Identification of a Novel IL-1 Cytokine Family Member in Teleost Fish Tiehui Wang, Steve Bird, Antonis Koussounadis, Jason W. Holland, Allison Carrington, Jun Zou and Christopher J. This information is current as Secombes of September 25, 2021. J Immunol 2009; 183:962-974; Prepublished online 24 June 2009; doi: 10.4049/jimmunol.0802953

http://www.jimmunol.org/content/183/2/962 Downloaded from

References This article cites 66 articles, 10 of which you can access for free at: http://www.jimmunol.org/content/183/2/962.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Identification of a Novel IL-1 Cytokine Family Member in Teleost Fish1

Tiehui Wang,* Steve Bird,* Antonis Koussounadis,† Jason W. Holland,* Allison Carrington,* Jun Zou,* and Christopher J. Secombes2*

A novel IL-1 family member (nIL-1F) has been discovered in fish, adding a further member to this cytokine family. The unique gene organization of nIL-1F, together with its location in the genome and low homology to known family members, suggests that this molecule is not homologous to known IL-1F. Nevertheless, it contains a predicted C-terminal ␤-trefoil structure, an IL-1F signature region within the final exon, a potential IL-1 converting enzyme cut site, and its expression level is clearly increased following infection, or stimulation of macrophages with LPS or IL-1␤. A thrombin cut site is also present and may have functional relevance. The C-terminal recombinant protein antagonized the effects of rainbow trout rIL-1␤ on inflammatory gene expression in a trout macrophage cell line, suggesting it is an IL-1␤ antagonist. Modeling studies confirmed that nIL-1F has the potential to Downloaded from bind to the trout IL-1RI receptor protein, and may be a novel IL-1 receptor antagonist. The Journal of Immunology, 2009, 183: 962–974.

he IL-1 family (IL-1F)3 of cytokines is characterized by of transcription factors such as NF-␬B and MAPK-regulated tran- their common secondary structure of an all-␤ fold, the scription factors, leading to IL-1F-regulated gene transcription in T ␤-trefoil, which they have in common with another cyto- the target cells (1). http://www.jimmunol.org/ kine family, the fibroblast growth factors (1, 2). To date, 11 mem- Each of the pathways mentioned above has natural inhibitors bers of this family are known, with IL-1F1 (IL-1␣), 2 (IL-1␤), 4 that can down-regulate the elicited responses. In some cases the (IL-18), 6, 8, 9, and 11 (IL-33) all having agonist activity, and they inhibitor is an IL-1F that can act as a receptor antagonist, as with generally promote inflammatory and adaptive immune responses IL-1F3 (IL-1ra) for IL-1RI and IL-1F5 for IL-1Rrp2. IL-1F7, (3). In several cases these agonist IL-1F proteins are produced as which is another IL-1F that requires processing by ICE (9), is also inactive precursors that require cleavage by IL-1 converting en- an antagonist, in that it helps to reduce IL-1F4 activity by inter- zyme (ICE/caspase 1) to generate the biologically active mature acting with the IL-18 binding protein to form a complex that in- protein, as seen with IL-1F1, 4, and 11 (only in vitro in the latter hibits receptor signaling (10, 11). Additionally, soluble receptors by guest on September 25, 2021 case (3)). The proteins signal via a number of receptors, namely can be produced to prevent binding to the signaling receptor, as IL-1RI for IL-1F1 and 2, IL-18R for IL-1F4, IL-1Rrp2 for IL-1F6, with IL-1RII and soluble ST2, which in the latter case is a splice 8, and 9, and ST2 for IL-1F11 (5, 6). In each case an accessory variant of the signaling receptor transcript (12). The last member protein (AcP) is needed to join the ligand-receptor complex to of the IL-1F, IL-1F10, may also be involved in some form of allow a signal to be transduced, and the IL-1RAcP is used by regulation of IL-1F activity, and it binds to the soluble form of the IL-1R1, IL-1Rrp2, and ST2, whereas IL-18R uses the IL-18AcP IL-1RI, although the function of this is unknown. What is clear (3, 6, 7). Signaling, in common with the TLRs, requires recruit- from these complex inhibitory pathways is that IL-1F actions need ment of the adaptor molecule MyD88, which allows activation of to be tightly regulated, and in humans many disease states are the IL-1R-associated kinase (IRAK) (8) and ultimately activation known to be associated with their actions if their activity is not appropriately controlled (3). Most of the IL-1F are found on human chromosome 2 (q13–21) *Scottish Fish Immunology Research Centre, School of Biological Sciences, Uni- (13, 14), in the order IL-1F1, 2, 7, 9, 6, 8, 5, 10, 3, and this suggests † versity of Aberdeen, Aberdeen, United Kingdom; and Bioinformatics Group, that these genes have arisen by tandem gene duplication, with this Department of Computer Science, University College London, London, United Kingdom region of chromosome 2 considered a “hotspot for IL-1 gene du- Received for publication September 5, 2008. Accepted for publication May 4, 2009. plication” (15). The remaining IL-1F, IL-1F4 and IL-1F11, are The costs of publication of this article were defrayed in part by the payment of page found on chromosomes 11 and 9, respectively. Analysis of the charges. This article must therefore be hereby marked advertisement in accordance genomic structure of the genes shows that they all possess introns with 18 U.S.C. Section 1734 solely to indicate this fact. that lie in similar positions within the proteins they encode, again 1 This work was supported by the European Community with Contracts 513692 indicating they have arisen from a common ancestor. Since the (Aquafirst), Q5RS-2001-002211 (Stressgenes), and 007103 (Improved Immunity of Aquacultured Animals, IMAQUANIM). control of inflammatory events is likely to be ancient in origin, it 2 Address correspondence and reprint requests to Dr. Christopher J. Secombes, seems likely that some IL-1F members will be universally present Scottish Fish Immunology Research Centre, School of Biological Sciences, Uni- in vertebrates, although the possibility that independent duplica- versity of Aberdeen, Aberdeen AB24 2TZ, U.K. E-mail address: c.secombes@ abdn.ac.uk tion events may have given rise to unique IL-1F in particular ver- tebrate groups also exists. 3 Abbreviations used in this paper: IL-1F, IL-1 family; AcP, accessory protein; BLAST, basic local alignment search tool; CHO, Chinese hamster ovary; COX, Studies aimed at elucidating the cytokine network in fish cyclooxygenase; EF-1␣, elongation factor-1␣; ICE, IL-1 converting enzyme; nIL- have made large advances in recent years (16, 17). One of the 1F, novel IL-1 family; pI, isoelectric point; UTR, untranslated region. earliest cytokines to be cloned in fish was IL-1␤ (18), partly Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 due to a relatively high homology compared with known www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802953 The Journal of Immunology 963

Table I. Primers used for cloning and expression

Name Gene Sequence (5Ј to 3Ј) Application

nIL-1F-F nIL-1F CCCATTCCTCGTGACACCAG Real-time PCR nIL-1F-R CTGGACGACCTGGAGAGTGACT Real-time PCR nIL-1F-F1 CGCGTAGGATGTGGAGTATTCC 3Ј-Racing nIL-1F-F2 GACTGAAAGCATCAGGAAGGATGA 3Ј-Racing nIL-1F-R1 CCTGGGCTCTGTTTCTCTAC 5Ј-Racing nIL-1F-R2 CCAGTATAGCCCACTCAGCAATC 5Ј-Racing nIL-1F-gF1 CCAGTCAGAAGACTGCCTAC Library screening nIL-1F-gR1 CTGTAGGTCCACTCCACTCCATTGATC Library screening nIL-1F-gF2 TGTCACGAGGAATGGGCAAC Library screening nIL-1F-gR2 CTGGTGAAGTTGAGCACCAC Library screening nIL-1F-rF CACCGCCATGGTCGCAGAGTCCAGCA Recombinant production nIL-1F-rR TTTATGGATGACAAAGAAGAATGACTGG Recombinant production IL-1␤1 F IL-1␤1 GCTGGAGAGTGCTGTGGAAGAACATATAG Real-time PCR IL-1␤1R CCTGGAGCATCATGGCGTG Real-time PCR IL-1␤2 F IL-1␤2 GAGCGCAGTGGAAGTGTTGG Real-time PCR IL-1␤2R AGACAGGTTCAAATGCACTTTATGGT Real-time PCR EF1aEF EF-1␣a CAAGGATATCCGTCGTGGCA Real-time PCR EF1aER ACAGCGAAACGACCAAGAGG Real-time PCR IL-8 F IL-8 AGAGACACTGAGATCATTGCCAC Real-time PCR Downloaded from IL-8 R CCCTCTTCATTTGTTGTTGGC Real-time PCR TGF-␤1F TGF-␤1 CTCACATTTTACTGATGTCACTTCCTGT Real-time PCR TGF-␤1R GGACAACTGCTCCACCTTGTG Real-time PCR TNF-␣F TNF-␣ ATGGAAGAC(C/T)G(G/T)CAACGATGC Real-time PCR TNF-␣R CGTCATCCTTTCTCCACTGCAC Real-time PCR COX-2F COX-2 AACTGCACAACTCCTGAATTCCT Real-time PCR

