Autocrine and Paracrine Regulation of Keratinocyte Proliferation Through a Novel Nrf2–IL-36Γ Pathway

Autocrine and Paracrine Regulation of Keratinocyte Proliferation through a Novel Nrf2−IL-36γ Pathway

This information is current as Svitlana Kurinna, Sukalp Muzumdar, Ulrike Anne Köhler, of October 1, 2021. Tobias Kockmann, Ulrich auf dem Keller, Matthias Schäfer and Sabine Werner J Immunol 2016; 196:4663-4670; Prepublished online 25 April 2016; doi: 10.4049/jimmunol.1501447 http://www.jimmunol.org/content/196/11/4663 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2016/04/23/jimmunol.150144

Material 7.DCSupplemental http://www.jimmunol.org/ References This article cites 37 articles, 16 of which you can access for free at: http://www.jimmunol.org/content/196/11/4663.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on October 1, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Autocrine and Paracrine Regulation of Keratinocyte Proliferation through a Novel Nrf2–IL-36g Pathway

Svitlana Kurinna,*,1 Sukalp Muzumdar,*,1 Ulrike Anne Ko¨hler,* Tobias Kockmann,*,† Ulrich auf dem Keller,* Matthias Scha¨fer,* and Sabine Werner*

The Nrf2 transcription factor is well known for its cytoprotective functions through regulation of genes involved in the detoxification of reactive oxygen species or toxic compounds. Therefore, activation of Nrf2 is a promising strategy for the protection of tissues from various types of insults and for cancer prevention. However, recent studies revealed a proinflammatory activity of activated Nrf2 and a stimulating effect on epithelial cell proliferation, but the underlying mechanisms of action and the responsible target genes are largely unknown. Using a combination of gene expression profiling, chromatin immunoprecipitation, and targeted proteomics via selected reaction monitoring, we show that the gene encoding the proinflammatory cytokine IL-36g is a novel direct target of Nrf2 in keratinocytes and hepatocytes in vitro and in vivo. As a consequence, upregulation of IL-36g expression occurred upon genetic Downloaded from or pharmacological activation of Nrf2 in the epidermis and in the normal and regenerating liver. Functional in vitro studies demonstrate that IL-36g directly stimulates proliferation of keratinocytes. In particular, it induces expression of keratinocyte mitogens in fibroblasts, suggesting that the Nrf2–IL-36g axis promotes keratinocyte proliferation through a double paracrine loop. These results provide mechanistic insight into Nrf2 action in the control of inflammation and cell proliferation through regulation of a proinflammatory cytokine with a key function in various inflammatory diseases. The Journal of Immunology, 2016, 196: 4663–4670.

he transcription factor NF erythroid derived 2, like 2 (Nrf2) in response to ROS directly, the Nrf2–Keap1 interaction is weak- http://www.jimmunol.org/ is a master regulator of the cellular stress response through ened, leading to stabilization of Nrf2 and translocation of newly T the activation of genes involved in the detoxiﬁcation of synthesized Nrf2 protein to the nucleus (2). This enhances expres- various compounds and of reactive oxygen species (ROS) (1). This sion of Nrf2 target genes and initiates a cytoprotective response. important function is reﬂected by the phenotype of Nrf2-knockout Therefore, Nrf2-activating compounds are in preclinical and clinical (Nrf2ko) mice, which are highly susceptible to treatment with dif- studies for protection from neurodegenerative disease and for cancer ferent toxins and to cancer development in various tissues and organs prevention (2). (2). Under homeostatic conditions, Nrf2 is retained in the cytoplasm However, recent studies uncovered severe negative effects of ex-

through binding to the inhibitory protein kelch-like ECH-associated cessive Nrf2 activation. In particular, NRF2-activating mutations or by guest on October 1, 2021 protein 1 (Keap1), which also mediates its ubiquitination and sub- KEAP1-inactivating mutations are a hallmark of different malignan- sequent proteasomal degradation. However, this inhibition is not cies. This causes enhanced drug resistance, increased survival under complete, and low amounts of Nrf2 can translocate to the nucleus stress conditions, and hyperproliferation of the tumor cells as a result and bind to antioxidant response elements (AREs) in promoter or of an increased abundance of multidrug-resistance proteins, ROS- enhancer regions, resulting in a basal expression of most Nrf2 target detoxifying enzymes, and metabolic enzymes (2, 3). Recent studies genes. In response to electrophiles and under certain circumstances from our laboratory also demonstrated that chronic activation of Nrf2 in keratinocytes causes hyperkeratosis, epidermal thickening due to keratinocyte hyperproliferation, cutaneous inflammation, and sebo- *Department of Biology, Institute of Molecular Health Sciences, Swiss Federal Insti- cyte hyperplasia (4–6). Therefore, we searched for soluble mediators tute of Technology (ETH) Zurich, 8093 Zurich, Switzerland; and †Functional Geno- mics Center Zurich, Swiss Federal Institute of Technology (ETH) Zurich/University of that are controlled by Nrf2 and may affect cell proliferation and/or Zurich, 8057 Zurich, Switzerland inflammation. We identified IL-36g (formerly designated IL-1 family 1S.K. and S.M. contributed equally to this work. member 9 [IL-1f9]) as a novel direct target of Nrf2 and show the Received for publication June 26, 2015. Accepted for publication March 24, 2016. importance of its regulation for keratinocyte growth control. This work was supported by the Swiss National Science Foundation (Grant 310030- 142884 to S.W.) and by the Gebert-Ruf€ Foundation (Grant GRS-052/13 to S.W. and Materials and Methods M.S.). Animal experiments Address correspondence and reprint requests to Dr. Sabine Werner and Dr. Matthias Scha¨fer, Institute of Molecular Health Sciences, Swiss Federal Institute of Technology Animal maintenance and experiments with animals were approved by the (ETH) Zurich,€ Otto-Stern-Weg 7, 8093 Zurich,€ Switzerland. E-mail addresses: sabine. local veterinary authorities of Zurich. K5cre-caNrf2 mice, K5cre-CMVcaNrf2 [email protected] (S.W.) and [email protected] (M.S.) mice, and Albcre-caNrf2 mice (C57BL/6/FVB F1 genetic background), as The online version of this article contains supplemental material. well as Nrf2ko mice (C57BL/6 genetic background) or mice expressing a Abbreviations used in this article: ARE, antioxidant response element; caNrf2, consti- dominant-negative Nrf2 mutant in keratinocytes (K14-dnNrf2 mice; FVB tutively active Nrf2 mutant; ChIP, chromatin immunoprecipitation; H3K4me1, H3 genetic background) were described previously (4, 5, 7–9). Two thirds (par- monomethyl Lys4; Keap1, kelch-like ECH-associated protein 1; MEF, mouse embry- tial) hepatectomy was performed as previously described (10). The regener- onic fibroblast; MIK, murine immortalized keratinocyte; MPK, murine primary kerati- ating liver was removed at different time points after partial hepatectomy nocyte; Nqo1, NAD(P)H dehydrogenase, quinone 1; Nrf2, NF erythroid derived 2, like (PH). The liver tissue resected during PH was considered the 0-h time point. 2; PH, partial hepatectomy; qRT-PCR, quantitative RT-PCR; ROS, reactive oxygen species; SRM, selected reaction monitoring; tBHQ, tert-butylhydroquinone; tg, trans- Cell culture genic; TPA, 12-O-tetradecanoylphorbol-13-acetate; wt, wild-type. Murine primary keratinocytes (MPKs) were isolated from newborn mice, as Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 previously described (4). MPKs and murine immortalized keratinocytes www.jimmunol.org/cgi/doi/10.4049/jimmunol.1501447 4664 REGULATION OF IL-36g BY Nrf2

