DOCSLIB.ORG

Mouse Riok1 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Riok1 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Riok1 Knockout Project (CRISPR/Cas9) Objective: To create a Riok1 knockout mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Riok1 gene (NCBI Reference Sequence: NM_024242.3 ; Ensembl: ENSMUSG00000021428 ) is located on mouse chromosome 13. 17 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 17 (Transcript: ENSMUST00000021866). Exon 2~3 will be selected as target site . Cas9 and gRNA will be co-injected into fertilized eggs for KO mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 2 starts from about 4.23% of the coding region. Exon 2~3 covers 17.23% of the coding region. The size of effective KO region: ~3069 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 17 Legends Exon of mouse Riok1 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Note: The 2000 bp section upstream of Exon 2 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Note: The 767 bp section downstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 9 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Summary: Full Length(2000bp) | A(29.4% 588) | C(18.0% 360) | T(28.05% 561) | G(24.55% 491) Note: The 2000 bp section upstream of Exon 2 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Summary: Full Length(767bp) | A(28.94% 222) | C(15.78% 121) | T(35.2% 270) | G(20.08% 154) Note: The 767 bp section downstream of Exon 3 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 9 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr13 + 38038074 38040073 2000 browser details YourSeq 55 957 1224 2000 71.5% chr16 - 4524425 4524592 168 browser details YourSeq 54 957 1109 2000 96.8% chr1 + 55070703 55185474 114772 browser details YourSeq 50 964 1237 2000 69.0% chr16 + 8784255 8784413 159 browser details YourSeq 47 957 1109 2000 94.5% chr11 - 3626741 3626893 153 browser details YourSeq 44 961 1109 2000 94.2% chr19 - 54336778 54336926 149 browser details YourSeq 44 957 1110 2000 81.7% chr7 + 29546531 29546678 148 browser details YourSeq 41 957 1067 2000 91.2% chr12 + 101102223 101102332 110 browser details YourSeq 39 958 1095 2000 95.4% chr15 - 56873400 56873538 139 browser details YourSeq 38 958 1095 2000 91.4% chr16 + 32075984 32076122 139 browser details YourSeq 37 957 1007 2000 88.4% chr19 - 45979405 45979454 50 browser details YourSeq 35 956 1009 2000 86.1% chr14 - 122316706 122316758 53 browser details YourSeq 35 957 995 2000 89.5% chr1 - 58432124 58432161 38 browser details YourSeq 35 957 995 2000 89.5% chr12 + 4682352 4682389 38 browser details YourSeq 34 958 995 2000 89.2% chr14 - 89249393 89249429 37 browser details YourSeq 34 957 994 2000 89.2% chr1 - 158213248 158213284 37 browser details YourSeq 34 964 1067 2000 89.5% chr16 + 59358374 59358476 103 browser details YourSeq 33 957 1009 2000 83.8% chr12 - 91695110 91695161 52 browser details YourSeq 33 957 1001 2000 83.4% chr12 - 19602632 19602673 42 browser details YourSeq 33 964 1005 2000 89.2% chr3 + 108843506 108843546 41 Note: The 2000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 767 1 767 767 100.0% chr13 + 38043143 38043909 767 browser details YourSeq 26 444 476 767 96.6% chr10 - 22915231 22915266 36 browser details YourSeq 23 225 248 767 100.0% chr11 - 112971641 112971669 29 browser details YourSeq 22 251 272 767 100.0% chr2 - 44248571 44248592 22 browser details YourSeq 22 739 763 767 95.9% chr11 - 110471647 110471672 26 browser details YourSeq 20 481 500 767 100.0% chr12 - 93223343 93223362 20 Missing a match? Note: The 767 bp section downstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. Page 5 of 9 https://www.alphaknockout.com Gene and protein information: Riok1 RIO kinase 1 [ Mus musculus (house mouse) ] Gene ID: 71340, updated on 4-Feb-2018 Gene summary Official Symbol Riok1 provided by MGI Official Full Name RIO kinase 1 provided by MGI Primary source MGI:MGI:1918590 See related Ensembl:ENSMUSG00000021428 Gene type protein coding RefSeq status REVIEWED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as Ad034; 3110046C13Rik; 5430416A05Rik Summary This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a Expression component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011] Orthologs Ubiquitous expression in CNS E11.5 (RPKM 10.2), CNS E14 (RPKM 8.0) and 28 other tissues See more human all Genomic context Location: 13; 13 A3.3 See Riok1 in Genome Data Viewer Map Viewer Exon count: 17 Annotation release Status Assembly Chr Location 106 current GRCm38.p4 (GCF_000001635.24) 13 NC_000079.6 (38036989..38061433) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 13 NC_000079.5 (38129164..38153298) Chromosome 13 - NC_000079.6 Page 6 of 9 https://www.alphaknockout.com Transcript information: This gene has 14 transcripts Gene: Riok1 ENSMUSG00000021428 Description RIO kinase 1 (yeast) [Source:MGI Symbol;Acc:MGI:1918590] Synonyms 5430416A05Rik, 3110046C13Rik Location Chromosome 13: 38,036,995-38,061,433 forward strand. GRCm38:CM001006.2 About this gene This gene has 14 transcripts (splice variants), 93 orthologues, 1 paralogue and is a member of 1 Ensembl protein family. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt RefSeq Flags Riok1- ENSMUST00000021866.9 2738 567aa ENSMUSP00000021866 Protein coding CCDS26461 Q922Q2 NM_024242 TSL:1 201 NP_077204 GENCODE basic APPRIS P1 Riok1- ENSMUST00000224956.1 619 206aa ENSMUSP00000152922 Protein coding - - - CDS 5' and 206 3' incomplete Riok1- ENSMUST00000226110.1 386 113aa ENSMUSP00000153217 Protein coding - - - CDS 3' 214 incomplete Riok1- ENSMUST00000223656.1 2373 85aa ENSMUSP00000153494 Nonsense mediated - - - 202 decay Riok1- ENSMUST00000224477.1 886 152aa ENSMUSP00000153030 Nonsense mediated - - - 204 decay Riok1- ENSMUST00000225954.1 569 No - Processed transcript - - - 211 protein Riok1- ENSMUST00000223910.1 2509 No - Retained intron - - - 203 protein Riok1- ENSMUST00000226006.1 2307 No - Retained intron - - - 212 protein Riok1- ENSMUST00000225174.1 2006 No - Retained intron - - - 208 protein Riok1- ENSMUST00000225816.1 1791 No - Retained intron - - - 210 protein Riok1- ENSMUST00000224962.1 1464 No - Retained intron - - - 207 protein Riok1- ENSMUST00000226056.1 1198 No - Retained intron - - - 213 protein Riok1- ENSMUST00000225418.1 734 No - Retained intron - - - 209 protein Riok1- ENSMUST00000224683.1 619 No - Retained intron - - - 205 protein Page 7 of 9 https://www.alphaknockout.com 44.44 kb Forward strand 38.03Mb 38.04Mb 38.05Mb 38.06Mb 38.07Mb Genes (Comprehensive set... Riok1-201 >protein coding Riok1-202 >nonsense mediated decay Riok1-203 >retained intron Riok1-210 >retained intron Riok1-207 >retained intron Riok1-211 >processed transcript Riok1-209 >retained intron Riok1-208 >retained intron Riok1-212 >retained intron Riok1-213 >retained intron Riok1-204 >nonsense mediated decay Riok1-214 >protein coding Riok1-205 >retained intron Riok1-206 >protein coding Contigs < CT010477.16 AC140331.2 > Genes < Cage1-203protein coding (Comprehensive set... < Cage1-201protein coding < Cage1-202protein coding < Cage1-204protein coding Regulatory Build 38.03Mb 38.04Mb 38.05Mb 38.06Mb 38.07Mb Reverse strand 44.44 