Plant Science 231 (2015) 40–51

Contents lists available at ScienceDirect

Plant Science

j ournal homepage: www.elsevier.com/locate/plantsci

Ectopic expression of a bungei () PISTILLATA

homologue rescues the petal and stamen identities in Arabidopsis pi-1 mutant

a,1 a,1 b a a a,∗

Danlong Jing , Yan Xia , Faju Chen , Zhi Wang , Shougong Zhang , Junhui Wang

a

State Key Laboratory of Forest Genetics and Tree Breeding, Key Laboratory of Tree Breeding and Cultivation of State Forestry Administration,

Research Institute of Forestry, Chinese Academy of Forestry, Beijing 100091, PR China

b

Biotechnology Research Center, China Three Gorges University, Yichang City 443002, Hubei Province, PR China

a r t i c l e i n f o a b s t r a c t

Article history: PISTILLATA (PI) plays crucial roles in Arabidopsis flower development by specifying petal and stamen iden-

Received 17 August 2014

tities. To investigate the molecular mechanisms underlying organ development of woody angiosperm in

Received in revised form 2 November 2014

Catalpa, we isolated and identified a PI homologue, referred to as CabuPI (C. bungei PISTILLATA), from two

Accepted 17 November 2014

genetically cognate C. bungei (Bignoniaceae) bearing single and double flowers. Sequence and phyloge-

Available online 25 November 2014

netic analyses revealed that the gene is closest related to the eudicot PI homologues. Moreover, a highly

conserved PI-motif is found in the C-terminal regions of CabuPI. Semi-quantitative and quantitative real

Keywords:

time PCR analyses showed that the expression of CabuPI was restricted to petals and stamens. How-

Catalpa bungei

ever, CabuPI expression in the petals and stamens persisted throughout all floral development stages,

B-class MADS box gene

PISTILLATA but the expression levels were different. In 35S::CabuPI transgenic homozygous pi-1 mutant Arabidopsis,

Ectopic expression the second and the third whorl floral organs produced normal petals and a different number of stamens,

Flower development respectively. Furthermore, ectopic expression of the CabuPI in transgenic wild-type or heterozygote pi-

Functional conservation 1 mutant Arabidopsis caused the first whorl sepal partially converted into a petal-like structure. These

results clearly reveal the functional conservation of PI homologues between C. bungei and Arabidopsis.

© 2014 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Arabidopsis, mutations in PI or AP3 cause homeotic changes, in

which the second whorl floral part (i.e., petal) is converted into

The well-established ABCE-model predict how a few genes act a sepal structure and the third whorl floral part (i.e., stamen) is

together to specify any flower organ that make up a perfect flower converted into a carpel structure [13]. Moreover, molecular genet-

in Arabidopsis [1–7]. According to this model, the class A and E genes ics and protein-protein interaction assays suggest that PI-like and

together specify sepal formation, the class A, B, and E genes com- AP3-like proteins of eudicot species are thought to act as obligate

bine to regulate petal formation, the class B, C, and E genes together heterodimers and the presence of both gene products is required

determine stamen identity, the class C and E genes combine to to cause an ectopic phenotype [12,19]. Phylogenetic analysis

regulate carpel identity. Furthermore, most ABCE-genes encode revealed that the two major lineages of B class genes have arisen

MADS box proteins which contain four conserved domains, the from a duplication that probably occurred in the common ancestor

MADS-, Intervening-, Keratin-like, and C-terminal (MIKC) domains of angiosperms after it has diverged from the gymnosperms, and

[2,7–11]. generated the PI and paleoAP3 lineages [9,15,20–22]. The PI lineage

The B class MADS-box genes, members of PISTILLATA (PI) and is composed of PI homologues that encode a highly conserved

APETALA3 (AP3) gene lineages, have been shown to play a major region in the C-terminal domain known as the PI-motif [14]. The

role in specifying petal and stamen development [12–18]. In paleoAP3 lineage is composed of AP3 homologues identified in

magnolid dicots, lower , and basal angiosperms [14]. A

second duplication from the basal paleoAP3 lineage is thought to

have generated two classes of AP3-like genes during evolution,

∗

Corresponding author. Tel.: +86 010 62888539.

replace paleoAP3 by the euAP3 and TM6 gene lineages, which is

E-mail addresses: [email protected] (D. Jing), xia [email protected]

close to the base of core eudicots [14]. However, proteins of the

(Y. Xia), [email protected] (F. Chen), [email protected] (Z. Wang),

euAP3 and paleoAP3 lineages are not able to form homodimers,

[email protected] (S. Zhang), [email protected] (J. Wang).

1

Equally contributed to this work: Danlong Jing and Yan Xia. and have to interact with PI to form heterodimers to specify petal

http://dx.doi.org/10.1016/j.plantsci.2014.11.004

0168-9452/© 2014 Elsevier Ireland Ltd. All rights reserved.

D. Jing et al. / Plant Science 231 (2015) 40–51 41

Fig. 1. The morphological observation on the single and double flowers of C. bungei. (a) The petals, stamens and a carpel from the single flower of C. bungei; (b) The double

flower of C. bungei, showing homeotic conversional petals from stamens (black arrows). Bars = 2 mm.

and stamen identities [23–26]. Besides these two major gene petals, stamens and carpels were sampled, frozen immediately in

◦

duplications, a number of small scale duplications have also been liquid nitrogen and stored at −80 C until used.

identified in various clades within the PI lineage [14,22]. It has

been suggested that PI homologues shaped floral diversification

2.2. Morphological analysis the flowers of C. bungei

of some in a dramatic way by modularizing the floral

perianth [25,27]. However, the crucial roles of PI homologues in

The floral buds from the single and double flowers of C.

Catalpa flower development are sorely lacking.

bungei were collected in series of development stages and fixed

Catalpa bungei, a Chinese originated ornamental tree, belongs to

in the FAA under vacuum. Samples were dehydrated by a graded

the Bignoniaceae family in Asterids, and is cultivated broadly. The

aqueous ethanol series 70, 85, 95 and 100% ethanol, then decol-

single flowers of C. bungei have four whorls of normal floral organs,

orized through dimethylbenzene: ethanol (50:50, by vol.) and

including sepals in whorl 1, petals in whorl 2, stamens in whorl

100% dimethylbenzene. Samples then were gone through three

◦

3, and one carpel in whorl 4 (Fig. 1a), respectively. However, the

changes of 100% paraffin at 63 C and finally embedded. Paraffin-

double-flower C. bungei, a recently discovered natural variation,

embedded materials were cut to a thickness of 6 ␮m and stained

only found in the Northwest of Hubei Province, having four whorls

with safranine-fast green solution after dewaxed. Morphology was

of floral organs, including sepals in whorl 1, petals in whorl 2,

examined and photographed using Nikon D3000, Leica M205 FA,

stamens and homeotic conversional petals from stamens in whorl 3

and Leica DM 6000B fully automated upright microscope (Leica

(Fig. 1b), and one carpel in whorl 4. In order to uncover the possible

Microsystems GmbH, Wetzlar, Germany).

