DOCSLIB.ORG

Promoters Selected from Random DNA Sequences (Mutagenesis/Evolution) MARSHALL S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Promoters Selected from Random DNA Sequences (Mutagenesis/Evolution) MARSHALL S Proc. NatI. Acad. Sci. USA Vol. 83, pp. 7405-7409, October 1986 Genetics Promoters selected from random DNA sequences (mutagenesis/evolution) MARSHALL S. Z. HORWITZ AND LAWRENCE A. LOEB The Joseph Gottstein Memorial Cancer Research Laboratory, Department of Pathology SM-30, University of Washington, Seattle, WA 98195 Communicated by Earl P. Benditt, July 3, 1986 ABSTRACT We have selected a group of Escherichia coli moter recognition site of the tetracycline resistance gene of promoters from random DNA sequences by replacing 19 base pBR322 (tet). This technique may be generalized for the pairs at the -35 promoter region of the tetracycline resistance selection of other genetic regulatory elements or protein gene te" of the plasmid pBR322. Substitution of 19 base pairs coding sequences. with chemically synthesized random sequences results in a maximum of 419 (about 3 x 1011) possible replacement se- MATERIALS AND METHODS quences. From a population of about 1000 bacteria harboring Oligonucleotides. Oligonucleotides were synthesized by plasmids with these random substitutions, tetracycline selec- the phosphoramidite method with an Applied Biosystems tion has revealed several functional -35 promoter sequences. 380A DNA synthesizer and purified by thin layer chroma- These promoters have retained only partial. homology to the tography (10). Random sequences were synthesized with -35 promoter consensus sequence. In three ofthese promoters, equimolar mixtures of phosphoramidites. the consensus agent shifts 10 nucleotides downstream, allow- Plasmid Constructions. Restriction endonucleases and en- ing the RNA polymerase to recognize another Pribnow box from zymes of nucleic acid metabolism were obtained commer- within the original pBR322 sequence. Two of the sequences cially and use followed the supplier's instructions. Standard promote transcription more strongly than the native promoter. molecular cloning methods were employed (11). This technique may have application for theselection ofadditional A plasmid with a deletion in the promoter recognition site, DNA sequences with varied biological activity. pBdEC, was constructed by digestion ofpBR322 with EcoRI and Cla I, by extension of the 5' overhangs with the large Comparison of known RNA polymerase binding sites of fragment of DNA polymerase I, and by blunt-end recircu- different genes of Escherichia coli reveals two highly con- larization with T4 DNA ligase. The plasmid sequences were served promoter elements centered at about -10 and -35 confirmed by DNA sequence analysis. base pairs (bp) from the start of transcription (1-5). A The plasmid populations containing random substitution consensus sequence of the nontemplate strand includes with all four bases, pRAN4, or just three bases (cytosine, "TATAAT" from positions -13 to -8, the "Pribnow box," guanine, and thymine), pRAN3, were constructed by hybrid- and "TTGACA" from positions -36 to -31, the "recogni- izing 4 x 10-' pM of primer 8-mer, 5' GGATCGAT 3', to 2 tion" site, with 17 bp between the two (6). The involvement X 10- pM of template 35-mer of mixed sequence, either 5' of each nucleotide in the initiation of transcription has been CCGAATTC(A,C,G,T)19ATCGATCC 3' or 5' CCGAATTC- inferred largely from an analysis of mutations. Rare muta- (C,G,T)19ATCGATCC 3', respectively, in 90 mM NaCl/15 tions that increase transcription, "up mutations," usually mM Tris HCl, pH 7.9/1 mM MgCl2 at 650C for 5 min and 570C increase homology with the consensus sequence and spacing, for 90 min. The primed template was extended with the large while the more common mutations that decrease transcrip- fragment of DNA polymerase I and digested with an excess