agronomy

Article Isolation and Characterization of the PISTILLATA Ortholog Gene from Cymbidium faberi Rolfe

Yue Fei and Zhi-Xiong Liu *

College of Horticulture and Gardening, Yangtze University, Jingzhou 434025, China * Correspondence: [email protected]; Tel.: +86-716-8066260



Received: 29 May 2019; Accepted: 1 August 2019; Published: 2 August 2019


Abstract: Cymbidium faberi Rolfe is a very popular potted plant in China, Japan and Korea where it has been cultivated for centuries. The economic value of this popular native Asian orchid could be enhanced by changes in its floral traits. In Arabidopsis, PISTILLATA (PI) is involved in regulating petal and stamen development. In order to investigate the possible role of the PI ortholog involved in floral development, we isolated CyfaPI from C. faberi. Protein alignment and a phylogenetic tree grouped CyfaPI in the PI lineage. CyfaPI transcripts were detected in all floral organs, but were absent in leaves. Moreover, in flowers, the highest expression level of CyfaPI was present in the gynostemium and the lowest level was found in anther caps. In addition, ectopic expression of CyfaPI in Arabidopsis pi-1 mutant rescued petal development, and complement the development of filament-like structure (part of stamen), but failed to complement anther development in the stamen whorl. All these finding suggest that CyfaPI is mainly responsible for perianth and gynostemium development in C. faberi. Our data may help to trace the development of the gynostemium program and evolution in orchids.

Keywords: PISTILLATA; Cymbidium faberi; MADS-box gene; Floral development; Orchidaceae

1. Introduction Cymbidium faberi Rolfe is a very popular potted plant in several countries of East Asia, and has been cultivated for centuries in China, Japan and Korea. Many artificially propagated varieties have been developed based on various flower traits including their color and number as well as the form of the perianth (sepal and petal). All of these elements contribute to the visual appreciation of orchids. The perianth is the most visually obvious structure, which is related to its primarily function as an optical attraction for pollinators. Moreover, the molecular mechanisms underlying the perianth identity program have been intensively studied in model species such as Arabidopsis thaliana, Antirrhinum majus and Petunia hybrida [1], and the evolution of the perianth identity has been extensively discussed recently in [2]. However, the perianth in monocots does not completely correspond to the obvious differentiation of sepal and petal whorls in model eudicots. In eudicots, the conserved function of the PISTILLATA (PI)/GLOBOSA (GLO) orthologs, such as MtPI from Medicago truncatula [3], TrPI from Taihangia rupestris [4], CabuPI from Catalpa bungei [5], is the regulation of petal and stamen development. Furthermore, each ortholog is able to fully complement the floral phenotype of the Arabidopsis pi mutant, and the expression pattern of each corresponds to their conserved function. In basal angiosperm, PI-like genes usually show broad expression zones in floral organs. For example, HoPI_1 and HoPI_3 from Hedyosmum orientale are expressed in all floral organs including the bracts and carpels. In addition, HoPI_1 mimics the endogenous Arabidopsis PI and fully rescues both petal and stamen development in Arabidopsis pi-1 mutants, while HoPI_3 only rescues petal development, and partially rescues stamen development [6]. In another basal angiosperm Magnolia wufengensis, the PI ortholog MawuPI was only able to rescue filament-like structures in the third whorl, but failed to rescue petal development in

Agronomy 2019, 9, 425; doi:10.3390/agronomy9080425 www.mdpi.com/journal/agronomy Agronomy 2019, 9, 425 2 of 11

Agronomy 2019, 20 FOR PEER REVIEW 2 the second whorl [7]. Together, these data provide interesting evidence of a B-function evolutionary Together, these data provide interesting evidence of a B-function evolutionary scenario among scenario among early-diverging clades of the angiosperm. early-diverging clades of the angiosperm. MonocotsMonocots are are one one of theof the major major clades clades of angiosperm,of angiosperm, and and the the Orchidaceae Orchidaceae family family is oneis one of of the the most species-richmost species-rich in this clade; in this it clade; includes it includes species species with highly with highly diversified diversified and specialized and specialized floral floral shapes. Previousshapes. studies Previous have studies indicated have thatindicated floral that diversity floral diversity in orchids in results orchids from results changes from changes in the regulatory in the regionsregulatory of the regionsMADS -boxof the genes MADS followed-box genes by followed gene duplication by gene duplication events [8], events and that [8],PI and-like that genes PI-like work togethergenes with work di togetherfferent AP3 with/AGL6 different homologs AP3/AGL6 involved homologs in specifying involved sepal in specifying/petal/lip sepal/petal/lip development in Oncidiumdevelopmentand Phalaenopsis in Oncidiumorchids and Phalaenopsis [9]. Here, we orchids isolated [9]. aHere,PI ortholog, we isolatedCyfaPI, a PIfrom ortholog, a Chinese CyfaPI, traditional from orchida ChineseC. faberi traditionalRolfe. The orchid flower C. offaberiC. faberiRolfe.consists The flower of three of C. whorls faberi consists of floral of organs, three whorls with three of floral sepals in whorlorgans, 1, with two three petals sepals and ain lip whorl in whorl 1, two 2, petals and a gynostemiumand a lip in whorl fused 2, and by thea gynostemium male and female fused tissues by in whorlthe male 3 (Figure and female1). CyfaPI tissuestranscripts in whorl 3 (Figure are detected 1). CyfaPI in all transcripts floral organs, are detected but are in absent all floral in theorgans, leaves, whichbut showed are absent a di infferent the leaves, expression which pattern showed to PI a -likedifferent genes expression from eudicots. pattern Further to PI-like functional genes analysis from revealedeudicots. that FurtherCyfaPI functionalis able to analysis fully complement revealed that petals CyfaPI in is whorl able to 2, fully but cancomplement only rescues petals filament-like in whorl structures2, but can in whorlonly rescues 3 of flowers filament-like in transformed structuresArabidopsis in whorl 3 pi-1 of flowersmutants. in Ourtransformed data may Arabidopsis provide the pi-1 clue to helpmutants. trace Our the data gynostemium may provide development the clue to help program trace andthe gynostemium evolution in orchids.development program and evolution in orchids.