kb Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript Regulation Legend CTCF Enhancer Promoter Promoter Flank Motif feature Page 8 of 9 https://www.alphaknockout.com Transcript: ENSMUST00000021866 24.44 kb Forward strand Riok1-201 >protein coding ENSMUSP00000021... Low complexity (Seg) Conserved Domains Coiled-coils (Ncoils) hmmpanther PTHR10593:SF85 PTHR10593 Superfamily domains Protein kinase-like domain SMART domains RIO kinase Pfam domain PF01163 PROSITE patterns RIO kinase, conserved site PIRSF domain Serine/threonine-protein kinase Rio1 Gene3D 3.30.200.20 1.10.510.10 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend inframe deletion missense variant synonymous variant Scale bar 0 60 120 180 240 300 360 420 480 567 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC, VectorBuilder. Page 9 of 9.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Riok1 (BC002158) Mouse Tagged ORF Clone – MR204785 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR204785 Riok1 (BC002158) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Riok1 (BC002158) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Riok1 Synonyms: 3110046C13Rik, Ad034, MGC7300 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR204785 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAGGACGTGGGCAGAGAAGGAGATGAGGAATTTGTGCAGGCTAAAAACAGCAAACATACCATGTC CAGAACCAATCAGGCTAAGAAGTCATGTTCTTCTCATGGGCTTCATTGGCAAGGATGACATGCCAGCCCC ACTTTTGAAAAATGTCCAGCTGTCAGAGTCCAAGGCACGGGAGTTGTACCTGCAGGTCATTCAGTACATG AGGAAAATGTATCAGGATGCTAGACTTGTCCACGCGGATCTCAGTGAATTCAACATGCTGTACCATGGTG GAGATGTTTACATCATTGATGTTTCTCAGTCTGTGGAGCATGACCACCCACATGCATTGGAGTTCTTGAG AAAAGACTGTACCAATGTCAATGATTTCTTTTCCAAGCATGCTGTTGCAGTGATGACCGTGCGGGAGCTC TTCGACTTCGTCACAGATCCCTCCATCACTGCTGACAACATGGATGCTTACCTGGAAAAGGCTATGGAAA TAGCATCCCAGAGGACCAAGGAAGAAAAGACTAGCCAAGATCATGTGGATGAAGAGGTGTTCAAACAAGC ATATATTCCCAGAACCTTAAACGAAGTAAAGAATTATGAGAGAGATGTGGACATCATGATGAGGTTAAAG GAAGAAGACATGGCTTTGAACACTCAGCAAGACAACATTCTATACCAGACTGTCATGGGATTGAAAAAAG ATTTGTCAGGAGTCCAGAAGGTCCCCGCGCTCCTAGAAAGTGAAGTTAAGGAAGAGACTTGTTTTGGTTC AGACGATGCTGGGGGCTCTGAGTGCTCCGACACAGTCTCTGAAGAGCAGGAAGATCAAGCCGGATGCAGA AACCATATTGCTGACCCCGACGTTGATAAAAAGGAAAGAAAAAAGATGGTCAAGGAAGCCCAGAGAGAGA
    [Show full text]
  • Human RIOK1 / RIO Kinase 1 Protein (His & GST Tag)
    Human RIOK1 / RIO kinase 1 Protein (His & GST Tag) Catalog Number: 14477-H20B General Information SDS-PAGE: Gene Name Synonym: AD034; bA288G3.1; RRP10; 3110046C13Rik; 5430416A05Rik; Ad034 Protein Construction: A DNA sequence encoding the human RIOK1 (Q9BRS2) (Met1-Lys568) was expressed with the N-terminal polyhistidine-tagged GST tag at the N-terminus. Source: Human Expression Host: Baculovirus-Insect Cells QC Testing Purity: > 85 % as determined by SDS-PAGE Bio Activity： Protein Description Kinase activity untested RIOK1, also known as RIO kinase 1, is a member of the RIO family of Endotoxin: atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 < 1.0 EU per μg of the protein as determined by the LAL method functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex Stability: composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a Samples are stable for up to twelve months from date of receipt at -70 ℃ mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct Predicted N terminal: Met complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its Molecular Mass: symmetrical methylation. The recombinant human RIOK1/GST chimera consists of 805 amino acids References and has a calculated molecular mass of 93.4 kDa. The recombinant protein migrates as an approximately 94 kDa band in SDS-PAGE under reducing 1.Widmann B.