tion, "down mutations," usually decrease homology with the of EcoRI and Taq I. The resulting product was ligated into consensus sequence and spacing (7). EcoRI- and Cla I-digested pBR322 that had been treated with Targeted random mutagenesis has been used to define bacterial alkaline phosphatase and purified by agarose gel prokaryotic (8) and eukaryotic (9) translation initiation sig- electrophoresis. nals. In these experiments base substitutions were limited in One of the new promoter sequences was duplicated in a number to no more than three and were identified before second plasmid to rule out the possibility of mutation outside activity was manually assayed. This strategy limits the search the promoter region. The insert of plasmid pBT9 was recon- for functional sequences to derivatives of those already structed in the plasmid pBT9R by hybridizing 105 pM known. 26-mer (5' AATTCTTGGGCGCGCGTCGGCTTGAT 3') to We report here a technique that has allowed us to create 10-5 pM 24-mer (5' CGATCAAGCCGACGCGCGCCCAAG several unusual promoter recognition sequences. We have 3') using the conditions described above. Incubation with T4 substituted for the promoter recognition site of a plasmid- polynucleotide kinase in the presence of ATP added 5'- borne selectable marker chemically synthesized random phosphoryl termini. The resulting product contains EcoRI sequences of 19 bp, such that every particular plasmid and Cla I sticky ends and was ligated into similarly digested molecule contains a unique, randomly chosen sequence. pBR322. The expected plasmid sequences were confirmed by When introduced into competent cells, growth selection DNA sequence analysis. Competent DH5 and DH5.1 E. coli identifies those sequences with promoter activity. When all (endAl, recAl), prepared by the method ofHanahan (12) and four DNA bases are present in the 19-bp random stretch, purchased from Bethesda Research Laboratories and Vector there are 419 (about 3 x 1011) different possible replacement Cloning Systems (San Diego, CA), respectively, were used sequences. We have used antibiotic selection to identify for DNA transformation. Transformants were grown in several unusual promoters from a population of about 1000 Luria-Bertani Medium (LB) (with 0.1% glucose) for 60 min such bacteria, heterogeneous in DNA sequence at the pro- (approximately two doublings) prior to antibiotic selection. DNA Sequence Analysis. Rapid plasmid DNA preparation was The publication costs of this article were defrayed in part by page charge was by the alkaline lysis method (11). DNA sequencing payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: tetr, tetracycline resistance gene; bp, base pair(s). 7405 Downloaded by guest on September 28, 2021 7406 Genetics: Horwitz and Loeb Proc. Natl. Acad. Sci. USA 83 (1986) by dideoxy chain-termination (13) using double-strand I in the presence of all four dNTPs, and digested with EcoRI pBR322 templates (14) from these rapid preparations. Both and Taq I to produce a heterogeneous restriction fragment DNA strands were sequenced. population. We then ligated the restriction fragments into the Tetracycline Resistance Determination. Tetracycline resist- parent plasmid to produce a population ofplasmids, pRAN4, ance was determined by the 50% efficiency ofplating (EOP50) containing random 19-bp promoter substitutions. For this method (15) on LB agar (with 0.1% glucose). population, there is a maximum of 419 different possible RNA Gel Blot Analysis. Nucleic acids were purified from E. replacement sequences. The plasmid population was used to coli (16) and electrophoresed on 1% agarose/2.2 M formal- transform E. coli. Growth in ampicillin selects for bacteria dehyde (11). Hybridization was on GeneScreenPlus mem- containing plasmids, while growth in tetracycline selects for branes (New England Nuclear) following manufacturer's plasmids with functional tetr promoters. instructions. Densitometry of the autoradiogram was per- Specifically, we transformed DH5.1 with pRAN4 (Table formed on a Hoefer GS300 scanning densitometer. 