DOCSLIB.ORG

Joint Effects of WT1, CA10 Methylation in Peripheral Blood Leukocyte and Dietary Zinc on Breast Cancer Risk: a Case-Control Study

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Joint Effects of WT1, CA10 Methylation in Peripheral Blood Leukocyte and Dietary Zinc on Breast Cancer Risk: a Case-Control Study Joint effects of WT1, CA10 methylation in peripheral blood leukocyte and dietary zinc on breast cancer risk: a case-control study Anqi Ge Harbin Medical University School of Public Health Song Gao Tumor Hospital of Harbin Medical University Yupeng Liu Harbin Medical University School of Public Health Hui Zhang Harbin Medical University School of Public Health Xuan Wang Harbin Medical University School of Public Health Lei Zhang Harbin Medical University School of Public Health Da Pang Tumor Hospital of Harbin Medical University Yashuang Zhao ( [email protected] ) Harbin Medical University https://orcid.org/0000-0002-7425-5773 Research article Keywords: breast cancer, CA10, WT1, DNA methylation, leukocytes, zinc Posted Date: May 27th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-27678/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on July 31st, 2020. See the published version at https://doi.org/10.1186/s12885-020-07183- 8. Page 1/12 Abstract Background Studies have shown that abnormal changes of specic-gene DNA methylation in leukocytes may be associated with elevated risk of cancer. However, associations between the methylation of zinc-related genes, WT1 and CA10, and breast cancer risk, and interactions between WT1, CA10 methylation and dietary zinc intake on breast cancer risk remain unknown. Methods The methylation of WT1, CA10 was analyzed by methylation-sensitive high-resolution-melting (MS-HRM) in a case-control study with female subjects (N = 959). Logistic regression was used to analyze the associations and propensity score (PS) method was used to adjust confounders. Results The results showed that WT1 hypermethylation was associated with an increased risk of breast cancer with an odds ratio (OR) of 3.069 [95% condence interval (CI): 1.669–5.643, P < 0.001]. Subgroup analyses showed that WT1 hypermethylation was specically associated with an elevated risk of Luminal A subtype (OR = 2.620, 95%CI: 1.107-6.200, P = 0.029) and Luminal B subtype (OR = 3.231, 95%CI: 1.339–7.796, P = 0.009). CA10 hypermethylation was associated with an increased risk of Luminal B subtype (OR = 1.798, 95%CI: 1.085–2.982, P = 0.023). Furthermore, the joint effects of methylation of WT1, CA10 and lower dietary zinc intake were associated a strongly elevated risk of breast cancer with ORs of 11.220 (95%CI: 4.057–31.032, P < 0.001) and 4.145 (95%CI: 2.717–6.324, P < 0.001), respectively. Conclusion The study suggested the hypermethylation of WT1 methylation in leukocytes was signicantly associated with an increased risk of breast cancer. Notably, the joint effects of WT1, CA10 methylation and lower dietary zinc intake might signicantly associate with breast cancer risk. Introduction Breast cancer is one of the most common malignancies in women worldwide [1] and presents with different molecular subtypes, including luminal A, luminal B, HER2-enriched, and basal-like that also called triple negative [2]. As a major type of epigenetic modication, DNA methylation involves in regulating cellular processes, including chromosomal instability [3] and gene expression. Hypermethylation of CpG regions in specic genes contribute to neoplastic formation through the transcriptional silencing of tumor suppressor genes. Aberrant patterns of specic gene methylation can help identifying differences in breast cancer subtypes [2], and showing promise for utilizing in large-scale epidemiological studies. It is suggested that leukocyte DNA methylation, as simple non-invasive blood markers [4, 5], could serve as a surrogate of systematic methylation activity, which offered great potential for predicting the increasing breast cancer risk [6]. Wilm’s Tumor gene (WT1) is tumor suppressor gene which involved in human cell growth and differentiation. WT1 have been reported signicantly different methylated in the tissues of hepatocellular carcinoma [7], lung cancer [8] and breast cancer [9]. WT1 aberrant methylation may lead to the reduction or absence of expression of WT1, which results in the overexpression of the insulin-like growth factor I receptor (IGF 1R) and insulin-like growth factor II (IGF II), therefore promotes breast cancer process [10–12]. CA10 is a member of the carbonic anhydrase family, which is a large family of zinc-containing metalloenzymes that catalyze the reversible hydration of carbon dioxide and the dehydration of carbonic acid [13]. Ivanov et al. suggested that induction or enhancement of carbonic anhydrase expression may contribute to the tumor microenvironment by