DOCSLIB.ORG

Latrotoxin Binding and ␣-Latrotoxin-Stimulated Secretion a STUDY with CALCIUM-INDEPENDENT RECEPTOR of ␣-LATROTOXIN (CIRL) DELETION MUTANTS*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Latrotoxin Binding and ␣-Latrotoxin-Stimulated Secretion a STUDY with CALCIUM-INDEPENDENT RECEPTOR of ␣-LATROTOXIN (CIRL) DELETION MUTANTS* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 274, No. 6, Issue of February 5, pp. 3590–3596, 1999 © 1999 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Structural Requirements for a-Latrotoxin Binding and a-Latrotoxin-stimulated Secretion A STUDY WITH CALCIUM-INDEPENDENT RECEPTOR OF a-LATROTOXIN (CIRL) DELETION MUTANTS* (Received for publication, October 26, 1998, and in revised form, November 25, 1998) Valery Krasnoperov‡, Mary A. Bittner§, Ronald W. Holz§, Oleg Chepurny‡, and Alexander G. Petrenko‡¶i From the ‡Departments of Pharmacology, ¶Physiology and Neuroscience, and ¶Environmental Medicine, New York University Medical Center, New York, New York 10016 and the §Department of Pharmacology, University of Michigan Medical School, Ann Arbor, Michigan 48109 Stimulation of neurotransmitter release by a-latro- a-latrotoxin (CIRL)1 (5, 6). CIRL is thought to be more impor- toxin requires its binding to the calcium-independent tant for a-latrotoxin effects in neurons than neurexin Ia be- receptor of a-latrotoxin (CIRL), an orphan neuronal G cause a-latrotoxin can stimulate neurotransmitter release from protein-coupled receptor. CIRL consists of two nonco- neurons in Ca21-free media (7, 8). CIRL, also called latrophilin, valently bound subunits, p85, a heptahelical integral belongs to a family of closely related orphan G protein-coupled membrane protein, and p120, a large extracellular receptors (GPCRs) homologous to the secretin receptor family polypeptide with domains homologous to lectin, olfacto- (9, 10). In this family of three closely homologous proteins, medin, mucin, the secretin receptor family, and a novel CIRL-1 is a brain-enriched high affinity a-latrotoxin receptor, structural motif common for large orphan G protein- whereas CIRL-2 is a ubiquitously expressed low affinity recep- coupled receptors. The analysis of CIRL deletion mu- tor of the toxin (11). tants indicates that the high affinity a-latrotoxin-bind- The CIRL receptors have an unusual structure for GPCRs. ing site is located within residues 467–891, which First, they are significantly larger (about 200 kDa) than most of comprise the first transmembrane segment of p85 and the GPCRs. Second, they consist of two heterologous subunits the C-terminal half of p120. The N-terminal lectin, olfac- tomedin, and mucin domains of p120 are not required because of endogenous proteolytic processing of the precursor for the interaction with a-latrotoxin. Soluble p120 and protein. The site of this cleavage is located 18 residues up- all its fragments, which include the 467–770 residues, stream from the first transmembrane segment. As a result, bind a-latrotoxin with low affinity suggesting the impor- mature CIRL consists of two noncovalently bound subunits, tance of membrane-embedded p85 for the stabilization p120 and p85. p120 is a hydrophilic protein that is soluble and of the complex of the toxin with p120. Two COOH-termi- secreted if expressed separately from p85, whereas p85 has nal deletion mutants of CIRL, one with the truncated structural features typical of a generic GPCR although with an cytoplasmic domain and the other with only one trans- unusually large cytoplasmic tail (9, 11). membrane segment left of seven, supported both a-lat- There is ample evidence that a-latrotoxin receptors are crit- rotoxin-induced calcium uptake in HEK293 cells and ically required for the effects of a-latrotoxin (1, 12, 13). How- a-latrotoxin-stimulated secretion when expressed in ever, the mechanism of signaling downstream of the receptors chromaffin cells, although with a different dose depend- is not known. The heptahelical structure of CIRL suggests its ence than wild-type CIRL and its N-terminal deletion function as a regulator