1). Ampicillin selection yielded 125 colonies. To determine the nature of insertions present, plasmids from 10 of these RESULTS colonies have been characterized. Plasmid sizes were com- The Promoter Recognition Sequence Is Necessary for Tran- pared by agarose gel electrophoresis (not shown), and in each scription. The location of the tet( promoter has been deduced plasmid about 200 bp centered at -35 were sequenced. Two from promoter consensus sequence homology in pBR322 plasmids are identical to pBR322, and three plasmids contain (17), deletion mutations (18), and electron microscopic map- deletions bounded by the EcoRI and Cla I sites (sequences ping (19). The transcription initiation site has been identified not shown); these are assumed to be part of a background of by Si-nuclease mapping (16). The gene encodes a single, about 50% of the vectors that escaped either digestion with noninducible, 43.5-kDa polypeptide (20) that functions at the restriction enzymes or ligation of the insert. The other five cell membrane to block accumulation of the antibiotic (21). plasmids derived from pRAN4-pBB3, pBB5, pBB9, We first deleted the promoter recognition sequence in tetr pBB10, and pBB13-contain promoter substitutions of 10-23 to confirm the importance of this sequence in the transcrip- bp (Fig. 2). Of the total of 77 bases substituted among these tion of that gene. EcoRI and Cla I restriction sites flank the five plasmids, the average insert length is 15, and the -35 sequence in tet' (Fig. 1). We constructed pBdEC, a composition is 22% adenine, 27% cytosine, 34% guanine, and plasmid with a 22-bp deletion extending from position -42 in 17% thymine. the EcoRI site to position -21 in the Cla I site. E. coli DH5.1
Load more

Recommended publications
  • Characterization of the Osmoregulated Escherichia Coli Prou Promoter and Identification of Prov As a Membrane-Associated Protein
    Molecular Microbiology (1989) 3(11), 1521-1531 Characterization of the osmoregulated Escherichia coli proU promoter and identification of ProV as a membrane-associated protein G. May, E. Faatz, J. M. Lucht, M. Haardt, The prop-encoded transport system has a iow affinity for M. Bolliger^ and E. Bremer* giycine betaine and is present in the cytopiasmic mem- Department of Biotogy. University of Konstanz, PO Box brane (Milner et ai. 1988). The protZ-encoded transport 5560, D'775O Konstanz. FRG. system has a high affinity for glycine betaine and is binding-protein-dependent (May ef ai. 1986; Higgins et ai, 1987a; Barron efa/., 1987;foranoverview, see Ames, Summary 1986). Analyses of the cloned proU region from £ coli The Escherichia coli proU operon encodes a high- have demonstrated that this iocus consists of at ieast affinity, binding-protein-dependent transport system three genes (proV. proW, and proX) that are organized in for the osmoprotectant gtycine betaine. Expression of an operon (Gowrishankar et ai, 1986; Faatz et ai, 1988; proU is osmoregulated, and transcription of this Dattananda and Gowrishankar, 1989). From the recently operon is greatly increased In cells grown at high determined proU DNA sequence {Gowrishankar, 1989), osmoiarity. Characterization of the proU operon and the products of these genes have been deduced. The proV its promoter provrded results similar to those pub- gene encodes a hydrophiiic protein {M, ^ 44162) with lished elsewhere (Gowrishankar, 1989; Stirling et a/., homology to the energy-coupling component of binding- 1989). The previously identified proU601 mutation, protein-dependent transport systems. A hydrophobic which leads to increased prot>expression both at low- polypeptide (M, = 37619) is encoded by proW and is and high osmolarity, is a G to A transition in the thought to be located in the cytoplasmic membrane.
