DOCSLIB.ORG

Crystal Structure of the Human PRMT5:MEP50 Complex

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Crystal Structure of the Human PRMT5:MEP50 Complex Crystal structure of the human PRMT5:MEP50 complex Stephen Antonysamya,1, Zahid Bondayb, Robert M. Campbellb, Brandon Doyleb, Zhanna Druzinaa, Tarun Gheyia, Bomie Hanb, Louis N. Jungheimb, Yuewei Qianb, Charles Raucha, Marijane Russella, J. Michael Saudera, Stephen R. Wassermanc, Kenneth Weicherta, Francis S. Willardb, Aiping Zhanga, and Spencer Emtagea,1 aLilly Biotechnology Center, Eli Lilly and Company, San Diego, CA 92121; bLilly Research Laboratories, Eli Lilly and Company, Indianapolis, IN 46285; and cLilly Research Laboratories Collaborative Access Team, Eli Lilly and Company, Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439 Edited* by Wayne A. Hendrickson, Columbia University, New York, NY, and approved September 20, 2012 (received for review June 12, 2012) Protein arginine methyltransferases (PRMTs) play important roles RAS to ERK signaling pathway through methylation of RAF in several cellular processes, including signaling, gene regulation, proteins (10), regulates ribosome biogenesis through methylation and transport of proteins and nucleic acids, to impact growth, of ribosomal protein S10 (RPS10) (11), and plays an essential role differentiation, proliferation, and development. PRMT5 symmetri- in cell survival through regulation of eIF4E expression and cally di-methylates the two-terminal ω-guanidino nitrogens of ar- p53 translation. PRMT5 in association with MEP50 methylates ginine residues on substrate proteins. PRMT5 acts as part of a mul- cytosolic H2A to repress differentiation genes in ES cells (12). timeric complex in concert with a variety of partner proteins that During germ-cell development, the PRMT5 complex with tran- regulate its function and specificity. A core component of these scriptional repressor Blimp1 translocates from the nucleus to the complexes is the WD40 protein MEP50/WDR77/p44, which medi- cytoplasm at embryonic day 11.5 (E11.5), concomitantly with the ates interactions with binding partners and substrates. We have up-regulation of likely target genes (13). Recent data indicate that PRMT5 and MEP50 are components of the Grg4 complex, es- determined the crystal structure of human PRMT5 in complex with sential for its mediation of transcriptional repression (14). PRMT5 MEP50 (methylosome protein 50), bound to an S-adenosylmethio- has also been shown to inhibit the tumor suppressive function of nine analog and a peptide substrate derived from histone H4. The PDCD4 (15). The methyltransferase activity of PRMT5 can be structure of the surprising hetero-octameric complex reveals the controlled by phosphorylation of either MEP50 or of PRMT5 β close interaction between the seven-bladed -propeller MEP50 itself. Cyclin D1/CDK4 phosphorylates Thr5 on MEP50, activating and the N-terminal domain of PRMT5, and delineates the structural the methyltransferase activity of PRMT5 and resulting in pro- elements of substrate recognition. longed survival of tumor cells (16). In contrast, oncogenic mutants of Jak2 (V617F, K539L) phosphorylate tyrosine residues 297, 304, epigenetics | protein-protein complex | A9145C and 306 of PRMT5, disrupt association with MEP50 and down- regulate its methyltransferase activity on histone substrates (17). osttranslational methylation of lysine and arginine residues MEP50 was initially identified as a WD40 repeat protein that Pby protein lysine methyltransferases and protein arginine associates with PRMT5 and as an integral component of the 20S methyltransferases (PRMTs) alters the activity and interactions protein methyltransferase complex, termed the methylosome of substrate proteins, with crucial consequences to diverse cellular (18), and independently as an androgen receptor cofactor (p44) functions (1–3). Histone methylation is an epigenetic mark that that is overexpressed in prostate cancer cells (19). WD40 pro- plays a vital role in normal cell function, and whose dysregulation teins are known to play vital roles in various cellular networks – is associated with several diseases (4). (20, 21). These proteins function as protein protein and pro- The PRMT family of methyltransferases belongs to the largest tein–DNA interaction platforms and also as recognition mod- fi class (class I) of S-adenosylmethionine (AdoMet)-dependent meth- ules of posttranslational modi cations (22, 23). Recent studies fi yltransferase enzymes, responsible for the transfer of a methyl group on MEP50 identi ed the presence of two nuclear exclusion from AdoMet to the arginine side-chains of histones and other signals and three nuclear localization signals that control its proteins. PRMTs are further subdivided into type I, type II, type subcellular localization and its function as a transcriptional III, and type IV enzymes based on their patterns of arginine cofactor of androgen receptor during prostate development and methylation. Eleven human PRMTs have been identified to date tumorigenesis (24). MEP50 serves as a coactivator of both an- (5), and they all methylate the terminal guanidino nitrogen atoms drogen receptor and estrogen receptor in ovarian cells, and of arginine residues. Type I PRMT enzymes (PRMT1, -2, -3, -4, mediates hormonal effects during ovarian tumorigenesis (25). -6, and -8) generate ω-NG-monomethyl and ω-NG,NG-asymmetric MEP50 has been shown to interact with SUZ12 (a component di-methyl arginines, whereas PRMT5 is a type II PRMT that cat- of the PRC2/EED-EZH2 complexes), and to selectively bind alyzes the formation of ω-NG-monomethyl and ω-NG,N′G-sym- H2A, and has been postulated to be an adapter protein between PRMT5 and its substrates (26). MEP50 and PRMT5 have been metric di-methyl arginine residues. PRMT7 was initially thought to fi have type II activity, but recent evidence suggests that it may be identi ed as components of the FCP1 complex, suggesting a link a type III enzyme that is only able to monomethylate substrates to form ω-NG-monomethyl arginine (6). A type IV enzyme that ca- talyses the formation of δ-N-methyl arginine has been identified in Author contributions: S.A., Z.D., T.G., B.H., C.R., M.R., J.M.S., F.S.W., and S.E. designed yeast (7). All PRMTs share the highly conserved methyltransferase research; S.A., B.D., Z.D., T.G., B.H., C.R., M.R., J.M.S., S.R.W., K.W., F.S.W., and A.Z. performed research; L.N.J. and Y.Q. contributed new reagents/analytic tools; S.A., B.D., catalytic domain, and several PRMTs contain additional domains Z.D., T.G., B.H., C.R., M.R., S.R.W., F.S.W., A.Z., and S.E. analyzed data; and S.A., Z.B., R.M.C., that modulate their activity and specificity. PRMT2, PRMT3, and B.D., Z.D., B.H., J.M.S., F.S.W., and S.E. wrote the paper. fi PRMT9 contain SH3, zinc nger, and TRP2 domains, respectively, Conflict of interest statement: This research was funded by Lilly Research Laboratories and PRMT5 contains a largely uncharacterized N-terminal region. and all the authors are employees of Eli Lilly and Company. In contrast to type I PRMTs, PRMT5 functions as part of various *This Direct Submission article had a prearranged editor. high molecular weight protein complexes that invariably contain Freely available online through the PNAS open access option. the WD-repeat–containing protein MEP50 (methylosome protein Data deposition: The atomic coordinates and structure factors have been deposited in the 50). PRMT5 associates with other cellular proteins in a context- Research Collaboratory for Structural Bioinformatics Protein Data Bank, www.rscb.org dependent manner (Fig. S1), enabling the methylation of a myriad (PDB ID code 4GQB). of cytoplasmic and nuclear substrates, including Sm proteins, 1To whom correspondence may be addressed. E-mail: [email protected] or nucleolin, p53, histones H2A, H3, and H4, SPT5, and MBD2, and [email protected]. thereby plays a role in RNA processing, chromatin remodeling, This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. and control of gene expression (1, 8, 9). PRMT5 modulates the 1073/pnas.1209814109/-/DCSupplemental. 17960–17965 | PNAS | October 30, 2012 | vol. 109 | no. 44 www.pnas.org/cgi/doi/10.1073/pnas.1209814109 Downloaded by guest on September 30, 2021 between transcription elongation and splicing (27, 28). PRMT5 that eluted as a dimer in gel filtration columns, but had a pro- together with MEP50 is thought to constitute a core complex, pensity to aggregate and did not crystallize. which either binds pICln to methylate Sm proteins, or binds Coexpression of PRMT5 with MEP50 in insect cells increased Riok1 to methylate nucleolin (29, 30). the yield of soluble protein, and dramatically improved the ho- Protein methyltransferases are being actively pursued as drug mogeneity of the purified