Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. cito fteCsotrdca Rtfl ta.21b.This 2012b). al. et recircum- (Rothfels and Cystopteridaceae resurrection the the of character in scription culminating and group, this taxon understanding of clear increasingly greater an yielded phylo- with sampling—have molecular (Athyriaceae Subsequent studies—those ferns (2012b)). athyrioid genetic al. and et (2006)) Rothfels al. sensu et Smith (Dryopteridaceae evolu- sensu dryopteroid are the they both that from and distinct another, tionarily one to allied closely indeed, that evidence molecular first 2012b). al. grouped et (2006) that al. R. et concepts Z. Smith and and familial recently, (2004) Quite advocated al. et 2012b). each Wang al. L. Fraser-Jenkins M. et (1997), 2000; Rothfels Wang al. 2008; et Liu Sano 2008; 1977; Kato Athyriaceae; the te oyo en a otne ni eyrcnl.For included recently. Schmakov confusion very (2001) Cystopteridaceae, family until the This continued naming when has example, 1973). ferns polypod Sledge of other (e.g. affinities the positions uncertain phylogenetic regarding their thus that anomalous and were morphologically lineages each those were with within they respectively, the that to lineages, caveat assigned fern the were athyrioid usually and taxa dryopteroid two these not Instead, did allied. taxonomists proliferation most the however, consider to evidence, Prior molecular 1963). of of Blasdell concept 1935; historically broad Tagawa a authors (e.g. under many together them with treating relatives, close considered contentious. North been in have Acystopteris relationships habitats familiar- phylogenetic rocky their their despite frequently ity, and However, Asia. most forested and Europe, hemisphere, America, most the northern in among the in ferns occurring ferns E–H)—are oak familiar and and 1A–C, ferns, encountered fragile Fig. ferns, bladder (see fern, bulblet the O 10.1600/036364413X666787 DOI © Botany Systematic oyih 03b h mrcnSceyo ln Taxonomists Plant of Society American the by 2013 Copyright lsi hlgn fteCsooia enFml ytpeiaee(Polypodiopsida) Cystopteridaceae Family Fern Cosmopolitan the of Phylogeny Plastid A ofe l 19)adHsb ta.(95 rvddthe provided (1995) al. et Hasebe and (1994) al. et Wolf Cystopteris Gymnocarpium hticue otrcgie pce ntefml n utpeacsin fwdsra aafo costergorpi ags All ranges. geographic their with across from taxa widespread of ( dataset accessions plastid multiple to three-locus and sister a monophyletic, are as assemble family supported together we the robustly sampling in Here are in Antarctica), family sparse. genera except this species been sampled continent of three has recognized every ubiquity date most on the to (occurring Despite includes studies distribution Cystopteridaceae. that phylogenetic cosmopolitan the in its family, Cystopteridaceae and own the hemisphere, their of northern into the placed across and habitats Woodsiaceae rocky from removed been have genera is oeua hlgntceiec o pce onais hs aapoiea seta onainfrfrhrivsiain fcomplex of family. investigations this further in for reticulation foundation and essential an speciation, provide diversification, data geographic These of boundaries. patterns species for evidence phylogenetic molecular first sudetica the clade, genera Abstract— Keywords— .taiwaniana A. Cystopteris Acystopteris 1 ld,the clade, eateto ilg,Dk nvriy otOfc o 03,Dra,NrhCrln 70,U .A. S. U. 27708, Carolina North Durham, 90338, Box Office Post University, Duke Biology, of Department 21) 82:p.295–306 pp. 38(2): (2013), aa Fg D and 1D) (Fig. Nakai robertianum en.and Bernh. mn h oe eut frcn oeua hlgntcaaye r h nxetdycoeeouinr eainhp fthe of relationships evolutionary close unexpectedly the are analyses phylogenetic molecular recent of results novel the Among ompltnspecies, Cosmopolitan Pseudocystopteris bulbifera ihvr itnl eae aa(Rothfels taxa related distantly very with , itrt the to sister Cystopteris ..and s.l. Gymnocarpium ld,adcore and clade, Gymnocarpium alJ Rothfels, J. Carl ld,adthe and clade, Cystopteris Cystopteris ,and japonica/tenuisecta Gymnocarpium Cystopteris Gymnocarpium The . hn wihblnsin belongs (which Ching Gymnocarpium Cystopteris fragilis 2 and and Gymnocarpium uhrfrcrepnec ([email protected]) correspondence for Author Newman—including Gymnocarpium Gymnocarpium 1,2 complex. enphylogeny, fern , aeln been long have n h hlgntcioaino hs eeafrom genera these of isolation phylogenetic the and , omnctn dtr utnMast Austin Editor: Communicating ld.Orrslsyedtefrtseislvlpyoeyo h ytpeiaeeadthe and Cystopteridaceae the of phylogeny species-level first the yield results Our clade. ihe .Windham, D. Michael ob closely be to .The Cystopteris Cystopteris hlgn sdel iie notremjrcae,wihw ae the label we which clades, major three into divided deeply is phylogeny Cystopteris Acystopteris Cystopteris are, to Gymnocarpium hlgn,smlry etrsfu epydvre clades: diverged deeply four features similarly, phylogeny, 295 nldsol he pce,ec fwihi upre smonophyletic, as supported is which of each species, three only includes he in three i eei ocp) n h lss ehv oaglobal a to have we closest the of and monograph concept), included he generic 1963; his (Blasdell ago yr 50 graphed unclear. remain the well taxa among relatively included relationships now and are boundaries life species of established, tree fern the within placement 2012). Rothfels 1963; approximately comprise genera in seven three species: 37 other The Rothfels, and Sundue unpubl.). of 2012b; member al. a et be morpho- (Rothfels may Cystopteridaceae limited it suggests the available date, information logical to study phylogenetic molecular Gymnocarpium Pryer 2012a). lineages al. and fern last et (Schuettpelz Rothfels extant ago 2009; ferns—it years other million with eupolypod 100 ancestor approximately a within represents common and a 2012a) lineage shared al. Pryer et isolated and Rothfels Schuettpelz 2011; deeply al. 2000; et al. Kuo et large 2007; (Sano the of clade rest the II to eupolypod sister position critical a occupies family netgtosudrae odt aervae htthe that revealed have date to undertaken investigations nesenadsuhr fia atr utai,New islands Australia, “ oceanic the eastern rocky D; isolated 2C, Africa, (Fig. many and southern Hawai’i, and del Zealand, Tierra occurring eastern to Eurasia, and of arctic in most high 2A), blanketing the Americas, (Fig. the from in ranging Fuego Eurasia world, the and in fern America North fragilis of Cystopteris both Populations of 2). half (Fig. dryopteris distributions G. geographical broad Both 1978). al. et (Rothfels extinct be may and Although PE from 2012b). at only known specimen is type that China the from species single a includes Cystoathyrium ssrnl upre ssse to sister as supported strongly is lhuhtecrusrpino ytpeiaeeadits and Cystopteridaceae of circumscription the Although genera— three least at of consists Cystopteridaceae The nrlnaeicnrec,seiscomplex. species incongruence, intralinkage , 1 n ahenM Pryer M. Kathleen and Acystopteris o xml,aesatrdars h northern the across scattered are example, for , Cystopteris , hn Rtfl ta.21a 02) h latter The 2012b). 2012a, al. et (Rothfels Ching Gymnocarpium Acystopteris .fragilis C. Cystoathyrium ..i ehp h otwdl distributed widely most the perhaps is s.l. Gymnocarpium n bu 7in 27 about and , Woodsia and ope”.Tefwbiosystematic few The complex”). and , Acystopteris Gymnocarpium sasxpg yoss(Sarvela synopsis six-page a is sacneune hs three these consequence, a As . Cystopteris a o enicue nany in included been not has 1 Cystopteris Srea17;Pyr1993), Pryer 1978; (Sarvela n hs w genera two those and , aK bL trnG-R rbcL, matK, Cystopteris ..wsls mono- last was s.l. .montana C. aeextremely have adpossibly —and Acystopteris disjunctum (Blasdell ,the ) in Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. iepedseiso both of species widespread 38 [Volume BOTANY SYSTEMATIC 296 B. ouigo h rnhn dvret eainhp sa as boundaries species relationships investigating (divergent) for branching prerequisite necessary family— the the for on phylogeny robust focusing first the primary establish geographic Our to polyploids). is the the goal (especially across taxa many from of Cystopteridaceae, ranges accessions of dataset multiple species plastid rela- recognized including three-locus most phylogenetic a includes basic assemble that their we understand complexes, Here, to species tionships. need these first within we phylogeography 1983; and al. tion and Pryer et 1991; Pryer Windham and 1978; Haufler 1993). Sarvela Haufler 1990; al. 1974; et 1972, Haufler (Vida his- evolutionary in tories reticulate involve differ typically often and level these ploidy lineages; independent multiple include rmOuaaMci oy,Hnh,Jpn.D. Japan]. Honshu, Tokyo, Okutama-Machi, from egib,Gihu.E. Guizhou]. Lengjiaba, DK) aaa atnRgo,Otro.G. Ontario]. Region, H. Halton Canada, (DUKE), .dryopteris G. Fig. nodrt xlr h nrgigpten fdiversifica- of patterns intriguing the explore to order In .pellucida C. .Sloetso ersnaieCsotrdca pce.A. species. Cystopteridaceae representative of Silhouettes 1. [ ofod249 oohe Ree & Donoghue, 27439, Boufford [ ohes4048.3 Rothfels ytpei montana Cystopteris DK) .S . iahvnIln,Mie.C. Maine]. Island, Vinalhaven A., S. U. (DUKE), Cystopteris [ ida 7 Haufler & 670 Windham CS,Cia uigXa,Sichuan]. Xian, Luding China, (CAS), .bulbifera C. and csotrsjaponica Acystopteris Gymnocarpium [ ohes35 .Rothfels P. & 3951 Rothfels DK) .S . umtCut,Clrd] F. Colorado]. County, Summit A., S. U. (DUKE), yncrimrobertianum Gymnocarpium [ ioAeia uzo oaia xeiin1961 Expedition Botanical Guizhou Sino-American ntels f3 pce ettvl cetdb ohes(02 his (2012; Rothfels by accepted tentatively of species species three all 37 includes study of Tejero-Dı our E), and Appendix list 1993; Mickel Haufler the and 1981; 1998; Pryer on al. 1993; al. al. et et Sarvela et Haufler 1978; Blasdell 1983; Pellinen Sarvela al. 1935; et 1974; Pryer (Tagawa Trikha 1983; and Moran works Bir named taxonomic 1972; of Mickel published inclusion 1963; the in