![Catalyzing Discovery in Mechanistic Biomedicine](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
The Max Perutz Labs Catalyzing discovery in mechanistic biomedicine A joint venture of Part of Mission Statement The Max Perutz Labs are dedicated to a mechanistic understanding of impor- tant biological processes. We have the potential to AATACTAGATATGAAAGATTCCCCCTTTATTTACACGGCTCTAGCAGCAGCGTCGTCAAGAAGAAAAGCCAGTACACGTACCAGAAAATAGAAGTAACAGCGTCCCCCATCGAATGGCTATTATGCAAAGGGTTACACAATAATTACCACCACCGTGAGACACCACCGCCAGCAGTGCTTATCCATATTCCAGCAGCCATACTTAGTATCGTCTATAACCAACAATAGATCATATCACGCAGCACCAGCAACGGGCTTCCGCCACCACCTTCAGCAGAAATGGTAGTAGTGGGAACAGCAGCACTAACGCCAACAACCGATGAGCGTTGGCAGCACCAGCAGTCCAGATACCGGAACATGCAGGCAGATCATCCGCCTCGCAAGAAGATAATGACGAAAAAAGAGTCACAATAGTCAAGATACGAACGGCAGGACCACGAGCATGGTACAAATTCGTACCACCTACCGCAACGTGGCATTACCAAGCACAACCATCCCCCAGGTACAACAAGATACAAGGCCGTACTATTCAGCTAATAGCAGGGACAAACCGGAGCATACTATCGAAACGGATACACGACTATGAGCAGCCGCCCCAAGAGGGAGACTTGACGGTAATGCGTCTTATGGCGCGAGATACAACAGTGTAGAGGTGGAGCAGGCGGATCGTATTACAGAGGGAGCAAAGGGGGGGTTATCACCATGCGAGACGAATACTCATCCACTCCTCCATGAGCGGATACACGGGAAATAATTATAGCAGA catalyze groundbreaking discoveries in mechanistic - biomedicine. - We combine world-class research facilities with modern teaching methods to educate, inspire, and empower the next generation of 21st century scientists. The Max Perutz Labs are a joint ven- ture between the University of Vienna and the Medical University of Vienna that builds on the unique opportunities that arise from being embedded in the Vienna BioCenter Campus while having one of the largest hospitals in Europe, the Vienna General Hospital, on our door step. In visualizing haemoglobin, Max Perutz paved the way towards the era of precision medicine. To realize its full potential, precision medicine necessitates a molecular mechanistic approach. Shaping the Future of the Max Perutz Labs 2005 Highlights Founding Part of the Vienna BioCenter 52/48 The Max Perutz Labs were founded The Max Perutz Labs are part of the 2017—2019 in 2005 as a joint venture of the Vienna BioCenter, one of Europe’s Female and Male Staff University of Vienna and the Medical hotspots for life sciences. University of Vienna. Facts & Figures The last two years have seen a period of significant change that will shape the future of the Max Max Perutz Labs Perutz Labs. With the Seeding Success in Science Symposium in 2017 we said farewell 366 to scientific director Graham Warren. at a Glance Arndt von Haeseler was elected as Research Grants, Graham’s successor and continues to With the implementation of a new ERC Grants Prizes and Awards lead the Max Perutz Labs today. He is name—Max Perutz Labs Vienna—we 1 ERC Starting Grant supported by a team of co-directors: aim to strengthen the identity of the Including 12 ERC Grants 3 ERC Consolidator Grants Alwin Köhler, Peter Schlögelhofer institute and reinforce our connection and 8 START Awards 1 ERC Proof of Concept Grant and Kristin Tessmar-Raible, as well with an outstanding scientist, leader as Fabien Martins as administrative and educator. The first Max Perutz Academic Achievements Data as of May Australia 2019 Mexico director. Day in May 2019 brought together our Full Professorship: Austria New Zealand stakeholders, scientists and students Andreas Bachmair, Verena Belarus Pakistan The Catalyzing Change project was to celebrate the 105th birthday and Jantsch, Alwin Köhler, Sascha Australia Belgium Australia Australia Mexico Mexico Poland Mexico kicked off in 2018 and has initiated an legacy of Max Perutz. Austria Austria Austria New Zealand New Zealand New Zealand Martens, Isabella Moll, Kristin Brazil Australia Portugal Mexico internal change process. It has brought Belarus Belarus Belarus Pakistan Pakistan Pakistan Tessmar-Raible, Bojan Zagrovic Belgium Bulgaria Belgium Austria Belgium Poland Poland RussiaNewPoland Zealand together all group leaders of the Max Researchers at the Max Perutz Labs Brazil Brazil Belarus Brazil Portugal PortugalPakistanPortugal Bulgaria Bulgaria Russia Russia Perutz Labs in a series of workshops continue to deliver internationally Associate Professorship: Canada Bulgaria Belgium Russia Serbia Poland Canada Canada Serbia Serbia Canada Brazil Serbia Portugal to redefine the mission of the institute, recognized research in fundamental Boris Görke, Thomas Leonard, China China Slovakia Slovakia China China Bulgaria Slovakia Slovakia Russia Croatia Croatia Slovenia Slovenia finding common ground in the pursuit biological processes. Our group lea- Gijs Versteeg Croatia Canada Slovenia Serbia Czech Croatia Republic Czech Republic Somalia Slovenia Somalia China Slovakia of mechanistic biomedicine. The new ders successfully secured multiple Estonia Czech Republic Estonia40+ Spain