jun1;22(6):879- Mechanism Prevents HematopoieticStem Cell Manuela Baccarini:AnERK-Dependent Feedback Fischer, Veronika Sexl, ChristophBock,and Farlik, FlorianHalbritter, RuthScheicher, Irmgard Christian Baumgartner, StefanieToifl, Matthias -

© Alessia Schirripa Aktivity Lipid- improving cancer therapies. fore essential fordeveloping and that govern Aktactivity is there Understanding themechanisms 50% ofallhumancancers. than in overgrowth disorders andmore Akt activityisobservedcontrolled and survival. Unsurprisingly, un controls cellgrowth,proliferation, an essentialsignaltransducerthat must betightlycoordinated. Akt is cells inamulticellularorganism The growthandproliferationof Feb 2;65(3):416-431.e6. Activity toCellularMembranes.MolecularCell,2017 Yudushkin: PI(3,4,5)P3 EngagementRestricts Akt Michael Ebner, Leonard, Iva Lučić,ThomasA. Ivan Research Highlight meiotic events. flexibility tosupportthoseearly scaffolding ofthenucleusacquires lamina, theusuallystiffandrigid Jantsch’sthe groupshowsthat mix ofparentalgenomes.Verena ‘crossing over ’,to anew leading change partsinanevent called from themotherandfatherex cess, homologouschromosomes ducing organisms. Duringthispro- which occursinallsexually repro- Meiosis isaformofcelldivision, dependent dependent - -

© Iva Lučić What’s toDo Got Lamin with It? each other. Thisismediatedby rapid nextthe twoparentsalignpairwise to overs is that thechromosomesfrom A crucialstepforsuccessfulcross- have thepotential todrive inanunregulatedmanner. tissuegrowth independent oftheactivating signal. These pro-proliferative andpro-survival signals to these signalsarebypassed, leading runaway activity throughoutthecellthatis A mutationassociatedwithovergrowth disordersofthebrainunlocksAkt suchthat this mechanismalsorestricts activitytodiscretelocationsinthe cell. magnitude of the stimulus. Since thesesignalsareembeddedincellularmembranes, of thesignaltoAktactivity, tothe the cellularresponseismaintainedproportional a conformationalchangeinAktthatunblocksitsactive site.Bycouplingengagement haveby eliciting activity determinedthatthesignalsactivate Aktdirectlycontrol Two MaxPerutz LabsPhDstudents,ledby Thomas Leonard andIvan Yudushkin, for chromosomemovement. nucleus, posingapotentialobstacle theshapeandstabilityof supports brane, a stiffandrigidlaminanetwork cleus. Yet underthenuclearmem the insidemembraneofcellnu chromosome endsaredraggedalong chromosome movements, where Prophase. Developmental Cell,2018Apr23;45(2):212-225.e7. Verena Jantsch:Transient NuclearLaminaDisruptionPromotesChromosomeMovement andPartial inEarlyMeiotic ChristianStigloher,Markert, EnriqueMartinez-Perez, Alexander Dammermann,ManfredAlsheimer, MoniqueZetka, Sarai PachecoPiñol,Alex Montoya, HolgerKramer, Alexander Woglar, SebastianMathias AntoineBaudrimont, Jana Link,DimitraPaouneskou, MariaVelkova, Triin AnahitaDaryabeigi, Laos,SaraLabella,ConsueloBarroso, Research Highlight Chromosomes in Motion: Chromosomes inMotion: - are operatinginmammaliancells. amine whethersimilarmechanisms ings alsoprovide anincentive toex structures wereobserved. Thefind- slower andaberrantchromosome and chromatinreorganizationwere during meiosis,chromosomepairing somes. Ifthelaminaremainsstiff the rapidmovement ofthechromo- This iscriticalforfacilitating meiosis. the laminanetworkloosensupduring like slightlyopeningaknot, ered that, In C.elegans,theresearchersdiscov- -

Education Teaching Mission Statement

The Max Perutz Labs seek to educate students to think critically and analyt- Inspiring and ically, challenge them to set ambitious goals, and instill in them both broad horizons and deep understanding. In doing so, we aspire to furnish them Enabling the Next with the necessary knowledge and skills to push forward the frontiers of Generation 21st century biomedical science.

PostDoc Moving Towards Independence Postdocs at the Max Perutz Labs benefit from a supportive environment, coaching, and tailored workshops aimed at their career development. More than 50 research labs, excellent research facilities, and the vibrant international atmosphere at the Vienna BioCenter ensure that young researchers find all they need at this important career stage.