product, as judged by gel filtration (Fig. targets for various types of cancer where enhanced levels of 1 A–C and Fig. S2). In contrast to the homo-dimer observed from PRMT5 have been observed (4, 31–33). Despite the vital role PRMT5 alone, coexpression with MEP50 produced a tight com- played by PRMT5 in diverse cellular processes, and its potential plex that eluted from preparative gel filtration columns in the 400- as a drug target, there has been scant structural information on to 500-kDa molecular weight range. To additionally characterize PRMT5 or its interaction with MEP50. We present here the this complex, we determined the molecular weight by sedimenta- complex of human PRMT5 with MEP50 analyzed by chroma- tion velocity analytical centrifugation (Fig. 1D). The most abun- tography, sedimentation analysis, enzymology, and X-ray crystal- dant species (65% by mass) had an estimated molecular weight of lography. We have elucidated the crystal structure of the complex 435 kDa, consistent with a PRMT5:MEP50 complex containing bound to an AdoMet analog A9145C (34) and a substrate peptide four molecules each of PRMT5 and MEP50. The second most from histone H4. As we were preparing this article, the crystal abundant species (12.5% by mass), with an estimated molecular structure of PRMT5 from Caenorhabditis elegans, which shares weight of 720 kDa, potentially consists of higher-order complexes a sequence identity of 31% with human PRMT5, was published of hetero-octamer, or alternative PRMT5:MEP50 complexes.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Riok1 (BC002158) Mouse Tagged ORF Clone – MR204785 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR204785 Riok1 (BC002158) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Riok1 (BC002158) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Riok1 Synonyms: 3110046C13Rik, Ad034, MGC7300 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR204785 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAGGACGTGGGCAGAGAAGGAGATGAGGAATTTGTGCAGGCTAAAAACAGCAAACATACCATGTC CAGAACCAATCAGGCTAAGAAGTCATGTTCTTCTCATGGGCTTCATTGGCAAGGATGACATGCCAGCCCC ACTTTTGAAAAATGTCCAGCTGTCAGAGTCCAAGGCACGGGAGTTGTACCTGCAGGTCATTCAGTACATG AGGAAAATGTATCAGGATGCTAGACTTGTCCACGCGGATCTCAGTGAATTCAACATGCTGTACCATGGTG GAGATGTTTACATCATTGATGTTTCTCAGTCTGTGGAGCATGACCACCCACATGCATTGGAGTTCTTGAG AAAAGACTGTACCAATGTCAATGATTTCTTTTCCAAGCATGCTGTTGCAGTGATGACCGTGCGGGAGCTC TTCGACTTCGTCACAGATCCCTCCATCACTGCTGACAACATGGATGCTTACCTGGAAAAGGCTATGGAAA TAGCATCCCAGAGGACCAAGGAAGAAAAGACTAGCCAAGATCATGTGGATGAAGAGGTGTTCAAACAAGC ATATATTCCCAGAACCTTAAACGAAGTAAAGAATTATGAGAGAGATGTGGACATCATGATGAGGTTAAAG GAAGAAGACATGGCTTTGAACACTCAGCAAGACAACATTCTATACCAGACTGTCATGGGATTGAAAAAAG ATTTGTCAGGAGTCCAGAAGGTCCCCGCGCTCCTAGAAAGTGAAGTTAAGGAAGAGACTTGTTTTGGTTC AGACGATGCTGGGGGCTCTGAGTGCTCCGACACAGTCTCTGAAGAGCAGGAAGATCAAGCCGGATGCAGA AACCATATTGCTGACCCCGACGTTGATAAAAAGGAAAGAAAAAAGATGGTCAAGGAAGCCCAGAGAGAGA
    [Show full text]
  • Folding-TIM Barrel
    Protein Folding Practical September 2011 Folding up the TIM barrel Preliminary Examine the parallel beta barrel that you constructed, noting the stagger of the strands that was needed to connect the ends of the 8-stranded parallel beta sheet into the 8-stranded beta barrel. Notice that the stagger dictates which side of the sheet is on the inside and which is on the outside. This will be key information in folding the complete TIM linear peptide into the TIM barrel. Assembling the full linear peptide 1. Make sure the white beta strands are extended correctly, and the 8 yellow helices (with the green loops at each end) are correctly folded into an alpha helix (right handed with H-bonds to the 4th ahead in the chain). 2. starting with a beta strand connect an alpha helix and green loop to make the blue-red connecting peptide bond. Making sure that you connect the carbonyl (red) end of the beta strand to the amino (blue) end of the loop-helix-loop. Secure the just connected peptide bond bond with a twist-tie as shown. 3. complete step 2 for all beta strand/loop-helix-loop pairs, working in parallel with your partners 4. As pairs are completed attach the carboxy end of the strand- loop-helix-loop to the amino end of the next strand-loop-helix-loop module and secure the new peptide bond with a twist-tie as before. Repeat until the full linear TIM polypeptide chain is assembled. Make sure all strands and helices are still in the correct conformations.