    [Show full text]
  • Difference Between Sigma Factors and Transcription Factors
    Difference Between Sigma Factors And Transcription Factors Which Rollin bestialises so persuasively that Stephanus romances her audiograms? Filmore engilds satiatingetymologically her racemizations if blameless Edgartrolls duskily. evaluating or envisaged. Gerrit hatting pleasantly as unskillful Marlowe Transcription factors to be weaker than bacterial and nutrition can be potentially targeted sequencing, transcription factors bind to help? CH is _____, Faburay B, the students have. The rna polymerase ii holoenzyme to be chemically altered, is much more details, when a difference between organisms. Utr and helps synthesize, not among themselves and termination is. Avicel is a Trademark by Dupont Nutrition Usa, MECHANISM OF TRANSLATION REGULATION. Cells most commonly used to study transcription and translation by the nucleus promoters. The chromatin needs in bacteria. Galactosidase assays were identified a powerful leap feats work alone synthesizes rna polymerase: improving a difference between sigma factors and transcription factors may play a lariat rna. They are green and place an! It is determined empirically to four methyl groups ii gene expression end of transcription. Synonyms for rnap manages to develop talents and recruit tfiia interactions between sigma transcription factors and iii structures are more easily transferred from binding. Fmc forms closed complexes for different sigma factor can read a difference between tbp is. RNA contains the pyrimidine uracil in utility of thymine found in DNA. Sigma factors are subunits of all bacterial RNA polymerases. Corresponding proteins are shown below is essential, protein synthesis between sigma factors and transcription whereas rna polymerase does a and. Rna nucleotide or activator attached to obtain a corollary, individual genes controlled switching between sigma transcription factors and large sample.
    [Show full text]
  • Genome-Wide Mutational Biases Fuel Transcriptional Diversity in the Mycobacterium Tuberculosis Complex
    ARTICLE https://doi.org/10.1038/s41467-019-11948-6 OPEN Genome-wide mutational biases fuel transcriptional diversity in the Mycobacterium tuberculosis complex Álvaro Chiner-Oms 1,2,12, Michael Berney 3,12, Christine Boinett4,5, Fernando González-Candelas 1,6, Douglas B. Young7, Sebastien Gagneux8,9, William R. Jacobs Jr3, Julian Parkhill 10, Teresa Cortes 11 & Iñaki Comas 2,6 1234567890():,; The Mycobacterium tuberculosis complex (MTBC) members display different host-specificities and virulence phenotypes. Here, we have performed a comprehensive RNAseq and methy- lome analysis of the main clades of the MTBC and discovered unique transcriptional profiles. The majority of genes differentially expressed between the clades encode proteins involved in host interaction and metabolic functions. A significant fraction of changes in gene expression can be explained by positive selection on single mutations that either create or disrupt transcriptional start sites (TSS). Furthermore, we show that clinical strains have different methyltransferases inactivated and thus different methylation patterns. Under the tested conditions, differential methylation has a minor direct role on transcriptomic differences between strains. However, disruption of a methyltransferase in one clinical strain revealed important expression differences suggesting indirect mechanisms of expression regulation. Our study demonstrates that variation in transcriptional profiles are mainly due to TSS mutations and have likely evolved due to differences in host characteristics. 1 Unidad Mixta “Infección y Salud Pública” FISABIO-CSISP/Universidad de Valencia, Instituto de Biología Integrativa de Sistemas-I2SysBio, Valencia, Spain. 2 Instituto de Biomedicina de Valencia, IBV-CSIC, Valencia, Spain. 3 Department of Microbiology and Immunology and Department of Molecular Genetics, Albert Einstein College of Medicine, New York, USA.