maximize appearing to taxa selected Cystopteridaceae, of sions notru fnn pce ctee hogottermidrof remainder and the (Schuettpelz included throughout Cystopteridaceae we to scattered tree, group species the sister nine root II—the scattered To Eupolypods of accessions ranges. outgroup multiple geographic an include known to their attempted across we species, spread of species n eiuaeeouinwti ytpeiaee(Rothfels Cystopteridaceae unpubl.). al., within et evolution reticulate and .oyamense G. aooi Sampling— Taxonomic Gymnocarpium DK) aaa ed n rnil ony Ontario]. County, Grenville and Leeds Canada, (DUKE), [ aaos n. s. Nakato aeil n Methods and Materials [ aso 282 Larsson n 9o h 7seisof species 27 the of 19 and , eaaye nigopsml f7 acces- 75 of sample ingroup an analyzed We DK) rmcliain rgnlycollected originally cultivation; from (DUKE), DK) owy ot fFauske]. of north Norway, (DUKE), .tenuis C. ´ z20;Wn 08.Based 2008). Wang 2004; ez M) hn,vcnt of vicinity China, (MO), [ ohes32 Lewer & 3927 Rothfels Acystopteris Cystopteris. l seven all , o wide- For Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 94 rsrJnis18;Lbn18;Paa18;SloadOemn18;Beke18;Hulre l 90 afe n ida 91 afe tal. et Haufler al 1991; et Windham Britton and 1983; 2012). Haufler Tejero-Dı Systematics Moran 1990; and Plant al. 1981; Mickel for et al. 2001; Society Haufler et al. Japanese 1987; et Sarvela 2011; Breckle Velayos 1978; al. 1986; 2000; Sarvela et Otermin Latorre Crouch 1974; 1998; and Trikha Denk Salvo and 1993; 1986; Bir Pryer Prada 1993; 1972; 1986; Mickel Lobin 1935; 1986; (Tagawa Fraser-Jenkins works 1984; floristic published from determined 03 OHESE L:CSOTRDCA HLGN 297 PHYLOGENY CYSTOPTERIDACEAE AL.: ET ROTHFELS 2013] neti ag iis ooe ice niaetecleto oaino h ocesue nti td;anmrlisd h ooe iceindi circle colored the inside numeral a study; this in A: used location. vouchers laurentiana that the C. of from location accessions collection of the indicate number circles Colored limits. range uncertain Fig. .Gorpi agso ape aao ytpeiaee agsaeapoiae yteclrdplgn,wt otdlnsindicating lines dotted with polygons, colored the by approximated are Ranges Cystopteridaceae. of taxa sampled of ranges Geographic 2. and .reevesiana C. :The D: . .fragilis C. Gymnocarpium ope (excluding complex .B: Acystopteris .laurentiana C. and ytpei montana Cystopteris ´ and z20;Mrh n usy20;Fae-ekn 08 ag2008; Wang 2008; Fraser-Jenkins 2005; Rumsey and Murphy 2004; ez .reevesiana C. hc r rsne npnlC.Rneboundaries Range C). panel in presented are which , .C:The .bulbifera C. ld,the clade, C . sudetica ld,and clade, ae the cates . Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ieiodbosrpspot Tecmie aae a nlzdudrapriindmdl ihec ou ie t w etftigmodel. best-fitting own its given locus each with model, partitioned a under analyzed was dataset combined *The support. bootstrap likelihood eune n soitddt r rvddi al .Tefl egh of lengths full The 1. Table in matK provided are data associated and sequences rbcL obnd8 6915 74– 0 85% 90% –* 17.4 1353 3639 84 combined trnG-R rbcL matK 38 [Volume analysis: for selected were loci Valencia, (Qiagen, plastid kits Three DNeasy using USA). or pro- 1987), California, CTAB Dickson standard and a (Doyle of doi:10.5061/dryad.11p757m0) tocol 2011; al. Silica Lab et modification Fern (Beck 96-well the a in using material (http://fernlab.biology.duke.edu/) silica-dried Archive or specimens herbarium from accessions 84 includes sample total Our 1). 2012a). (Appendix al. et Rothfels BOTANY 2007; SYSTEMATIC Pryer trnG-R trnG-R trnG-R trnG-R rbcL rbcL rbcL rbcL matK matK matK matK 298 eue h aeporm xetta h neln eprtr was temperature annealing the that except program, 45 same the used we 2 and rbcL ESRBCL1F et,uigteprimers the using ments, ain n ro,Mcia) n h eutn 6 el generated newly 169 resulting 1). (Appendix the GenBank in and deposited are Chromato- Michigan), Corpo- sequences Codes Arbor, 2007). (Gene 4.5 Ann Pryer Sequencher in ration, edited and and assembled (Schuettpelz were grams protocols the again Resource, established at Prism Core California) Analysis ABI using and Carlsbad, an Sequencing Biosystems, on Genome University sequenced (Applied Duke and Analyzer estab- 2012a) DNA al. following 3700 et Ohio) (Rothfels Cleveland, protocols (USB, lished Phosphatase Alkaline Shrimp neln,adeogto yls(94 cycles elongation and annealing, . i) n ia lnainse (72 step elongation final a and min), 1.5 0.2 Most matK erhswr efre n50bosrppedrpiaedtst,each datasets, pseudoreplicate bootstrap 500 on performed were searches 2004) Anderson and Burnham 1989; in Tsai and Hurvich Criterion 1974; Information Akaike Akaike (AICc; three-locus the for correction combined small-sample the by a mined and in incongruence) maximum (ML) under likelihood analyzed single- were for datasets three single-locus The the test 2). analyzed: (Table dataset were (to datasets four datasets of locus total A to analysis. (limited to prior regions Maddison aligned and (Maddison Ambiguously v2.72 2009). Mesquite in aligned manually were locus osse fa nta eauainse (94 step denaturation initial an of consisted 13.6 and DNA, ou rmrSqec (5 Sequence Primer Locus m aae aaIcue ie aibestsMsigdt % etftigmodel Best-fitting (%) data Missing sites Variable sites Included Taxa Dataset N slto,Apiiain n Sequencing— and Amplification, Isolation, DNA euneAinetadPyoeei Analysis— Phylogenetic and Alignment Sequence Table Table jModeltest evlebfe 1x,2 (10x), buffer Denville l for C m n the and , ES645F a mlfe ntopee,uigtepie pairs primer the using pieces, two in amplified was evleCoc a 5U/ (5 taq Choice Denville l and and rbcL rbcL .Saitc o h aaesaaye nti td.Msigdt nldsbt neti ae ? ,R ,ec)adgp -;MB:maximum MLBS: (-); gaps and etc.) Y, R, N, (?, bases uncertain both includes data Missing study. this in analyzed datasets the for Statistics 2. reverse). = R forward; = (F sequencing and amplification in used Primers 1. trnG-R trnG1F + eune eeapiidi n ic sn h rmrpair primer the using piece one in amplified were sequences + ES1361R ES1361R 011(oaa20;seTbe2.Frec ou,M tree ML locus, each For 2). Table see 2008; (Posada v0.1.1 trnG-trnR n 55 and + eeapiidadsqecdi w vrapn frag- overlapping two in sequenced and amplified were m CRcysTRNGr1 fwtr u hra yln rga for program cycling thermal Our water. of l Garli o oehraimseieswt erddDNA, degraded with specimens herbarium some For . rR2 TTCTAAGTGC Nglnu ta.2007) al. et (Nagalingum 2007) al. et (Nagalingum study This study This 2007) 2007) Pryer Pryer and and (Schuettpelz CTATCCATTAGACGATGGACG (Schuettpelz study This 2007) 2007) Pryer Pryer and and (Schuettpelz (Schuettpelz study This GCGGGTATAGTTTAGTGGTAA GTGGCATCCATAAAATCYATGTCAG GCTAYACGACCAARACGTAAGC R study study This ATGTCACCACAAACGGAGACTAAAGC This TCAGGACTCCACTTACTAGCTTCACG TACRAATARGAAACGRTCTCTCCAACG F TCAGGACTCCACTTACTAGCTTCACG R CGATTTCGTAMATGTARAAATTTCG F ATYTCAATCTACGCAATCCAT TGGAAAGGTYAYTCAGTTYCGGTCTTGG F R GTATTACAKAAAAGTGRAGRGCTTAG R trnR22R F CRcysTRNGr1 R CRcysTRNGf1 R trnG1F F ESRBCL1361R F ESRBCL663R ES645F ESRBCL1F AJmatKr3B AJmatKr1 AJmatKf3 AJmatKf1 411 3 . V++ 7 80% 85% 67% 87% 90% 81% TVM+I+G TrNef+I+G GTR+G 4.9 6.2 1.6 538 256 559 1119 1309 1211 84 61 74 oiwr mlfe n21 in amplified were Loci . for C 20(wcl20) sn h etmdla deter- as model best the using 2006), (Zwickl v2.0 AJmatKf1 negncsae hneot “ (henceforth spacer intergenic m NP ec m) 0.2 2mM), (each dNTPs l trnG-R m and + ) 1 l), AJmatKr3B C rdcswr uiidusing purified were products PCR . o 5sc 50 sec, 45 for C CRcysTRNGf1 m o 0mn.For min). 10 for C fec rmr(10 primer each of l o i) 5denaturation, 35 min), 3 for C and m trnG-R ecin ossigof consisting reactions l AJmatKf3 + o 0sc 72 sec, 30 for C N a extracted was DNA trnR22R m eune o each for Sequences ESRBCL1F S 1 mg/ml), (10 BSA l trnG-R eeexcluded were ) rbcL + AJmatKr1 m and for ) 1 M), ) Primer ”). + ES633R trnG-R trnG-R matK matK for C m lof for , . ihrpretg fsrnl upre iattos than bipartitions) of supported numbers strongly trnG-R of differing percentage higher the dif- the comparisons of While precise ficult, make one datasets the and combined. among individually, sequences locus loci each for three one study: this ie o l aaeeswr rae hn30 u ia three-locus final Our 300. than S13449). greater (accession sample TreeBASE were effective from available samples; parameters summarizing is 24,000 dataset to all included prior for burn-in, pool as final sizes run Our each posterior. the of excluded the generations we million conservative, space) very 5 parameter be first of to area generations; same 500,000 the before to (and well converged each runs The 2007). in ihasml ae vr ,0 eeain.Tersligsample resulting The generations. genera- in 7,500 visualized million every were 50 traces taken for parameter run sample were a heated), (ratepr=variable); each with three runs, tions different cold, independent (one Four be chains values. default four to their with allowed at left were were priors partition other each average for The rates statefreqpr=dirichlet(1,1,1,1)). rates=gamma (nst=6 forward for settings model (statefreqpr=fixed(equal)). The is fteecnlcsi eaieyminor: relatively is conflicts these of first lea ta.20) ihprmtr nikdaogtetrepartitions. three the the among for in models unlinked best-fitting parameters The performed with 2004), were al. et analyses of Altekar Bayesian version of The random- parallel assessed each two trees. from from was starting searched started support each addition tree and pseudoreplicates, (subset- best bootstrap trees, ML 1,000 rate starting with the average random-addition for own different search its 20 The among 1). permitted unlinked = partition parameters specificrates each the substitution and as locus, by partitions, settings single partitioned same a data the in the used (above), analyses analyses ML single-locus The frameworks. Bayesian ( supported highly 1996). Kellogg for from and compared trees (Mason-Gamer splits were consensus incompatible support) majority-rule trees bootstrap bootstrap The of values. pool default each their at settings other left