of a G protein pathway. However, no mutant. Thus the signaling domains of CIRL are not coupling of CIRL to any G protein has been convincingly critically important for the stimulation of exocytosis in shown. Moreover, no direct data are currently available to a intact chromaffin cells by -latrotoxin. prove that a-latrotoxin acts as an agonist or antagonist of its receptors. To analyze the structural requirements for a-latrotoxin bind- a -Latrotoxin, a potent natural stimulator of secretion from ing and a-latrotoxin stimulatory function, we generated three neurons and secretory cells, has two structurally and pharma- series of CIRL deletion mutants. Soluble fragments of the ex- cologically distinct classes of high affinity receptors (1). The tracellular region of CIRL were used to map the a-latrotoxin- a a calcium-dependent receptor of -latrotoxin or neurexin I is a binding site. On the basis of this information, N-terminally large (160–220 kDa) cell surface membrane protein existing in truncated membrane-bound forms of CIRL were produced, multiple isoforms (2, 3). It has one transmembrane segment which were shown to retain high affinity a-latrotoxin binding and structurally resembles cell adhesion proteins (4). A second activity. Finally, deletions in the COOH-terminal region of high affinity receptor is the calcium-independent receptor of CIRL were produced to remove the domains potentially in- volved in receptor signaling. The constructs lacking the CIRL * This study was supported by public health service Grants cytoplasmic tail and six of its seven transmembrane segments R01NS35098 and R01NS34937 from the NINDS, National Institutes of appeared to be fully functional in terms of a-latrotoxin binding, Health (to A. G. P.) and Grant R01DK27959 from the NIDDK, National Ca21 influx in HEK293 cells, and coupling of the toxin to Institutes of Health (to R. W. H.). The costs of publication of this article secretion in transfected chromaffin cells. Our data suggest that were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. i To whom correspondence should be addressed: Dept. of Pharmacol- 1 The abbreviations used are: CIRL, calcium-independent receptor of ogy, New York University Medical Center, 550 First Ave., MSB-202, a-latrotoxin; GPCR, G protein-coupled receptor; PCR, polymerase chain New York, NY 10016. Tel.: 212-263-5969; Fax: 212-263-7133; E-mail: reaction; GPS, GPCR proteolysis site; PSS, physiological salt solution; [email protected]. STP domain, Ser, Thr, and Pro-rich domain. 3590 This paper is available on line at http://www.jbc.org Interaction of a-Latrotoxin with CIRL 3591 G protein-mediated signaling is not critically important for the blotting with anti-p120 antibody. a a-latrotoxin-stimulated secretion in chromaffin cells. -Latrotoxin Binding Analysis of Cell Membranes—Three days after transfection, the COS cells were harvested on ice in physiological saline and centrifuged. The pellet was resuspended in a 50 mM Tris-HCl, 150 EXPERIMENTAL PROCEDURES mM NaCl, 2 mM EDTA, and 1% bovine serum albumin, pH 8.0, incuba- a-Latrotoxin was purified from lyophilized black widow spider tion buffer, and 10% of the cell material harvested from one 100-mm 125 glands and radioactively labeled with I using the chloramine T pro- Petri dish was incubated with 5 nM 125I-a-latrotoxin in the final volume cedure. The toxin was immobilized on BrCN-Sepharose as described (2). of 200 ml for 15 min. The binding reaction suspensions were diluted Soluble Deletion Mutants of the Extracellular Region of CIRL—The with the ice-cold incubation buffer and immediately centrifuged at pCDR7N construct encoding the extracellular region of CIRL (residues 14,000 rpm in the Eppendorf centrifuge for 10 min. The pellets were 1–856) with COOH-terminal His6 tag was described previously (9). The counted for radioactivity in a g-counter. The nonspecific binding was pCDR120 construct encoding the p120 subunit of CIRL precisely was measured in the presence of 100 nM cold toxin. prepared by ligating the AgeI/XbaI-digested PCR product obtained with Chromaffin