(MIKs) were cultured in defined keratinocyte-serum free medium (Life Tech- Uniprot reference proteome using the Mascot search engine (Matrix Science) nologies, Zug, Switzerland). Mouse embryonic fibroblasts (MEFs) and HaCaT and the following search parameters: tryptic enzyme specificity and zero cells were cultured in DMEM supplemented with penicillin/streptomycin and missed cleavages; fixed modifications: carbamidomethyl cysteine; variable 10% FCS. They were treated with 50 or 500 mM tert-butylhydroquinone modifications: methionine oxidation; 20-ppm peptide tolerance; 0.5-Da tan- (tBHQ; Sigma, Buchs, Switzerland) for 1, 6, 12 or 24 h or with 5.8 nM mu- dem mass spectrometry tolerance. Mascot search results were converted to a rine truncated rIL-36g or rIL-36a (both from R&D Systems, Minneapolis, spectral library using the BiblioSpec implementation in Skyline (15). In ad- MN) for 6 h, according to the manufacturer’s instructions. dition, we converted empirical retention times into iRT scores following the procedure described by Escher et al. (16). For each target protein we selected BrdU labeling and immunofluorescence analysis three unique peptide precursors present in the spectral library and their most intense (top3) fragment ions from the y and b ion series. Fragment ions within BrdU labeling was performed by incubation of cultured cells in 100 mM a 5-Da window centered around the precursor mass were excluded. BrdU (Roche, Rotkreuz, Switzerland) for 2 h. Cells were fixed with 4% paraformaldehyde, and BrdU was detected by immunofluorescence anal- The preliminary assays were tested on a QTRAP 5500 operated in-line with ysis, as described previously (11). an Eksigent nanoLC Ultra 1D plus (both from AB Sciex) in scheduled SRM mode applying iRT calibration. Optimal collision energy and declustering RNA isolation and quantitative RT-PCR potential for each target were predicted by linear regression. Q1 and Q3 were operated at unit resolution during data acquisition. We separated peptides Total cellular RNA isolation, purification using the MinElute Kit (QIAGEN, using a linear gradient from 1 to 35% buffer B over 57.5 min at a constant Hilden, Germany), cDNA synthesis, and quantitative RT-PCR (qRT-PCR) flow rate of 300 nl/min. Buffer A: 0.1% formamide in water; Buffer B: 0.1% were described previously (6). Primers used are listed in Table I. formamide in acetonitrile. Separated peptides were electrosprayed into the mass spectrometer via a 10-mm inner-diameter spray tip (PicoTip emitter, Chromatin immunoprecipitation New Objective; MS Wil, Wil, Switzerland). The column was maintained at Chromatin immunoprecipitation (ChIP) was performed as previously de- 50˚C using a column heater (MS Wil). Fused silica columns (75 mminner 3 scribed (12). Chromatin was precleared with nonspecific IgG and incubated diameter 150 mm) were made in-house and packed with ReproSil-Pur Downloaded from overnight with Abs against Nrf2 (Santa Cruz Biotechnology, Santa Cruz, 1.9-mm C18 reverse-phase material (Dr. Maisch, Ammerbuch-Entringen, CA), histone H3 (Abcam, Cambridge, U.K.), histone H3 monomethyl Lys4 Germany). For protein quantification we chose the two assays resulting in (H3K4me1; Active Motif, Carlsbad, CA), or normal rabbit IgG (Millipore, the highest overall signal intensity. Billerica, MA). The percentage of the input that was bound was calculated IL-36g–specific SRM assays were developed by digesting 1 mg recombi- by the DCt method and averaged over at least three experiments. H3K4me1 nant protein (R&D Systems), followed by peptide cleanup and data-dependent occupancy was calculated as fold change over total histone H3 occupancy, analysis, as outlined above. For each IL-36g peptide detected in the shotgun and ChIP was repeated at least three times. analysis, we selected the most intense (top5) transitions from the y and b ion

series, again excluding a 5-Da window around the precursor mass. All selected http://www.jimmunol.org/ Protein extraction and quantification by label-free selected transitions were further tested in an unscheduled SRM experiment (fixed 20 ms reaction monitoring dwell time/transition). Based on SRM signal intensity, we selected the top three-ranked transitions/peptide to be included in the final assays. Epidermis was homogenized and sonicated in 8 M urea, 100 mM ammonium We quantified protein levels by scheduled SRM, monitoring a 5-min bicarbonate buffer containing complete protease inhibitors (Roche). Soluble window around the expected retention time, as predicted by iRT calibration. proteins were separated from insoluble material by two rounds of high-speed The mass spectrometry duty cycle was fixed at 3 s, taking care not to exceed centrifugation. Selected reaction monitoring (SRM) measurements were es- 150 concurrent transitions during data recording (thereby assuring a minimum sentially performed as described (13). For this purpose, 20 mg epidermal protein dwell time of 20 ms/transition and 7–10 data points across a typical chro- extract was reduced with 5 mM TCEP for 30 min and alkylated with 40 mM matographicpeak).InadditiontoIL-36g, NAD(P)H dehydrogenase quinone IAA at room temperature. Subsequently, the extract was adjusted to 6 M urea 1(Nqo1),andGsta3,wetargeted29housekeeping proteins showing no by adding 50 mM NH4CO3. For the primary digestion step, 0.2 mgLys-C differential abundance upon constitutively active Nrf2 mutant (caNrf2) by guest on October 1, 2021 (Wako Pure Chemicals, Osaka, Japan) was added (protein/Lys-C ratio = 100:1) overexpression, as analyzed by microarray analysis. To control correct peak and incubated for 4 h at 37˚C. After further diluting the extract to 1.5 M urea, group selection, we added one synthetic decoy transition for each target 0.5 mg trypsin (Promega, Madison, WI) was added (protein/trypsin ratio = transition (calculated by the random mass shift method). Peak group selection 50:1) and incubated at 37˚C overnight. Resulting peptides were desalted on and signal integration were done in Skyline after fitting an mProphet model C18 StageTips, as described (14). (17) to the acquired data. False-negative peak groups were inferred using the For SRM assay development, tryptic peptides were analyzed in data- data acquired for decoy transitions. We suppressed peak area integration for dependent analysis mode on a TripleTOF 5600 (AB Sciex, Concord, ON, peak groups with a q-value , 0.01, according to the fitted mProphet model. Canada) connected to a nano liquid chromatography system (Eksigent Finally, peak areas were exported to R for further statistical analysis using the NanoLC Ultra 1D plus; AB Sciex Switzerland GmbH, Zug, Switzerland). MSstats package (18). First, raw peak areas were normalized according to the Acquired fragment ion spectra were matched against the current mouse 29 housekeeping proteins serving as global standard proteins. We then tested