roles of PI homologue in regulating flower development of C. bungei,

we isolated a PI homologue, CabuPI, from two genetically cognate

2.3. Isolation of PI homologue in C. bungei

C. bungei bearing single and double flowers, respectively. Sequence

and phylogenetic analyses revealed that CabuPI fall into the clades

Total RNA was extracted from floral buds of the single and

of eudicot PI lineages. Moreover, semi-quantitative PCR and quan-

double flowers at different developmental stages using the mod-

titative real time RT-PCR analyses suggested that the expression

ified CTAB method [28]. First-strand cDNA was synthesized from

pattern of CabuPI was consistent with other classic core eudicot

2 ␮g of the DNase I-treated RNA using oligo(dT)-18 adaptor primer

petal and stamen identity program. However, the expression levels

and M-MLV reverse transcriptase (TaKaRa, Japan). To isolate the PI

were different during the flower development in single and double

homologue from C. bungei, a 393-bp fragment was amplified from

floral buds of C. bungei. Furthermore, ectopic expression of the

the cDNA using the forward primer PIF and the reverse primer PIR.

CabuPI revealed that it could substitute endodgenous PI to rescue

Comparison with sequences in the NCBI databases revealed that

the petals and stamens development in homozygous pi-1 mutant

the fragment is an internal coding region of a PI homologue. Isola-

Arabidopsis. Moreover, the 35S::CabuPI transgenic Arabidopsis in 

tion of the 3 end of the PI homologue from C. bungei was carried

wild-type or heterozygote pi-1 mutant background could pro-  

out through a 3 RACE using the 3 -full RACE Core Set Version 2.0 kit

duce flowers with partially petaloid speals. These observations

(TaKaRa, Japan), according to instructions from the manufacturer

suggested that the function of PI homologues between C. bungei 

and the gene-specific primer GSPPI1 and 3 RACE Outer Primer. A

and Arabidopsis was conservative in specifying petal and stamen

second PCR was performed using the nested gene specific primer

identities.  

GSPPI2 and 3 RACE Inner Primer. The 5 partial cDNA of PI homo-



logue from C. bungei was isolated by using the 5 -Full RACE Kit

2. Materials and methods (TaKaRa, Japan) for Rapid Amplification of cDNA Ends, following

the protocol from the manufacturer. First strand cDNA was synthe-



2.1. Plant material sized from 1 ␮g of total RNA using the Random 9 mers and 5 RACE

Adaptor. Amplification by PCR was accomplished with LA Taq DNA



Flower buds at different development stages were collected polymerase (TaKaRa, Japan), a gene specific primer PIGSP1 and 5

from the single and double flowers of C. bungei growing in a nat- RACE Outer Primer. A second PCR was performed using the nested



ural, secondary forest in Xiangyang, in the Northwest of Hubei gene specific primer PIGSP2 and 5 RACE Inner Primer. To verify

Province. Before anthesis, the root, stem, juvenile leaves, sepals, the integrity of the cDNA sequences of the PI homologue from C.

42 D. Jing et al. / Plant Science 231 (2015) 40–51

Table 1

CabuPI gene isolated using the primer sequences, annealing temperatures and the position of homology-based cloning and RACE.

  ◦

Primer Primer sequences (5 to 3 ) C The position

PIF TCATCTTCGCTAGTTCTGGGAA 55 198 bp

PIR TCACATTATCGTCCATTGGATC 590 bp

GSPPI1 GAGAATGACAGCATGCAGATTG 56 350 bp

 

3 RACE Outer Primer TACCGTCGTTCCACTAGTGATTT 3 RACE Adaptor

GSPPI2 CTCTCAAAGCAAAACAGATGGA 56 462 bp

 

3 RACE Inner Primer CGCGGATCCTCCACTAGTGATTTCACTATAGG 3 RACE Adaptor

PIGSP1 ATATCTTCTCCCTTGAGGTGCC 55 399 bp

 

5 RACE Outer Primer CATGGCTACATGCTGACAGCCTA 5 RACE Adaptor

PIGSP2 GTTGATTTCATTGTCCAAATGC 55 337 bp

 

5 RACE Inner Primer CGCGGATCCACAGCCTACTGATGATCAGTCGATG 5 RACE Adaptor

CabuPIF GAGAACCAAATTAAGAGAAAGACCA 56 30 bp

CabuPIR GCACCAAGACAACCACATACGTA 859 bp

Table 2

bungei, PCR was carried out to amplify the full-length cDNA using

Multiple B class proteins from various angiosperm lineages were selected, including

the forward primer CabuPIF and the reverse primer CabuPIR. PCR

◦ their family name and the GenBank accession numbers.

parameters was performed with a 5 min at 94 C denaturation step,

◦ ◦

Protein Species Family Accession number

followed by 30 cycles of 45 s at 94 C, 45 s annealing at 56 C and

◦

45 s extension at 72 C, with a final extension period of 10 min at AktAP3 Akebia trifoliata Lardizabalaceae AAT46097

◦

72 C. These PCR was performed using the primers shown in Table 1. AP3 Arabidopsis thaliana Brassicaceae NP 191002

ChspAP3 Chloranthus spicatus Chloranthaceae AAR06664

These PCR products were subcloned into pMD18-T Vector (TaKaRa,

CMB2 Dianthus caryophyllus Caryophyllaceae AAB05559

Japan) and sequenced.

DEF Antirrhinum majus Scrophulariaceae CAA44629

GDEF1 Gerbera hybrid Asteraceae CAA08802

GDEF2 Gerbera hybrid Asteraceae CAA08803

2.4. Sequence alignments and phylogenetic analysis

GGM2 Gnetum gnemon Gnetaceae CAB44448

GhMADS50 Gossypium hirsutum Malvaceae AGW23352

Deduced amino acid sequences of CabuPI were used for GLO Antirrhinum majus Scrophulariaceae CAA48725

HmPI Hydrangea macrophylla Saxifragaceae BAG68951

BLAST analysis on the GenBank database. During the BLAST

HPI1 Hyacinthus orientalis Hyacinthaceae AF134114

searches, multiple B class proteins from various angiosperm

LFGLOA Lilium regale Liliaceae BAB91551

lineages were selected for alignment, including two B-class gym-

LMADS8 Lilium longiflorum Liliaceae AEI88009

nosperm proteins. Full-length amino acid sequences comprising MASAKO B3 Rosa rugosa Rosaceae BAB63261