trees; were starting random-addition different two from searched tings; set- rates=invgamma statefreqpr=dirichlet(1,1,1,1) and nst=mixed, the with hr r w elspotdcnlcsaogtelc.The loci. the among conflicts well-supported two are There Analyses— Phylogenetic h obndtrelcsdtstwsaaye ne ohM and ML both under analyzed was dataset three-locus combined The rbcL hc ntr outperforms turn in which , matK 0 –3 ifrdi htbs rqece eefxda .5each 0.25 at fixed were frequencies base that in differed 0 Reference ) per ob oeifraie(..i a a has it (i.e. informative more be to appears MrBayes rbcL 312(oqitadHesnek2003; Huelsenbeck and (Ronquist v3.1.2 and Results ordtst eeaaye in analyzed were datasets Four trnG-R Tracer 15(abu n Drummond and (Rambaut v1.5 seTbe2 eeimplemented were 2) Table (see rbcL Garli Tbe2). (Table matK Zik 06 u with run 2006) (Zwickl Mean trnG-R eemr straight- more were MLBS uprsa supports Partitions >70% ³ 70% Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. aial upre ssse eea n hy oehr are together, they, to and sister genera, sister as supported maximally aiya hl smxmlyspotd(. posterior genera. three (1.0 mono- the supported the is the of as maximally of support), phyly bootstrap is monophyly ML and 100% whole The and bootstrapping probability 2). a ML Table as 4; both family (Fig. under analysis tree, inter- Bayesian the of majority across vast the nodes for support strong inferred dataset mjrcae” the clades”: “major aae nlds33 ie o 4tx;adtoa dataset additional taxa; 84 2. Table for in combined provided sites are The characteristics result. 3639 that this includes regions to any dataset contributing uncover be careful to possibly failed Furthermore, could alignments analysis. the to of prior review excluded were they ldswt 26 otta upr ( support bootstrap 92.6% with the between clades relationship sister a whereas ports support, bootstrap 82.4% with complex the between relationship The sister stronger. of much is divergence discordance the the the of (following base the group the Here, crown near substantial. are more relationships is conflicting 70% incongruence our intralinkage than of greater for marginally (70.6% only cut-off is support bootstrap roso lgmn neec eanapsiiiy u only but case). possibility, each ( a locus in remain all one involved inference for alignment misidenti- were used of of were accessions Errors extractions result multiple same and the (the loci, not error lab is or incongruence fication This 3B). Fig. large 299 PHYLOGENY CYSTOPTERIDACEAE AL.: ET ROTHFELS 2013] the our all of clade a the in those for except u aae i ahcs,teei igesc conflict). such single a is there case, each (in dataset ( our support of absence an Gymnocarpium The ytpeiaeePhylogeny— Cystopteridaceae Fig. robertianum Gymnocarpium .Itaikg nogune ipiid otdtretxntessoigspotfrtetocnlcigrltosisi u aae,oein one dataset, our in relationships conflicting two the for support showing trees three-taxon rooted Simplified, incongruence. Intralinkage 3. Gymnocarpium Gymnocarpium trnG-R A n h te in other the and (A) ld Fg A.I hscs,teconflicting the case, this In 3A). (Fig. clade Gymnocarpium trnG-R a ra fabgosainet and alignment, ambiguous of areas has ) < 0) n hcee rnhsidct upre eainhp htcnlc iharltosi upre yaohrlcsin locus another by supported relationship a with conflict that relationships supported indicate branches thickened and 70%), hlgn etrstredel diverged deeply three features phylogeny disjunctum ld hticue l u accessions our all includes that clade disjunctum Fg 4). (Fig. n 2 for 72% and Cystopteris Cystopteris bulbifera cesosecp o hs in those for except accessions ld,the clade, ld,whereas clade, nlsso h combined the of Analysis B.Nmesaoebace r aiu ieiodbosrpspotvle,dse rnhsindicate branches dashed values, support bootstrap likelihood maximum are branches above Numbers (B). rbcL matK bulbifera ld n the and clade and rbcL .Tescn case second The ). robertianum .montana C. ou uprsa supports locus Acystopteris sequivocal; is rbcL and trnG-R Cystopteris supports sudetica fragilis clade, and ) sup- are ewe them, Thebetween uncertain. allotetraploid spread are them disjunctum among relationships supported, core and American pce eogt h eann ld ifral nw as known (informally of clade bulk remaining the The the America. to belong North species to limited is ploids, diploid the contrast, includes In which Eurasia. across west extends Asian east the and anomalous genus the phologically Japanese of a core remainder as the The well comprises identity. as uncertain species, of that accession of accessions all includes isaecnoue,wt aytx (including taxa many with convoluted, are cies remaining the among Relationships separates the robustly within divergence first The monophyletic. oiatyAin fistrercgie species, recognized and three its of Asian; dominantly ( clades fragilis supported highly the at three situation the of to supported—similar base well not is branch separating sister are together, to they, and support), bootstrap ML 100% and monophyletic. japonica as supported maximally is species of subspecies pern nmlil subclades. multiple in appearing ihnthe Within h is pi within split first The .taiwaniana A. .fragilis C. .moupinensis C. ope)rmi neti.The uncertain. remain complex) and Gymnocarpium Gymnocarpium ld nldstediploid the includes clade .appalachianum G. .montana C. .tenuisecta A. .jessoense G. Acystopteris ope) hc smxmlyspotdas supported maximally is which complex), . G. r xlsvl atAin while Asian, East exclusively are .remotepinnatum G. .protrusa C.

Gymnocarpium + brittonianum .dryopteris G. osqety eainhp among relationships Consequently, . rmters ftegns h next The genus. the of rest the from (subsp. huhec fteei strongly is these of each Though . Cystopteris r itr(. otro probability posterior (1.0 sister are ld,ec ftetrerecognized three the of each clade, .bulbifera C. .oyamense G. w aacretytetdas treated currently taxa two , rmters ftecomplex. the of rest the from jessoense sudetica .The n h rpodhybrid triploid the and , ld,icuigtemor- the including clade, smxmlysupported, maximally is . .fragilis C. .disjunctum G. n eae allopoly- related and h atr North eastern the , n subsp. and sudetica .robertianum G. , bulbifera .fragilis C. bulbifera ope spe- complex .fragilis C. ld spre- is clade Acystopteris .pellucida C. h wide- the , Cystopteris parvulum n the and , .sudetica C. clade, clade clade s.s.) ), Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 300 irpoaiiy perblwtebace;vle f10 n .,rsetvl,aeidctdb seik.Bl rnhsaehgl upre ( supported highly information. are voucher further branches for Bold 1 asterisks. Appendix by see indicated (http://fernlab.biology.duke.edu/); are database respectively, Lab 1.0, Fern and the and 100% support of bootstrap values likelihood branches; maximum the below appear probability) rior Fig. .Mxmmlklho hlga ftecnaeae lsi aa upr aus(aiu ieiodbosrpspotBysa poste- support/Bayesian bootstrap likelihood (maximum values Support data. plastid concatenated the of phylogram likelihood Maximum 4. ³ .5pseirpoaiiy.Nmesi rcesfloigteseis ae r ceso ubr from numbers accession are names species’ the following brackets in Numbers probability). posterior 0.95 ³ 70% Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. norsmln,i nldsbt cesoso h diploid the of accessions ploid both includes it species sampling, our In the of sample of enigmatic. history remains evolutionary previous early the largest (2012a)), rela- al. et (the data of studies 4). amounts Gymnocarpium previous (Fig. substantial data to of combined tive addition the from the obtained Despite result same own, the its as On relationship 3A). same Fig. support; bootstrap robertianum G. from Data 4). the divergence (Fig. port deepest uncertain is the genus the monophyletic, within as supported mally 03 OHESE L:CSOTRDCA HLGN 301 PHYLOGENY CYSTOPTERIDACEAE AL.: ET ROTHFELS 2013] h eu 7%bosrpspot,whereas support), bootstrap (71% genus the rsn hi w aiy ahrta nldn hmi a Woodsiaceae in or (2006). al. them (2004) et al. including Smith et sensu than Wang sensu rather Athyriaceae family, com- broad as own genera their diver- three al. these further deep prising et recognize 2012a), to al. its Rothfels need et 2011; and the (Rothfels emphasizes al. relatives family, closest et the its phylogenies Li from of gence C. molecular monophyly 2008; The Liu earlier 2012a). 2000; in al. et relationships (Sano these for Gymnocarpium, oyli between polyploid taigta ohtefml n t osiun eeaare genera constituent its that and and family monophyletic the both that strating unusual process. or substitution stochastic representation, the taxon loci in in variance across changes composition slight base taxa, in operating and biases selection loci, of individual patterns the different on our to in due conflicts be the could (2012), data Weisrock with of As data single 2012). mitogenomic of Weisrock the 2012a; studies al. multi-region these et other (Rothfels in in groups fully linkage seen evolution been to molecular has methods as of taxa, to inference idiosyncrasies due phylogenetic the is our capture incongruence of this and locus failure that Mason-Gamer the suspect 3; another Fig. We by support; 1996). 70% Kellogg well-supported least at relationship with has (again, a locus with one ble least at cases where two ³ reveal incongruence data intralinkage our contrary, of the evo- To common history. a with lutionary constitute group should linkage An they non-recombining genome, single 2012a). plastid a well- the al. in are of et loci Because three appearance 3). Rothfels all (Fig. loci the 2011; individual the al. was among (Kuo conflicts supported et however, depths Li evolutionary result, F.