COX-2R AGTAGGCCTCCCAGCTCTTGT Real-time PCR http://www.jimmunol.org/ HP GTCAGCTACGTCTCCTCAGTCAAGCAGTGGTATCAACGCAGAGT 5Ј-Racing HPS GTCAGCTACGTCTCCTCAGTC 5Ј-Racing HPS1 CCTCAGTCAAGCAGTGGTATC 5Ј-Racing

a Note that TNF-␣ primers can amplify both trout TNF-␣1 and TNF-␣2.

mammalian genes, and partly due to the high transcript level of fected fish, as described previously (29). 3Ј-RACE using forward prim- this molecule. Since then, IL-1␤ has been cloned in many fish ers F1 and F2 (Table I) resulted in a 0.7-kb product that when se- Ј species, including cartilaginous fish (19), and the bioactivity of quenced contained the C terminus and the 3 -untranslated region by guest on September 25, 2021 (UTR). Additional primers R1 and R2 (Table I) were designed in the the recombinant protein has been established (20–22). In the 3Ј-UTR and used for 5Ј-RACE. The resulting 1.5-kb product was search for other IL-1F genes, it was quickly discovered that cloned and sequenced and found to contain the 5Ј-UTR and complete several species of fish possess two IL-1␤ molecules (23, 24), coding region. The nucleotide sequences generated were assembled and thought to be a consequence of further genome duplication analyzed with the AlignIR program (LI-COR). A sequence similarity events in particular fish lineages. Additionally, alleles of IL-1␤ search was performed using FASTA (30) and basic local alignment search tool (BLAST) (31). Direct comparison between two sequences exist, which in rainbow trout (Oncorhynchus mykiss) are readily was performed using the MatGAT program (32). Multiple sequence identified due to retroposition events within intron 3 (25). More alignments were generated using CLUSTAL W (version 1.7) (33). Phy- recently, IL-18 (IL-1F4) has been discovered in fish, from in logenetic analysis was also performed on the predicted full-length silico analysis of sequenced fish genomes and expressed se- amino acid sequences, with the known IL-1 family molecules, using the quence tag databases (26, 27). While other IL-1F have not yet neighbor-joining method (34). The tree was drawn using CLUSTAL X version 1.81 and TreeView version 1.6.1 (35), and confidence limits been described, the receptor for IL-1F11, ST2, has been cloned were added (36). (28) and may suggest at least one further IL-1F has still to be discovered. In this paper we describe a novel IL-1F (nIL-1F) in fish, discovered by us during studies to identify immune genes Gene organization and promoter analysis of nIL-1F involved in host defense against bacterial infection in rainbow A rainbow trout genomic library constructed with ␭ GEM-11 was PCR trout, where the gene expression profile of bacterially chal- screened with nIL-1F-specific primers at the 5Ј (gF1 and gR1) and 3Ј lenged fish was surveyed by means of suppression subtraction ends (gF2 and gR2) of cDNA (Table I), as described previously (37). hybridization and sequence analysis (29). This nIL-1F appears Two overlapping positive clones were plaque purified and their DNA was prepared using a Wizard Preps DNA purification system (Pro- to have no clear homology to any IL-1F described to date, and mega). After an initial restriction enzyme analysis with BamHI, EcoRI, it resides in the genome in a unique location. Functional and SacI, XbaI, and XhoI (all from Promega), the digestions were subcloned expression analysis of this molecule are also presented. into pGEM-7zf(ϩ) and sequenced. Three contigs were identified that contained the full-length cDNA, as well as the 5Ј and 3Ј flanking re- gions. The large introns III and VII, ϳ11 and 6 kb, respectively, as Materials and Methods defined by PCR from genomic DNA, were not sequenced completely. Identification of nIL-1F in trout The cDNA sequence was aligned to the genomic sequence, and the intron/exon boundaries were identified using the SIM4 program (38). Rainbow trout suppressive subtractive hybridization (SSH) libraries The gene organization data of human IL-1F members, including exon/ from bacterially challenged fish were constructed as described previ- intron sizes, intron phase, and coding regions, was extracted from the ously (29). Analysis of SSH clones from a gill SSH library revealed a Ensembl database (www.ensembl.org/Homo_sapiens/exonview) for short sequence with limited homology to IL-1 family members. 3Ј- and comparison to this fish nIL-1F. The 5Ј flanking region sequence was 5Ј-RACE was conducted using SMART cDNA prepared from gills of next analyzed using the program Signal Scan (39). To get more insight Aeromonas salmonicida- (a Gram-negative fish bacterial pathogen) in- into the regulation of gene expression of nIL-1F, a comparative 964 A NOVEL IL-1 FAMILY MEMBER IN FISH

FIGURE 1. cDNA sequence and intron positions of nIL-1F in rainbow

trout. The start and stop codons, the Downloaded from repeat sequence (ttttataccacca, 4ϫ)in the 3Ј-UTR, and the poly(A) signal are boxed. The potential ICE cut site (LESD) and thrombin cut site (RGR) are shaded. The two potential N-gly- cosylation sites (NXT) are shaded and

boxed. The triangles indicate intron http://www.jimmunol.org/ positions. by guest on September 25, 2021

promoter analysis was conducted using the Possum program (http:// ces. The first 1-kb sequences (including the first exon) of both the zlab.bu.edu/ϳmfrith/possum/), which predicts cis elements in DNA se- nIL-1F and IL-1␤1 (40) genes from rainbow trout were analyzed for quences using the standard method of position-specific scoring matri- potential transcription factor binding sites.

Table II. Identity (percentage, top right)/similarity (percentage, bottom left) of the nIL-1F to other members of the IL-1 family from trout and humans

123456789101112131415

1. Trout nIL-1F 20.4 18.3 15.2 15.0 18.8 16.3 14.8 13.2 13.1 17.4 13.8 12.8 12.8 16.4 2. Trout IL-1␤1 34.0 74.6 17.0 22.1 26.9 25.3 15.6 19.9 19.2 21.3 16.1 18.7 16.8 17.6 3. Trout IL-1␤2 32.6 85.0 13.2 21.4 26.5 26.7 16.9 19.8 16.9 19.6 16.5 18.3 16.9 21.8 4. Trout IL-18 27.1 31.2 30.3 17.8 16.8 16.7 27.3 15.9 15.1 16.6 14.8 17.1 15.8 16.3 5. IL-1F1 31.8 43.5 40.2 32.8 25.7 15.9 19.1 16.7 17.0 18.6 14.4 17.1 13.6 17.9 6. IL-1F2 32.9 46.8 43.9 32.3 43.9 22.1 15.3 18.2 19.1 21.6 16.3 18.5 17.3 15.0 7. IL-1F3 24.9 35.0 35.0 32.7 27.7 32.0 21.4 40.6 26.3 23.1 16.3 29.1 33.0 18.2 8. IL-1F4 27.1 35.0 37.0 52.3 35.4 33.8 35.8 19.1 19.6 20.8 14.7 22.6 16.3 16.8 9. IL-1F5 21.1 31.5 30.7 35.2 25.8 29.0 52.0 37.3 31.9 26.2 18.2 28.8 42.0 15.8 10. IL-1F6 22.2 30.8 30.3 30.2 28.8 31.2 42.9 35.2 49.4 26.4 30.5 52.9 27.0 15.8 11. IL-1F7 27.7 40.4 39.0 35.3 31.7 38.7 39.0 39.4 37.2 39.4 19.7 27.4 25.3 17.0 12. IL-1F8 21.4 28.1 28.0 31.7 23.6 26.4 30.5 33.7 37.8 46.3 35.8 26.3 18.5 14.1 13. IL-1F9 23.3 32.3 33.9 32.2 29.5 30.1 48.0 39.9 46.7 69.2 42.2 44.4 28.7 13.0 14. IL-1F10 20.3 30.8 29.5 33.7 23.6 28.3 45.8 35.8 57.4 46.2 38.5 36.6 44.4 15.0 15. IL-1F11 30.7 36.7 38.9 32.6 35.8 37.0 29.6 32.2 24.8 27.4 31.9 28.1 27.4 24.8 The Journal of Immunology 965

Genome analysis of the IL-1 family in Tetraodon nigroviridis Since the positions of IL-1F in the genome of mammals is well known, we undertook a comparison of the location of both the novel IL-1F and IL-1␤ in the genome of a fish species for which the genome had been sequenced, the pufferfish T. nigroviridis. The Tetraodon IL-1␤ and nIL-1F sequences were found using the Tetraodon genome, and evidence of conservation of synteny between the human and Tetraodon genomes was investigated. The Tetraodon genome was searched by BLAST analysis (31) using amino acid sequences for trout IL-1␤ and nIL-1F. Tetraodon homologs for IL-1␤ and nIL-1F were found on chromosome 12 and on chromosome 5, respectively. Subsequently, the DNA sequence around these two genes was retrieved for further analysis using various sequence software programs. Using GEN- SCAN (41), possible coding regions within the DNA sequence were pre- dicted, and the amino acid sequences were analyzed using BLAST (31) and FASTA (30). Regions of chromosome 2 (the location of most IL-1F in mammals) and X (where some of the neighboring genes around nIL-1F are found) in the human genome were used to look for synteny to the regions of the Tetraodon genome analyzed.