Figure 1. Flower and inflorescence of Cymbidium faberi. (A) Flower of C. faberi;(B) The gynostemium Figure 1. Flower and inflorescence of Cymbidium faberi. (A) Flower of C. faberi; (B) The gynostemium and ovary of C. faberi;(C) The inflorescence of C. faberi. Sepals (sep), petals (pet), lips (lip), anther cap and ovary of C. faberi; (C) The inflorescence of C. faberi. Sepals (sep), petals (pet), lips (lip), anther cap (anc),(anc), gynostemium gynostemium (gyn), (gyn), ovary ovary (ova). (ova). Bars:Bars: 5 mm. 2. Results 2. Results 2.1. Cloning and Sequence Alignments of CyfaPI 2.1. Cloning and Sequence Alignments of CyfaPI The CyfaPI (Cymbidium faberi PISTILLATA) cDNA is 932 bp with a 633 bp ORF (Open Reading The CyfaPI (Cymbidium faberi PISTILLATA) cDNA is 932 bp with a 633 bp ORF (Open Reading Frame) encoding a 210 amino acid (aa) protein (Genbank accession number: MK450600.1). Putative Frame) encoding a 210 amino acid (aa) protein (Genbank accession number: MK450600.1). Putative proteinprotein alignment alignment and and a a phylogenetic phylogenetic analysis analysis grouped grouped CyfaPI CyfaPI into into the theGLO/PI GLO lineage/PI lineage (Figure (Figure 2). In 2). In addition,addition, CyfaPI CyfaPI is is nested nested within within a a clade clade of of orthologs orthologs from from other other monocots monocots and and is mostis most closely closely relatedrelated to orthologsto orthologs from from the the Orchidaceae, Orchidaceae, suchsuch as Oncidium OMADS8OMADS8 (97.14% (97.14% identity) identity) (Figure (Figure 2A).2A). ComputationalComputational translation translation showsshows thatthat CyfaPI is is a aputative putative transcriptional transcriptional regulator regulator that thatcontains contains a a highlyhighly conserved 57 57 aa aa MADS-box MADS-box domain domain (1–57) (1–57) at the atN-terminal the N-terminal region, a region, less conserved a less conserved64 aa K 64domain aa K domain (87–150) (87–150) in the middle in the region middle and region a highly and conserved a highly 16 aa conserved PI motif (193–208) 16 aa PI in motif the variable (193–208) in theC terminal variable region C terminal (151–210). region Moreover, (151–210). CyfaPI Moreover, contains CyfaPI three contains putative three amphipathic putative amphipathic α-helices, α-helices,K1(87–108), K1(87–108), K2 (121–135) K2 (121–135) and K3 (143v167) and K3 (143v167) subdomains subdomains that could that potentially could potentially mediate protein mediate proteininteraction interaction (Figure (Figure 2B) [10–12].2B) [ 10 In– 12addition,]. In addition, CyfaPI is CyfaPI 55.56%, is 55.66%, 55.56%, 59.05%, 55.66%, 60.85%, 59.05%, 71.09%, 60.85%, 64.29%, 71.09%, 64.29%,74.53%, 74.53%, 79.05%, 79.05%, and 67.14% and 67.14% identified identified to PI tofrom PI from A. thalianaA. thaliana, TrPI, TrPIfrom from T. rupestrisT. rupestris, MtPI, MtPI from from M. M. truncatulatruncatula, CabuPI, CabuPI from fromC. bungei C. bungei, HoPI_1, HoPI_1 and HoPI_3 and HoPI_3 from H. from orientale H. orientale, MAwuPI, MAwuPI from M. fromwufengensis M. , andwufengensis LMASDS8, and and LMASDS8 LMADS9 and from LMADS9Lilium longiflorum from Lilium, respectivelylongiflorum, respectively (Figure2B). (Figure 2B).

Agronomy 2019, 9, 425 3 of 11 Agronomy 2019, 20 FOR PEER REVIEW 3

Figure 2. Phylogenetic analysis and sequence alignments of CyfaPI with B-class MADS-box proteins fromFigure other 2. plantPhylogenetic species. analysis (A) Phylogenetic and sequence analysis alignments of B-classof CyfaPI MADS-box with B-class proteins; MADS-box (B) proteins Sequence alignmentsfrom other of CyfaPIplant species. with PI-like (A) Phylogenetic proteinsfrom analysis other of plant B-class species; MADS-box the first proteins; underline (B) Sequence indicates thealignments MADS-box of domainCyfaPI with and PI-like the second proteins the from K domain. other plant The species; PI motif the first in theunderline C-terminal indicates region the is MADS-box domain and the second the K domain. The PI motif in the C-terminal region is boxed. boxed. Dots represent amino acids (aa) identical to CyfaPI. Dashes indicate gaps inserted to improve Dots represent amino acids (aa) identical to CyfaPI. Dashes indicate gaps inserted to improve the the sequence. The K1, K2 and K3 helices with the (abcdefg)n heptad repeats are also underlined. sequence. The K1, K2 and K3 helices with the (abcdefg)n heptad repeats are also underlined. 2.2. Expression Analyses of CyfaPI in C. faberi 2.2. Expression Analyses of CyfaPI in C. faberi CyfaPI expression was restricted to floral organs, such as sepals, petals, lips, anther caps, gynostemia and ovaries, and was absent in juvenile leaves (Figure3). In addition, the highest CyfaPI AgronomyAgronomy2019 2019, 9,, 42520 FOR PEER REVIEW 4 4of 11

CyfaPI expression was restricted to floral organs, such as sepals, petals, lips, anther caps, expressiongynostemia was and observed ovaries, and in gynostemia, was absent in where juvenile the leaves expression (Figure was3). In significantly addition, the higherhighest thanCyfaPI that in sepals,expression petals, was lips,observed anther in gynostemia, caps and ovaries where (theLSD, expression p < 0.05). was Moreover, significantly there higher was than no significant that in diffsepals,erences petals, in CyfaPI lips, expression anther caps in and the ovaries sepals and (LSD, petals, p < 0.05). where Moreover, the CyfaPI thereexpression was no insignificant both these tissuesdifferences was significantly in CyfaPI expression higher than in thatthe sepals in the lips,and petals, anther where caps and the ovariesCyfaPI expression (LSD, p < 0.05). in both The these lowest CyfaPItissuesexpression was significantly was detected higher in than anther that caps,in the where lips, anther the expression caps and ovaries was considerably (LSD, p < 0.05). lower The than thatlowest in sepals, CyfaPI petals, expression gynostemia was detected and ovaries in anther (LSD, caps, p 0.05) (Figure and ovaries3A). CyfaPI (LSD, expressionp < 0.05), but was showed also detectable no significant in floral budsdifference at 5 mm to (early CyfaPI stages expression of flower in di lipsfferentiation), (LSD, p > 0.05)8 mm (Figure (seasonal 3A). dormancy CyfaPI expression of floral buds), was also 10 mm (breakingdetectable dormancy in floral andbuds further at 5 mm development), (early stages 15of mm,flower 20 differentiation), mm, 25 mm and 8 mm at bud (seasonal opening dormancy (Figure3 B). Moreover,of floral buds),CyfaPI 10expression mm (breaking became dormancy detectable and further during development), the early stages 15 mm, of 20 flower mm, 25 di mmfferentiation and at andbud increased opening until(Figure the 3B). seasonal Moreover, dormancy CyfaPI expression of floral buds. became In addition,detectable withduring the the breaking early stages of flower of dormancyflower differentiation and further development, and increasedCyfaPI until theexpression seasonal increaseddormancy continuouslyof floral buds. and In addition, achieved with its highest the breaking of flower dormancy and further development, CyfaPI expression increased continuously level (LSD, p < 0.05) in floral buds of 25 mm when it reached maturity, and then began to drop after and achieved its highest level (LSD, p < 0.05) in floral buds of 25 mm when it reached maturity, and the floral buds opened. then began to drop after the floral buds opened.