    [Show full text]
  • Supplemental Table 7. Every Significant Association
    Supplemental Table 7. Every significant association between an individual covariate and functional group (assigned to the KO level) as determined by CPGLM regression analysis. Variable Unit RelationshipLabel See also CBCL Aggressive Behavior K05914 + CBCL Emotionally Reactive K05914 + CBCL Externalizing Behavior K05914 + K15665 K15658 CBCL Total K05914 + K15660 K16130 KO: E1.13.12.7; photinus-luciferin 4-monooxygenase (ATP-hydrolysing) [EC:1.13.12.7] :: PFAMS: AMP-binding enzyme; CBQ Inhibitory Control K05914 - K12239 K16120 Condensation domain; Methyltransferase domain; Thioesterase domain; AMP-binding enzyme C-terminal domain LEC Family Separation/Social Services K05914 + K16129 K16416 LEC Poverty Related Events K05914 + K16124 LEC Total K05914 + LEC Turmoil K05914 + CBCL Aggressive Behavior K15665 + CBCL Anxious Depressed K15665 + CBCL Emotionally Reactive K15665 + K05914 K15658 CBCL Externalizing Behavior K15665 + K15660 K16130 KO: K15665, ppsB, fenD; fengycin family lipopeptide synthetase B :: PFAMS: Condensation domain; AMP-binding enzyme; CBCL Total K15665 + K12239 K16120 Phosphopantetheine attachment site; AMP-binding enzyme C-terminal domain; Transferase family CBQ Inhibitory Control K15665 - K16129 K16416 LEC Poverty Related Events K15665 + K16124 LEC Total K15665 + LEC Turmoil K15665 + CBCL Aggressive Behavior K11903 + CBCL Anxiety Problems K11903 + CBCL Anxious Depressed K11903 + CBCL Depressive Problems K11903 + LEC Turmoil K11903 + MODS: Type VI secretion system K01220 K01058 CBCL Anxiety Problems K11906 + CBCL Depressive
    [Show full text]
  • Tertiary Structure
    Comments Structural motif v sequence motif polyproline (“PXXP”) motif for SH3 binding “RGD” motif for integrin binding “GXXXG” motif within the TM domain of membrane protein Most common type I’ beta turn sequences: X – (N/D/G)G – X Most common type II’ beta turn sequences: X – G(S/T) – X 1 Putting it together Alpha helices and beta sheets are not proteins—only marginally stable by themselves … Extremely small “proteins” can’t do much 2 Tertiary structure • Concerns with how the secondary structure units within a single polypeptide chain associate with each other to give a three- dimensional structure • Secondary structure, super secondary structure, and loops come together to form “domains”, the smallest tertiary structural unit • Structural domains (“domains”) usually contain 100 – 200 amino acids and fold stably. • Domains may be considered to be connected units which are to varying extents independent in terms of their structure, function and folding behavior. Each domain can be described by its fold, i.e. how the secondary structural elements are arranged. • Tertiary structure also includes the way domains fit together 3 Domains are modular •Because they are self-stabilizing, domains can be swapped both in nature and in the laboratory PI3 kinase beta-barrel GFP Branden & Tooze 4 fluorescence localization experiment Chimeras Recombinant proteins are often expressed and purified as fusion proteins (“chimeras”) with – glutathione S-transferase – maltose binding protein – or peptide tags, e.g. hexa-histidine, FLAG epitope helps with solubility, stability, and purification 5 Structural Classification All classifications are done at the domain level In many cases, structural similarity implies a common evolutionary origin – structural similarity without evolutionary relationship is possible – but no structural similarity means no evolutionary relationship Each domain has its corresponding “fold”, i.e.