Modeling

Trout nIL-1F was modeled using the ␤-trefoil modeling method, as de- Downloaded from scribed previously (42). Briefly, an object-oriented database containing representative ␤-trefoil protein structures was queried using BLAST (31) to identify a template structure with the highest sequence similarity to the target, and then to identify segments in the database to model loops that differed in length from the template. Three criteria were applied in loop modeling. First, the fragments had the correct number of residues for the target loop region. Second, the fragments had endpoints that geometrically http://www.jimmunol.org/ matched the residues in the template structure between which the loop was inserted. Third, only candidate fragments from the same ␤-trefoil loop category were considered for subsequent fitting. Structural information from the ␤-trefoil database was also used in side-chain modeling. The final three-dimensional model was built using MODELLER (43). The generated FIGURE 2. Phylogenetic tree showing the relationship between the model was assessed for its stereochemical properties with PROCHECK (44). Molecular visualizations were prepared with the program DeepView full-length trout nIL-1F amino acid sequence, with other known vertebrate version 3.7 (45). IL-1 family members. This tree was constructed using the CLUSTAL X and TreeView packages and was bootstrapped 10,000 times. Bootstrapping values Ͻ75 are shown (F–F). The GenBank accession numbers of the

Expression of IL-1 family members in vivo IL-1␤ genes are: cow, M35589; horse, D42147; human, M15330; mouse, by guest on September 25, 2021 A comparative expression analysis of the known trout IL-1␤ genes, IL-1␤1 M15131; pig, M86725; dolphin, BAA87947; dog, DQ251036; rabbit, and IL-1␤2, and the nIL-1F was undertaken by real-time PCR as described M26295; platypus, AJ245728; possum, AF071539; catshark, AJ251201; previously (46, 47) to assess levels of expression in vivo. Briefly, six leopard shark, AB074142; cod, AJ535730; goldfish IL-1␤1, AJ249136; healthy rainbow trout (average, 130 g/fish) were killed and tissues (gills, goldfish IL-1␤2, AJ129137; halibut, BAB86882; icefish, CAD92853; skin, muscle, liver, spleen, head kidney, intestine, and brain) were removed salmon, AAT36642; seabass, AJ269472; seabream, AJ277166; red sea- for RNA preparation and cDNA synthesis. A common reference containing bream, AY257219; carp IL-1␤1, AB010701; carp IL-1␤2-1, AJ401030; equal molar amounts of purified PCR products of each gene was con- carp IL-1␤2-2, J401031; chicken, Y15006; xenopus, AJ010497; haddock, structed. The samples were run with a serial dilution of the common ref- ␤ ␤ erence in the real-time PCR and quantified. The expression level of each AJ550166; trout IL-1 1, AJ223954; trout IL-1 2, AJ245925; turbot, gene was expressed as arbitrary units normalized against the expression AJ295836; Tetraodon, AJ574910; Chinese perch, AY647430; cobia, level of elongation factor-1␣ (EF-1␣). AY641829; zebrafish, AY340959. The GenBank accession numbers of the IL-1␣ genes are: cow, X12497; dog, AF047011; dolphin, AB028215; horse, U92480; human, M15329; mouse, X01450; pig, M86730; rabbit, Modulation of the expression of trout IL-1 family members in X02852. The GenBank accession numbers of the IL-1F3 genes are: cow, vivo by bacterial Yersinia ruckeri infection BC134577; dog, AY026462; dolphin, AB038268; horse, D83714; human, A pathogenic strain (MT3072) of the Gram-negative fish pathogen Y. ruck- AY196903; mouse, AK076296; rabbit, M57526; pig, Q29056. The Gen- eri, the causative agent of enteric redmouth disease, was supplied by Prof. Bank accession numbers of the human IL-1 family member genes are: A. E. Ellis (Fisheries Research Services Marine Laboratory, Aberdeen, IL1F5, AF186094; IL1F6, AF201831; IL1F7, AF201832; IL1F8, Scotland, U.K.). The bacteria were spread onto a tryptic soy agar (Fluka BC101831; IL1F9, AF200492; IL1F10, AF334755. The GenBank acces- BioChemika) plate and incubated for 2 days at 22°C. Then, the bacteria sion numbers of the mouse IL-1 family member genes are: IL1F5, were scraped off and suspended into PBS (pH 7.2), washed three times with AF200495; IL1F6, AF200493; IL1F8, AK009787; IL1F9, AK081783; ϫ 6 PBS, and resuspended in PBS to a concentration of 2 10 CFU/ml. IL1F10, AL732430. The GenBank accession numbers of the IL-18 genes Rainbow trout, ϳ100 g, were put into two tanks (30 fish/tank) 2 wk before challenge. The water temperature throughout the experiment was con- are: rabbit, B1A3U4; dog, Q9XSR0; human, Q6FGY3; horse, B1AB85; trolled at 15 Ϯ 1°C and the fish were fed with commercial trout pellets cow, B2LSE6; pig, O19073; mouse, Q80SS8; chicken, Q6IT44; trout, (EWOS) twice a day. The waste water was sterilized by ozonation. Fish Q70PK1; Fugu, Q70T31. The GenBank accession numbers of the IL-33 from one tank were injected i.p. with bacteria (0.5 ml/fish). Fish in the genes are: human, O95760; mouse, Q8BVZ5. The GenBank accession second tank were injected i.p. with PBS (0.5 ml/fish) as control. Six fish numbers of the nIL-1F genes are: trout, AJ555869; Tetraodon, FM207486. from each treatment group were sampled at 6, 24, 48, and 72 h postinjec- tion, when the spleen was collected and used for total RNA preparation using TRIzol (Invitrogen). The expression of trout IL-1 family members Expression and modulation of trout IL-1 family members in the was quantified by real-time PCR as above. The relative expression of each RTS-11 cell line by LPS, rIL-1␤, and poly(I:C) member was normalized to the average level of IL-1␤2 in the fish injected with PBS 6 h earlier, which was defined as 1. A fold change was also The mononuclear cell line RTS-11 (48) was routinely grown in L-15 me- calculated as the average expression level in the bacterial challenged fish dium supplemented with 30% FCS at 20°C. RTS-11 cells (3 ϫ 106) were divided by that of the PBS-injected control fish at the same time point. seeded in 25-cm2 culture flasks in 5 ml medium (L-15 plus 0.5% FCS) and 966 A NOVEL IL-1 FAMILY MEMBER IN FISH Downloaded from

FIGURE 3. Exon/intron structure of IL-1 family members from human and trout. The coding regions are represented by filled boxes and the UTRs are depicted by open boxes. Introns are represented by a gray bar with the intron phase shown below. The intron sizes are reduced by a factor of 10. The sequence data were http://www.jimmunol.org/ extracted from the following database entries: ENSG00000115008 (human IL-1␣), ENSG00000125538 (human IL-1␤), ENSG00000136689 (human IL-1F3), ENSG00000150782 (human IL-18), ENSG00000136695 (human IL-1F5), ENSG00000136694 (human IL-1F6), ENSG00000125571 (human IL-1F7), ENSG- 00000136696 (human IL-1F8), ENSG00000136688 (human IL-1F9), ENSG00000136697 (human IL-1F10), ENST00000381434 (human IL-33), AJ278242 (trout IL-1␤1), AJ245925 (trout IL-1␤2), AJ781817 (trout IL-18), AJ245635 (carp IL-1␤), AJ311925 (seabass IL-1␤), and sequence data from this study.

cultured overnight before any treatments or RNA preparation. The cell culture supernatant was replaced with the same medium (0.5% FCS) with or without Escherichia coli LPS (Sigma-Aldrich;, 25 ␮g/ml), poly(I:C) by guest on September 25, 2021 (Sigma-Aldrich; 50 ␮g/ml), or rIL-1␤ (30 ng/ml). These concentrations were chosen based on our previous studies (49) and were deemed optimal. The treatments were terminated by dissolving the cells in TRIzol (Invitro- gen) at 1–24 h poststimulation and total RNA was prepared. The expres- sion of trout IL-1F members was quantified by real-time PCR as above. The relative expression of each member was normalized to the average level in the control samples at 1 h, which was defined as 1. Northern blot analysis Total RNA isolated from RTS-11 cells stimulated with LPS for 4 h, or from control unstimulated cells, was also used for Northern blot analysis, per- formed as described previously (49). In each experiment, 10–25 ␮g of total RNA per lane was transferred from a 1.1% formaldehyde-MOPS agarose gel to nylon membranes by capillary action and hybridized overnight at 65°C with a 32P-labeled cDNA probe purified from a trout nIL-1F PCR fragment amplified using F and R primers (Table I). Following stringent washing, membranes were put into an x-ray cassette with intensifying screens and film (Kodak) and exposed for 2 days. Expression of recombinant trout nIL-1F and bioactivity analysis Although it is not known whether the trout nIL-1F is produced as a pre- cursor that is subsequently cleaved, it seems likely that this is the case based on our modeling analysis. Thus, the C-terminal region downstream of the two possible cut sites (see Fig. 1) has 12 predicted ␤-strand regions that typify the known mature IL-1F peptides. The recombinant protein FIGURE 4. Comparative analysis of potential transcription factor bind- produced was designed to contain the 12 predicted ␤-strands (i.e., to begin ing sites between trout nIL-1F and IL-1␤1. The first exons are shown in upstream of the first ␤-strand) and to start immediately down stream of the filled boxes and the potential transcription factor binding sites are shown possible thrombin cut site. The C-terminal region chosen contained 197 aa by colored bars with theirs height representing the confidence of the pre- 169 and started at Gly . Briefly, the trout nIL-1F sequence was amplified diction. The bars above or below the solid lines depict the direction of the using primers (forward primer; GGTTGTCGTGACGGGAGCTCTT; re- sites as the same or reverse of the DNA sequences. The matrix used for verse primer, TTTATGGATGACAAAGAAGAATGAC) and cloned to pTriEx-6 vector (Novagen) that has the option to express the cloned protein prediction are extracted from the TRANSFAC database (http://transfac. in E. coli as well as in eukaryotic cells. To facilitate purification, an N- gbf.de/TRANSFAC/lists/matrix) with accession numbers: M00174 (AP-1), terminal Strep-tag II and a C-terminal His tag from the vector were incor- M00189 (AP-2), M00175 (AP-4), M00249 (CHOP:C/EBP␣), M00109 (C/ porated, and thus the recombinant nIL-1F had an N-terminal MASWSH EBP␤), M00191 (ER), M00250 (Gfi-1), M00192(GR), M00054 (NF-␬B), PQFEKGALEGS sequence and a C-terminal GSSAHHHHHHHHHH M00185 (NF-Y), M00196 (Sp1), and MA0108 (TATA-box). The Journal of Immunology 967