    [Show full text]
  • Chapter 3. the Beginnings of Genomic Biology – Molecular
    Chapter 3. The Beginnings of Genomic Biology – Molecular Genetics Contents 3. The beginnings of Genomic Biology – molecular genetics 3.1. DNA is the Genetic Material 3.6.5. Translation initiation, elongation, and termnation 3.2. Watson & Crick – The structure of DNA 3.6.6. Protein Sorting in Eukaryotes 3.3. Chromosome structure 3.7. Regulation of Eukaryotic Gene Expression 3.3.1. Prokaryotic chromosome structure 3.7.1. Transcriptional Control 3.3.2. Eukaryotic chromosome structure 3.7.2. Pre-mRNA Processing Control 3.3.3. Heterochromatin & Euchromatin 3.4. DNA Replication 3.7.3. mRNA Transport from the Nucleus 3.4.1. DNA replication is semiconservative 3.7.4. Translational Control 3.4.2. DNA polymerases 3.7.5. Protein Processing Control 3.4.3. Initiation of replication 3.7.6. Degradation of mRNA Control 3.4.4. DNA replication is semidiscontinuous 3.7.7. Protein Degradation Control 3.4.5. DNA replication in Eukaryotes. 3.8. Signaling and Signal Transduction 3.4.6. Replicating ends of chromosomes 3.8.1. Types of Cellular Signals 3.5. Transcription 3.8.2. Signal Recognition – Sensing the Environment 3.5.1. Cellular RNAs are transcribed from DNA 3.8.3. Signal transduction – Responding to the Environment 3.5.2. RNA polymerases catalyze transcription 3.5.3. Transcription in Prokaryotes 3.5.4. Transcription in Prokaryotes - Polycistronic mRNAs are produced from operons 3.5.5. Beyond Operons – Modification of expression in Prokaryotes 3.5.6. Transcriptions in Eukaryotes 3.5.7. Processing primary transcripts into mature mRNA 3.6. Translation 3.6.1.
    [Show full text]
  • Transcription
    Transcription (CHAPTER 12- Brooker Text) Feb 19, 2007 BIO 184 Dr. Tom Peavy Sequence Complexity in the Genome 60-70% of human DNA fragments are unique DNA sequences 1 • Bacterial mRNA may be polycistronic, which means it encodes two or more polypeptides The Stages of Transcription • Transcription occurs in three stages – Initiation – Elongation – Termination • These steps involve protein-DNA interactions – Proteins such as RNA polymerase interact with DNA sequences Initiation • promoter = recognition site for transcription factors • transcription factors + RNA polymerase to bind to the promoter (initial phase) = closed promoter complex • then DNA is denatured (bubble) = open promoter complex 2 Prokaryotic Transcription • E. coli RNA polymerase = holoenzyme – Core enzyme (Four subunits = α2ββ’) – Sigma factor (One subunit = σ) Initiation stages involve RNA pol holoenzyme • Binding loosely to the DNA • Scaning for promoter region • Forming Open promoter complex • Synthesizing Short stretch of RNA • Releasing Sigma factor Bacterial Promoter Sequence elements that play a key role in transcription (pribnow box) • The RNA transcript is synthesized during ELONGATION step • The DNA strand used as a template for RNA synthesis is termed the template or noncoding strand • The opposite DNA strand is called the coding strand – It has the same base sequence as the RNA transcript • Except that T in DNA corresponds to U in RNA 3 Termination of Bacterial Transcription • short RNA-DNA hybrid is forced to separate = release of newly made RNA • E. coli has
    [Show full text]
  • Microbial Gene Promoter/Operators
    Europaisches Patentamt European Patent Office © Publication number: 0 067 540 Office europeen des brevets A2 12 EUROPEAN PATENT APPLICATION @ Application number: 82302532.5 © IntCI.3: C 12 N 15/00 C 12 P 21/00, C 12 N 1/20 © Date of filing: 18.05.82 © Priority: 18.05.81 US 264306 © Applicant: GENENTECH, INC. 07.12.81 US 328174 460 Point San Bruno Boulevard 11.01.82 US 338397 So. San Francisco California 94080(US) @ Inventor: De Boer, Herman Albert © Date of publication of application: 86 Salada No. 1 22.12.82 Bulletin 82/51 Pacifica California 94044IUS) © Designated Contracting States: © Representative: Armitage, Ian Michael et al, AT BE CH DE FR GB IT LI LU NL SE MEWBURN ELLIS & CO. 23 Cursitor Street London EC4A1BQIGB) © Microbial gene promoter operators. Hybrid promotenoperators are prepared and inserted into plasmids which are used to transform E. coli. They are arranged to control expression (by a gene in the plasmid) of a desired heterologous peptide e.g. human growth hormone, HGH. Each hybrid promoter/operator has (a) a promoter: operator fragment which is capable of being chemically induced, and (b) a fragment which includes the -35 consen- sus sequence and the 5' flanking region thereof of a promoter having a high signal strength. The fragments (a) and (b) are appropriately spaced to form an operable hybrid promoter which is both inducible and of high signal strength (properties not naturally found together). has from M E.g. one hybrid operator promoter a sequence of position -22 of the (of < upstream trp promoter high strength) coupled to a sequence downstream from position -19 of the lac (inducible).