    [Show full text]
  • Biochemical Investigation of the Interaction of Picln, Riok1 and COPR5 with the PRMT5–MEP50 Complex
    Communications ChemBioChem doi.org/10.1002/cbic.202100079 1 2 3 Biochemical Investigation of the Interaction of pICln, RioK1 4 5 and COPR5 with the PRMT5–MEP50 Complex 6 [a, b] [c] [d, e] ' [f] 7 Adrian Krzyzanowski, Raphael Gasper, Hélène Adihou, Peter t Hart,* and [a, b] 8 Herbert Waldmann* 9 10 compete for the same binding site, but are not competitive 11 The PRMT5–MEP50 methyltransferase complex plays a key role with MEP50.[5] 12 in various cancers and is regulated by different protein–protein PRMT5 contains three domains, that is, the catalytic site- 13 interactions. Several proteins have been reported to act as containing Rossmann fold, a β-barrel domain used for dimeriza- 14 adaptor proteins that recruit substrate proteins to the active tion, and the TIM barrel, which acts as interaction site for 15 site of PRMT5 for the methylation of arginine residues. To MEP50 (Figure 1A).[3a,c] PRMT5 and MEP50 form a hetero- 16 define the interaction between these adaptor proteins and octameric complex whose structure has been determined,[3a] 17 PRMT5, we employed peptide truncation and mutation studies and structural information on the interaction between PRMT5 18 and prepared truncated protein constructs. We report the and the other adaptor proteins has only very recently been 19 characterisation of the interface between the TIM barrel of described in preliminary form.[7] Overexpression of PRMT5 is 20 PRMT5 and the adaptor proteins pICln, RioK1 and COPR5, and frequently observed in cancer which makes the protein an 21 identify the consensus amino acid sequence GQF[D/E]DA[E/D] intensively investigated anticancer target, and active-site di- 22 involved in binding.
    [Show full text]
  • Targeting Posttranslational Modifications of RIOK1
    RESEARCH ARTICLE Targeting posttranslational modifications of RIOK1 inhibits the progression of colorectal and gastric cancers Xuehui Hong1,2,3,4†, He Huang5,6†, Xingfeng Qiu2,3,4, Zhijie Ding2,3,4, Xing Feng7, Yuekun Zhu8, Huiqin Zhuo2,3,4, Jingjing Hou2,3,4, Jiabao Zhao2,3,4, Wangyu Cai2,3,4, Ruihua Sha9, Xinya Hong10, Yongxiang Li11*, Hongjiang Song12*, Zhiyong Zhang1,13* 1Longju Medical Research Center, Key Laboratory of Basic Pharmacology, Ministry of Education, Zunyi Medical College, Zunyi, China; 2Department of Gastrointestinal Surgery, Zhongshan Hospital of Xiamen University, Xiamen, China; 3Institute of Gastrointestinal Oncology, Medical College of Xiamen University, Xiamen, China; 4Xiamen Municipal Key Laboratory of Gastrointestinal Oncology, Xiamen, China; 5Department of Histology and Embryology, Xiangya School of Medicine, Central South University, Changsha, China; 6Digestive Cancer Laboratory, Second Affiliated Hospital of Xinjiang Medical University, Urumqi, China; 7Department of Radiation Oncology, Cancer Institute of New Jersey, Rutgers University, New Brunswick, United States; 8Department of General Surgery, The First Affiliated Hospital of Harbin Medical University, Harbin, China; 9Department of Digestive Disease, Hongqi Hospital, Mudanjiang Medical University, Mudanjiang, China; 10Department *For correspondence: of Medical Imaging and Ultrasound, Zhongshan Hospital of Xiamen University, 11 [email protected] Xiamen, Fujian, China; Department of General Surgery, The First Affiliated (YL); Hospital of Anhui Medical University, Hefei, China; 12Department of General [email protected] Surgery, The Third Affiliated Hospital of Harbin Medical University, Harbin, China; (HS); 13Department of Surgery, Robert-Wood-Johnson Medical School University [email protected] (ZZ) † Hospital, Rutgers University, The State University of New Jersey, New Brunswick, These authors contributed United States equally to this work Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Genomic Alterations Link Rho Family of Gtpases to the Highly Invasive Phenotype of Pancreas Cancer