FIGURE 5. Genome location of nIL-1F relative to other IL-1F. Com- parative gene location maps between chromosome 2 in human and 12 in Te- traodon contaning the IL-1␤ homolog and chromosome X in human and 5 in Tetraodon containing the teleost nIL-1F homolog. Downloaded from

sequence. A sequence-confirmed plasmid was used to transform BL21 Star using a Multiporator (Eppendorf). The transformed cells were selected us- (DE3)-competent cells (Invitrogen), and protein expression was induced by ing 5 ␮g/ml blasticidin (Invitrogen). The cell culture supernatant was re- isopropyl ␤-D-thiogalactoside as described previously (46). The recombi- moved and replaced with 1/20 volume of PBS and stored at Ϫ80°C. After nant nIL-1F was expressed at high yield as inclusion bodies. Thus, puri- freezing-thawing three times, the cell lysate was clarified by centrifugation

fication under native condition was not feasible. The rnIL-1F was lysed in (12,000 rpm, 15 min) and the supernatant was used for Western blot and http://www.jimmunol.org/ a lysis buffer containing 50 mM Tris-HCl (pH 8.0), 6 M guanidine hydro- bioactivity analysis. chloride, 15 mM 2-ME, and 15 mM imidazole, and purified using His GraviTrap columns (GE Healthcare Life Sciences). After binding and ex- Bioactivity analysis tensive washing with lysis buffer, the denatured rnIL-1F was eluted in lysis buffer containing 500 mM imidazole. The purified denatured rnIL-1F was To assess the potential agonistic or antagonistic activity of the rnIL-1F, the refolded in a refolding buffer containing 50 mM Tris-HCl (pH 7.0), 0.5 M purified rIL-1F produced in E. coli, or the clarified lysate from CHO cells, arginine, 0.5% Triton X-100, and 5 mM 2-ME at 4°C for 2 days. The was added to RTS-11 cells and the effect on expression of a number of refolded rnIL-1F was repurified under native conditions, eluted at high genes involved in inflammatory responses (IL-1␤, IL-8, TNF-␣, TGF-␤, concentrations of up to 2 mg/ml, and checked for purity on a NuPAGE COX-2), and on nIL-1F itself, was analyzed in the presence or absence of Novex Bis Tris MiniGel (Invitrogen) under reducing conditions. When up costimulation with rIL-1␤ (20), a potent proinflammatory molecule. It was by guest on September 25, 2021 to 20 ␮g/ml rnIL-1F was added to RTS-11 cells for 4.5 h, the up-regulation anticipated that the nIL-1F may influence IL-1␤ activity since it had high- of known LPS-responsive genes (IL-1␤, rnIL-1F, TNF-␣, and cyclooxy- est homology to trout IL-1␤ and the modeling studies identified human genase (COX)-2 genes) was not detectable, suggesting that LPS contami- IL-1ra as the most similar structure, and that it was potentially able to bind nation was negligible. to the IL-1R (see Results). In the case of single stimulations, analysis was A second rnIL-1F of 175 aa, starting from Met191 (i.e., still upstream of performed 4.5 h poststimulation with nIL-1F or 4 h with IL-1␤ (10 ng/ml). the predicted 12 ␤-strands), was also produced in Chinese hamster ovary In the costimulation experiments, the rnIL-1F was added for 0.5 h before (CHO) cells to confirm whether native produced and potentially glycosy- subsequent addition of the rIL-1␤ for a further4htoassess whether the lated protein also has the same activity as the E. coli-produced rnIL-1F. nIL-1F could antagonize the rIL-1␤-induced effects. While the optimal The coding region was cloned using primers nIL-1F-r (F and R) (Table I) stimulatory concentration range for trout rIL-1␤ is well established, this and directly cloned to pcDNA 6.2/GW/D-TOPO (Invitrogen), which al- was unknown for the nIL-1F, and so a range of concentrations (from 0.5 to lows production of the protein fused with a V5 tag from the vector for 4 ␮g/ml) of the E. coli-produced rnIL-1F or dilutions of the lysates from detection and bioactivity analysis. A sequence-confirmed plasmid was lin- CHO cells (from 0.4 to 250 ␮l/ml) were used in these experiments. After earized using ScaI and used to transform CHO cells by electroporation treatment, the cells were lysed in TRIzol and gene expression was detected

FIGURE 6. Multiple sequence align- ment of human and mouse IL-1ra, trout IL-1␤, and trout nIL-1F mature peptides. Identical residues and the 12 ␤-strands of the human structure are indicated. 968 A NOVEL IL-1 FAMILY MEMBER IN FISH

Table III. Loop insertion and deletion sites in trout nIL-1F and upstream of a 20-bp poly(A) tail. Analysis of the predicted trans- proximal receptor binding sites lation revealed a protein of 41.2 kDa, with a theoretical isoelectric point (pI) of 5.67. No signal peptide was apparent, in common with Insertion (ϩ)/Deletion (Ϫ) Receptor other IL-1F, but it contained a potential ICE cut site (LEXD) at aa Loop Length Binding Sitea positions 126–129, and a thrombin cut site (RGR) at aa positions I1 N-ter ϩ4B166–168. Interestingly, the latter divided the protein into an N- Ϫ D2 1–2 1Aterminal acidic domain (pI of 4.67) of 18.6 kDa and a C-terminal D3 2–3 Ϫ1A I4 3–4 ϩ1Abasic domain (pI of 8.75) of 22.6 kDa. No signal peptide or trans- I5 4–5 ϩ9Bmembrane domain was detectable within the sequence, but two I6 7–8 ϩ3 potential glycosylation sites (NXT) were found at aa positions ϩ I7 8–9 1 B (hinge) 271–273 and 341–343 (Fig. 1). D8 10–11 Ϫ2A D9 11–12 Ϫ1 A position-specific iterated (PSI)-BLAST search (20 iterations) vs nonredundant protein sequence databases revealed that nIL-1F a Site A, domains I and II of the receptor; site B, hinge and domain III. is similar to IL-1␤, IL-1ra, and other vertebrate IL-1F cytokines (the expect value Ͻ 10Ϫ30), confirming that it is an IL-1F family by real-time PCR (E. coli-produced rnIL-1F) or visualized on ethidium member. The nIL-1F sequence contains a PROSITE (50) IL-1 sig- bromide-stained agarose gels, as described previously (25), for CHO cell- nature (PS00253) in positions 327–347 that is modified in two produced rnIL-1F. The experiment was performed on three independent residues. Other piscine IL-1F molecules, such as trout IL-1␤, also Downloaded from flasks of cells for each treatment. contain the IL-1 signature with differences in the same positions. Statistical analysis The obtained sequences were used for homology and phylo- genetic tree analyses and revealed that the trout nIL-1F, to- Real-time quantitative PCR measurements were analyzed using the non- parametric Mann-Whitney U test within the SPSS package 15.0, with p Ͻ gether with the Tetraodon nIL-1F in the latter case, had little 0.05 between treatment groups and control groups considered significant. relatedness to known IL-1F. Thus, the trout nIL-1F showed only 15–20% identity and 27–34% similarity with other known http://www.jimmunol.org/ Results IL-1F in trout, and 13–19% identity and 20–33% similarity to Cloning and sequence analysis the known human IL-1F (Table II), although the highest iden- The trout nIL-1F was cloned (EMBL accession no. AJ555869; tity/similarity was to trout IL-1␤, followed by mammalian IL- www.ebi.ac.uk/embl/) and the full-length transcript shown to be 1␤. In phylogenetic tree analysis (Fig. 2), the nIL-1F formed a 1736 bp, consisting of a 165-bp 5Ј-UTR, an 1098-bp open reading separate and distinct clade, with no clear relationship with other frame encoding a protein of 365 aa, and a 473-bp 3Ј-UTR (Fig. 1). known IL-1F. Within the 3Ј-UTR a repeat (ϫ4) of ttttataccacca was present from A sequence-structure compatibility search using mGenTHR position 1318, and a polyadenylation signal was present 17 bp EADER (51) predicted the ␤-trefoil fold (52) and showed highest by guest on September 25, 2021

FIGURE 7. Ribbon representation of trout nIL-1F model. Side view (A) and view from the open end of the bar- rel (B) of unbound nIL-1F (green); side views (C and D) of nIL-1F bound to the trout IL-1RI receptor (cream). All models are superposed on the hu- man IL-1F3 structure (PDB code: 1IRA), shown in gray. The three Ig domains of the receptor (I, II, and III) and the amino (N) and carboxyl (C) terminals of the nIL-1F are indicated. The Journal of Immunology 969