MAwuAP3 Magnolia wufengensis Magnoliaceae AFM75880

the MADS, I, K, and C domains of these genes were aligned

MdTM6 Malus domestica Rosaceae BAC11907

with a ClustalW program under default settings [29]. Phyloge-

NTGLO Nicotiana t abacum Solanaceae CAA48142

netic trees were constructed by MEGA 5.0 software [30,31]. The

OMADS8 Oncidium Gower Ramsey Orchidaceae HM140842

phylogenetic tree was constructed based on the maximum like- OMADS9 Oncidium Gower Ramsey Orchidaceae ADJ67235

lihood method with the following parameters: bootstrap (500 OsMADS4 Oryza sativa Gramineae NM 001062125

PdPI Populus deltoides Salicaceae ABS71831

replicates), Jones–Taylor–Thornton (JTT) substitution model [32],

PhGLO1 Petunia × hybrid Solanaceae AAS46018

uniform rates, complete deletion of gaps/missing data, and near-

PI Arabidopsis thaliana Brassicaceae NM 122031

est neighbor interchange (NNI). The numbers at each node indicate

PrDGL Pinus radiata Pinaceae AAF28863

the percentage of bootstrap values from 500 replications, and val- PtoPI Populus tomentosa Salicaceae AGL09298

ScjPI Schoepfia jasminodora Olacaceae AFV74899

ues <50% were not shown. The GenBank accession numbers of the

TAP3 Solanum lycopersicum Solanaceae ABG73412

sequence data used are listed in Table 2.

TfGLO fournieri Scrophulariaceae BAJ15423

TM6 Petunia × hybrid Solanaceae AAS46017

TofoDEF Torenia fournieri Scrophulariaceae BAG24492

2.5. Expression of CabuPI in different floral organs of C. bungei

TrohDEF Tradescantia ohiensis Commelinaceae BAD80745

TrPI Taihangia rupestris Rosaceae CAB42988

For semi-quantitative RT-PCR analysis, total RNA was extracted, VvPI Vitis vinifera Vitaceae AFR53063

ZMM16 Zea mays Gramineae AJ292959

respectively from root, stem, juvenile leaves, sepals, petals,

ZMM18 Zea mays Gramineae CAC33849

stamens, and carpels of C. bungei at S6 and D6 stages, and treated

with DNase I (TaKaRa, Japan) prior to reverse transcription. Total

Table 3

RNA concentrations were determined by UV spectrophotometry

CabuPI gene analysed by semi RT-PCR, qRT-PCR and their primer sequences, anneal-

(Thermo Scientific, NanoDrop 8000 Spectrophotometer, USA). We

ing temperatures.

␮

used 2 g of total RNA from each sample to synthesize the first-   ◦

Primer Primer sequences (5 to 3 ) C

strand cDNA with an oligo(dT)-18 primer as described above. A

RTPIF TCGAGAACTCAAGCAACAGA 57

2 ␮l of cDNA sample from the RT reaction was used for PCR as fol-

◦ ◦ ◦ RTPIR AACGCTCCTGTAGATTAGGC

lows: 5 min at 94 C, 25 cycles of 30 s at 94 C, 30 s at 56 C, and 30 s

◦ ◦ CabuactinF TCACACTGGTGTGATGGTTG 56

at 72 C, followed by 10 min at 72 C. 20 ␮l of the total PCR prod-

CabuactinR AGTTCTTCTCCACAGCAGAG

␮

ucts (25 l) in each reaction was analyzed by electrophoresis in a QCabuPIF ATCTTCGCTAGTTCTGGGAA 55

1% agarose gel and photographed under UV light. The experiments QCabuPIR CAATCTGCATGCTGTCATTC

QCabuactinF GATGATGCTCCAAGAGCTGT 55

were repeated thrice for each sample. The CabuPI specific primers

QCabuactinR TCCATATCATCCCAGTTGCT

for semi-quantitative RT-PCR were the forward primer RTPIF and

qpiF TCGACAAAGTCCGAGACCAC 55

the reverse primer RTPIR. As a positive control, 2 ␮l of the first-

qpiR TCAATCGATGACCAAAGACA

strand RT reaction was used for amplification of the C. bungei ACTIN qactinF CGTATGAGCAAGGAGTACAC 55

qactinR CACATCTGTTGGAAGGTGCT

cDNA using the specific primers CabuactinF and CabuactinR. These

PI-1F TACCAGAAGTTATCTGGCAAGAAATCATG 52

semi-quantitative PCR was performed using the primers shown in

PI-1R TCTGATTCGCATAAGATTTGGTCT

Table 3.

D. Jing et al. / Plant Science 231 (2015) 40–51 43

Fig. 2. Phylogenetic analysis of PI/GLO-like MADS-box proteins. CabuPI from C. bungei are boxed.

Fig. 3. Sequence comparisons of CabuPI and the other PI/GLO-related MADS domain proteins. The first underlined regions represent the MADS domain and the second K

domain. The PI motif is boxed. Amino acid residues identical to CabuPI are indicated as dots. To improve the alignment, dashes were introduced into the sequence.

44 D. Jing et al. / Plant Science 231 (2015) 40–51

Fig. 4. Expression of CabuPI in root (ro), stem (ste), juvenile leaf (le), sepals (se), petals (pe), stamen (sta) and carpel (ca) by semi-quantitative RT-PCR with ACTIN as control.

2.6. Quantitative real-time PCR analytical expressions of CabuPI software (Qiagen, Germany) and the SYBR green I (KAPA, USA)

in C. bungei for transcript measurements. The reaction mixture was cycled as

◦ ◦ ◦

follows: 94 C for 5 min, followed by 40 cycles of 94 C for 15 s, 55 C

◦ ◦

Total RNA was extracted, respectively, from petals and stamens for 20 s, 72 C for 20 s, and 60 C for 90 s of pre-melt conditioning

◦ ◦

at various developmental stages, with RNase-free DNase I (Takara, on first step, temperature change 1.0 C/s to 95 C and 5 s for each

␮

Japan) treatment. 2 g total RNA from each sample were used as step afterwards for melt curve. For each sample, three biological

templates for the first-strand cDNA synthesis using an oligo(dT)-18 replicates were conducted. The CabuPI-specific primers were

␮

primer according to the manufacturer’s instructions using a 20 l QCabuPIF and QCabuPIR. The C. bungei ˇ-actin was used as a nor-

◦

reaction volume and an incubation time of 1 h at 42 C. The cDNA malization control with the primers QCabuactinF and QCabuactinR.

␮

reaction mixture was diluted twofold with water, and 2 l was The quantitative real-time PCR was performed using the primers

used as a template in a 20 ␮l PCR reaction using Rotor-gene-Q shown in Table 3. The relative quantification of gene expression −

CT

Real-time PCR Detection System and the Rotor-gene Q series level was determined by the comparative CT method 2 .