maintaining extracellular acidic pH and helping cancer cells grow and metastasize [14]. Studies have found the abnormal expression of carbonic anhydrase family by aberrant methylation was related with gastric cancer and metastasis of ovary tumors [15, 16]. Furthermore, Wojdacz et al. reported that both WT1 and CA10 hypermethylation were signicantly different between breast cancer tumor tissues and non-malignant tissues [17]. However, the methylation of these two genes in leukocyte DNA affects breast cancer susceptibility remains unclear. In recent years, nutri-epigenetics, the inuence of dietary components on the epigenome, has emerged as an exciting new eld [18]. While earlier studies have shown that high dietary zinc intake could decrease cancer risk [19, 20], the association of zinc intake and breast cancer risk remained controversial [21, 22]. Zinc deciency may inuence the function of zinc related genes, including changes the expression of WT1 in zinc deciency animal model [23], and decreases blood carbonic anhydrase activity in males in a double-blind, randomized crossover study [24]. Hu et al. discovered that zinc deciency increased BDNF methylation level in in vitro experiment [25]. However, studies have yet examined the associations between dietary intake of zinc and zinc related genes, WT1 and CA10, genes methylation in white blood cells with breast cancer risk. In this study, we explored the associations between the methylation of WT1, CA10 in peripheral blood leukocyte DNA and breast cancer risk. We further used a dataset of nested case-control cohort within the EPIC-Italy cohort study as external data to validate the association between gene methylation and breast cancer risk. We also investigated the associations between the methylation of two genes and the risk of different molecular types of breast Page 2/12 cancer. Furthermore, we examined the interaction and combination effects between methylation of the genes with dietary zinc intake on the risk of breast cancer. Materials And Methods Study subjects We investigated the relationship between WT1, CA10 methylation and breast cancer risk using a case-control study. All included breast cancer patients were newly diagnosed female and were recruited from the Tumor Hospital of Harbin Medical University from 2010 to 2014. Controls were recruited from patients admitted to the Orthopedic and Ophthalmology Department of the Second Aliated Hospital of Harbin Medical University and volunteers from the Xiangfang community of Harbin within the same period. All controls were also female. In addition, all control participants were asked about their disease history in the questionnaire and the ones with any cancer history were excluded from our nal subjects. Finally, 402 female breast cancer cases and 557 female controls were included in our study. Informed written consent was provided by all the subjects, and 5 mL blood samples were collected and then stored at − 80 °C. This study was approved by the Human Research and Ethics Committee of Harbin Medical University. Data collection All subjects were interviewed face-to-face by trained investigators with normalized questioning methods. The questionnaire was adopted from the study of Shu et al. [26], which included demographic information (age, ethnicity, and others); daily dietary intake (vegetables, fruits, beverages, and snacks); behaviors (smoking, drinking, physical activity and work activity); female-specic questions involving menstruation status, breast disease history (lobular hyperplasia, cyst, and others); gynecologic surgery history (hysterectomy, ovariotomy) and family history of cancer and breast cancer. The questions involved in dietary and behavioral were about the participants’ daily routine of one year prior to the interview. The daily dietary intake information were collected with Food Frequency Questionnaire contained 9 major food groups, which represented approximately 77 food items including Chinese staple foods, vegetables, fruits, dairy products, soybean products, meat products, egg, sea-food and fungus. The zinc intake derived from nutrient supplement was also included. The content of zinc in different foods were derived and calculated based on country specic food composition, Chinese Food Composition Table [27]. The study was validated with GEO-GSE51032 (IPEC-Italy cohort) dataset with nested case control study design to analyze the association between the methylation of CA10, WT1 and breast cancer risk in female. The blood samples were also collected and other anthropometric measurements were taken. The detailed criteria for sample selection and the methods were reported by Riboli et al. [28]. We extracted all 232 female breast cancer cases and all 340 female controls from this nested case-control study and located the methylation probes from Illumina 450 K array. The annotated CG sites covered by our MS-HRM sequence were illustrated