Gene organization and promoter analysis The nIL-1F gene was ϳ22 Kb in size (EMBL accession nos. FM207658, FM207659, and FM207660; www.ebi.ac.uk/embl/). Analysis of the gene organization of nIL-1F revealed that it con- tained 8 exons and 7 introns and was a unique organization relative to other IL-1F (Fig. 3). The 5Ј-UTR was located in the first exon, together with the first 12 bp of the open reading frame, which finished in exon 8. The predicted ICE cut site was located over exons 4 and 5, while the thrombin cut site was wholly located in exon 5. Intron phase was also examined, and as with most of the other IL-1F, the trout nIL-1F has the typical 1,1,0 arrangement for the last three introns, with the IL-1 family signature located in the final exon after the phase 0 intron. Analysis of potential transcription factor binding sites on the FIGURE 8. In vivo expression of trout nIL-1F, IL-1␤1, and IL-1␤2 5Ј-flanking region of the nIL-1F gene identified many sites, in- transcripts. The expression of trout nIL-1F, IL-1␤1, and IL-1␤2 tran- cluding those for CHOP:C/EBP␣, C/EBP␤ (NF-IL-6), AP-1, scripts in eight tissues of six fish was quantified by comparing to a serial AP-2, AP-4, NF-Y, Gfi-1, and ER (Fig. 4). In comparison to the dilution of a common reference that contained equal molar amounts of trout IL-1␤1 promoter region (40), most of these sites were also purified PCR products of each gene in the real-time PCR. The expres- Ј ␤ Downloaded from sion level of each gene was expressed as arbitrary units normalized identifiable in the 5 -flanking region of the IL-1 gene, as well as against the expression level of EF-1␣. The results represent the aver- a TATA box in both. The major differences were the lack of age Ϯ SEM of six fish. NF-␬B and Sp1 sites in the nIL-1F promoter and presence of the ER site. similarity to human IL-1␤ and IL-1ra structures ( p Ͻ 0.0001). These Genome analysis

IL-1F family members are structurally classified in the “cytokine” A search of the Tetraodon genome found the nIL-1F gene on chro- http://www.jimmunol.org/ (50353) and 2.80.10.50 superfamilies according to SCOP (53) and mosome 5 (Fig. 5), with FGIF and PIR downstream and ACES2 CATH classification (54), respectively. Other members of this struc- upstream. These neighboring genes were sought in the human ge- tural superfamily include fibroblast growth factors. A BLAST search nome, where they were also found to be colocated on chromosome of the ProDom database of protein domain families (55) identified the X, in the same order and orientation but with the BMX gene (the PD002536 (IL-1, the expect value Ͻ 0.0001) and the PD932791 (IL- gene for bone marrow tyrosine kinase, a TEC family kinase) in 1F7, the expect value ϭ 0.9) domains as the most similar. A search of between rather than a nIL-1F. A broader look at the gene synteny Pfam database (56), a large collection of multiple sequence align- between these two locations found a number of other genes con- ments and hidden Markov models covering many common protein served in this region, including GRPR, NHS, AP1S2, and ZRSR2 by guest on September 25, 2021 domains and families, identified the IL-1/18 domain (the expect (Fig. 5). In contrast, analysis of the gene locus containing the fish value Ͻ 10Ϫ5), supporting further that nIL-1F is indeed an IL-1F IL-1␤ gene in Tetraodon found the gene on chromosome 12, with family member. no further IL-1F members obvious and without any clear gene

FIGURE 9. Comparative expression study on nIL-1F, IL-1␤1, and IL-1␤2 in spleen of bacterial-infected trout. Fish were injected i.p. with PBS (0.5 ml/fish), or Y. ruckeri (MT3072), a Gram-negative fish pathogen causing enteric redmouth disease. Six fish from each treatment group were sampled at 6, 24, 48, and 72 h postinjection. Spleens were collected and used for total RNA preparation using TRIzol (Invitrogen). The expression of trout IL-1family members was quantified by real-time PCR as above. A, The relative expression of each member was normalized to the average level of IL-1␤2 in the fish injected with PBS 6 h earlier, which was defined as 1. B, The fold change was also calculated by the average expression level in the bacterial-challenged fish divided by that of the PBS-injected control fish at the same time point. The results represent the average Ϯ SEM of six fish. Note that significant up-regulation (p Ͻ 0.05) of all three trout IL-1 family members was observed in the bacterial-challenged group compared with the control group at all the time points examined. 970 A NOVEL IL-1 FAMILY MEMBER IN FISH synteny with the exception that CKAP2L was an immediate neigh- bor and is adjacent to the cluster of nine IL-1F genes seen on human chromosome 2 (Fig. 5). Modeling Since nIL-1F shows low similarity to other known IL-1F, a spe- cialized protein modeling method for modeling proteins that adopt the ␤-trefoil fold was used (42). PSI-BLAST search within the Protein Data Bank (PDB) identified the human IL-1ra (PDB code: 1IRA, chain X) as the most similar structure. Sequences of relevant IL-1F were aligned with the C-terminal region of the trout nIL-1F (starting at Asn207) using CLUSTAL (33) (Fig. 6), and in accordance with observations in other IL-1F cytokines, the trout nIL-1F had higher sequence similarity within the 12 predicted ␤-strand regions than in loops connecting them, where nine regions of insertions and deletions were identified (Table III). The protein models of nIL-1F (Fig. 7) show the characteristic 12 ␤-strands of the ␤-trefoil structure folding into three similar ␤-␤-␤-loop-␤ trefoil subunits. The overall struc- Downloaded from ture has a 3-fold pseudosymmetry and consists of a six-stranded barrel that is capped on its one side by a triangular hairpin triplet (52). To simulate whether a potential interaction of the trout nIL-1F with the known trout IL-1RI could occur, a theoretical

model of the trout IL-1R receptor was retrieved from PDB http://www.jimmunol.org/ (PDB code: 1OU1) (57). Similar to the human IL-1R, the trout receptor has three extracellular Ig-like domains. Domains I and II are intricately connected, forming an extensive interface, while domain III is linked via a flexible linker that allows ro- tation of domain III upon ligand binding. The trout nIL-1F/ IL-1R complex was simulated by structural superposition of the trout nIL-1F and IL-1R models onto the human complex (PDB code: 1IRA). Analysis of the complex revealed a number of regions that may be of importance in binding of nIL-1F to the by guest on September 25, 2021 receptor as outlined below. Within the receptor binding site A, the trout nIL-1F possesses 229–231 three exposed arginines (Arg ) in the loop connecting ␤ ␤ FIGURE 10. Modulation of nIL-1F and IL-1 members in RTS-11 -strands 2 and 3. Their positively charged side chains are located cells. RTS-11 cells were stimulated by E. coli LPS (25 ␮g/ml) or rIL-1␤ proximal to an acidic, positively charged region of the receptor (30 ng/ml). The treatments were terminated at 1–24 h poststimulation 25–28 domain I (Asp ), located in the loop between strands b1 and and total RNA was prepared. The expression of trout IL-1␤1(A), IL- c1. The close complementarity of the positive and negative sites 1␤2(B), and nIL-1F (C) was quantified by real-time PCR as above and suggests that they might interact directly with each other. Other normalized to the expression level of EF-1␣. The relative expression of charged surface residues, such as receptor Arg115 located at the each gene was normalized to the average level in the control samples at loop between strands b2 and c2 and Glu132of loop 10–11 of nIL- 1 h, which was defined as 1. Note that significant up-regulation (p Ͻ 0.05) 1F, may be involved in additional interactions. Other regions of of all three trout IL-1 family members was observed in the rIL-1␤ and LPS- potential interaction include nIL-1F loop 3–4, which is situated in stimulated groups compared with the control group from 2 to 24 h. the cleft between receptor domains I and II, potentially interacting with strand a2 of the receptor, and loop 1–2, which is situated proximal to receptor strands a2 and b2. It is therefore likely that as Additional regions may be important in conferring the inactive in the human complex, nIL-1F forms extensive interactions in site receptor conformation, such as the receptor loop b3–c3. This is A with its receptor. longer by six amino acids compared with the human receptor and In humans, the largest conformational differences in IL-1ra upon is potentially interacting with residues from strand 12 and the receptor binding occur in site B loop 4–5 (58). This loop is shorter barrel rim. than that of the agonist by six residues and interacts with receptor loop f3–g3. In nIL-1F, loop 4–5 is longer than in trout IL-1␤ by Expression analysis three residues, suggesting that it interacts with the receptor domain The trout nIL-1F was found to be broadly expressed across a III. The length of loop 7–8 is identical in the human agonist and wide range of tissues (Fig. 8) and was relatively highly ex- antagonist molecules, but they differ in their sequence composition pressed in lymphoid tissues such as the gills, spleen, and head and structural conformation, and only the agonist interacts with the kidney. In comparison to constitutive expression of the two receptor loop c3–d3 (59). The trout nIL-1F and IL-1␤ loops 7–8 IL-1␤ isoforms present in trout, nIL-1F expression was notice- are longer by four residues than their human homologs. Despite the ably higher in liver, spleen, head kidney, intestine, and brain. low confidence in the long loop regions of the protein models, it is Following infection of fish with a common Gram-negative bac- likely that, as in the human antagonist/receptor complex, nIL-1F terial pathogen, Y. ruckeri, the expression level of nIL-1F in the loop 7–8 and receptor loop c3–d3 are too far apart to interact. spleen was studied. nIL-1F increased significantly ( p Ͻ 0.05) The Journal of Immunology 971

also showed the induction of the expression of nIL-1F and IL- 1␤1 in RTS-11 cells by LPS (Fig. 11). Only a single hybridizing band was detected, with the expected size from the nIL-1F cDNA sequence of ϳ2 kb, indicating that no major splice vari- ants exist.