Fig. 5. Morphology and relative expression patterns of CabuPI at S1–S4 stages of the single and D1–D4 stages of double flowers from C. bungei. (A) Morphology at S1–S4

stages of the single flowers and D1–D4 stages of double flowers; S: an inflorescence of the single flowers; D: an inflorescence of the double flowers; S1–S4: differentiation and

elongation of petal and stamen primordia in the single flowers; D1–D4: differentiation and elongation of petal and stamen primordia in the double flowers; (B) quantitative

real time PCR analysis of CabuPI expression at S1–S4 stages of the single flowers and D1–D4 stages of double flowers; the flower buds of 1 mm, 2 mm, 4 mm, 5 mm length are

used by mixed buds. The error bar indicates the standard deviation of three biological replicates.

D. Jing et al. / Plant Science 231 (2015) 40–51 45

Fig. 6. Morphology and relative expression patterns of CabuPI at S5–S11 stages of the single and D5–D11 stages of double flowers from C. bungei. (A) Morphology at S5–S11

stages of the single flowers and D5–D11 stages of double flowers; S5–S7: the sizes of petal and stamen rapidly increased in the single flowers; S8–S11: the petal and stamen

reached maturity, and the single flowers were in anthesis; D5–D7: the sizes of petal and stamen rapidly increased in the double flowers; D8–D9: the petaloid organ of the

double flowers appeared, and elongated (black arrows). D10–D11: the double flowers were in anthesis, showing homeotic conversional petals from stamens (black arrows);

(B) quantitative real time PCR analysis of CabuPI expression in petals of the single and double flowers from C. bungei at various development stages; (C) quantitative real time

PCR analysis of CabuPI expression in stamens of the single and double flowers from C. bungei at various development stages. The error bar indicates the standard deviation

of three biological replicates. Bars = 500 ␮m in S1–S9 and D1–D9, 2 mm in D10.

2.7. Vectors construction and Arabidopsis transformation to the greenhouse under long-day conditions (16 h light/8 h dark)

◦

at 22 C for 10 days. Subsequently, the seedlings were transplanted

Full-length CabuPI was cloned into a binary vector pBI121 in soil. The 35S::CabuPI transgenic lines of A. thaliana were

(BD Biosciences Clontech, USA) using XbaI and SmaI restriction confirmed by PCR and quantitative real-time PCR with transgene-

enzymes under the control of the cauliflower mosaic virus 35S specific primers. Wild-type, heterozygote and homozygous pi-1

promoter in the sense orientation. The 35S::CabuPI constructs was transformants were isolated using a dCAPS marker designed with

transformed into heterozygous pi-1 mutant A. thaliana (Landsberg the dCAPS finder program [21,34,35], with at least one intronic

erecta) plants using the floral-dip method according to the pro- primer to amplify only the endogenous gene. The following primers

tocol suggested by Clough and Bent [33] via the Agrobacterium were used to identify pi alleles: PI-1F and PI-1R. A 2 ␮l of DNA sam-

tumefaciens strain GV3101-90. The seeds of transgenic Arabidop- ple of transgenic lines of A. thaliana plants was used as follow: 5 min

◦ ◦ ◦ ◦

sis plants were selected on a solid 0.5 × MS medium containing at 94 C, 30 cycles of 30 s at 94 C, 30 s at 52 C, and 30 s at 72 C, and

◦ ◦

50 ␮g/ml kanamycin at 4 C for 2 days, which were then transferred followed by 10 min at 72 C. 20 ␮l of the total PCR product in each

46 D. Jing et al. / Plant Science 231 (2015) 40–51

Fig. 7. Genotyping and phenotypes of wild-type, heterozygote and homozygous pi-1 mutant A. thaliana (Landsberg erecta) plants. (1–6) The amplicon of homozygous pi-1

mutant Arabidopsis plants was cleaved by BspH I to reduce a 267-bp and a 202-bp fragment. Homozygous pi-1 mutant Arabidopsis plants cause homeotic changes, in which the

second whorl floral parts (i.e., petals) are transformed into sepals structure and the third whorl floral parts (i.e., stamens) are transformed into a carpel structure. (7–13) The

amplified fragment from heterozygote pi-1 Arabidopsis plant was cleaved by BspH I to produce a 202-bp, a 227-bp and a 267-bp fragment. (14–17) The wild-type amplicon

was cleaved by BspH I to produce a fragment of 227-bp and a 267-bp fragment. The phenotypes of a heterozygote pi-1 Arabidopsis is the same with a wild type Arabidopsis,

which comprises four sepals in whorl 1, four petals in whorl 2, six stamens in whorl 3, and a carpel in whorl 4.

reaction was cleaved by BspH I, and analyzed by electrophoresis 3.2. Phylogenetic analysis and protein sequence comparisons

in a 4% agarose gel and photographed under UV light. After geno-

typing, wild-type, heterozygote and homozygous pi-1 mutant A. Phylogenetic analyses revealed that the gene is grouped with

thaliana plants in the Landsberg erecta background containing the the PI lineages of the dicots (Fig. 2). Therefore, the gene is referred

transgenes were analyzed. These transgenic plants were confirmed to as CabuPI (C. bungei PISTILLATA). Conceptual translation reveals

by quantitative real time PCR. For quantitative real-time PCR anal- that CabuPI has 212 amino acids (aa) containing a 59 aa MADS

ysis, triplicate quantitative assays were performed according to domain, a 27 aa I domain, an 82 aa K domain, and a 44 aa C domain

the earlier description with the following primers: QCabuPIF and (Fig. 3). Moreover, conserved regions were observed in the MADS

QCabuPIR, qpiF and qpiR. The amplification of ˇ-actin was used as domain, the I domain and K domains among these aligned proteins,

an internal control and to normalize all data. The amplification of whereas the C terminal domain was more divergent than the other

A. thaliana Actin was used as an internal control and to normalize domains (Fig. 3). At the C terminal region, all the aligned PI lineage

all data with the primers qactinF and qactinR. These PCR was per- proteins, including that of CabuPI, harbored a highly conserved PI

formed using the primers shown in Table 3. The cycle parameters motif (Fig. 3).

◦ ◦

were set at 94 C for 5 min, followed by 40 cycles of 94 C for 15 s,

◦ ◦ ◦

55 C for 20 s, 72 C for 20 s, and 60 C for 90 s of pre-melt condi-

3.3. Morphology and expression analysis of CabuPI in the single

◦ ◦

tioning on first step, temperature change 1.0 C/s to 95 C and 5 s

and double flower of C. bungei

for each step afterwards for melt curve.

In the single and double flower buds from C. bungei, CabuPI

2.8. Scanning electron microscopy analysis

expression was restricted in the petals and stamens, but no tran-

scription signal was detected in root, stem, juvenile leaves, sepals

Sepal and mature flowers of different A. thaliana lines were diss-

and carpels (Fig. 4). This pattern is similar to the spatial expression

ected and fixed in glutaraldehyde (2.5% glutaraldehyde in a 25 mM

pattern in Arabidopsis.