-W. of unexpected variety 2011; a al. across et ferns of yses rbcL h te w aa(re n afe 93 i.4.The 4). that Fig. suggest 1993; analyses Haufler isozyme and that (Pryer taxa of grouping two other the brittonianum h eaieifraieeso h oieaie nour in examined loci the of ( dataset informativeness relative The 0 otta upr o eainhpta sincompati- is that relationship a for support bootstrap 70% ftetremjrgop htcomprise that groups major three the Of yncrimPhylogeny— Gymnocarpium ytpeiaeePhylogeny— Cystopteridaceae hlgntcAaye n nrlnaeIncongruence— Intralinkage and Analyses Phylogenetic disjunctum scnitn ihohrmlclrpyoeei anal- phylogenetic molecular other with consistent is ) .dryopteris G. .disjunctum G. matK .disjunctum G. hc shpteie ob yrdbetween hybrid a be to hypothesized is which , .disjunctum G. outperforming ld stems tagtowr odescribe. to straightforward most the is clade a h he cesosicue nRothfels in included accessions three the was r ossetwt h ihspotinferred support high the with consistent are steeris iegn ieg wt 72% (with lineage diverging earliest the as n h nyacsino triploid of accession only the and , .disjunctum G. l ape ftecsooia tetra- cosmopolitan the of samples all , trnG-R ld ssse otermidrof remainder the to sister as clade Cystopteris Discussion and u ihu upr,wihis which support, without but , trnG-R .dryopteris G. While and u ra eut,demon- results, broad Our + hc a ueirto superior was which , .dryopteris G. .appalachianum G. Acystopteris Gymnocarpium matK sepce,given expected, is Gymnocarpium Gymnocarpium eovsthe resolves trnG-R rbcL ssse to sister is sa allo- an is smaxi- is (Pryer places G sup- . + , .W ie l 01 ohese l 02;Rtfl and Rothfels 2012a; not al. phylogeny, species. isolated the single, et of portions Rothfels significant elevated characterized the 2011; rates however, studies, 2006; these al. Pryer In unpubl.). and et Schuettpelz, Schuettpelz 2003; Li al. et groups F.-W. other Marais in (Des seen ferns been of have Such substitution evolution. of of rates elevated rates clock-like remarkably the in display species genus other all comparison, By evolution. molecular of mrc n atAi Fg ) hs w aaae in are, taxa two These 4). of (Fig. accessions to Asia sister turn, East and Appalachian America southeastern of The clade species. diploid remaining endemic the to n afe 93.Ordt ute upr hshypothesis this support that further indicating data by Our 1993). Haufler and ait,Nkie(99 one u hti a somewhat was the it naming that out in between pointed However, intermediate (1969) level. Nakaike varietal variety, the at recognition fti ld stegntcuiomt bevdars all across observed uniformity of genetic sequences the is loci—the clade this of dryopteris G. rmCiaadPksa r elspotdmmesof members well-supported the are core Pakistan the and China treated from typically are region recognized that as in the morphology beyond this of far Plants from finally, is of And accessions range 4). these (Fig. of Japan from one or are Scandinavia, they America, whether North loci, somewhat across sequences is near-identical tetraploid 2A) in as dryopteris Fig. Second, accessions. (5852: G. 1; other range the Appendix American from divergent North see its Minnesota; of USA, part southern of the accession from single a our First, refute elements. or worthy corroborate taxon. to this of necessary origin be hybrid possible will data nuclear of accession lone the of to similarity extends genetic dryopteris loci G. This Scandinavia, across Alaska, 4). from accessions (Fig. are Japan they or whether of regardless iewehrti aaeeacsinrpeet nunrec- an of represents extension accession range Japanese ognized this whether mine ie stesgeaegenus segregate the as nized including taxa, named 1936). (Koidzumi material because for nomenclature, consequences these important of have identity could the plants regarding conclusions Future parent. nal with allopolyploid unrecognized namc ogrbac,sgetn togyeeae rate elevated strongly a suggesting branch, longer much a on hthsa paetycnevd liimrhcmorphol- pleisiomorphic conserved, apparently ogy. an has group that larger a within embedded are taxa apomorphic certain strongly where 2012a), Aspleniaceae, al. (e.g. et II Rothfels Blechnaceae; Eupolypods Onocleaceae, in of elsewhere example seen another pattern yet provides a It 1C). Fig. dissection; pinnati- leaf fid and sori elongate (including morphology anomalous species this core of within inclusion The 1970). Klekowski and Lloyd 1909; ihntecore the Within u eut o the for results Our h hr ao ld of clade major third The .jessoense G. robertianum yncrimoyamense Gymnocarpium Gymnocarpium .jessoense G. .robertianum G. Gymnocarpium h eann cesosi hscaehave clade this in accessions remaining the , var. ouain ape.Aohrsrkn feature striking Another sampled. populations subsp. ld.Ncerdt ilb eddt deter- to needed be will data Nuclear clade. .appalachianum G. aokigaharaense .disjunctum G. Gymnocarpium subsp. jessoense .oyamense, G. .dryopteris G. ld n hsqiedvretfrom divergent quite thus and clade robertianum .jessoense G. .dryopteris G. 77:Jpn wt;seFg 2A). Fig. see Iwate; Japan, (7979: Gymnocarpium ssmwa upiiggvnits given surprising somewhat is parvulum .jessoense G. .robertianum G. loi oeotybcuei is it because noteworthy is also u w ape ftelatter the of samples two Our . Currania rvdn ospott its to support no providing , stemtra aeto all of parent maternal the is .robertianum G. ssse oawell-supported a to sister is clade, hc ssmtmsrecog- sometimes is which ld aetrenote- three have clade stpfe nJapanese on typified is and cesosfo North from accessions oe.(..Copeland (e.g. Copel. r eryidentical nearly are subsp. .oyamense G. otisms fthe of most contains .jessoense G. ri,ised an instead, is, or Gymnocarpium .robertianum G. jessoense stemater- the as .dryopteris G. ssister is Thus, . from Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC 302 (including eu.Ti oooywudpri h eonto fthe of recognition the permit the would of genus remainder topology the This and to sister genus. Norway, as supported Canada, strongly is from China, samples including accessions, h lcmn of Asian placement East The the + Asia mainland endemic to sister hkrao 95,wiesilrtiigamonophyletic a retaining still while Cystopteris 1985), Khokhrjakov .jessoense G. n igorpia etrs swl sarltvl deep relatively a level. generic as well from as divergence features, biogeographical and of concept entity, broader Acystopteris separate a into a merger as its recognition or continued its either permits .taiwaniana A. 18)included (1985) smnpyei,a stegnsa hl Fg ) The 4). (Fig. whole a as genus each species; the of named position is well-supported three as the monophyletic, of is each distribution Our from tropical accessions 2008). two low-elevation, Wang unpubl.), unusual, 2B; Rothfels, an and (Fig. as Sundue well 2012b; al. as in et differs Rothfels (Blasdell but spores 1963; light-tan indusium, tuberculate and hood-like scales catenate distinctive, having a and 1975) taxa. Asian on focus concerted a with approach, on work jessoense G. to Himalayan populations of majority the identity assigns (2008) uncertain Jenkins the is address not of does dataset our that lem Asian of treated nomenclature and Gymnocarpium be taxonomy should The taxa species. distinct these as that suggests clades supported Nki13;Sihe l 06 ag20;Rtfl tal. et Rothfels shares It 2008; 2012). Wang Systematics with Plant 2006; for of al. Society subgenus Japanese et 2012b; a Smith as 1933; either (Nakai element, distinctive Cystopteris a as ognized n hs w aaaerrl,i vr ofsdwith confused ever, between hybridization if by japonica formed A. rarely, allopolyploid an are be might taxa tenuisecta two A. these and lrt u oeua hlgn.Hsdarm ae entirely based diagram, His phylogeny. molecular sim- our to remarkably ilar is scheme”) divergence Wagner’s “groundplan of (1980) elements using inferred visualization tree-like early a recognizing not in is value assemblage little This monotypic seems long- H). there 1E, on and Fig. monophyletic, internodes (see spaced rhizomes widely creeping and deltate-to- broadly leaves with pentagonal taxa all includes then, Khokhrjakov, and upre yordata. our by supported Fg 4): (Fig. Cystopteris Within csotrsPhylogeny— Acystopteris lsels(93 0 eouinr ednis iga (an diagram tendencies” “evolutionary 80) (1963: Blasdell’s ytpei Phylogeny— Cystopteris .fedtschenkoanum G. .pellucida C. Cystopteris Rhizomatopteris montana .japonica A. .taiwaniana A. Acystopteris oee,i naming in However, . Gymnocarpium Badl 93 ao17)o sasprt genus separate a as or 1977) Kato 1963; (Blasdell and Rhizomatopteris .protrusa C. nldsfu ihyspotd“ao”clades “major” supported highly four includes omr atr ouain.Ftr taxonomic Future populations. eastern more to sesl igoe n a nqeecological unique has and diagnosed easily is subsp. ag(08 ugse that suggested (2008) Wang . sfeunl rae savreyof variety a as treated frequently is pce spriual ope,adoeprob- one and complex, particularly is species nhsgnrcconcept. generic his in ) .tenuisecta A. , aecrmsm ubrof number chromosome base a .sudetica C. sudetica .fedtschenkoanum G. Cystopteris n hscaei hnsse oteTaiwan the to sister then is clade this and , .jessoense G. parvulum , .Acaecmrsn all comprising clade A ). ..Koh.