Recombinant protein production and bioactivity testing The recombinant C-terminal protein, containing 197 aa and starting at Gly169, was successfully produced in E. coli and purified (Fig. 12A). The rnIL-1F was tested in terms of whether it had agonist or antagonist activity (Fig. 12B) on the expression FIGURE 11. Northern blot analysis of the nIL-1F and IL-1␤1 tran- of a number of proinflammatory genes, as determined by real- scripts. Total RNA samples from control (unstimulated) and LPS-stimu- time PCR. For the former, addition of rnIL-1F to RTS-11 cells lated RTS-11 cells were separated using 1.1% formaldehyde-MOPS aga- was found to have no effect on the expression of IL-1␤, IL-8, rose gel transferred to nylon membranes and hybridized in three COX-2, and TNF-␣. It also did not affect its own expression or independent reactions with 32P-labeled cDNA probes for nIL-1F, IL-1␤1, that of TGF-␤. In contrast, addition of rIL-1␤ to these cells had and ␤-actin. a marked and significant effect on proinflammatory gene ex- Downloaded from pression, and also increased nIL-1F expression, although again ␤ by 24 h postinfection, whether determined as relative expres- TGF- expression was unaffected. When the cells were pre- ␤ sion (Fig. 9A) or fold change (Fig. 9B), and it remained high for treated with rnIL-1F before addition of rIL-1 , the up-regula- ␤ the duration of the experiment (72 h). In comparison to the two tion of gene expression induced by rIL-1 was inhibited (Fig. IL-1␤ isoforms known in trout, which showed rapid increases in 12B). As the concentration of rnIL-1F was diluted out (from 4 to 0.5 ␮g/ml), keeping the amount of rIL-1␤ constant, the in- expression within6hofinfection, the increase in nIL-1F was http://www.jimmunol.org/ delayed and did not increase by the same magnitude but re- hibitory effect on rIL-1␤-induced proinflammatory gene expres- mained high when the IL-1␤ levels were beginning to decline at sion and nIL-1F gene expression was progressively lost, show- 72 h postinfection. ing that nIL-1F antagonized IL-1␤ activity. No effect on TGF-␤ Attempts to determine cell types able to express the trout expression was seen, suggesting that this was not a generalized nIL-1F focused on available cell lines. nIL-1F was expressed in effect on transcript expression. A second recombinant C-termi- RTS-11 cells, a trout macrophage cell line. When these cells nal protein produced in CHO cells, of 175 aa and beginning at were stimulated with two proinflammatory stimuli, LPS or trout Met191, showed essentially similar results (data not shown), in- rIL-1␤, nIL-1F was found to increase ( p Ͻ 0.05) in expression dicating that the potential glycosylation sites in the C terminus level with similar kinetics to IL-1␤ but did not increase to the were not essential for bioactivity, and that the loss of a further by guest on September 25, 2021 same degree, as found in vivo (Fig. 10). Northern blot analysis 22 aa also had little impact.

FIGURE 12. Production and bioactivity of recombinant nIL-1F. A, Induction of expression and purification of recombinant nIL-1F. Samples were mixed with LDS loading buffer and run on a NuPAGE Novex Bis Tris MiniGel (4–12%) (Invitrogen) under reducing conditions. A, Lane 1, Protein marker (New England Biolabs); lanes 2 and 3, lysates from uninduced and isopropyl ␤-D-thiogalactoside-induced bacteria transformed with pTriEx6/nIL-1F (theoretic molecular mass, 26.15 kDa); lane 4, purified and refolded nIL-1F. B, Antagonizing rIL-1␤ action with recombinant nIL-1F. Different amounts of recom- binant nIL-1F (0.5–4 ␮g/ml) were added to RTS-11 cells half an hour before the addition of rIL-1␤ (10 ng/ml) for 4 h. The gene expression of a housekeeping gene (EF-1␣), a rIL-1␤-unresponsive gene (TGF-␤1), as well as known IL-1␤ responsive genes (IL-1␤, IL-8, TNF-␣, COX-2) and nIL-1F itself, was detected by real-time RT-PCR. The gene expression level at each treatment was first normalized to that of EF-1␣ and then expressed as the p Ͻ 0.05 of the rnIL-1F ,ء .percentage of the rIL-1␤ only group (100%). The results represent the average Ϯ SEM of three samples from individual flasks plus rIL-1␤ treatment groups relative to that of rIL-1␤ only treatment. 972 A NOVEL IL-1 FAMILY MEMBER IN FISH

Discussion a tilt by 20° to domain III of the receptor compared with the The present paper describes the identification of a novel IL-1 agonist/receptor complex. The structural conformation of do- family member present in teleost fish. The unique gene orga- main III is critical in determining agonist/antagonist activity by nization, genomic location, and low homology to known family inducing binding of the accessory protein and activation (58). members suggest this molecule is not homologous to known The predicted nIL-1F loop 4–5 is longer than the corresponding ␤ IL-1F. However, it bears the hallmarks of other members in loop of trout IL-1 , possibly resulting in alternative conforma- having a predicted C-terminal ␤-trefoil structure, containing an tions of domain III in each complex. It is possible that nIL-1F IL-1F signature region within the final exon, an upstream po- binding confers an “inactive” orientation to domain III of the tential ICE cut site that may allow processing of the precursor receptor. It is therefore likely that, as in the human complex, the molecule, and a gene organization where the last three introns orientation of domain III relative to domains I and II determines are in phase 1,1,0 in common with other IL-1F (although 2,1,0 its agonist/antagonist activity by inducing binding of the acces- is also seen in some IL-1F) (13). Additionally, expression of the sory protein. However, if this is the case, then in trout the in- gene is clearly increased following infection, or stimulation of active conformation of the receptor is achieved by different an- macrophages with proinflammatory stimuli such as LPS or IL- tagonist-receptor interactions than in the human complex. 1␤. However, the recombinant protein does not appear to in- The trout nIL-1F is constitutively expressed at relatively high duce proinflammatory gene expression and in fact inhibits the levels in a number of immune sites, including the gills, spleen, effects of rIL-1␤ in in vitro studies, suggesting it may be a novel and head kidney, suggesting it is immune relevant. Addition- ally, it is highly inducible and within a day of bacterial infection fish IL-1␤ antagonist. increases some 10- to 12-fold. Curiously, relative to the expres- Downloaded from Many of the IL-1F are produced as precursor molecules that are sion levels of IL-1␤ isoforms in trout, the induction is slower to cleaved to release a biologically active mature peptide (3), so while occur but remains higher for a longer period, perhaps support- formal proof that this occurs with the nIL-1F is still to be obtained, ing the contention that it is involved in the down-regulation of it would not be surprising for an IL-1F to undergo such processing. IL-1␤-induced inflammatory responses. A macrophage cell line Several members are known to be cleaved by ICE, as with IL-1F1, was shown to express this gene, and good induction was seen 4, 7, and 11. While the ICE cut site is highly conserved during