◦

sodium phosphate buffer, pH 6.8) at 4 C overnight. After dehydra-

Early in floral buds formation, petals and stamens primordia

tion in a graded ethanol series, the specimens were introduced at a

of the single flowers were differentiation and elongation at S1–S4

critical point into the liquid CO . The dried material was mounted

2 stages (Table 4 and Fig. 5a). Then the sizes of petals and stamens

and coated with gold-palladium using a Hitachi E-1010 sputter

rapidly increased at S5–S7 (Table 4 and Fig. 6a). The petals and

Coater. Specimens were examined using a FEI-Quanta 200F scan-

stamens reached maturity, and the flowers were in anthesis

ning electron microscope with an accelerating voltage of 15 kV.

at S8-S11. However, the petaloid organ of the double flowers

appeared at D8, and elongated at D9 (Fig. 6a).

3. Results CabuPI expression in the petals and stamens persisted through-

out all stages of the single and double flower buds from C. bungei

3.1. Cloning of CabuPI from Catalpa bungei (Figs. 5 and 6). During the stages of a rapid increase in floral

buds differentiation, the expression of CabuPI in double floral

Full-length cDNA of CabuPI from C. bungei isolated using buds (D1–D4) was obviously higher than that in single floral

homology-based cloning and RACE techniques was 871 base pairs. buds (S1–S4) (Fig. 5b). Later in development of petals, CabuPI

This contains 639 bp ORF encoding for 212 amino acids, as well as a expression in single flowers (S5–S8) was obviously higher than

 

61 bp of 5 untranslated region (UTR) and a 171 bp 3 UTR including that in double flowers (D5–D8). However, CabuPI expression in the

a poly-A tail. The sequence was deposited in the GenBank under petaloid organ of the double flowers was higher than that in peals

accession number KM112022. of single flowers at D8–D11 stages (Fig. 6b). Later in development

D. Jing et al. / Plant Science 231 (2015) 40–51 47

Fig. 8. Comparison of the F1 generation phenotypes of the wild-type, 35S::CabuPI transgenic Arabidopsis in wild-type or heterozygote pi-1 mutant background. 35S::CabuPI

(I) was as 35S::CabuPI transgenic Arabidopsis plants in a wild-type background, and 35S::CabuPI (II) was as 35S::CabuPI transgenic Arabidopsis plants in a heterozygote pi-1

mutant background; (a–d) wild-type Arabidopsis plants; (Ia–Id) constitutive expression of 35S::CabuPI (I); (IIa–IId) constitutive expression of 35S:: CabuPI (II); (a–b) an

inflorescence of wild-type Arabidopsis thaliana; (Ia–Ib) an inflorescence of 35S::CabuPI (I), showing completely separating and opening sepals (white arrows) and partially

separating stamens (red arrows); (IIa–IIb) an inflorescence of 35S::CabuPI (II), showing completely separating sepals (white arrows); (c–d) a wild-type Arabidopsis flower;

(Ic–Id) a flower of 35S::CabuPI (I), showing completely separating sepals with petaloid margin (white arrows) and partially separating stamens (red arrows); (IIc–IId) a flower

of 35S::CabuPI (II), showing completely separating sepals with petaloid margin (white arrows); Bars = 2 mm in (a–b), (Ia–Ib) and (IIa–IIb), 1 mm in (c–d), (Ic–Id) and (IIc–IId).

(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

of stamens, the levels of CabuPI expression in double floral stamens homozygous pi-1 mutant Arabidopsis plant was cleaved by BspH I

(D5–D11) were obviously higher than that in single floral stamens to reduce a 267-bp and a 202-bp fragment (Fig. 7). However, the

(S5–S11) (Fig. 6c). phenotype of a heterozygote pi-1 Arabidopsis is the same with a

wild type Arabidopsis, which comprises four sepals in whorl 1, four

3.4. Functional analyses of CabuPI in pi-1 mutants of A. thaliana petals in whorl 2, six stamens in whorl 3, and a carpel in whorl 4. The

wild-type amplicon was cleaved by BspH I to produce a fragment

The homozygous pi-1 mutant Arabidopsis is a strong allele con- of 227-bp and a 267-bp fragment, while the amplified fragment

taining a stopcodon that results in a truncated protein product of from heterozygote pi-1 Arabidopsis plant was cleaved by BspH I to

79 aa, in which the second whorl floral parts (i.e., petals) are trans- produce a 202-bp, a 227-bp and a 267-bp fragments (Fig. 7).

formed into sepals structure and the third whorl floral parts (i.e., A total of twenty-three 35S::CabuPI (I) (35S::CabuPI transgenic

stamens) are transformed into a carpel structure. The amplicon of Arabidopsis plants in a wild-type background) were obtained. Two

48 D. Jing et al. / Plant Science 231 (2015) 40–51

Fig. 9. Scanning electron microscope (SEM) of the wild-type, 35S::CabuPI (I) or 35S::CabuPI (II). (a) SEM of adaxial surface cells of a wild-type Arabidopsis sepals; (b) SEM of

adaxial surface of wild-type Arabidopsis petals, showing the lower epidermic cells of a petal; (c) SEM of the adaxial surface of 35S::CabuPI (I), showing a sepal with petaloid

margins (white arrows); (d) SEM of the adaxial surface of 35S::CabuPI (II), showing a sepal with petaloid margin (white arrows). Bars = 100 ␮m.

Table 4

35S::CabuPI produced partially elongated green/white petal-like

The development stages of the single and double flowers of C. bungei.

structures (petaloid sepals) in the first whorl (Fig. 8Ia–Id). Mean-

Length of flower The stages and morphology The stages and morphology while, these first whorl floral parts (i.e., sepals) of 35S::CabuPI (I)

buds (mm) of the single flower buds of the double flower buds

were completely separated and opened immediately after flower

1–5 S1–S4, differentiation and D1–D4, differentiation and opening (Fig. 8Ic and Id), while the first whorl floral parts of

elongation of petal and elongation of petal and wild-type plants remained tightly associated even after pollina-

stamen primordia stamen primordia

tion (Fig. 8c and d). When the epidermal cells of the abaxial side in

6–8 S5–S7, the sizes of petal D5–D7, the sizes of petal and

these first whorl floral parts were examined, the cells in the con-

and stamen rapidly stamen rapidly increased

increased verted white portion of the petaloid sepals (Fig. 9c) were observed

9–35 S8–S11, the petal and D8–D11, the petaloid organ to be morphologically similar to the wild-type second whorl flo-

stamen reached maturity, appeared at D8, and

ral parts (i.e., petals) epidermal cells (Fig. 9b) and distinct from

and the flowers reached elongated at D9. The flowers

the wild-type first whorl floral parts epidermis (Fig. 9a). In addi-

anthesis reached anthesis

tion, these third whorl floral parts (i.e., stamens) of 35S::CabuPI (I)

were partially separated after flower opening (Fig. 8Ia and Ib), while

of these plants (8.70%) were phenotypically indistinguishable from the wild-type third whorl floral parts remained tightly associated

untransformed wild-type plants, whereas another twenty-one (Fig. 8a and b). Moreover, phenotypes of 35S::CabuPI (I) were stably

plants (91.30%) showed identical altered phenotypes. Compared inherited through sixty-three plants F2 (Fig. 10Ia and Ib) and one

with the wild Arabidopsis (Fig. 8a–d), transgenic lines containing hundred and eighty-nine plants F3 generations (Fig. 10Ic and Id).