(yiidon (typified Khokhr. A.P. hsrsl ssrrsn,gvnthat given surprising, is result This . .tenuisecta A. , oak Pjroa15) Fraser- 1950). (Pojarkova Pojark. bulbifera ilne oepaieaglobal a emphasize to need will cnann only (containing adb extension, by (and Acystopteris u hlgntchptei for hypothesis phylogenetic Our oee,ti yohssi not is hypothesis this however, ; efvrrcgiigi tthe at it recognizing favor we , Acystopteris Acystopteris ttali)i ifrn well- different in (tetraploid) subsp. Rhizomatopteris n the and , .remotepinnatum G. ssrnl upre as supported strongly is etitn h name the restricting , jessoense Cystopteris. ssse to sister as Rhizomatopteris a ogbe rec- been long has apigincludes sampling .fragilis C. .montana C. .moupinensis C. Khokhrjakov , .taiwaniana A. Gymnocarpium dpod and (diploid) x .montana C. 2(Mitui 42 = .montana C. .japonica A. ie that Given Cystopteris complex Fg 4). (Fig. ). sensu ; netgtosaencsayt eemn fcytctx exist taxa cryptic if within determine Further to cytologically 1993). necessary al. is are et investigations (Haufler species tetraploid the a as differences, only documented size spore for on cytotypes tetraploid based (1963) and Blasdell diploid Although both two 4). reports (Fig. American the samples North separating Scandinavian the split and from supported accessions highly Tibetan but high-elevation shallow a is the Within supported. strongly very Cystopteris from distinct 2008). is Fraser-Jenkins study) (see this in included (not Ching ei,btteeaevr lgtydvre rmadfr a form from—and two diverged slightly with—our very polytomy are related. these but closely letic, very of indeed, accessions are, two taxa Our two the that indicates sudetica C. ftrespecies: three of 2C), ( Fig. presence so; the nearly in very ( chiefly (or differ allopatric are and species two The ouain ntews,diploid west, the disjunct in with America populations North eastern of specialist limestone A h oiinof position The n oemmrnu evsadacasrla division leaf coarser of a variety and 2008). leaves from (Wang differs membranous cen- it more in 2C), range ing restricted (Fig. a China with species tral enigmatic sam- An our 4). In (Fig. 1). Fig. see shape; ple, pinnules leaf elongate-deltate basal an and expanded share pinnae) towards lowermost the tendency on a and leaves, widely-spaced rhizomes, long-creeping share they which (with are clade between this intermediate of somewhat Members morphologically 2C). (Fig. Europe into west extends spe- three the includes sampling from dis- Our cies 3). Incongruence Fig. Intralinkage and among lack above, (see signals cussion, a conflicting partitions by by rather different caused but not the data, is our support in signal of of lack This analysis. bined fragilis C. lx(i.4,rneigBadl’ (1963) Blasdell’s rendering Cystopteris the 4), within (Fig. nested deeply plex is latter the logeny, ihoebac agl orsodn oour to corresponding largely branch one with Acystopteris between division basal a includes characters, morphological on ( of (plus classification four-clade proposed our tips, anticipates branch to perfectly Acystopteris moved diagram are his branches then internal on included he osiue aahltcgaecmrsdof comprised grade paraphyletic a constitutes His phylogeny. our of aspects sudetica and C. with excluding (but clade plex oiinof position .moupinensis C. Emarginatae eainhp mn h he te ao ldsof clades major other three the among Relationships noraayi,the analysis, our In C SOTRSMONTANA YSTOPTERIS C .pellucida C. C . . .montana C. pellucida montana and hs pce r rmrl sa;only Asian; primarily are species These . —the ope—r o ihyspotdi u com- our in supported highly not complex—are aahltca well. as paraphyletic .sudetica C. C eut nteohrhn,Badl’ (1963) Blasdell’s hand, other the On result. ) and . bulbifera and diaphana sudetica ytpei moupinensis Cystopteris fgad nteindusia. the on glands of ) .montana C. rue oehr ned fteincongruent the if Indeed, together. grouped .bliea .tennesseensis C. bulbifera, C. sudetica tisbase, its at Cystopteris ssse oters fthe of rest the to sister is n hte h hns taxon Chinese the whether and , Cystopteris , bulbifera clade: lds plus clades, N THE AND yBadl 16) n u analysis our and (1963), Blasdell by sinrd n h xatseisthat species extant the and ignored, is .sudetica C. ld,the clade, .moupinensis C. ssse oters ftegnsis genus the of rest the to sister as olwdb usqetsplit subsequent a by followed , Cystopteris C .pluia .moupinensis, C. pellucida, C. sicmail ihcertain with incompatible is ) diaphana . Cystopteris SUDETICA ld opie l accessions all comprises clade bulbifera .bulbifera C. .bulbifera C. r eovda monophy- as resolved are .diaphana C. .montana C. bulbifera .sudetica C. .moupinensis C. ,adaohrbranch another and ), AND ..it w sections two into s.s. a eonzda a as recognized was et and next, section cesos(i.4). (Fig. accessions Cystopteris BULBIFERA and , wt hc they which (with shypothesized is ld,adthe and clade, .fragilis C. .montana C. .fragilis C. sudetica norphy- our In . ieg,there lineage, rabsence or ) .utahensis C. Emarginatae .montana C. .montana C. .montana C. C .modesta C. .sudetica C. C . nhav- in sudetica LADES section clade com- com- the , and — . Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. rmErp n ot America, North and Europe from allohexaploid nldsalLtnAeia ape fthe of samples that American clade Latin (61% probability) supported all posterior weakly includes 0.99 a and form taxa support three bootstrap latter The 4). (Fig. as identified accessions etr ot mrcnacsinof of accession American North western clade. this in fall 2008)—also (Fraser-Jenkins and ploid ntefrainof formation the in nlddmlil cesosi oohltc(i.4.Each members— 4). diploid known (Fig. three monophyletic the of is accessions multiple included deserved. for well is Except complexity systematic for reputation its broad that (1963) Blasdell’s for name the support of application some providing plex, alpine the including taxa, hexaploid of Eurasian assemblage con- interesting bootstrap clade an This 70% 4). tains has (Fig. probability it posterior 0.97 so: is and split support barely the of but side supported, One dichotomy. significantly basal a by distinguished is i n rka17;Nri17;Wn 93 rd 1986; Prada 1983; Wang or 1974; 2000) al. Nardi et 1974; Parks Trikha and Bir Most called spores—often (1991)). rugose Haufler by Windham mentioned and hexaploids unnamed two (including tenuis C. divergence groundplan his tree). in scheme (1963) Blasdell by diploid anticipated forest-dwelling American, protrusa North C. eastern the of tion or 03 OHESE L:CSOTRDCA HLGN 303 PHYLOGENY CYSTOPTERIDACEAE AL.: ET ROTHFELS that confirming 4), (Fig. sequences tical bulbifera C. tetraploid with tetraploid and of 1990) al. origin et the with in hybridization (through involved be to 2013] rmtencergenome. nuclear the from that confirmation Molecular 4). (Fig. h te ldsof in clades species other of the characteristic distinctiveness morphological of the cytotype diploid a and 93.Orpatddt,tog rlmnr,mk some cir- encompassing robust make a the preliminary, permit of (Blasdell they cumscription though First, octaploid contributions. data, new to important plastid diploid Our from includes 1963). and ranging D), levels 2C, (Fig. ploidy on Antarctica occurs except complex continent species biosyste- This every ferns.” formidable the most in the problem (1978: “perhaps matics Lovis as with systematics, it fern describing in 356) place special a has plex eie t lsi rmamme fthe of member a from only plastid its Our derived (1990)). al. a contain formed et they Haufler of that by sample and suggested tetraploids, (as both recently of parent maternal h itrcaei ihyspotd n nldsoronly our includes and supported, highly is clade sister The h uko the of bulk The C u rlmnr eut o the for results preliminary Our .sudetica C. .reevesiana C. SOTRSFRAGILIS YSTOPTERIS .douglasii C. .reevesiana C. .tasmanica C. n he ot mrcnacsin of accessions American North three and , .bulbifera C. , .laurentiana C. C ssse oters ftecmlx( position (a complex the of rest the to sister as .protrusa C. . Fg ) eod hysrnl upr h posi- the support strongly they Second, 4). (Fig. tennesseensis, .laurentiana, C. .fragilis C. ,a atr ot mrcnacsinof accession American North eastern an ), afe n ida 91.I u dataset, our In 1991). Windham and Haufler ; adpod,teNrhAeia putative American North the diploid), (a .fragilis C. ohHwia neis( endemics Hawaiian both , Cystopteris .alpina, C. .laurentiana C. .fragilis C. .fragilis C. eoe(anradHgnh1956), Hagenah and (Wagner genome C oeo h pce o hc we which for species the of none , OMPLEX .diaphana C. nalhxpodas huh to thought also allohexaploid an , and C .membranifolia C. ope ie excluding (i.e. complex .diaphana C. and . .dickieana C. .protrusa C. utahensis aiu olcin of collections various aigi ifcl odiagnose to difficult it making , h nei utaaintetra- Australasian endemic the .protrusa C. ope steicuieclade inclusive the as complex —The subsp. C Cystopteris . ilteeoerqiedata require therefore will utahensis opat rmti region. this from plants to .fragilis C. C .diaphana C. ytpei fragilis Cystopteris .protrusa C. truhhybridization (through . dickieana Badl 1963)—lacks (Blasdell hvr15;Haufler 1950; Shaver ; bulbifera .tenuis C. .Sm Aso 1951; (Alston Sim. R. u not but , .fragilis C. C aenal iden- nearly have and . pcmn with specimens .tennesseensis C. .fragilis C. bulbifera .sandwicensis C. ld confirm clade a involved was R i)Hyl. Sim) (R. , l samples all , n single and , .reevesiana C. .millefolia C. .protrusa C. .bulbifera C. .fragilis C. .fragilis C. complex sthe is com- com- ) , rto,D . .G twr,adW .Cd.1984. Cody. J. W. and Stewart, G. W. M., D. Britton, of ecology and Distribution genus 1987. fern W. the S. the of Breckle, of study species monographic Indian A A. the 1963. of F. C. Taxonomy R. 1974. Blasdell, Al-Shehbaz, Trikha. K. A. C. and I. S. S. Allphin, Bir, L. Alexander, J. P. 2004. B., Ronquist. J. F. Beck, and Huelsenbeck, P. J. Dwarkadas, S. G., Altekar, fern. American North identification. overlooked An model 1951. statistical A. Alston, the at look new A 1974. H. Akaike, greatly was manuscript reviewers. This anonymous two 1. and Mast, Fig. R. Austin Associate in Editor Ranker, Tom Editor-In-Chief shown from comments silhouettes through production improved fern our facilitated the #11100624 Andrew of Agreement the under Foundation The herbarium Mellon CJR. Duke to American W. the Department grant Latin to research provided Biology for field scanner Center Duke student “HerbScan” University graduate DDIG a Studies Duke NSF Caribbean a (DEB-1110767), and and an CJR CJR, and CJR, to and Sciences to Grant-in-Aid Natural KMP PGSD a to (Canada) from award Council funding by Research supported Engineering was research This of Auto support Nacional generous Universidad the secured with was SGPA/DGGFS/712/1323/09 material permit pop- under Mexican sample critical to and permission SHEN-2010-SCI-0019) (permit gave Service Park of National in ulations U.S. assistance The skilled assis- lab. provided and Johnson the hospitality Anne R. their Alan undergraduate for (NY), Duke (MO) Moran tance. Yatskievych Robbin TNS, George to TAIF, and