Table I. Murine and human qRT-PCR primers (59–39)

Gene Forward Primer Reverse Primer Murine Csf2 TCATTTTTGGCCTGGTTTTT TATTCGAGCAGGGTCTACGG Csf3 TGC ACT ATG GTC AGG ACG AG GGG GTG ACA CAG CTT GTA GG Gapdh AGGTCGGAGTCAACGGATT CTCCTGGAAGATGGTGATGG Gsta3 TACTTTGATGGCAGGGGAAG GCACTTGCTGGAACATCAGA Hgf TTTGCTTTAGGGATCAGTCTG GGCCTTGCAAGTGAAC Il1b GGACAGAATATCAACCAACAAGTG TGCTGATGTACCAGTTGGGG Il6 CCGGAGAGGAGACTTCACAG TTCTGCAAGTGCATCATCGT Il36a TGTGGATCCTGCAGAACAAT GCAGAACAGGCAGCTCATC Il36b GCCTGTCATTCTTAGCTTGAT TGTCTACTTCCTTAAGCTGC Il36g TCACGCTGACTGGGGTTACT TCCTGACTTTGGGGAGGTTTT Il36ra CATATCCCGCCGGTAGAAGG AGTGCCTATCTTGTGGGACAG Il1rl2 AAACACCUAGCAAAAGCCCAG AGACUGCCCGAUUUUCCUAUG Nrf2 CCAGCTACTCCCAGGTTGC CCAAACTTGCTCCATGTCCT Nqo1 CTGGCCCATTCAGAGAAGAC GTCTGCAGCTTCCAGCTTCT 18s rRNA CCAAGATCCAACTACGAGCTTTTT GATCCATTGGAGGGCAAGTCT Human NQO1 GTGATATTCCAGTTCCCCCTGC AAGCACTGCCTTCTTACTCCGG IL36G GGTCAGAACCTTGTGGCAGT CAAGAGCCTCTGGATACTTGC The Journal of Immunology 4665 for differential protein abundance by linear mixed-effect modeling (restricted In silico analysis of the Il36g gene promoter identified five AREs, of scope of biological replication). During fold-change estimation, missing which two (ARE1 and ARE2) are in close proximity to the puta- values were handled by imputation. tive transcriptional start site (Fig.1F).ChIPusinglysatesfromback Statistical analysis epidermis of (wt) mice and an Nrf2 Ab revealed modest binding of Nrf2 to ARE2 in the Il36g promoter and to an ARE in the Nqo1 Error bars represent SD. Statistical analysis was performed using the Mann–Whitney U test for non-Gaussian distribution. Significance analysis promoter but not to a nonspecific region in the Nqo1 promoter for SRM data was performed using MSstats (18). (Fig. 1G, white bars). However, the basal activity of Nrf2 did not contribute to Il36g expression under normal conditions, because no Results reduction in Il36g expression was observed in the epidermis of Nrf2ko mice and in MIKs of transgenic (tg) mice expressing a dominant- Nrf2 activation induces expression of Il36g in keratinocytes negative Nrf2 mutant (K14-dnNrf2) (9) (Supplemental Fig. 3D, 3E). in vivo and in vitro Consistent with the increased expression of Il36g in caNrf2-tg To identify Nrf2 target genes encoding soluble mediators that may mice, ChIP analysis using lysates from K5cre-CMVcaNrf2 mice affect cell proliferation and/or inflammation, we analyzed microarray revealed strong binding of Nrf2/caNrf2 to all three Il36g AREs and data obtained from skin of mice expressing low or high levels of caNrf2 to the Nqo1 ARE (Fig. 1G, black bars), and the increase in Nrf2 in keratinocytes (designated K5cre-caNrf2 and K5cre-CMVcaNrf2 binding compared with control mice was significant for all AREs. mice) (4, 5). The Affymetrix expression profiling was performed at Furthermore, ChIP analysis using an Ab against histone H3K4me1, postnatal day 2.5 before the hyperproliferative and inflammatory an epigenetic marker of active promoters (19), showed higher occu- phenotype had developed in these mice. Therefore, differentially pancy of H3K4me1 at ARE3 and ARE1 of the Il36g promoter in the expressed genes are likely to be direct Nrf2 targets. Interestingly, epidermis of K5cre-CMVcaNrf2 mice compared with control mice Downloaded from mRNA levels of IL-36g, a proinflammatory cytokine of the IL-36 (Fig. 1H). The difference in enrichment of H3K4me1 at the Il36g family, were increased in the skin of both mouse lines (Table II). qRT- AREs did not reach statistical significance in K5cre-CMVcaNrf2 PCR confirmed a mild, but nonsignificant, upregulation of Il36g in mice because of the high levels of H3K4me1 in the upstream re- isolated epidermis of adult K5cre-caNrf2 mice and a strong and gion of the Il36g gene. Nevertheless, this finding strongly suggests statistically significant upregulation in K5cre-CMVaNrf2 mice, which that binding of caNrf2 to the AREs of the Il36g promoter/enhancer correlated with increased expression of the classic Nrf2 target genes region activates expression of this gene. http://www.jimmunol.org/ Nqo1 and Gsta3 (Fig. 1A, 1B). To validate the Nrf2-dependent increase in abundance of IL-36g on the protein level, we established Nrf2 activation induces Il36a expression indirectly specific SRM assays using recombinant mouse IL-36g. These assays Expression of another member of the IL-36 family, Il36a, was target eight IL-36g peptides, thereby covering 62% of its primary mildly and nonsignificantly increased in the epidermis of mice with amino acid sequence (Supplemental Fig. 1). Applying these assays in low caNrf2 expression levels. This increase was statistically signif- parallel with SRM assays established for two classic Nrf2 targets, icant in the mice with strong caNrf2 expression and correlated with Gsta3 and Nqo1, indicated a significant and almost 10-fold higher increased expression of Il36g, Nqo1,andGsta3. In contrast, Il36b IL-36g protein level in the epidermis of adult K5cre-CMVcaNrf2 expression was not regulated, and Il36ra and Il36r mRNA levels mice compared with control animals (Fig. 1C, Supplemental Fig. 2). were even mildly reduced compared with control mice (Fig. 2A, by guest on October 1, 2021 Pharmacological activation of endogenous Nrf2 by treatment of MIKs 2B). The upregulation of Il36a in caNrf2-tg mice is most likely with tBHQ or MPKs with sulforaphane also increased the expres- indirect, because treatment of MIKs with tBHQ induced the ex- sion of Il36g and Nqo1 (Fig.1D,SupplementalFig.3A–C).Asimilar pression of this gene only slightly (Fig. 2C), whereas expression of effect was seen upon treatment of human HaCaT keratinocytes with Il36g was strongly upregulated under the same conditions (Fig. 1D). tBHQ, demonstrating that IL36G regulation by activated NRF2 is To determine whether the increase in Il36a in K5cre-CMVcaNrf2– conserved between mice and humans (Fig. 1E). tg mice is the consequence of the inflammation that develops in their