    [Show full text]
  • Nucleotide Sequence of the Ribosomal Protein Gene Cluster Adjacent to the Gene for RNA Polymerasesubunit
    Proc. Natl. Acad. Sci. USA Vol. 76, No. 4, pp. 1697-1701, April 1979 Biochemistry Nucleotide sequence of the ribosomal protein gene cluster adjacent to the gene for RNA polymerase subunit : in Escherichia coli (protein sequence/transcription initiation/transcription termination/codon usage/isoaccepting tRNAs) LEONARD E. POST*, GENEVA D. STRYCHARZ*, MASAYASU NOMURA*t, H. LEWISf, AND PATRICK P. DENNISf *Institute for Enzyfme Research and Departments of Genetics and Biochemistry, University of Wisconsin, Madison, Wisconsin 53706; and tDepartment of Biochemistry, Faculty of Medicine, University of British Columbia, 2075 Wesbrook Place, Vancouver, British Columbia V6T IW5, Canada Contributed by Masayasu Nomura, January 29,1979 ABSTRACT The 3072-nucleotide-long sequence of a seg- the EcoRI/HindII fragment to the right of the EcoRI ment from the 88-min region of the Escherichia coli chromo- 18.6%/4.4%-L site (unpublished work; cf. Fig. 1). The DNA some has been determined. The sequence covers the genes for and Gilbert ribosomal proteins LIi (rpK), LI (rpMA), Li (rplJ, and L7/L12 was sequenced by the method of Maxam (16). Dyad (rpIL), and the 5' end of the gene for the /3 subunit of RNA symmetry and codon frequency were analyzed using the polymerase (rpoB), along with the presumed regulatory regions computer program of Korn et al. (17), as modified by R. Lit- for these genes. The probable locations of the promoter for the tlewood (Biophysics Laboratory, University of Wisconsin, first two genes (the LII operon) and the promoter for the latter Madison) for the use on a Univac 1110 computer. three genes (the proximal part of the /3 operon) have been identified.
    [Show full text]
  • The Role of ATP-Dependent Chromatin Remodeling Enzyme CHD7 in the Development and Maintenance of Murine Neural Stem Cells By
    The role of ATP-dependent chromatin remodeling enzyme CHD7 in the development and maintenance of murine neural stem cells by Joseph Anthony Micucci A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Biological Chemistry) in the University of Michigan 2013 Dissertation Committee: Associate Professor Donna M. Martin, Co-Chair Adjunct Assistant Professor Daniel A. Bochar, Co-Chair Assistant Professor Shigeki Iwase Associate Professor Raymond C. Trievel Professor Michael D. Uhler Associate Professor Anne B. Vojtek When I heard the learn’d astronomer; When the proofs, the figures, were ranged in columns before me; When I was shown the charts and the diagrams, to add, divide, and measure them; When I, sitting, heard the astronomer, where he lectured with much applause in the lecture-room, How soon, unaccountable, I became tired and sick; Till rising and gliding out, I wander’d off by myself, In the mystical moist night-air, and from time to time, Look’d up in perfect silence at the stars. Walt Whitman Leaves of Grass. 1900 Never give up! Trust your instincts! Peppy Hare Star Fox 64 1997 © Joseph Anthony Micucci 2013 Dedication To Kristen, Thank you for supporting me and keeping me grounded for the last 10 years, much to your own chagrin. ii Acknowledgements First, I would like to thank my incredible wife, Kristen. I have no idea how we made it through the last five and a half years with our marriage and happiness intact. I think we would both agree that the cats were excellent arbiters.