due P, (UC) are NY, Smith thanks MO, particular DUKE, UC; sampling: loaning and and TRTE, in assistance, study critical for provided specimens herbaria their following KMP the curators introduced The of such. who staff as recognized and (1923–2012), was it Britton before long M. Cystopteridaceae the Donald to paper Sigel, of this dedicate memory Erin We the Smith, Yatskievych. to George F. and Scott Wood, Li-Yaung Schuettpelz, K. Thorsen, Eric Kelsey, Mike Brinker, Ranker, Ann Tom Sam Oldham, Palmer, Michael Kato, Metzgar, Barrington, Daniel Jordan Masahiro Matos, David Fernando Larsson, Harris, Anders Arana, Kuo, Alan Marcelo Ebihara, we thank particular, Atsushi In unavail- to possible. scope be like this otherwise of would research would made thus that who materials and able, quality high provided who yooia n iaetlmlclraaye,wihare which unpubl.). al., analyses, et coordinated (Rothfels molecular on underway depend currently defin- biparental will on and progress group Any this cytological story. in the informa- limits of species critical part ing provide only tell DNA they plastid tion, morphological Though on based alone. parentage data infer to or taxa polyploid e aas .L,A .Sih .M rto,adK .Pyr 2003. Pryer. M. K. and Britton, M. D. Smith, R. A. L., D. 2011. Marais, Burrows. Des M. S. of record and A Burrows, 1998. E. T. J. Denk, Klopper, R. R. R., IV. N. ferns. Philippine Crouch, interesting or New 1909. B. E. Copeland, under- inference: Multimodel 2004. Anderson. R. D. and P. K. Burnham, Acknowledgments. inlJunlo ln Sciences Plant of Journal tional Club Botanical Torrey the of Memoirs 5:59–65. 155: region. Iranica Flora the within species genus diploid hybridi- in Does asexuality 2011. to tion Windham. transition D. the M. drive and zation Bailey, D. C. Rushworth, Bayesian for inference. Carlo phylogenetic Monte chain Markov Metropolis-coupled Parallel 76–78. 41: Control Automatic on Transactions ae nclrpatDAsqec aa( data sequence DNA chloroplast on horsetails, extant based of evolution and relationships Phylogenetic Iran. from Africa Southern of Ferns Science of Journal selection. model in BIC Research and AIC standing Canada. of flora the to addition Naturalist Field an fern, fragile creeping 6 985–995. 66: Cystopteris yncrimappalachianum Gymnocarpium 3 261–304. 33: rna ora fBotany of Journal Iranian 9 380–382. 99: () 111–115. 4(C): Bernh. ra hnsaedet h aycollectors many the to due are thanks Great ´ ieaueCited Literature aeTw:Sri Nature. Struik Town: Cape . ytpei regia Cystopteris oad Me de noma Bioinformatics oaHedwigia Nova 6:737–751. 164: 9 716–723. 19: :259–264. 7: 1 1–102. 21: ´ io(NM n akOlson. Mark and (UNAM) xico nSeada ainlPark National Shenandoah in 0 407–415. 20: ln ytmtc n Evolution and Systematics Plant L)Dsax(Pteridophyta), Desvaux (L.) 7 1–21. 47: rbcL Cystopteris oilgclMtos& Methods Sociological mrcnFr Journal Fern American and ytpei protrusa Cystopteris ocea Evolu- Boechera? trnL-F (Athyriaceae) Cystopteris Equisetum ). Philippine Canadian Interna- IEEE . , , Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. u,L-. .W i .L ho,adC-.Wn.21.Frtisgt into insights First 2011. Wang. C.-N. and Chiou, W.-L. Li, F.-W. L.-Y., Kuo, Orientalis. Asiae florae cognitionem ad Contributiones 1936. G. Koidzumi, 1985. P. A. Khokhrjakov, i . .L,X u,adQ ag 01 hlgntcpstoso the of positions Phylogenetic 2011. Yang. Q. and Sun, X. Lu, S. C., Li, 2000. P. V. A. Latorre, of Classification 1977. M. Kato, 2012. Systematics. Plant for Society Japanese 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC for samples plant of Preservation 1987. Dickson. E. E. and D. J. Doyle, 304 i,Y-.2008. Y.-C. Liu, Windham, D. M. Chiou, W.-L. Ebihara, A. Rothfels, J. C. Kuo, L.-Y. F.-W., Li, model time-series and Regression 1989. Tsai. C.-L. 1993. and Windham. M. D. C. Hurvich, M. and Moran, C. R. H., C. Haufler, 1986. R. C. Fraser-Jenkins, identification species Molecular 2010. Ito. M. and Nitta, H. J. A., Ebihara, afe,C . .D ida,adT .Rne.19.Biosystematic 1990. Ranker. A. T. and Windham, D. M. H., C. Haufler, American North J. of species G. New 1991. Sano, Windham. D. R. M. and Ito, H. C. Haufler, M. Ueda, K. Pryer, M. K. Wolf, G. P. M., Hasebe, 2008. R. C. Fraser-Jenkins, aak,T 99 e ait of variety new A 1969. T. Nakaike, Japanese of classification new A IX. ferns Japanese on Notes 1933. T. Nakai, phy- Molecular 2007. Pryer. M. K. and Schneider, H. S., N. Nagalingum, Pteridophytes. Japanese of number Chromosome Tejero-Dı 1975. K. J. Mitui, and T. J. genus the Mickel, in fern” “filmy A 1972. phylogenetic T. for J. Mickel, Testing 1996. Kellogg. A. E. and J. R. Mason-Gamer, 2009. Maddison. R. D. and P., ferns. W. in Maddison, processes and patterns Evolutionary 1978. J. Lovis, 1986. W. viability Lobin, and germination Spore 1970. Jr. Klekowski E. and M. R. Lloyd, upy .J n .J usy 2005. Rumsey. J. F. and J. R. Murphy, 1983. C. R. Moran, fern Geobotanica et Phytotaxonomica Acta (Tokyo) Magazine Botanical ngai sai engenera fern asiatic enigmatic Ma 2012. 26, April on Accessed foj.c.u-tokyo.ac.jp/gbif/. N etito noulaeanalysis. endonuclease restriction DNA pone.0026597. 2011. Pryer. M. K. and genes. plastid four of analyses samples. small in selection Press. University Oxford York: New Committee. Editorial in 263–270. Pp. Garden Botanical Missouri the of Annals flora pteridophyte the barcoding Japan. DNA of sampling: floristic rich with rv,CnrlJapan. Central prov., N acd o ferns. for barcode DNA the of analysis tionships. Cystopteris Crane, on based H. phylogeny E. Fern 1995. Murakami, Hauk. sequences. D. N. nucleotide W. Manhart, and Haufler, R. H. J. C. Yokoyama, J. Gastony, subcontinent Indian Singh. the Pal fern- Mahendra in of Singh picture Bishen nomenclature new a and census-list: revised taxonomy a with pteridophytes continental Gazette clMgzn (Tokyo) Magazine ical Aspidium hetero- the in genus evolution fern Isles? sporous morphological British and relationships the logenetic to new native overlooked Watsonia an – (Woodsiaceae) College Dental Nippon of Mexico. from Polypodiaceae) and (Woodsiaceae Journal (Gramineae). Triticeae tribe Biology the Systematic in sets data molecular among conflict analysis evolutionary Research Botanical Gazette Fern spores. chlorophyllous Biotropica of significance evolutionary Pteridophyta: in University. Yat-sen Sun National Kaohsiung: species. ´ laga. matK 2 93–95. 62: 3 121. 13: Castanea Lagascalia ihseilve otesoe n onciecells. connective and spores the to view special with , 5 255–263. 25: LSONE PLoS phylogeny. :129–137. 2: mrcnFr Journal Fern American and aooi td fAhru nTaiwan in Athyrium of Study Taxonomic A Cystopteris 3 121. 13: ytpei tenuis Cystopteris Polypodium ytpei tennesseensis Cystopteris lr fNrhAmerica North of Flora 8 218–223. 48: ytpei viridula Cystopteris :229–415. 4: 5 524–545. 45: 1 338–339. 21: eso 2.72. Version . Marsilea :e53,di 10.1371/journal.pone.0015136. doi: e15136, 5: lr aaaso Oblasti Magadanskoi Flora 7 151–186. 47: oeua hlgntc n Evolution and Phylogenetics Molecular ora fGeobotany of Journal ytpei viridula Cystopteris mrcnFr Journal Fern American aooi eiino he ude ninsub- Indian hundred three of revision Taxonomic rbcL . nteCp ed n aayIslands. Canary and Verde Cape the in eea Education General LSONE PLoS 0 23–40. 90: ´ ihcmet nterrtclt rela- reticulate their on comments with , and Biometrika z 04 he e pce fferns of species new Three 2004. ez. . ytmtcBotany Systematic Athyrium mrcnFr Journal Fern American Diplaziopsis matK Mcx)Ds. oryunderstood poorly a Desv.: (Michx.) 1 7–23. 81: yncrimdryopteris Gymnocarpium ytpei diaphana Cystopteris :37–50. 5: Ds. ev nl rvni de provincia la en Desv. (Desv.) :e69,di 10.1371/journal. doi: e26597, 6: antotub pa h core the as up thumbs two earn 6 297–307. 76: 7 314–329. 77: d lr fNrhAmerica North of Flora ed. , n lidgnr fJapan. of genera allied and eqie oua ytmfor system modular a Mesquite: Taxon Dypeiaee complex. (Dryopteridaceae) nmiln Africa. mainland in lr fJapan of Flora 7 96–97. 17: :221–271. 4: Cystopteris and 5 134–181. 85: ocw Nauch. Moscow: . 6 715–722. 36: 2 16–25. 32: Brittonia Rhachidosorus 0:142–155. 101: . Br)Blasdell (Bory) hD Thesis. Ph.D. . vial at: Available . er Dun: Dehra . mrcnFern American 6 115–120. 56: 9 556–566. 59: dacsin Advances Cystopteris rmKai- from h Fern The Bulletin Botan- from rbcL The . oaa .20.joeTs:pyoeei oe averaging. model phylogenetic jModelTest: 2008. Himalayan D. on Posada, question and fern of species New 1950. I. A. Pojarkova, elnn . .Srea n .Utl.19.Crmsm onso the on counts Chromosome 1998. Uotila. P. and Sarvela, J. K., Pellinen, ak,J . .F yr n .Lnsy 00 loye pr n frond and spore Allozyme, 2000. Lindsay. S. and Dyer, F. A. C., J. Parks, ad,E 94 rbeisseaiiedsrbtv i« di distributivi e sistematici Problemi 1974. E. Nardi, re,K .1993. M. K. Pryer, 1986. C. Prada, re,K .adC .Hulr 93 szmcadchromosomal and Isozymic 1993. Haufler. H. C. and M. K. Pryer, re,K . .M rto,adJ cel.18.Anmrclaayi of analysis numerical A 1983. McNeill. J. and Britton, M. D. M., K. Pryer, mt,A . .M re,E cutpl,P oal .Shedr and Schneider, H. Korall, P. Schuettpelz, E. Pryer, M. K. and R., Aspidiaceae A. the Smith, in boundaries family and Generic 1973. W. Sledge, ohes .J 2012. phylo- J. Bayesian C. 3: MRBAYES Rothfels, 2003. Huelsenbeck. P. J. and F. Ronquist, 2007. Drummond. J. A. and A. Rambaut, ao . .Tkmy,M t,S uia n .Hsb.20.Phylog- 2000. Hasebe. M. and Kurita, S. Ito, M. Takamiya, M. R., Sano, E. Kato, M. Larsson, A A. Salvo, Kuo, L.-Y. Sundue, A. M. J., C. Rothfels, M. K. and Chiou, W.-L. Korall, P. Kuo, L.-Y. Larsson, A. J., C. Rothfels, ia .17.Cttxnm n eoeaayi fteEuropean the of analysis genome and Cytotaxonomy 1972. pteridophytes G. the of Vida, Checklist 2001. Viso. genus P. R. the and Aedo, C. of M., Velayos, review A 1935. M. Tagawa, avl,J,D .Bitn n .M re.18.Suiso the length on branch extreme Reconciling Studies 2006. Pryer. 