Table II. Microarray analysis of RNA from skin of K5cre-caNrf2 and K5cre-CMVcaNrf2 mice at postnatal day 2.5

K5cre-caNrf2 Mice K5cre-CMVcaNrf2 Mice

Mean Ratio Mean Ratio Abbreviation Gene Name Alternative Abbreviation (Fold Change) Mean p Value (Fold Change) Mean p Value IL-1 family Il1a IL-1 a 1.119 0.1647 1.15 1.15 Il1b IL-1 b 0.1647 0.0980 1.296 0.0309 Il1ra IL-1R antagonist N.A. N.A. N.A. N.A. Il18 IL-18 1.036 0.6613 1.031 0.1357 Il1f5 IL-1 family, member 5 Il36ra 0.9774 0.411 1.104 0.0487 Il1f6 IL-1 family, member 6 Il36a 1.035 0.705 0.8502 0.0458 Il1f7 IL-1 family, member 7 N.A. N.A. N.A. N.A. Il1f8 IL-1 family, member 8 Il36b 0.9675 0.687 1.501 1.90E204 Il1f9 IL-1 family, member 9 Il36g 1.948 4.47E205 4.396 1.01E205 Il1f10 IL-1 family, member 10 1.041 0.648 0.9071 0.9071 Il1f11 IL-1 family, member 11 N.A. N.A. N.A. N.A. IL-1R family Il1rl1 IL-1R–like 1 1.002 0.9392 0.9444 0.2302 Il1rl2 IL-1R–like 2 Il36R 1.102 0.2466 0.6592 0.0104 Il1rap IL-1R accessory protein 1.057 0.2202 1.03 0.4624 Mean ratio (fold change) and p value of genes of the IL-1 family and the IL-1R family, as analyzed by microarray analysis. N.A., not assigned. 4666 REGULATION OF IL-36g BY Nrf2 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 1. Nrf2 activation in keratinocytes induces expression of IL-36g. qRT-PCR for Il36g, Nqo1,andGsta3 relative to Gapdh using epidermal RNA from K5cre control (tg/wt) and K5cre-caNrf2–tg (tg/tg) mice (n = 4–6) (A)orK5cremice(tg/wt)andK5cre-CMVcaNrf2 (tg/tg) mice (n =6)(B)attheageof8wk.**p = 0.0095 (Nqo1), *p = 0.0361 (Gsta3)(A). **p = 0.0022 (Nqo1), **p = 0.0043 (Il36g, Gsta3)(B). (C) Relative protein abundance of IL-36g, Nqo1, and Gsta3 in the epidermis of adult K5cre-CMVcaNrf2 mice. Bar graph depicts protein level changes relative to control animals, as measured by SRM (n = 3). ***p , 0.0001. (D) qRT-PCR for Il36g using RNAs from MIKs of wt mice treated with vehicle or 50 mMtBHQ(n = 5–6). **p = 0.0022. (E) qRT-PCR for IL36G using RNAs from HaCaT keratinocytes treated with vehicle or 500 mMtBHQ(n =6).**p = 0.0043. (F)LocationofAREsinthe59-untranslated region of the mouse Il36g gene. Arrow indicates transcription start site. (G) ChIP showing binding of Nrf2/caNrf2 to ARE1–3 of the Il36g gene [shown in gray in (F)]andtoanAREintheNqo1 gene in the epidermis of K5cre mice (tg/wt) and K5cre-CMVcaNrf2 mice (tg/tg). Primers spanning a nonspeciﬁc (ns) region located 2 kb away from the ARE ofthe Nqo1 gene were used as negative control (n =4).* p = 0.0294 (Il36g ARE3, ARE2), *p = 0.0286 (Il36g ARE1, Nqo1 ARE). (H) ChIP using an H3K4me1 Ab and epidermal lysates from K5Cre (tg/wt) and K5Cre-CMVcaNrf2 mice (tg/tg) (n = 3–4). Mean values of control samples were set to 1 in all experiments. skin (4), we topically treated control and K5cre-caNrf2 mice, once a (Fig. 2I). This regulation is likely to be Nrf2 independent, because week for 3 wk, with the phorbol ester 12-O-tetradecanoylphorbol- IL-36a and IL-36g did not affect the expression of Nrf2 or its targets 13-acetate (TPA) and analyzed expression of IL-36 family members Nqo1 and Gsta3 (Supplemental Fig. 3F, 3G). 24 h after the last treatment. Concomitant with the strong inﬂam- Taken together, these results demonstrate that Nrf2 activation matory response, there was a dramatic increase in Il1b and Il36a directly induces Il36g expression, which, in turn, induces ex- expression, whereas the effect of TPA on Il36g expression was neg- pression of Il36a in keratinocytes. IL-36a and IL-36g have auto- ligible (Fig. 2D–G). Even under these conditions, Il36a was mildly and cross-regulatory functions and, thereby, promote their own upregulated in K5cre-caNrf2 mice, concomitant with a strong in- and each other’s expression (Fig. 2J). crease in Il36g and Nqo1 (Fig. 2D–G). This coregulation suggested that IL-36g induces expression of Il36a. Indeed, treatment of murine IL-36g induces keratinocyte proliferation in an autocrine and keratinocytes with rIL-36g protein resulted in upregulation of Il36a, paracrine manner as well as of Il36g itself (Fig. 2H). Treatment of murine keratino- To determine whether the increase in Il36a and Il36g expression in cytes with IL-36a also induced the expression of Il36a and Il36g response to Nrf2 activation is functionally relevant, we treated MIKs The Journal of Immunology 4667

FIGURE 2. Nrf2 activation in keratinocytes induces expression of IL- 36a indirectly. qRT-PCR for Il36a, Il36b, Il36ra,andIl36r relative to Gapdh using epidermal RNA from K5cre (tg/wt) and K5cre-caNrf2 (tg/tg) mice (A) or K5cre (tg/wt) and K5cre- CMVcaNrf2 (tg/tg) mice (B)atthe age of 8 wk (n = 4–6). **p = 0.0087. (C) Expression of the same genes in MIKs from wt mice treated with vehicle or 50 mM tBHQ. (D–G) qRT-PCR for Il1b, Il36a, Il36g, and Nqo1 relative to Gapdh using epidermal RNA from control (tg/wt) and K5cre-caNrf2 (tg/tg) mice (both untreated or treated three times with