Figure 3. CyfaPI expression was detected by RT-qPCR in different tissues (A) and various stages of Figure 3. CyfaPI expression was detected by RT-qPCR in different tissues (A) and various stages of flower development (B) in C. faberi. (A) Expression of CyfaPI in the juvenile leaves (lea), sepals (sep), flower development (B) in C. faberi. (A) Expression of CyfaPI in the juvenile leaves (lea), sepals (sep), petals (pet), lips (lip), anther caps (anc), gynostemia (gyn) and ovaries (ova) with the C. faberi ACTIN petals (pet), lips (lip), anther caps (anc), gynostemia (gyn) and ovaries (ova) with the C. faberi ACTIN gene used as the internal control; (B) Expression of CyfaPI at various stages of flower development. gene used as the internal control; (B) Expression of CyfaPI at various stages of flower development. Different letters indicate statistically significant differences. Different letters indicate statistically significant differences. 2.3. Ectopic Expression of CyfaPI in Arabidopsis pi-1 Mutant 2.3. Ectopic Expression of CyfaPI in Arabidopsis pi-1 Mutant To further determine the role of CyfaPI in flower development, we attempted to rescue To further determine the role of CyfaPI in flower development, we attempted to rescue the the loss-of-function Arabidopsis pi mutant (pi-1) via the expression of a CyfaPI transgene. Binary vectors loss-of-function Arabidopsis pi mutant (pi-1) via the expression of a CyfaPI transgene. Binary vectors carryingcarrying35S::CyfaPI 35S::CyfaPIwere were introduced introduced into into Arabidopsis byby AgrobacteriumAgrobacterium-mediated-mediated transformation. transformation. TheThe transgenic transgenicArabidopsis Arabidopsis lineslines were confirmed confirmed by by RT-qPCR RT-qPCR and and the themutant mutant allele allele was identified was identified by bydCAPS dCAPS genotyping genotyping (Figure (Figure S1). S1). Seven Seven wild-type, wild-type, 11 11 homozygous homozygous pi-1pi-1 andand 14 14 heterozygote heterozygote pi-1pi-1 independentindependent transgenic transgenicArabidopsis Arabidopsis lines lines were were obtained. obtained. Phenotypes Phenotypes ofof the the transgenic transgenic lines lines were were assayedassayed in ain homozygous a homozygouspi-1 pi-1mutant mutant background background to to evaluate evaluate whether whether the theCyfaPI CyfaPItransgene transgene couldcould act as aact substitute as a substitute for the endogenous for the endogenousPI gene inPI regulating gene in petalregulating and stamen petal and development. stamen development. Phenotypes of transgenicPhenotypes lines of weretransgenic also analyzedlines were inalso a wild-typeanalyzed inArabidopsis a wild-typebackground Arabidopsis background to evaluate to the evaluate function of CyfaPIthe functionin the of floral CyfaPI development in the floral (Table development1). In addition, (Table the 1). InCyfaPI addition,expression the CyfaPI in homozygous expression inpi-1 mutantshomozygous and wild pi-1 type mutants transgenic and wildArabidopsis type transgenicwith diff Arabidopsiserent phenotypes with different was also phenotypes determined was (Figure also 4). determinedAmong the (Figure 11 35S 4).:: CyfaPI homozygous pi-1 transformants, 3 (27.27%) lines showed strong complementationAmong the phenotypes 11 35S:: CyfaPI with homozygous flowers consisting pi-1 transformants, of four concentric 3 (27.27 %) whorls lines showed of floral strong organs. Thecomplementation flower has 4 petaloid phenotypes sepals with in whorlflowers 1 consisting (outmost ring),of four 4 concentric petals in whorlwhorls 2,of 3 floral (or 4) organs. filament-like The flower has 4 petaloid sepals in whorl 1 (outmost ring), 4 petals in whorl 2, 3 (or 4) filament-like organs without anther attachment in whorl 3 and a normal gynoecium in whorl 4 (innermost central organs without anther attachment in whorl 3 and a normal gynoecium in whorl 4 (innermost central area) (Figure5G,H). Two (18.18%) lines displayed medium complementation phenotypes that produced area) (Figure 5G, H). Two (18.18 %) lines displayed medium complementation phenotypes that flowers with four concentric whorls of floral organs. There were 4 normal sepals in whorl 1, 4 petals in produced flowers with four concentric whorls of floral organs. There were 4 normal sepals in whorl whorl 2, 3 (or 4) filament-like organs without anther attachment in whorl 3 and a normal gynoecium in whorl 4 of flowers of this complementation group (Figure5K,L). Six lines (54.55%) failed to Agronomy 2019, 9, 425 5 of 11 Agronomy 2019, 20 FOR PEER REVIEW 5 display1, 4 petals a phenotype in whorl complementation 2, 3 (or 4) filament-like and produced organs without flowers anther similar attachment to homozygous in whorlpi-1 3 andmutant a flowers.normal In gynoecium addition, in the whorl flower 4 of phenotypes flowers of ofthis transgenic complementationArabidopsis groupin heterozygous(Figure 5K, L). pi-1Six linesmutant and(54.55%) the wild-type failed background to display a were phenotype also assayed, complementation and almost and all the produced flower-phenotype flowers similar changes to in transgenichomozygousArabidopsis pi-1 mutantin heterozygous flowers. In PIaddition,/pi-1 background the flower resembled phenotypes the of flower transgenic phenotypes Arabidopsis displayed in heterozygous pi-1 mutant and the wild-type background were also assayed, and almost all the by wild-type lines expressing the introduced transgene. Among a total of 7 35S:: CyfaPI wild-type flower-phenotype changes in transgenic Arabidopsis in heterozygous PI/pi-1 background resembled transgenic Arabidopsis, 3 (42.86%) lines showed severe phenotype changes and produced flowers with the flower phenotypes displayed by wild-type lines expressing the introduced transgene. Among a sepals converted into petaloid organs in whorl 1 (Figure5E,F), and 3 (42.86%) lines displayed medium total of 7 35S:: CyfaPI wild-type transgenic Arabidopsis, 3 (42.86 %) lines showed severe phenotype phenotypechanges and changes produced and haflowers flowers with with sepals the converted first whorl into sepal petaloid partly organs converted in whorl into 1 petal (Figure (Figure 5E, F),5I,J). In addition,and 3 (42.86 the %)CyfaPI lines displayedexpression medium levels correspondedphenotype changes to the and flower-phenotype ha flowers with the changes first whorl in transgenic sepal plantspartly (Figure converted4). For into example, petal (FigureCyfaPI 5I,expression J). In addition, levels the in transgenicCyfaPI expressionArabidopsis levelslines corresponded in homozygous to pi-1thebackground flower-phenotype with strong changes complementation in transgenic plants phenotypes (Figure 4). (T For1-9 example,/pi-1,T1-10 CyfaPI/pi-1 )expression were significantly levels higherin transgenic than that inArabidopsis homozygous lines pi-1 in homozygoustransgenic plants pi-1 background with medium with complementation strong complementation phenotypes (T1phenotypes-7/pi-1,T1-8 /(Tpi-11-9/) orpi-1 without, T1-10/pi-1 complementation) were significantly of petal higher and than stamen that developmentin homozygous (T 1pi-1-1/pi-1 transgenic,T1-2/pi-1 ) (LSD,plants p < with0.05). medium Moreover, complementationCyfaPI expression phenotypes levels in (T homozygous1-7/pi-1, T1-8/pi-1pi-1) transgenicor without plantscomplementation with medium complementationof petal and stamen phenotypes development (T1-7 /(Tpi-11-1/,Tpi-11-8, /Tpi-11-2/)pi-1 were) (LSD, also observedp < 0.05). Moreover, to be significantly CyfaPI expression higher than thatlevels in homozygous in homozygouspi-1 pi-1transgenic transgenic plants plants without with medium phenotype complementation complementation phenotypes (T1-1/pi-1 (T,T1-7/1pi-1-2/pi-1, ) (LSD,T1-8/ ppi-1< 0.05).) were Similar also observed resultswere to be also significantly observed higher in wild-type than that transgenic in homozygousArabidopsis pi-1. Furthermore,transgenic threeplants interesting without phenotype flower phenotypes complementation were also (T1-1/ foundpi-1, T in1-2/ thepi-135S) (LSD,:: CyfaPI p < 0.05).transgenic Similar resultsArabidopsis were in thealso heterozygous observed inPI wild-type/pi-1 background. transgenic Specifically, Arabidopsis. one Furthermore, line produced three significantly interesting flower larger phenotypes sized flowers, were also found in the 35S:: CyfaPI transgenic Arabidopsis in the heterozygous PI/pi-1 background. and another line produced flowers with five petals in whorl 2. The third line produced flowers with Specifically, one line produced significantly larger sized flowers, and another line produced flowers six petals in whorl 2 (Figure6). with five petals in whorl 2. The third line produced flowers with six petals in whorl 2 (Figure 6).