1981. M. K. and Pryer. Russia. E. of Schuettpelz, ferns M. the of Synopsis K. 2001. A. Schmakov, and Britton, M. genus D. fern J., the of Sarvela, synopsis A 1978. J. Sarvela, cutpl,E,H cnie,L ue,M .Wnhm n .M Pryer. M. K. and Windham, D. M. Huiet, L. Schneider, H. E., Schuettpelz, cutpl,E n .M re.20.Eiec o eoocradia- Cenozoic a for Evidence 2009. Pryer. M. K. 400 and from E. inferred phylogeny Schuettpelz, Fern 2007. Pryer. M. K. and E. Schuettpelz, hvr .M 90 e fern, new A 1950. M. J. Shaver, lmn ntefrs ei lr fMdl Asia. Middle of flora relic Nauk forest Akademii Filiala the Tadzhikistan in element Fennici Botanici ilg n Evolution and Biology engenus fern aito nsm ctihppltoso h ferns and the of populations Scottish some in variation dickieana vdnefrtealttali rgnof origin allotetraploid (Dryopteridaceae). the for evidence Oxford York: New Committee. Press. Editorial University America North of Flora ed. Cientı Investigaciones de Superior (Consejo CSIC Madrid: hoaorpi rflsi ot mrcntx ftefr genus fern the of taxa American Gymnocarpium North in profiles chromatographic .G of 06 lsiiainfretn ferns. extant for classification A 2006. Wolf. G. P. Athyriaceae. eei neec ne ie models. mixed under inference genetic http://beast.bio.ed.ac.uk/Tracer. at: n fteld engop rb hsmtee(Dryopteridaceae), Physematieae tribe group, chloroplast fern on lady based the of eny Polypodiales). (Polypodiidae: ferns classifi- 515–533. II family-level 61: revised eupolypod A for 2012b. Pryer. cation M. K. and ferns. Schuettpelz, II inter- eupolypod short of radiation and rapid rates, ancient Biology fast Systematic the resolve roots, to deep nodes Overcoming 2012a. Pryer. Family Fern University. Cosmopolitan Duke a in Divergence netgcoe Cientı Investigaciones Iberica en.P.5–0 in 51–60. Pp. ferns. Guinea. Equatorial of Geobotanica et Phytotaxonomica n Evolution and Akade ifrne:dculn ieadrt hog h vltoayhis- evolutionary ferns. the filmy through of rate tory and time decoupling differences: 421–431. 83: robertianum Gymnocarpium Fennici Botanici Tennessee. unsampled previously of assess- affinities Pteridaceae: the genera. family and fern relationships the overall of ing phylogeny molecular A 2007. ino en na nisemdmntdcanopy. USA angiosperm-dominated Sciences of an Academy in National the ferns of tion genes. plastid three and species leptosporangiate ´ .adP tri.1986. Otermin. P. and E. . ytpei fragilis Cystopteris ´ d .M amni.Mdi:CI CneoSpro de Superior (Consejo CSIC Madrid: Garmendia. M. F. ed. , iiKiado miai oeua hlgntc n Evolution and Phylogenetics Molecular .L nItalia. in L. S. » Cystopteris ora fteTneseAaeyo Science of Academy Tennessee the of Journal Gymnocarpium oaia ora fteLnenSociety Linnean the of Journal Botanical 5 403–413. 15: Gymnocarpium . aainJunlo Botany of Journal Canadian 5 265–266. 35: 5 101–106. 15: ´ hlgntc fCsotrdca:Rtclto and Reticulation Cystopteridaceae: of Phylogenetics . 1 490–509. 61: ytmtcBotany Systematic ytmtcBiology Systematic p 1–2.in 115–121. Pp. . 5 1253–1256. 25: ´ . ega ora fBotany of Journal Belgian ficas). vlto nPlants in Evolution rbcL dnug ora fBotany of Journal Edinburgh Webbia Dypeiaee rmFinland. from (Dryopteridaceae) eesequences. gene p 5–6.in 258–262. Pp. . ope nNrhAmerica. North in complex ytpei tennesseensis Cystopteris V 51–57. IV: 9 329–360. 29: Gymnocarpium SSSR 8 150–172. 18: 0:11200–11205. 106: 5 485–502. 55: lr Iberica Flora Tracer Bioinformatics 2 9–13. 22: Cystopteris 1 2592–2602. 61: d .Vd.Budapest: Vida. G. ed. , .Ph.D.Thesis.Durham: yncrimdryopteris Gymnocarpium eso ..Available 1.5. Version . 4 1172–1185. 44: Gymnocarpium oeua Phylogenetics Molecular p 2–2.in 121–123. Pp. . Turczaninowia lr fNrhAmerica North of Flora 3:145–191. 134: Taxon Taxon ytpei dickieana Cystopteris d .Castroviejo. S. ed. , 7 83–105. 57: 7 203–210. 67: 5 106–113. 25: fJapan. of 9 1572–1574. 19: p o. from nov., sp. 6 1037–1050. 56: rceig of Proceedings Soobshcheniya 5 705–731. 55: ´ Cystopteris ficas). Molecular . :36–72. 4: Rhodora Annales Annales Taxon Flora Acta , Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. trmn X705 X702 JX873975. JX874032, Bernh., JX874075, Storuman, DK) 81 AWN atu F319(ohese l 2012a), al. JX873974. et 2012a), (Rothfels al. JF832189 et Nantou: (Rothfels 2011). TAIWAN. JF832053 al. 4831, et (DUKE), JX873973. (Kuo JF303925 JX874074,–, Pahang: 2011), al. tenuisecta et (Kuo JF303968 aso 4 Rautenberg & 242 Larsson ag .R 97 udvso ftefml tyica Alston. Athyriaceae family the of subdivision A 1997. Z.-R. Wang, atu F318(ohese l 02) F302(ohese l 2012a), al. et (Rothfels JF832052 2012a), al. JX873972. JX873971. et (Rothfels JF832188 2010), Nantou: al. Lo A. et (Tagawa) (Ebihara AB574893 JX873970. JX874071,–, 060728-01 Kyoto: Ebihara JAPAN. 7097, (MO), sequences) published for previously for citations Provenance, (with numbers (http://fernlab.biology.duke.edu/), GenBank and number Fern database ACRONYM), (HERBARIUM Lab Voucher Species, format: following the JX873977. Lewer JX873976. JX874033, JX874076, County, 305 PHYLOGENY CYSTOPTERIDACEAE of AL.: 1983. subdivision ET Z.-R. revised ROTHFELS Wang, A 2004. Zhao. G.-F. and Hsieh, Y.-T. M.-L., Wang, groundplan- bulblet- the some on of Observations 1956. Hagenah. philosophy J. D. and and Jr. H. Origin W. Wagner, 1980. Jr. H. W. Wagner, European the of analysis Genome 1974. G. Vida, 2013] of .G,P .Sli,adD .Sli.19.Pyoeei relationships Phylogenetic 1994. Soltis. E. D. phylo- and Soltis, mitogenomic S. in P. G., analysis P. Wolf, Concordance 2012. W. D. Weisrock, http:// at: Available Draft]. [First 1) (part Athyriaceae 2008. Z.-R. Wang, wcl .J 2006. J. D. Zwickl, ihatoiyicue.Msigdt r niae y“–”. by indicated are data Missing included. authority with nai:TudrByRgo,J849,,JX873987. JX874091,–, Region, Bay membranifolia Thunder Ontario: OT IA a Jose San RICA. COSTA .S . th atLk ony X700– JX873986. JX874090,–, County, Lake Salt Utah: laurentiana A.. S. U. DK) 87 AAA nai:Mntui itit JX874089, District, Manitoulin Ontario: CANADA. JX874044,–. 2012a). 5847, JF832266 2012a), al. (DUKE), al. et et (Rothfels JF832062 (Rothfels 2012a), al. et (Rothfels JF832204 81 th atLk ony X707 JX874042,–. JX873985. JX874087, 2 County, Lake Smith Salt Utah: 5851, JX873984. JX874041, #H100823 JX873983. JX874085,–, Xalisco, 50 aic:MncpoTqia X704 X700 JX873982. JX874040, JX874084, Tequila, Municipio diaphana Cystopteris Jalisco: 6560, 85 EIO aaa X700 JX874036,–. JX874080, Oaxaca: MEXICO. 5845, JX873979. JX874035, JX874079, diaphana Cystopteris X703 X709 JX873981. JX873980. JX874039, JX874083, JX874038, 3073 JX874082, Rothfels Cilaos, Reunion: diaphana Cystopteris 889 Appendix csotrsjaponica Acystopteris rGR bL matK rbcL, trnG-R, httxnmc Sinica Phytotaxonomica Sinica nlsso ag ilgclsqec aaesudrtemxmmlikelihood maximum the under criterion datasets sequence biological large of analysis h Athyriaceae. the Journal Fern the of populations producing cladistics. of method divergence 181–192. 20: taxa. tetraploid 1: plex. fdnsadii en:eiec from evidence ferns: dennstaedtioid of genetics. 2011. 12 October on Accessed original.htm. flora.huh.harvard.edu/china/mss/volume02/Athyriaceae-MO-part1_ hlgntc n Evolution and Phylogenetics DK) 30 RETN.SnLi:J848,JX874037,–. JX874081, Luis: San ARGENTINA. 6380. (DUKE), DK) 60 AAA nai:Hmlo ein JX874077,–, Region, Hamilton Ontario: CANADA. 7650, (DUKE), ida 94-189 Windham DK) 90 ooao akCut,J848,JX874043, JX874088, County, Park Colorado: 5950, (DUKE), ytpei diaphana Cystopteris ytpei fragilis Cystopteris csotrstaiwaniana Acystopteris DK) 26 .S .Hwii aaa itit JX874086, District, Makawao Hawai’i: A. S. U. 6206, (DUKE), 1 102–104. 21: B. Tagawa. (Bl.) hD hss utn h nvriyo Texas. of University The Austin: Thesis. Ph.D. . Wah)Blasdell. (Weath.) ytpei fragilis Cystopteris DK) 53 EIO unjao uiii Corta Municipio Guanajuato: MEXICO. 6513, (DUKE), .Ls facsin ape nti td,peetdin presented study, this in sampled accessions of List 1. oeua hlgntc n Evolution and Phylogenetics Molecular ¨ e&D Lo D. & ve Mickel. 6 137–146. 46: ytpei dickieana Cystopteris TS739) 98 oy:Nsiaagn JX874072, Nishitama-gun, Tokyo: 7978, (TNS:763998), AL.Gntcagrtmapoce o h phylogenetic the for approaches algorithm Genetic GARLI. , , , ytpei fragilis Cystopteris rnad1875bis Grangaud ohes2620 Rothfels i htodr.Tefrtisac fatxni nbold, in is taxon a of instance first The order). that (in caPyoaooiaSinica Phytotaxonomica Acta ohes3171 Rothfels ´ atnVlaMls X708 X704 JX873978. JX874034, JX874078, Mills, Villa Canton : ohes3365 Rothfels ¨ ve. DK) 86 .S . rzn:Coconino Arizona: A.: S. U. 5836, (DUKE), ytpei fragilis Cystopteris Les. Nakai. (Luerss.) cutpl 807 Schuettpelz , 5 32–36. 35: caBooiaAaeieSinirmHungaricae Scientiarum Academiae Biologica Acta aso 21 Larsson cutpl 1127A Schuettpelz DK) 90 WDN Va SWEDEN. 7920, (DUKE), ytpei diaphana Cystopteris ytpei diaphana Cystopteris Br)Blasdell,(Bory) ytpei douglasii Cystopteris “haufleri”, :383–392. 3: lhm17525 Oldham csotrstenuisecta Acystopteris , u 175 Kuo DK) 62 atnPrzZeledon, Perez Canton 5622, (DUKE), ytpei fragilis Cystopteris DK) 52 aai:Municipio Nayarit: 6592, (DUKE), ytmtcBotany Systematic i nChina. in Sim DK) 72 EIO Oaxaca: MEXICO. 6732, (DUKE), ytpei bulbifera Cystopteris DK) 36 RNE l ela de Ile FRANCE. 6386, (DUKE), DK) 13 WDN Uppsala SWEDEN. 7103, (DUKE), L)Bernh. (L.) TI) 17 ha:JX874073, Chial: 6137, (TAIF), ida .n. s. Windham DK) 25 MALAYSIA. 4225, (DUKE), sgr aaah 25409 Takahashi & Tsugaru ytpei bulbifera Cystopteris ao 08-147 Matos DK) 01 CANADA. 8081, (DUKE), “brittonii”, ytpei alpina Cystopteris rbcL ytpei diaphana Cystopteris csotrstaiwaniana Acystopteris DK) 80 TAIWAN. 4870, (DUKE), 2 524–527. 42: , ytpei fragilis Cystopteris , 5 194–202. 65: ida 560 Windham ohes3123 Rothfels sequences. ytpei diaphana Cystopteris caPhytotaxonomica Acta csotrsjaponica Acystopteris esys n. s. Kelsey , Hook. complex. ytpei fragilis Cystopteris :173–193. 5: cutpl 1088A Schuettpelz , ohes32 & 3929 Rothfels DK) 7034, (DUKE), ida 865 Windham DK) 5316, (DUKE), Acystopteris Oppenheimer Cystopteris Cystopteris ¨ sterbotten: Molecular American (DUKE), (DUKE), (DUKE), , Arana Desv. com- ´ Acta zar, (L.) , , , 09 HN.Tbt oiXa,J842,J846,JX874020. JX874066, JX874127, JX874021. Xian, parvulum JX874128,–, Parbat, Bomi Nanga Tibet: jessoense Gymnocarpium CHINA. JX874019. 