TPA) at the age of 8 wk (n = 4–6). Downloaded from **p = 0.0095 (Il1b, Nqo1 untr.), **p =0.0022(Nqo1 33TPA). (H) qRT-PCR for Il36a, Il36b, Il36g, Il36ra,andIl36r using RNA from MIKs treated with vehicle or 5.8 nM IL-36g (n =4).**p =0.0294 (Il36a), **p =0.0286(Il36g). (I) http://www.jimmunol.org/ qRT-PCR for Il36a and Il36g using epidermal RNA from MIKs treated with vehicle or 5.8 nM IL-36a (–n =4 6). **p = 0.0095 (Il36a), **p =0.0022 (Il36g). (J) Working model showing the regulation network of Nrf2, IL- 36g, and IL-36a in keratinocytes. Mean values of control samples were

set to 1. by guest on October 1, 2021

from wt mice with IL-36a or IL-36g. Surprisingly, IL-36g stimulated analyzed expression of Il36g in mouse liver after PH. qRT-PCR proliferation of these cells, as revealed by incorporation of BrdU, analysis revealed an increase in Il36g expression at 6, 24, and whereas IL-36a had no effect (Fig. 3A–C). Nevertheless, cultured 48 h after PH when the inflammation, followed by the peak of he- keratinocytes from K5cre-CMVcaNrf2 mice proliferate normally (4). patocyte proliferation, reaches its maximum (21) (Fig. 4A). Binding Therefore, the IL-36g that is produced in response to Nrf2 activation of endogenous Nrf2 to ARE1 and ARE2 of the Il36g promoter/ in keratinocytes is insufficient to cause hyperproliferation of these enhancer region was detected in the liver within 24 h after PH, cells, most likely as a result of the strong dilution of the cytokine in but not in noninjured liver (Fig. 4B), suggesting that Nrf2 contributes the culture medium and/or the inefficient secretion of this cytokine by to the increased expression of Il36g in the regenerating liver. This cultured keratinocytes, which only occurs in the presence of extra- coincided with an increase in binding of Nrf2 to the Nqo1 ARE cellular ATP (20). However, IL-36a and IL-36g may also stimulate (Fig.4B).However,Il36g expression was not affected in the injured keratinocyte proliferation indirectly in vivo via activation of fibro- liver of Nrf2ko mice compared with wt controls, suggesting that blasts. Thus, we previously demonstrated a strong upregulation of the other factors can compensate for the lack of Nrf2 in these mice and keratinocyte mitogens Hgf, Il6, Csf2,andCsf3 in the skin of K5cre- induce Il36g expression in the regenerating liver (Fig. 4C–E). In CMVcaNrf2 mice, which is most likely responsible for the increased contrast, caNrf2 expression in hepatocytes (Albcre-caNrf2 mice) (7) keratinocyte proliferation and consequent epidermal hyperthickening further promoted the expression of Il36g in normal and regenerating in these mice (4). Treatment of cultured MEFs with IL-36a or IL- liver, as revealed by microarray analysis (Supplemental Table I) and 36g indeed induced the expression of Il6, Csf3,andCsf2, but not Hgf qRT-PCR (Fig. 4F). These results demonstrate that Il36g is also a (Fig. 3D–G). These results suggest that Nrf2-mediated upregula- direct target of Nrf2 in hepatocytes and that activation of Nrf2 in the tion of IL-36g and the subsequent induction of IL-36a induce the liver promotes expression of this proinflammatory cytokine. expression of keratinocyte mitogens in fibroblasts, which, in turn, stimulate keratinocyte proliferation in a paracrine manner (Fig. 3H). Discussion We identified a major proinflammatory cytokine as a novel target of Il36g is a direct Nrf2 target gene in hepatocytes the Nrf2 transcription factor. Furthermore, our in vitro studies pro- Finally, we determined whether induction of Il36g expression is skin vide strong evidence of an important role for the Nrf2–IL-36g axis specific or a general feature of activated Nrf2. For this purpose, we in the control of keratinocyte proliferation through a direct effect of 4668 REGULATION OF IL-36g BY Nrf2 Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021

FIGURE 3. IL-36g stimulates keratinocyte proliferation in an autocrine and paracrine manner. (A) Immunofluorescence staining for BrdU (green) and propidium iodide (red) using MIKs treated with vehicle or IL-36g. Percentage of BrdU+ cells among all cells after treatment of MIKs with vehicle or 5.8 nM rIL-36g (B)or5.8 nM rIL-36a (C)(n = 4–12). *p = 0.0286. qRT-PCR of Hgf, Il6,andCsf3 using RNA from MEFs treated with vehicle or 5.8 nM IL-36g (D)or5.8nMIL-36a (E) (n = 4–6). *p = 0.0286, **p = 0.0022. (F and G)RT-PCRforCsf2 and Gapdh using the same RNA samples (n =4).(H) Working model showing the regulation of IL-36g and IL-36a by Nrf2 in keratinocytes and their effect on keratinocyte proliferation. Expression levels in control samples were set to 1. Scale bar (in A), 50 mm. the cytokine on keratinocytes and, in particular, through the induc- NRF2 occurs in different types of human cancers, which pro- tion of a double paracrine loop involving dermal fibroblasts. Evi- motes proliferation of cancer cells and their survival under dence of Nrf2-dependent regulation of IL-36g was provided at stress conditions (2). multiple levels by combining ChIP, mRNA profiling, and a newly The Nrf2-mediated upregulation of IL-36g and the subsequent established highly specific SRM assay panel that will be instru- increase in IL-36a expression observed in this study may well explain mental for reliable identification and quantification of this important some of these unexpected activities. IL-36 cytokines are overex- cytokine in future studies. Our findings shed new light onto the re- pressed in affected skin of patients with inflammatory skin diseases, cently identified proinflammatory and promitogenic functions of including atopic dermatitis and psoriasis (25–28). The functional Nrf2. These are of major medical importance, because Nrf2 acti- importance of this upregulation is supported by several recent find- vation is considered a powerful strategy for protection of different ings: IL-36g mediates the alarmin function of the antimicrobial tissues and organs from various insults and, in particular, for cancer peptide LL37, and it functions as an alarmin that signals pathogen prevention; however, evidence is emerging that activation of Nrf2 infections (20, 29); injection of IL-36a promotes myeloid cell infil- also has negative consequences. For example, genetic or pharma- tration and their activation in the skin (30); tg mice overexpressing cological activation of Nrf2 in keratinocytes caused skin inflam- IL-36a in keratinocytes develop a psoriasis-like phenotype (31); mation, hyperkeratosis, and sebaceous gland enlargement (4, 5). the psoriasiform dermatitis that develops in mice after treatment Furthermore, various NRF2-activating compounds are skin with imiquimod depends on an IL-36–mediated cross-talk between sensitizers (22, 23), and recent studies suggest that Nrf2 can dendritic cells and keratinocytes (32); and IL-36RA deficiency promote atherosclerosis in mice (24). Finally, activation of causes generalized pustular psoriasis in humans (33). Finally, a The Journal of Immunology 4669

FIGURE 4. Il36g is a direct Nrf2 target gene in the liver. (A)qRT-PCR of Il36g relative to 18s-rRNA using RNA from noninjured and injured (PH) liver of Alb-Cre control mice (n = 3–5). *p = 0.0159. (B)ChIP showing binding of Nrf2 to the AREs of the Il36g and Nqo1 gene promoters in normal liver of wt mice and 24 h after PH (n =2–4).*p = 0.0286. qRT- PCR for Il36g (C), Nqo1 (D), and Gsta3 (E) using RNA isolated from liver of wt or Nrf2ko mice (n = 2 pools of three mice/genotype). Values obtained for each pool are indicated (N).