Fig. 10. The phenotypes of 35S::CabuPI (I) and 35S::CabuPI (II) in F2 and F3 generations. (Ia–Ib) an inflorescence and a flower of 35S::CabuPI (I) in F2 generation, showing

completely separating sepals (white arrows) and partially separating stamens (red arrows); (IIa–IIb) an inflorescence and a flower of 35S::CabuPI (II) in F2 generation, showing

completely separating sepals (white arrows); (Ic–Id) an inflorescence and a flower of 35S::CabuPI (I) in F3 generation, showing completely separating sepals (white arrows)

and partially separating stamens (red arrows); (IIc–IId) an inflorescence and a flower of 35S::CabuPI (II) in F3 generation, showing completely separating sepals (white

arrows). Bars = 2 mm in Ia, Ic, IIa and IIc, 1 mm in Ib, Id, IIb and IId. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

D. Jing et al. / Plant Science 231 (2015) 40–51 49

Fig. 11. Comparison of phenotypes of the homozygous pi-1 mutant, 35S::CabuPI transgenic Arabidopsis in a homozygous pi-1 mutant background. 35S::CabuPI (III) was

as 35S::CabuPI transgenic Arabidopsis plants in a homozygous pi-1 mutant background; (a) an inflorescence of a homozygous pi-1 mutant Arabidopsis; (b) a flower of a

homozygous pi-1 mutant Arabidopsis; (IIIa and IIId) an inflorescence and a flower of 35S::CabuPI (III) with normal petals and four stamens (red arrows); (IIIb and IIIe) an

inflorescence and a flower of 35S::CabuPI (III) with normal petals and five stamens (red arrows); (IIIc and IIIf) an inflorescence and a flower of 35S::CabuPI (III) with normal

petals and six stamens (red arrows). Bars = 2 mm in a, IIIa, IIIb, IIIc, 1 mm in b, IIId, IIIe, IIIf. (For interpretation of the references to color in this figure legend, the reader is

referred to the web version of this article.)

A total of thirty-four 35S::CabuPI (II) (35S::CabuPI transgenic whorl floral parts of 35S::CabuPI (II) were also completely separated

Arabidopsis plants in a heterozygote pi-1 mutant background) were immediately after flower opening (Fig. 7IIa and IIb), but the sepa-

obtained. Twenty-nine plants (85.30%) showed altered phenotypes rated degree was also relatively weaker than that in 35S::CabuPI

similar to those observed in the 35S::CabuPI (I) flowers whereas the (I). Furthermore, phenotypes of transgenic Arabidopsis plants in

other five plants (14.70%) were phenotypically indistinguishable 35S::CabuPI (II) were also stably inherited through eighty-seven

from untransformed wild-type plants. The partial conversion of the plants F2 (Fig. 10IIa and IIb) and two hundred and sixty-one plants

first whorl green sepals into green/white petaloid sepals was also F3 (Fig. 10IIc and IId) generations.

observed in these 35S::CabuPI (II) flowers (Fig. 8IIc and IId). How- Thirty-one 35S::CabuPI (III) (35S::CabuPI transgenic Arabidop-

ever, the petaloid degree of sepals in these 35S:: CabuPI (II) flowers sis plants in homozygous pi-1 mutant background) were obtained.

was relatively weaker than that in the 35S::CabuPI (I). Moreover, Twenty-nine of these plants (93.55%) showed identical altered

the epidermal cells in the converted white portion in these first phenotypes during reproductive development, whereas the

whorl floral parts were morphologically similar to wild-type petal two other plants (6.45%) were phenotypically indistinguishable

epidermal cells (Fig. 9d). Compared with 35S::CabuPI (I), these first from untransformed homozygous pi-1 mutant plants. In these

Fig. 12. The detection of the CabuPI expression in transgenic Arabidopsis plants. (a) The total RNAs and cDNAs were obtained from one severe (CabuPI/w 19), one wild-type-

like (CabuPI/w 2) 35S::CabuPI (I) and one untransformed wild-type plant (WT) were used as templates for quantitative real-time PCR. CabuPI is expressed at a higher level

in the CabuPI/w 19 than that in the CabuPI/w 2 transgenic plants. CabuPI expression was undetectable in untransformed wild-type plants. The total RNAs and cDNAs were

obtained from one severe (CabuPI/he 27), one wild-type-like (CabuPI/he 4) 35S::CabuPI (II) and one untransformed heterozygote pi-1 mutant plant (he-pi) were used as

templates for quantitative real-time PCR. CabuPI is expressed at a higher level in the CabuPI/he 27 than that in the CabuPI/he 4 transgenic plants. The total RNAs and cDNAs

were obtained from one with four stamens (CabuPI/ho 5), one with five stamens (CabuPI/ho 9), one with six stamens (CabuPI/ho 11) and one wild-type-like (CabuPI/ho 1)

35S::CabuPI transgenic Arabidopsis in a homozygous pi-1 mutant background and one homozygous pi-1 mutant plant (ho-pi) were used as templates for quantitative real-time

PCR. CabuPI is expressed at level in the CabuPI/ho 11 > CabuPI/ho 9 > CabuPI/ho 5 > CabuPI/ho 1 in the transgenic plants. (b) The expression levels of the Arabidopsis PI gene

were no significant difference in untransformed wild-type plants, CabuPI/w 2 and CabuPI/w 19 transgenic plants. Meanwhile, the expression levels of the Arabidopsis PI gene

were also no significant difference in untransformed heterozygote pi-1 mutant plant (he-pi) plants, CabuPI/he 4 and CabuPI/he 27 transgenic plants. The error bar indicates

the standard deviation of three biological replicates.