    Genomic alterations link Rho family of GTPases to the highly invasive phenotype of pancreas cancer Alec C. Kimmelmana,b, Aram F. Hezela,c, Andrew J. Aguirrea, Hongwu Zhenga, Ji-hye Paika, Haoqiang Yinga, Gerald C. Chua, Jean X. Zhanga,d, Ergun Sahina, Giminna Yeod, Aditya Ponugotid, Roustem Nabioullind, Scott Derooa, Shenghong Yangb, Xiaoxu Wangb, John P. McGrathd, Marina Protopopovad, Elena Ivanovad, Jianhua Zhangd, Bin Fengd, Ming S. Tsaoe, Mark Redstonf, Alexei Protopopovd, Yonghong Xiaod, P. Andrew Futrealg, William C. Hahna,h,i, David S. Klimstraj, Lynda China,d,k, and Ronald A. DePinhoa,d,h,1 aDepartment of Medical Oncology and bHarvard Radiation Oncology Program, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; dCenter for Applied Cancer Science of the Belfer Institute for Innovative Cancer Science, Dana-Farber Cancer Institute, Boston, MA 02115; kDepartment of Dermatology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; hDepartments of Medicine and Genetics, Harvard Medical School, Boston, MA 02115; eUniversity Health Network, Ontario Cancer Institute and Princess Margaret Hospital, Toronto, ON, Canada M5G 2M9; jDepartment of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY 10065; fMolecular Diagnostics, Ameripath, Newton, MA 02464; gCancer Genome Project, Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, United Kingdom; iBroad Institute of Harvard and MIT, Cambridge, MA 02142; and cTucker Gosnell Center for Gastrointestinal Cancers, Massachusetts General Hospital Cancer Center, Lawrence House, P.O. Box 232, Boston, MA 02114 Communicated by David M. Livingston, Dana–Farber Harvard Cancer Center, Boston, MA, October 10, 2008 (received for review May 7, 2008) Pancreas ductal adenocarcinoma (PDAC) is a highly lethal cancer that high-resolution aCGH to better define the atlas of recurrent CNAs typically presents as advanced, unresectable disease.
    [Show full text]
  • Co-Overexpression of RIOK1 and AKT1 As a Prognostic Risk Factor In
    Journal of Cancer 2021, Vol. 12 5745 Ivyspring International Publisher Journal of Cancer 2021; 12(19): 5745-5752. doi: 10.7150/jca.60596 Research Paper Co-overexpression of RIOK1 and AKT1 as a prognostic risk factor in glioma Yiwei Wang1, 2, Xiaochen Xie3, Shu Li1, Dongyong Zhang4, Heyu Zheng1, Min Zhang2, Zhong Zhang2 1. Department of Human Anatomy, Shenyang Medical College, Shenyang City, Liaoning Province 110034, P.R. China. 2. Department of Pathology, College of Basic Medical Sciences, Shenyang Medical College, Shenyang City, Liaoning Province 110034, P.R. China. 3. Department of Endocrinology and Metabolism, Institute of Endocrinology, Liaoning Provincial Key Laboratory of Endocrine Diseases, The First Affiliated Hospital of China Medical University, China Medical University, Shenyang, Liaoning, 110001, P.R. China. 4. Department of Neurosurgery, First Affiliated Hospital of China Medical University, Heping District, Shenyang City, Liaoning Province, 110001, P.R. China Corresponding author: E-mail: [email protected] © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2021.03.18; Accepted: 2021.07.19; Published: 2021.07.25 Abstract Glioblastoma multiforme (GBM) is one of the most frequent primary malignancies of the brain. Although the treatment strategy has significantly improved, patient prognosis remains poor. In vitro studies have shown that the right open reading frame kinase 1/protein kinase B (RIOK1-AKT) signaling pathway plays an important role in the malignant phenotype of glioma cells. This study aimed to investigate the co-expression of RIOK1 and ATK in glioma tissues and its clinical significance.
    [Show full text]
  • RIOK1 Kinase Activity Is Required for Cell Survival Irrespective of MTAP Status
    www.oncotarget.com Oncotarget, 2018, Vol. 9, (No. 47), pp: 28625-28637 Research Paper RIOK1 kinase activity is required for cell survival irrespective of MTAP status Alexandra Hörmann1,*, Barbara Hopfgartner1,*, Thomas Köcher2, Maja Corcokovic1, Teresa Krammer1, Christoph Reiser1, Gerd Bader1, Junwei Shi3, Katharina Ehrenhöfer1, Simon Wöhrle1, Norbert Schweifer1, Christopher R. Vakoc3, Norbert Kraut1, Mark Pearson1, Mark Petronczki1 and Ralph A. Neumüller1 1Boehringer Ingelheim RCV GmbH & Co KG, 1120 Vienna, Austria 2Vienna Biocenter Core Facilities GmbH, 1030 Vienna, Austria 3Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA *These authors have contributed equally to this work Correspondence to: Ralph A. Neumüller, email: [email protected] Keywords: RIOK1; MTAP; PRMT5; cancer; target Received: November 16, 2017 Accepted: May 19, 2018 Published: June 19, 2018 Copyright: Hörmann et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Genotype specific vulnerabilities of cancer cells constitute a promising strategy for the development of new therapeutics. Deletions of non-essential genes in tumors can generate unique vulnerabilities which could be exploited therapeutically. The MTAP gene is recurrently deleted in human cancers because of its chromosomal proximity to the tumor suppressor gene CDKN2A. Recent studies have uncovered an increased dependency of MTAP-deleted cancer cells on the function of a PRMT5 containing complex, including WDR77, PRMT5 and the kinase RIOK1. As RIOK1 kinase activity constitutes a potential therapeutic target, we wanted to test if MTAP deletion confers increased sensitivity to RIOK1 inhibition.