PhD Studies Being Part of an International Community PhD education is a strong priority at the Max Perutz Labs. Over the years, we have been running several strong PhD programs, recruiting and training many excellent young scientists who have strengthened our research. More than 100 PhD students from over 30 countries currently participate in the research activities of the Max Perutz Labs. We support their curiosity and dedicated work by providing excellent facilities, mentoring, and high-quality seminars with renowned international experts from all fields of molecular biology.

PhD students can choose from specialised PhD tracks within the Vienna Doctoral School Molecules of Life, a joint doctoral programme of the University of Vienna and the Medical University of Vienna. While the curricula of the individual tracks are spe- cifically tailored to the scientific focus, the VDS fosters interdisciplinary and scientific exchange between programmes. Many research groups at the Max Perutz Labs ad- ditionally participate in the Vienna BioCenter PhD programme. The four research in- stitutes at the Vienna BioCenter jointly organise the programme. Doctoral training is complemented by a number of more specialised PhD programmes, some of which are third party funded.

Going forward, we plan to harmonize PhD education in molecular biology at the University of Vienna and the Medical University of Vienna, creating a unified School that awards a joint PhD degree of the co-founding Universities and merges the act ivities of ‘Molecules of Life’ and the VBC PhD program. Connecting the Past and the Future Kicking off a New Era— “The Max Perutz Labs are a leading Max Perutz Day 2019 example of an evolving inter-university cooperation.” – Rector Heinz Engl, University of Vienna

“Scientists affiliated with the University of Vienna and the Medical University of Vienna work side by side to investigate the basic mechanisms of life, while at the same time ensuring top quality education for students at all levels. Education at the Max Perutz Labs is a mission and a legacy; today’s students will be tomorrow’s scientists. Research and education in Molecular Biology are among the key strengths of the University of Vienna and we will continue to invest in this area in the future. The Max Perutz Labs are part of our long-term strategy to establish new professorships in Cell and Developmental Biology, Quantitative Modeling of Biological Networks, Advanced Microscopy and Cellular Dynamics, and Molecular Biology.” – Rector Heinz Engl, University of Vienna

On the occasion of Max Perutz’s 105th birthday, the science community, students and stakeholders from the University of Vienna and the Medical University gathered to celebrate the first Max Perutz Day on May 23rd 2019 to honour the scientific legacy of the Nobel Prize winner for whom the institute is named. Beyond his intellectual brilliance, Max Perutz was a humanist as well as an ambassador for science, and whose ideas are shaping the future of the Max Perutz Labs. “The future of internationally In her keynote speech, science writer and Max Perutz biographer Georgina Ferry competitive science is necessarily honoured Max Perutz’s life and his passion for research by quoting his famous say- ing: “In science, truth always wins”. In this spirit the Max Perutz Labs Vienna will seek to uphold the values he stood for: creating an open environment where ideas collaborative, interdisciplinary, can be exchanged and international researchers can thrive. and forward thinking.” – Rector Markus Müller, Medical University of Vienna

“In the long term, individuals and the “Max Perutz was a beacon of scientific curiosity and his legacy is our inspiration. recognition they compete for are less Basic science has always been a strong focus of the Medical University of Vienna, important than the collective endeavor and the Max Perutz Labs, with its emphasis on mechanistic biomedicine, provide of the scientific community.” an outstanding environment in which to nurture the creativity and intellectual freedom that are the hallmarks of outstanding scientific discovery. The cures of – Georgina Ferry, science writer and tomorrow are rooted in the discoveries of today. The development of a new 2-year Max Perutz biographer Master’s course in Molecular Precision Medicine, which is being spearheaded by the Max Perutz Labs, is just one example that illustrates these values, as well as our commitment to basic science. I sincerely hope that the education of students in basic, clinical, translational, and medical science will help bridge the gap between the bench and the clinic, strengthen our ties to the University of Vienna and the Vienna BioCenter, and maximize the synergies of our research programmes.” From left to right: Arndt von Haeseler, Alwin Köhler, – Rector Markus Müller, Georgina Ferry, Marion Turnovszky (Max Perutz’ cousin), Rector Heinz Engl, Rector Markus Müller Medical University of Vienna 1914 — 2002 “I owe my first step to popularity to scarlet fever which I caught when I was Max F. Perutz fourteen. To disinfect the classroom, Max Perutz was one of a handful of pioneers who began something that has become so familiar to us: Molecular Biology. my schoolmates got three days off, for which they thanked me solemnly in a letter signed by the entire class.” Pupil at the Theresianum, – Max F. Perutz aged fifteen