following stimulation with LPS or rIL-1␤. Analysis for regu- http://www.jimmunol.org/ evolution in IL-1F4 (27), in IL-1F1 it is not obviously present latory elements within the 5Ј flanking region revealed a number outside of mammals (60). However, a number of other enzymes of potentially important transcription factors involved in con- can also cleave the IL-1␤ precursor, and it is quite possible these trolling the expression of this gene. However, in contrast to the are of more importance in lower vertebrates, where evidence of IL-1␤ promoter (trout and mammals) (40) and IL-1ra promoter IL-1␤ processing is apparent (61, 62). In the case of the nIL-1F (63, 64), no NF-␬B sites were discovered, consistent with the further possibilities also exist for processing, with a thrombin cut rather slow induction seen, with NF-␬B being a rapidly acti- site present, that interestingly divides the protein into an N-termi- vated transcription factor induced via pattern recognition recep- nal acidic domain and a C-terminal basic domain, and would give tor recognition of pathogen-derived molecules (8). IL-1ra exists a mature peptide with a shorter N-terminal tail beyond the pre- as secreted (sIL-1ra) and intracellular (icIL-1ra) molecules, by guest on September 25, 2021 ␤ ␤ dicted first -sheet of the -trefoil. Processing of the precursor is driven by two independent promoters, with alternative splicing associated with secretion in some IL-1F (e.g., IL-1F2 and IL-1F4), of the exon containing the signal peptide generating the two while others remain intracellular or membrane bound, as seen with forms (65). The sIL-1ra promoter also requires PU.1 and GABP IL-1F1 (3). for LPS responsiveness (63), whereas the icIL-1ra promoter The produced C-terminal recombinant protein was demon- requires NF-IL-6 in addition to NF-␬B (64), with AP-1 driving strated to have biological activity, in that it could antagonize the constitutive expression (66). Multiple NF-IL-6 and AP-1 sites ␤ effects of trout rIL-1 . These studies could not distinguish be- were identifiable in the nIL-1F promoter region, although in tween whether this effect was due to receptor antagonism or to contrast to the icIL-1ra promoter there was a TATA box, also some signaling interference brought about after binding to a present in the sIL-1ra promoter (65), suggesting conventional different receptor. However, modeling of the nIL-1F and the transcriptional initiation of the nIL-1F gene. trout IL-1RI does hint at the possibility that the nIL-1F could be The genome analysis revealed that the IL-1␤ locus in fish a receptor antagonist. Thus, comparison of the human IL-1ra/ lacks any other IL-1F, in distinct contrast to the situation in IL-1R complex and the modeled trout nIL-1F/IL-1R complex mammals. Thus the IL-1ra gene (IL-1F3), together with many revealed that potential interactions between the two molecules others, is either lacking completely from fish or is in some other and the receptor involved the same loops. However, different region of the genome yet to be discovered. However prelimi- types of bonds are possibly formed as a consequence of the lack nary data here indicates that perhaps a functional homolog of an of sequence similarity between human IL-1ra and the trout nIL- IL-1ra exists in fish, that together with IL-1RII (67) could po- 1F. This is particularly evident in receptor site A. For instance, tentially control IL-1␤ function. Nevertheless, many curious the trout nIL-1F loop 10–11 is shorter by two residues com- features of nIL-1F exist, and its regulation at the gene and pro- pared with humans and may form fewer interactions in that tein levels and the means by which it exerts its biological ac- region. Moreover in site B, modeling studies suggest that the tivity require future investigation. receptor loop c3–d3, which is important in human IL-1␤/IL-1R binding, in trout is located far away from loop 7–8 in a similar way to the human IL-1ra/IL-1R complex. Another region of Disclosures The authors have no financial conflicts of interest. interaction in receptor binding site B of human IL-1␤/IL-1R and IL-1ra/IL-1R complexes is between the loop connecting strands 4 and 5 of IL-1␤ and IL-1ra and the loop between References strands f3 and g3 of the receptor (2, 59). In humans, the length 1. Dunn, E. F., N. J. Gay, A. F. Bristow, D. P. Gearing, L. A. J. O’Neill, and X. Y. Pei. 2003. High-resolution structure of murine interleukin 1 homologue of the loop 4–5 in the antagonist is shorter by six residues IL-1F5 reveals unique loop conformations for receptor binding specificity. Bio- compared with agonist molecules, and upon binding it confers chemistry 42: 10938–10944. The Journal of Immunology 973

2. Koussounadis, A. I., D. W. Ritchie, G. J. L. Kemp, and C. J. Secombes. 2004a. 28. Stansberg, C., S. Subramaniam, L. Olsen, C. J. Secombes, and C. Cunningham. Analysis of fish IL-1␤ and derived peptide sequences indicates conserved struc- 2003. Cloning and characterisation of a putative ST2L homologue from Atlantic tures with species-specific IL-1 receptor binding: implications for pharmacolog- salmon (Salmo salar). Fish Shellfish Immunol. 15: 211–224. ical design. Curr. Pharm. Design 10: 3857–3871. 29. Wang, T., and C. J. Secombes. 2003. Complete sequencing and expression of 3. Barksby, H. E., S. R. Lea, P. M. Preshaw, and J. J. Taylor. 2007. The expanding three complement components, C1r, C4 and C1 inhibitor, of the classical acti- family of interleukin-1 cytokines and their role in destructive inflammatory dis- vation pathway of the complement system in rainbow trout Oncorhynchus orders. Clin. Exp. Immunol. 149: 217–225. mykiss. Immunogenetics 55: 615–628. 4. Schmitz, J., A. Owyang, E. Oldham, Y. Song, E. Murphy, T. K. McClanahan, 30. Pearson, W. R., and D. I. Lipman. 1988. Improved tools for biological sequence G. Zurawski, M. Moshrefi, J. Qin, X. Li, et al. 2005. IL-33, an interleukin-1-like comparison. Proc. Natl. Acad. Sci. USA 85: 2444–2448. cytokine that signals via the IL-1 receptor-related protein ST2 and induces T 31. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and helper type 2-associated cytokines. Immunity 23: 479–490. D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of pro- 5. Auron, P. E. 1998. The interleukin-1 receptor: ligand interactions and signal tein database search programs. Nucleic Acids Res. 25: 3389–3402. transduction. Cytokine Growth Factor Rev. 13: 483–502. 32. Campanella, J. J., L. Bitincka, and J. Smalley. 2003. MatGAT: an application that 6. Towne, J. E., K. E. Garka, B. R. Renshaw, G. D. Virca, and J. E. Sims. 2004. generates similarity/identity matrices using protein or DNA sequences. BMC Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP Bioinformatics 4: 29. to activate the pathway leading to NF-␬B and MAPKs. J. Biol. Chem. 279: 33. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improv- 13677–13688. ing the sensitivity of progressive multiple sequence alignment through sequence 7. Chackerian, A. A., E. R. Oldham, E. E. Murphy, J. Schmitz, S. Pflanz, and weighting, position specific gap penalties and weight matrix choice. Nucleic Ac- R. A. Kastelein. 2007. IL-1 receptor accessory protein and ST2 comprise the ids Res. 22: 4673–4680. IL-33 receptor complex. J. Immunol. 179: 2551–2555. 34. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for 8. Ringwood, L., and L. Li. 2008. The involvement of the interleukin-1 receptor- reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–425. associated kinases (IRAKs) in cellular signaling networks controlling inflamma- 35. Page, R. D. 1996. TreeView: an application to display phylogenetic trees on tion. Cytokine 42: 1–7. personal computers. Comput. Appl. Biosci. 12: 357–358. 9. Kumar, S., C. R. Hanning, M. R. Brigham-Burke, D. J. Rieman, R. Lehr, 36. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the S. Khandekar, R. B. Kirkpatrick, G. F. Scott, J. C. Lee, F. J. Lynch, et al. 2002. bootstrap. Evolution 39: 783–791. Downloaded from Interleukin-1F7B (IL-1H4/IL-1F7) is processed by caspase-1 and mature IL- 37. Wang, T., M. Ward, P. Grabowski, and C. J. Secombes. 2001. Molecular cloning, ␥ 1F7B binds to the IL-18 receptor but does not induce IFN- production. Cytokine gene organization and expression of rainbow trout (Oncorhynchus mykiss) in- 18: 61–71. ducible nitric oxide synthase (iNOS) gene. Biochem. J. 358: 747–755. 10. Novick, D., S.-H. Kim, G. Fantuzzi, L. L. Reznikov, C. A. Dinarello, and 38. Florea, L., G. Hartzell, Z. Zhang, G. M. Rubin, and W. Miller. 1998. A computer M. Rubinstein. 1999. Interleukin-18 binding protein: a novel modulator of the program for aligning a cDNA sequence with a genomic DNA sequence. Genome Th1 cytokine responses. Immunity 10: 127–136. Res. 8: 967–974. 11. Bufler, P., T. Azam, F. Gamboni-Robertson, L. L. Reznikov, S. Kumar, 39. Prestridge, D. S. 1991. SIGNAL SCAN: a computer program that scans DNA C. A. Dinarello, and S.-H. Kim. 2002. A complex of the IL-1 homologue IL-1F7b sequences for eukaryotic transcriptional elements. Comput. Appl. Biosci. 7: and IL-18-binding protein reduces IL-18 activity. Proc. Natl. Acad. Sci. USA 99: 203–206. http://www.jimmunol.org/ 13723–13728. 40. Wang, T., J. Zou, C. Cunningham, and C. J. Secombes. 2002. Cloning and func- 12. Moulin, D., O. Donze´, D. Talabot-Ayer, F. Me´zin, G. Palmer, and C. Gabay. tional characterisation of the interleukin-1␤ 1 promoter of rainbow trout (On- 2007. Interleukin (IL)-33 induces the release of pro-inflammatory mediators by corhynchus mykiss). Biochim. Biophys. Acta 1575: 108–116. mast cells. Cytokine 40: 216–225. 41. Burge, C. B., and S. Karlin. 1998. Finding the genes in genomic DNA. Curr. 13. Taylor, S. L., B. R. Renshaw, K. E. Garka, D. E. Smith, and J. E. Sims. 2002. Opin. Struct. Biol. 8: 346–354. Genomic organization of the interleukin-1 locus. Genomics 79: 726–733. 42. Koussounadis, A., D. W. Ritchie, and C. J. Secombes. 2004b. Modelling ␤-trefoil 14. Nicklin, M. J. H., J. L. Barton, M. Nguyen, M. G. FitzGerald, G. W. Duff, and proteins using an object-oriented database. In 21st Annual British National Con- K. Kornman. 2002. A sequence-based map of the nine genes of the human in- ference on Databases, Proceedings, Vol. 2. Heriot-Watt University, Edinburgh, terleukin-1 cluster. Genomics 79: 718–725. pp. 59–67. 15. Busfield, S. J., C. A. Comrack, G. Yu, T. W. Chickering, J. S. Smutko, H. Zhou, 43. Sali, A., and T. L. Blundell. 1993. Comparative protein modelling by satisfaction K. R. Leiby, L. M. Holmgren, D. P. Gearing, and Y. Pan. 2000. Identification and