    [Show full text]
  • RIOK2 and Other Trans-​Acting Factors (Nat
    NEWS & ANALYSIS BIOBUSINESS BRIEFS TARGET WATCH release of RIOK2 and other trans- acting factors (Nat. Struct. Mol. Biol. 19, 1316–1323; 2012). RIOK2 has also been linked to AKT RIOK2: straddling the kinase/ATPase line signalling in glioblastoma (PLoS Genet. 9, e1003253; 2013). RIOK2 and RIOK1 The RIO kinases (RIOKs) are a family Biological functions were found in a complex with TORC2, of atypical kinases present in eukaryotes RIOK2 is essential in yeast, mice and in and overexpression of RIOK2 resulted in and archaea (Genome Res. 8, 1038–1047; at least 560 human cell lines (see DepMap increased phosphorylation of AKT S473, 1998). RIOK1 and RIOK2 are conserved in Related links). Essentiality is largely a TORC2 substrate. In turn, activation of throughout evolution, whereas multicellular attributed to the role of RIOK2 in small AKT resulted in stabilization of RIOK2 eukaryotes, including humans, have a third ribosomal subunit maturation, a complex protein levels creating a feed-forward RIOK, RIOK3. All three RIOKs are found process involving more than 150 trans- activation loop. Although untested, RIOK2 in the pre-40S ribosome, and RIOK1 and acting factors in the nucleus and cytoplasm. has a putative AKT consensus sequence with RIOK2 are essential for ribosomal maturation RIOK2 functions as a trans- acting factor documented phosphorylation. (Mol. Cell. Biol. 23, 2083–2095; 2003), that shepherds the last steps of maturation but their functions are non-overlapping and of the 40S subunit. Depletion of RIOK2 Chemical tools poorly understood mechanistically. More results in a late pre-40S-biogenesis defect. Broad kinase screening has demonstrated that recently, RIOKs have been found to regulate In the nucleus, RIOK2 binds the pre-40S RIOK2 is competent to bind small molecules other biological pathways including cell cycle subunit and helps facilitate export through (PLoS One 12, e0181585; 2017).
    [Show full text]
  • 95742748.Pdf
    EBioMedicine 20 (2017) 79–97 Contents lists available at ScienceDirect EBioMedicine journal homepage: www.ebiomedicine.com Research Paper The Atypical Kinase RIOK1 Promotes Tumor Growth and Invasive Behavior Florian Weinberg a,b,c,NadineReischmanna,b,d,LisaFauthe,#, Sanaz Taromi f,#, Justin Mastroianni b,f,#, Martin Köhler a,b,d, Sebastian Halbach a,b,d, Andrea C. Becker g,h, Niantao Deng i,j, Tatjana Schmitz a, Franziska Maria Uhl a,b,f, Nicola Herbener e, Bianca Riedel e, Fabian Beier e, Alexander Swarbrick i,j, Silke Lassmann c,e,k, Jörn Dengjel c,g,h,l, Robert Zeiser c,f, Tilman Brummer a,b,c,k,⁎ a Institute of Molecular Medicine and Cell Research (IMMZ), Faculty of Medicine, Albert-Ludwigs-University (ALU), Freiburg, Germany b Faculty of Biology, ALU, Freiburg, Germany c BIOSS Centre for Biological Signalling Studies, BIOSS, ALU, Germany d Spemann Graduate School of Biology and Medicine (SGBM), ALU, Freiburg, Germany e Institute for Surgical Pathology, Medical Center and Faculty of Medicine, ALU, Germany f Department of Hematology and Oncology, University Medical Center, ALU, Freiburg, Germany g Freiburg Institute for Advanced Studies (FRIAS), ALU, Freiburg, Germany h Department of Dermatology, University Medical Center - ALU, Freiburg, Germany i Garvan Institute of Medical Research, Darlinghurst, New South Wales, Australia j St Vincent's Clinical School, Faculty of Medicine, UNSW, Sydney, Australia k German Cancer Consortium (DKTK, Freiburg) and German Cancer Research Center (DKFZ), Heidelberg, Germany l Department of Biology, University of Fribourg, Fribourg, Switzerland article info abstract Article history: Despite being overexpressed in different tumor entities, RIO kinases are hardly characterized in mammalian cells.