cell and HEK293 cell transfections and functional anal- primers ACATCTAGAGGTGGCTGCAGGCACATGTGGTA and ACA- ysis of CIRL mutants were performed as described previously (9, 14). GGCCCAGCCGGCCAACACCATCAAGCAGAACAGCC on the 87-7 CIRL cDNA clone as a template into pCDR7 plasmid cut with AgeI/ RESULTS XbaI. The structure of the PCR-derived region of the final plasmid was Domain Structure of CIRL—Computer-assisted analysis of verified by sequencing. The recombinant DNA fragments encoding other deletion mutants were prepared by high fidelity PCR with Pfu the CIRL protein sequence reveals a number of distinct struc- polymerase and synthetic oligonucleotide primers containing SfiI tural domains (Fig. 1). A central region of CIRL (residues (sense) or XbaI (antisense) restriction sites. The expression constructs 850–1100) shows significant homology to the members of the were prepared by ligating the SfiI/XbaI-digested PCR products into secretin family of GPCRs (9). According to the hydrophobicity SfiI/XbaI-digested pSecTag plasmid (Invitrogen) in frame with the His 6 plot of CIRL, this region contains seven long hydrophobic tag. Thus prepared constructs encoded the following residues of CIRL: stretches, a hallmark of GPCRs. In GPCRs, these hydrophobic pSTR7-1, residues 25–598; pSTR7-2, residues 25–856; pSTR7-3, resi- a dues 25–631; pSTR7-4, residues 25–705; pSTR7-5, residues 25–770; sequences are -helical rods that form a compact oval-shaped pSTR7-6, residues 128–856; pSTR7–9, residues 538–856; pSTR7-16, integral transmembrane cluster (15). Similar to other GPCRs, residues 467–705; pSTR7-20, residues 185–856. The plasmids were three intracellular and three extracellular hydrophilic loops in transfected into COS-7 cells using the LipofectAMINE method accord- between transmembrane helices can be identified in CIRL. ing to Life Technologies, Inc. protocol. After 3 days, the conditioned The intracellular COOH-terminal region of CIRL (residues media and cells were harvested and analyzed for the presence of the 1100–1471) is unusually large for an average GPCR. It con- recombinant protein by precipitation with nickel-agarose followed by Western blotting with anti-p120 antibody.
Load more

Recommended publications
  • Insights Into Nuclear G-Protein-Coupled Receptors As Therapeutic Targets in Non-Communicable Diseases
    pharmaceuticals Review Insights into Nuclear G-Protein-Coupled Receptors as Therapeutic Targets in Non-Communicable Diseases Salomé Gonçalves-Monteiro 1,2, Rita Ribeiro-Oliveira 1,2, Maria Sofia Vieira-Rocha 1,2, Martin Vojtek 1,2 , Joana B. Sousa 1,2,* and Carmen Diniz 1,2,* 1 Laboratory of Pharmacology, Department of Drug Sciences, Faculty of Pharmacy, University of Porto, 4050-313 Porto, Portugal; [email protected] (S.G.-M.); [email protected] (R.R.-O.); [email protected] (M.S.V.-R.); [email protected] (M.V.) 2 LAQV/REQUIMTE, Faculty of Pharmacy, University of Porto, 4050-313 Porto, Portugal * Correspondence: [email protected] (J.B.S.); [email protected] (C.D.) Abstract: G-protein-coupled receptors (GPCRs) comprise a large protein superfamily divided into six classes, rhodopsin-like (A), secretin receptor family (B), metabotropic glutamate (C), fungal mating pheromone receptors (D), cyclic AMP receptors (E) and frizzled (F). Until recently, GPCRs signaling was thought to emanate exclusively from the plasma membrane as a response to extracellular stimuli but several studies have challenged this view demonstrating that GPCRs can be present in intracellular localizations, including in the nuclei. A renewed interest in GPCR receptors’ superfamily emerged and intensive research occurred over recent decades, particularly regarding class A GPCRs, but some class B and C have also been explored. Nuclear GPCRs proved to be functional and capable of triggering identical and/or distinct signaling pathways associated with their counterparts on the cell surface bringing new insights into the relevance of nuclear GPCRs and highlighting the Citation: Gonçalves-Monteiro, S.; nucleus as an autonomous signaling organelle (triggered by GPCRs).