of spatial restraints. J. Mol. Biol. 234: 779–815. by guest on September 25, 2021 gene organization of three novel members of the IL-1 family on human chromo- some 2. Genomics 66: 213–216. 44. Laskowski, R. A., M. W. MacArthur, D. S. Moss, and J. M. Thornton. 1993. PROCHECK: a program to check the stereochemical quality of protein struc- 16. Bird, S., J. Zou, and C. J. Secombes. 2006. Advances in fish cytokine biology tures. J. Appl. Crystallogr. 26: 283–291. give clues to the evolution of a complex network. Curr. Pharm. Design 12: 3051–3069. 45. Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: Electrophoresis 17. Savan, R., and M. Sakai. 2006. Genomics of fish cytokines. Comp. Biochem. an environment for comparative protein modeling. 18: Physiol. D Genomics Proteomics. 1: 89–101. 2714–2723. 18. Zou, J., P. S. Grabowski, C. Cunningham, and C. J. Secombes. 1999. Molecular 46. Wang, T., J. W. Holland, A. Carrington, J. Zou, and C. J. Secombes. 2007. ␤ Molecular and functional characterization of IL-15 in rainbow trout Oncorhyn- cloning of interleukin 1 from rainbow trout Oncorhynchus mykiss reveals no ␥ evidence of an ICE cut site. Cytokine 11: 552–560. chus mykiss: a potent inducer of IFN- expression in spleen leukocytes. J. Im- munol. 19. Bird, S., T. Wang, J. Zou, C. Cunningham, and C. J. Secombes. 2002. The first 179: 1475–1488. cytokine sequence within cartilaginous fish: IL-1␤ in the small spotted catshark 47. Wang, T., P. C. Hanington, M. Belosevic, and C. J. Secombes. 2008. Two mac- (Scyliorhinus canicula). J. Immunol. 168: 3329–3340. rophage colony-stimulating factor genes exist in fish that differ in gene organi- 20. Hong, S., J. Zou, M. Crampe, S. Peddie, G. Scapigliati, N. Bols, zation and are differentially expressed. J. Immunol. 181: 3310–3322. C. Cunningham, and C. J. Secombes. 2001. The production and bioactivity of 48. Ganassin, R. C., and N. Bols. 1998. Development of a monocyte/macrophage- rainbow trout (Oncorhynchus mykiss) recombinant IL-1␤. Vet. Immunol. Im- like cell line, RTS11, from rainbow trout spleen. Fish Shellfish Immunol. 8: munopathol. 81: 1–14. 457–476. 21. Martin, S. A. M., J. Zou, D. F. Houlihan, and C. J. Secombes. 2007. Directional 49. Wang, T., J. W. Holland, N. Bols, and C. J. Secombes. 2005. Cloning and ex- responses following recombinant cytokine stimulation of rainbow trout (On- pression of the first nonmammalian interleukin-11 gene in rainbow trout On- corhynchus mykiss) RTS-11 macrophage cells as revealed by transcriptome pro- corhynchus mykiss. FEBS J. 272: 1136–1147. filing. BMC Genomics 8: 150. 50. Hulo, N., C. J. Sigrist, V. Le Saux, P. S. Langendijk-Genevaux, L. Bordoli, 22. Peddie, S., J. Zou, C. Cunningham, and C. J. Secombes. 2001. Rainbow trout A. Gattiker, E. De Castro, P. Bucher, and A. Bairoch. 2004. Recent improve- (Oncorhynchus mykiss) recombinant IL-1␤ and derived peptides induce mi- ments to the PROSITE database. Nucleic Acids Res. 32: D134–D137. gration of head kidney leucocytes in vitro. Fish Shellfish Immunol. 11: 51. McGuffin, L. J., and D. T. Jones. 2003. Improvement of the GenTHREADER 697–709. method for genomic fold recognition. Bioinformatics 19: 874–881. 23. Pleguezuelos, O., J. Zou, and C. J. Secombes. 2000. Cloning, sequencing and 52. Murzin, A. G., A. M. Lesk, and C. Clothia. 1992. ␤-trefoil fold: patterns of analysis of expression of a second IL-1␤ gene in rainbow trout (Oncorhynchus structure and sequence in the Kunitz inhibitors, interleukin-1␤ and 1␣ and fibro- mykiss). Immunogenetics 51: 1002–1011. blast growth factors. J. Mol. Biol. 223: 531–543. 24. Engelsma, M. Y., R. J. M. Stet, J. P. Saeij, and B. M. L. Verburg-van Kemenade. 53. Murzin, A. G., S. E. Brenner, T. Hubbard, and C. Chothia. 1995. SCOP: a struc- 2003. Differential expression and haplotypic variation of two interleukin-1␤ tural classification of proteins database for the investigation of sequences and genes in the common carp (Cyprinus carpio). Cytokine 22: 21–32. structures. J. Mol. Biol. 247: 536–540. 25. Wang, T., N. Johnson, J. Zou, N. Bols, and C. J. Secombes. 2004. Sequencing 54. Orengo, C. A., A. D. Michie, S. Jones, D. T. Jones, M. B. Swindells, and and expression of the second allele of the interleukin-1␤1 gene in rainbow trout J. M. Thornton. 1997. CATH: a hierarchic classification of protein domain struc- (Oncorhynchus mykiss): identification of a novel SINE in the third intron. Fish tures. Structure 5: 1093–1108. Shellfish Immunol. 16: 335–358. 55. Corpet, F., J. Gouzy, and D. Kahn. 1998. The ProDom database of protein do- 26. Huising, M. O., R. J. M. Stet, H. F. J. Savelkoul, and B. M. L. Verburg-van main families. Nucleic Acids Res. 26: 323–326. Kemenade. 2004. The molecular evolution of the interleukin-1 family of cytokines; 56. Finn, R. D., J. Mistry, B. Schuster-Bo¨ckler, S. Griffiths-Jones, V. Hollich, IL-18 in teleost fish. Dev. Comp. Immunol. 28: 395–413. T. Lassmann, S. Moxon, M. Marshall, A. Khanna, R. Durbin, et al. 2006. Pfam: 27. Zou, J., S. Bird, J. Truckle, N. Bols, M. Horne, and C. J. Secombes. 2004. clans, web tools and services. Nucleic Acids Res. 34: D247–D251. Identification and expression analysis of an IL-18 homologue and its alternatively 57. Scapigliati, G., S. Costantini, G. Colonna, A. Facchiano, F. Buonocore, P. Bossu`, spliced form in rainbow trout Oncorhynchus mykiss. Eur. J. Biochem. 271: C. Cunningham, J. W. Holland, and C. J. Secombes. 2004. Modelling of fish 1913–1923. interleukin-1 and its receptor. Dev. Comp. Immunol. 28: 429–441. 974 A NOVEL IL-1 FAMILY MEMBER IN FISH

58. Schreuder, H., C. Tardif, S. Trump-Kallmeyer, A. Soffientini, E. Sarubbi, 63. Smith, M. F., Jr., V. S. Carl, T. Lodie, and M. J. Fenton. 1998. Secretory inter- A. Akeson, T. Bowlin, S. Yanofsky, and R. W. Barrett. 1997. A new cytokine- leukin-1 receptor antagonist gene expression requires both a PU.1 and a novel receptor binding mode revealed by the crystal structure of the IL-1 receptor with composite NF-␬B/PU.1/GA-binding protein binding site. J. Biol. Chem. 273: an antagonist. Nature 386: 194–200. 24272–24279. 59. Vigers, G. P. A., L. J. Anderson, P. Caffes, and B. J. Brandhuber. 1997. Crystal 64. La, E., and S. M. Fischer. 2001. Transcriptional regulation of intracellular IL-1 structure of type-I interleukin-1 receptor complexed with interleukin-1␤. Nature receptor antagonist gene by IL-1␣ in primary mouse keratinocytes. J. Immunol. 386: 190–194. 166: 6149–6155. 60. Bird, S., J. Zou, T. Wang, B. Munday, C. Cunningham, and C. J. Secombes. 65. Arend, W. P., and C. H. Evans. 2003. Intereluekin-1 receptor antagonist (IL-1F3). 2002b. Evolution of IL-1␤ in vertebrates. Cytokine Growth Factor Rev. 13: In The Cytokine Handbook, 4th Ed. A. W. Thomson and M. T. Lotze, eds. Ac- 483–502. ademic, London, pp. 669–708. 61. Hong, S., J. Zou, B. Collet, N. C. Bols, and C. J. Secombes. 2004. Analysis and 66. La, E., J. E. Rundhaug, A. Pavone, and S. M. Fischer. 2002. Regulation of characterisation of IL-1␤ processing in trout, Oncorhynchus mykiss. Fish Shell- transcription of the intracellular interleukin-1 receptor antagonist gene by AP-1 in fish Immunol. 16: 453–459. mouse carcinoma cells. Mol. Carcinog. 33: 237–243. 62. Pelegrin, P., E. Chaves-Pozo, V. Mulero, and J. Meseguer. 2004. Production and 67. Sangrador-Vegas, A., S. A. M. Martin, P. G. O’Dea, and T. J. Smith. 2000. mechanisms of secretion of interleukin-1␤ from the marine fish gilthead sea- Cloning and characterisation of the rainbow trout (Oncorhynchus mykiss) type II bream. Dev. Comp. Immunol. 28: 229–237. interleukin-I receptor cDNA. Eur J. Biochem. 267: 7031–7037. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021