50 D. Jing et al. / Plant Science 231 (2015) 40–51

35S::CabuPI (III), the defects of petals and stamens formation were and 3 meristem fate [25]. The characterization of the CabuPI gene

fully restored, i.e., can be used to rescue the second whorl floral provides useful information for understanding the function of PI

parts (i.e., petals) and the third whorl floral parts (i.e., stamens) for- homologue in regulating petals and stamens formation of C. bungei.

mation (Fig. 11IIIa–IIIc). Moreover, an interesting phenotype was

observed in our experiment, i.e., eight 35S::CabuPI (III) (25.81%)

produced four stamens in whorl 3 (Fig. 11IIId), nine 35S::CabuPI Acknowledgements

(III) (29.03%) formed five stamens (Fig. 11IIIe), and others (38.71%)

grew six stamens (Fig. 11IIIf). This work was financially supported by the 12th Five-Year

The expression levels of CabuPI in transgenic wild-type or Plan of National Science and Technology Support of China (No.

heterozygote pi-1 mutant plants with strong phenotypes were 2012BAD21B03). The experimental materials were provided by the

significantly higher than those of transgenic plants with indistin- National Catalpa bungei Germplasm Bank.

guishable phenotypes (Fig. 12a). However, the expression levels

of the Arabidopsis PI gene were no significant difference between

References

transgenic and untransgenic Arabidopsis in wild-type and heterozy-

gous pi-1 mutant (Fig. 12b). Furthmore, the expression levels of

[1] J.L. Bowman, D.R. Smyth, E.M. Meyerowitz, Genetic interactions among floral

transgenic homozygous pi-1 mutant plants with more stamens

homeotic genes of Arabidopsis, Development 112 (1991) 1–20.

were also significantly higher than those of transgenic plants with [2] E.S. Coen, E.M. Meyerowitz, The war of the whorls: genetic interactions con-

trolling flower development, Nature 353 (1991) 31–37.

fewer stamens (Fig. 12a).

[3] S. Pelaz, G.S. Ditta, E. Baumann, E. Wisman, M.F. Yanofsky, B and C floral organ

identity functions require SEPALLATA MADS-box genes, Nature 405 (2000)

200–203.

4. Discussion [4] B.A. Krizek, J.C. Fletcher, Molecular mechanisms of flower development: an

armchair guide, Nat. Rev. Genet. 6 (2005) 688–698.

[5] D. Weigel, E.M. Meyerowitz, The ABCs of floral homeotic genes, Cell 78 (1994)

Molecular studies in model species, such as Arabidopsis and 203–209.

Antirrhinum, demonstrate that functions of floral class B genes are [6] G. Theissen, Development of floral organ identity: stories from the MADS house,

Curr. Opin. Plant Biol. 4 (2001) 75–85.

highly correlated with expression patterns; therefore, expression

[7] A. Litt, E.M. Kramer, The ABC model and the diversification of floral organ

patterns in other species may be good predictors of gene function

identity, Semin. Cell Dev. Biol. 21 (2010) 129–137.

[36]. The expression patterns obtained from angiosperms are gen- [8] M.D. Purugganan, S.D. Rounsley, R.J. Schmidt, M.F. Yanofsky, Molecular evolu-

tion of flower development: diversification of the plant MADS-box regulatory

erally consistent with the morphology predicted by ABC-model. In

gene family, Genetics 140 (1995) 345–356.

this study, we determined that CabuPI, a PI homologous gene from

[9] G. Theissen, A. Becker, A. Di Rosa, A. Kanno, J.T. Kim, T. Munster, K.U. Winter, H.

C. bungei, was transcribed only in petals and stamens. The CabuPI Saedler, A short history of MADS-box genes in plants, Plant Mol. Biol. 42 (2000)

115–149.

expression pattern matched well with expression zones of PI homo-

[10] G. Theissen, H. Saedler, Plant biology. Floral quartets, Nature 409 (2001)

logues in other eudicots, such as Arabidopsis [13], Antirrhinum [23],

469–471.

Torenia fournieri [37], and Nicotiana tabacum [38]. However, the [11] K. Kaufmann, R. Melzer, G. Theissen, MIKC-type MADS-domain proteins: struc-

tural modularity, protein interactions and network evolution in land plants,

expression pattern was different from PI homologues in basal eudi-

Gene 347 (2005) 183–198.

cots Aquilegia (Ranunculaceae) and Aristolochia (Aristolochiaceae),

[12] T. Jack, G.L. Fox, E.M. Meyerowitz, Arabidopsis homeotic gene APETALA3 ectopic

which expressed in sepals, petals and stamens. The expression pat- expression: transcriptional and posttranscriptional regulation determine floral

tern of CabuPI was also different from those of PI homologues in organ identity, Cell 76 (1994) 703–716.

[13] K. Goto, E.M. Meyerowitz, Function and regulation of the Arabidopsis floral

monocot orchids, which expressed in all four whorls of flower

homeotic gene PISTILLATA, Genes Dev. 8 (1994) 1548–1560.

organs [39,40]. These data suggested that the expression pattern of

[14] E.M. Kramer, R.L. Dorit, V.F. Irish, Molecular evolution of genes controlling petal

CabuPI was highly coincident with eudicots PI genes from related and stamen development: duplication and divergence within the APETALA3

and PISTILLATA MADS-box gene lineages, Genetics 149 (1998) 765–783.

species in the Asterids.

[15] T. Hernandez-Hernandez, L.P. Martinez-Castilla, E.R. Alvarez-Buylla, Functional

Further functional analyses suggested that ectopic expression

diversification of B MADS-box homeotic regulators of flower development:

of CabuPI in transgenic wild-type or heterozygote pi-1 mutant Adaptive evolution in protein-protein interaction domains after major gene

duplication events, Mol. Biol. Evol. 24 (2007) 465–481.

Arabidopsis caused the first whorl floral parts partially converted

[16] C.J. Whipple, M.J. Zanis, E.A. Kellogg, R.J. Schmidt, Conservation of B class gene

into a petal-like structure. In ornamental plant torenia (T. fournieri

expression in the second whorl of a basal grass and outgroups links the origin

Lind.), sepals of TfGLO-overexpressing in transgenic torenia also of lodicules and petals, Proc. Natl. Acad. Sci. U.S.A. 104 (2007) 1081–1086.

[17] D. Jing, Z. Liu, B. Zhang, J. Ma, Y. Han, F. Chen, Two ancestral APETALA3 homologs

showed petal-like cells [37,41]. Meanwhile, the flower phenotypes

from the basal angiosperm Magnolia wufengensis (Magnoliaceae) can affect

of 35S::CabuPI in a wild-type or heterozygote pi-1 mutant Ara-

flower development of Arabidopsis, Gene 537 (2014) 100–107.

bidopsis are different from those of monocots PI homologues in [18] V.F. Irish, Evolution of petal identity, J. Exp. Bot. 60 (2009) 2517–2527.