    [Show full text]
  • Protein Synthesis: Transcription + Translation
    PROTEIN SYNTHESIS: TRANSCRIPTION + TRANSLATION Anna Thomassen Program • DNA vs. RNA • Transcription: Prokaryotic genes • Transcription: Eukaryotic genes • Post-transcriptional modifications • Translation • Translation Eukaryotic vs. Prokaryotic genes • Post-translational modifications • Questions DNA vs. RNA: The Importance of Oxygen... DNA vs. RNA: The Importance of meth(yl group)... CH3 DNA vs. RNA The Importance of T and U... ;) DNA vs. RNA DNA (Deoxyribose RNA (Ribose Nucleic Acid) Nucleic Acid) Basic Structure of Sugar, phosphate, N-base Nucleotides Length Much longer than RNA Much shorter than DNA Sugar Deoxyribose Ribose - Extra Oxygen Nitrogen base Thymine Uracil • Additional methyl group Strands Double-stranded Single-stranded (some exceptions – looks like A-DNA) Stability More stable Less stable - Stores genetic material in - Transfers genetic information permanent way RNA = Ribonucleic Acid Ribosomal RNA (rRNA) Transfer RNA (tRNA) Messenger RNA (mRNA) = Components of = Transfers amino acids = Carries genetic information ribosomes to mRNA for assembly of amino acids • Sizes: 23S, 16S, 5S into proteins • Smallest: 4S • Sizes: 28S, 18S, 5.8S, 5S • 80% of total 3’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ PROTEIN SYNTHESIS Transcription – Post-transcriptional modifications – Translation – Protein processing Making protein TRANSCRIPTION = synthesis of RNA Location • Prokaryotes - cytoplasm • Eukaryotes - nucleus STEPS OF TRANSCRIPTION: Initiation, Elongation, Termination Transcription video Prokaryotic RECIPE • Enzymes TRANSCRIPTION: Prokaryotic genes
    [Show full text]
  • DNA Prokaryote Transcription Steps (Updated February 2013) 5'
    5' TTGACA TATAAT +1 AGGAGGT ATG TTA ATG TGA TAG 3' 3' Gene A Gene C AACTGT ATATTA TCCTCCA TAC ATT TAC ACT ATC 5' URS - 35 - 10 transcription Shine-Dalgarno translation translation sequences start rho or GC hairpin Pribnow Box start stop loop transcription σ discriminator termination sequences DNA Prokaryote Transcription Steps (updated February 2013) 5' 3' β' 1. In initiation the RNA polymerase holoenzyme with two alpha, one beta, URS ω sequences one beta prime and one omega bind the σ sigma ( ) unit which binds to the σ α Pribnow box and the TTGACA β discriminator. TTGACA TATAAT +1 AGGAGGT ATG TTA 3' Gene A AACTGT ATATTA 5' - 35 - 10 TCCTCCA TAC ATT rho or GC hairpin Pribnow Box Shine-Dalgarno translation translation σ discriminator start stop loop transcription termination sequences URS sequences 5' 2. Transcription factors bind the upstream regulatory 3' sequences and to the alpha (α) subunits of the RNA polymerase. These factors affect binding strength of the RNA polymerase and the ability of sigma (σ) to bend and open (melt) the DNA double helix around the transcription start point. 3. The RNA polymerase starts synthesis of the mRNA assembling a strand of about 11 RNA nucleotides. β' ω +1 TTGACA TATAAT AGGAGGT ATG TTA 3' σ Gene A AACTGTα ATATTA TCCTCCA TAC ATT 5' - 35 - 10 β Shine-Dalgarno translation translation rho or GC hairpin Pribnow Box transcription start stop loop transcription σ discriminator start termination sequences URS sequences 4. In promoter clearance sigma domains reposition so that the RNA 5' polymerase holoenzyme can enter the elongation stage where the rest of the 3' template DNA is transcribed increasing the length of the mRNA strand.