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]
  • Multi-Functionality of Proteins Involved in GPCR and G Protein Signaling: Making Sense of Structure–Function Continuum with In
    Cellular and Molecular Life Sciences (2019) 76:4461–4492 https://doi.org/10.1007/s00018-019-03276-1 Cellular andMolecular Life Sciences REVIEW Multi‑functionality of proteins involved in GPCR and G protein signaling: making sense of structure–function continuum with intrinsic disorder‑based proteoforms Alexander V. Fonin1 · April L. Darling2 · Irina M. Kuznetsova1 · Konstantin K. Turoverov1,3 · Vladimir N. Uversky2,4 Received: 5 August 2019 / Revised: 5 August 2019 / Accepted: 12 August 2019 / Published online: 19 August 2019 © Springer Nature Switzerland AG 2019 Abstract GPCR–G protein signaling system recognizes a multitude of extracellular ligands and triggers a variety of intracellular signal- ing cascades in response. In humans, this system includes more than 800 various GPCRs and a large set of heterotrimeric G proteins. Complexity of this system goes far beyond a multitude of pair-wise ligand–GPCR and GPCR–G protein interactions. In fact, one GPCR can recognize more than one extracellular signal and interact with more than one G protein. Furthermore, one ligand can activate more than one GPCR, and multiple GPCRs can couple to the same G protein. This defnes an intricate multifunctionality of this important signaling system. Here, we show that the multifunctionality of GPCR–G protein system represents an illustrative example of the protein structure–function continuum, where structures of the involved proteins represent a complex mosaic of diferently folded regions (foldons, non-foldons, unfoldons, semi-foldons, and inducible foldons). The functionality of resulting highly dynamic conformational ensembles is fne-tuned by various post-translational modifcations and alternative splicing, and such ensembles can undergo dramatic changes at interaction with their specifc partners.
    [Show full text]
  • Current Status of Radiopharmaceuticals for the Theranostics of Neuroendocrine Neoplasms
    Review Current Status of Radiopharmaceuticals for the Theranostics of Neuroendocrine Neoplasms Melpomeni Fani 1,*, Petra Kolenc Peitl 2 and Irina Velikyan 3 1 Division of Radiopharmaceutical Chemistry, University Hospital of Basel, 4031 Basel, Switzerland; [email protected] 2 Department of Nuclear Medicine, University Medical Centre Ljubljana, 1000 Ljubljana, Slovenia; [email protected] 3 Department of Medicinal Chemistry, Uppsala University, 751 23 Uppsala, Sweden; [email protected] * Correspondence: [email protected]; Tel.: +41-61-556-58-91; Fax: +41-61-265-49-25 Academic Editor: Klaus Kopka Received: 7 February 2017; Accepted: 9 March 2017; Published: 15 March 2017 Abstract: Nuclear medicine plays a pivotal role in the management of patients affected by neuroendocrine neoplasms (NENs). Radiolabeled somatostatin receptor analogs are by far the most advanced radiopharmaceuticals for diagnosis and therapy (radiotheranostics) of NENs. Their clinical success emerged receptor-targeted radiolabeled peptides as an important class of radiopharmaceuticals and it paved the way for the investigation of other radioligand-receptor systems. Besides the somatostatin receptors (sstr), other receptors have also been linked to NENs and quite a number of potential radiolabeled peptides have been derived from them. The Glucagon- Like Peptide-1 Receptor (GLP-1R) is highly expressed in benign insulinomas, the Cholecystokinin 2 (CCK2)/Gastrin receptor is expressed in different NENs, in particular medullary thyroid cancer, and the Glucose-dependent Insulinotropic Polypeptide (GIP) receptor was found to be expressed in gastrointestinal and bronchial NENs, where interestingly, it is present in most of the sstr-negative and GLP-1R-negative NENs. Also in the field of sstr targeting new discoveries brought into light an alternative approach with the use of radiolabeled somatostatin receptor antagonists, instead of the clinically used agonists.