Load more

Recommended publications
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
    [Show full text]
  • DNA Sequences of Ca2+-Atpase Gene in Rice KDML 105
    Kasetsart J. (Nat. Sci.) 40 : 472 - 485 (2006) DNA Sequences of Ca2+-ATPase Gene in Rice KDML 105 Sakonwan Prasitwilai1, Sripan Pradermwong2, Amara Thongpan3 and Mingkwan Mingmuang1* ABSTRACT Total RNA isolated from the leaves of KDML 105 rice was used as template to make complementary DNA (cDNA). Primer combinations of CA1-CA10 which were designed from Lycopersicon esculentum and Arabidopsis thaliana Ca2+-ATPase gene sequence were used. The nucleotide sequences amplified from 7 primer combinations gave 2,480 bp (fragment A). This fragment was found to be 99% homology to that of the putative calcium ATPase of Oryza sativa (Japonica cultivar-group) as shown in the GenBank. Amplification of 3v end fragment done by Rapid Amplification of cDNA Ends (3vRACE) technique using 3vGSP1, 3vGSP2, and 3vUAP as primers gave a DNA fragment of 933 bp having an overlapping region with DNA fragment A, which resulted in the combined length of 2,944 bp (fragment B). To find the sequence of 5v end, 5vRACE technique was used having 5vGSP1, 5vGSP2, 5v AP and 5vUAP as primers. It gave a DNA fragment of 473 bp showing an overlapping region with DNA fragment B, which ultimately resulted in the combined length of 3,331 bp (total CA). The deduced 1,008 amino acid sequence of total CA showed 99% homology to putative calcium ATPase of O. sativa (Japonica cultivar-group) cv. Nipponbare. The higher percent homology of this Ca2+-ATPase gene in KDML105 to that of O. sativa cv. Nipponbare (99%) than to O. sativa cv. IR36 (89%) was not as anticipated since both KDML105 and O.
    [Show full text]
  • Datasheet A07237-1 Anti-Carbonic Anhydrase 10/CA10 Antibody
    Product datasheet Anti-Carbonic anhydrase 10/CA10 Antibody Catalog Number: A07237-1 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Basic Information Product Name Anti-Carbonic anhydrase 10/CA10 Antibody Gene Name CA10 Source Rabbit IgG Species Reactivity human Tested Application WB,Direct ELISA Contents 500ug/ml antibody with PBS ，0.02% NaN3 , 1mg BSA and 50% glycerol. Immunogen E.coli-derived human Carbonic anhydrase 10/CA10 recombinant protein (Position: M1-K328). Purification Immunogen affinity purified. Observed MW Dilution Ratios Western blot: 1:500-2000 Direct ELISA： 1:100-1000 Storage 12 months from date of receipt，-20℃ as supplied.6 months 2 to 8℃ after reconstitution. Avoid repeated freezing and thawing Background Information Carbonic anhydrase-related protein 10 is an enzyme that in humans is encoded by the CA10 gene. This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha-carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. Reference Anti-Carbonic anhydrase 10/CA10 Antibody被引用在0文献中。 暂无引用 FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC AND CLINICAL USE. 1 Product datasheet Anti-Carbonic anhydrase 10/CA10 Antibody Catalog Number: A07237-1 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Selected Validation Data FOR RESEARCH USE ONLY.
    [Show full text]
  • SMARCA4 Regulates Spatially Restricted Metabolic Plasticity in 3D Multicellular Tissue
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.21.436346; this version posted March 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. SMARCA4 regulates spatially restricted metabolic plasticity in 3D multicellular tissue Katerina Cermakova1,2,*, Eric A. Smith1,2,*, Yuen San Chan1,2, Mario Loeza Cabrera1,2, Courtney Chambers1,2, Maria I. Jarvis3, Lukas M. Simon4, Yuan Xu5, Abhinav Jain6, Nagireddy Putluri1, Rui Chen7, R. Taylor Ripley5, Omid Veiseh3, and H. Courtney Hodges1,2,3,8,9,‡ 1. Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX, USA 2. Center for Precision Environmental Health, Baylor College of Medicine, Houston, TX, USA 3. Department of Bioengineering, Rice University, Houston, TX, USA 4. Therapeutic Innovation Center, Baylor College of Medicine, Houston, TX, USA 5. Department of Surgery, Division of General Thoracic Surgery, Baylor College of Medicine, Houston, TX, USA 6. Department of Epigenetics and Molecular Carcinogenesis, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 7. Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, USA 8. Center for Cancer Epigenetics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA 9. Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, Houston, TX, USA * These authors contributed equally to this work ‡ Corresponding author: H. Courtney Hodges, Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX, USA, [email protected]. Abstract SWI/SNF and related chromatin remodeling complexes act as tissue-specific tumor suppressors and are frequently inactivated in different cancers.