2010), 6059, al. et jessoense (Ebihara Gymnocarpium AB574993 JX874126, Minamitsuru-gun, JX874018. aokigaharaense 2010), al. et (Ebihara AB574992 HK2007-815 JX874017. JX874064, JX874123, 209 Metzgar JX874122,–,–. County, JX874016. Snohomish JX874063, JX874121, Borough, Peninsula disjunctum Kenai Gymnocarpium Alaska: A. S. U. disjunctum Gymnocarpium 3897 ihtm-u,J843,A549 Eiaae l 00,JX874025. 2010), al. et remotepinnatum (Ebihara AB574995 Gymnocarpium JX874132, (Rothfels JF832069 Nishitama-gun, 2012a),–. 2012a), al. al. et (Rothfels et JF832219 Tokyo: JAPAN. 6399, psl:J821 Rtfl ta.21a,J826 Rtfl ta.2012a), al. et 2012a). (Rothfels al. JF832068 et (Rothfels 2012a), JF832277 al. et (Rothfels JF832218 Uppsala: JX874065,–. JX874124, Jurmo, Archipelago: Varsinais-Suomi FINLAND. 5837, (DUKE), X719– JX874014. JX874119,–, 3914 Zylinski JX874024. uiii at ai epxo X702 X705 JX873988. JX874045, JX874092, Teopoxco, Me Maria millefolia Cystopteris Santa Municipio JX874012. utahensis parvulum montana 380 JX874011. JX874060, JX874115, County, Haufler. & Windham JX874010. JX874058, JX874059, JX874113, JX874114, County, County, Chittenden Coconino Arizona: A. JX874009. S. U. 5833, (DUKE), JX874008. JX874112,–, JX874007. JX874057, JX874111, tennesseensis County, Jones Carolina: North itit X710 X707 JX874023. JX874067, JX874130, District, ie:suhatTbt X705– JX873991. JX874095,–, Tibet, southeast Tibet: 2012a). al. et (Rothfels JX873990. 2012a), 2012a), al. 073 al. et et (Rothfels (Rothfels JF832205 District, JF832063 North Barbe St. Newfoundland: DK) 39 E ELN.Oao X710 X706 JX874006. JX874056, JX874110, Otago, tennesseensis ZEALAND. Cystopteris NEW 6379, (DUKE), Wu 32 igna ryo ony X713 X702 JX874000. JX874052, JX874103, County, Grayson reevesiana Cystopteris Virginia: 6362, X712 X701 JX873999. JX874051, JX874102, C.Chr. JX873995. ex JX874048, JX874098, amr,60,U .A aa’:Kui X717 X705 JX874003. JX874055, JX874107, Kauai, Hawai’i: A. sudetica S. Cystopteris U. 6208, Palmer), JX873998. protrusa JX874050, JX874101, JX873997. County, Wilkinson JX874049, Mississippi: JX874100, County, protrusa Zhongdian JX873994. 6060, 2012a), JX873996. al. JX874099,–, et (Rothfels JF832064 2012a), moupinensis al. Cystopteris et (Rothfels 1118A JX873993.Schuettpelz JX874097,–, Alta, Finnmark: JX873992. rzn:Ccnn ony X714 F519(cutpl ta.2007), al. et (Schuettpelz EF452149 JX874001. JX874104, County, Coconino Arizona: 90 AA.Ngn:Mtuoosi X719 B799(Ebihara JX874005. AB574939 2010), JX874109, al. Matsumoto-shi, et Nagano: JAPAN. 7980, JX874002. JX874004. JX874054, JX874108,–, RUSSIA. JX874106, County Fremont sandwicensis Cystopteris Colorado: 6342, JX874053,–. JX874105, County, ´ ¨ io uiii cia,J849,J844,JX873989. JX874046, JX874093, Ocuilan, Municipio xico: dsh94-79-23 ndisch DK) 99 nai:TudrByDsrc,J849,,JF832267 JX874094,–, District, Bay Thunder Ontario: 6969, (DUKE), DK) 84 ooioCut,J841,JX874061,–. JX874116, County, Coconino 5834, (DUKE), DK) 80 aeCut,J842,J846,JX874015. JX874062, JX874120, County, Page 7800, (DUKE), , , , Lm)Brn xDesv. ex Berhn. (Lam.) Wahry Blasdell. (Weatherby) Sarvela. ohes2973 Rothfels url 1582 Murrell yncrimoyamense Gymnocarpium elr877 Legler yncrimappalachianum Gymnocarpium ytpei tenuis Cystopteris ytpei reevesiana Cystopteris ytpei montana Cystopteris ofese ta.22 al. et Hoffmeister , yncrimdryopteris Gymnocarpium DK) 61 .S .Aak:KniPnnuaBorough, Peninsula Kenai Alaska: A. S. U. 4601, (DUKE), ida 81-13 Windham TS,78,JPN okio rugn JX874125, Uryu-gun, Hokkaido: JAPAN. 7981, (TNS), DK) 69 .S .Vrii:Hgln County, Highland Virginia: A. S. U. 7639, (DUKE), Nakaike. yncrimoyamense Gymnocarpium rne 1628 Brinker DK) 81 AWN atuCut,JF832206 County, Nantou TAIWAN. 4861, (DUKE), U) 02 ie:suhTbt X706 JX874047, JX874096, Tibet, south Tibet: 7072, (UC), ytpei montanaCystopteris N) 10 USA ahlnRgo,JX874131,–, Region, Sakhalin RUSSIA. 8120, (NY), ik6566 Rink .Ban&Milde. & Braun A. , ytpei pellucida Cystopteris yncrimappalachianum Gymnocarpium , Dickore Lellinger. Mickel. DK) 88 th thCut,JX874117,–, County, Utah Utah: 6848, (DUKE), ytpei tenuis Cystopteris , Dickore ytpei tasmanica Cystopteris ie ie 2010-82 Miles & Sigel kgw 1976 Okegawa DK) 81 etcy arnCounty, Warren Kentucky: 5841, (DUKE), Shaver. Kiz)Koidz. (Koidz.) Rpeh)Ching. (Ruprecht) Brack. , DK) 90 ense:Pta County, Putnam Tennessee: 7990, (DUKE), ´ arntn2373 Barrington yncrimdryopteris Gymnocarpium ytpei sudetica Cystopteris , ytpei protrusa Cystopteris DK) 03 AAA nai:Kenora Ontario: CANADA. 8053, (DUKE), 11892 ´ yncrimdryopteris Gymnocarpium DK) 82 .S .Aioa Coconino Arizona: A. S. U. 5832, (DUKE), , ytpei reevesiana Cystopteris aso 315 Larsson ohes3411 Rothfels M) 05 unn eQnCounty, Qin De Yunnan: 6055, (MO), ytpei pellucida Cystopteris 12767 eln 6448 LeBlond ida 462 Windham lod2088 Alford cutpl 419 Schuettpelz yncrimdryopteris Gymnocarpium ohes2441 Rothfels Hyt)Ching. (Hayata) od9009 Wood , Bkr Ching. (Baker) U) 04 HN.Tbt ETibet, SE Tibet: CHINA. 7074, (UC), aso 6 Larsson yncrimjessoense Gymnocarpium ytpei utahensis Cystopteris , ytpei moupinensis Cystopteris TS,78,JPN Yamanashi: JAPAN. 7984, (TNS), U) 09 AITN Astor/ PAKISTAN. 7069, (UC), Dickore , yncrimjessoense Gymnocarpium yncrimdryopteris Gymnocarpium Unknown , uioo071023 Fujimoto ytpei montana Cystopteris asivc ta.02-57 al. et Yatskievych re Haufler. & Pryer ofode l 29916 al. et Boufford ytpei montana Cystopteris Mcx)Desv. (Michx.) DK) 93 NORWAY. 7943, (DUKE), DK) 71 Washington: 7751, (DUKE), eza 224 Metzgar ´ DK) 89 CANADA. 5839, (DUKE), DK) 71 MEXICO. 6761, (DUKE), DK) 88 .S A. S. U. 5838, (DUKE), DK) 37 Vermont: 6387, (DUKE), DK) 09 SWEDEN. 7059, (DUKE), 11796 , pr.hr.Dne D. Daniel herb. (pers. DK) 84 Cochise 5844, (DUKE), DK) 53 .S A. S. U. 4513, (DUKE), eo1314 Ueno DK) 16 .S A. S. U. 3126, (DUKE), , Hook. ohes2879 Rothfels ytpei utahensis Cystopteris M 380) 7096, 4378105), (MO , aaos n. s. Nakato , U) 01 CHINA. 7071, (UC), ohes&Zylinski & Rothfels mt 12 Smith , asivc 02-31 Yatskievych , hitnuz3758 Christenhusz Fac. Ching (Franch.) bhr Kadota & Ebihara hre 192/07 Thorsen DK) 4710, (DUKE), , (TNS:766629), TS,7983, (TNS), ida 92- Windham Cystopteris Cystopteris L)Newm. (L.) , ig6374 Ring Cystopteris Cystopteris Cystopteris ohes& Rothfels ars09- Harris , (DUKE), (DUKE), (DUKE), ih & Miehe Franch. subsp. subsp. (MO), (MO), var. Delivered by Publishing Technology to: Duke University IP: 152.3.71.163 on: Fri, 31 May 2013 00:39:35 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 38 [Volume BOTANY SYSTEMATIC JX874026. 2007), Pryer and remotepinnatum al. (Schuettpelz et (Rothfels EF463317 JF832220 County, 2012a), Jianchuan Yunnan: CHINA. 3066, (MO), 306 99 AA.Iae hmhign X719 B794(bhr tal. et (Ebihara AB574994 JX874022. JX874129, Shimohei-gun, 2010), Iwate: JAPAN. 7979, JX874028. JX874134,–, County, JX874027. JX874068, ( JX874133, County, X709 JX874031. JX874069, 282 JX874030. JX874136,–, District, Cochrane robertianum JX874029. Gymnocarpium JX874135,–, District, Cochrane Ontario: CANADA 7178, (TRTE), Haufler. lcnmschomburgkii Blechnum 02 2007),–. Pryer and (Schuettpelz n. s. Smith JX874013. JX874118,–, ShetezadPyr20) F321(ohese l 2012a). al. et (Rothfels JF832261 2007), Pryer and EF463160 2012a), (Schuettpelz al. et (Rothfels JF832198 Zamora-Chinchipe: ECUADOR. of. Newm. Hoffm.) TS,,JPN hzoa–– F328(ohese l 2012a). al. et (Rothfels JF832258 Shizuoka:–,–, JAPAN. (TNS),–, DK) 95 OWY odad aseCut,JX874137, County, Fauske Nordland: NORWAY. 7945, (DUKE), mt 212.1 Smith U) 74 ut,J829 Rtfl ta.21a,EF463305 2012a), al. et (Rothfels JF832195 Cult., 3744, (UC), , cutpl 1119A Schuettpelz re .n. s. Pryer Gymnocarpium Gymnocarpium DK) 86 .S .Clrd:GadCounty, Grand Colorado: A. S. U. 7806, (DUKE), OUTGROUP: Kozc)C Chr. C. (Klotzsch) , DK) 82 .S .Mneoa Clearwater Minnesota: A. S. U. 5852, (DUKE), lhm&Bkwk 28524 Bakowsky & Oldham tyimotophorum Athyrium yncrimrobertianum Gymnocarpium

+ DK) 82 AWN Nantou TAIWAN. 4862, (DUKE), sp. tyimotophorum Athyrium brittonianum yncrimrobertianumGymnocarpium bhr ta.TH2007-996 al. et Ebihara cutpl 242 Schuettpelz yncrimrobertianum Gymnocarpium , bhr ta.070210- al. et Ebihara Srea re & Pryer (Sarvela) DK) 7197, (DUKE), , DK) 2410, (DUKE), Gymnocarpium Mq)Koidz. (Miq.) rgr .n. s. Gregory Deparia , Larsson (TNS), DK) 93 ut:oiial rmU .A ea:Bre County, Burnet Texas: A. S. U. 2007),–. Pryer from and (Schuettpelz originally EF463319 JX874138, Cult.: JF832286 2973, 2007), 2012a). Pryer (DUKE), al. and (Schuettpelz et EF463279 (Rothfels 2012a), al. et (Rothfels Presl. 2011). al. et (Kuo JF303928 2012a),–. TAIWAN.–,–, al. et (Rothfels JF832066 2011). 1220A al. et (Kuo rehue,J820 Rtfl ta.21a,E430 Shetezand (Schuettpelz EF463306 2007),–. 2012a), Pryer al. et (Rothfels JF832207 Greenhouse), lancea 87 AWN atuCut,J823 Rtfl ta.2012a), al. 2012a). et al. (Rothfels et Holttum. (Rothfels JF832235 JF832285 County, Nantou 2012a). JX874070,–. al. TAIWAN. et (Rothfels 4837, JF832281 2012a), atkinsonii al. Pseudocystopteris et (Rothfels JF832077 2012a), al. 2011). et al. Pryer 3360 et and (Schuettpelz (Kuo EF463318 JF303927 2012a), al. 2007), et (Rothfels JF832221 Tortue, hitnuz2476 Christenhusz DK) 97 AWN ln F322(ohese l 2012a), al. et (Rothfels JF832212 Ilan: TAIWAN. 4967, (DUKE), Tub)R Sano. R. (Thunb.) ase 2724 Janssen suoytpei atkinsonii Pseudocystopteris DK) 79 EIO aaa F320(ohese al. et (Rothfels JF832230 Oaxaca: MEXICO. 6729, (DUKE), eai lancea Deparia ilzossjavanica Diplaziopsis P,35,FAC.Ied aRuin JF832236 Reunion, la de Ile FRANCE. 3559, (P), DK) 04 RNHGIN.Montagnes GUIANA. FRENCH 3054, (DUKE), odi obtusa Woodsia cutpl 298 Schuettpelz , u 112 Kuo Bd. Ching. (Bedd.) ilzossjavanica Diplaziopsis ncepi hintonii Onocleopsis suohgpei cruciata Pseudophegopteris , u 477 Kuo TI)– AWN–– JF303940 TAIWAN,–,–, (TAIF),–, eiitu marginatum Hemidictyum DK) 58 ut Dk U. (Duke Cult. 2558, (DUKE), Sr)Torrey (Spr.) Bue .Chr. C. (Blume) TI)– atuCounty,–,–, Nantou (TAIF),–, cutpl 1094 Schuettpelz , u 138 Kuo Ballard. cutpl 328 Schuettpelz Schuettpelz (TAIF),–, (DUKE), (Willd.) Rothfels L)C. (L.)