    [Show full text]
  • Family-B G-Protein-Coupled Receptors
    Edinburgh Research Explorer Family-B G-protein-coupled receptors Citation for published version: Harmar, AJ 2001, 'Family-B G-protein-coupled receptors', Genome Biology, vol. 2, no. 12, 3013.1, pp. -. https://doi.org/10.1186/gb-2001-2-12-reviews3013 Digital Object Identifier (DOI): 10.1186/gb-2001-2-12-reviews3013 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Genome Biology Publisher Rights Statement: © 2001 BioMed Central Ltd General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021 http://genomebiology.com/2001/2/12/reviews/3013.1 Protein family review Family-B G-protein-coupled receptors comment Anthony J Harmar Address: Department of Neuroscience, University of Edinburgh, 1 George Square, Edinburgh EH8 9JZ, UK. E-mail: [email protected] Published: 23 November 2001 Genome Biology 2001, 2(12):reviews3013.1–3013.10
    [Show full text]
  • Cell Signaling: Role of GPCR
    Available online a t www.scholarsresearchlibrary.com Scholars Research Library Archives of Applied Science Research, 2010, 2 (5):363-377 (http://scholarsresearchlibrary.com/archive.html) ISSN 0975-508X CODEN (USA) AASRC9 Cell signaling: Role of GPCR Anil Marasani 1*, Venu Talla 2, Jayapaul Reddy Gottemukkala 1, Deepthi Rudrapati 3 1Department of Pharmacology, St. Peter’s Institute of Pharmaceutical Sciences, Hanamkonda, A.P, India 2Department of Pharmacology, National Institute of Pharmaceutical Education and Research Hyderabad, A.P, India 3Department of Pharmacology, Sri Venkateswara University, Tirupati, A.P, India. ______________________________________________________________________________ ABSTRACT The control and mediation of the cell cycle is influenced by cell signals. Different types of cell signaling molecules: Proteins (growth factors), peptide hormones, amino acids, steroids, retenoids, fatty acid derivatives, and small gases can all act as signaling molecules. G- protein coupled receptors(GPCR) are heptahelical, serpentine receptors and are multi functional receptors having lot more clinical implications. Many reports have been clarified the basic mechanism of GPCR signal transduction, numerous laboratories have published on the clinical implication/application of GPCR. To name a few, dysfunction of GPCR signal pathway plays a role in cancer, autoimmunity, and diabetes. In this report, we will review the role of GPCR in cell signaling and impact of GPCR in clinical medicine, Key words: GPCR, Paracrine, Juxtacrine, Ligand binding, Oligomerisation, Translocation. ______________________________________________________________________________ INTRODUCTION Cell signaling is a complex system of communication, which controls and governs basic cellular activities and coordinates cell actions [1]. In biology point of view signal transduction refers to any process through which a cell converts one kind of signal or stimulus into another.
    [Show full text]
  • The Role of Gpcrs in Bone Diseases and Dysfunctions
    Bone Research www.nature.com/boneres REVIEW ARTICLE OPEN The role of GPCRs in bone diseases and dysfunctions Jian Luo 1, Peng Sun1,2, Stefan Siwko3, Mingyao Liu1,3 and Jianru Xiao4 The superfamily of G protein-coupled receptors (GPCRs) contains immense structural and functional diversity and mediates a myriad of biological processes upon activation by various extracellular signals. Critical roles of GPCRs have been established in bone development, remodeling, and disease. Multiple human GPCR mutations impair bone development or metabolism, resulting in osteopathologies. Here we summarize the disease phenotypes and dysfunctions caused by GPCR gene mutations in humans as well as by deletion in animals. To date, 92 receptors (5 glutamate family, 67 rhodopsin family, 5 adhesion, 4 frizzled/taste2 family, 5 secretin family, and 6 other 7TM receptors) have been associated with bone diseases and dysfunctions (36 in humans and 72 in animals). By analyzing data from these 92 GPCRs, we found that mutation or deletion of different individual GPCRs could induce similar bone diseases or dysfunctions, and the same individual GPCR mutation or deletion could induce different bone diseases or dysfunctions in different populations or animal models. Data from human diseases or dysfunctions identified 19 genes whose mutation was associated with human BMD: 9 genes each for human height and osteoporosis; 4 genes each for human osteoarthritis (OA) and fracture risk; and 2 genes each for adolescent idiopathic scoliosis (AIS), periodontitis, osteosarcoma growth, and tooth development. Reports from gene knockout animals found 40 GPCRs whose deficiency reduced bone mass, while deficiency of 22 GPCRs increased bone mass and BMD; deficiency of 8 GPCRs reduced body length, while 5 mice had reduced femur size upon GPCR deletion.