Somalia Spain Croatia Slovenia France Czech Republic Estonia France Switzerland Spain Somalia Switzerland Student Awards and Grants Czech Republic Somalia ‘Think Tank’, a meeting space de sig- high-profile grants, among them five Germany France GermanyNationalities Thailand Switzerland Thailand Estonia Estonia Spain Spain Greece Germany Greece The Netherlands Thailand The Netherlands ned to encourage exchange and com- highly competitive ERC grants. France Switzerland Uni:docs Fellowship: Hungary France Greece Hungary Tunesia The NetherlandsSwitzerland Tunesia munication was opened in November India Hungary Germany India Turkey TunesiaThailandTurkey Martina Borroni, Madhwesh Greece The Netherlands 2018. A new logo and visual appear- 2017—2019 also saw five Max Perutz IndonesiaGermany India Indonesia U.S.A. Turkey Thailand U.S.A. Coimbatore Ravichandran, Italy Indonesia Hungary Italy Ukraine U.S.A.TunesiaUkraine ance of the institute were introduced Labs group leaders promoted to full Japan Greece Italy India Japan United Kingdom Ukraine TheTurkeyUnited Netherlands Kingdom Merrit Romeike, Adriana Savova, Latvia Venezuela Latvia Japan Indonesia Venezuela United KingdomU.S.A. in May 2019 as a symbolic milestone, professor and three promoted to Lithuania Hungary Lithuania Tunesia Maria Velkova, Theresa Zekoll Latvia Italy Venezuela Ukraine kicking off a new era. associate professors, demonstrating India Lithuania Japan Turkey United Kingdom Latvia Venezuela the success of the tenure track system. DocAward: Indonesia Lithuania U.S.A. Research Groups and their relation to Research Areas Research Groups and their relation to Research Areas Finally, in July 2019 we celebrated Iva Lučić Italy Ukraine the 95th birthday of Professor Hans Research Groups and their relation to Research Areas 55 Group Leaders 55 Group Leaders VBC PhD Award: Japan and Lecturers andUnited Lecturers Kingdom Tuppy, who was honoured for his ResearchResearch Groups Groups and and their their relation relation to Research to ResearchAreas 114 Administrative Areas staff 114 Administrative55 staff Group Leaders Dorotea Fracchiolla, and science support and science support outstanding scientific achievements. Latvia 97 Post Docs and Lecturers Venezuela97 Post Docs Laura D. Gallego, Iva Lučić 114 Administrative staff 55 Group Leaders and Lecturers Lithuania and science support 97 Post Docs 114 Administrative staff At the Max Perutz Labs Vienna we ÖAW Doc Fellowship: and science support 97 Post Docs draw inspiration from the legacy of Tanja Kaufmann, Max Perutz, are home to the talented Anete Romanauska, scientists of today, and educate an Raffaela Torggler, Georg Vucak, Research Groups and their relation to Research Areas 7 50 452 aspiring young generation of scientists. Milica Vunjak Research Areas Research Groups Scientists & Over the next few years our institute 47 Undergraduates 47 Undergraduates L’Oreal Fellowship: 55 GroupStaff Leaders will continue to focus on our mission 126 PhD Students 126 PhD Students Laura D. Gallego and Lecturers to push forward the frontiers of mecha- Cell Biology & Signalling Computational Modelling Immunity & Infection Cell BiologyStructure & Signalling & Function Computational Modelling Immunity & Infection Structure & Function 47 Undergraduates of Biological Systems of Biological Systems of Macromolecular Chromatin, RNA & Mechanisms of HumanChromatin, of Macromolecular RNA & Mechanisms of Human 114 Administrative staff 126 PhD Students nistic biomedicine as we see more Assemblies Assemblies 47 Undergraduates Chromosome Biology Developmental Dynamics Disease Chromosome Biology Developmental Dynamics Disease and science support of the Catalyzing Change process Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function 12697 PhD Post Students Docs of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular coming to life. Cell Biology & Signalling Chromosome Biology DevelopmentalComputational Dynamics ModellingDisease Immunity & Infection AssembliesStructure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies 47 Undergraduates 126 PhD Students Cell Biology & Signalling Computational Modelling Immunity & Infection Structure & Function of Biological Systems Chromatin, RNA & Mechanisms of Human of Macromolecular Chromosome Biology Developmental Dynamics Disease Assemblies Research Areas Research at the Max Perutz Labs Is Curiosity-Driven and Spans the Fields of Molecular and Cell Biology. Cell Biology & Signalling Chromatin, RNA & Computational Modelling Cells communicate at every level and Chromosome Biology of Biological Systems molecular misunderstandings must Unravelling nature’s genetic and Making
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages13 Page
-
File Size-