(F)qRT-PCRofIl36g using RNA Downloaded from from noninjured and injured (PH) liver of Alb-Cre (tg/wt) [see also (A)] and Albcre-CMVcaNrf2 (tg/tg) mice (n = 3–5). Expression levels in noninjured liver of control mice were set to 1. **p = 0.0097, *p = 0.0159. http://www.jimmunol.org/

proinflammatory function of IL-36 cytokines in tissues other than Our results demonstrate that activation of Il36g expression is a the skin is emerging (34). rapid response to Nrf2 activation and likely contributes to the by guest on October 1, 2021 The potent proinflammatory activity of IL-36 cytokines also pro- effects of activated Nrf2 on inflammation and cell proliferation. vides a possible explanation for the increased proliferation of kera- Although this may be beneficial in response to tissue injury, it is tinocytes that occurs in response to these cytokines in vivo (30, 32, likely to promote chronic inflammation and may even contribute 35), because immune cells produce various keratinocyte mitogens to cancer development. Therefore, this new Nrf2–IL-36g axis (36). In addition, we show in this article that IL-36g directly stimu- needs to be considered when Nrf2-activating compounds are used lates keratinocyte proliferation. Most importantly, IL-36a and IL-36g pharmacologically in patients. In the future, genetic or pharma- induce expression of keratinocyte mitogens in fibroblasts, which are cological activation of Nrf2 in mice lacking IL-36R will unravel likely to promote keratinocyte proliferation in a paracrine manner. whether and to what extent the upregulation of IL-36g contributes Thus, our results strongly suggest that Nrf2 can mediate autocrine to the beneficial or detrimental in vivo activities of Nrf2. and paracrine growth control of keratinocytes in vivo via IL-36g. Nrf2-mediated upregulation of IL-36g also occurred in hepato- Acknowledgments cytes in vivo. This may contribute to liver regeneration, as suggested We thank Hayley Hiebert, Andreas Bapst, and Urs Wegmann (Swiss Federal by the upregulation of IL-36g after PH (this study) and in response to Institute of Technology [ETH] Zurich) for invaluable experimental help; Dr. treatment with acetaminophen, which also causes liver injury (37). Yuet Wai Kan (University of California San Francisco, San Francisco, CA) for Importantly, treatment of mice with IL-36ra impaired the regeneration Nrf2-knockout mice; Dr. Petra Boukamp (German Cancer Research Center, of the liver in this toxin-induced injury model, suggesting that IL-36 Heidelberg, Germany) for HaCaT cells; and Dr. Paul Hiebert and Beat directly or indirectly promotes proliferation of hepatocytes (37). Siegenthaler (Swiss Federal Institute of Technology [ETH] Zurich) for Our ChIP experiments revealed that Nrf2 binds to AREs in the Il36g MEFs and MIKs. S.M. is a member of the Ph.D. program in Molecular and Translational Biomedicine. gene promoter/enhancer region upon additional activation/stabilization of endogenous Nrf2 or expression of the caNrf2 mutant, resulting in activation of Il36g expression. In quiescent hepatocytes and in Disclosures keratinocytes, endogenous Nrf2 binding was below the level of de- The authors have no financial conflicts of interest. tection; however, a significant increase in Nrf2 binding to Il36g AREs occurred in wt mice in response to PH, and this was accompanied by References an increase in Il36g expression upon liver injury. These findings 1. Sykiotis, G. P., and D. Bohmann. 2010. Stress-activated cap’n’collar transcrip- strongly suggest that endogenous Nrf2 contributes to the expression tion factors in aging and human disease. Sci. Signal. 3: re3. 2. Sporn, M. B., and K. T. Liby. 2012. NRF2 and cancer: the good, the bad and the of Il36g in proliferating hepatocytes of wt mice; however, no dif- importance of context. Nat. Rev. Cancer 12: 564–571. ference was observed in the expression of Il36g in Nrf2ko mice, 3. Mitsuishi, Y., K. Taguchi, Y. Kawatani, T. Shibata, T. Nukiwa, H. Aburatani, M. Yamamoto, and H. Motohashi. 2012. Nrf2 redirects glucose and gluta- suggesting compensation by other transcription factors in Nrf2- mine into anabolic pathways in metabolic reprogramming. Cancer Cell 22: deficient mice, which also control expression of the Il36g gene. 66–79. 4670 REGULATION OF IL-36g BY Nrf2