Figure 4. The CyfaPI expression was detected by RT-qPCR in the T1 transgenic plants in wild-type Figure 4. The CyfaPI expression was detected by RT-qPCR in the T1 transgenic plants in wild-type and homozygous Arabidopsis pi-1 mutant background. (A) CyfaPI expression was detected in wild-type and homozygous Arabidopsis pi-1 mutant background. (A) CyfaPI expression was detected in transgenic Arabidopsis;(B) CyfaPI expression was detected in homozygous pi-1 mutant transgenic wild-type transgenic Arabidopsis; (B) CyfaPI expression was detected in homozygous pi-1 mutant Arabidopsis. Different letters indicate statistically significant differences. transgenic Arabidopsis. Different letters indicate statistically significant differences.

Wild-type (WT) Arabidopsis; (T1-1/WT) 35S:: CyfaPI transgenic line without phenotypic changes; Wild-type (WT) Arabidopsis; (T1-1/WT) 35S:: CyfaPI transgenic line without phenotypic changes; (T1-2/WT, T1-3/WT, T1-4/WT) 35S:: CyfaPI transgenic lines displayed weak phenotype changes in floral (T1-2/WT, T1-3/WT, T1-4/WT) 35S:: CyfaPI transgenic lines displayed weak phenotype changes in structure; (T -5/WT, T -6/WT) 35S:: CyfaPI transgenic lines displayed severe phenotype changes in floral structure;1 (T1-5/WT,1 T1-6/WT) 35S:: CyfaPI transgenic lines displayed severe phenotype floralchanges structure; in floral (pi-1) Homozygous structure; (pi-1pi-1) Homozygousmutant Arabidopsis pi-1 mutant; (T1-1/pi-1 Arabidopsis,T1-2/pi-1; ) (T35S::CyfaPI1-1/pi-1, T1transgenic-2/pi-1) lines35S::CyfaPI without phenotypetransgenic complementation;lines without phenotype (T1-7/ pi-1 complementation;,T1-8/pi-1) 35S::CyfaPI (T1-7/pi-1transgenic, T1-8/pi-1) lines 35S::CyfaPI displayed mediumtransgenic complementation lines displayed phenotypes; medium and complementation (T1-9/pi-1,T1-10 phenotypes;/pi-1) 35S::CyfaPI and transgenic (T1-9/pi-1, lines T1-10/ showedpi-1) strong35S::CyfaPI complementation transgenic lines phenotypes. showed strong complementation phenotypes.