    [Show full text]
  • Regulation and Roles of Carbonic Anhydrases IX and XII
    HEINI KALLIO Regulation and Roles of Carbonic Anhydrases IX and XII ACADEMIC DISSERTATION To be presented, with the permission of the board of the Institute of Biomedical Technology of the University of Tampere, for public discussion in the Auditorium of Finn-Medi 5, Biokatu 12, Tampere, on December 2nd, 2011, at 12 o’clock. UNIVERSITY OF TAMPERE ACADEMIC DISSERTATION University of Tampere, Institute of Biomedical Technology Tampere University Hospital Tampere Graduate Program in Biomedicine and Biotechnology (TGPBB) Finland Supervised by Reviewed by Professor Seppo Parkkila Docent Peppi Karppinen University of Tampere University of Oulu Finland Finland Professor Robert McKenna University of Florida USA Distribution Tel. +358 40 190 9800 Bookshop TAJU Fax +358 3 3551 7685 P.O. Box 617 [email protected] 33014 University of Tampere www.uta.fi/taju Finland http://granum.uta.fi Cover design by Mikko Reinikka Acta Universitatis Tamperensis 1675 Acta Electronica Universitatis Tamperensis 1139 ISBN 978-951-44-8621-0 (print) ISBN 978-951-44-8622-7 (pdf) ISSN-L 1455-1616 ISSN 1456-954X ISSN 1455-1616 http://acta.uta.fi Tampereen Yliopistopaino Oy – Juvenes Print Tampere 2011 There is a crack in everything, that’s how the light gets in. -Leonard Cohen 3 CONTENTS CONTENTS .......................................................................................................... 4 LIST OF ORIGINAL COMMUNICATIONS...................................................... 7 ABBREVIATIONS .............................................................................................
    [Show full text]
  • Functional and Immunohistological Studies on Cancer-Associated Carbonic Anhydrase Ix
    D868etukansi.kesken.fm Page 1 Monday, January 16, 2006 1:35 PM D 868 OULU 2006 D 868 UNIVERSITY OF OULU P.O. Box 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA D SERIES EDITORS Mari Leppilampi MEDICA MariLeppilampi ASCIENTIAE RERUM NATURALIUM Professor Mikko Siponen FUNCTIONAL AND BHUMANIORA IMMUNOHISTOLOGICAL Professor Harri Mantila STUDIES ON CANCER- CTECHNICA Professor Juha Kostamovaara ASSOCIATED CARBONIC DMEDICA Professor Olli Vuolteenaho ANHYDRASE IX ESCIENTIAE RERUM SOCIALIUM Senior assistant Timo Latomaa FSCRIPTA ACADEMICA Communications Officer Elna Stjerna GOECONOMICA Senior Lecturer Seppo Eriksson EDITOR IN CHIEF Professor Olli Vuolteenaho EDITORIAL SECRETARY Publication Editor Kirsti Nurkkala FACULTY OF MEDICINE, DEPARTMENT OF CLINICAL CHEMISTRY, DEPARTMENT OF PATHOLOGY, ISBN 951-42-7993-X (nid.) UNIVERSITY OF OULU ISBN 951-42-7994-8 (PDF) ISSN 0355-3221 ACTA UNIVERSITATIS OULUENSIS D Medica 868 MARI LEPPILAMPI FUNCTIONAL AND IMMUNOHISTOLOGICAL STUDIES ON CANCER-ASSOCIATED CARBONIC ANHYDRASE IX Academic Dissertation to be presented with the assent of the Faculty of Medicine, University of Oulu, for public discussion in the Auditorium 7 of Oulu University Hospital, on February 17th, 2006, at 12 noon OULUN YLIOPISTO, OULU 2006 Copyright © 2006 Acta Univ. Oul. D 868, 2006 Supervised by Professor Seppo Parkkila Docent Tuomo Karttunen Reviewed by Docent Teuvo Hentunen Professor Claudiu Supuran ISBN 951-42-7993-X (nid.) ISBN 951-42-7994-8 (PDF) http://herkules.oulu.fi/isbn9514279948/ ISSN 0355-3221 http://herkules.oulu.fi/issn03553221/ OULU UNIVERSITY PRESS OULU 2006 Leppilampi, Mari, Functional and immunohistological studies on cancer-associated carbonic anhydrase IX Faculty of Medicine, Department of Clinical Chemistry, Department of Pathology, University of Oulu, P.O.Box 5000, FI-90014 University of Oulu, Finland Acta Univ.