[19] B.A. Krizek, E.M. Meyerowitz, Mapping the protein regions responsible for the

transgenic Arabidopsis, such as LMADS8 and LMADS9 [42]. Further-

functional specificities of the Arabidopsis MADS domain organ-identity pro-

more, functional analyses displayed that CabuPI could substitute for

teins, Proc. Natl. Acad. Sci. U.S.A. 93 (1996) 4063–4070.

the endogenous PI gene of A. thaliana to rescue the loss-of-function [20] S. Kim, M.J. Yoo, V.A. Albert, J.S. Farris, P.S. Soltis, D.E. Soltis, Phylogeny and

homozygous pi-1 mutant Arabidopsis. The 35S::CabuPI transgenic diversification of B-function MADS-box genes in angiosperms: evolutionary

and functional implications of a 260-million-year-old duplication, Am. J. Bot.

plants in a homozygous pi-1 mutant background produce normal

91 (2004) 2102–2118.

flowers with the second whorl floral parts and the third whorl floral

[21] R.S. Lamb, V.F. Irish, Functional divergence within the APETALA3/PISTILLATA

parts. We conclude that the data presented by us could be inter- floral homeotic gene lineages, Proc. Natl. Acad. Sci. U.S.A. 100 (2003)

6558–6563.

preted as the functional conservation of PI homologues between

[22] G.M. Stellari, M.A. Jaramillo, E.M. Kramer, Evolution of the APETALA3 and PIS-

C. bungei and Arabidopsis. In our experiment, we observed the very

TILLATA lineages of MADS-box-containing genes in the basal angiosperms, Mol.

interesting phenotype that the transgenic Arabidopsis in a homozy- Biol. Evol. 21 (2004) 506–519.

[23] W. Trobner, L. Ramirez, P. Motte, I. Hue, P. Huijser, W.E. Lonnig, H. Saedler,

gous pi-1 mutant background produced the flower with normal

H. Sommer, Z. Schwarz-Sommer, GLOBOSA: a homeotic gene which interacts

petals and 4 to 6 stamens. Quantitative real-time PCR analysis

with DEFICIENS in the control of Antirrhinum floral organogenesis, EMBO J. 11

showed the numbers of stamens in these transgenic phenotypes (1992) 4693–4704.

[24] Y.H. Moon, J.Y. Jung, H.G. Kang, G. An, Identification of a rice APETALA3 homo-

were correlated with the CabuPI expression in the transgenic plants.

logue by yeast two-hybrid screening, Plant Mol. Biol. 40 (1999) 167–177.

Previous studies in Petunia hybrida homeotic conversion of floral

[25] M. Vandenbussche, J. Zethof, S. Royaert, K. Weterings, T. Gerats, The duplicated

organ, suggest that the gene dosage effects for several mutant com- B-class heterodimer model: whorl-specific effects and complex genetic inter-

actions in Petunia hybrida flower development, Plant Cell 16 (2004) 741–754.

binations cause qualitative and quantitative changes in whorl 2

D. Jing et al. / Plant Science 231 (2015) 40–51 51

[26] S.G. Yao, S. Ohmori, M. Kimizu, H. Yoshida, Unequal genetic redundancy of [34] M.M. Neff, E. Turk, M. Kalishman, Web-based primer design for single

rice PISTILLATA orthologs, OsMADS2 and OsMADS4, in lodicule and stamen nucleotide polymorphism analysis, Trends Genet.: TIG 18 (2002) 613–615.

development, Plant Cell Physiol. 49 (2008) 853–857. [35] M.M. Neff, J.D. Neff, J. Chory, A.E. Pepper, dCAPS, a simple technique for the

[27] T. Viaene, D. Vekemans, V.F. Irish, A. Geeraerts, S. Huysmans, S. Janssens, E. genetic analysis of single nucleotide polymorphisms: experimental applica-

Smets, K. Geuten, Pistillata—duplications as a mode for floral diversification in tions in Arabidopsis thaliana genetics, Plant J. 14 (1998) 387–392 (for cell and

(Basal) asterids, Mol. Biol. Evol. 26 (2009) 2627–2645. molecular biology).

[28] L. Jaakola, A.M. Pirttila, M. Halonen, A. Hohtola, Isolation of high quality RNA [36] H. Ma, C. dePamphilis, The ABCs of floral evolution, Cell 101 (2000) 5–8.

from bilberry (Vaccinium myrtillus L.) fruit, Mol. Biotechnol. 19 (2001) 201–203. [37] K. Sasaki, H. Yamaguchi, M. Nakayama, R. Aida, N. Ohtsubo, Co-modification

[29] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTAL W: improving the sensitiv- of class B genes TfDEF and TfGLO in Torenia fournieri Lind. alters both flower

ity of progressive multiple sequence alignment through sequence weighting, morphology and inflorescence architecture, Plant Mol. Biol. 86 (2014) 319–334.

position-specific gap penalties and weight matrix choice, Nucleic Acids Res. 22 [38] G. Hansen, J.J. Estruch, H. Sommer, A. Spena, NTGLO: a tobacco homologue of

(1994) 4673–4680. the GLOBOSA floral homeotic gene of Antirrhinum majus: cDNA sequence and

[30] S. Kumar, M. Nei, J. Dudley, K. Tamura, MEGA: a biologist-centric software for expression pattern, Mol. Gen. Genet.: MGG 239 (1993) 310–312.

evolutionary analysis of DNA and protein sequences, Brief. Bioinform. 9 (2008) [39] Y.Y. Chang, N.H. Kao, J.Y. Li, W.H. Hsu, Y.L. Liang, J.W. Wu, C.H. Yang, Characteri-

299–306. zation of the possible roles for B class MADS box genes in regulation of perianth

[31] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: formation in orchid, Plant Physiol. 152 (2010) 837–853.

molecular evolutionary genetics analysis using maximum likelihood, evolu- [40] Y. Xu, L.L. Teo, J. Zhou, P.P. Kumar, H. Yu, Floral organ identity genes in the

tionary distance, and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) orchid Dendrobium crumenatum, Plant J. 46 (2006) 54–68 (for cell and molecular

2731–2739. biology).

[32] D.T. Jones, W.R. Taylor, J.M. Thornton, The rapid generation of mutation data [41] K. Sasaki, R. Aida, H. Yamaguchi, M. Shikata, T. Niki, T. Nishijima, N. Ohtsubo,

matrices from protein sequences, Comput. Appl. Biosci.: CABIOS 8 (1992) Functional divergence within class B MADS-box genes TfGLO and TfDEF in

275–282. Torenia fournieri Lind, Mol. Genet. Genomics: MGG 284 (2010) 399–414.

[33] S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacterium- [42] M.K. Chen, W.P. Hsieh, C.H. Yang, Functional analysis reveals the possible role of

mediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735–743 the C-terminal sequences and PI motif in the function of lily (Lilium longiflorum)

(for cell and molecular biology). PISTILLATA (PI) orthologues, J. Exp. Bot. 63 (2012) 941–961. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。 图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具