Agronomy 2019, 9, 425 6 of 11 Agronomy 2019, 20 FOR PEER REVIEW 6

Figure 5. Phenotypes comparison of the wild-type, homozygous pi-1 mutant, 35S:: CyfaPI transgenic Figure 5. Phenotypes comparison of the wild-type, homozygous pi-1 mutant, 35S:: CyfaPI transgenic Arabidopsis pi-1 A Arabidopsisunder under a wild-type a wild-type and homozygous and homozygousmutant pi-1 mutant background. background. ( ) Inflorescence (A) Inflorescence of wild-type of Arabidopsiswild-type;( BArabidopsis) Wild-type; (BArabidopsis) Wild-typeflower Arabidopsis with normalflower 4 with concentric normal whorls 4 concentric of floral whorls organs of (4 floral sepals in whorlorgans 1,(4 4sepals petals in in whorl whorl 1, 4 2, petals 6 stamens in whorl in whorl2, 6 stamens 3 and in a whorl gynoecium 3 and a in gynoecium whorl 4); in (C whorl) Inflorescence 4); (C) of homozygousInflorescence ofpi-1 homozygousmutant Arabidopsis pi-1 mutant;(D )Arabidopsis Flower of; homozygous (D) Flower ofpi-1 homozygousmutant Arabidopsis pi-1 mutantwith twoArabidopsis outer whorl with sepals two outer and onewhorl inner sepals whorl and gynoecium; one inner whorl (E) Inflorescence gynoecium; (E) of 35S::Inflorescence CyfaPI transgenicof 35S:: ArabidopsisCyfaPI transgenicin wild-type Arabidopsis background in wild-type displaying background severe phenotype displaying changes; severe phenotype (F) Flower changes; of 35S:: CyfaPI (F) transgenicFlower ofArabidopsis 35S:: CyfaPIin wild-type transgenic backgroundArabidopsis in showing wild-type severe background phenotype showing changes; severe (G) phenotypeInflorescence of 35S::changes; CyfaPI (G)homozygous Inflorescencepi-1 of 35S::transgenic CyfaPI Arabidopsishomozygousshowing pi-1 transgenic strong complementationArabidopsis showing phenotypes; strong (H)complementation Flower of 35S:: CyfaPI phenotypes;homozygous (H) Flowerpi-1 transgenic of 35S:: CyfaPIArabidopsis homozygousshowing pi-1 strongtransgenic complementation Arabidopsis phenotypes;showing strong (I) Inflorescence complementation of 35S:: phenotypes; CyfaPI transgenic (I) InflorescenceArabidopsis of in35S:: wild-type CyfaPI transgenic background Arabidopsis displaying mediumin wild-type phenotype background changes; ( displayingJ) Flower of medium35S:: CyfaPI phenotypetransgenic changes;Arabidopsis (J) Flowerin wild-type of 35S:: background CyfaPI showingtransgenic medium Arabidopsis phenotype in wild-typechanges; (K background) Inflorescence showing of 35S:: medium CyfaPI homozygous phenotype changes;pi-1 transgenic (K) ArabidopsisInflorescenceshowing of medium 35S:: CyfaPI complementation homozygous phenotypes;pi-1 transgenic (L) Flower Arabidopsis of 35S:: showing CyfaPI homozygous medium pi-1complementationtransgenic Arabidopsis phenotypes;showing (L) medium Flower complementationof 35S:: CyfaPI homozygous phenotypes. pi-1 sepal transgenic (sep), petaloidArabidopsis sepal (psep),showing petals medium (pet), stamen complementation (sta), filament-like phenotypes. organ (filo), sepal carpel (sep), (car);petaloid Bars: sepal (C) 2(psep), mm; (A, petals B, E, (pet), F, G, H, stamen (sta), filament-like organ (filo), carpel (car); Bars: (C) 2 mm; (A, B, E, F, G, H, J, K) 1 mm; (D, I, J, K) 1 mm; (D, I, L) 500 µm. L) 500 μm.

Table 1. Summary of different phenotypes of transgenic lines.

Transgenic Lines Phenotype of Flower No. Plants strong complementation 3(27.27%) 35S:: CyfaPI homozygous pi-1 transformants medium complementation 2(18.18%) no complementation 6(54.55%) severe phenotype change 3(42.86%) 35S:: CyfaPI wild-type transformants weak phenotype change 3(42.86%) no phenotype change 1(14.28%) Agronomy 2019, 9, 425 7 of 11

3. Discussion Molecular studies in model species have indicated that the function of floral MADS-box genes is highly correlated with their expression patterns; therefore, the expression patterns of MADS-box genes in other species may be a good predictor [13]. In Arabidopsis, PI works together with another B-function protein APETALA3 (AP3) to specify petal and stamen identity. Therefore, high levels of PI expression are restricted to petals and stamens [14]. Moreover, PI orthologs, such as MtPI from M. truncatula [3,15], TrPI from T. rupestris [4], and CabuPI from C. bungei [5], show conserved expression patterns and functions in these core eudicots. However, some PI orthologs from basal angiosperm species, such as H. orientale and M. wufengensis, have shown broad expression zones in floral organs and have been demonstrated to have different functions [6,7]. H. orientale, HoPI_1 and HoPI_3 showed similar expression zones, but different expression levels. In addition, HoPI_1 fully rescued both petal and stamen development in Arabidopsis pi-1 mutants, while HoPI_3 could only rescue petal development as well as partially rescuing stamen development [6]. However, the MawuPI from M. wufengensis only partly rescued the stamen development in Arabidopsis pi-1 mutants [7]. In addition, some monocots’ PI orthologs were also found to have expressions that extended outwards from the first whorl perianth [16,17]. For examples, two L. longiflorum PI orthologs, LMASDS8 and LMADS9, are expressed persistently in all the perianth whorls during flower development, but only in the stamens of young flower buds. Moreover, both genes could fully rescue petal development, but failed to complement stamen development in the Arabidopsis pi-1 mutant [16]. Together, these data suggest that changes in expression domains or an altered sequence within the PI orthologs may contribute to functional divergence. O. Gower Ramsey OMADS8, an orchid PI ortholog, was expressed in all floral organs and vegetative leaves, and was able to fully complement petal and stamen development in the Arabidopsis pi-1 mutant [17,18]. Moreover, the Oncidium PI ortholog has been demonstrated to work together with AP3-like and AGL6-like proteins to regulate sepal/petal/lip development and differentiation [9]. Similar expression and function of PI ortholog was also observed in Phalaenopsis [9,19–21]. Some PI orthologs from other Orchidaceae species, such as Liparis distans, Phaius tankervilliae, Dendrobium Spring were also found to be expressed in all floral whorls [22]. Interestingly, two copied orchid PI orthologs are present in Orchis italica, and both genes are expressed in all floral organs. In addition, the highest expression level of both genes is detected in the lateral inner tepals of the immature inflorescence, and is detected in the lips of the mature inflorescence; while the continued lowest expression level of both genes is found in the columns from immature to mature inflorescence [23,24]. In our study, C. faberi CyfaPI expression was found in all floral organs, but was absent in leaves. In addition, the highest expression level of CyfaPI was present in the gynostemia, and the lowest expression level was in the anther caps. A relatively high expression level of CyfaPI was also found in the sepals and petals (Figure3A). That is, CyfaPI showed a different expression pattern with the PI orthologs from closely related species, such as L. longiflorum and O. Gower Ramsey. Moreover, protein sequence alignments suggested that CyfaPI is 79.05%, 67.14%, 97.14% identified with LMASDS8, LMADS9 from L. longiflorum, and OMADS8 from O. Gower Ramsey, respectively (Figure2B). Furthermore, ectopic expression of CyfaPI in Arabidopsis pi-1 mutant fully rescued petal development, and complemented filament-like structure but failed to complement anther development in the stamen whorl. Together, these data suggest that changes in expression zones or an altered sequence within the PI orthologs in different groups of monocots may contribute to floral morphology changes. In C. faberi, high CyfaPI expression was found in the perianth (sepal and petal) and gynostemium (fused organ of filament and column). In addition, complementary loss-of-function alleles showed that CyfaPI could rescue petal and filament development in Arabidopsis pi-1 mutant. These results suggest that CyfaPI is mainly responsible for perianth and gynostemium development in C. faberi. Specifically, one line of transgenic Arabidopsis in heterozygous PI/pi-1 background produced noticeably larger sized flower, and another line produced flowers with five petals in whorl 2. The third line produced flowers with six petals in whorl 2 (Figure6). Perhaps the future challenge is to uncover how C. faberi PI ortholog, CyfaPI, is involved in increasing petal number and the size of floral organs. Agronomy 2019, 20 FOR PEER REVIEW 8