4. Scha¨fer, M., H. Farwanah, A. H. Willrodt, A. J. Huebner, K. Sandhoff, D. Roop, 21. Michalopoulos, G. K., and M. C. DeFrances. 1997. Liver regeneration. Science D. Hohl, W. Bloch, and S. Werner. 2012. Nrf2 links epidermal barrier function 276: 60–66. with antioxidant defense. EMBO Mol. Med. 4: 364–379. 22. El Ali, Z., C. Gerbeix, P. Hemon, P. R. Esser, S. F. Martin, M. Pallardy, and 5. Scha¨fer, M., S. Dutsch,€ U. auf dem Keller, F. Navid, A. Schwarz, D. A. Johnson, S. Kerdine-Ro¨mer. 2013. Allergic skin inflammation induced by chemical sen- J. A. Johnson, and S. Werner. 2010. Nrf2 establishes a glutathione-mediated sitizers is controlled by the transcription factor Nrf2. Toxicol. Sci. 134: 39–48. gradient of UVB cytoprotection in the epidermis. Genes Dev. 24: 1045–1058. 23. Emter, R., J. W. van der Veen, G. Adamson, J. Ezendam, H. van Loveren, and 6. Scha¨fer, M., A. H. Willrodt, S. Kurinna, A. S. Link, H. Farwanah, A. Geusau, A. Natsch. 2013. Gene expression changes induced by skin sensitizers in the F. Gruber, O. Sorg, A. J. Huebner, D. R. Roop, et al. 2014. Activation of Nrf2 in KeratinoSens™ cell line: Discriminating Nrf2-dependent and Nrf2-independent keratinocytes causes chloracne (MADISH)-like skin disease in mice. EMBO events. Toxicol. In Vitro 27: 2225–2232. Mol. Med. 6: 442–457. 24. Harada, N., K. Ito, T. Hosoya, J. Mimura, A. Maruyama, N. Noguchi, 7. Ko¨hler, U. A., S. Kurinna, D. Schwitter, A. Marti, M. Scha¨fer, C. Hellerbrand, K. Yagami, N. Morito, S. Takahashi, J. M. Maher, et al. 2012. Nrf2 in bone T. Speicher, and S. Werner. 2014. Activated Nrf2 impairs liver regeneration in marrow-derived cells positively contributes to the advanced stage of athero- mice by activation of genes involved in cell-cycle control and apoptosis. Hep- sclerotic plaque formation. Free Radic. Biol. Med. 53: 2256–2262. atology 60: 670–678. 25. Johnston, A., X. Xing, A. M. Guzman, M. Riblett, C. M. Loyd, N. L. Ward, 8. Chan, K., R. Lu, J. C. Chang, and Y. W. Kan. 1996. NRF2, a member of the C. Wohn, E. P. Prens, F. Wang, L. E. Maier, et al. 2011. IL-1F5, -F6, -F8, and NFE2 family of transcription factors, is not essential for murine erythropoiesis, -F9: a novel IL-1 family signaling system that is active in psoriasis and promotes growth, and development. Proc. Natl. Acad. Sci. USA 93: 13943–13948. keratinocyte antimicrobial peptide expression. J. Immunol. 186: 2613–2622. 9. auf dem Keller, U., M. Huber, T. A. Beyer, A. Kumin,€ C. Siemes, S. Braun, 26. Sua´rez-Farinãs, M., B. Ungar, J. Correa da Rosa, D. A. Ewald, M. Rozenblit, P. Bugnon, V. Mitropoulos, D. A. Johnson, J. A. Johnson, et al. 2006. Nrf J. Gonzalez, H. Xu, X. Zheng, X. Peng, Y. D. Estrada, et al. 2015. RNA se- transcription factors in keratinocytes are essential for skin tumor prevention but quencing atopic dermatitis transcriptome profiling provides insights into novel not for wound healing. Mol. Cell. Biol. 26: 3773–3784. disease mechanisms with potential therapeutic implications. J. Allergy Clin. 10. Bo¨hm, F., T. Speicher, C. Hellerbrand, C. Dickson, J. M. Partanen, D. M. Ornitz, Immunol. 135: 1218–1227. and S. Werner. 2010. FGF receptors 1 and 2 control chemically induced injury 27. Quaranta, M., B. Knapp, N. Garzorz, M. Mattii, V. Pullabhatla, D. Pennino, and compound detoxification in regenerating livers of mice. Gastroenterology C. Andres, C. Traidl-Hoffmann, A. Cavani, F. J. Theis, et al. 2014. Intra- 139: 1385–1396. individual genome expression analysis reveals a specific molecular signature of 11. Rolfs, F., M. Huber, F. Gruber, F. Bo¨hm, H. J. Pfister, V. N. Bochkov, psoriasis and eczema. Sci. Transl. Med. 6: 244ra90. E. Tschachler, R. Dummer, D. Hohl, M. Scha¨fer, and S. Werner. 2013. Dual role 28. D’Erme, A. M., D. Wilsmann-Theis, J. Wagenpfeil, M. Ho¨lzel, S. Ferring- Downloaded from of the antioxidant enzyme peroxiredoxin 6 in skin carcinogenesis. Cancer Res. Schmitt, S. Sternberg, M. Wittmann, B. Peters, A. Bosio, T. Bieber, and 73: 3460–3469. J. Wenzel. 2015. IL-36g (IL-1F9) is a biomarker for psoriasis skin lesions. 12. Kurinna, S., M. Scha¨fer, P. Ostano, E. Karouzakis, G. Chiorino, W. Bloch, J. Invest. Dermatol. 135: 1025–1032. A. Bachmann, S. Gay, D. Garrod, K. Lefort, et al. 2014. A novel Nrf2-miR-29- 29. Li, N., K. Yamasaki, R. Saito, S. Fukushi-Takahashi, R. Shimada-Omori, desmocollin-2 axis regulates desmosome function in keratinocytes. Nat. Com- M. Asano, and S. Aiba. 2014. Alarmin function of cathelicidin antimicrobial mun. 5: 5099. peptide LL37 through IL-36g induction in human epidermal keratinocytes. 13. Sabino, F., O. Hermes, F. E. Egli, T. Kockmann, P. Schlage, P. Croizat, J. Immunol. 193: 5140–5148.

J. N. Kizhakkedathu, H. Smola, and U. auf dem Keller. 2015. In vivo assessment 30. Foster, A. M., J. Baliwag, C. S. Chen, A. M. Guzman, S. W. Stoll, http://www.jimmunol.org/ of protease dynamics in cutaneous wound healing by degradomics analysis of J. E. Gudjonsson, N. L. Ward, and A. Johnston. 2014. IL-36 promotes myeloid porcine wound exudates. Mol. Cell. Proteomics 14: 354–370. cell infiltration, activation, and inflammatory activity in skin. J. Immunol. 192: 14. Rappsilber, J., M. Mann, and Y. Ishihama. 2007. Protocol for micro-purification, 6053–6061. enrichment, pre-fractionation and storage of peptides for proteomics using 31. Blumberg, H., H. Dinh, E. S. Trueblood, J. Pretorius, D. Kugler, N. Weng, StageTips. Nat. Protoc. 2: 1896–1906. S. T. Kanaly, J. E. Towne, C. R. Willis, M. K. Kuechle, et al. 2007. Opposing 15. MacLean, B., D. M. Tomazela, N. Shulman, M. Chambers, G. L. Finney, activities of two novel members of the IL-1 ligand family regulate skin in- B. Frewen, R. Kern, D. L. Tabb, D. C. Liebler, and M. J. MacCoss. 2010. flammation. J. Exp. Med. 204: 2603–2614. Skyline: an open source document editor for creating and analyzing targeted 32. Tortola, L., E. Rosenwald, B. Abel, H. Blumberg, M. Scha¨fer, A. J. Coyle, proteomics experiments. Bioinformatics 26: 966–968. J. C. Renauld, S. Werner, J. Kisielow, and M. Kopf. 2012. Psoriasiform der- 16. Escher, C., L. Reiter, B. MacLean, R. Ossola, F. Herzog, J. Chilton, matitis is driven by IL-36-mediated DC-keratinocyte crosstalk. J. Clin. Invest. M. J. MacCoss, and O. Rinner. 2012. Using iRT, a normalized retention time for 122: 3965–3976.