    [Show full text]
  • G Protein‐Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2019/20: G protein-coupled receptors. British Journal of Pharmacology (2019) 176, S21–S141 THE CONCISE GUIDE TO PHARMACOLOGY 2019/20: G protein-coupled receptors Stephen PH Alexander1 , Arthur Christopoulos2 , Anthony P Davenport3 , Eamonn Kelly4, Alistair Mathie5 , John A Peters6 , Emma L Veale5 ,JaneFArmstrong7 , Elena Faccenda7 ,SimonDHarding7 ,AdamJPawson7 , Joanna L Sharman7 , Christopher Southan7 , Jamie A Davies7 and CGTP Collaborators 1School of Life Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK 2Monash Institute of Pharmaceutical Sciences and Department of Pharmacology, Monash University, Parkville, Victoria 3052, Australia 3Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK 4School of Physiology, Pharmacology and Neuroscience, University of Bristol, Bristol, BS8 1TD, UK 5Medway School of Pharmacy, The Universities of Greenwich and Kent at Medway, Anson Building, Central Avenue, Chatham Maritime, Chatham, Kent, ME4 4TB, UK 6Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK 7Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2019/20 is the fourth in this series of biennial publications. The Concise Guide provides concise overviews of the key properties of nearly 1800 human drug targets with an emphasis on selective pharmacology (where available), plus links to the open access knowledgebase source of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. Although the Concise Guide represents approximately 400 pages, the material presented is substantially reduced compared to information and links presented on the website.
    [Show full text]
  • G-Protein Coupled Receptors: Structure and Function in Drug Discovery Cite This: RSC Adv., 2020, 10,36337 Chiemela S
    RSC Advances View Article Online REVIEW View Journal | View Issue G-Protein coupled receptors: structure and function in drug discovery Cite this: RSC Adv., 2020, 10,36337 Chiemela S. Odoemelam, a Benita Percival, a Helen Wallis,a Ming-Wei Chang,b Zeeshan Ahmad,c Dawn Scholey,a Emily Burton,a Ian H. Williams, d Caroline Lynn Kamerlin e and Philippe B. Wilson *a The G-protein coupled receptors (GPCRs) superfamily comprise similar proteins arranged into families or classes thus making it one of the largest in the mammalian genome. GPCRs take part in many vital physiological functions making them targets for numerous novel drugs. GPCRs share some distinctive features, such as the seven transmembrane domains, they also differ in the number of conserved residues in their transmembrane domain. Here we provide an introductory and accessible review Received 20th July 2020 detailing the computational advances in GPCR pharmacology and drug discovery. An overview is Accepted 22nd September 2020 provided on family A-C GPCRs; their structural differences, GPCR signalling, allosteric binding and DOI: 10.1039/d0ra08003a cooperativity. The dielectric constant (relative permittivity) of proteins is also discussed in the context of Creative Commons Attribution-NonCommercial 3.0 Unported Licence. rsc.li/rsc-advances site-specific environmental effects. Background virtual screening as well as better off-target rationalisation.6 Recently, the Tikhonova group developed a computational The G-protein coupled receptor (GPCR) superfamily consists of protocol which combines concepts from statistical mechanics structurally similar proteins arranged into families (classes), and cheminformatics to explore the exibility of the bioamine and is one of the most abundant protein classes in the receptors as well as to identify the geometrical and physico- mammalian genome.1–5 GPCRs undertake a plethora of essen- chemical properties which characterise the conformational This article is licensed under a 13 tial physiological functions and are targets for numerous novel space of the bioamine family.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 8,354,378 B2 Kuliopulos Et Al
    USOO8354378B2 (12) United States Patent (10) Patent No.: US 8,354,378 B2 Kuliopulos et al. (45) Date of Patent: *Jan. 15, 2013 (54) GPROTEIN COUPLED RECEPTOR FOREIGN PATENT DOCUMENTS ANTAGONSTS AND METHODS OF AU T201010 3, 2007 ACTIVATING AND INHIBITING G PROTEIN AU 1257169 5/2007 COUPLED RECEPTORS USING THE SAME CA 2406839 A1 11 2001 EP 1278777 A2 1, 2003 JP 200353O875 10, 2003 (75) Inventors: Athan Kuliopulos, Winchester, MA WO WO-98.00538 A2 1, 1998 (US); Lidija Covic, Somerville, MA WO WO-98.34948 A1 8, 1998 WO WO-99.43711 A1 9, 1999 (US) WO WO-9962494 A2 12, 1999 WO WO-0181408 A2 11/2001 (73) Assignee: Tufts Medical Center, Inc., Boston, MA WO WO2006052723 A2 5, 2006 (US) OTHER PUBLICATIONS Notice: Subject to any disclaimer, the term of this (*) Anand-Srivastava et al., J. Biol. Chem., 271:19324-19329 (1996). patent is extended or adjusted under 35 Andrade-Gordon, et al., “Design, Synthesis, and Biological Charac U.S.C. 154(b) by 0 days. terization of a Peptide-Mimetic Antagonist for a Tethered-Ligand This patent is Subject to a terminal dis Receptor', Proc. Natl. Acad. Sci. U.S.A., 96(22J: 12257-12262 claimer. (1999). Aoki et al., “A novel human G-protein-coupled receptor, EDG7, for lysophosphatidic acid with unsaturated fatty-acid moiety'. Annals of (21) Appl. No.: 12/394,715 the New York Academy of Sciences. Lysophospholipids and Eicosanoids in Biology and Pathophysiologi, pp. 263-266 (2000). Bernatowicz et al., “Development of Potent Thrombin Receptor (22) Filed: Feb. 27, 2009 Antagonist Peptides”, J.