contribute to floral morphology changes. In C. faberi, high CyfaPI expression was found in the perianth (sepal and petal) and gynostemium (fused organ of filament and column). In addition, complementary loss-of-function alleles showed that CyfaPI could rescue petal and filament development in Arabidopsis pi-1 mutant. These results suggest that CyfaPI is mainly responsible for perianth and gynostemium development in C. faberi. Specifically, one line of transgenic Arabidopsis in heterozygous PI/pi-1 background produced noticeably larger sized flower, and another line produced flowers with five petals in whorl 2. The Agronomy 2019, 9, 425 8 of 11 third line produced flowers with six petals in whorl 2 (Figure 6). Perhaps the future challenge is to uncover how C. faberi PI ortholog, CyfaPI, is involved in increasing petal number and the size of In addition,floral organs. our In experiment addition, our suggests experiment that CyfaPI suggestsholds that the CyfaPI potential holds forthe biotechnicalpotential for engineeringbiotechnical to developengineering new ornamental to develop plant new varietiesornamental of orchids plant varieties with interesting of orchids and with valuable interesting traits. and valuable traits.

Figure 6. Interesting flower phenotypes of 35S::CyfaPI transgenic PI/pi-1 Arabidopsis.(A) The large Figure 6. Interesting flower phenotypes of 35S::CyfaPI transgenic PI/pi-1 Arabidopsis. (A) The large flower of 35S::CyfaPI transgenic PI/pi-1 Arabidopsis and the PI/pi-1 Arabidopsis flower (he_pi) with flower of 35S::CyfaPI transgenic PI/pi-1 Arabidopsis and the PI/pi-1 Arabidopsis flower (he_pi) with four four sepals in whorl 1, four petals in whorls 2, six stamens in whorl 3 and a gynoecium in whorl 4; sepals in whorl 1, four petals in whorls 2, six stamens in whorl 3 and a gynoecium in whorl 4; (B) B 35S::CyfaPI PI pi-1 Arabidopsis C 35S::CyfaPI ( ) 35S::CyfaPI transgenictransgenic PI/pi-1/ Arabidopsisproducing producing flower flower with with five petals five petals in whorl in 2; whorl ( ) 2; (C) transgenic35S::CyfaPIPI/ pi-1transgenic Arabidopsis PI/pi-1producing Arabidopsis flower producing with flower six petals within six whorl petals 2. in Bars:whorl (A) 2. Bars: 5 mm; (A) (C) 5 mm; 1 mm; (B)(C) 500 1µ mm;m. (B) 500 μm. 4. Materials and Methods 4. Materials and Methods 4.1. Plant Material 4.1. Plant Material Cymbidium faberi plants were grown in ceramic flowerpots (∅25.5 26 cm) full with orchid Cymbidium faberi plants were grown in ceramic flowerpots (⌀25.5 × × 26 cm) full with orchid substratessubstrates in in the the Botanical Botanical Garden Gardenof of YangtzeYangtze UniversityUniversity under under natural natural conditions conditions in inJingzhou Jingzhou city, city, HubeiHubei Province. Province. Juvenile Juvenile leaves, leaves, sepals, sepals, petals, lips, lips, anther anther caps, caps, gynostemia gynostemia and and ovaries ovaries were were sampled when the flower buds opened, immediately frozen in liquid nitrogen and stored at 80 C sampled when the flower buds opened, immediately frozen in liquid nitrogen and stored at −80− °C ◦ untiluntil use. use. In In addition, addition, floral floral budsbuds measuringmeasuring 5 mm (early (early stages stages of of flower flower differentiation), differentiation), 8 mm 8 mm (seasonal(seasonal dormancy dormancy of of floral floral buds),buds), 10 10 mm mm (breaking (breaking flower flower dormancy dormancy and andfurther further development), development), 15 15 mm,mm, 2020 mm,mm, 25 mm long and opening floral floral buds buds were were also also sampled. sampled. The The pi-1pi-1 mutantmutant ArabidopsisArabidopsis (CS77)(CS77) seeds seeds were were obtained obtained from from the the ABRC ABRC (Arabidopsis (ArabidopsisBiological Biological Resource Resource Center, Center, ABRC) ABRC) at theat the Ohio StateOhio University, State University, USA. USA.

4.2.4.2. Isolation Isolation and and Characterization Characterization of of PI PI Ortholog Ortholog fromfrom C. Faberi faberi TotalTotal RNA RNA was was extractedextracted from from different different tissues tissues as described as described above above by using by an using EASYspin an EASYspin Plant PlantRNA RNA Kit (Aidlab, Kit (Aidlab, Beijing, Beijing, China) China)according according to the manufacturer’s to the manufacturer’s protocols. First-strand protocols. cDNA First-strand was cDNAsynthesized was synthesized from 1 μg from of DNase1 µg of I-treated DNase I-treated total RNA total with RNA an with oligo an (dT)18 oligo (dT)18adaptor adaptor primer primer and M-MLV Reverse Transcriptase (TaKaRa, Shiga, Japan). The CyfaPI 3′ end cDNA sequences were and M-MLV Reverse Transcriptase (TaKaRa, Shiga, Japan). The CyfaPI 30 end cDNA sequences amplified with gene-specific forward primer GSPPI (5’-ATCAATAGGCAGGTGACCTTCTC-3’) and were amplified with gene-specific forward primer GSPPI (50-ATCAATAGGCAGGTGACCTTCTC-30) 3′RACE Outer Primer (5’-TACCGTCGTTCCACTAGTGATTT-3’) following the manufacturer’s and 3 RACE Outer Primer (5 -TACCGTCGTTCCACTAGTGATTT-3 ) following the manufacturer’s protocols0 as described in the0 3′-full RACE Core Set Ver. 2.0 kit (TaKaRa,0 Shiga, Japan), but with 45 s protocols as described in the 30-full RACE Core Set Ver. 2.0 kit (TaKaRa, Shiga, Japan), but with 45 s annealing at 57 ◦C. The full length of CyfaPI cDNA was amplified with the forward primer CyfaPIF (50- CTTTTTGCTTCTGTTCTTGAGATC -30) and the reverse primer CyfaPIR (50- GCACGCACATATGTCATAATCATC-30), and the PCR amplification procedure followed Liu et al. [25]. The primer design was based on the sequence of PI/GLO orthologs, CyenPI (Genbank accession numbers: JQ326259.1) from the closely related species C. ensifolium (Orchidaceae). Putative protein sequences of CyfaPI and 85 B-class MADS-box proteins in NCBI Genbank (Table S1) from other angiosperms species were selected for constructing phylogenetic trees. The B-class MADS-box proteins were identified based on previously published papers and a BLAST search in the Genbank sequence database. Phylogenetic trees were constructed with MEGA5.0 software using the neighbor-joining method described by Tamura et al. [26]. with the default setting, and bootstrap values were based on Agronomy 2019, 9, 425 9 of 11