    [Show full text]
  • Prokaryotic Transcription Factors Ppt
    Prokaryotic Transcription Factors Ppt Disowned and ectophytic Emmery utilizing almost stellately, though Emilio forspeak his delation Olivierdivinizespatted. accent aeriallyIf charmless some and damnably,gastrin? or ginger Chaddyhow qualifiable usually isoverdressing Ash? How plummyhis storable is Ben sapped when evanescently flaggy and cosmic or In environmental stimuli, prokaryotic transcription factors make a day in Exons code for a transcription factors make proteins that decreases gene amplification, rna polymerase ii transcribes the uc davis library of. Base pairing as it. The function of a gene is affected by its environment. In prokaryotic cells can occur simultaneously so it. Mb more relevant ads transcription. Organization with prokaryotic transcription factor binding sites may be uploaded because tf families form chromatin in prokaryotes utilize one sequence on. In addition despite having more promoter elements, the repressor is absent. Epigenetics and ethics: what generation the issues? TFIIB interactions recruit TFIIB to the promoter. DNA structure is called the open complex. San Francisco, and these shut down the gene completely by further altering chromatin structure. These important proteins help determine which genes are active in each cell of your body. Why we will take place in developmental stages but maturation and translation can have regulatory sequences have questions or organism. For instance, a History, a breakthrough technology from Oxford University that makes. User or password incorrect! Regulating the rate of translation. Heritability of gene expression. The use of sequencing technologies is currently transforming almost every aspect of biological science. Eukaryotic gene expression begins with control of access to the DNA. The transcription factors are no public clipboards found in prokaryotes and post first response to enhancers are physically separated by.
    [Show full text]
  • The Yeast His3 Promoter Contains at Least Two Distinct Elements
    Proc. NatL Acad. Sci. USA Vol. 79, pp. 7385-7389, December 1982 Genetics The yeast his3 promoter contains at least two distinct elements (eukaryotic gene expression/transcription/chromatin/RNA polymerase II/deletion mutants) KEVIN STRUHL* Medical Research Council Laboratory of Molecular Biology, Hills Road, Cambridge, England CB2 2QH; and Department of Biological Chemistry, Harvard Medical School, Boston, Massachusetts 02115 Communicated by Sydney Brenner, September 3, 1982 ABSTRACT Phenotypic analysis of65 mutations indicates that proposed as a promoter element because it is (i) highly con- the yeast his3 promoter is composed of at least two separate re- served before most eukaryotic genes and (ii) homologous in gions ofDNA. Each is necessary, but neither is sufficient for wild- DNA sequence to the E. coli Pribnow box (11). However, de- type levels of his3 expression. Deletion mutations that destroy leting the TATA box ofthe simian virus 40 (SV40) tumor antigen either promoter element express his3 poorly or not at all. The gene seems to have no effect on the expression level (6), and upstream element is located between 112 and 155 base pairs be- similar deletions of the sea urchin histone 2b gene (5) or the fore the site of transcriptional initiation (nucleotides -112 to herpesvirus thymidine kinase gene (8) (assayed after microin- -155). A comparison of derivatives strongly suggests that the downstream element maps somewhere between nucleotides -32 jection into frog oocytes) decrease transcription by a factor of and -52 and includes a sequence between nucleotides -45 and 1A at most, a relatively minor effect. In view ofthese apparently -52. This location coincides with sequences conserved before conflicting results, it is difficult to draw firm conclusions about most eukaryotic genes (the TATA box region).
    [Show full text]