    [Show full text]
  • Investigating the Effects of Human Carbonic Anhydrase 1 Expression
    Investigating the effects of human Carbonic Anhydrase 1 expression in mammalian cells Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Xiaochen Liu, BSc, MSc January 2016 ABSTRACT Amyotrophic Lateral Sclerosis (ALS) is one of the most common motor neuron diseases with a crude annual incidence rate of ~2 cases per 100,000 in European countries, Japan, United States and Canada. The role of Carbonic Anhydrase 1 (CA1) in ALS pathogenesis is completely unknown. Previous unpublished results from Dr. Jian Liu have shown in the spinal cords of patients with sporadic amyotrophic lateral sclerosis (SALS) there is a significant increased expression of CA1 proteins. The purpose of this study is to examine the effect of CA1 expression in mammalian cells, specifically, whether CA1 expression will affect cellular viability and induce apoptosis. To further understand whether such effect is dependent upon CA1 enzymatic activity, three CA1 mutants (Thr199Val, Glu106Ile and Glu106Gln) were generated using two- step PCR mutagenesis. Also, a fluorescence-based assay using the pH-sensitive fluorophore Pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) to measure the anhydrase activity was developed. The assay has been able to circumvent the requirement of the specialized equipment by utilizing a sensitive and fast microplate reader and demonstrated that three - mutants are enzymatically inactive under the physiologically relevant HCO3 dehydration reaction which has not been tested before by others. The data show that transient expression of CA1 in Human Embryonic Kidney 293 (HEK293), African Green Monkey Kidney Fibroblast (COS7) and Human Breast Adenocarcinoma (MCF7) cell lines did not induce significant changes to the cell viability at 36hrs using the Water Soluble Tetrazolium-8 (WST8) assay.
    [Show full text]
  • Human Carbonic Anhydrase IX Quantikine
    Quantikine® ELISA Human Carbonic Anhydrase IX Immunoassay Catalog Number DCA900 For the quantitative determination of human Carbonic Anhydrase IX (CA9) concentrations in cell culture supernates, serum, plasma, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION ....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ..................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE ................................................................................................................................2 TECHNICAL HINTS ................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ..................................................................................................3 OTHER SUPPLIES REQUIRED ............................................................................................................................................3 PRECAUTIONS ........................................................................................................................................................................4
    [Show full text]
  • New Insights Into the Physiological Role of Carbonic Anhydrase IX in Tumour Ph Regulation
    Oncogene (2010) 29, 6509–6521 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc REVIEW New insights into the physiological role of carbonic anhydrase IX in tumour pH regulation P Swietach1, A Hulikova1, RD Vaughan-Jones1,3 and AL Harris2,3 1Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford, UK and 2Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Oxford, UK In this review, we discuss the role of the tumour-associated acidity, commonly expressed using the pH scale. A carbonic anhydrase isoform IX (CAIX) in the context of particularly important class of pH-sensitive molecules is pH regulation. We summarise recent experimental find- protein because of the strong link between protonation ings on the effect of CAIX on cell growth and survival, and state, tertiary structure and functional output. The þ present a diffusion-reaction model to help in the assess- responsiveness to pH depends on H affinity (KH), ment of CAIX function under physiological conditions. bestowed on the protein by the chemistry of its amino CAIX emerges as an important facilitator of acid acid residues. For many proteins, KH is numerically diffusion and acid transport, helping to overcome large close to physiological [H þ ], thus even small displace- cell-to-capillary distances that are characteristic of solid ments from ‘normal’ intracellular pH (pHi) can sig- tumours. The source of substrate for CAIX catalysis is nificantly alter cellular biochemistry. H þ ions serve as likely to be CO2, generated by adequately oxygenated universal and potent modulators of virtually all aspects mitochondria or from the titration of metabolic acids with of life.