    [Show full text]
  • Structural Insights Into Protein Arginine Symmetric Dimethylation by PRMT5
    Structural insights into protein arginine symmetric dimethylation by PRMT5 Litao Suna,b,1,MingzhuWanga,1, Zongyang Lva,b, Na Yanga,YingfangLiua, Shilai Baoc,WeiminGonga,2, and Rui-Ming Xua,2 aNational Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China; bGraduate University of Chinese Academy of Sciences, Beijing 100049, China; and cState Key Laboratory of Molecular and Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China Edited by* Dinshaw J. Patel, Memorial Sloan-Kettering Cancer Center, New York, NY, and approved October 19, 2011 (received for review May 2, 2011) Symmetric and asymmetric dimethylation of arginine are isomeric enzyme shares high sequence homology with its human counter- protein posttranslational modifications with distinct biological part, and the recombinant protein displays robust and specific effects, evidenced by the methylation of arginine 3 of histone H4 symmetric arginine dimethylase activity in vitro (Fig. 1). The (H4R3): symmetric dimethylation of H4R3 leads to repression of structure shows the PRMT5 is composed of four clearly defined gene expression, while asymmetric dimethylation of H4R3 is asso- domains, a previously unsuspected TIM-barrel at the N-terminal ciated with gene activation. The enzymes catalyzing these modifi- end, a middle Rossmann-fold domain, a C-terminal β-barrel cations share identifiable sequence similarities, but the relationship domain, and a ∼60 residue dimerization domain inserted be- between their catalytic mechanisms is unknown. Here we analyzed tween β1 and β2 of the β-barrel domain (Fig. 2A). The first three the structure of a prototypic symmetric arginine dimethylase, domains are packed in a triangular manner, with direct contacts PRMT5, and discovered that a conserved phenylalanine in the between sequential domains, and the oligomerization domain active site is critical for specifying symmetric addition of methyl bridges the TIM-barrel and β-barrel domains.
    [Show full text]
  • IEEE Conference Paper Template
    Two-Column Template for LACCEI Conference Proceedings Based on IEEE Format (Title) Albert Djoum1, Hongpeng Wang1, and Nicole Laronde, PhD1 1University of Maryland, College Park, United States, [email protected] ,[email protected], [email protected] Abstract DIFFERENCE BETWEEN A NORMAL OVARY AND ONE AFFECTED For all cancers, increased ribosome biogenesis is a critical BY CANCER.2 requirement and RIO kinases play a critical role in maintaining processing efficiency. RioK1 is important because it is required for cytoplasmic maturation of the small(40S) subunit. RioK1 is also important to other cancer promoting processes, such as proliferation and migration. In functions other than ribosome biogenesis, RioK1 is used as an adaptor protein of PRMT5 (protein arginine methyltransferase 5) and recruits nucleolin for symmetrical demethylation. In relation to cancer, however, specific roles, as well as structure for the RioK1-PRMT5-nucleolin complex is still unknown. Overall, this research will investigate the effects of RIOK1 knockdown and overexpression on cancer-supporting processes such as proliferation, migration, and invasion. The goal of this specific project was as such: what is the ideal molar ratio of mixing RioK-1 and PRMT5, that results in the best, most homogeneous, complex being formed? After determining this ratio, X-ray crystallography will be used on the RioK1-PRMT5-nucleolin complex and the structure will be determined. The methodology used was as follows: first, Riok1 and PRMT5 from Chaetomium Thermophilum were expressed in E. coli bacteria and then purified. Afterwards, RioK1 and PRMT5 were mixed in various molar ratios and then analyzed on native PAGE gel. Initially, RioK1 and PRMT5 were both varied, but then RioK1 was kept at a constant FIGURE 1.
    [Show full text]