more targeted measurement of peptides. Proteomics 12: 1111–1121. 33. Marrakchi, S., P. Guigue, B. R. Renshaw, A. Puel, X. Y. Pei, S. Fraitag, J. Zribi, by guest on October 1, 2021 17. Reiter, L., O. Rinner, P. Picotti, R. Huttenhain,€ M. Beck, M. Y. Brusniak, E. Bal, C. Cluzeau, M. Chrabieh, et al. 2011. Interleukin-36-receptor antagonist M. O. Hengartner, and R. Aebersold. 2011. mProphet: automated data pro- deﬁciency and generalized pustular psoriasis. N. Engl. J. Med. 365: 620–628. cessing and statistical validation for large-scale SRM experiments. Nat. Methods 34. Gabay, C., and J. E. Towne. 2015. Regulation and function of interleukin-36 8: 430–435. cytokines in homeostasis and pathological conditions. J. Leukoc. Biol. 97: 645– 18. Choi, M., C. Y. Chang, T. Clough, D. Broudy, T. Killeen, B. MacLean, and 652. O. Vitek. 2014. MSstats: an R package for statistical analysis of quantitative 35. Yang, J., M. Meyer, A. K. Muller,€ F. Bo¨hm, R. Grose, T. Dauwalder, F. Verrey, mass spectrometry-based proteomic experiments. Bioinformatics 30: 2524– M. Kopf, J. Partanen, W. Bloch, et al. 2010. Fibroblast growth factor receptors 1 2526. and 2 in keratinocytes control the epidermal barrier and cutaneous homeostasis. 19. Pekowska, A., T. Benoukraf, J. Zacarias-Cabeza, M. Belhocine, F. Koch, J. Cell Biol. 188: 935–952. H. Holota, J. Imbert, J. C. Andrau, P. Ferrier, and S. Spicuglia. 2011. H3K4 tri- 36. Werner, S., and R. Grose. 2003. Regulation of wound healing by growth factors methylation provides an epigenetic signature of active enhancers. EMBO J. 30: and cytokines. Physiol. Rev. 83: 835–870. 4198–4210. 37. Scheiermann, P., M. Bachmann, L. Ha¨rdle, T. Pleli, A. Piiper, B. Zwissler, 20. Lian, L. H., K. A. Milora, K. K. Manupipatpong, and L. E. Jensen. 2012. The J. Pfeilschifter, and H. Muhl.€ 2015. Application of IL-36 receptor antagonist double-stranded RNA analogue polyinosinic-polycytidylic acid induces kerati- weakens CCL20 expression and impairs recovery in the late phase of murine nocyte pyroptosis and release of IL-36g. J. Invest. Dermatol. 132: 1346–1353. acetaminophen-induced liver injury. Sci. Rep. 5: 8521. Supplementary Figures and Table

Supplementary Figure S1: Label-free protein quantification by selected reaction monitoring (SRM). Dotplots showing normalized, log2-transformed feature intensities over 6 mass spectrometry (MS) runs. In each run, tryptic peptides were analyzed on a QQQ MS in scheduled SRM mode. Peptides were derived from back skin epidermis of adult control and K5cre-CMVcaNrf2 mice. Each quantitative feature corresponds to an SRM transition as given by the figure legends. Transitions targeting identical peptides are given in the same color. (A,B) Transitions monitored for Il-36γ (A) and their corresponding sequence coverage (B). (C,D) Transitions monitored for Gsta3 (C) and Nqo1 (D). Missing data points indicate signals below limit of detection (see Supplementary Figure S2 for a representative example).

Supplementary Figure S2: Mass chromatograms for the doubly charged peptide GIAIYLGIQNPDK originating from IL-36γ. Each panel shows raw signal intensities recorded on a QQQ MS operated in scheduled SRM mode. The predicted RT of the transition group y7, y8, y9 is marked by a vertical grey bar. Vertical black bars indicate integration boundaries. The apex of the best scoring peak group is marked by a black arrowhead.

Supplementary Figure S3: Regulation of Il36g and classical Nrf2 target genes in vitro and in vivo. (A,B) qRT-PCR for Il36g using RNA from murine immortalized keratinocytes (MIKs) of wild-type mice treated for 24h with vehicle or 12.5µM, 25µM or 50µM tBHQ (A) or for 1h, 6h, 12h or 24h with vehicle or 50µM tBHQ (B). **P= 0.0022 (12.5, 25µM); **P= 0.0043 (50µM); N=6. (C) qRT-PCR for Il36g using RNA from murine primary keratinocytes (MPKs) of wild-type mice treated for 24h with vehicle or 5µM sulforaphane (SFN). **P= 0.0022, N=6. Mean values of control samples were set to 1. (D,E) qRT-PCR for Il36g, Nqo1 and Gsta3 using RNA isolated from epidermis of wild-type or Nrf2ko mice (D) or MIKs from wild-type or K14-dnNrf2 transgenic mice (E). N=4-5. (F,G) qRT-PCR for Nrf2, Nqo1 and Gsta3 using RNA isolated from MIKs from wt mice treated with Il-36γ or vehicle (F) or IL- 36α or vehicle (G).

3 Supplementary Table S1: Microarray analysis of RNA from liver of Albcre-caNrf2 and Albcre mice 0h and 24h after partial hepatectomy

AlbCre_caNrf2 > AlbCre AlbCre_caNrf2 > AlbCre Altern. mice 0h Phx mice 24h Phx Abbr. Gene name abbr. strongest strongest strongest strongest ratio pValue ratio pValue

Interleukin 1 family

Il1a Interleukin 1 alpha 0.85 0.09 1.65 0.02

Il1b Interleukin 1 beta 1.05 0.68 1.87 0.004 Interleukin1 receptor Il1ra N.A. N.A. N.A. N.A. antagonist Il18 Interleukin 18 0.77 0.0098 0.5 0.047 Interleukin 1 family, Il1f5 Il36ra N.D. N.D. N.D. N.D. member 5 Interleukin 1 family, Il1f6 Il36a N.D. N.D. N.D. N.D. member 6 Interleukin 1 family, Il1f7 N.A. N.A. N.A. N.A. member 7 Interleukin 1 family, Il1f8 Il36b N.D. N.D. N.D. N.D. member 8 Interleukin 1 family, Il1f9 Il36g 2.17 0.0034 76.6 0.00005 member 9 Interleukin 1 family, Il1f10 1.042 0.47 1.06 0.64 member 10 Interleukin 1 family, Il1f11 N.A. N.A. N.A. N.A. member 11

Interleukin 1 receptor family

Interleukin 1 Il1rl1 0.89 0.42 0.93 0.77 receptor-like 1 Interleukin 1 Il1rl2 Il36R N.D. N.D. 1.3 0.14 receptor-like 2 Interleukin 1 Il1rap receptor accessory 0.67 0.06 0.52 0.04 protein

Strongest ratio and pValue of genes of the interleukin 1 family and the interleukin 1 receptor family analyzed by microarray analysis using liver of Alb-caNrf2 compared to control mice, 0hrs and 24hrs after partial hepatectomy (PH). N.A.; not assigned, N.D.; not defined.