    [Show full text]
  • Carbonic Anhydrase X (CA10) (NM 020178) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG213425 Carbonic anhydrase X (CA10) (NM_020178) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Carbonic anhydrase X (CA10) (NM_020178) Human Tagged ORF Clone Tag: TurboGFP Symbol: CA10 Synonyms: CA-RPX; CARPX; HUCEP-15 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG213425 representing NM_020178 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAATAGTCTGGGAGGTGCTTTTTCTTCTTCAAGCCAATTTCATCGTCTGCATATCAGCTCAACAGA ATTCACCAAAAATCCATGAAGGCTGGTGGGCATACAAGGAGGTGGTCCAGGGAAGCTTTGTTCCAGTTCC TTCTTTCTGGGGATTGGTGAACTCAGCTTGGAATCTTTGCTCTGTGGGGAAACGGCAGTCGCCAGTCAAC ATAGAGACCAGTCACATGATCTTCGACCCCTTTCTGACACCTCTTCGCATCAACACGGGGGGCAGGAAGG TCAGTGGGACCATGTACAACACTGGAAGACACGTATCCCTTCGCCTGGACAAGGAGCACTTGGTCAACAT ATCTGGAGGGCCCATGACATACAGCCACCGGCTGGAGGAGATCCGACTACACTTTGGGAGTGAGGACAGC CAAGGGTCGGAGCACCTCCTCAATGGACAGGCCTTCTCTGGGGAGGTGCAGCTCATCCACTATAACCATG AGCTATATACGAATGTCACAGAAGCTGCAAAGAGTCCAAATGGATTGGTGGTAGTTTCTATATTTATAAA AGTTTCTGATTCATCAAACCCATTTCTTAATCGAATGCTCAACAGAGATACTATCACAAGAATAACATAT AAAAATGATGCATATTTACTACAGGGGCTTAATATAGAGGAACTATATCCAGAGACCTCTAGTTTCATCA CTTACGATGGGTCGATGACTATCCCACCCTGCTATGAGACAGCAAGTTGGATCATAATGAACAAACCTGT CTATATAACCAGGATGCAGATGCATTCCTTGCGCCTGCTCAGCCAGAACCAGCCATCTCAGATCTTTCTG
    [Show full text]
  • Addition of Carbonic Anhydrase 9 Inhibitor SLC-0111 to Temozolomide Treatment Delays Glioblastoma Growth in Vivo
    Addition of carbonic anhydrase 9 inhibitor SLC-0111 to temozolomide treatment delays glioblastoma growth in vivo Nathaniel H. Boyd, … , Shoukat Dedhar, Anita B. Hjelmeland JCI Insight. 2017;2(24):e92928. https://doi.org/10.1172/jci.insight.92928. Research Article Neuroscience Oncology Tumor microenvironments can promote stem cell maintenance, tumor growth, and therapeutic resistance, findings linked by the tumor-initiating cell hypothesis. Standard of care for glioblastoma (GBM) includes temozolomide chemotherapy, which is not curative, due, in part, to residual therapy-resistant brain tumor-initiating cells (BTICs). Temozolomide efficacy may be increased by targeting carbonic anhydrase 9 (CA9), a hypoxia-responsive gene important for maintaining the altered pH gradient of tumor cells. Using patient-derived GBM xenograft cells, we explored whether CA9 and CA12 inhibitor SLC-0111 could decrease GBM growth in combination with temozolomide or influence percentages of BTICs after chemotherapy. In multiple GBMs, SLC-0111 used concurrently with temozolomide reduced cell growth and induced cell cycle arrest via DNA damage in vitro. In addition, this treatment shifted tumor metabolism to a suppressed bioenergetic state in vivo. SLC-0111 also inhibited the enrichment of BTICs after temozolomide treatment determined via CD133 expression and neurosphere formation capacity. GBM xenografts treated with SLC-0111 in combination with temozolomide regressed significantly, and this effect was greater than that of temozolomide or SLC-0111 alone. We determined that SLC-0111 improves the efficacy of temozolomide to extend survival of GBM-bearing mice and should be explored as a treatment strategy in combination with current standard of care. Find the latest version: https://jci.me/92928/pdf RESEARCH ARTICLE Addition of carbonic anhydrase 9 inhibitor SLC-0111 to temozolomide treatment delays glioblastoma growth in vivo Nathaniel H.
    [Show full text]
  • Carbonic Anhydrase X (CA10) (NM 020178) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP313425 Carbonic anhydrase X (CA10) (NM_020178) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human carbonic anhydrase X (CA10), transcript variant 2 Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 37.4 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_064563 Locus ID: 56934 UniProt ID: Q9NS85, A0A384MTY8 RefSeq Size: 3260 Cytogenetics: 17q21.33-q22 RefSeq ORF: 984 Synonyms: CA-RPX; CARPX; HUCEP-15 Summary: This gene encodes a protein that belongs to the carbonic anhydrase family of zinc metalloenzymes, which catalyze the reversible hydration of carbon dioxide in various biological processes. The protein encoded by this gene is an acatalytic member of the alpha- carbonic anhydrase subgroup, and it is thought to play a role in the central nervous system, especially in brain development. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only.
    [Show full text]