Born in Vienna, Max Perutz studied Growing up in Vienna Groundbreaking Studies The Challenge Continued in Cambridge, was later deported to Canada, and eventually found his Max Ferdinand Perutz was born in In 1946 Max Perutz was joined in Cam For Max Perutz the challenge con- way back to Cambridge to discover Vienna on May 19th, 1914 into a family bridge by John Kendrew, who set out tinued. To understand the oxygen- the structure of DNA together with of textile manufacturers. Max was to work on myoglobin, the much small- binding function of haemoglobin, Francis Crick. supposed to study law in preparation er single-chain cousin of haemoglobin. he needed atomic models of both for entering the family business. Both spent several years collecting the oxygenated and deoxygenated His own quest to reveal the struc- However, a good schoolmaster at the huge amounts of data and using the forms of haemoglobin. This required ture of haemoglobin was reward- Theresianum grammar school kindled intensities of the reflections to calcu- measuring several hundred thousand ed with the Nobel Prize in 1962 and his interest in chemistry, and he made late contour maps, hoping that these reflections. launched a new era of medicine. this the subject of his studies at the would allow them to determine the Beyond intellectual brilliance, Max University of Vienna. haemoglobin structure. Max Perutz and his collaborators com- Perutz stands out as an ambassador pleted it in 1970, about thirty-three for science, a humanist, and as an Although largely disappointed with The approach failed. Provoked and in- years after he had taken the first X-ray inspiration for young scientists. the way in which the subject was spired by a graduate student, Francis picture of the molecule. He proposed taught, he acquired a special interest Crick, Perutz decided to attack the so- a cooperative mechanism with the dif- in organic biochemistry, having heard called phase problem from a different ferent parts of the model swinging about the work of the Nobel Prize angle. back and forth between the two forms. Mountains and Glaciers winner (and discoverer of vitamins) It beautifully illustrated, and refined, Sir Gowland Hopkins at Cambridge. The breakthrough came in 1953, when the mechanism of conformational Mountains played an important part Perutz and Kendrew managed to soak change (or allostery) postulated in Max Perutz’s life. He had a great His teacher, Herman Mark, visited a heavy atom (mercury) into their hae- by the French biochemist Jacques passion for mountaineering and ski- Cambridge with plans to pave the moglobin crystal. For being the first Monod. ing. Barely a year passed without a way for Perutz to join Hopkins’ group. to successfully determine the struc- visit to Austria or Switzerland. He But Mark met J. D. Bernal, who said tures of complex proteins, Perutz and Approaching his eightieth birthday, also led courses in alpine skiing for that he would take Perutz as his stu- Kendrew were awarded the Nobel Prize Max Perutz took an interest in Hun his friends. dent. Max left Austria in 1936 to pur- for Chemistry in 1962. tington disease, a neurodegenerative sue his scientific career in Cambridge. disorder caused by abnormal expan- From his early twenties Perutz had a sions of glutamine repeats in the mu- deep interest in glaciers. How do gla- tant protein (later called huntingtin). ciers flow? Does this occur like honey Max Perutz led by example and car- Max F. Perutz with his first flowing out of a tilted container, or is high-resolution model of ried out his own experiments at the there some other mechanism? More haemoglobin bench well into his eighties. or less as a hobby, Perutz, examined this problem and proposed that they

behave like a ductile metal such as al- Diffraction photograph of uminium when it is rolled into a sheet. oxyhaemoglobin The story was published in Nature in 1953. In honour of his contributions to “Discoveries cannot be glaciology, a glacier in the Antarctic was named after him. planned, they pop up, like Puck, in unexpected corners.” – Max F. Perutz Max F. Perutz also had a great passion for mountaineering and skiing. When asked in a BBC radio interview what luxury he would take on a remote island, 87-year old Max Perutz said: “ A pair of skis.”

Max Perutz Labs

Vienna BioCenter (VBC) Dr.-Bohr-Gasse 9, 1030 Vienna, Austria

+43 1 4277 - 2400 1 [email protected] www.maxperutzlabs.ac.at

One of Imprint Max Perutz’s many Editor stunning Max F. Perutz Laboratories Support GmbH mountain Dr. Bohr-Gasse 9, A-1030 Wien photographs, +43 1 4277-24001 taken on a [email protected] trip to the Swiss Alps. Photo Credits Max Kropitz, Felicitas Matern (feel imageDesign) Many thanks to Vivien Perutz (Cambridge) for allowing us to reprint pictures that are owned by the Perutz family.

Design buero bauer maxperutzlabs.ac.at