    [Show full text]
  • 2.4. Microarray Experiments
    https://theses.gla.ac.uk/ Theses Digitisation: https://www.gla.ac.uk/myglasgow/research/enlighten/theses/digitisation/ This is a digitised version of the original print thesis. Copyright and moral rights for this work are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This work cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Enlighten: Theses https://theses.gla.ac.uk/ [email protected] University of Glasgow Identification of gene markers for in vitro toxicity control testing of pertussis vaccines Noela Moncassin BSc Hons, MSc A thesis submitted to the University of Glasgow for the degree of Master of Science Division of Bacteriology and Immunology National Institute for Biological Standards and Control Division of Infection and Immunity, Institute of Biomedical and Life Sciences, University of Glasgow May 2005 __ ProQuest Number: 10390729 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest ProQuest 10390729 Published by ProQuest LLO (2017).
    [Show full text]
  • United States Patent (10) Patent No.: US 8.440,627 B2 Kuliopulos Et Al
    USOO844.0627B2 (12) United States Patent (10) Patent No.: US 8.440,627 B2 Kuliopulos et al. (45) Date of Patent: May 14, 2013 (54) GPROTEIN COUPLED RECEPTOR CA 2586344 A1 5, 2006 AGONSTS AND ANTAGONSTS AND ES 101st A2 1392 METHODS OF USE JP 2008519039 T 6, 2008 WO WO 98.00538 1, 1998 (75) Inventors: Athan Kuliopulos, Winchester, MA WO WO 98,34948 8, 1998 (US); Lidija Covic, Lexington, MA WO WO99.437.11 9, 1999 (US); Nicole Kaneider, Innsbruck (AT) WO WO99/62494 12/1999 WO 200181408 A2 11/2001 (73) Assignee: t Medical Center, Inc., Boston, MA W. Wiggs A. 1 558 OTHER PUBLICATIONS (*) Notice: Subject to any disclaimer, the term of this Loetscher et al., Journal of Biological Chemistry, 269:232-237. patent is extended or adjusted under 35 1994.* U.S.C. 154(b) by 0 days. Anand-Srivastava et al., "Cytoplasmic domain of natriuretic peptide receptor-C inhibits adenylyn cyclase'. J. Biol. Chem. (21) Appl. No.: 11/667,042 271 (32):19324-19329 (1996). Andrade-Gordon et al., “Design, Synthesis, and Biological Charac (22) PCT Filed: Nov. 4, 2005 terization of a Peptide-Mimetic Antagonist for a Tethered-Ligand Receptor', Proc. Natl. Acad. Sci. USA, 96(22): 12257-12262 (1999). Aoki et al., “A novel human G-protein-coupled receptor, EDG7, for (86) PCT NO.: PCT/US2005/039959 lysophosphatidic acid with unsaturated fatty-acid moiety'. Annals New York Academy of Sciences. Lysophospholipids and Eicosanoids S371 (c)(1), in Biology and Pathophysiologi, pp. 263-266 (2000). (2), (4) Date: Jan. 15, 2008 Bernatowicz et al., “Development of Potent Thrombin Receptor Antagonist Peptides”, J.
    [Show full text]