    [Show full text]
  • Human RIOK1 / RIO Kinase 1 Protein (His & GST Tag)
    Human RIOK1 / RIO kinase 1 Protein (His & GST Tag) Catalog Number: 14477-H20B General Information SDS-PAGE: Gene Name Synonym: AD034; bA288G3.1; RRP10; 3110046C13Rik; 5430416A05Rik; Ad034 Protein Construction: A DNA sequence encoding the human RIOK1 (Q9BRS2) (Met1-Lys568) was expressed with the N-terminal polyhistidine-tagged GST tag at the N-terminus. Source: Human Expression Host: Baculovirus-Insect Cells QC Testing Purity: > 85 % as determined by SDS-PAGE Bio Activity： Protein Description Kinase activity untested RIOK1, also known as RIO kinase 1, is a member of the RIO family of Endotoxin: atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 < 1.0 EU per μg of the protein as determined by the LAL method functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex Stability: composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a Samples are stable for up to twelve months from date of receipt at -70 ℃ mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct Predicted N terminal: Met complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its Molecular Mass: symmetrical methylation. The recombinant human RIOK1/GST chimera consists of 805 amino acids References and has a calculated molecular mass of 93.4 kDa. The recombinant protein migrates as an approximately 94 kDa band in SDS-PAGE under reducing 1.Widmann B.
    [Show full text]
  • BMC Structural Biology Biomed Central
    BMC Structural Biology BioMed Central Research article Open Access Natural history of S-adenosylmethionine-binding proteins Piotr Z Kozbial*1 and Arcady R Mushegian1,2 Address: 1Stowers Institute for Medical Research, 1000 E. 50th St., Kansas City, MO 64110, USA and 2Department of Microbiology, Molecular Genetics, and Immunology, University of Kansas Medical Center, Kansas City, Kansas 66160, USA Email: Piotr Z Kozbial* - [email protected]; Arcady R Mushegian - [email protected] * Corresponding author Published: 14 October 2005 Received: 21 July 2005 Accepted: 14 October 2005 BMC Structural Biology 2005, 5:19 doi:10.1186/1472-6807-5-19 This article is available from: http://www.biomedcentral.com/1472-6807/5/19 © 2005 Kozbial and Mushegian; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: S-adenosylmethionine is a source of diverse chemical groups used in biosynthesis and modification of virtually every class of biomolecules. The most notable reaction requiring S- adenosylmethionine, transfer of methyl group, is performed by a large class of enzymes, S- adenosylmethionine-dependent methyltransferases, which have been the focus of considerable structure-function studies. Evolutionary trajectories of these enzymes, and especially of other classes of S-adenosylmethionine-binding proteins, nevertheless, remain poorly understood. We addressed this issue by computational comparison of sequences and structures of various S- adenosylmethionine-binding proteins. Results: Two widespread folds, Rossmann fold and TIM barrel, have been repeatedly used in evolution for diverse types of S-adenosylmethionine conversion.
    [Show full text]
  • Molecular Modeling 2021 Lecture 3 -- Tues Feb 2
    Molecular Modeling 2021 lecture 3 -- Tues Feb 2 Protein classification SCOP TOPS Contact maps domains Domains To a cell biologist a domain is a sequential unit within a gene, usually with a specific function. To a structural biologist a domain is a compact globular unit within a protein, classified by its 3D structure. 2 A domain is... • ... an autonomously-folding substructure of a protein. • ... > 30 residues, but typically < 200. May be bigger. • ...usually has a single hydrophobic core • ... usually composed of one chain (occasionally composed of multiple chains) • ...is usually composed on one contiguous segment (occasionally made of discontiguous segments of the same chain) 3 SARS-CoV-2 spike protein — a multi domain protein 4 SCOPe -- classification of domains !http://scop.berkeley.edu similar secondary structure (1) class content (2) fold vague structural homology (3) superfamily Clear structural homology (4) family increasing structural similarity structural increasing (5) protein Clear sequence homology (6) species nearly identical sequences individual structures SCOPe -- class 1. all α (289) classes of domains 2. all β (178) 3. α/β (148) 4. α+β (388) 5. multidomain (71) 6. membrane (60) 7. small (98) Not true classes of globular 8. coiled coil (7) protein domains 9. low-resolution (25) 10. peptides (148) 11. designed proteins (44) 12. artifacts (1) Proteins of the same class conserve secondary structure content SCOPe -- fold level within α/β proteins -- Mainly parallel beta sheets (beta-alpha-beta units) TIM-barrel (22) swivelling beta/beta/alpha domain (5) Many folds have historical spoIIaa-like (2) names. “TIM” barrel was flavodoxin-like (10) first seen in TIM.