1000 replicates. The full-length CyfaPI proteins consisting of complete MADS, I, K and C domains were aligned with BioEdit 7.0.9 software using the ClustalW program with default settings.

4.3. Expression Analysis of CyfaPI For RT-qPCR analysis, total RNAs from juvenile leaves, sepals, petals, lips, anther caps, gynostemia, ovaries, floral buds of different length (5 mm, 8 mm, 10 mm, 15 mm, 20 mm, 25 mm) and opening floral buds were extracted using the procedure described above. DNA free total RNA and first-strand cDNA were prepared by using the HiScript® II Q RT SuperMix for qPCR kit (Vazyme, Nanjing China) following the manufacturer’s protocols. The RT-qPCR of three biological replicates was performed with the gene-specific forward primer qCyfaPIF(50- CACATACCTATTGCACCATC-30) and the gene-specific reverse primer qCyfaPIR(50- GGTCATTGGCATCTGAGCTG-30) on the Line-Gene 9600 Plus Real-time PCR Detection System, with SYBR green I for transcript measurements. Amplification of C. faberi actin (Genbank accession numbers: JN177719.1) fragment with specific primers qCyfaactinF (50- AAGACTTACACCAAGCCGAAGAAGATC-30) and qCyfaactinR (50- CCAGCTCCACAGGTTGCGTTAG -30) was used as the internal control. The PCR procedure was as follows: 95 ◦C for 30 s, followed by 40 cycles of 95 ◦C for 10 s, 60 ◦C for 30 s, which was followed by melt curve stages of 95 ◦C for 15 s, 60 ◦C for 60 s, and 95 ◦C for 15 s. The experiments were repeated three ∆∆Ct times for each sample. Relative expression levels were calculated based on the 2− method [27].

4.4. Ectopic Expression of CyfaPI in Arabidopsis pi-1 Mutant and Function Analysis CyfaPI cDNAs containing full-ORF (open reading frame) were cloned into the pBI121 vector with Xba I and Xma I restriction enzymes in the sense orientation. The 35S:: CyfaPI constructs were then transformed into heterozygous PI/pi-1 Arabidopsis with the floral-dip method suggested by Clough and Bent [28]. The T1 seeds were selected and seedlings were cultivated by referring to the methods described by Li et al. [29]. Moreover, the positive transgenic lines were confirmed by RT-qPCR as described above with the same CyfaPI-gene-specific primers qCyfaPIF and qCyfaPIR suggested above. For RT-qPCR, the A. thaliana β-actin (Genbank accession numbers: NM_116090.3) fragment was amplified as the internal control with the forward primer qactinF (50- AAGACTTACACCAAGCCGAAGAAGATC -30) and the reverse primer qactinR (50- CCAGCTCCACAGGTTGCGTTAG -30). Homozygous pi-1 transformants were identified by dCAPS genotyping following the method suggested by Lamb and Irish [30]. Phenotypes of transgenic Arabidopsis in homozygous pi-1 mutant background and wild-type background were assayed after flowering, respectively.

4.5. Statistical Analyses All experiments were carried out with three biological replicates, and data were expressed as mean SE (standard error). Statistical significance was determined using one-way ANOVA with the LSD ± (Least significant difference) test at p < 0.05 level in SPSS 19.0. P values of less than 0.05 were regarded as statistically significant.

Supplementary Materials: Supplementary materials can be found at http://www.mdpi.com/2073-4395/9/8/425/s1. Figure S1: Genotyping and phenotype of wild-type, homozygous pi-1 mutant and heterozygous PI/pi-1 Arabidopsis. Supplementary Table S1: Information on sequences selected for alignments and phylogenetic analyses from NCBI GenBank. Author Contributions: Z.-X.L. designed the experiments, provided project supervision and revised the manuscript, Y.F. conducted the experiments and wrote the draft manuscript. All authors approved the final draft of the manuscript. Funding: This research was supported by the Excellent Master Dissertation Cultivation Program of Yangtze University (YS2018049). Conflicts of Interest: The authors declare no conflict of interest. Agronomy 2019, 9, 425 10 of 11

Abbreviations

BLAST Basic local alignment search tool PCR Polymerase chain reaction RT-qPCR Quantitative reverse transcription PCR LSD Least significant difference