    [Show full text]
  • Biochemical Investigation of the Interaction of Picln, Riok1 and COPR5 with the PRMT5–MEP50 Complex
    Communications ChemBioChem doi.org/10.1002/cbic.202100079 1 2 3 Biochemical Investigation of the Interaction of pICln, RioK1 4 5 and COPR5 with the PRMT5–MEP50 Complex 6 [a, b] [c] [d, e] ' [f] 7 Adrian Krzyzanowski, Raphael Gasper, Hélène Adihou, Peter t Hart,* and [a, b] 8 Herbert Waldmann* 9 10 compete for the same binding site, but are not competitive 11 The PRMT5–MEP50 methyltransferase complex plays a key role with MEP50.[5] 12 in various cancers and is regulated by different protein–protein PRMT5 contains three domains, that is, the catalytic site- 13 interactions. Several proteins have been reported to act as containing Rossmann fold, a β-barrel domain used for dimeriza- 14 adaptor proteins that recruit substrate proteins to the active tion, and the TIM barrel, which acts as interaction site for 15 site of PRMT5 for the methylation of arginine residues. To MEP50 (Figure 1A).[3a,c] PRMT5 and MEP50 form a hetero- 16 define the interaction between these adaptor proteins and octameric complex whose structure has been determined,[3a] 17 PRMT5, we employed peptide truncation and mutation studies and structural information on the interaction between PRMT5 18 and prepared truncated protein constructs. We report the and the other adaptor proteins has only very recently been 19 characterisation of the interface between the TIM barrel of described in preliminary form.[7] Overexpression of PRMT5 is 20 PRMT5 and the adaptor proteins pICln, RioK1 and COPR5, and frequently observed in cancer which makes the protein an 21 identify the consensus amino acid sequence GQF[D/E]DA[E/D] intensively investigated anticancer target, and active-site di- 22 involved in binding.
    [Show full text]
  • 8-Barrel Enzymes John a Gerlt and Frank M Raushely
    252 Evolution of function in (b/a)8-barrel enzymes John A Gerltà and Frank M Raushely The (b/a)8-barrel is the most common fold in structurally closed, parallel b-sheet structure of the (b/a)8-barrel is characterized enzymes. Whether the functionally diverse formed from eight parallel (b/a)-units linked by hydrogen enzymes that share this fold are the products of either divergent bonds that form a cylindrical core. Despite its eightfold or convergent evolution (or both) is an unresolved question that pseudosymmetry, the packing within the interior of the will probably be answered as the sequence databases continue barrel is better described as four (b/a)2-subdomains in to expand. Recent work has examined natural, designed, and which distinct hydrophobic cores are located between the directed evolution of function in several superfamilies of (b/a)8- b-sheets and flanking a-helices [2]. barrel containing enzymes. The active sites are located at the C-terminal ends of the Addresses b-strands. So placed, the functional groups surround the ÃDepartments of Biochemistry and Chemistry, University of Illinois at active site and are structurally independent: the ‘old’ and Urbana-Champaign, 600 South Mathews Avenue, Urbana, ‘new’ enzymes retain functional groups at the ends of Illinois 61801, USA e-mail: [email protected] some b-strands, but others are altered to allow the ‘new’ yDepartment of Chemistry, Texas A&M University, PO Box 30012, activity [3]. With this blueprint, the (b/a)8-barrel is opti- College Station, Texas 77842-3012, USA mized for evolution of new functions.
    [Show full text]
  • Targeting Posttranslational Modifications of RIOK1
    RESEARCH ARTICLE Targeting posttranslational modifications of RIOK1 inhibits the progression of colorectal and gastric cancers Xuehui Hong1,2,3,4†, He Huang5,6†, Xingfeng Qiu2,3,4, Zhijie Ding2,3,4, Xing Feng7, Yuekun Zhu8, Huiqin Zhuo2,3,4, Jingjing Hou2,3,4, Jiabao Zhao2,3,4, Wangyu Cai2,3,4, Ruihua Sha9, Xinya Hong10, Yongxiang Li11*, Hongjiang Song12*, Zhiyong Zhang1,13* 1Longju Medical Research Center, Key Laboratory of Basic Pharmacology, Ministry of Education, Zunyi Medical College, Zunyi, China; 2Department of Gastrointestinal Surgery, Zhongshan Hospital of Xiamen University, Xiamen, China; 3Institute of Gastrointestinal Oncology, Medical College of Xiamen University, Xiamen, China; 4Xiamen Municipal Key Laboratory of Gastrointestinal Oncology, Xiamen, China; 5Department of Histology and Embryology, Xiangya School of Medicine, Central South University, Changsha, China; 6Digestive Cancer Laboratory, Second Affiliated Hospital of Xinjiang Medical University, Urumqi, China; 7Department of Radiation Oncology, Cancer Institute of New Jersey, Rutgers University, New Brunswick, United States; 8Department of General Surgery, The First Affiliated Hospital of Harbin Medical University, Harbin, China; 9Department of Digestive Disease, Hongqi Hospital, Mudanjiang Medical University, Mudanjiang, China; 10Department *For correspondence: of Medical Imaging and Ultrasound, Zhongshan Hospital of Xiamen University, 11 [email protected] Xiamen, Fujian, China; Department of General Surgery, The First Affiliated (YL); Hospital of Anhui Medical University, Hefei, China; 12Department of General [email protected] Surgery, The Third Affiliated Hospital of Harbin Medical University, Harbin, China; (HS); 13Department of Surgery, Robert-Wood-Johnson Medical School University [email protected] (ZZ) † Hospital, Rutgers University, The State University of New Jersey, New Brunswick, These authors contributed United States equally to this work Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Genomic Alterations Link Rho Family of Gtpases to the Highly Invasive Phenotype of Pancreas Cancer
    Genomic alterations link Rho family of GTPases to the highly invasive phenotype of pancreas cancer Alec C. Kimmelmana,b, Aram F. Hezela,c, Andrew J. Aguirrea, Hongwu Zhenga, Ji-hye Paika, Haoqiang Yinga, Gerald C. Chua, Jean X. Zhanga,d, Ergun Sahina, Giminna Yeod, Aditya Ponugotid, Roustem Nabioullind, Scott Derooa, Shenghong Yangb, Xiaoxu Wangb, John P. McGrathd, Marina Protopopovad, Elena Ivanovad, Jianhua Zhangd, Bin Fengd, Ming S. Tsaoe, Mark Redstonf, Alexei Protopopovd, Yonghong Xiaod, P. Andrew Futrealg, William C. Hahna,h,i, David S. Klimstraj, Lynda China,d,k, and Ronald A. DePinhoa,d,h,1 aDepartment of Medical Oncology and bHarvard Radiation Oncology Program, Dana-Farber Cancer Institute and Harvard Medical School, Boston, MA 02115; dCenter for Applied Cancer Science of the Belfer Institute for Innovative Cancer Science, Dana-Farber Cancer Institute, Boston, MA 02115; kDepartment of Dermatology, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; hDepartments of Medicine and Genetics, Harvard Medical School, Boston, MA 02115; eUniversity Health Network, Ontario Cancer Institute and Princess Margaret Hospital, Toronto, ON, Canada M5G 2M9; jDepartment of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY 10065; fMolecular Diagnostics, Ameripath, Newton, MA 02464; gCancer Genome Project, Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA, United Kingdom; iBroad Institute of Harvard and MIT, Cambridge, MA 02142; and cTucker Gosnell Center for Gastrointestinal Cancers, Massachusetts General Hospital Cancer Center, Lawrence House, P.O. Box 232, Boston, MA 02114 Communicated by David M. Livingston, Dana–Farber Harvard Cancer Center, Boston, MA, October 10, 2008 (received for review May 7, 2008) Pancreas ductal adenocarcinoma (PDAC) is a highly lethal cancer that high-resolution aCGH to better define the atlas of recurrent CNAs typically presents as advanced, unresectable disease.
    [Show full text]