References

1. Heijmans, K.; Morel, P.; Vandenbussche, M. MADS-box Genes and Floral Development: The Dark Side. J. Exp. Bot. 2012, 63, 5397–5404. [CrossRef][PubMed] 2. Monniaux, M.; Vandenbussche, M. How to Evolve a Perianth: A Review of Cadastral Mechanisms for Perianth Identity. Front. Plant Sci. 2018, 9, 1573. [CrossRef][PubMed] 3. Hecht, V. Duplicate MADS genes with split roles. J. Exp. Bot. 2016, 67, 1609–1611. [CrossRef][PubMed] 4. Lü, S.; Fan, Y.; Liu, L.; Liu, S.; Zhang, W.; Meng, Z. Ectopic expression of TrPI, a Taihangia rupestris (Rosaceae) PI ortholog, causes modifications of vegetative architecture in Arabidopsis. J. Plant Physiol. 2010, 167, 1613–1621. [CrossRef][PubMed] 5. Jing, D.; Xia, Y.; Chen, F.; Wang, Z.; Zhang, S.; Wang, J. Ectopic expression of a Catalpa bungei (Bignoniaceae) PISTILLATA homologue rescues the petal and stamen identities in Arabidopsis pi-1 mutant. Plant Sci. 2015, 231, 40–51. [CrossRef][PubMed] 6. Liu, S.; Sun, Y.; Du, X.; Xu, Q.; Wu, F.; Meng, Z. Analysis of the APETALA3- and PISTILLATA-like genes in Hedyosmum orientale (Chloranthaceae) provides insight into the evolution of the floral homeotic B-function in angiosperms. Ann. Bot. 2013, 112, 1239–1251. [CrossRef][PubMed] 7. Liu, W.; Shen, X.; Liang, H.; Wang, Y.; He, Z.; Zhang, D.; Chen, F. Isolation and Functional Analysis of PISTILLATA Homolog from Magnolia wufengensis. Front. Plant Sci. 2018, 9, 1743. [CrossRef] 8. Aceto, S.; Gaudio, L. The MADS and the Beauty: Genes Involved in the Development of Orchid Flowers. Curr. Genom. 2011, 12, 342–356. [CrossRef] 9. Hsu, H.F.; Hsu, W.H.; Lee, Y.I.; Mao, W.T.; Yang, J.Y.; Li, J.Y.; Yang, C.H. Model for perianth formation in orchids. Nat. Plants 2015, 1, 15046. [CrossRef] 10. Riechmann, J.L.; Krizek, B.A.; Meyerowitz, E.M. Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS. Proc. Natl. Acad. Sci. USA 1996, 93, 4793–4798. [CrossRef] 11. Yang, Y.; Jack, T. Defining subdomains of the K domain important for protein-protein interactions of plant MADS proteins. Plant Mol. Biol. 2004, 55, 45–59. [CrossRef][PubMed] 12. Kim, S.; Yoo, M.J.; Albert, V.A.; Farris, J.S.; Soltis, P.S.; Soltis, D.E. Phylogeny and diversification of B-function MADS-box genes in angiosperms: Evolutionary and functional implications of a 260-million-year-old duplication. Am. J. Bot. 2004, 91, 2102–2118. [CrossRef][PubMed] 13. Ma, H.; Depamphilis, C. The ABCs of Floral Evolution. Cell 2000, 101, 5–8. [CrossRef] 14. Goto, K.; Meyerowitz, E.M. Function and regulation of the Arabidopsis floral homeotic gene PISTILLATA. Genes Dev. 1994, 8, 1548–1560. [CrossRef][PubMed] 15. Roque, E.; Fares, M.A.; Yenush, L.; Rochina, M.C.; Wen, J.; Mysore, K.S.; Gomez-Mena, C.; Beltrán, J.P.; Cañas, L.A. Evolution by gene duplication of Medicago truncatula PISTILLATA-like transcription factors. J. Exp. Bot. 2016, 67, 1805–1817. [CrossRef][PubMed] 16. Chen, M.K.; Hsieh, W.P.; Yang, C.H. Functional analysis reveals the possible role of the C-terminal sequences and PI motif in the function of lily (Lilium longiflorum) PISTILLATA (PI) orthologues. J. Exp. Bot. 2012, 63, 941–961. [CrossRef][PubMed] 17. Chang, Y.Y.; Kao, N.H.; Li, J.Y.; Hsu, W.H.; Liang, Y.L.; Wu, J.W.; Yang, C.H. Characterization of the possible roles for B class MADS box genes in regulation of perianth formation in orchid. Plant Physiol. 2010, 152, 837–853. [CrossRef] 18. Mao, W.T.; Hsu, H.F.; Hsu, W.H.; Li, J.Y.; Lee, Y.I.; Yang, C.H. The C-Terminal Sequence and PI motif of the Orchid (Oncidium Gower Ramsey) PISTILLATA (PI) Ortholog Determine its Ability to Bind AP3 Orthologs and Enter the Nucleus to Regulate Downstream Genes Controlling Petal and Stamen Formation. Plant Cell Physiol. 2015, 56, pcv129. Agronomy 2019, 9, 425 11 of 11

19. Tsai, W.C.; Lee, P.F.; Chen, H.I.; Hsiao, Y.Y.; Wei, W.J.; Pan, Z.J.; Chuang, M.H.; Kuoh, C.S.; Chen, W.H.; Chen, H.H. PeMADS6, a GLOBOSA/PISTILLATA-like Gene in Phalaenopsis equestris Involved in Petaloid Formation, and Correlated with Flower Longevity and Ovary Development. Plant Cell Physiol. 2005, 46, 1125–1139. [CrossRef] 20. Hsieh, M.H.; Lu, H.C.; Pan, Z.J.; Yeh, H.H.; Wang, S.S.; Chen, W.H.; Chen, H.H. Optimizing virus-induced gene silencing efficiency with Cymbidium mosaic virus in Phalaenopsis flower. Plant Sci. 2013, 201, 25–41. [CrossRef] 21. Tsai, W.C.; Pan, Z.J.; Hsiao, Y.Y.; Jeng, M.F.; Wu, T.F.; Chen, W.H.; Chen, H.H. Interactions of B-class complex proteins involved in tepal development in Phalaenopsis orchid. Plant Cell Physiol. 2008, 49, 814–824. [CrossRef][PubMed] 22. Pan, Z.J.; Cheng, C.C.; Tsai, W.C.; Chung, M.C.; Chen, W.H.; Hu, J.M.; Chen, H.H. The Duplicated B-class MADS-Box Genes Display Dualistic Characters in Orchid Floral Organ Identity and Growth. Plant Cell Physiol. 2011, 52, 1515–1531. [CrossRef] [PubMed] 23. Salemme, M.; Sica, M.; Gaudio, L.; Aceto, S. Expression pattern of two paralogs of the PI/GLO-like locus during Orchis italica (Orchidaceae, Orchidinae) flower development. Dev. Genes Evol. 2011, 221, 241–246. [CrossRef][PubMed] 24. Cantone, C.; Gaudio, L.; Aceto, S. The PI/GLO-like locus in orchids: Duplication and purifying selection at synonymous sites within Orchidinae (Orchidaceae). Gene 2011, 481, 48–55. [CrossRef][PubMed] 25. Liu, Z.; Zhang, D.; Liu, D.; Li, F.; Lu, H. Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae). Plant Cell Rep. 2013, 32, 227–237. [CrossRef] 26. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [CrossRef][PubMed] 27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [CrossRef] 28. Clough, S.J.; Bent, A.F. Floral dip: A simplified method forAgrobacterium-mediated transformation ofArabidopsis thaliana. Plant J. 1998, 16, 735–743. [CrossRef] 29. Li, L.Y.; Fang, Z.W.; Liu, Z.X. Isolation and characterization of the C-class MADS-box gene from the distylous pseudo-cereal Fagopyrum esculentum. J. Plant Biol. 2017, 60, 189–198. [CrossRef] 30. Lamb, R.S.; Irish, V.F. Functional divergence within the APETALA3/PISTILLATA floral homeotic gene lineages. Proc. Natl. Acad. Sci. USA 2003, 100, 6558–6563. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).